Pharmaceutical composition for treating tumor
A lysosomal membrane permeabilizer like ifenprodil, combined with lysine restriction or antagonists, enhances tumor treatment efficacy by increasing membrane permeability and inducing cell death, addressing drug delivery and resistance issues.
Patent Information
- Application Number
- JP2025177750
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-22
- Publication Date
- 2026-01-27
AI Technical Summary
Existing antitumor drugs face challenges in delivering effective concentrations to tumors, particularly those in the central nervous system, due to the blood-brain barrier, and some tumor cells are resistant to apoptosis, necessitating new approaches to enhance drug delivery and increase susceptibility to cell death.
A pharmaceutical composition comprising a lysosomal membrane permeabilizer, such as ifenprodil, combined with lysine restriction or a lysine antagonist, to increase lysosomal membrane permeability and induce cell death in tumor cells, potentially enhanced by autophagy inhibitors.
The composition effectively targets and reduces tumor cell viability, including brain tumors, by increasing intracellular calcium and reactive oxygen species, leading to enhanced tumor cell death and prolonged survival in animal models.
Smart Images

Figure 2026012832000005 
Figure 2026012832000006 
Figure 2026012832000007
Abstract
Description
[Technical Field]
[0001] The present invention relates to a pharmaceutical composition used for treating and / or preventing tumors. [Background technology]
[0002] Numerous antitumor drugs have been developed for use in chemotherapy of malignant tumors. Antitumor drugs are classified according to their mechanism of action into DNA synthesis inhibitors, DNA replication inhibitors, microtubule inhibitors, hormone analogs, biologics (cytokines), molecularly targeted drugs, etc. The drug to be used and its administration method are selected taking into account numerous factors, such as the tumor's location, nature, and target molecule. Depending on the tumor's location, systemic administration can sometimes be difficult to deliver a therapeutically effective concentration of the drug to the tumor without causing serious side effects. In particular, for tumors of the central nervous system, such as brain tumors, the influence of the blood-brain barrier often makes it difficult for systemically administered drugs to reliably reach the tumor. To circumvent the influence of the blood-brain barrier, various drug delivery systems have been developed (e.g., Non-Patent Document 1).
[0003] Autophagy is an intracellular purification and recycling system present in all eukaryotes. When nutrients are depleted, it breaks down excess proteins to generate proteins necessary for survival. It also breaks down denatured proteins and unnecessary organelles within the cell, preventing disease. Non-Patent Document 2 reports that autophagy inhibitors increase sensitivity to antitumor drugs.
[0004] Lysosomal membranes have attracted attention as a target for tumor therapy. Many antitumor agents have a mechanism for inducing apoptosis in tumor cells, but some tumor cells are known to be resistant to apoptosis. Tumor cells have a characteristic that lysosome function is higher than that of normal cells, making them more susceptible to lysosomal cell death due to increased permeability of the lysosomal membrane. Non-Patent Documents 3 to 6 report that drugs that increase the permeability of the lysosomal membrane have been shown to have antitumor effects. [Prior art documents] [Non-patent literature]
[0005] [Non-Patent Document 1] Takayasu Kamei, Mariko Takeda, Drug Delivery System, 28-4, pp. 287-299 (2013) [Non-patent document 2] JM Mulcahy Levy, et al., Nat. Rev. Cancer, 17(9), pp. 528-542 (2017) [Non-patent document 3] RF Dielschneider, et al., Oxid. Med. Cell. Longev,. Vol. 2017, Article ID 3749157 (2017) [Non-patent document 4] M. Hu, et al., Frontiers in Oncology, Vol. 10, Article 605361 (2020) [Non-Patent Document 5] K. Min and T. Kwon, Cancers, 12, 3388 (2020) [Non-patent document 6] P. Boya and G. Kroemer, Oncogene, Vol. 27, pp. 6434-6451 (2008) Summary of the Invention [Problem to be solved by the invention]
[0006] The present invention aims to provide a novel pharmaceutical composition for treating tumors. [Means for solving the problem]
[0007] The present invention provides the following: (1) A pharmaceutical composition comprising a lysosomal membrane permeabilizer, which is used to treat and / or prevent tumors in a subject in combination with restricting lysine intake or administering a lysine antagonist. (2) The pharmaceutical composition according to (1), wherein the lysosomal membrane permeability enhancer is ifenprodil or a salt thereof. (3) The pharmaceutical composition according to (1) or (2), wherein the tumor is a brain tumor. (4) The pharmaceutical composition according to any one of (1) to (3), wherein the lysine antagonist is homoarginine, arginine, or a salt thereof. (5) A pharmaceutical composition comprising a lysine antagonist and used to treat and / or prevent tumors in a subject in combination with the administration of a lysosomal membrane permeabilizer. (6) A pharmaceutical composition comprising a lysosomal membrane permeabilizer and a lysine antagonist. (7) The pharmaceutical composition according to (6), which is used to treat and / or prevent a tumor in a subject. (8) A pharmaceutical composition used for treating and / or preventing a tumor in a subject, comprising ifenprodil. (9) A method for treating and / or preventing tumors in a subject, comprising combining a step of administering a lysosomal membrane permeabilizer with a step of restricting lysine intake or a step of administering a lysine antagonist. [Effects of the Invention]
[0008] The present invention makes it possible to provide a novel pharmaceutical composition for treating tumors. [Brief explanation of the drawings]
[0009] [Figure 1] This graph shows the effect of L-leucyl-L-leucine methyl ester (LLoMe) concentration on sphere formation in glioblastoma cells in the presence and absence of chloroquine. The number of spheres formed was calculated relative to the number of spheres formed under the same conditions without LLoMe, with 1.0 taken as the number. Experiments were performed in triplicate. "**" and "***" indicate p<0.0021 and p<0.0002, respectively, in two-way ANOVA. [Figure 2] 1 is a graph showing the relationship between ifenprodil concentration and lysosomal membrane disruption in glioblastoma cells. Galectin-3 puncta is an indicator of the degree of disruption of the membrane structure of intracellular organelles. [Figure 3] This graph shows the time course of calcium release when glioblastoma cells were pretreated with DMSO and LLoMe, followed by treatment with LLoMe and ifenprodil. Fluo4 is a calcium indicator. The vertical axis shows ΔF / F0, the value obtained by dividing the change in fluorescence intensity ΔF by F0, where F0 is the fluorescence intensity at the start of treatment. [Figure 4] 1 is a bar graph showing the relationship between ifenprodil concentration and sphere formation of glioblastoma cells. [Figure 5] This shows a flow cytometry chart of glioblastoma cells that were fluorescently stained for mitochondrial reactive oxygen species after being cultured for 6 hours in a medium containing DMSO and 5 μM ifenprodil. [Figure 6] This shows a flow cytometry chart of glioblastoma cells whose surface was reacted with fluorescently labeled annexin V after being cultured for 6 hours in a medium containing DMSO and 5 μM ifenprodil. [Figure 7] 7A and 7B are graphs showing the effect of a calcium chelator (BAPTA-AM) or an antioxidant (N-acetylcysteine (NAC)) on sphere formation by glioblastoma cells in the presence of ifenprodil. Figure 7A shows the results of a sphere formation assay in which ifenprodil and BAPTA-AM were added. Figure 7B shows the results of a sphere formation assay in which ifenprodil and NAC were added. [Figure 8]These graphs show the effect of autophagy inhibitors on sphere formation in glioblastoma cells in the presence of ifenprodil. Figure 8A shows the results of a sphere formation assay of glioblastoma cells treated with ifenprodil and bafilomycin. Figure 8B shows the results of a sphere formation assay of glioblastoma cells treated with ifenprodil and chloroquine. Figure 8C shows the results of a sphere formation assay of glioblastoma cells treated with ifenprodil and MRT68921. Figure 8D shows the results of a sphere formation assay of normal cells treated with ifenprodil and chloroquine. Figures 8A and 8B show the number of spheres formed per 500 cells. Figure 8C shows the relative number of spheres formed under the same conditions without ifenprodil, set at 1.0. Figure 8D shows the number of spheres formed per 1,000 cells. [Figure 9] This is a bar graph comparing the lysosomal activity of glioblastoma cells cultured in bafilomycin-supplemented medium and one amino acid-depleted medium. Lysosomal activity was determined by further culturing glioblastoma cells cultured under various conditions in DQ-BSA-supplemented medium to allow the cells to incorporate DQ-BSA, and measuring the mean fluorescence intensity of the DQ-BSA incorporated into the cells by flow cytometry. The vertical axis represents fluorescence intensity. Experiments were performed with n = 3. "**" and "***" in the figure indicate p<0.0021 and p<0.0002, respectively, in two-way ANOVA. [Figure 10] 1 is a graph showing the relationship between ifenprodil concentration and lysosomal membrane disruption in glioblastoma cells when cultured in a lysine-free medium. [Figure 11] This graph shows the time course of calcium release when glioblastoma cells cultured in lysine-depleted medium and NSPC medium were treated with ifenprodil. Fluo4 is a calcium indicator. The vertical axis shows ΔF / F0, the value obtained by dividing the change in fluorescence intensity ΔF by F0, where F0 is the fluorescence intensity at the start of treatment. [Figure 12]This graph shows the results of a sphere formation assay of glioblastoma cells cultured in media containing 100%, 20%, or 10% lysine containing various concentrations of ifenprodil. The experiment was performed in triplicate. "**" and "****" indicate p<0.0021 and p<0.0002, respectively, in two-way ANOVA. [Figure 13] These are survival curves for mice intraperitoneally injected with a control (DMSO), mice intraperitoneally injected with ifenprodil, mice fed a lysine-free diet, and mice intraperitoneally injected with ifenprodil and fed a lysine-free diet. The number of mice in each group was n=5, and the subsequent survival rates were examined. [Figure 14] 1 is a graph showing the results of a sphere formation assay in which ATG5 knockout (KO) cells and wild-type (WT) cells were cultured in the presence of various concentrations of ifenprodil. In the figure, "****" indicates p<0.0002 in two-way ANOVA. [Figure 15] This is a scatter plot comparing the lysosomal activity of glioblastoma cells cultured in homoarginine-supplemented medium and control medium. Lysosomal activity was determined by further culturing glioblastoma cells cultured under various conditions in DQ-BSA-supplemented medium to allow the cells to incorporate DQ-BSA, and measuring the mean fluorescence intensity of the incorporated DQ-BSA by flow cytometry. The vertical axis represents fluorescence intensity. The number of cells measured was n = 30 for each group. "****" in the figure indicates p < 0.0001 in an unpaired t-test. [Figure 16] 1 is a graph showing the relationship between ifenprodil concentration and lysosomal membrane disruption in glioblastoma cells when cultured in a homoarginine-supplemented medium. [Figure 17] This graph shows the results of a sphere-forming assay of glioblastoma cells cultured in homoarginine-containing / homoarginine-free media containing various concentrations of ifenprodil. The vertical axis shows the relative number of spheres formed when the same conditions were not added with ifenprodil, with the number of spheres formed being set at 1.0. The experiment was performed with n=3. In the figure, "**" indicates that p<0.0021 in two-way ANOVA. [Figure 18]These are survival curves for mice intraperitoneally injected with control (DMSO), ifenprodil, homoarginine, and ifenprodil and homoarginine. The number of mice in each group was n=5, and the subsequent survival rates were examined. DETAILED DESCRIPTION OF THE INVENTION
[0010] 1. Pharmaceutical Composition 1-1 Pharmaceutical composition containing a lysosomal permeability enhancer (first embodiment) A first embodiment of the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a lysosomal membrane permeabilizer, which is used for treating and / or preventing a tumor in a subject in combination with the following a) and / or b): a) administration of autophagy inhibitors; b) Restriction of lysine intake or administration of lysine antagonists.
[0011] As used herein, the term "derivative" refers to a compound whose structure has been modified to enhance the desired activity of the compound, reduce side effects (e.g., cytotoxicity), increase water solubility, or increase stability, without losing the desired activity. Applicable modifications include, but are not limited to, PEG modification, amino acid modification, peptide modification, biotin modification, methylation, etc.
[0012] As used herein, "salt" refers to basic salts such as salts with inorganic bases, such as alkali metal salts and alkaline earth metal salts, and salts with organic bases, including salts with sodium, potassium, calcium, magnesium, ammonium, or diethanolamine, ethylenediamine, etc. Alternatively, as used herein, "salt" refers to acidic salts, including salts with inorganic acids, such as salts of mineral acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, and phosphoric acid; salts with organic acids, such as methanesulfonic acid, benzenesulfonic acid, paratoluenesulfonic acid, acetic acid, propionic acid, tartaric acid, fumaric acid, maleic acid, malic acid, oxalic acid, succinic acid, citric acid, benzoic acid, mandelic acid, cinnamic acid, lactic acid, glycolic acid, glucuronic acid, ascorbic acid, nicotinic acid, salicylic acid, gluconic acid, and palmitic acid; and salts with acidic amino acids, such as aspartic acid and glutamic acid.
[0013] As used herein, a "subject" refers to an individual for whom tumor treatment and / or prevention is to be performed, specifically a human or an animal (e.g., a mammal such as a dog, cat, cow, horse, pig, sheep, monkey, or ferret, or a bird such as a chicken), preferably a human.
[0014] As used herein, the term "tumor" includes any lesion in which cells grow excessively regardless of the body's control, but particularly refers to malignant tumors. This also includes lesions known as cancers and malignant neoplasms. Herein, tumors to be treated and / or prevented are not particularly limited in terms of their site of origin or nature, and include leukemias such as acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL), and chronic lymphocytic leukemia (CLL), lymphomas such as Hodgkin's lymphoma, non-Hodgkin's lymphoma, and multiple myeloma, as well as sarcoma, skin cancer, melanoma, bladder cancer, brain cancer, breast cancer, uterine cancer, ovarian cancer, prostate cancer, lung cancer, colorectal cancer, cervical cancer, liver cancer, head and neck cancer, esophageal cancer, pancreatic cancer, kidney cancer, adrenal cancer, gastric cancer, testicular cancer, gallbladder cancer and biliary tract cancer, thyroid cancer, thymus cancer, bone tumors, and brain tumors (glioma, astrocytoma, glioblastoma), etc. The tumor is preferably a brain tumor, more preferably a glioblastoma.
[0015] As used herein, the term "lysosomal membrane permeabilizer" refers to a drug that increases the permeability of the membrane of lysosomes, intracellular organelles, or disrupts the membrane in abnormal cells such as tumor cells. When the permeability of the lysosomal membrane is increased within a cell, contents are released from the lysosomal membrane, increasing the intracellular calcium concentration. This increases mitochondrial reactive oxygen species (ROS), resulting in cell damage and death. Abnormal cells such as tumor cells are exposed to more stressful conditions than normal cells, resulting in increased lysosomal function and a high dependency on this function. Therefore, by increasing the permeability of the lysosomal membrane, they are more susceptible to cell death than normal cells. In other words, a lysosomal membrane permeabilizer is a drug that specifically disrupts the lysosomal membrane in abnormal cells, thereby causing cell death in abnormal cells.
[0016] Examples of lysosomal membrane permeabilizers include hydrophobic or cationic weakly basic amphipathic drugs. These drugs are characterized by being protonated when passing through the lysosomal membrane, being taken up into the lysosome, and damaging the lysosomal membrane. Examples of lysosomal membrane permeabilizers include, but are not limited to, L-leucyl-L-leucine methyl ester (LLoMe), ifenprodil, promethazine, azathioprine, famotidine, idarubicin, nystatin, mestranol, rifabutin, terconazole, mitoxantrone, oxiconazole, naftifine, and salts and derivatives thereof. The lysosomal membrane permeability enhancer of the present invention is preferably a drug that can pass through the blood-brain barrier, and is particularly preferably ifenprodil or a salt or derivative thereof (hereinafter also simply referred to as "ifenprodil").
[0017] Ifenprodil is a compound represented by the following formula (I), and is usually distributed in the form of a tartrate salt represented by the following formula (II) contained in oral medications for improving dizziness associated with the sequelae of cerebral infarction and cerebral hemorrhage. Ifenprodil is known to have medicinal effects such as cerebral vasodilatory action, increasing cerebral blood flow, promoting cerebral glucose uptake, suppressing lactic acid production, inhibiting platelet aggregation, and improving red blood cell deformability. [ka] [ka]
[0018] Ifenprodil is a drug that has been reported to exert its pharmacological effect in the brain when orally administered, i.e., it is clear that it can pass through the blood-brain barrier. On the other hand, ifenprodil has not been reported to have the effect of increasing the permeability of lysosomal membranes. Furthermore, it is not a drug known to be usable as an antitumor drug. The present inventors have found that ifenprodil acts as a lysosomal membrane permeability enhancer in tumor cells, and thus has an antitumor effect.
[0019] As will be explained in detail in the Examples below, culturing tumor cells in the presence of ifenprodil confirmed that ifenprodil reduced tumor cell sphere formation (Figure 4), and the reduction in sphere formation was suppressed in the presence of a calcium chelator and an antioxidant (Figure 7). This confirms that the effect of ifenprodil depends on calcium ions and reactive oxygen species. Furthermore, culturing tumor cells in the presence of ifenprodil increased the number of cells positive for galectin 3, an indicator of intracellular organelle membrane damage; cells positive for mitochondrial ROS; and cells reactive to annexin V, an indicator of cell death (Figures 5 and 6).
[0020] Furthermore, when ifenprodil was added to tumor cells treated with LLoMe and untreated tumor cells, calcium release was barely observed in the former, whereas calcium release equivalent to that observed with LLoMe was observed in the latter (Figure 3). This indicates that ifenprodil can replace LLoMe in increasing the permeability of lysosomal membranes. Therefore, in this specification, ifenprodil is considered a lysosomal membrane permeabilizer.
[0021] The pharmaceutical composition of this embodiment contains a lysosomal membrane permeabilization enhancer. The pharmaceutical composition of this embodiment may contain only one type of lysosomal membrane permeabilization enhancer, or may contain multiple types of lysosomal membrane permeabilization enhancers.
[0022] The route of administration of the pharmaceutical composition of this embodiment is not particularly limited, and may be any known route of administration such as oral, nasal, sublingual, intravascular, subcutaneous, or intramuscular.
[0023] The pharmaceutical composition of this embodiment may contain, in addition to the lysosomal membrane permeabilization enhancer, a pharmaceutically acceptable carrier, if necessary. The term "pharmaceutically acceptable carrier" as used herein refers to additives commonly used in the pharmaceutical technology field. Examples include excipients, binders, disintegrants, fillers, emulsifiers, flow regulators, lubricants, etc.
[0024] Examples of excipients include sugars such as monosaccharides, disaccharides, cyclodextrins, and polysaccharides (more specifically, but not limited to, glucose, sucrose, lactose, raffinose, mannitol, sorbitol, inositol, dextrin, maltodextrin, starch, and cellulose), metal salts (e.g., sodium chloride, sodium or calcium phosphate, calcium sulfate, magnesium sulfate, calcium carbonate), citric acid, tartaric acid, glycine, low-, medium-, and high-molecular-weight polyethylene glycols (PEGs), pluronics, kaolin, silicic acid, or combinations thereof.
[0025] Examples of binders include starch paste using corn, wheat, rice, or potato starch, simple syrup, glucose solution, gelatin, tragacanth, methylcellulose, hydroxypropylmethylcellulose, sodium carboxymethylcellulose, shellac, and / or polyvinylpyrrolidone.
[0026] Examples of disintegrants include the above-mentioned starches, lactose, carboxymethyl starch, cross-linked polyvinylpyrrolidone, agar, laminaran powder, sodium hydrogen carbonate, calcium carbonate, alginic acid or sodium alginate, polyoxyethylene sorbitan fatty acid esters, sodium lauryl sulfate, stearic acid monoglyceride, or salts thereof.
[0027] Examples of fillers include the above-mentioned sugars and / or calcium phosphate (for example, tricalcium phosphate or calcium hydrogen phosphate).
[0028] Examples of emulsifiers include sorbitan fatty acid esters, glycerin fatty acid esters, sucrose fatty acid esters, and propylene glycol fatty acid esters.
[0029] Examples of flow regulators and lubricants include silicates, talc, stearates or polyethylene glycol.
[0030] Such carriers are primarily used to facilitate the formation of the dosage form and to maintain the dosage form and pharmacological effect, and may be used appropriately as needed. In addition to the above-mentioned additives, flavoring agents, solubilizing agents, suspending agents, diluents, surfactants, stabilizers, absorption enhancers, bulking agents, wetting agents, humectants, adsorbents, disintegration inhibitors, coating agents, coloring agents, preservatives, antioxidants, perfumes, flavoring agents, sweeteners, buffers, etc. may also be included as needed.
[0031] The pharmaceutical composition of this embodiment may also contain other drugs to the extent that the effect of the lysosomal membrane permeabilizer is not lost. For example, in the case of an injection, the pharmaceutical composition may contain a predetermined amount of other antibiotics.
[0032] The dosage form of the pharmaceutical composition of this embodiment is not particularly limited as long as it does not inactivate the active ingredient, the lysosomal membrane permeability enhancer, and other additional active ingredients. For example, it may be any of liquid, solid, and semisolid. Specific dosage forms include oral dosage forms such as liquids, powders, granules, tablets, capsules, sublingual tablets, and lozenges, and parenteral dosage forms such as injections, suspensions, emulsions, eye drops, nasal drops, creams, ointments, plasters, patches, and suppositories.
[0033] The pharmaceutical composition of this embodiment can be administered by any suitable method that does not inactivate the active ingredient contained therein. For example, it may be administered orally or parenterally (e.g., by injection, aerosol, topical application, eye drops, or nasal drops). Oral administration is particularly preferred.
[0034] The pharmaceutical composition of this embodiment preferably contains the lysosomal membrane permeabilizer in an amount that is effective in treating or preventing tumors and is highly unlikely to cause serious side effects. The dosage of the lysosomal membrane permeabilizer is not particularly limited as long as it is effective in treating or preventing tumors and is highly unlikely to cause serious side effects. For example, in the case of ifenprodil, the dosage can be adjusted to 0.01 to 10 mg / kg body weight / day, particularly 0.02 to 5 mg / kg body weight / day.
[0035] The number of times the pharmaceutical composition of this embodiment is administered is not particularly limited as long as it provides a sufficient therapeutic or preventive effect on tumors and does not cause serious side effects, but is preferably administered, for example, once every three days to five times a day, and particularly once to three times a day. The administration period of the pharmaceutical composition of this embodiment is not particularly limited and is determined carefully taking into consideration the clinical effect and the level of side effects.
[0036] The pharmaceutical composition of this embodiment may be used in combination with the administration of an autophagy inhibitor. As used herein, the term "autophagy inhibitor" refers to a drug that inhibits autophagy by a mechanism other than lysosomal membrane permeabilization. Any drug that inhibits autophagy other than a lysosomal membrane permeabilization agent may be used, and examples of such drugs include chloroquine, hydroxychloroquine, bafilomycin A1, concanamycin A, salicylihalamide, MRT68921, and Lys05.
[0037] In a sphere-formation assay of tumor cells, the addition of an autophagy inhibitor alone had little effect on sphere formation. In other words, the autophagy inhibitor itself has almost no antitumor effect. However, the present inventors found that the antitumor effect of a lysosomal membrane permeabilizer was significantly enhanced by its combined use with an autophagy inhibitor.
[0038] The dosage of an autophagy inhibitor varies depending on the type and administration method, but in the case of hydroxychloroquine, for example, it can be 0.1 to 20 mg / kg body weight / day, particularly 0.5 to 15 mg / kg body weight / day.
[0039] The pharmaceutical composition of this embodiment may be used in combination with restricting lysine intake, or with the administration of a lysine antagonist.
[0040] As used herein, "restricting lysine intake" refers to consuming a diet in which the amount of lysine contained in a normal average diet is reduced by 10% or more, 20% or more, 30% or more, 40% or more, 50% or more, 60% or more, 70% or more, 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100%. Lysine is an essential amino acid, and its complete elimination from the diet may produce short-term effects but cannot be used for long-term treatment. Therefore, it is preferable to limit the amount of lysine to about 30 to 90%, particularly about 50 to 80%.
[0041] Lysine restriction has been reported to be useful in treating pyridoxine-dependent epilepsy in children (MP Kava et al., JIMD Reports, Vol. 54, pp. 9-15 (2020)). This means that it is a therapeutic method that can treat brain diseases without being affected by the blood-brain barrier.
[0042] The present inventors have found that restricting the amount of lysine in the culture medium of tumor cells treated with a lysosomal membrane permeabilizer produces antitumor effects similar to those observed with the addition of an autophagy inhibitor. Furthermore, they have confirmed that the combined administration of a lysosomal membrane permeabilizer and lysine restriction significantly prolongs the survival time of brain tumor model mice.
[0043] As used herein, the term "lysine antagonist" refers to a drug that competes with lysine to inhibit the uptake of lysine into cells. While any drug that competes with lysine may be used, homoarginine or a salt or derivative thereof (hereinafter simply referred to as "homoarginine") is particularly suitable.
[0044] Lysine (more specifically, L-lysine) has the structure shown in formula (III) below. [ka]
[0045] On the other hand, homoarginine (more specifically, L-homoarginine) has the structure shown in formula (IV) below. [ka]
[0046] Homoarginine has a structure and properties similar to those of lysine, and therefore competes with lysine for cellular uptake, thereby suppressing lysine uptake. The present inventors have found that the addition of homoarginine to tumor cells treated with a lysosomal membrane permeabilizer results in an antitumor effect similar to that observed under lysine-limited conditions. Furthermore, they have confirmed that the combined use of a lysosomal membrane permeabilizer and homoarginine significantly extends the survival time of brain tumor model mice.
[0047] The dosage of homoarginine varies depending on its dosage form and administration method, but can be, for example, 1 to 50 mg / kg body weight / day, particularly 5 to 20 mg / kg body weight / day.
[0048] The pharmaceutical composition of this embodiment is used for the treatment and / or prevention of tumors in combination with at least one selected from the group consisting of restricted lysine intake, administration of a lysine antagonist, and administration of an autophagy inhibitor. Two or more or three of the restricted lysine intake, administration of a lysine antagonist, and administration of an autophagy inhibitor may be combined under conditions that do not significantly inhibit the action of the lysosomal membrane permeabilizer and are highly unlikely to cause serious side effects.
[0049] 1-2 Pharmaceutical composition containing an autophagy inhibitor and / or a lysine antagonist (Second embodiment) A second embodiment of the pharmaceutical composition of the present invention is a pharmaceutical composition comprising at least one agent selected from the group consisting of an autophagy inhibitor and a lysine antagonist, and used for treating and / or preventing a tumor in a subject in combination with administration of a lysosomal membrane permeabilizer.
[0050] Although the autophagy inhibitor and / or lysine antagonist contained in the pharmaceutical composition of this embodiment does not exhibit significant antitumor effects by itself, when used in combination with the administration of a lysosomal membrane permeabilization enhancer, it can significantly enhance the antitumor effect of the lysosomal membrane permeabilization enhancer. In other words, the pharmaceutical composition of this embodiment is a pharmaceutical composition used to supplement the administration of a lysosomal membrane permeabilization enhancer.
[0051] The autophagy inhibitor contained in the pharmaceutical composition of this embodiment is not particularly limited as long as it is a drug that inhibits autophagy other than a lysosomal membrane permeabilization enhancer, and for example, any of chloroquine, hydroxychloroquine, bafilomycin A1, concanamycin A, salicylihalamide, MRT68921, and Lys05 can be used.
[0052] The lysine antagonist contained in the pharmaceutical composition of this embodiment is not limited as long as it is a drug that has the effect of competing with lysine to inhibit the uptake of lysine into cells, but homoarginine or arginine can be particularly preferably used.
[0053] The pharmaceutical composition of this embodiment is used in combination with a lysosomal membrane permeabilizer. Examples of lysosomal membrane permeabilizers include, but are not limited to, LLoMe, ifenprodil, promethazine, azathioprine, famotidine, idarubicin, nystatin, mestranol, rifabutin, terconazole, mitoxantrone, oxidinazole, naftifine, and salts and derivatives thereof. The lysosomal membrane permeabilizer is preferably a drug that can pass through the blood-brain barrier. Ifenprodil is particularly preferred.
[0054] The pharmaceutical composition of this embodiment may further contain a pharmaceutically acceptable carrier as needed. Details of the carrier are the same as those described in the first embodiment unless otherwise inconsistent. Furthermore, the dosage form and administration method are the same as those described in the first embodiment unless otherwise inconsistent.
[0055] When the pharmaceutical composition of this embodiment contains an autophagy inhibitor, the amount of the autophagy inhibitor contained varies depending on the type and administration method, but in the case of hydroxychloroquine, for example, the dosage can be adjusted to 0.1 to 20 mg / kg body weight / day, particularly 0.5 to 15 mg / kg body weight / day. In this case, the administration period is not particularly limited and is carefully determined taking into consideration the clinical effect and the degree of side effects.
[0056] When the pharmaceutical composition of this embodiment contains homoarginine or arginine, the content of homoarginine or arginine varies depending on the dosage form and administration method, but can be adjusted to, for example, a dosage of 1 to 50 mg / kg body weight / day, particularly 5 to 20 mg / kg body weight / day. In this case, the administration period is not particularly limited and is carefully determined taking into consideration the clinical effect and the degree of side effects.
[0057] The pharmaceutical composition of this embodiment may contain both an autophagy inhibitor and a lysine antagonist. In this case, the contents of each are similar to those described above, but are preferably adjusted so as not to significantly inhibit the action of the lysosomal membrane permeabilization enhancer and to minimize the possibility of causing serious side effects.
[0058] 1-3 Pharmaceutical composition comprising a lysosomal membrane permeabilizer and an autophagy inhibitor and / or a lysine antagonist (third embodiment) A third embodiment of the pharmaceutical composition of the present invention is a pharmaceutical composition comprising a lysosomal membrane permeabilizer and at least one agent selected from the group consisting of an autophagy inhibitor and a lysine antagonist. The pharmaceutical composition of this embodiment can be used to treat and / or prevent tumors in a subject.
[0059] The pharmaceutical composition of this embodiment contains a lysosomal membrane permeability enhancer that has an antitumor effect, and an autophagy inhibitor and / or a lysine antagonist that enhances the effect, and thereby has a significantly high antitumor effect.
[0060] The pharmaceutical composition of this embodiment contains a lysosomal membrane permeabilization enhancer. Examples of lysosomal membrane permeabilization enhancers include, but are not limited to, LLoMe, ifenprodil, promethazine, azathioprine, famotidine, idarubicin, nystatin, mestranol, rifabutin, terconazole, mitoxantrone, oxidinazole, naftifine, and salts and derivatives thereof. The lysosomal membrane permeabilization enhancer is preferably a drug that can pass through the blood-brain barrier. Ifenprodil is particularly preferred.
[0061] The autophagy inhibitor contained in the pharmaceutical composition of this embodiment is not particularly limited as long as it is a drug that inhibits autophagy other than a lysosomal membrane permeabilization enhancer, and for example, any of chloroquine, hydroxychloroquine, bafilomycin A1, concanamycin A, salicylihalamide, MRT68921, and Lys05 can be used.
[0062] The lysine antagonist contained in the pharmaceutical composition of this embodiment is not limited as long as it is a drug that has the effect of competing with lysine to inhibit the uptake of lysine into cells, but homoarginine or arginine can be particularly preferably used.
[0063] The pharmaceutical composition of this embodiment may further contain a pharmaceutically acceptable carrier as needed. Details of the carrier are the same as those described in the first embodiment unless otherwise inconsistent. Furthermore, the dosage form and administration method are the same as those described in the first embodiment unless otherwise inconsistent.
[0064] The pharmaceutical composition of this embodiment preferably contains the lysosomal membrane permeabilizer in an amount that is effective in treating or preventing tumors and is highly unlikely to cause serious side effects. The dosage of the lysosomal membrane permeabilizer is not particularly limited as long as it is effective in treating or preventing tumors and is highly unlikely to cause serious side effects. For example, in the case of ifenprodil, the dosage can be adjusted to 0.01 to 10 mg / kg body weight / day, particularly 0.02 to 5 mg / kg body weight / day.
[0065] The number of times the pharmaceutical composition of this embodiment is administered is not particularly limited as long as it provides a sufficient therapeutic or preventive effect on tumors and does not cause serious side effects, but is preferably administered, for example, once every three days to five times a day, and particularly once to three times a day. The administration period of the pharmaceutical composition of this embodiment is not particularly limited and is determined carefully taking into consideration the clinical effect and the level of side effects.
[0066] When the pharmaceutical composition of this embodiment contains an autophagy inhibitor, the amount of the autophagy inhibitor contained varies depending on the type and administration method. For example, in the case of hydroxychloroquine, the dosage can be adjusted to 0.1 to 20 mg / kg body weight / day, particularly 0.5 to 15 mg / kg body weight / day.
[0067] When the pharmaceutical composition of the present embodiment contains homoarginine or arginine, the content of homoarginine or arginine varies depending on the dosage form and administration method, but can be adjusted so that the dosage is, for example, 1 to 50 mg / kg body weight / day, particularly 5 to 20 mg / kg body weight / day.
[0068] The pharmaceutical composition of this embodiment may contain both an autophagy inhibitor and a lysine antagonist. In this case, the contents of each are similar to those described above, but are preferably adjusted so as not to significantly inhibit the action of the lysosomal membrane permeabilization enhancer and to minimize the possibility of causing serious side effects.
[0069] 1-4 Pharmaceutical composition containing ifenprodil (fourth embodiment) A fourth embodiment of the pharmaceutical composition of the present invention is a pharmaceutical composition used for treating and / or preventing a tumor in a subject, comprising ifenprodil.
[0070] As mentioned above, ifenprodil is a drug contained in commercially available pharmaceuticals in the form of its tartrate salt, but it is not typically used as a lysosomal membrane permeabilizer for inducing cell death or as an antitumor agent. The present inventors have found that ifenprodil induces cell death by increasing the permeability of the lysosomal membrane in tumor cells. Furthermore, we have confirmed that administration of ifenprodil prolongs survival in brain tumor model mice (Figures 13 and 18).
[0071] The pharmaceutical composition of this embodiment may further contain a pharmaceutically acceptable carrier as needed. Details of the carrier are the same as those described in the first embodiment unless otherwise inconsistent. Furthermore, the dosage form and administration method are the same as those described in the first embodiment unless otherwise inconsistent.
[0072] The pharmaceutical composition of this embodiment preferably contains ifenprodil in an amount that is effective in treating or preventing tumors and has an extremely low likelihood of causing serious side effects. The dosage of ifenprodil is not particularly limited as long as it is an amount that is effective in treating or preventing tumors and has an extremely low likelihood of causing serious side effects, and can be adjusted to 0.01 to 10 mg / kg body weight / day, particularly 0.02 to 5 mg / kg body weight / day.
[0073] The number of times the pharmaceutical composition of this embodiment is administered is not particularly limited as long as it provides a sufficient therapeutic or preventive effect on tumors and does not cause serious side effects, but is preferably administered, for example, once every three days to five times a day, and particularly once to three times a day. The administration period of the pharmaceutical composition of this embodiment is not particularly limited and is determined carefully taking into consideration the clinical effect and the level of side effects.
[0074] 2. Methods for treating and / or preventing tumors The method of the present invention is a method for treating and / or preventing tumors in a subject, which comprises combining the step of administering a lysosomal membrane permeabilizing agent with the following steps a) and / or b): a) administration of autophagy inhibitors; b) Restriction of lysine intake or administration of lysine antagonists.
[0075] The method of the present invention includes a step of administering a lysosomal membrane permeabilization enhancer to a subject. Examples of lysosomal membrane permeabilization enhancers include, but are not limited to, LLoMe, ifenprodil, promethazine, azathioprine, famotidine, idarubicin, nystatin, mestranol, rifabutin, terconazole, mitoxantrone, oxidinazole, naftifine, and salts and derivatives thereof. The lysosomal membrane permeabilization enhancer is preferably a drug that can pass through the blood-brain barrier. Ifenprodil is particularly preferred.
[0076] In the method of the present invention, it is preferable to administer a lysosomal membrane permeabilizer to a subject in an amount that is effective for treating or preventing tumors and has an extremely low possibility of causing serious side effects. The dose of the lysosomal membrane permeabilizer is not particularly limited as long as it is effective for treating or preventing tumors and has an extremely low possibility of causing serious side effects. For example, in the case of ifenprodil, the dose can be adjusted to 0.01 to 10 mg / kg body weight / day, particularly 0.02 to 5 mg / kg body weight / day.
[0077] In the method of the present invention, the frequency of administration of the lysosomal membrane permeabilizer is not particularly limited as long as a sufficient therapeutic or preventive effect on tumors is obtained and no serious side effects occur, but is preferably, for example, once every three days to five times a day, particularly once to three times a day. The administration period is not particularly limited and is carefully determined taking into consideration the clinical effect and the degree of side effects.
[0078] In the method of the present invention, the lysosomal membrane permeabilizer can be administered by any suitable method that does not inactivate the active ingredient contained therein. For example, it may be administered orally or parenterally (e.g., by injection, aerosol, topical application, eye drops, or nasal drops). Oral administration is particularly preferred.
[0079] The methods of the present invention can include a step of administering an autophagy inhibitor. The autophagy inhibitor is not particularly limited as long as it is a drug that inhibits autophagy other than a lysosomal membrane permeabilizer, and examples of the autophagy inhibitor that can be used include chloroquine, hydroxychloroquine, bafilomycin A1, concanamycin A, salicylihalamide, MRT68921, and Lys05.
[0080] When the methods of the present invention include the step of administering an autophagy inhibitor, the dosage of the autophagy inhibitor varies depending on the type and administration method. For example, in the case of hydroxychloroquine, the dosage can be adjusted to 0.1 to 20 mg / kg body weight / day, particularly 0.5 to 15 mg / kg body weight / day.
[0081] The method of the present invention can include a step of restricting lysine intake and / or a step of administering a lysine antagonist instead of or in addition to administering an autophagy inhibitor. Restricting lysine intake to 80% or more carries the risk of essential amino acid deficiency, so the treatment period must be carefully determined while checking the subject's nutritional status, such as the state of skeletal muscle. However, by alternating the administration of the autophagy inhibitor with separate periods, the overall treatment period can be extended. Alternatively, by administering the agent simultaneously with an autophagy inhibitor, the restriction of lysine intake can be relatively lenient, for example, to 50% or less, allowing for a longer treatment period.
[0082] When the method of the present invention includes a step of administering a lysine antagonist, the lysine antagonist is not limited as long as it is a drug that has the effect of competing with lysine to inhibit the uptake of lysine into cells, but homoarginine or arginine can be particularly preferably used.
[0083] When homoarginine or arginine is used as a lysine antagonist, the dosage of homoarginine or arginine varies depending on its dosage form and administration method, but can be adjusted to, for example, 0.1 to 5 mg / kg body weight / day, particularly 0.5 to 2.0 mg / kg body weight / day. [Example]
[0084] Example 1: Lysosomal disruption in glioblastoma cells by ifenprodil (1-1) Cell culture Patient-derived glioblastoma cells (TGS04) were cultured as spheroids in NSPC medium (DMEM / F12, 1x B27, 20 ng / mL hEGF, 20 ng / mL hbFGF, 1x GlutaMax™, penicillin / streptomycin) at 37°C, 5% CO2, and 5% O2.
[0085] (1-2) Sphere formation assay Cells dispersed in NSPC medium containing 1% methylcellulose containing 0, 0.5, 1.0, or 2.0 μM ifenprodil were added, mixed by rotation, and then transferred to a 96-well plate and cultured for approximately 10 days. Sphere formation was measured using a Keyence BZ-9000 fluorescence microscope. For BAPTA-AM or NAC treatment, cells dispersed in NSPC medium containing 1% methylcellulose containing BAPTA-AM or NAC were added, mixed by rotation for 30 minutes, then the treatment agent was added, mixed by rotation again, and transferred to a 96-well plate and cultured for approximately 10 days. Sphere formation was measured using a Keyence BZ-9000 fluorescence microscope. Figure 4 shows the number of spheres formed per 500 cells in the presence of each concentration of ifenprodil. It was confirmed that the sphere formation rate decreased with increasing ifenprodil concentration.
[0086] (1-3) Galectin-3-GFP puncta assay TGS04 cells transfected with EGFP-galectin (pEGFP-hGal3 (addgene #73080)) using a lentivirus were cultured in NSPC medium on laminin-coated 96-well glass-bottom plates. After 15 minutes of treatment with 0, 0.5, 1.0, or 2.0 μM ifenprodil, nuclear staining (Hoechst 33342) was performed, and galectin-3 puncta were observed under a confocal fluorescence microscope. The percentage of cells containing galectin-3 puncta was calculated from the images. Figure 2 shows the percentage of galectin-3 puncta in the presence of various concentrations of ifenprodil. It was confirmed that the percentage of galectin-3 puncta, i.e., the percentage of cells with lysosomal membrane damage, increased with increasing ifenprodil concentration.
[0087] (1-4) Measurement of calcium release Cells were cultured overnight in NSPC medium on laminin-coated plates. After treatment with the calcium indicator Fluo-4 (Thermo Fisher Scientific) for 1 hour, they were washed with the same medium. KRB calcium-free medium was added, and pretreatment was performed with DMSO or L-leucyl-L-leucine methyl ester (LLoME). Three hours after pretreatment, LLoME and ifenprodil were added (main treatment), and the change in fluorescence intensity was measured using a Keyence BZ-9000 fluorescence microscope. Figure 3 shows the change in fluorescence intensity over time, with the fluorescence intensity at the start of treatment set at 1. Treatment with DMSO (control) followed by ifenprodil significantly increased calcium release, whereas treatment with the lysosomal membrane permeabilizer LLoME did not increase calcium release with ifenprodil. These results confirm that ifenprodil exhibits calcium release behavior similar to that of LLoME.
[0088] (1-5) Measurement of mitochondrial reactive oxygen species Cells were cultured for 6 hours in control (DMSO) or medium containing 5 μM ifenprodil, then dispersed and washed with PBS. They were treated with 2.5 μM MitoSox-red (Thermo Fisher Scientific) at 37°C for 15 minutes, washed with 3% FBS / PBS, and then measured for fluorescence intensity using flow cytometry. The flow cytometry results are shown in Figure 5. Increased mitochondrial ROS in cells was confirmed in the presence of ifenprodil.
[0089] (1-6) Apoptosis assay Cells were cultured for 6 hours in control (DMSO) or 5 μM ifenprodil-containing medium, then dispersed and washed with 3% FBS / PBS(-). Cells were then treated with 5 μM FITC-Annexin V (apoptosis indicator, BD Biosciences), 2 μM 7AAD (50 μg / mL BioLegend), and 100 μL 1× Annexin V Binding Buffer (BD Biosciences) at room temperature for 15 minutes. After washing with 1× Annexin V Binding Buffer, fluorescence intensity was measured using flow cytometry. Figure 6 shows the flow cytometry results. Cell apoptosis was confirmed to be enhanced in the presence of ifenprodil.
[0090] (1-7) Effects of intracellular calcium and reactive oxygen species on the inhibition of sphere formation by ifenprodil Cells dispersed in NSPC medium containing 1% methylcellulose containing various concentrations of ifenprodil and either a calcium chelator (BAPTA-AM) or an antioxidant (N-acetylcysteine (NAC)) were added and mixed by rotation. The cells were then transferred to a 96-well plate and cultured for approximately 10 days. Sphere formation was measured using a Keyence BZ-9000 fluorescence microscope. Figure 7 shows the results of the sphere formation assay. Figure 7A shows the results of the sphere formation assay with BAPTA-AM added, and Figure 7B shows the results of the sphere formation assay with NAC added. Both calcium chelators and antioxidants were able to suppress the reduction in sphere formation induced by ifenprodil. This indicates that ifenprodil is involved in apoptosis of glioblastoma cells.
[0091] These studies demonstrated that ifenprodil, like LLoME, is involved in the destruction of lysosomal membranes in tumor cells and has antitumor effects.
[0092] [Example 2] Combined use of a lysosomal membrane permeabilizer and an autophagy inhibitor (2-1) Sphere formation assay in the presence of LLoMe Cells were cultured under the same conditions as in Example 1 (1-1). A sphere formation assay was performed under the same conditions as in Example 1 (1-2), except that LLoMe was added at 0, 200, 500, or 1000 μmol / L and chloroquine at 0 or 5 μmol / L. The results are shown in Figure 1. It was shown that the sphere formation rate decreased depending on the concentration of LLoMe added. Furthermore, it was confirmed that the sphere formation rate decreased even more significantly when chloroquine was added together with LLoMe.
[0093] (2-2) Sphere formation assay in the presence of ifenprodil A sphere-forming assay was performed under the same conditions as in Example 1 (1-2), except that various concentrations of ifenprodil, bafilomycin, chloroquine, or MRT6892 were added. A sphere-forming assay was also performed on normal human cells (obtained from Lonza Japan) with the addition of ifenprodil and chloroquine. The results are shown in Figures 8A-D. Figures 8A-C show the results of a sphere-forming assay using glioblastoma cells. Figure 8A shows the results with bafilomycin, Figure 8B shows the results with chloroquine, and Figure 8C shows the results with MRT68921. Figure 8D shows the results of a sphere-forming assay using normal cells with chloroquine. Figures 8A and 8B show the number of spheres formed per 500 cells, Figure 8C shows the relative number of spheres formed under the same conditions without ifenprodil, defined as 1.0, and Figure 8D shows the number of spheres formed per 1,000 cells. The addition of various autophagy inhibitors further enhanced the effect of ifenprodil in reducing sphere formation. However, in normal cells, no significant change in the number of spheres formed by ifenprodil was observed, regardless of the addition of chloroquine.
[0094] (2-3) Sphere formation assay of autophagy knockout cells in the presence of ifenprodil TGS04 ATG5-knockout (KO) cells were prepared by knocking out autophagy function using the following genome editing technique (Ha et al., Cancer Sci. 2018 Aug;109(8):2497-2508). The sgATG5 (GGCCATCAATCGGAAACTCA) oligonucleotide was inserted into the vector pX330-U6-Chimeric_BB-CBh-hSpCas9 (addgene #42230) and then transfected into TGS04 cells. The cells were then single cloned, and ATG5 knockout was confirmed by Western blotting to establish ATG5 knockout (KO) cells. TGS04 ATG5-KO cells were cultured under the same conditions as in Example 1 (1-1).
[0095] A sphere formation assay was performed on ATG5 KO cells and wild-type (WT) cells in the presence of ifenprodil under the same conditions as in Example 1 (1-2). The results are shown in Figure 14. While ifenprodil had almost no effect on sphere formation in WT cells, the sphere formation rate in KO cells significantly decreased depending on the ifenprodil concentration.
[0096] These results demonstrate that the lysosomal membrane permeabilization enhancers and ifenprodil have an enhanced lysosomal disruption effect through the inhibition of autophagy.
[0097] [Example 3] Measurement of lysosomal activity in glioblastoma cells cultured in an amino acid-depleted medium Amino acid-depleted medium was prepared by adding all amino acids except for the one to be depleted to amino acid-free NSPC medium (DMEM / F12 (amino acid-free) (Funakoshi), 1x B27, 20 ng / mL hEGF, 20 ng / mL hbFGF, penicillin / streptomycin). Glioblastoma cells were washed with amino acid-free medium and then cultured overnight in control medium (complete medium), one amino acid-depleted medium, or bafilomycin-supplemented medium. The cells were dispersed and further cultured for 6 hours in the same medium containing 10 μg / mL DQ-BSA (Thermo Fisher Scientific). After dispersing and washing with 3% FBS / PBS, the fluorescence intensity was measured using flow cytometry. Experiments were performed in triplicate.
[0098] The mean fluorescence intensity under each condition is shown in Figure 9. The mean fluorescence intensity indicates the ability of lysosomes to uptake and degrade DQ-BSA, i.e., lysosomal activity. A significant decrease in lysosomal activity was observed under conditions with the addition of bafilomycin. Furthermore, a significant decrease in lysosomal activity was observed in the lysine-free medium, similar to the case with the addition of bafilomycin.
[0099] [Example 4] Measurement of antitumor effects of lysosomal inhibitors and lysine restriction (4-1) Sphere formation assay The assay was performed under the same conditions as in Example 1 (1-2), except that the medium was changed to one containing 100%, 20%, or 10% lysine. The results of the sphere formation assay are shown in Figure 12. It was confirmed that the reduction in sphere formation caused by ifenprodil increased as the lysine content decreased.
[0100] (4-2) Galectin-3-GFP puncta assay A galectin-3-GFP puncta assay was performed under the same conditions as in Example 1 (1-3), except that the medium was changed to a medium containing 0% lysine. As a control, a similar test was performed using NSPC medium. The results are shown in Figure 10. It was confirmed that limiting the lysine content of the medium enhanced lysosomal membrane damage caused by ifenprodil.
[0101] (4-3) Measurement of calcium release Cells were cultured overnight in NSPC medium or 0% lysine medium on laminin-coated plates. After treatment with Fluo-4 for 1 hour, the cells were washed with the same medium, and calcium-free KRB medium was added. 0.5 μM ifenprodil was added. The fluorescence intensity was measured using a Keyence BZ-9000 fluorescence microscope. Figure 11 shows the change in fluorescence intensity over time, with the fluorescence intensity at the start of treatment set at 1. It was confirmed that the addition of ifenprodil significantly enhanced calcium release in lysine-limited cells.
[0102] (4-4) Comparison of survival curves in glioblastoma model mice TGS04 cells were orthotopically transplanted (1 × 10) into the head of 4-week-old nude mice (BALBc-nu / nu). 5The mice were then divided into control and lysine-restricted diet groups (cells / mouse), and each group was administered a control (DMSO) or ifenprodil (Selleck) (5 mg / kg body weight) via intraperitoneal injection. The lysine-restricted diet was administered two days prior to transplantation. The lysine-restricted diet group then underwent a 5-day lysine-restricted diet followed by a 2-day control diet cycle, and four cycles of ifenprodil treatment were performed, with a 5-day administration and 2-day rest period. Each group consisted of five mice (n = 5), and the subsequent survival rates were examined. Figure 13 shows the survival curves for mice under each condition. It was confirmed that combining ifenprodil with a lysine-restricted diet significantly increased the survival rate of mice.
[0103] [Example 5] Measurement of antitumor effects of lysosomal inhibitors and lysine antagonists (5-1) Lysosomal activity measurement Glioblastoma cells were cultured overnight in NSPC medium containing 30 mM homoarginine. As a control, similar culture was performed in NSPC medium. The cells were dispersed and further cultured for 6 hours in NSPC medium containing 10 μg / mL DQ-BSA (Thermo Fisher Scientific). After dispersing the cells and washing with 3% FBS / PBS, fluorescence intensity was measured using flow cytometry. Measurements were performed on n=30 cells for each group. The results are shown in Figure 15. A significant decrease in lysosomal activity was confirmed in cells cultured in medium containing homoarginine.
[0104] (5-2) Sphere formation assay The assay was performed under the same conditions as in Example 1 (1-2), except that 25 mM homoarginine was added to the medium. The results of the sphere formation assay are shown in Figure 17. It was confirmed that the addition of homoarginine increased the rate of reduction in sphere formation by ifenprodil.
[0105] (5-3) Galectin-3-GFP puncta assay A galectin-3-GFP puncta assay was performed under the same conditions as in Example 1 (1-3), except that 30 mM homoarginine was added to the medium. The results are shown in Figure 16. It was confirmed that the addition of homoarginine enhanced lysosomal membrane damage caused by ifenprodil.
[0106] (5-4) Comparison of survival curves in glioblastoma model mice TGS04 cells were orthotopically transplanted (1 × 10) into the head of 4-week-old nude mice (BALBc-nu / nu). 5 The mice were then treated with a control (DMSO), ifenprodil (Selleck) (5 mg / kg body weight), homoarginine (Wako) (50 mg / kg body weight), or ifenprodil and homoarginine via intraperitoneal injection. Four cycles of treatment were performed, with five mice in each group (n = 5), and the survival rate was then assessed. Figure 18 shows the survival curves for mice under each condition. It was confirmed that combining ifenprodil with a lysine-restricted diet significantly increased the survival rate of mice.
[0107] The present specification includes the following embodiments. (1) A pharmaceutical composition comprising a lysosomal membrane permeabilizer and used to treat and / or prevent a tumor in a subject in combination with the following a) and / or b): a) administration of autophagy inhibitors; b) Restriction of lysine intake or administration of lysine antagonists. (2) The pharmaceutical composition according to (1), wherein the lysosomal membrane permeability enhancer is ifenprodil or a salt or derivative thereof. (3) The pharmaceutical composition according to (1) or (2), wherein the tumor is a brain tumor. (4) The pharmaceutical composition according to any one of (1) to (3), wherein the autophagy inhibitor is at least one drug selected from the group consisting of chloroquine, hydroxychloroquine, bafilomycin A1, concanamycin A, salicylihalamide, MRT68921, and Lys05. (5) The pharmaceutical composition according to any one of (1) to (4), wherein the lysine antagonist is homoarginine or a salt or derivative thereof. (6) A pharmaceutical composition comprising at least one agent selected from the group consisting of an autophagy inhibitor and a lysine antagonist, and used to treat and / or prevent a tumor in a subject in combination with administration of a lysosomal membrane permeabilizer. (7) A pharmaceutical composition comprising a lysosomal membrane permeabilizer and at least one agent selected from the group consisting of an autophagy inhibitor and a lysine antagonist. (8) The pharmaceutical composition according to (7), which is used to treat and / or prevent a tumor in a subject. (9) A pharmaceutical composition used for treating and / or preventing a tumor in a subject, comprising ifenprodil. (10) A method for treating and / or preventing a tumor in a subject, comprising administering a lysosomal membrane permeabilizer in combination with the following steps a) and / or b): a) administering an autophagy inhibitor; b) restricting lysine intake or administering a lysine antagonist.
Claims
1. A pharmaceutical composition comprising a lysosomal membrane permeabilizer, which is used to treat and / or prevent tumors in a subject in combination with restricting lysine intake or administering a lysine antagonist.
2. The pharmaceutical composition according to claim 1, wherein the lysosomal membrane permeabilizer is ifenprodil or a salt thereof.
3. The pharmaceutical composition according to claim 1 or 2, wherein the tumor is a brain tumor.
4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the lysine antagonist is homoarginine or arginine, or a salt thereof.
5. A pharmaceutical composition comprising a lysine antagonist, which is used to treat and / or prevent tumors in a subject in combination with the administration of a lysosomal membrane permeabilizing agent.
6. A pharmaceutical composition comprising a lysosomal membrane permeabilizer and a lysine antagonist.
7. The pharmaceutical composition according to claim 6, which is used to treat and / or prevent a tumor in a subject.
8. A pharmaceutical composition for use in treating and / or preventing a tumor in a subject, comprising ifenprodil.