Novel mrna5' - terminal cap analogs modified in phosphate residues, RNA molecules incorporating same, uses thereof, and methods of synthesizing RNA molecules or peptides
Novel trinucleotide cap analogs with phosphate residue modifications improve capping and translation efficiency of mRNA, overcoming limitations of existing cap analogs by enabling site-specific substitutions and natural epigenetic modifications, thus enhancing protein expression and reducing synthesis costs.
Patent Information
- Application Number
- JP2025162161
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2020-02-12
- Filing Date
- 2025-09-29
- Publication Date
- 2026-01-23
AI Technical Summary
Existing mRNA cap analogs face challenges in achieving high capping efficiency and translation efficiency, particularly when enzymatic treatments to remove uncapped mRNA are not applied, and they do not allow for the introduction of natural epigenetic modifications like 2'-O-methylation or N6-methylation, leading to reduced incorporation efficiency and increased synthesis costs.
Development of novel trinucleotide cap analogs modified in the phosphate residue, allowing for site-specific substitutions such as O to S or O to CH2 in the triphosphate chain, enabling higher capping efficiency and translation efficiency without the need for additional enzymatic treatments, and permitting the incorporation of natural epigenetic modifications.
The trinucleotide cap analogs provide higher capping efficiency and protein expression levels compared to prior art cap analogs, even without enzymatic treatment, and allow for the simultaneous introduction of natural epigenetic modifications, enhancing translation efficiency and reducing synthesis costs.
Smart Images

Figure 2026012181000031 
Figure 2026012181000032 
Figure 2026012181000033
Abstract
Description
[Technical Field]
[0001] The present invention relates to novel mRNA 5'-end cap analogs modified in the phosphate residue, RNA molecules incorporating same, their uses, and methods for synthesizing RNA molecules in vitro, as well as methods for synthesizing proteins or peptides in vitro or in cells, which methods include a step of translating the RNA molecules. [Background technology]
[0002] 7-methylguanosine (m) present at the 5' end of eukaryotic mRNA 7 G) The cap plays a key role in many fundamental cellular processes, primarily by protecting the mRNA from premature degradation and by serving as a molecular platform for proteins involved in mRNA transport and translation. 1 Thus, chemical modification of the 5' cap opens the door to designing molecular tools to selectively modulate cap-dependent processes and, therefore, mRNA metabolism. 2 The presence of a 5' cap is required for mRNA surveillance and efficient translation under normal conditions. 7 Chemically synthesized mRNA cap analogs of the GpppG type are utilized as reagents for the in vitro synthesis of capped mRNA. 3
[0003] In vitro transcribed (IVT) 5'-capped mRNA is a useful tool for studying mRNA translation, transport, and turnover and represents an emerging class of highly promising therapeutic molecules. IVT mRNA finds application in protein expression in eukaryotic cell extracts, cultured cells, or even whole organisms. Finally, IVT mRNA has attracted considerable attention in recent years as a tool for the safe delivery of exogenous proteins for anticancer and antiviral vaccination and gene replacement therapy. 4
[0004] Synthesis of 5'-capped mRNA using mRNA cap analogs can be achieved by in vitro transcription. 3 This process, called co-transcriptional capping, allows all four NTPs and m 7 RNA synthesis is carried out by RNA polymerase on a DNA template in the presence of a cap dinucleotide such as GpppG. The DNA template is usually designed to incorporate G as the first transcribed nucleotide. The polymerase can then react with GTP or m 7 Transcription begins with GpppG, which incorporates a single nucleotide onto the 5' end of the nascent RNA. To improve the rate of incorporation of the cap analog (capping efficiency), the concentration of GTP is reduced relative to the other NTPs and the concentration of the cap dinucleotide is increased (4-10-fold excess over GTP). Unfortunately, back-incorporation of the cap dinucleotide can occur, resulting in the translationally inactive GpppmG. 7 This problem has been solved by the discovery of "anti-reverse cap analogs" (ARCAs), which modify the 2' or 3' position of 7-methylguanosine (usually by replacing one of the OH groups with OCH3) to prevent reverse incorporation. 5、6
[0005] Modifications that confer ARCA properties to cap analogs result in mRNAs modified within 7-methylguanosine, but the effects of these modifications on various processes involved in mRNA expression and metabolism have not yet been fully investigated. 7 Another limitation to the use of GpppN-type dinucleotides (where N = any nucleotide) is that natural epigenetic modifications cannot be introduced within N, such as 2'-O-methylation or methylation at the N6 position of adenosine. 19 This type of modification occurs naturally in some eukaryotic mRNAs and has important, though still poorly understood, biological functions; however, m 7Their introduction into the N of the GpppN structure can result in significantly reduced incorporation efficiency into mRNA (in the case of methylation at the N6 position of adenine) or in reverse incorporation of the cap into mRNA (in the case of 2'-O methylation of N or a combination of both modifications). 20 The resulting mRNA at the dinucleotide can be subjected to enzymatic 2'-O-methylation within the first transcribed nucleotide, for example, using the commercially available enzyme VCE. 21 However, this solution increases the synthesis costs and represents an additional step in the mRNA preparation process, which is particularly disadvantageous for mRNAs intended for therapeutic use. Another known solution to the problem is to use a compound of the general structure m 7 GpppN * The use of cap analogs with pG (where N * is a natural nucleotide that can be epigenetically modified by methylation) 20、22 .
[0006] Co-transcriptional capping has been shown to allow the incorporation of various modified cap structures at the 5' end of RNA. These modified cap structures may carry molecular tags or confer new properties to mRNA, such as improved translation efficiency and stability. Among them, particularly useful dinucleotide cap analogs are those modified with a triphosphate bridge. 7 It has been shown that even a single atom substitution in the 5',5'-triphosphate bridge can have a profound effect on mRNA properties. For example, a single atom substitution at the β-position of the oligophosphate bridge of the cap, introduced by the so-called β-S-ARCA, leads to a significant increase in the translation efficiency of mRNA in vitro and in vivo. 8,9 On the other hand, a single O to CH2 substitution at the α-β position results in a decrease in translation efficiency. 10 The dramatically different biological effects of different single atom substitutions within the cap indicate the high sensitivity of the translation machinery to modifications of the oligophosphate chain, suggesting that this is an area for further research. Such modifications of the cap structure can sometimes affect the mRNA synthesis process and capping efficiency. 23and the overall translation efficiency may decrease.
[0007] Prior art has shown that subjecting in vitro transcribed mRNA to the steps of enzymatic removal of uncapped (5' triphosphate) RNA and purification by HPLC reduces the immunogenicity of the mRNA and improves the efficiency of in vivo expression of proteins encoded by such mRNA. 11,12 However, because the removal of uncapped mRNA by enzymatic methods is time-consuming and expensive, for some applications it is desirable to obtain mRNA molecules that are efficiently expressed even if they have not been subjected to the procedure for removal of uncapped mRNA. [Prior art documents] [Patent documents]
[0008] [Patent Document 1] International Application No. 2019175356 [Patent Document 2] U.S. Patent No. 7,074,596 [Non-patent literature]
[0009] [Non-Patent Document 1] Moore, M., From birth to death: The complex lives of eukaryotic mRNAs. Science 2005, 309 (5740), pp. 1514-1518. [Non-patent document 2] Ziemniak, M.; Strenkowska, M.; Kowalska, J.; Jemielity, J., Potential therapeutic applications of RNA cap analogs. Future Medicinal Chemistry 2013, 5 (10), pp. 1141-1172. [Non-patent document 3] Grudzien-Nogalska, E.; Stepinski, J.; Jemielity, J.; Zuberek, J.; Stolarski, R.; Rhoads, R. E.; Darzynkiewicz, E., Synthesis of anti-reverse cap analogs (ARCAs) and their applications in mRNA translation and stability. Translation Initiation: Cell Biology, High-Throughput Methods, and Chemical-Based Approaches 2007, 431, 203 - 227 pages. Non-Patent Document 4 Sahin, U.; Kariko, K.; Tureci, O., mRNA-based therapeutics - developing a new class of drugs. Nature Reviews Drug Discovery 2014, 13 (10), 759 - 780 pages. Non-Patent Document 5 Stepinski, J.; Waddell, C.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Synthesis and properties of mRNAs containing the novel "anti-reverse" cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'-deoxy)GpppG. Rna-a Publication of the Rna Society 2001, 7 (10), 1486 - 1495 pages. Non-Patent Document 6 Jemielity, J.; Fowler, T.; Zuberek, J.; Stepinski, J.; Lewdorowicz, M.; Niedzwiecka, A.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Novel "anti-reverse" cap analogs with superior translational properties. Rna-a Publication of the Rna Society 2003, 9 (9), 1108 - 1122.
Non-Patent Document 7
Non-Patent Document 8
Non-Patent Document 9
Non - Patent Document 10
Non - Patent Document 11
Non - Patent Document 12
[0010] The object of the present invention is to provide in the art new mRNA 5' end (cap) analogs that will make it possible to obtain mRNAs with higher capping efficiency and to obtain higher expression levels of proteins encoded by these mRNAs compared to mRNAs obtained using prior art cap analogs, particularly when the mRNA used has not previously been subjected to enzymatic treatment to remove uncapped mRNA.
[0011] A particular object of the present invention is to provide analogs of 5'-end mRNA that do not require modification of the OH group belonging to the ribose of the 7-methylguanosine moiety to ensure the incorporation of the cap analog in the correct orientation.
[0012] It is also a particular object of the present invention to provide analogs of the 5' end of mRNAs that do not reduce, but preferably increase, the translation efficiency of mRNAs that contain them. [Means for solving the problem]
[0013] The subject of the present invention are novel trinucleotide analogues (cap analogues) at the 5' end of mRNA, modified in the phosphate residue, as defined below.
[0014] An embodiment of the present invention is a compound of the formula:
[0015] [ka]
[0016] (In the formula, R1, R2, R3 are selected from the group consisting of H, CH3, alkyl, and the substituents R with different numbers may be the same or different; base 1 The configuration:
[0017] [ka]
[0018] and selected from the group having In the formula, R 4 is selected from the group consisting of H, CH3, alkyl, alkenyl, alkynyl, alkylaryl; X1 and X3 are selected from the group consisting of O, S, and Se, and the substituents X with different numbers may be the same or different; X2 and X4 are selected from the group consisting of O, S, Se, and BH3, and the substituents X with different numbers may be the same or different; X5 is selected from the group consisting of O, CH2, CF2, and CCl2; at least one substituent among X1, X2, X3, X4, and X5 is different from O; R1 represents hydrogen or CH3, R2 represents hydrogen, R3 represents CH3, X1, X3, X4, and X5 represent oxygen, X2 represents sulfur, and base 1 represents guanine. is a compound of
[0019] Advantageously, in the compounds according to the invention, R2 represents OH and, at the same time, R3 represents OH.
[0020] Advantageously, in the compounds according to the invention, X5 represents CH2.
[0021] Advantageously, in the compounds according to the invention, X2 denotes S.
[0022] Advantageously, in the compounds according to the invention, X3 denotes S.
[0023] Advantageously, in the compounds according to the invention, X4 denotes S.
[0024] Advantageously, the compound according to the invention is formula:
[0025] [ka]
[0026] Compound m 7 Gpp S pApG, formula:
[0027] [ka]
[0028] Compound m 7 Gpp S pA m p.g., formula:
[0029] [ka]
[0030] Compound m 7 Gpp S p m6 ApG, formula:
[0031] [ka]
[0032] Compound m 7 Gpp S p m6 A m p.g., formula:
[0033] [ka]
[0034] Compound m 7 GpppAp S G. formula:
[0035] [ka]
[0036] Compound m 7 Gppp5'SApG, formula:
[0037] [ka]
[0038] Compound m 7 Gppp5'SA m p.g., formula:
[0039] [ka]
[0040] Compound m 7 GppCH2pApG, formula:
[0041] [ka]
[0042] Compound m 7 GppCH2pA m p.g., formula:
[0043] [ka]
[0044] Compound m 7 GppCH2p m6 ApG is selected from the group consisting of:
[0045] Preferably, the compounds according to the invention consist essentially of a single stereoisomer or comprise a mixture of at least two stereoisomers, a first diastereoisomer and a second diastereoisomer, which diastereoisomers are identical except that they have different stereochemical configurations around a stereogenic phosphorus atom, which is bonded to a sulfur atom, a selenium atom, or a borane group.
[0046] Another embodiment of the present invention is an RNA molecule containing at its 5' end a compound according to the invention as defined above.
[0047] A further embodiment of the present invention is a method for the in vitro synthesis of an RNA molecule according to the invention as defined above, comprising the step of reacting ATP, CTP, UTP and GTP, a compound according to the invention as defined above, and a polynucleotide template in the presence of an RNA polymerase under conditions that allow the RNA polymerase to synthesize RNA copies on the polynucleotide template, some of the RNA copies containing the compound according to the invention as defined above, resulting in the production of an RNA molecule according to the invention.
[0048] Another embodiment of the present invention is a method for synthesizing a protein or peptide in vitro, comprising the step of translating an RNA molecule according to the invention as defined above in a cell-free protein synthesis system, wherein the RNA molecule comprises an open reading frame under conditions that allow translation from the open reading frame of the RNA molecule of the protein or peptide encoded by the open reading frame.
[0049] Another embodiment of the present invention is a method for synthesizing a protein or peptide in vivo, comprising the step of introducing an RNA molecule according to the invention as defined above into a cell, wherein said RNA molecule comprises an open reading frame under conditions that allow translation of the RNA molecule from the open reading frame with formation of a protein or peptide encoded by the open reading frame, and wherein said cell is not contained within a patient's body.
[0050] Another embodiment of the present invention is the use of a compound according to the invention as defined above for the in vitro synthesis of RNA molecules.
[0051] Another embodiment of the present invention is the use of an RNA molecule according to the invention as defined above in the in vitro synthesis of proteins or peptides.
[0052] Another embodiment of the present invention is a compound according to the invention as defined above or an RNA molecule according to the invention as defined above for use in medicine, diagnostics or pharmacology. [Effects of the Invention]
[0053] Surprisingly, it has been found that the trinucleotide analogues of the mRNA 5'-end (cap) according to the present invention make it possible to obtain mRNAs with higher capping efficiency and to obtain higher expression levels of proteins encoded by these mRNAs compared to mRNAs obtained using mRNA 5'-end (cap) analogues known in the art.
[0054] Furthermore, since the compounds proposed by the present invention are incorporated into the resulting mRNA only in the correct orientation, the present invention provides a site-specific replacement of O by S, or O by CH2, or O by another atom or group of atoms in the 5',5'-triphosphate chain of the mRNA cap, in addition to the additional ARCA modification (i.e., the known methylation at the 2'-O or 3'-O position of 7-methylguanosine). 24,25 This makes it possible without the need for
[0055] International Application No. WO2019175356 discloses modified 5' trinucleotides for RNA capping. However, unlike the compounds described in the present application, they have an ARCA-type modification in the 7-methylguanosine. The presence of this unnatural modification increases the cost of cap synthesis and, especially in combination with certain triphosphate bridge modifications, may have negative consequences in vivo, for example, by slowing down cap degradation by the enzyme DcpS. 26 As a result, caps accumulate in cells, which reduces the efficiency of mRNA expression in therapeutic applications and may even induce toxicity in high doses or repeated administration. Therefore, compounds according to the present invention in which R2=OH and R3=OH are particularly preferred.
[0056] The present invention also allows for the site-specific replacement of an O with an S in the structure of the first phosphodiester bond at the 5' end of an mRNA. The replacement of an O with an S in the structure of the first phosphodiester bond of an mRNA allows for higher expression levels of the protein encoded by such mRNA compared to mRNA obtained using analogs of capping techniques known in the art, particularly if the mRNA used has not been subjected to prior enzymatic treatment to remove uncapped mRNA.
[0057] Furthermore, the present invention allows for the simultaneous implementation of several modifications, in particular the substitution of O by S in the structure of the triphosphate chain or the first phosphodiester bond, together with the introduction of natural epigenetic modifications at the 5' end of the mRNA, such as 2'-O-methylation of the first transcribed nucleotide and N6-methylation of adenosine.
[0058] It has also been surprisingly found that the presence of certain phosphate modifications in trinucleotides according to the invention can have a different effect on the properties of the molecule than the presence of the same modifications in dinucleotides known from the prior art. For example, it has been found that cap analogs according to the invention having an O to CH2 substitution make it possible to obtain in vitro transcribed mRNAs characterized by a higher expression level of the protein encoded by such mRNAs compared to mRNAs obtained using prior art trinucleotide cap analogs. Prior art dinucleotide cap analogs (compound m2 7,3'-O The substitution of O by CH2 in the triphosphate bridge of the mRNA cap obtained using GppCH2pG was compared with the prior art cap analog (compound m2) which does not possess a substitution of O by CH2. 7,3'-O Previous studies have shown that this results in a significant reduction in protein expression compared to mRNA obtained using GpppG. 10 Additionally, trinucleotide cap analogs according to the invention having an O to CH2 substitution at the X5 position or an O to S substitution at the X2 position (respectively, m 7 GppCH2pAmpG and m 7 Gpp S pA m pG D2) have very similar translational properties, while the mRNAs modified with each dinucleotide (m2 7,3'-O GppCH2pG and m2 7,2'-O Gpp S pG D2) have opposite effects on translational properties (the former decreases translational efficiency and the latter increases it relative to the unmodified compound). 25、8 This means that observations about dinucleotides do not directly apply to trinucleotides.
[0059] It has also surprisingly been found that cap analogs according to the present invention, which possess a substitution of O with CH2 or a substitution of O with S, enable the production of in vitro transcribed mRNA with a capping yield that is higher than that obtained with a dinucleotide cap analog containing the same modification and used at the same concentration.
[0060] The cap analogs of the present invention can efficiently prepare in vitro transcribed mRNAs containing any nucleobase within the nucleotide present at the originally transcribed nucleotide position (in contrast to known dinucleotide cap analogs, which are only suitable for purine incorporation due to the sequence restrictions used for in vitro transcription by most viral polymerases (T7, SP6)).
[0061] All publications cited herein and references indicated herein are hereby incorporated by reference.
[0062] For a better understanding of the invention, a brief description of the drawings is provided in the examples and accompanying drawings. [Brief explanation of the drawings]
[0063] [Figure 1] Figure 1 presents an analysis of the capping efficiency of RNA obtained using selected trinucleotide cap analogs according to the present invention (used in 6-fold excess over GTP) or dinucleotide cap analogs known in the art (also used in 6-fold excess over GTP). [Figure 2] FIG. 1 shows protein expression as a function of time in 3T3-L1 cells obtained for enzymatically treated and HPLC purified mRNA. [Figure 3] FIG. 1 shows protein expression as a function of time in JAWS II cells obtained for enzymatically treated and HPLC purified mRNA. [Figure 4] FIG. 1 shows total protein expression in 3T3-L1 cells for enzymatically treated and HPLC purified mRNA. [Figure 5] FIG. 1 shows total protein expression in JAWSII cells for enzymatically treated and HPLC purified mRNA. [Figure 6]FIG. 1 shows protein expression as a function of time in JAWS II cells obtained for mRNA that has not been subjected to the procedure for removal of uncapped mRNA. [Figure 7] FIG. 1 shows total protein expression in JAWSII cells obtained for mRNA that has not been subjected to the procedure for removal of uncapped mRNA. DETAILED DESCRIPTION OF THE INVENTION
[0064] The term "alkyl" refers to a saturated, straight-chain or branched hydrocarbon substituent having the indicated number of carbon atoms, preferably 1 to 10. Examples of alkyl substituents are -methyl, -ethyl, -n-propyl, -n-butyl, -n-pentyl, -n-hexyl, -n-heptyl, -n-octyl, -n-nonyl, and -n-decyl. Representative branched (C1-C10) alkyls include -isopropyl, -sec-butyl, -isobutyl, -tert-butyl, -isopentyl, -neopentyl, -1-methylbutyl, -2-methylbutyl, -3-methylbutyl, -1,1-dimethylpropyl, -1,2-dimethylpropyl, -1-methylpentyl, -2-methylpentyl, -3-methylpentyl, -4-methylpentyl, -1-ethylbutyl, -2-ethylbutyl, -3-ethylbutyl, -1,1-dimethylbutyl, -1,2-dimethylbutyl, 1,3-dimethylbutyl, -2,2-dimethylbutyl, -2,3-dimethylbutyl, -3,3-dimethylbutyl, -1-methylhexyl, 2-methylhexyl, - Examples include 3-methylhexyl, -4-methylhexyl, -5-methylhexyl, -1,2-dimethylpentyl, -1,3-dimethylpentyl, -1,2-dimethylhexyl, -1,3-dimethylhexyl, -3,3-dimethylhexyl, 1,2-dimethylheptyl, -1,3-dimethylheptyl, and -3,3-dimethylheptyl.
[0065] The term "alkenyl" refers to a saturated, straight-chain or branched, acyclic hydrocarbon substituent having the indicated number of carbon atoms and containing at least one carbon-carbon double bond. Examples of alkenyl substituents are -vinyl, -allyl, -1-butenyl, -2-butenyl, -isobutyleneyl, -1-pentenyl, -2-pentenyl, -3-methyl-1-butenyl, -2-methyl-2-butenyl, -isoprenyl, -2,3-dimethyl-2-butenyl, -1-hexenyl, -2-hexenyl, -3-hexenyl, -1-heptenyl, -2-heptenyl, -3-heptenyl, -1-octenyl, -2-octenyl, -3-octenyl, -1-nonenyl, -2-nonenyl, -3-nonenyl, -1-decenyl, -2-decenyl, -3-decenyl, and the like.
[0066] The term "alkynyl" refers to a saturated, straight-chain or branched, acyclic hydrocarbon substituent having the indicated number of carbon atoms and containing at least one carbon-carbon triple bond. Examples of alkynyl substituents are acetylenyl, propynyl, -1-butynyl, -2-butynyl, -1-pentynyl, -2-pentynyl, -3-methyl-1-butynyl, 4-pentynyl, -1-hexynyl, 2-hexynyl, -5-hexynyl, and the like.
[0067] The term "aryl" refers to an unsaturated, cyclic, aromatic, or heteroaromatic (i.e., containing heteroatoms in place of carbon) substituted hydrocarbon having the indicated number of carbon atoms, preferably 6 to 10. Examples of aryl are phenyl, naphthyl, anthracyl, and phenanthryl.
[0068] The term "alkylaryl" refers to an unsaturated hydrocarbon substituent composed of an alkyl portion and an aryl portion (as defined above) bonded together. Examples of alkylaryl are benzyl, phenylethyl, phenylpropyl, naphthylmethyl, naphthylethyl, and the like.
[0069] The term "heteroatom" means an atom selected from the group of oxygen, sulfur, nitrogen, phosphorus, and the like.
[0070] The term "HPLC" refers to high performance liquid chromatography, and solvents designated as "HPLC" solvents refer to solvents of sufficient purity for HPLC (high performance liquid chromatography) analysis.
[0071] The term "NMR" means nuclear magnetic resonance.
[0072] The term "HRMS" means high resolution mass spectrometry.
[0073] The following examples are provided solely to illustrate the present invention and to clarify certain aspects thereof, and are not intended to limit the invention or to equate its full scope as defined by the appended claims. In the following examples, standard materials and methods used in the art were used, or manufacturer's recommendations for particular materials and methods were followed, unless otherwise indicated. [Example]
[0074] Trinucleotide cap analogs were synthesized using a combination of solid-support and solution-phase synthesis, followed by isolation using a two-step purification process. The starting point was a dinucleotide (5'-monophosphate pNpG; 5'-thioester p 5'S NpG, 5'-methylenebisphosphonate pCH2pNpG, and dinucleotide pNp with 3',5'-phosphorothioate linkage S G). DDTT [((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazoline-3-thione] was used for oxidation of the phosphoramidite to form a 3',5'-phosphorothioate linkage. The dinucleotide was cleaved from the support, deprotected, and isolated by ion-exchange chromatography as a triethylammonium salt suitable for ZnCl2-mediated coupling reactions.
[0075] p 5'S NpG and pNp S G dinucleotide to m 7 GDP-Im
[15] and subjected to coupling reaction, respectively 7 Gppp 5'S NpG and m 7 GpppNp S G-type analogues were obtained, while the pCH2pNpG dinucleotide was 7 GMP-Im
[15] and subjected to a coupling reaction with m 7 The synthesis of analogs bearing the β-thiophosphate moiety requires activation of the dinucleotide 5'-phosphate to the corresponding P-imidazolide, followed by m 7 coupled with GDP-β-S
[15] All compounds were isolated by ion exchange chromatography and further purified by RP HPLC to obtain ammonium salts suitable for biological studies. For analogs bearing β-thiophosphate or 3',5'-phosphorothioate, compound diastereomers were separated during the RP HPLC purification step and designated D1 and D2 according to their elution order. Other trinucleotides modified within the triphosphate bridge according to the present invention can be obtained by using the synthetic strategies described in Examples 1-8 in combination with methods for introducing the appropriate phosphate bridge modifications described in the literature for dinucleotide cap analogs. 26, 27、28、29、30
[0076] Example 1 Synthesis of 5'-phosphorylated dinucleotide (pNpG) The dinucleotide was synthesized using an AKTA Oligopilot plus 10 synthesizer (GE Healthcare) to prepare 5'-O-DMT-2'-O-TBDMS-rG. iBu The coupling step was carried out on PrimerSupport 5G (308 μmol / g) solid support (GE Healthcare). The coupling step consisted of 2.0 equivalents of 5′-O-DMT-2′-O-TBDMS / 2′-O-Me-3′-O-phosphoramidite (rA Ac , rA m Pac , m6 A Ac or m6A m Pac )
[12] Or biscyanoethyl phosphoramidite and 0.30 M 5-(benzylthio)-1-H-tetrazole were recirculated through the column for 15 min. A solution of 3% (v / v) dichloroacetic acid in toluene was used as the detritylation reagent, 0.05 M iodine in pyridine / water (9:1) was used for oxidation, 20% (v / v) N-methylimidazole in acetonitrile was used as Cap A, and a mixture of 40% (v / v) acetic anhydride and 40% (v / v) pyridine in acetonitrile was used as Cap B. After the final cycle of synthesis, the RNA still on the solid support was treated with 20% (v / v) diethylamine in acetonitrile to remove the 2-cyanoethyl protecting group. Finally, the solid support was washed with acetonitrile and dried with argon. The product was cleaved from the solid support and deprotected with AMA (40% methylamine / 33% ammonium hydroxide, 1:1). v / v The product was deprotected at 55°C for 1 h, evaporated to dryness, and redissolved in DMSO (200 μL). The TBDMS group was removed using triethylammonium trihydrofluoride (TEA·3HF; 250 μL, 65°C for 3 h), after which the mixture was cooled and diluted with 0.25 M NaHCO₃ in water (20 mL). The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–0.9 M TEAB), yielding the triethylammonium salt of pNpG dinucleotide after evaporation. The yield was estimated by UV absorption at 260 nm using an extinction coefficient ε = 27.1 μL / mmol / cm.
[0077] [Table 1]
[0078] p(m 6 A m )pG: 1 H NMR (500 MHz, D2O, 25℃): δ = 8.37 (s, 1H, H8 A ), 8.14 (s, 1H, H2 A ), 7.89 (s, 1H, H8G ), 6.09 (d, 3 J H,H = 4.4 Hz, 1H, H1' A ), 5.81 (d, 3 J H,H = 5.1 Hz, 1H, H1' G ), 4.91 (m, 1H, H3' A ), 4.68 (dd, 3 J H,H = 5.1 Hz, 3 J H,H = 5.1 Hz, 1H, H2' G ), 4.48-4.43 (m, 3H, H2' A , H4' A , H3' G ), 4.34 (m, 1H, H4' G ), 4.25-4.08 (m, 4H, H5' A , H5" A , H5' G , H5" G ), 3.53 (s, 3H, 2'-O-CH3), 3.46 (q, 3 J H,H = 7.3 Hz, 18H, CH 2 [TEAH+] ), 3.09 (s, TEAH + overlaps with, N 6 -CH3), 1.31 (t, 3 J H,H = 7.3 Hz, 27H, CH 3 [TEAH+] ) ppm; 31 P NMR (202.5 MHz, D2O, H3PO4, 25℃): δ = 1.1 (s, 1P, P A ), 0.0 (s, 1P, P G ) ppm;
[0079] Example 2 Dinucleotide 3',5'-thiophosphodiester (pAp S Synthesis of G) The synthesis of 5'-O-DMT-2'-O-TBDMS-rG was carried out on a 25 μmol scale using an AKTA Oligopilot Plus 10 synthesizer (GE Healthcare). iBu The coupling step was carried out on PrimerSupport 5G (308 μmol / g) solid support (GE Healthcare). The coupling step consisted of 5.0 equivalents of 5′-O-DMT-2′-O-TBDMS-rA in acetonitrile. Ac 3'-O-phosphoramidite or biscyanoethyl phosphoramidite and 0.30 M 5-(benzylthio)-1-H-tetrazole were recirculated through the column for 15 min. A solution of 3% (v / v) dichloroacetic acid in toluene was used as the detritylation reagent, 20% (v / v) N-methylimidazole in acetonitrile was used as Cap A, and a mixture of 40% (v / v) acetic anhydride and 40% (v / v) pyridine in acetonitrile was used as Cap B. Oxidation to the phosphorothioate was carried out using ((dimethylamino-methylidene)amino)-3H-1,2,4-dithiazoline-3-thione (DDTT), and oxidation to the 5'-phosphate was carried out using 0.05 M iodine in pyridine / water (9:1). After the final cycle of synthesis, the RNA still on the solid support was treated with 20% (v / v) diethylamine in acetonitrile to remove the 2-cyanoethyl protecting group. Finally, the solid support was washed with acetonitrile and dried under argon. The product was cleaved from the solid support and purified with AMA (40% methylamine / 33% ammonium hydroxide, 1:1). v / v The product was deprotected at 55°C for 1 h, evaporated to dryness, and redissolved in DMSO (200 μL). The TBDMS group was removed using triethylammonium trihydrofluoride (TEA·3HF; 250 μL, 65°C for 3 h), after which the mixture was cooled and diluted with 0.25 M NaHCO3 in water (20 mL). The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–0.9 M TEAB) and, after evaporation, the pAp S Triethylammonium salt of G (395 mOD 260nm, 14.6 μmol) was obtained as a mixture of two diastereomers in an approximate ratio of 2:3.
[0080] pAp S G D1:RP-HPLC:R t =11.012 minutes * HRMS ESI(-): m / z 707.08078(C 20 H 25 N 10 O 13 P2S - [MH] - Calculated value: 707.08040); pAp S G D2:RP-HPLC:R t =11.179 minutes * ;HRMS ESI(-):m / z 707.08088(C 20 H 25 N 10 O 13 P2S - [MH] - Calculated value: 707.08040); * Linear gradient elution: 0–50% MeOH in CH3COONH4, pH 5.9, 30 min
[0081] Example 3 Dinucleotide 5'-phosphorothiolate (p 5'S ApG and p 5'S A m Synthesis of pG The 5'-OH-NpG dinucleotide was synthesized at a 50 μmol scale using an AKTA Oligopilot plus 10 synthesizer (GE Healthcare). iBu The coupling step was carried out on 3'-lcaa PrimerSupport 5G (308 μmol / g) solid support (GE Healthcare). The coupling step consisted of 2.5 equivalents of adenosine 3'-O-phosphoramidite (5'-O-DMT-2'-O-PivOM-rA) in acetonitrile. Pac or 5'-O-DMT-rA mPac ) and 0.30 M 5-(benzylthio)-1-H-tetrazole were recirculated through the column for 15 min. A solution of 3% (v / v) dichloroacetic acid in toluene was used as the detritylation reagent, 0.05 M iodine in pyridine / water (9:1) for oxidation, 20% (v / v) N-methylimidazole in acetonitrile as cap A, and a mixture of 40% (v / v) acetic anhydride and 40% (v / v) pyridine in acetonitrile as cap B. After the final cycle of synthesis, the support was treated with 20% (v / v) diethylamine in acetonitrile to remove the 2-cyanoethyl protecting group, washed with acetonitrile, and dried with argon. The dinucleotide, still on the solid support, was then converted to its 5'-iodo derivative by pumping (using two syringes attached to the column) methyltriphenoxyphosphonium iodide (1.5 g) in DMF (5 mL) back and forth for 15 min. The resin was then washed with DMF (10 mL) and acetonitrile (10 mL), dried, and transferred to a flask containing triethylammonium thiophosphate (approximately 0.16 M) and triethylamine (0.64 M) in DMF (1 mL). The slurry was stirred overnight at 4°C, filtered, and washed with acetonitrile. The product was cleaved and purified with AMA (40% methylamine / 33% ammonium hydroxide, 1:1 v / v The product was deprotected using a 500-molecular-weight fraction (55°C, 1 hour) and isolated by ion exchange chromatography on DEAE Sephadex (gradient elution, 0-0.9 M TEAB). After evaporation, the product was purified by p 5'S The triethylammonium salt of NpG dinucleotide was obtained.
[0082] [Table 2]
[0083] Example 4 Dinucleotide 5'-methylenebisphosphonate (pCH2pApG, pCH2pA m pG, and pCH2p m6 Synthesis of ApG The 5'-OH-NpG dinucleotide was synthesized using an AKTA Oligopilot plus 10 synthesizer (GE Healthcare) to give 5'-O-DMT-2'-O-TBDMS-rG. iBu The coupling step was carried out on PrimerSupport 5G (308 μmol / g) solid support (GE Healthcare). The coupling step consisted of 5.0 equivalents of 5′-O-DMT-2′-O-TBDMS / 2′-O-Me-3′-O-phosphoramidite (rA Ac , rA m Pac , or m6 A Ac ) and 0.30 M 5-(benzylthio)-1-H-tetrazole were recirculated through the column for 15 min. A solution of 3% (v / v) dichloroacetic acid in toluene was used as the detritylation reagent, 0.05 M iodine in pyridine / water (9:1) for oxidation, 20% (v / v) N-methylimidazole in acetonitrile as Cap A, and a mixture of 40% (v / v) acetic anhydride and 40% (v / v) pyridine in acetonitrile as Cap B. After synthesis, the support was washed with acetonitrile and dried with argon. Methylenebis(phosphonic acid dichloride) (500 mg, 2 mmol) in trimethyl phosphate (5 mL) cooled to -18 °C was loaded onto the column and left at 2 °C for 7 h. The solution was then removed, and the support was washed with trimethyl phosphate (5 mL) and acetonitrile (10 mL) and dried with argon. The column was washed with 5 mL of 0.9 M TEAB, and the resin was incubated with a fresh portion of TEAB overnight at 2° C. The product was cleaved from the solid support and purified with AMA (40% methylamine / 33% ammonium hydroxide, 1:1 v / vThe product was deprotected at 55°C for 1 h, evaporated to dryness, and redissolved in DMSO (200 μL). The TBDMS group was removed using triethylammonium trihydrofluoride (TEA·3HF; 250 μL, 65°C for 3 h). The mixture was then cooled, diluted with water, adjusted to pH 1 with hydrogen chloride, and left at room temperature for 7 days to hydrolyze the fluorobisphosphonate. The product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–0.9 M TEAB) and, after evaporation, yielded the triethylammonium salt of the pCH2pNpG dinucleotide.
[0084] [Table 3]
[0085] pCH2pApG:RP-HPLC:R t =7.200 minutes; 1 H NMR (500 MHz, D2O, 25℃): δ = 8.57 (s, 1H, H8 A ), 8.28 (s, 1H, H2 A ), 8.03 (s, 1H, H8 G ), 6.02 (d, 3 J H,H = 4.7 Hz, 1H, H1' A ), 5.84 (d, 3 J H,H = 5.2 Hz, 1H, H1' G ), 4.84-4.80 (m, overlapping with HDO, 1H, H3' A ), 4.79 (m, overlapping with HDO, 1H, H2' A ) 4.74 (dd, 3 J H,H = 5.2 Hz, 3 J H,H ≒ 5.2 Hz, 1H, H2' G ), 4.49 (m, 2H, H4' A , H3' G ), 4.34 (m, 1H, H4'G ), 4.27 (m, 1H, H5' G ), 4.21 - 4.12 (m, 3H, H5" G , H5' A , H5" A ), 3.20 (q, 3 J H,H = 7.3 Hz, 1.5H, CH 2 [TEAH+] ), 2.21 (t, 2 J H,P = 18.9 Hz, 2H, P - CH2 - P), 1.28 (t, 3 J H,H = 7.3 Hz, 2.25H, CH 3 [TEAH+] ) ppm; 31 P NMR (202.5 MHz, D2O, H3PO4, 25℃): δ = 19.1 (m, 1P, P α ), 16.1 (m, 1P, P β ), 0.3 (s, 1P, P G ) ppm; HRMS ESI(-): m / z 769.09100 (C 21 H 28 N 10 O 16 P3 - [M - H] - calculated value 769.09031); pCH2p(m 6 A)pG:RP - HPLC:R t = 9.008 min; 1 H NMR (500 MHz, D2O, 25℃): δ = 8.42 (s, 1H, H8 A ), 8.16 (s, 1H, H2 A ), 7.89 (s, 1H, H8 G ), 5.99 (d, 3 J H,H = 3.6 Hz, 1H, H1' A ), 5.80 (d, 3 J H,H = 5.1 Hz, 1H, H1' G ), 4.84 - 4.76 (m, overlapping with HDO, 2H, H3' A , H2'A ), 4.66 (dd, 3 J H,H = 5.1 Hz, 3 J H,H ≒ 5.1 Hz, 1H, H2' G ), 4.49 (m, 1H, H4' A ), 4.46 (m, 1H, H3' G ), 4.35-4.48 (m, 2H, H4' G H5 G ), 4.22-4.11 (m, 3H, H5" G H5 A H5 A ), 2.80 (s, 3H, N 6 -CH3), 2.20 (t, 2 J H,P = 19.7 Hz, 2H, P-CH2-P) ppm; 31 P NMR (202.5 MHz, D2O, H3PO4, 25℃): δ = 19.2 (m, 1P, P α ), 15.8 (td, 2 J P,H = 19.7 Hz, 2 J P,P = 9.1 Hz, 1P, P β ), 0.3 (s, 1P, P G ) ppm; HRMS ESI(-): m / z 783.10690 (C 22 H 30 N 10 O 16 P3 - [MH] - のcalculated value 783.10596);
[0086] (Example 5) β-ホスホロチオエートトリヌクレオチドキャップ analogue (m 7 Gpp S pApG D1 and びD2, m 7 Gpp S pA m pG D1 and びD2, m 7 Gpp S pm 6 ApG D1 and びD2, m7 Gpp S pm 6 A m Synthesis of pG D1 and D2 Step 1. Activation of pNpG: The dinucleotide 5'-phosphate was dissolved in DMF (to obtain a 0.05 M solution), followed by the addition of imidazole (16 equivalents), 2,2'-dithiodipyridine (6 equivalents), triethylamine (3 equivalents), and triphenylphosphine (6 equivalents). The mixture was stirred at room temperature for 48 hours. The product was precipitated by adding sodium perchlorate (10 equivalents) in acetonitrile (10 times the volume of DMF). The precipitate was centrifuged at 4°C, washed three times with cold acetonitrile, and dried under reduced pressure to obtain the sodium salt of the dinucleotide P-imidazolide (Im-pNpG).
[0087] Step 2. Triphosphate bridge formation: 7-methylguanosine β-thiodiphosphate (m 7 GDP-β-S; obtained as previously described and stored in TEAB at -20°C)
[15] The residue was evaporated to an oil and redissolved in DMF (to obtain a 0.05 M solution). ZnCl (8 equiv.) and Im-pNpG (0.5 equiv.) were then added, and the mixture was stirred at room temperature for 2 h. The reaction was quenched by adding a solution of NaEDTA (20 mg / mL, 8 equiv.) and NaHCO (10 mg / mL) in water, and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–1.2 M TEAB) and, after evaporation, m 7 Gpp S The triethylammonium salt of pNpG was obtained. The diastereomers were separated by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous buffer of CH3COONH4, pH 5.9, and after repeated lyophilization from water, m 7 Gpp S The ammonium salt of a single diastereomer of pNpG was obtained.
[0088] [Table 4]
[0089] Example 6 Thiophosphodiester trinucleotide cap analogs (m 7 GpppAp S Synthesis of G D1 and D2) Dinucleotide pAp S G (197 mOD, 7.27 μmol), 7-methylguanosine-5′-diphosphate P 2 -Imidazolide m 7 GDP-Im
[15] (10.0 mg, 18.2 μmol) and ZnCl2 (19.8 mg, 145 μmol) were dissolved in DMSO (145 μL), and the mixture was stirred at room temperature for 24 h. The reaction was quenched by adding a solution (2.7 mL) of Na2EDTA (54 mg, 145 μmol) and NaHCO3 (27 mg, 321 μmol) in water, and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–1.2 M TEAB) and evaporated to m 7 GpppAp S The triethylammonium salt of G was obtained. The diastereomers were separated by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous buffer of CH3COONH4, pH 5.9, and after repeated lyophilization from water, m 7 GpppAp S The ammonium salt of a single diastereomer of G was obtained (D1: 42.5 mOD, 1.33 μmol; D2: 77.0 mOD, 2.41 μmol).
[0090] m 7 GpppAp S G D1:RP-HPLC:R t =8.974 minutes * HRMS ESI(-): m / z 1146.11093(C 31 H 40 N 15 O 23 P4S - [MH] - Calculated value: 1146.10981); m 7 GpppAp S G D2: RP-HPLC: Rt =9.662 minutes * HRMS ESI(-): m / z 1146.11137(C 31 H 40 N 15 O 23 P4S - [MH] - Calculated value: 1146.10981); * Linear gradient elution: 0–50% MeOH in CH3COONH4, pH 5.9, 30 min
[0091] Example 7 5'-phosphorothiolate trinucleotide cap analogs (m 7 Gppp 5'S ApG and m 7 Gppp 5'S A m Synthesis of pG Dinucleotide 5'-phosphorothiolate p 5'S NpG, 7-methylguanosine-5′-diphosphate P 2 -Imidazolide m 7 GDP-Im
[15] (2 equiv.), and ZnCl2 (20 equiv.) were dissolved in DMSO (0.05 M p 5'S The mixture was stirred at room temperature for 3 days. The reaction was quenched by adding a solution of NaEDTA (20 mg / mL, 20 equivalents) and NaHCO (10 mg / mL) in water, and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–1.2 M TEAB) and evaporated to m 7 Gppp 5'S The triethylammonium salt of NpG was obtained. Further purification by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous buffer of CH3COONH4, pH 5.9 (after repeated lyophilization from water) gave m 7 Gppp 5'S The ammonium salt of NpG was obtained.
[0092] [Table 5]
[0093] Example 8 α,β-Methylenebisphosphonate trinucleotide cap analogs (m 7 GppCH2pApG, m 7 GppCH2pA m pG, and m 7 GppCH2p m6 Synthesis of ApG Dinucleotide 5'-methylenebisphosphonate pCH2pNpG, 7-methylguanosine-5'-monophosphate P-imidazolide m 7 GMP-Im
[15] (5 equiv.) and ZnCl2 (20 equiv.) were dissolved in DMSO (to 0.05 M pCH2pNpG), and the mixture was stirred at room temperature for 24 h. The reaction was quenched by adding a solution of Na2EDTA (20 mg / mL, 20 equiv.) and NaHCO3 (10 mg / mL) in water, and the product was isolated by ion-exchange chromatography on DEAE Sephadex (gradient elution, 0–1.2 M TEAB) and evaporated to m 7 The triethylammonium salt of GppCH2pNpG was obtained. Further purification by RP HPLC (C18) using a linear gradient of acetonitrile in aqueous buffer of CH3COONH4, pH 5.9, gave (after repeated lyophilization from water) m 7 The ammonium salt of GppCH2pNpG was obtained.
[0094] [Table 6]
[0095] m 7 GppCH2pApG:RP-HPLC:R t =8.395 minutes; 1 H NMR (500 MHz, D2O, 25℃): δ = 9.14 (s, 1H, H8 m7G ), 8.47 (s, 1H, H8 A ), 8.18 (s, 1H, H2 A ), 7.95 (s, 1H, H8 G), 5.96 (d, 3 J H,H = 5.1 Hz, 1H, H1' A ), 5.92 (d, 3 J H,H = 3.4 Hz, 1H, H1' m7G ), 5.81 (d, 3 J H,H = 5.5 Hz, 1H, H1' G ), 4.85 - 4.76 (m, overlapping with HDO, 1H, H3' A ), 4.75 (m, 2H, H2' A , H2' G ) 4.60 (m, 1H, H2' m7G ), 4.52 - 4.46 (m, 3H, H3' G , H3' m7G , H4' A ), 4.38 - 4.32 (m, 3H, H4' m7G , H4' G , H5' G ), 4.30 - 4.11 (m, 5H, H5' A , H5" A , H5" G , H5' m7G , H5" m7G ), 4.03 (s, 3H, N 7 -CH3), 2.41 (t, 2 J H,P = 19.8 Hz, 2H, P-CH2-P) ppm; 31 P NMR (202.5 MHz, D2O, H3PO4, 25℃): δ = 17.8 (m, 1P, P α ), 8.7 (m, 1P, P β ), 0.3 (s, 1P, P G ), -10.2 (d, 2 J P,P = 26.8 Hz, 1P, P γ ) ppm; HRMS ESI(-): m / z 1128.15467 (C 32 H 42 N 15 O 23 P4- [MH] - のcalculated value 1128.15339); m 7 GppCH2p(m 6 A) pG:RP-HPLC: R t =9.721 points; 1 H NMR (500 MHz, D2O, 25℃): δ = 9.09 (s, 1H, H8 m7G ), 8.30 (s, 1H, H8 A ), 8.06 (s, 1H, H2 A ), 7.88 (s, 1H, H8 G ), 5.91 (d, 3 J H,H = 4.6 Hz, 1H, H1' A ), 5.88 (d, 3 J H,H = 3.1 Hz, 1H, H1' m7G ), 5.78 (d, 3 J H,H = 5.3 Hz, 1H, H1' G ), 4.78-4.70 (m, 2H, H3' A , H2' A ), 4.65 (dd, 3 J H,H = 5.3 Hz, 3 J H,H = 5.3 Hz, 1H, H2' G ), 4.55 (m, 1H, H2' m7G ), 4.50 (m, 1H, H4' A ), 4.47 (m, 1H, H3' G ), 4.44 (m, 1H, H3' m7G ), 4.38-4.15 (m, 8H, H4' m7G H5 m7G , H4' G H5 G H5 A H5 m7G H5 A H5 G ), 3.99 (s, 3H, N 7 -CH3), 3.04 (s, 3H, N6 -CH3) 2.41 (t, 2 J H,P = 19.0 Hz, 2H, P-CH2-P) ppm; 31 P NMR (202.5 MHz, D2O, H3PO4, 25℃): δ = 17.8 (m, 1P, P α ), 8.7 (m, 1P, P β ), 0.3 (s, 1P, P G ), -10.2 (d, 2 J P,P = 24.5 Hz, 1P, P γ ) ppm; HRMS ESI(-): m / z 1142.17009 (C 33 H 44 N 15 O 23 P4 - [MH] - のcalculated value 1142.16904);
[0096] Biological properties of this compound Transcripts incorporating compounds of the present invention or benchmark (reference) compounds at their 5' ends were obtained using in vitro transcription in the presence of RNA polymerase T7 and a DNA template containing the Φ6.5 promoter sequence for this polymerase. To analyze capping efficiency, short RNA transcripts were obtained as described in Example 9. Transcription resulting in 35-nt-long RNAs was performed in the presence of selected compounds of the present invention or reference compounds representative of the prior art and containing the same phosphate group modifications as the analyzed compounds of the present invention. The resulting RNAs were shortened by treatment with DNAzyme 10-23 to reduce 3'-end heterogeneity, and analysis on a 15% polyacrylamide gel allowed separation of capped and uncapped mRNAs. The results of this analysis are shown in Figure 1. To analyze protein expression levels in mammalian cells, mRNAs encoding Gaussia luciferase as a reporter gene were obtained carrying compounds of the present invention or reference compounds. In vitro transcription reactions were performed under the conditions described in Example 10. The resulting mRNA was then subjected to a procedure for enzymatic removal of uncapped (5'-triphosphate) RNA as described in Example 10, followed by RP HPLC purification to remove double-stranded RNA impurities as described in Example 12. The resulting mRNA was transfected into mammalian cell lines (fibroblasts—3T3-L1 and dendritic cells—JAWS II) using lipofectamine, and Gaussia luciferase expression in the extracellular medium was measured at appropriate time intervals by luminescence as described in Example 13. The results of these experiments are shown in Figures 2 and 3 as a function of time. Furthermore, Figures 4 and 5 show the overall (total) Gaussia luciferase expression achieved over the entire experimental period (88 hours), which is the sum of the Gaussia luciferase expression levels achieved at specific time points. Furthermore, for selected compounds according to the present invention, protein expression levels in JAWS II cells were also determined for in vitro transcribed mRNA that had not been subjected to enzymatic removal of uncapped RNA impurities.The mRNAs used in these experiments were prepared as described in Example 11, while their purification by HPLC and protein expression analysis were performed as described in Examples 12 and 13, respectively. The results of these experiments are shown in Figures 6 and 7.
[0097] Example 9 In vitro transcription and capping efficiency analysis of short capped RNAs RNA was generated using annealed oligonucleotides (CAGTAATACGACTCACTATAGGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA and TGATCGGCTATGGCTGGCCGCATGCCCGCTTCCCCTATAGTGAGTCGTATTACTG)
[16] as a template, which contain the T7 promoter sequence (TAATACGACTCACTATA) and encode a 35-nt-long sequence (GGGGAAGCGGGCATGCGGCCAGCCATAGCCGATCA). A typical in vitro transcription reaction (20 μl) was incubated for 2 hours at 37°C. It contained RNA Pol buffer (40 mM Tris-HCl, pH 7.9, 10 mM MgCl, 1 mM DTT, 2 mM spermidine), 10 U / μl T7 RNA polymerase (ThermoFisher Scientific), 1 U / μl RiboLock RNase inhibitor (ThermoFisher Scientific), 2 mM ATP / CTP / UTP, 0.5 mM GTP, 2.5 mM cap analog of interest, and annealed oligonucleotide as template. After the 2-hour incubation, 1 U / μl DNase I (ThermoFisher Scientific) was added, and incubation was continued for 30 minutes at 37°C. To homogenize the 3' ends of these RNAs, transcripts (1 μM) were incubated with 1 μM DNAzyme 10-23 (TGATCGGCTAGGCTAGCTACAACGAGGCTGGCCGC) in 50 mM MgCl2 and 50 mM Tris-HCl, pH 8.0, for 1 h at 37°C
[16] to generate 25-nt RNAs with homogenous 3' ends. The transcripts were precipitated with ethanol and treated with DNase I to remove the DNAzyme. The transcript concentration was determined spectrophotometrically. The capping efficiency of the resulting RNA was confirmed on a 15% acrylamide / 7M urea gel.
[0098] Example 10 In vitro transcription of capped mRNA with subsequent removal of 5'-triphosphate-terminated RNA mRNA encoding Gaussia luciferase was generated using the pJET_T7_Gluc_128A plasmid digested with the restriction enzyme AarI (ThermoFisher Scientific) as a template. The plasmid was obtained by cloning the T7 promoter sequence and Gaussia luciferase coding sequence into pJET_luc_128A.
[12] A typical in vitro transcription reaction (20 μl) was incubated at 37°C for 2 hours and contained: RNA Pol buffer (40 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 1 mM DTT, 2 mM spermidine), 10 U / μl T7 RNA polymerase, 1 U / μl RiboLock RNase inhibitor, 2 mM ATP / CTP / UTP, 0.5 mM GTP, 3 mM cap analog of interest, and 50 ng / μl digested plasmid as template. After 2 hours of incubation, 1 U / μl of DNase I was added, and incubation continued at 37°C for 30 minutes. Crude mRNA was purified using NucleoSpin Clean-up XS (Macherey-Nagel). The quality of the transcripts was checked on a native 1.2% 1x TBE agarose gel, and the concentration was determined spectrophotometrically. To remove uncapped RNA, the transcripts were treated with 5'-polyphosphatase (Epicentre) and Xrn1 (New England Biolabs). Briefly, mRNA was incubated with 5'-polyphosphatase (20 U / 5 μg of mRNA) in a proprietary buffer at 37°C for 30 minutes, after which the mRNA was purified using NucleoSpin RNA Clean-up XS. The purified mRNA was incubated with Xrn-1 (1 U / 1 μg of mRNA) in a dedicated buffer at 37°C for 60 minutes, and then the mRNA was purified using NucleoSpin RNA Clean-up XS.
[0099] Example 11 In vitro transcription of capped mRNA without subsequent removal of 5'-triphosphate-terminated RNA mRNA encoding Gaussia luciferase was generated using the pJET_T7_Gluc_128A plasmid digested with the restriction enzyme AarI (ThermoFisher Scientific) as a template. The plasmid was obtained by cloning the T7 promoter sequence and Gaussia luciferase coding sequence into pJET_luc_128A.
[12] A typical in vitro transcription reaction (20 μl) was incubated at 37°C for 2 hours and contained: RNA Pol buffer (40 mM Tris-HCl, pH 7.9, 10 mM MgCl2, 1 mM DTT, 2 mM spermidine), 10 U / μl T7 RNA polymerase, 1 U / μl RiboLock RNase inhibitor, 2 mM ATP / CTP / UTP, 0.5 mM GTP, 3 mM cap analog of interest, and 50 ng / μl digested plasmid as template. After 2 hours of incubation, 1 U / μl of DNase I was added, and incubation was continued for 30 minutes at 37°C. Crude mRNA was purified using NucleoSpin Clean-up XS (Macherey-Nagel). The quality of the transcripts was checked on a native 1.2% 1x TBE agarose gel, and the concentration was determined spectrophotometrically.
[0100] Example 12 Purification of capped mRNA using HPLC mRNA was purified at 55°C using an RNASep™ Prep-RNA Purification Column (ADS Biotec) on an Agilent Technologies Series 1200 HPLC as described in
[11] . A linear gradient of 35% to 55% buffer B (0.1 M triethylammonium acetate, pH 7.0 and 25% acetonitrile) in buffer A (0.1 M triethylammonium acetate, pH 7.0) was applied over 22 minutes at 0.9 ml / min. mRNA was precipitated with isopropanol and recovered from the collected fractions. The quality of the transcript was checked on a native 1.2% 1x TBE agarose gel, and the concentration was determined spectrophotometrically.
[0101] Example 13 Protein expression analysis 3T3-L1 (mouse embryonic fibroblast-like cells, ATCC CL-173) were grown in DMEM (Gibco) supplemented with 10% FBS (Sigma), GlutaMAX (Gibco), and 1% penicillin / streptomycin (Gibco) at 5% CO2 and 37°C. The mouse immature dendritic cell line JAWS II (ATCC CRL-11904) was grown in RPMI 1640 (Gibco) supplemented with 10% FBS, sodium pyruvate (Gibco), 1% penicillin / streptomycin, and 5 ng / ml GM-CSF (PeproTech) at 5% CO2 and 37°C. In a typical experiment, 10 4 JAWS II cells and 4 x 10 3 3T3-L1 cells were seeded in 100 μl of antibiotic-free medium per well of a 96-well plate. Cells in each well were transfected for 16 hours using 10 μl of Opti-MEM (Gibco) mixed with 0.3 μl of Lipofectamine MessengerMAX Transfection Reagent (Invitrogen) and 25 ng of mRNA. To assess Gaussia luciferase expression at multiple time points, the medium was completely removed and replaced with fresh medium at each time point. To detect luminescence from Gaussia luciferase, 50 μl of 10 ng / ml h-coelenterazine (NanoLight) in PBS was added to 10 μl of cell culture medium, and luminescence was measured using a Synergy H1 (BioTek) microplate reader.
[0102] conclusion Examples 1-8 describe methods for obtaining trinucleotide cap analogs according to the present invention. Inventions encompassed by the claims, the synthesis of which is not described in the examples, can be obtained by methods identical or very similar to those exemplified.
[0103] Example 9 describes how to perform capping efficiency analyses on RNA obtained using compounds according to the present invention and compare them with reference compounds representative of the prior art. The results of the analyses showed that trinucleotide cap analogs used in a 5-fold excess relative to GTP resulted in significantly higher capping efficiency than dinucleotide cap analogs containing the same type of modification used in the same excess. As shown in Figure 1, the incorporation of triphosphate modifications into mRNA using trinucleotide cap analogs can improve the efficiency of incorporation. Furthermore, the incorporation of triphosphate modifications using trinucleotide cap analogs does not require the incorporation of additional ARCA-type modifications (e.g., methylation at the 2'-O or 3'-O positions of 7-methylguanosine).
[0104] Examples 10, 11, 12, and 13 describe methods for analyzing protein expression in mammalian cells from mRNAs according to the present invention obtained using compounds according to the present invention. The analysis was performed on two cell lines (fibroblasts—3T3-L and dendritic cells—JAWS II) representing cells of different origins, and on two variants: (i) mRNAs enzymatically treated to remove capped mRNA impurities (Figures 2, 3, 4, and 5), and (ii) mRNAs not enzymatically treated (Figures 6 and 7). Each mRNA obtained using compounds according to the present invention showed higher protein expression compared to capped analogs representative of the prior art in at least one of the variants studied. Achieving increased protein expression has been found to have many applications in biotechnology and biopharmaceutical manufacturing (recombinant protein production) as well as mRNA-based gene therapy. Increased protein expression in dendritic cells is particularly beneficial for anti-cancer therapeutic vaccine applications. Increased protein expression in cells derived from other tissues (lung, liver, and other organs) is particularly beneficial for gene replacement therapy applications.
[18] The mRNA of the present invention obtained by using the compounds of the present invention would be expected to achieve a therapeutic effect at a lower mRNA concentration than that obtained using prior art methods. Lowering the mRNA dosage reduces the risk of side effects related to the toxicity of the treatment, thereby improving the probability of successful treatment. (References) 1. Moore, M., From birth to death: The complex lives of eukaryotic mRNAs. Science 2005, 309 (5740), 1514-1518. 2. Ziemniak, M.; Strenkowska, M.; Kowalska, J.; Jemielity, J., Potential therapeutic applications of RNA cap analogs. Future Medicinal Chemistry 2013, 5 (10), 1141-1172. 3. Grudzien-Nogalska, E.; Stepinski, J.; Jemielity, J.; Zuberek, J.; Stolarski, R.; Rhoads, R. E.; Darzynkiewicz, E., Synthesis of anti-reverse cap analogs (ARCAs) and their applications in mRNA translation and stability. Translation Initiation: Cell Biology, High-Throughput Methods, and Chemical-Based Approaches 2007, 431, 203-227. 4. Sahin, U.; Kariko, K.; Tureci, O., mRNA-based therapeutics - developing a new class of drugs. Nature Reviews Drug Discovery 2014, 13 (10), 759-780. 5. Stepinski, J.; Waddell, C.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Synthesis and properties of mRNAs containing the novel "anti-reverse" cap analogs 7-methyl(3 '-O-methyl)GpppG and 7-methyl(3 '-deoxy)GpppG. Rna-a Publication of the Rna Society 2001, 7 (10), 1486-1495. 6. Jemielity, J.; Fowler, T.; Zuberek, J.; Stepinski, J.; Lewdorowicz, M.; Niedzwiecka, A.; Stolarski, R.; Darzynkiewicz, E.; Rhoads, R. E., Novel "anti-reverse" cap analogs with superior translational properties. Rna-a Publication of the Rna Society 2003, 9 (9), 1108-1122. 7. Jemielity, J.; Kowalska, J.; Rydzik, A. M.; Darzynkiewicz, E., Synthetic mRNA cap analogs with a modified triphosphate bridge - synthesis, applications and prospects. New Journal of Chemistry 2010, 34 (5), 829-844. 8. Grudzien-Nogalska, E.; Jemielity, J.; Kowalska, J.; Darzynkiewicz, E.; Rhoads, R. E., Phosphorothioate cap analogs stabilize mRNA and increase translational efficiency in mammalian cells. Rna-a Publication of the Rna Society 2007, 13 (10), 1745-1755. 9. Kuhn, A. N.; Diken, M.; Kreiter, S.; Selmi, A.; Kowalska, J.; Jemielity, J.; Darzynkiewicz, E.; Huber, C.; Tureci, O.; Sahin, U., Phosphorothioate cap analogs increase stability and translational efficiency of RNA vaccines in immature dendritic cells and induce superior immune responses in vivo. Gene Therapy 2010, 17 (8), 961-971. 10. Grudzien, E.; Kalek, M.; Jemielity, J.; Darzynkiewicz, E.; Rhoads, R. E., Differential inhibition of mRNA degradation pathways by novel cap analogs. Journal of Biological Chemistry 2006, 281 (4), 1857-1867. 11. Katalin Kariko, Hiromi Muramatsu, Janos Ludwig, Drew Weissman, Generating the optimal mRNA for therapy: HPLC purification eliminates immune activation and improves translation of nucleoside-modified, protein-encoding mRNA, Nucleic Acids Research, Vol. 39, Issue 21, 1 November 2011, 142. 12. Sikorski, Pawel J; Warminski, Marcin; Kubacka, Dorota; Ratajczak, Tomasz; Nowis, Dominika; Kowalska, Joanna; Jemielity, Jacek; The identity and methylation status of the first transcribed nucleotide in eukaryotic mRNA 5′ cap modulates protein expression in living cells. Nucleic Acids Research 2020, 305-1048. 13. M. Warminski et al. Journal of the American Chemical Society 2018, 140, 5987-5999. 14. M. Kalek, J. Jemielity, J. Stepinski, R. Stolarski, E. Darzynkiewicz, Tetrahedron Letters 2005, 46, 2417-2421. 15. J. Kowalska et al. RNA 2008, 14, 1119-1131. 16. Coleman, T., Wang, G. and Huang, F. (2004) Superior 5 ' homogeneity of RNA from ATP-initiated transcription under the T7 phi 2.5 promoter. Nucleic Acids Research, 32:e14 17. Norbert Pardi, Michael J. Hogan, Frederick W. Porter, Drew Weissman, N. Nature Reviews Drug Discovery vol. 17, 261-279 (2018). [ PubMed ] 18. Berraondo P, Martini PGV, Avila MA, et al Messenger RNA therapy for rare genetic metabolic diseases Gut 2019;68:1323-1330. 19. Jin Wang et al. al., Nucleic Acids Research, Volume 47, Issue 20, 18 November 20. Masahide Ishikawa, Ryuta Murai, Hiroyuki Hagiwara, Tetsuya Hoshino, Kamui Suyama, Nucleic Acids Symposium Series, Volume 53, Issue 1, September-October 2009, Pages 129-130. 21. Anand Ramanathan, G. Brett Robb, Siu-Hong Chan, Nucleic Acids Research, Volume 44, Issue 16, 19 September 2016, Pages 7511-7526, 2016; 22. Pawel J Sikorski, Marcin Warminski, Dorota Kubacka, Tomasz Ratajczak, Dominika Nowis, Joanna Kowalska, Jacek Jemielity, Nucleic Acids Research, Volume 48, Issue 4, February 28, 2020, Pages 1607-1626, 23. Sylwia Walczak et al., Chem. Sci., 2017, 8, 260–267. 24. US7074596B2 25. E. Grudzien Nogalska et al., Methods in Enzymology, Vol. 431, 2007, Pages 203-227. 26. Anna Maria Rydzik et. al., Organic & Biomolecular Chemistry, Issue 22, 2009. 27. M. Kalek et al., Bioorganic & Medicinal Chemistry, Vol. 14, Issue 9, 1 May 2006, Pages 3223-3230 28. J. Kowalska et.al. (2009), Phosphoroselenoate Dinucleotides for Modification of mRNA 5′ End. ChemBioChem, 10: 2469-2473. 29. J. Kowalska, et. al., Nucleic Acids Research, Volume 42, Issue 16, 15 September 2014, Pages 10245-10264, 30. A. Rydzik et.al., Nucleic Acids Research, Volume 45, Issue 15, 6 September 2017, Pages 8661-8675,
Claims
1. formula: 【Chemistry 1】 (In the formula, R 1 , R 3 , R 4 is H, CH 3 and alkyl, wherein the R substituents with different numbers may be the same or different; base 1 teeth 【Chemistry 2】 is selected from the group consisting of In the formula, R 5 is H, CH 3 , alkyl, alkenyl, alkynyl, alkylaryl; X 1 , X 3 is selected from the group consisting of O, S, and Se, and X substituents with different numbers may be the same or different; X 2 , X 4 O, S, Se, BH 3 wherein the X substituents with different numbers may be the same or different; X 5 is O, CH 2 , C.F. 2 , CCl 2 is selected from the group consisting of X 1 , X 2 , X 3 , X 4 , and X 5 at least one substituent of is different from O; R 1 is hydrogen or CH 3 and R 2 is hydrogen and R 3 is CH 3 and X 1 , X 3 , X 4 , and X 5 is oxygen and X 2 is sulfur and the base 1 (excluding compounds where is G) Compound.
2. formula: 【Transformation 3】 m 7 Gpp S pApG compound, formula: 【Chemistry 4】 Compound m 7 Gpp S pA m p.g., formula: 【Transformation 5】 Compound m 7 Gpp S p m6 ApG, formula: 【Transformation 6】 Compound m 7 Gpp S p m6 A m p.g., formula: 【Transformation 7】 Compound m 7 GpppAp S G. formula: 【Transformation 8】 Compound m 7 Gppp 5'S ApG, formula: 【Chemistry 9】 Compound m 7 Gppp 5'S A m p.g., formula: 【Chemistry 10】 Compound m 7 GppCH 2 pApG, formula: 【Chemistry 11】 Compound m 7 GppCH 2 pA m p.g., formula: 【Chemistry 12】 Compound m 7 GppCH 2 p m6 ApG 2. The compound of claim 1, selected from the group consisting of:
3. 10. The compound of claim 1, consisting essentially of a single stereoisomer or comprising a mixture of at least two stereoisomers, a first diastereoisomer and a second diastereoisomer, which diastereoisomers are identical except that they have different stereochemical configurations about a stereogenic phosphorus atom, which is bonded to a sulfur atom, a selenium atom, or a borane group.
4. An RNA molecule having a compound according to any one of claims 1 to 3 at its 5' end.
5. An in vitro method for synthesizing an RNA molecule described in claim 4, comprising the step of reacting ATP, CTP, UTP and GTP, a compound described in any one of claims 1 to 3, and a polynucleotide matrix in the presence of an RNA polymerase under conditions that allow transcription of RNA copies by the RNA polymerase on the polynucleotide matrix, wherein some of the RNA copies contain a compound described in any one of claims 1 to 3, resulting in the formation of an RNA molecule described in claim 4.
6. A method for synthesizing a protein or peptide in vitro, comprising translating an RNA molecule described in claim 4 in a cell-free protein synthesis system, wherein the RNA molecule contains an open reading frame under conditions that allow translation of the RNA protein or peptide encoded by the open reading frame from the open reading frame.
7. 10. A method for synthesizing a protein or peptide in vivo, comprising the step of introducing the RNA molecule of claim 4 into a cell, wherein the RNA molecule comprises an open reading frame under conditions that allow translation from the open reading frame of the RNA molecule to form a protein or peptide encoded through the open reading frame, and wherein the cell is not contained within a patient's body.
8. 10. Use of a compound according to any one of claims 1 to 3 in the in vitro synthesis of RNA molecules.
9. 10. Use of an RNA molecule according to claim 4 in the in vitro synthesis of a protein or peptide.
10. A compound according to any one of claims 1 to 3 or an RNA molecule according to claim 4 for use in medicine, pharmacology or diagnostics.
Citation Information
Patent Citations
Synthesis and use of anti-reverse mRNA cap analogues
US7074596B2
5'-cap-trinucleotide- or higher oligonucleotide compounds and their uses in stabilizing RNA, expressing proteins and in therapy
WO2019175356A1