Lipid nanoparticles for delivering nucleic acids and related methods of use

Ionizable cationic lipids with specific chemical structures and optimized lipid compositions in LNPs address oxidative degradation issues, ensuring stability and enhanced nucleic acid delivery to dendritic cells for improved vaccine efficacy.

JP2026016373APending Publication Date: 2026-02-03AKAGERA MEDICINES INC
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025157188
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-11-25
Filing Date
2025-09-22
Publication Date
2026-02-03

AI Technical Summary

Technical Problem

Existing ionizable cationic lipids (ICLs) used in lipid nanoparticles (LNPs) are susceptible to oxidative degradation during storage, which compromises their stability and transfection efficacy.

Method used

Development of ionizable cationic lipids with specific chemical structures, such as those containing two or more methylene groups between carbon-carbon double bonds, reducing oxidation susceptibility and enhancing stability, and incorporation of specific lipid compositions in LNPs to improve targeting and delivery of nucleic acids to dendritic cells.

Benefits of technology

The new ionizable cationic lipids exhibit reduced oxidation by-products, maintaining high transfection activity and stability, and enhance the targeting and delivery of nucleic acids to dendritic cells, potentially improving vaccine efficacy against infectious diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026016373000001_ABST
    Figure 2026016373000001_ABST
Patent Text Reader

Abstract

To provide improved compositions of ionized lipid nanoparticles for delivering therapeutic nucleic acids to cells.SOLUTION: What is claimed is: A lipid nanoparticle (LNP) composition comprising an ionizable lipid having a chemical structure consisting of a pair of linear polyunsaturated lipid tails covalently attached to a head group, wherein: Wherein the head group comprises a dialkylamino group having a pKa of 6 to 7, wherein the head group comprises a heterocyclyl or alkyl moiety covalently bonded to the dialkylamino group, and optionally further comprises a phosphate group, wherein each polyunsaturated lipid tail is unsaturated except for at least two olefins separated by at least two methylene groups along the length of the lipid tail, and optionally comprises a single acyl group at the end of the lipid tail covalently bonded to the head group.SELECTED DRAWING: Figure 15
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] Related Applications This patent application is a continuation of U.S. Provisional Patent Application No. 63 / 118, filed November 25, 2020. This application claims the benefit of and priority to Patent Application No. 534, the entire contents of which are incorporated herein by reference. and is hereby incorporated by reference in its entirety as if set forth in its entirety herein.

[0002] Sequence Listing Reference This specification was created on November 24, 2021, and has a size of 7,061 bytes. The file named 191016-010403_ST25.txt is including the sequence listing submitted herewith, the contents of which are incorporated herein by reference. can be.

[0003] Field The present disclosure relates to cationic ionizable lipids and lipid nanoparticles (LNPs). In some embodiments, LNPs comprising one or more cationic ionizable lipids are used for targeting dendritic cells. or for delivery of nucleic acid compounds for use in methods of using these LNP compositions as vaccines. In some embodiments, the LNPs are useful as bioreducible ionizable cationic lipids. The lipids may include polyolefinic or non-conjugated ionizable cationic lipids. [Background technology]

[0004] Lipid nanoparticles (LNPs) are used to deliver therapeutic nucleic acids into cells. For example, LNP pharmaceutical compositions are used in vaccines to deliver mRNA therapeutics. LNP formulations are typically Typically, these include ionizable cationic lipids (ICLs). However, certain ICL compounds is known in the art to be susceptible to oxidation during storage, which is undesirable. Therefore, it has improved stability against oxidative degradation during storage and In some cases, when incorporated into LNPs together with therapeutic agents such as nucleic acids, desired transfection occurs within cells. There is a need for improved ICL compounds that also provide transfection activity or efficacy.

[0005] SNALP compositions are useful for delivery of nucleic acid therapeutics for a variety of infectious diseases, including tuberculosis, Infectious diseases such as HIV / AIDS, malaria, and COVID-19 affect human health. For example, mycobacteria are the genus of bacteria responsible for tuberculosis (TB). According to the World Health Organization, TB is one of the top ten causes of death worldwide. It is the single most common cause of death among pathogens. Despite current best efforts, The development of effective vaccines to prevent infectious diseases has presented a great challenge. New approaches in identifying peptides or antigen-peptide combinations may improve vaccine efficacy. Nevertheless, these antigen sequences were transferred to professional antigen-presenting cells such as dendritic cells. There is great potential in engineering adjuvants to aid in efficient delivery to target cells. Antigen peptides or proteins combined with ionized cationic lipid nanoparticles remain mRNA coding for proteins represents a particularly promising strategy for vaccine development. SNALP PHARMACEUTICAL COMPOSITIONS FOR DELIVERY OF mRNA FOR THE TREATMENT AND PREVENTION OF VARIOUS DISEASES - Patent application There is a need for safe and effective treatments, including vaccine compositions. Summary of the Invention

[0006] In some embodiments, ionizable cationic lipids (ICLs) are provided. The carboxylic lipids can be stored for a long time while retaining high transfection activity or potency in cells. The present disclosure also provides a method for producing a pair of aluminum nitrites, which are engineered to improve their stability against oxidative degradation. By containing two or more methylene groups between the quinyl double bonds, ions with polyene chains can be obtained. The discovery that the undesirable oxidation and / or degradation of hydroxylated lipids can be ameliorated is The lipids disclosed herein are based on at least two methylene groups or substituted methylene groups. at least two carbon-carbon double bonds (olefins) spaced apart by groups, wherein The substituted methylene is C(R1)(R2)-, where R1 and R2 are independently H, a The lipids disclosed herein are composed of two symmetric polyene carbonyls. Each of these has two carbon-carbon double bonds (olefins) and two, three, or four on either side of two methylene groups separated by at least two methylene groups The olefins in the lipid tail are separated by a single methylene group, e.g., D Compared to Lin-MC3-DMA, the compounds described herein are significantly less susceptible to oxidation. Thus, it is considered the gold standard in ionizable cationic lipid design and solves stability issues. In some embodiments, the compounds provided herein have been reported to have Compared to LNP, oxidation by-products were reduced by more than 30%, 50%, 75%, 90%, and In some embodiments, the compounds provided herein have a Compared with control LNPs containing DLin-KC2-DMA lipids, 3% of oxidation by-products with a reduction of more than 0%, more than 50%, more than 75%, more than 90%, and more than 95%.

[0007] In some embodiments, ionizable cationic lipid compositions are provided. In embodiments, the ionizable cationic lipid can comprise two polyene hydrocarbon chains, Each contains one or two alkenyl double bond moieties. The ionizable cationic lipid may contain two polyene hydrocarbon chains, each of which may be 2 In some embodiments, the alkenyl double bond moiety contains two or more methylene groups between the two alkenyl double bond moieties. The ionized cationic lipids have two C 16 or C 18 Polyene hydrocarbon chain-containing It is possible.

[0008] In some embodiments, each of the two adjacent unsaturated fatty acids in each polyene hydrocarbon chain Between the saturated alkynyl double bonds, there is an unsaturated linear ethylene, n-propylene, or n-butylene A pair of linear polyenes containing C 16 or C 18 Ionized cations with hydrocarbon chains In some embodiments, the liposome composition comprises a liposome containing a soluble lipid. The compound is covalently attached to a head group containing a dialkylamino group with a pKa of 6-7. It has a chemical structure consisting of a pair of 16- or 18-carbon linear polyunsaturated lipid tails The lipids may include ionizable lipids, wherein the head group is covalently attached to a dialkylamino group. and optionally further containing a phosphate group. Each polyunsaturated lipid tail has at least two methylene groups along the length of the lipid tail. Each lipid tail is unsaturated except for at least two olefins separated by , optionally containing a single acyl group at the terminus covalently attached to the head group. In embodiments, each lipid tail is identical and each lipid tail is unsubstituted ethylene, n-propyl It has a total of two olefins separated only by n-butyl or n-butyl. In some embodiments, each lipid tail combines with an oxygen of the head group to form an ester. It further contains an acyl group.

[0009] In some embodiments, the dialkylamino moiety of the head group of the ionizable cationic lipid The moiety has a dialkylamino chemical structure of formula (IV-A).

[0010] [ka] [wherein n in formula (IV-A) is 2, 3 or 4, and R in formula (IV-A) 10 and R 12 are each independently selected from the group consisting of methyl, ethyl, and n-propyl. R is selected from alkyl groups selected from 10 and R 12 The alkyl in substituted with one or more hydroxyls] In some embodiments, R in formula (IV-A) 10 and R 12 are independent of each other and methyl, ethyl, -(CH2)(CH2)OH, or (CH2)2(CH2)O It's H.

[0011] In some embodiments, the ionizable cationic lipid is [ka] wherein R 22 is the first end of the lipid tail , [ka] indicates the connection of the head group to the dialkylamino chemical structure. wherein the ionizable cationic lipid comprises a chemical substructure of formula (IV-A): [ka] wherein R 22 is the first lipid tail It is the end of 1, [ka] indicates the attachment of the head group to the dialkylamino chemical structure of the head group.

[0012] In some embodiments, the ionizable cationic lipid has a monovalent structure linked to a head group. and further comprising a pair of lipid tails, wherein each lipid tail has the chemical structure of Formula A or Formula B. It contains a hydrocarbon chain.

[0013] [ka] [wherein, in formula A, a is 1, 2, 3 or 4, and b is 2, 3 or 4; , c is 3, 4, 5, 6, or 7]

[0014] [ka] [wherein, in Formula B, a is 5, 6, or 7, and in Formula B, c is 3, 4, or 5] In some embodiments, b is 4, and the sum of a, b, and c in Formula A is 10, 11, 12, or 13. In some embodiments, the ionizable cationic lipid is , R in the chemical structure shown above 22 In some embodiments, the lipid tail of formula A or formula B is In one embodiment, the ionizable cationic lipid comprises a lipid tail of formula A, wherein [ka] is the R in the chemical structure shown above. 22 In some embodiments, The ionizable cationic lipid comprises a lipid tail of formula B, wherein [ka] is the R in the chemical structure shown above. 22 Indicates the position of the connection.

[0015] In some embodiments, the ionizable cationic lipid has the chemical structure of formula (IA): Has.

[0016] [ka] [In the formula, a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 3, 4, 5, 6, or 7, the sum of a, b, and c is 10 or 12, and q is 1 , 2, 3, or 4, and R 10 and R 12 Each of the is a (C1-C4) alkyl substituted with one or more hydroxyl groups; L is [ka] where v is 0 or 1, q is 1, 2 or 3, and q2 is 1 or 2 is] In some embodiments, in formula IA, when v is 0, q is 1, 2, or 3; When v is 1, q is 1, 2, 3, or 4.

[0017] In some embodiments, v in formula IA is 0. In some embodiments, v in formula IA is 0 and q is 1, 2, or 3. wherein v in formula IA is 0 and q is 1 or 2. In some embodiments, The ionizable lipid is a cation selected from the group consisting of compounds 17-19 and 23-25. It is a fatty acid.

[0018] [ka]

[0019] In some embodiments, the ionizable lipid is AKG-UO-1, AKG-UO-2 , AKG-UO-4, and AKG-UO-5. In some embodiments, the ionizable lipid is AKG-UO-1.

[0020] [ka] In some embodiments, the ionizable lipid is AKG-UO-1A.

[0021] [ka] In some embodiments, the ionizable lipid is AKG-UO-1B.

[0022] [ka] In some embodiments, the ionizable lipid is AKG-UO-2.

[0023] [ka] In some embodiments, the ionizable lipid is AKG-UO-4.

[0024] [ka] In some embodiments, the ionizable lipid is AKG-UO-4A.

[0025] [ka] In some embodiments, the ionizable lipid is AKG-UO-5.

[0026] [ka] In some embodiments, the ionizable lipid is AKG-UO-6, AKG-UO-7, AKG-UO-7, AKG-UO-8, AKG-UO-9, or AKG-UO-10 be.

[0027] [ka] In some embodiments, the ionizable lipid has a head group comprising a methylated phosphate moiety. In some embodiments, the ionizable lipid comprises a compound of formula IA, wherein v is 1. In some embodiments, the ionizable lipid has a chemical structure of formula IA, , v is 1, and q is 3 or 4. In this case, ionized lipids are [ka] In some embodiments, the ionizable lipid is selected from the group consisting of AKG-UO It is -3.

[0028] [ka]

[0029] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0030] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is , 4, 5, 6, 7 or 8, R2 is [ka] and q is 1 or 2, R 10 and R 12 each independently optionally containing one or more hydroxyl is (C1-C4) alkyl substituted with

[0031] In some embodiments, the ionizable lipid is selected from compounds 1-3 and compounds 5-8. is selected from the group consisting of:

[0032] [ka]

[0033] In some embodiments, the ionizable lipid is selected from the group consisting of compounds 1-8. do.

[0034] [ka]

[0035] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0036] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is , 4, 5, 6, 7 or 8, R2 is [ka] and q' is 1 or 2, R 10 and R 12 each independently optionally containing one or more hydroxyl is (C1-C4) alkyl substituted with

[0037] In some embodiments, the ionizable lipid is selected from the group consisting of compounds 9-19. It is a compound that can be

[0038] [ka]

[0039] In some embodiments, the ionizable lipid has the chemical structure of formula II-A:

[0040] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is , 4, 5, 6, 7 or 8, R2 is [ka] and L is [ka] where v is 0 or 1, q is 1, 2, 3 or 4, and q2 is 1 or 2 and R 10 and R 12 each of which may independently optionally be one or more is a (C1-C4) alkyl substituted with a hydroxyl of In some embodiments, in Formula II-A, when v is 0, q is 1, 2, or 3. Or when v is 1, q is 3 or 4.

[0041] In some embodiments, the lipids are designed to be biodegradable, and therefore in The nanoparticles thereby formed in vivo are better tolerated.

[0042] In some embodiments, the ionizable lipid has the chemical structure of formula II-B:

[0043] [ka] wherein a is 5, 6, or 7, and c is 3, 4, or 5; R2 is [ka] and q and q' are each independently 1 or 2; R 10 and R 12 are each optionally substituted with hydroxyl (C 1-C4) alkyl]

[0044] In some embodiments, the ionizable cationic lipid comprises compounds 29-34. The compound is selected from the group:

[0045] [ka]

[0046] In some embodiments, the ionizable lipid is a bioreducible cationic lipid. In some embodiments, the ionizable lipid is a bioreducible lipid comprising a sterol chemical structure. In some embodiments, the ionizable lipid is a cationic lipid having the formula (VI-A): : [ka] wherein q is 3 or 4, and R3 is [ka] or a pharmaceutically acceptable salt thereof. In this case, the ionizable cationic lipid is selected from the group consisting of compounds 35 to 38.

[0047] [ka]

[0048] In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, The ionic nanoparticles may comprise an ionizable lipid of formula I, II, III, IV, or a combination thereof. In some embodiments, the lipid nanoparticle composition includes pharmaceutically acceptable salts thereof. The composition includes lipids and nucleic acids, and the lipidic nanoparticles are represented by Formulas IA, II-A, II-B, I VA, or VI-A, or a combination thereof, or a pharmaceutical composition thereof In some embodiments, the lipid-based nanoparticle composition comprises a lipid and a soluble salt thereof. and nucleic acid, and the lipid nanoparticles are of formula A, formula A', formula A", or formula B or any of these. or a pharmaceutically acceptable salt thereof. Includes.

[0049] In some embodiments, the present disclosure also provides a method for administering a therapeutic nucleic acid to a cell using a lipid-based method. Also provided are compositions of nanoparticles (LNPs). The soluble lipids are less than 20 mol% of the total lipids in the composition (for example, 2.5 to 1 mol% of the total lipids in the composition). 0 mol%), LNP compositions combined with specific low amounts of phosphatidyl-L-serine were surprisingly Remarkably, based in part on findings that demonstrated greatly enhanced targeting of encapsulated nucleic acids, Ku.

[0050] In some embodiments, the LNP composition comprises: (a) nucleic acid; (b) ionized cation; (c) sterols (e.g., cholesterol or cholesterol derivatives, or or plant sterols such as beta-sitosterol), (d) phosphatidylserine phospholipids (e.g., mixtures of phosphatidylserine and DSPC), and (e) complex lipids In one embodiment, the LNP composition comprises (a) a nucleic acid, (b) ionized cationic lipids, (c) sterols (e.g., cholesterol or cholesterol-containing lipids), (d) composition of plant sterols, such as beta-sitosterol derivatives or beta-sitosterol 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 10 mol%) of the total lipids in the product phosphatidylserine lipid in a total amount of 7.5 mol%, and additional phospholipids (e.g., D SPC), and (e) conjugated lipids (e.g., PEG-DMG). In one embodiment, the LNP composition comprises: (a) a nucleic acid; (b) an ionizable cationic lipid; (c) a nucleic acid; Sterols (e.g., cholesterol or cholesterol derivatives, or beta-sitol) (d) 1 to 10 mol % of the total lipids in the composition (e.g., plant sterols, e.g., sterols); , 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) in total amount of phosphatidyl Serine lipids and phospholipids including additional phospholipids (e.g., DSPC), and (e 0.5 to 4.5 mol% (e.g., 0.5 to 2.5 mol%, 1.5 mol%) of the total lipids in the composition In one embodiment, the LNP composition comprises a total of 100% of a conjugated lipid (e.g., PEG-DMG). The composition comprises (a) nucleic acid, (b) 40 to 65 mol% (e.g., 50 mol%) of the total lipids in the composition. ionized cationic lipids in a total amount of 25 to 40 mol % (e.g., 25 to 40 mol %) of the total lipids in the composition; For example, 38.5 mol% of total sterols (e.g., cholesterol or cholesterol (d) the total amount of sterols in the composition; 1 to 10 mol% of lipids (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7.5 mol%) Phosphatidylserine lipids, and additional phospholipids (e.g., DSPC) in a total amount of 100% and (e) 0.5 to 4.5 mol% (e.g., 0.5 to 4.5 mol% of the total lipids in the composition) Containing a total amount of conjugated lipid (e.g., PEG-DMG) of 0.5 to 2.5 mol%, 1.5 mol%) In one embodiment, the LNP composition comprises (a) nucleic acid, (b) 40-60% of the total lipids in the composition. (c) a total amount of ionizable cationic lipids in the composition; 25-40 mol% (e.g., 38.5 mol%) of the total amount of sterols (e.g., cholesterol) of the lipids Sterol or cholesterol derivatives, or plant sterols such as beta-sitosterol (d) phospholipids in a total amount of 5 to 25 mol% of the total lipids in the composition, 1 to 10 mol% (e.g., 2.5 to 10 mol%, 3 to 9 mol%, 5.0 to 7 0.5 mol%) total amount of phosphatidylserine lipid, and additional phospholipid (e.g., DS (e) a phospholipid comprising phospholipids containing phospholipids (e.g., 10 mol % of the total lipids in the composition); 0.5 to 4.5 mol% (e.g., 0.5 to 2.5 mol%, 1.5 mol%) of the total lipids in the product The total amount of conjugated lipid (e.g., PEG-DMG) is

[0051] In one embodiment, the LNP composition comprises: (a) a nucleic acid; (b) a polyene hydrocarbon; Between two adjacent unsaturated alkynyl double bonds in the main chain, there is an unsaturated linear ethylene, n-propanol A pair of linear polyenes containing propylene or n-butylene C 16 or C 18 hydrocarbon chain An ionized cationic lipid having a total amount of 40 to 65 mol % of the total lipids in the composition. (c) 25 to 40 molar equivalents of the total lipids in the composition; (d) 5-2% of the total lipids in the composition; 5 mol % of total phospholipids, and 1 to 10 mol % of total lipids in the composition. phospholipids (e.g., phosphatidyl-L-serine lipids) and additional phospholipids (e.g., DSPC in a total amount of 10 mole % of the total lipids in the composition), and (e) a complex lipid (e.g., PEG-D) in an amount of 0.5 to 2.5 mol% of the total lipid in the composition; In one embodiment, the LNP composition comprises (a) an mRNA nucleic acid; (b) a nucleic acid sequence comprising: The total amount of 40 to 65 mol% of the total lipids is the formula (IA), formula (II-A) when v is 0, or an ionizable cationic lipid of formula (II-B), (c) 25 to 40% of the total lipids in the composition (d) 1 to 10 mol% (e.g., 2 mol%) of the total lipids in the composition; 0.5-10 mol%, 3-9 mol%, 5.0-7.5 mol%) of total amount of L-serine phosphate tidylserine lipids (e.g., DPPS or DSPS), and 5 to 10% of the total lipids in the composition 25 mol % total amount of DSPC, and (e) 0.5 to 2.5 mol % of the total lipids in the composition In one embodiment, the LNP composition comprises a total amount of conjugated lipid (e.g., PEG-DMG). (a) mRNA nucleic acid, (b) a total amount of 40 to 65 mol% of the total lipids in the composition, where v is 0 (c) an ionizable cationic lipid of formula (IA) when the total lipid content in the composition is 25 to 40 moles; (d) a total amount of L-celery in the composition of 3 to 9 mol % of the total lipids in the composition; a phospholipid (e.g., DPPS or DSPS), and the total amount of phospholipid in the composition (e) DSPC in a total amount of 5 to 25 mol% of the lipids, and (f) DSPC in a total amount of 0.5 to 25 mol% of the total lipids in the composition 0.5 mol% total amount of conjugated lipid (e.g., PEG-DMG).

[0052] In some embodiments, the composition comprises: (a) a polyunsaturated ionizable cationic lipid; and (b) a charged phospholipid phosphatidylserine lipid.

[0053] In some embodiments, the composition comprises: (a) an ionizable cationic lipid of formula IV-A , and (b) DSPS (L isomer), DPPS (L isomer), DMPS (L isomer) , DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-D anionic phospholipid targets selected from the group consisting of SPE, and N-Suc-DSPE In some embodiments, the composition comprises (a) an ionizable moiety of formula IV-A. (b) a thionic lipid, and (b) an anionic phospholipid targeting moiety of formula VA. In an embodiment, the composition comprises: (a) an ionizable cationic lipid of formula IV-A; and (b) an aniline selected from the group consisting of DSPS (L isomer) and DPPS (L isomer); The phospholipid targeting moiety is a phospholipid-targeting moiety.

[0054] In some embodiments, the composition comprises: (a) an ionizable cationic lipid of formula IV; and and (b) an anionic phospholipid targeting moiety of formula VA. In some embodiments, The composition comprises (a) an ionizable cationic lipid of formula IV, and (b) DSPS (L-type esters of DSPS). (isomer), DPPS (L isomer), DMPS (L isomer), DOPS (L isomer), DSP S (D isomer), DSPG, DPPG, N-Glu-DSPE, and D-Suc-DS PE. In one embodiment, the composition comprises (a) an ionizable cationic lipid of formula IV, and (b) an ionizable cationic lipid of formula VA. In some embodiments, the composition comprises an anionic phospholipid targeting moiety of ) ionizable cationic lipids of formula IV-A, and (b) DSPS (L isomer) and D PPS (L isomer).

[0055] In one embodiment, the LNP composition comprises (a) mRNA nucleic acid, (b) 4% of the total lipids in the composition. 0 to 65 mol% in total of AKG-KC2-OA, AKG-KC3-OA, Dlin-K an ionized cation selected from the group consisting of C2-DMA and Dlin-KC3-DMA; (c) cholesterol (or (d) two or more phospholipids in a total amount of 5 to 25 mol % of the total lipids in the composition; A mixture, wherein the phospholipids are 3 to 9 mol% (e.g., 5.0 to 7.0 mol%) of the total lipids in the composition. 5 mol%) total amount of L-serine phosphatidylserine lipid (e.g., DPPS or DS (e) a mixture of phospholipids containing 0.5 to 2.5 molar equivalents of the total lipids in the composition; Contains 1% total amount of conjugated lipid (e.g., PEG-DMG).

[0056] [ka]

[0057] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, an ionized cationic lipid, and AKG-UO-1, and a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. (L-serine) PS lipid. In some embodiments, the nucleic acid is mRNA, The PS lipids are (L-serine)DSPS, (L-serine)DPPS, or a mixture thereof. and the LNP composition is composed of cholesterol and DSPC, DPPC, and DOPC. The LNP composition further comprises a second phospholipid selected from the group consisting of: 0.5 to 1.5 mol% PEG-DMG or PEG-DSG relative to the total lipid content Further includes:

[0058] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, KC2OA, KC2, Ionized cationic selected from KC2-01, ALC-0315, and SM102 Lipids, and (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition ) PS lipids. In some embodiments, the LNP composition comprises an N / P ratio ( For example, a ratio of 5 to 7 or 5.

[0059] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) composition comprises a nucleic acid, AKG-UO-6, and and AKG-UO-7, and the total lipid content of the LNP composition. The total amount of (L-serine) PS lipids is 2.5 to 10 mol% of the total lipid content. In some embodiments, the N / P ratio is 3 to 8 (e.g., 5 to 7 or a ratio of 5 or 7).

[0060] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) vaccine composition has an N / P ratio of 3 to 8. mRNA nucleic acid having a total amount of ALC- of 46 to 65 mol% of the total lipid content of the LNP composition 0315 Ionized cationic lipid, 25-40 mol% total of the total lipid content of the LNP composition A total amount of cholesterol of 2.5 to 10 mol% of the total lipid content of the LNP composition (L- Serine) PS lipid, DSPC phosphorus in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition lipids, and PEG-DMG in a total amount of 0-2.5 mol% of the total lipid content of the LNP composition include.

[0061] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) vaccine composition has an N / P ratio of 3 to 8. mRNA nucleic acid, a total amount of Dlin of 40 to 65 mol% of the total lipid content of the LNP composition -KC2-DMA ionized cationic lipid, 25-40% of the total lipid content of the LNP composition % total cholesterol, 2.5 to 10 mol% total lipid content of the LNP composition (L-serine) PS lipid, a total amount of DS of 5 to 25 mol% of the total lipid content of the LNP composition PC phospholipids, and PEG- in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition. Includes DMG.

[0062] In one embodiment, the lipid nanoparticle (LNP) vaccine composition has an N / P ratio of 3 to 8. The total amount of KC3-OA is 40 to 65 mol% of the total lipid content of the LNP composition. Ionized cationic lipids, in a total amount of 25-40 mol% of the total lipid content of the LNP composition Sterols, (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, DSPC phospholipid in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition, and and PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition.

[0063] In one embodiment, the nucleic acid-lipid nanoparticle (LNP) vaccine composition has an N / P ratio of 3 to 8. ionized mRNA nucleic acid, a total amount of 40-65 mol% of the total lipid content of the LNP composition Cationic lipids, cholesterol in a total amount of 25-40 mol% of the total lipid content of the LNP composition (L-serine)PS lipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition and DSPC phospholipids in a total amount of 5 to 25 mol % of the total lipid content of the LNP composition. and PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition.

[0064] One aspect of the present disclosure is a method for targeting LNPs to dendritic cells using a method comprising: The present invention relates to the use of (L-serine) PS lipids in LNPs in a total amount of 2.5 to 10 mol % of the total amount of the (L-serine) PS lipids. In some embodiments, the LNP comprises mRNA. The NP further comprises cholesterol. In some embodiments, the LNP comprises an ICL. In some embodiments, the LNP further comprises one or more additional In some embodiments, the LNP further comprises a complex lipid. In some embodiments, the LNP comprises an mRNA nucleic acid having an N / P ratio of 3 to 8. Ionized cationic lipids (ICLs) in a total amount of 40–65 mol% of the total lipid content of the NP composition ), the total lipid content of the LNP composition is 25 to 40 mol% of the total cholesterol, A total amount of (L-serine) PS lipid of 2.5 to 10 mol% of the total lipid content of the LNP composition DSPC phospholipids in a total amount of 5 to 25 mol % of the total lipid content of the LNP composition, It contains a total amount of complex lipids of 0 to 2.5 mol% of the total mass content. [Brief explanation of the drawings]

[0065] [Figure 1] FIG. 1 is a diagram of the oxidative degradation mechanism of lipid esters of linoleic acid containing conjugated multiple unsaturations that are particularly susceptible to oxidation. [Figure 2] Figure 1 shows the reaction of the reduced C-terminal cysteine ​​of a Fab' antibody fragment with maleimide-terminated poly(ethylene glycol) 2000-derivatized distearoylphosphatidylethanolamine. R1 and R2 are stearic acid. The final antibody-lipopolymer conjugate is an intermediate that subsequently inserts into the lipid outer layer of lipid nanoparticles for active targeting. [Figure 3A] The effect of 0 to 2.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours with each formulation at a concentration of 1 μg mRNA / mL. UT samples correspond to cells without added LNPs. Lipofect refers to lipofectamine-treated samples. [Figure 3B]The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated for 24 hours with each formulation at a concentration of 1 μg mRNA / mL. UT samples correspond to cells without added LNPs. Lipofect refers to lipofectamine-treated samples. [Figure 3C] The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated with each formulation at a concentration of 0.3 μg mRNA / mL for 24 hours. UT samples correspond to cells without added LNPs. [Figure 3D] The effect of 0 to 7.5 mol% DSPS content on the transfection efficiency of dendritic cells (MutuDC1940) using mCherry mRNA LNPs formulated with DLin-KC2-DMA as the ionizable cationic lipid. The ICL, cholesterol, and PEG-DMG were maintained at 50 mol%, 38.5 mol%, and 1.5 mol%, respectively, while the DSPS content was varied. DSPS was included by reducing the DSPC content by the same mol% as the added DSPS. Cells were incubated with each formulation at a concentration of 0.1 μg mRNA / mL for 24 hours. UT samples correspond to cells without added LNPs. [Figure 4]Transfection of murine dendritic cells (MutuDC1940) with LNPs containing various ICLs (KC2, KC2-OA, KC3-OA, and SM-102) and 5 mol% DSPS, and comparison with LNPs containing Glu-DSPE or Suc-DSPE rather than DSPS. UT samples correspond to cells without added LNPs. [Figure 5] DSPS or DPPS increases mCherry LNP transfection with ICLs containing KC2, KC2-01, KC2-PA, KC3-01, and KC3-OA. UT samples correspond to cells to which no LNPs were added. [Figure 6A] Comparison of various chemical forms of phosphatidylserine and AKG-UO-1-containing LNPs in transfecting mouse dendritic cells. UT samples correspond to cells to which no LNPs were added. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNPs. [Figure 6B] Comparison of DSPS and other negatively charged phospholipids in transfecting mouse dendritic cells using AKG-UO1-containing LNPs. UT samples correspond to cells to which no LNPs were added. Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNPs. [Figure 7] Effect of DSPS concentration in AUG-UO-1-containing LNPs on the transfection of dendritic cells. The UT sample corresponds to cells to which no LNPs were added. [Figure 8] Effect of PEG-DMG concentration in AUG-UO-1-containing LNPs with and without 5 mol% DSPS on dendritic cell transfection. The Y-axis indicates the % PEG used in the composition after which mRNA concentrations (0.11, 0.33, or 1 μg / mL) were added to the cells. The UT sample corresponds to cells to which no LNPs were added. [Figure 9A]Oxidative degradation of lipid suspensions of ICLs with a single methylene between the two olefins (KC2, KC3, and O-11769) and ICLs with four methylenes between the two olefins (KC2-01, KC3-01, and UO-1). [Figure 9B] Oxidative degradation of liposomes containing O-11769 (an ICL with a single methylene between the two olefins) and UO-1 (an ICL with four methylenes between the two olefins). [Figure 10A] Effect of N / P on mCherry expression in mouse dendritic cells containing 1 μg / mL of KC2-01-containing LNPs. The UT sample corresponds to cells to which no LNPs were added. [Figure 10B] Effect of N / P on mCherry expression in mouse dendritic cells from 0.33 μg / mL KC2-01-containing LNPs. The UT sample corresponds to cells to which no LNPs were added. [Figure 11] Transfection efficiency of LNPs containing different ionized cationic lipids with and without DSPS (7.5 mol %). The UT sample corresponds to cells to which no LNPs were added. [Figure 12] Transfection efficiency of LNP formulations containing various concentrations of DOPS (0, 10, and 25 mol% as % of total lipids) and mCherry mRNA in mouse dendritic cells. [Figure 13A-1] VRN-029 mRNA sequence, SARS-COV2 spike protein producing sequence. [Figure 13A-2] VRN-029 mRNA sequence, SARS-COV2 spike protein producing sequence. [Figure 13B] Effect of PEG-DMG(C14) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNPs using the ionizable lipid UO1 with increasing mol% of 7.5% DSPS and PEG-DPPE. The middle graph shows the endpoint antibody titers at day 34. The right graph shows the corresponding CD4 T cell responses. [Figure 13C] Effect of PEG-DPPE(C16) concentration (mol%) on LNP vaccine immunogenicity. Total anti-spike antibody titers in mice immunized with mRNA-LNP using the ionizable lipid UO1 with 7.5% DSPS and increasing mol% of PEG-DMG. The middle graph shows the endpoint antibody titers at day 34. The mol% of PEG-DPPE oppositely affected antibody levels. The right graph shows the corresponding CD4 T cell responses. [Figure 13D] Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNP using the ionizable lipid KC2OA with 7.5% DSPS and 1.5 mol% of either PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titers on day 34. The graph on the right shows the corresponding CD4 T cell responses. [Figure 13E] Total anti-spike antibody titers and CD4 responses in mice immunized with mRNA-LNP using the ionized lipid UO1 with 7.5% DSPS and 1.5 mol% of either PEG-DMG(14C) or PEG-DSG(18C). The graph on the left shows the endpoint antibody titers on day 34. The graph on the right shows the corresponding CD4 T cell responses. [Figure 13F] Effect of phosphatidylserine incorporation on mRNA-LNP immunogenicity. Total anti-spike antibody titers (A) and spike-specific CD4 T cell responses in mice immunized with mRNA-LNP using various ionizable lipids and PEG-lipid plus / minus 7.5 mol% DSPS. Antibody data were log-transformed and analyzed using two-way ANOVA with Sidak multiple comparison test. CD4 T cell data were analyzed using a REML mixed-effects model with Sidak multiple comparison test. [Figure 13G] Effect of phosphatidylserine lipid tail (DPPS vs. DSPS) composition on mRNA-LNP priming of B (Panel A) and T cell (Panel B) responses. Antibody data were log-transformed prior to analysis. Data were analyzed using one-way ANOVA with Tukey's multiple comparison test. [Figure 14A]Comparison of mCherry expression for 24 hours at 1 μg / mL mRNA in KC2-01 LNP, 7.5 mol% DSPS (D isomer), and DSPS (L isomer). [Figure 14B] Comparison of mCherry expression for 24 hours at 0.33 μg / mL mRNA in KC2-01 LNP, 7.5 mol% DSPS (D isomer) and DSPS (L isomer). [Figure 15] Comparison of mCherry expression between KC2 LNPs, those with 5 and 7.5 mol% DSPS (L isomer), and LNPs prepared with SM-102 or ALC-0315 (1 μg / mL mRNA, 24 h). The Y-axis is mean fluorescence intensity (MFI). The UT sample corresponds to cells without added LNPs. [Figure 16] Comparison of mCherry expression in UO1, UO6, and UO7 formulations alone or supplemented with 7.5 mol% D isomer of DSPS (1 μg / mL mRNA, 24 h). The UT sample corresponds to cells without added LNPs. [Figure 17] Comparison of mCherry expression in UO1, SM102, and ALC-0315 formulations alone or with DSPS (1 μg / mL mRNA, 24 h). Lipo refers to Lipofectamine MessengerMax (ThermoFisher) used according to the manufacturer's instructions at the same dosage level as LNP. UT samples correspond to cells without LNP. DETAILED DESCRIPTION OF THE INVENTION

[0066] Both the foregoing general description and the following detailed description are exemplary and explanatory only. It is to be understood that the compositions and methods of the present disclosure are not limited.

[0067] Stabilized nucleic acid lipid particles (SNALPs) have been used for the systemic delivery of mRNA or other nucleic acid therapeutics. The SNALP compositions are used as a vehicle for A pair of linear 18-carbon aliphatic chains containing a pair of carbon-carbon double bonds ( MC3 or MC4, which contain a protonatable tertiary amine head group linked to a carboxylic acid (e.g., linoleic acid). or KC2. However, each contains a single methylene group. The structure of these hydrocarbon chains, containing a pair of double bonds separated by a The chemical substructure confers desirable biological properties to the compound, but the chemical substructure also provides resistance to oxidative degradation. This can also lead to undesirable problems such as increased sensitivity of materials to oxidation. Diagram of the oxidative degradation mechanism of lipid esters of linoleic acid containing conjugated multiple unsaturations. Suitable for use in SNALP compositions, but with enhanced resistance to oxidative degradation. Novel cationic lipids are needed.

[0068] Disclosed herein are compounds, compositions and methods related to the treatment of bacterial infections. As used herein, the terms "compound," "drug," and "active agent" are used interchangeably. Some aspects of the present disclosure relate to novel ionizable lipids or bioreducible ionizable lipids. These lipids are cationic (i.e., positively charged) at acidic pH, For example, they are encountered intracellularly after endocytosis or phagocytosis by the cell. and compositions containing them have an approximately neutral charge when present at pH 7.4. These lipids have at least two methyl groups present in their alkyl or acyl groups. It may also have multiple olefins separated by olefin groups.

[0069] Some aspects of the present disclosure relate to processes for the synthesis of novel ionizable lipids.

[0070] Another aspect relates to a composition comprising lipidic nanoparticles comprising ionized cationic lipids, The lipid-based nanoparticles contain nucleic acids. In some embodiments, the nucleic acids are is encapsulated inside.

[0071] Another aspect of the present disclosure is the use of these ionized mAbs in vaccines for the prevention of infectious diseases or cancer. Some embodiments relate to the use of lipid-based nanoparticle compositions comprising lipids or ionizable lipids. In some embodiments, the infectious disease may be a bacterial or viral infection. In some embodiments, the compositions described herein may be used to treat infections related to tuberculosis, HIV / AIDS, used to prevent infection with malaria or coronavirus-related infections such as COVID-19 In other embodiments, the infectious disease is influenza, hepatitis B, hepatitis C, Dengue fever, human papillomavirus (HPV), norovirus, mumps, measles, Meningococcal disease, pneumococcal disease, polio, rotavirus, respiratory syncytial virus (RSV) V), rubella, shingles / herpes virus, tetanus, or whooping cough.

[0072] In some embodiments, the compounds and compositions described herein are directed to tissue macrophages. Efficient uptake and transfection of target cells, including phage and dendritic cells As a result, the antigens specific to the infectious virus or bacteria can be coated. and the efficient delivery of nucleic acids to induce the desired immune response that protects against the corresponding infection. In some embodiments, the nucleic acid is a SARS-CoV-2 antigen. - Coronavirus epitopes such as CoV, MERS-CoV or SARS-CoV-2 The polypeptide may also be a synthetic nucleic acid (e.g., an engineered codon-optimized mRNA) encoding the polypeptide. In some embodiments, the nucleic acid is a nucleic acid encoding SARS-CoV, MERS-CoV, or SARS-CoV. S-protein (spike protein) of coronaviruses such as S-CoV-2 or its derivatives Even synthetic nucleic acids (e.g., engineered codon-optimized mRNAs) encoding fragments of good.

[0073] definition For convenience, certain terms are used in the specification, examples, and appended claims. Unless otherwise specified, all technical terms and All scientific and technical terms have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. do.

[0074] As used herein, the following terms and phrases are intended to have the following meanings: will be done.

[0075] The articles "a" and "an" refer to one or more of the grammatical articles of the It is used to refer to an object (i.e., at least one). For example, ) element" means one element or more than one element.

[0076] As used herein, the terms "comprising" or "including" "comprises" refers to the inclusion of elements that are present in a given embodiment but are not specified. It is used in reference to compositions, methods, and components thereof, ranging from 1 to 1000 mg / kg.

[0077] As used herein, the term "consisting essentially of" refers to any element necessary for a given embodiment. This term refers to a compound that substantially relates to the basic and novel or functional properties of that embodiment of the present disclosure. This allows for the presence of additional elements that do not affect the overall performance.

[0078] The term "consisting of" refers to any element in the specification excluding all elements not recited in the description of the embodiment. The present invention refers to the compositions, methods, and components thereof described in

[0079] As used herein, the term "comprising" means "consisting of" and "consisting essentially of."

[0080] When referring to "as mentioned above" or "above" in the description, This refers to any of the disclosures made in the specification in any of the above.

[0081] The statements "as described herein," "described herein," and "provided herein" are examples of "as described herein" or "as defined herein" In the case of a reference to a specific disclosure, the reference may refer to any of the disclosures made in the specification on either the preceding or following pages. .

[0082] As used herein, the term "about" means within 20%, within 10%, and This means an acceptable variation of within 5%. In certain embodiments, "about" means + / - This can mean a variation of 1%, 2%, 3%, 4%, 5%, 10% or 20% .

[0083] As used herein in reference to a compound or composition, the term "effective amount" means a bactericidal or or an active compound (also referred to herein as an active agent or active drug) sufficient to produce a bacteriostatic effect. In one embodiment, an effective amount refers to an amount of a compound that alleviates the symptoms of the bacterial infection being treated. By "therapeutically effective amount" is meant that amount of active compound sufficient to provide relief.

[0084] As used herein, the term "subject (or alternatively "patient")" refers to a patient receiving prophylactic or refers to an animal, preferably a mammal, most preferably a human, receiving either a therapeutic or therapeutic treatment. vinegar.

[0085] As used herein, the terms "administration" or " "Administering" means administering a compound or pharmaceutical composition to a subject in need thereof. means of introducing the agent into a subject, including but not limited to oral, intravenous, intramuscular, These include intramuscular, intraperitoneal, subcutaneous, transdermal, inhalation, oral, ophthalmic, sublingual, vaginal, and rectal. The administration of the compound or composition is preferably parenteral. For example, the compound or composition The substance can be administered intravenously, preferably intravenously, but is currently not suitable for use with Mycobacterium avium (myco Clinical evaluation of liposomal amikacin in the treatment of bacterium avium It can also be administered intraperitoneally or via inhalation, as used in ley et al.,Amikacin Liposome Inhalation Suspension:A Review in Mycobacterium avi um Complex Lung Disease.Drugs.2019 Apr;7 9(5):555-562).

[0086] As used herein, the terms "treat" and "trea" are used interchangeably. "Treatment" and "treatment" refer to treatments such as those described herein. Refers to therapeutic or preventive measures.

[0087] The term "pharmaceutically acceptable salts" refers to relatively non-toxic, inorganic or organic acid salts of compounds of the present disclosure. It refers to an addition salt, which has the desired pharmacological activity.

[0088] The term "alkyl" refers to a carbon chain that may be straight or branched, unless otherwise specified. It means a saturated carbon chain having 1 to 20 carbon atoms, which may be a combination of Examples of alkyl groups are methyl, ethyl, propyl, isopropyl, butyl, sec- and butyl-. and tert-butyl, pentyl, hexyl, heptyl, and octyl. Unless otherwise specified in the specification, an alkyl group is optionally substituted. do.

[0089] The term "phosphatidylserine" refers to any of its acyl chain compositions in certain embodiments. Unless otherwise specified in the examples, the L-isomer of the serine in the head group is referred to.

[0090] The term "lipid complex" refers to a complex lipid that inhibits aggregation of lipid particles. Conjugates include, but are not limited to, polysarcosine (e.g., for all purposes See WO2021191265A, which is incorporated herein by reference. ), polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates (di PEG coupled with alkyloxypropyl, diacylglycerol and Ringed PEG, cholesterol-coupled PEG, phosphatidyl PEG coupled to ethanolamine, PEG conjugated to ceramide, etc.) (See, for example, U.S. Pat. No. 6,119,149, which is incorporated herein by reference for all purposes.) US Patent No. 5,885,613), cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or via a linker moiety. Any linker moiety suitable for coupling PEG to a lipid, such as For example, non-ester-containing linker moieties and ester-containing linker moieties may be used. In preferred embodiments, non-ester containing linker moieties are used.

[0091] Abbreviations for ionizable cationic lipids are truncated from those used in the Examples and Tables. For example, AKG-UO-1 or AKG-KC2-01 can be used in combination with UO1 or KC It can also be called 2-01.

[0092] The abbreviation UT used in various studies refers to untreated samples.

[0093] The term "lipid nanoparticle" or "LNP" refers to particles having a diameter of approximately 5 to 500 nm. In some embodiments, the lipid nanoparticles comprise one or more active agents. In some embodiments, the lipid nanoparticles comprise nucleic acids. The cations are cationic lipids, polymers, or multivalent small molecules that interact with the biological environment. The nanoparticles are condensed inside the lipid-coated nanoparticles due to the repulsion between the phosphate groups. Nucleic acids are necessarily rigid polymers, and elongated shapes are preferred. To cope, DNA, with the help of ions and other molecules, can, under the right solution conditions, DNA condensation is usually achieved by packing one of the extended DNA strands together. or the breakdown into compact systematic particles containing only a few molecules. By binding to the phosphate group, cationic lipids neutralize the phosphate charge and increase the density of the lipids. DNA can be condensed by filling.

[0094] In some embodiments, the active agent is encapsulated in the LNP. In some embodiments, the active agent may be an anionic compound, e.g., DNA, RNA, Natural and synthetic oligonucleotides (antisense oligonucleotides, interfering RNA and and small interfering RNA), nucleoproteins, peptides, nucleic acids, ribozymes, and DNA-containing Nucleoproteins, e.g., intact or partially deproteinized virus particles (virions) anionic compounds other than DNA (e.g., acidic polysaccharides and In some embodiments, the polypeptide may be, but is not limited to, a polypeptide of the present invention. In some cases, the active agent may be mixed with an adjuvant.

[0095] In LNP vaccine products, the active agent is generally contained within the LNP. In this embodiment, the active agent comprises a nucleic acid. Typically, the water-soluble nucleic acid is present in the interior of the particle. The surface of the particles is condensed with cationic lipids or polycationic polymers, and the surface of the particles is coated with neutral lipids. or enriched with PEG-lipid derivatives. Additional ionizable cationic lipids may also be present on the surface. , responds to environmental acidification by carrying a positive charge and promotes endosomal escape.

[0096] Ionized lipids may have different properties or functions than LNPs. Therefore, lipid molecules can become positively charged in acidic conditions. The molecule can electrostatically bind to the phosphate groups of nucleic acids, leading to the formation of LNPs and the decomposition of nucleic acids. In some embodiments, the pKa is at a physiological pH value, such as blood. The surface charge of the LNP may be low enough to be substantially neutral in any biological fluid. The P surface charge contributes to toxicity, rapid removal from the circulation by sessile and free macrophages, and hemolysis. associated with toxicity (including immune activation) (Filion et al. Biochim B iophys Acta.1997 Oct 23;1329(2):345-56).

[0097] In some embodiments, the pKa is such that the ionized cationic lipid is The pH value may be high enough to allow the cation to assume a positive charge form. The anionic lipids, in combination with endogenous endosomal anionic lipids, form membrane-soluble structures such as the hexahedral HII phase. Dissociation can promote non-bilayer structures, resulting in more efficient intracellular transport In some embodiments, the pKa ranges from 6.2 to 6.5. a may be about 6.2, about 6.3, about 6.4, or about 6.5. It also contributes to the lipid's ability to form molecular layers (Jayaraman et al., Ang ew Chem Int Ed Engl.2012 Aug 20;51(34):8 529-33).

[0098] Among other properties, such as liposome clearance and circulation half-life, the release of nucleic acids from LNP formulations The extract may contain polyethylene glycol and / or sterols (e.g., cholesterol) or the presence of other potential excipients in the LNP, as well as the overall chemical structure (as part of the formulation) The lipids can be modified by the pKa of any ionizable cationic lipids included in the do.

[0099] The term "bioreductive" refers to accelerated degradation due to cleavage of disulfide bonds in a reducing environment. Unlike other nucleic acid therapeutics such as siRNA, the formation of mRNA-based therapeutics Success will depend on the availability of safe and efficient delivery vehicles that encapsulate the mRNA. mRNA is fragile and requires a protective coating to remain active until it reaches its target site. mRNA-containing LNPs are promising vaccines for Covid-19 immunity (Jackson et al., Preliminary Report tN Engl J Med.2020 Nov 12;383(20):1920- The efficacy and tolerability of LNP are attributed to the amino lipids, and the drug can be administered for several weeks or months. Unlike many biomaterial applications that may require a biosensor, functional LNP-mediated delivery of mRNA is This occurs within hours, eliminating the need for permanent lipids. This is particularly important in the context of LNPs, which enter cells via endocytosis and Ionized cationic lipids (ICLs) have been demonstrated to accumulate in the drysosomal compartment. In late endosomes / lysosomes, lipase-mediated enzymatic hydrolysis or lysosomal reduction Susceptible to hydrolysis induced by the original environment, completely biodegradable but not endo After cytosis, mRNA can be efficiently delivered into the cytosol. The extracellular space is relatively acidic. The intracellular space is a reducing environment, while the intracellular space is a reducing environment. It is maintained intact, but is rapidly reduced once internalized (Huang et al. ,Mol Ther.2005 Mar;11(3):409-17,2005). Some embodiments are stable in LNP formulations during circulation but undergo cleavage in the reducing environment of the lysosome. To provide bioreducible disulfide-linked ICL molecules (compounds 29-36 (see Table 2)) Such compounds and compositions can promote the rapid biological breakdown of lipids, and ICL lipids. The potentially toxic accumulation of proteins can be prevented (Laser with DLin-MC3-DMA). When observed in a lab (Sabins et al., Mol Ther. 2018 Ju n 6;26(6):1509-1519).

[0100] As used herein, the terms "encapsulation" and "encapsulated" refer to the Incorporation of DNA, siRNA or other nucleic acid drugs into or on lipid nanoparticles As used herein, the term "encapsulated" refers to an association with a particle. siRNA refers to complete or partial encapsulation of a gene. For example, siRNA can selectively knock down or down regulate When a nanoparticle composition comprising siRNA is administered to a subject in need thereof, it is possible to treat certain diseases, disorders, Alternatively, the siRNA may be selected to silence a gene associated with a disease state. It may contain a sequence complementary to the mRNA sequence encoding the gene or protein of interest. good.

[0101] The term "mol%" in relation to cholesterol refers to the amount of cholesterol expressed in percentage points. The molar amount of cholesterol relative to the total molar amount of sterol and non-PEGylated phospholipid is For example, "55 mol %" in liposomes containing cholesterol and HSPCs "Cholesterol" refers to a composition of 55 molar parts cholesterol per 45 molar parts HSPC Refers to...

[0102] The related term "mol %" of PEG-lipid refers to the amount of PEG expressed in percentage points. -refers to the molar ratio of lipid and non-PEGylated phospholipid. For example, HSPC and PEG- "5 mol% PEG-DSPE" in DSPE-containing LNPs is 100 mol parts of HS Refers to a composition having 5 molar parts PEG-DSPE per PC.

[0103] As used herein, the term "pharmaceutically acceptable carrier, diluent, or excipient" means approved by the U.S. Food and Drug Administration as acceptable for use in humans or veterinary medicines Any adjuvants, carriers, excipients, glidants, sweeteners, diluents, preservatives, dyes / Coloring agents, flavor enhancers, surfactants, wetting agents, dispersing agents, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers, but are not limited to these.

[0104] Various aspects and embodiments are described in further detail in the following subsections.

[0105] compound As provided herein, compounds, compositions for the treatment or prevention of infectious diseases, including tuberculosis, According to an embodiment of the present disclosure, the cationic lipid is represented by Formula I, II, III, or IV, or a pharmaceutically acceptable salt thereof. According to the formula, the ionizable cationic lipid is represented by Formula IV, Formula IV-A, Formula A, Formula A', Formula A'', one or more chemical substructures selected from the group consisting of Formula A''', and / or Formula B In some aspects of the present disclosure, the ionizable cationic lipid includes a compound having the formula I, Formula IA, Formula I-A', Formula I-A'', Formula II, Formula II-A, Formula II-A', Formula II -B, a compound having formula II-B', formula III, or formula III-A, or a drug thereof In some embodiments of the present disclosure, the LNPs may comprise a physiologically acceptable salt. The compound may include a compound having formula V or formula VA, or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNP has Formula VI or Formula VI-A. Some of the compounds of the present disclosure may be compounds or pharmaceutically acceptable salts thereof. In embodiments, the LNP comprises a compound having Formula VII or a pharmaceutically acceptable salt thereof. In some embodiments of the present disclosure, the LNP can be a compound having formula VIII. According to an embodiment of the present disclosure, the present invention can include a cation or a pharmaceutically acceptable salt thereof. The carboxylic lipids are (a) those of formula I, formula IA, formula I-A', formula I-A'', formula II, formula II-A, a compound of formula II-A', II-B, II-B', III, or III-A; or a sterol lipid of formula VI-A, or a sterol lipid of formula V III, and (b) a sterol of formula VI, optionally comprising (c) a branched lipid of formula In some embodiments, the compound further comprises an alkylene glycol lipid of formula VII. In some embodiments, the LNP further comprises a phospholipid of formula V or formula VA. wherein the LNP further comprises an anionic phospholipid targeting moiety of Table 3.

[0106] Also provided herein are compounds for the treatment or prevention of infectious diseases, including tuberculosis, Compositions and methods are also provided. According to an embodiment of the present disclosure, the cationic lipid has the formula A: In some embodiments, the cation The fatty lipid contains two fatty acyl groups such as those in formula II, II, III or IV.

[0107] The present invention provides compounds of formula I, II, III and IV useful in the preparation of vaccines. Also disclosed herein are compounds of formula I, or pharmaceutically acceptable salts thereof. , a cationic lipid of Formula II, Formula III, Formula IV, or a pharmaceutically acceptable salt thereof. Also disclosed are compositions comprising: In some embodiments, the agent is used for the prevention of mycobacterium infection. The vaccines are for tuberculosis, nontuberculous mycobacteria (NTM), nontuberculous lung disease, leprosy, and malaria. Mycobacterium avium intracellulare (Mycobacterium avium ium-intracellulare), Mycobacterium kansasii (myco bacterium kansasii), Mycobacterium marinum (mycob Mycobacterium marinum, Mycobacterium ulcerans (mycob Acterium ulcerans, Mycobacterium chelonae (mycoba Mycobacterium chelonae), Mycobacterium fortuitum (myc obacterium fortuitum), Mycobacterium abscessus (m Mycobacterium abscessus), and other infectious diseases, e.g., Viruses (COVID-19, SARS CoV2, SARS-CoV, MERS-C oV), diphtheria, Ebola, influenza, hepatitis, Hib disease, HIV / A IDS, HPV (human papillomavirus), malaria, measles, meningococcal disease, Colds, norovirus, plague, pneumococcal disease, polio, respiratory syncytial virus ( RSV), rotavirus, rubella (three-day measles), shingles (herpes), tetanus (tetanus) It can be used to prevent acute cough, whooping cough (pertussis), and Zika.

[0108] As provided herein, compounds, compositions for the treatment or prevention of infectious diseases, including tuberculosis, According to an embodiment of the present disclosure, the cationic lipid is represented by Formula I, II, III, or IV or a pharmaceutically acceptable salt thereof. In embodiments, the cationic lipid comprises two fatty acyl groups of formula I, II, III, or IV. Contains a group.

[0109] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A: do.

[0110] [ka] [Wherein, a is 1, 2, 3 or 4, b is 2, 3 or 4, and c is 3, 4 , 5, 6 or 7] In some embodiments, the ionizable lipid is a polyunsaturated polyene having two carbon atoms, wherein b is 4. In some embodiments, the ionizable lipid comprises two aryl groups of formula A. and a polyunsaturated polyene hydrocarbon chain, wherein the sum of a, b, and c is 10; 11, 12, or 13. In some embodiments, the ionizable lipid is one of two of formula A and a polyunsaturated polyene hydrocarbon chain, wherein a is 4 and b is 4; c is 4 or 5. In some embodiments, the ionizable lipid is a mixture of two polyunsaturated fatty acids of formula A. It may comprise a saturated polyene hydrocarbon chain, where a is 1, 2 or 3 and b is 4. and c is 3, 4, 5, 6, or 7. In some embodiments, the ionizable lipid is It may comprise two polyunsaturated polyene hydrocarbon chains of formula A, where a is 5 or 6. wherein b is 2, 3, or 4, and c is 3, 4, 5, 6, or 7. In the present invention, the ionizable lipid may comprise two polyunsaturated polyene hydrocarbon chains of formula A. wherein the sum of a, b, and c is 10, 11, 12, or 13. In the present invention, the ionizable lipid may comprise two polyunsaturated polyene hydrocarbon chains of formula A. wherein the sum of a, b, and c is 12. In some embodiments, the ionizable lipid can comprise two polyunsaturated polyene hydrocarbon chains of formula A, where b is 2 and The sum of a, b and c is 12. In some embodiments, the ionizable lipid has the formula A wherein b is 3 and a, b and the sum of c is 12. In some embodiments, the ionizable lipid is a compound having two groups of formula A a, b, and c may comprise a polyunsaturated polyene hydrocarbon chain, The sum of is 12. In some embodiments, the ionizable lipid is a mixture of two polyunsaturated The polyene may contain a hydrocarbon chain.

[0111] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A: do.

[0112] [ka] wherein a is 1, 2 or 3, b is 2, 3 or 4, and c is 3, 4, 5, 6 or or 7] In some embodiments, the ionizable lipid is a polyunsaturated polyene having two carbon atoms, wherein b is 4. In some embodiments, the ionizable lipids may comprise a, b, and The sum of c is 10, 11, 12 or 13, It may contain hydrogen chains.

[0113] One aspect of the present disclosure is a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A″ provide.

[0114] [ka] wherein a is 4, b is 4, and c is 4 or 5. In some embodiments, the ionizable lipid has formula A', where a, b, and c are each 12. ' may contain two polyunsaturated polyene hydrocarbon chains.

[0115] One aspect of the present disclosure is a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula A''' to provide.

[0116] [ka]

[0117] wherein a is 5 or 6, b is 2, 3 or 4, and c is 3, 4, 5, 6 or 7] In some embodiments, the ionizable lipids are those in which the sum of a, b, and c is 10, 11, 12, or or 13, and may include two polyunsaturated polyene hydrocarbon chains of formula A''' In some embodiments, the ionizable lipid has the formula A, wherein the sum of a, b, and c is 12. In some embodiments, the polyunsaturated polyene hydrocarbon chains may include two polyunsaturated polyene hydrocarbon chains. and the ionizable lipid is of formula A''', where b is 2 and the sum of a, b, and c is 12. In some embodiments, the polyunsaturated polyene hydrocarbon chain may comprise two polyunsaturated polyene hydrocarbon chains: The ionizable lipid is two of formula A''', where b is 3 and the sum of a, b and c is 12. In some embodiments, the ionic surfactant may comprise a polyunsaturated polyene hydrocarbon chain of the formula: The modified lipid is a mixture of two polysaccharides of formula A''', where b is 4 and the sum of a, b, and c is 12. In some embodiments, the ionizable lipid may comprise an unsaturated polyene hydrocarbon chain. can comprise two polyunsaturated polyene hydrocarbon chains of formula A'''.

[0118] One aspect of the present disclosure provides a lipid comprising one or more polyunsaturated polyene hydrocarbon chains of formula B: do.

[0119] [ka] wherein a is 5, 6, or 7, and c is 3, 4, or 5. In some embodiments, the ionizable lipid is a polyunsaturated polyene having two carbon atoms, wherein b is 4. In some embodiments, the ionizable lipid may comprise a and c. and two polyunsaturated polyene hydrocarbon chains of formula B, the total of which is 9, 10, or 11. This can be done.

[0120] In some embodiments, the ionizable lipid has the chemical structure of formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', or is a polyene hydrocarbon chain of formula A''' or formula B, and R 10 and R 12 Each of the independently (C1-C4) alkyl optionally substituted with hydroxyl .

[0121] In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon chain of formula A In some embodiments, R in formula (IV-A) 22 is a polyene hydrocarbon of formula A' In some embodiments, R in formula (IV-A) is a substituted or unsubstituted alkyl chain. 22 is a polyester of formula A'' In some embodiments, R in formula (IV-A) is a cyclic hydrocarbon chain. 22 is the formula A'' In some embodiments, R in formula (IV-A) is a polyene hydrocarbon chain of the formula: 22 teeth , a polyene hydrocarbon chain of formula B.

[0122] In some embodiments, in formula (IV-A), R 10 and R 12 are independent of each other. methyl, ethyl, propyl, -(CH2)(CH2)OH, and -(CH2)2( In some embodiments, in formula (IV-A), R 10 Oh BiR 12 are each independently methyl. In some embodiments, ), R 10 and R 12 are each independently ethyl. In formula (IV-A), R 10and R 12 At least one of the groups is optionally a hydrochloride. In some embodiments, the compound of formula (IV-A) is n-propyl substituted with xyl. Medium, R 10 is methyl and R 12 is methyl, ethyl, -(CH2)(CH2)OH, and —(CH 2 ) 2 (CH 2 ) OH. In some embodiments, the compound of formula (I VA) in R 10 is methyl and R 12 is -(CH2)(CH2)OH, and - (CH2)2(CH2)OH. In some embodiments, the compound represented by formula (IV-A) In a compound containing the chemical structure 10 is methyl and R 12 is -(CH2)(C In some embodiments, the aryl group is selected from —(CH)(CH)OH, —(CH)(CH)OH, and —(CH)(CH)OH. In formula (IV-A), R 10 and R 12 independently and optionally one or more In some embodiments, the hydroxyl group is selected from methyl or ethyl, each substituted with hydroxyl. In the formula (IV-A), R 10 and R 12 is one or both of the following in formula (IV-A): -(CH2)(CH2)OH, or -(CH2)2(CH2)OH. In the embodiment of formula (IV-A), R 10 is methyl and R 12 is a hydroxyl In some embodiments, the methyl or ethyl group in formula (IV-A) is substituted. R 10 One or both of R 12 represents -(CH2) in formula (IV-A). In some embodiments, R in formula (IV-A) is (CH2)OH. 10 On the other hand Both are methyl, and R 12 is -(CH2)2(CH2)OH in formula (IV-A) be.

[0123] In some embodiments, the ionizable lipid is covalently attached to the Y moiety of formula (IV-A). and one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' '' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of these is independent. and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid is a 1-hydroxybenzoate covalently attached to the Y moiety of formula (IV-A). one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', or is a polyene hydrocarbon chain of formula A''', and R 10 and R 12 Each of the It is (C1-C4) alkyl optionally substituted with hydroxyl. In this embodiment, the ionizable lipid comprises one or more covalently attached Y moieties of formula (IV-A). wherein Y is a polyunsaturated polyene hydrocarbon chain; [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula B , R 10 and R 12 each of which is independently optionally substituted with hydroxyl It is a (C1-C4) alkyl.

[0124] In some embodiments, the ionizable lipid is covalently attached to the Y moiety of formula (IV-A). and one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' '' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of these is independent. and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid is a 1-hydroxybenzoate covalently attached to the Y moiety of formula (IV-A). one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', or is a polyene hydrocarbon chain of formula A''', and R 10 and R 12 Each of the It is (C1-C4) alkyl optionally substituted with hydroxyl. In this embodiment, the ionizable lipid comprises one or more covalently attached Y moieties of formula (IV-A). wherein Y is a polyunsaturated polyene hydrocarbon chain; [ka] where n is an integer of 2, 3, or 4, and R22 is a polyene hydrocarbon chain of formula B , R 10 and R 12 each of which is independently optionally substituted with hydroxyl It is a (C1-C4) alkyl.

[0125] In some embodiments, the ionizable lipid is covalently attached to the Y moiety of formula (IV-A). and one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' '' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of these is independent. and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, the ionizable lipid is one or more polyunsaturated poly(amino)-1-hydroxybenzoates of formula (IV-A): and a phenyl hydrocarbon chain or a pharmaceutically acceptable salt thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', or is a polyene hydrocarbon chain of formula A''', and R 10 and R 12 Each of the It is a (C1-C4) alkyl optionally substituted with hydroxyl.

[0126] In some embodiments, the ionizable lipid is covalently attached to the Y moiety of formula (IV-A). and one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' '' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of these is independent. and (C1-C4) alkyl optionally substituted with hydroxyl.

[0127] In some embodiments, the ionizable lipid is covalently attached to the Y moiety of formula (IV-A). and one or more polyunsaturated polyene hydrocarbon chains, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' '' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of these is independent. and (C1-C4) alkyl optionally substituted with hydroxyl.

[0128] In some embodiments, the ionizable lipid has formula (IV): [ka] one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of and acceptable salts thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is formula A, formula A', formula A'', formula A' or a polyene hydrocarbon chain of formula B. In some embodiments, the ionized lipid The compound has the formula (IV): [ka] one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of and acceptable salts thereof, wherein Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is a polyene hydrocarbon chain of formula A In some embodiments, the ionizable lipid has formula (IV): [ka] one or more polyunsaturated polyene hydrocarbon chains covalently attached to the Y moiety of and acceptable salts thereof, wherein Y is [ka] where n is an integer equal to 2, and R 22 is a polyene hydrocarbon chain of formula A'.

[0129] One aspect of the disclosure provides a compound of Formula I, or a pharmaceutically acceptable salt thereof:

[0130] [ka] wherein Y is independently a methyl or ethyl group; where the two fatty acyl groups have 16-18 carbons and two non-conjugated olefins containing]

[0131] Another aspect of the present disclosure is a composition comprising an ionizable lipid, the ionizable lipid having formula I or Lipid-based nanoparticles including pharmaceutically acceptable salts thereof are provided.

[0132] [ka] wherein Y is independently a methyl or ethyl group; where the two fatty acyl groups have a total of 16-18 carbons and 2-4 methyl groups. containing two olefins separated by an olefin group]

[0133] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In the formula, the two fatty acyl groups have 18 carbons.

[0134] In some embodiments, an ionizable lipid of formula IA or a pharmaceutically acceptable salt thereof Provide salt.

[0135] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, and c is , 3, 4, 5, 6 or 7, the sum of a, b and c is 10 or 12, and L is [ka] and R 10 and R 12 each of which is independently optionally substituted with a hydroxyl substituted (C1-C4) alkyl, v is 0 or 1, and q is 1, 2, 3 or or 4, and q2 is 1 or 2] In some embodiments, in the ionizable lipid of formula IA, v is 0 and q is 1, 2 or 3, and the sum of a, b, and c is 12. In some embodiments, In the ionized lipid of A, v is 1, q is 3 or 4, and the sum of a, b, and c The total is 12. In some embodiments, in the ionizable lipid of formula I-A′, R10 and R 12 are independently selected from methyl, ethyl, and propyl, each of which is , optionally substituted with a single hydroxyl. In some embodiments, a The sum of b and c is 12, and R 10 and R 12 are independently methyl, ethyl, - is selected from —(CH2)(CH2)OH, and —(CH2)2(CH2)OH.

[0136] In some embodiments, an ionizable lipid of formula I-A', or a pharmaceutically acceptable salt thereof, The salt is provided.

[0137] [ka] wherein a is 1, 2 or 3, c is 3, 4, 5, 6 or 7, and L is [ka] wherein Y' is methyl or ethyl, v is 0 or 1, and q is 2, 3, or 4. and q2 is 1 or 2] In some embodiments, in the ionizable lipid of formula I-A', v is 0 and q is 1, 2 or is 3 and the sum of a and c is 6 or 8. In some embodiments, In the ionized lipid of ', v is 1, q is 3 or 4, and the sum of a and c is 6 or is 8.

[0138] In some embodiments, an ionizable lipid of formula I-A″, or a pharmaceutically acceptable salt thereof The salt is provided.

[0139] [ka] wherein a is 4, 5 or 6; b is 2, 3 or 4; and c is 3, 4, 5, 6 or or 7, and L is [ka] and R 10 and R 12 each of which is independently optionally substituted with a hydroxyl substituted (C1-C4) alkyl, v is 0 or 1, and q is 1, 2, 3 or or 4, and q2 is 1 or 2] In some embodiments, in the ionizable lipid of formula I-A'', v is 0 and q is 1, 2 or or 3, and the sum of a, b, and c is 12. In some embodiments, In the ionized lipid of '', v is 1, q is 3 or 4, and the sum of a, b and c is 12. In some embodiments, R 10 and R 12 is the ionization of formula I-A″ In the lipid, independently selected from methyl, ethyl, and propyl, each optionally In some embodiments, a, b, and c are substituted with a single hydroxyl. The sum of is 12, and R 10 and R 12 are independently methyl, ethyl, -(CH2) is selected from —(CH2)OH, and —(CH2)2(CH2)OH.

[0140] Another aspect of the present disclosure provides a compound of Formula II, or a pharmaceutically acceptable salt thereof:

[0141] [ka] wherein R is a substituent containing one dialkylamino group of the structure shown above, and two Fatty acyl groups have 16 to 18 carbon atoms and are separated by at least two methylene groups. containing two olefins

[0142] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In the formula, the two fatty acyl groups have 18 carbons.

[0143] Another aspect of the present disclosure provides a compound of formula II-A, or a pharmaceutically acceptable salt thereof: .

[0144] [ka] wherein a is 1, 2, 3, 4, 5 or 6, b is 2, 3 or 4, c is 4, 5, 6, 7 or 8, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 Haso are methyl or ethyl, respectively] In some embodiments, in the ionizable lipid of formula IA, the sum of a, b, and c is 11 or is 13. In some embodiments, the ionizable lipid of formula IA is one of the following: Characterized by: a is 1, 2 or 3; q is 2; q' is 1. Ru, and R 10 or R 12 At least one of is ethyl. In some embodiments, in the ionizable lipid of formula II-A, b is 4. In the ionized lipid, a is 4, b is 4, and c is 4. In the ionizable lipid of formula II-A, a is 1, b is 4, and c is 8. In some embodiments, in the ionizable lipid of formula II-A, a is 2, b is 4, and c is 5. is.

[0145] Another aspect of the present disclosure provides a compound of formula II-A' or a pharmaceutically acceptable salt thereof: do.

[0146] [ka] wherein a is 1, 2 or 3, b is 2, 3 or 4, and c is 4, 5, 6, 7 or or 8, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 Haso are methyl or ethyl, respectively] In some embodiments, in the ionizable lipid of formula I-A', the sum of a, b, and c is 11 or less. or 13. In some embodiments, the ionizable lipid of formula IA is one of the following: characterized by one or more of: q is 2, q' is 1, and R 10 or R 12 is ethyl. In some embodiments, the ion of formula II-A' In some embodiments, in the ionizable lipid of formula II-A', a is 4, b is 4, and c is 4. In some embodiments, the i of formula II-A' In the ionized lipid, a is 1, b is 4, and c is 8. In some embodiments, In the ionizable lipid of formula II-A′, a is 2, b is 4, and c is 5.

[0147] Another aspect of the present disclosure provides a compound of formula II-B, or a pharmaceutically acceptable salt thereof: .

[0148] [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 Haso are methyl or ethyl, respectively] In some embodiments, in the ionizable lipid of formula IB, the sum of a and c is 9 or 11 In some embodiments, the ionizable lipid of formula IB is one or more of the following: characterized by: q is 2, q' is 1, and R 10 or R 12 few At least one is ethyl. In some embodiments, the ionizable lipid of formula IB is characterized by one or more of the following: q is 1, q' is 2, and R 10 and R 12 In some embodiments, each of the groups of formula II-B is methyl. In the ionized lipid, c is 4. In some embodiments, in the ionized lipid of formula II-B, a is 5 or 7 and c is 4. In some embodiments, the ionization In the lipid, a is 5 and c is 4. In some embodiments, the ionization In lipids, a is 7 and c is 4.

[0149] Another aspect of the present disclosure provides a compound of formula II-B' or a pharmaceutically acceptable salt thereof: do.

[0150] [ka] wherein a is 5 or 7, c is 3 or 4, and R2 is [ka] wherein q and q' are each independently 1 or 2; R 10 and R 12 Haso methyl] In some embodiments, in the ionizable lipid of formula I-B', the sum of a and c is 9 or 1. In some embodiments, in the ionizable lipid of formula I-B′, c is 4. In some embodiments, in the ionizable lipid of formula II-B′, a is 5 or 7 and c is 4. In some embodiments, in the ionizable lipid of formula II-B, a is 5 and c is 4. In some embodiments, in the ionizable lipid of formula II-B′, a is 7 and c is 4. In some embodiments, in the ionizable lipid of formula II-B, a is 5 and c is 3. In some embodiments, in the ionizable lipid of formula II-B', a is 7 and c is It is 3.

[0151] Another aspect of the present disclosure provides a compound of formula III, or a pharmaceutically acceptable salt thereof:

[0152] [ka] wherein Y is a methyl or ethyl group; The two fatty acyl groups have 16 to 18 carbons and contain a single olefin. disulfide fatty acyl group]

[0153] In some embodiments, the two fatty acyl groups have 16 carbons. In some embodiments, the two fatty acyl groups have 17 carbons. In the formula, the two fatty acyl groups have 18 carbons.

[0154] Another aspect of the present disclosure provides a compound of formula III-A or a pharmaceutically acceptable salt thereof: do.

[0155] [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, and q is 2 or 3; , R 10 and R 12 is methyl or ethyl] In some embodiments, the ionizable lipid is a compound of formula III-A, wherein a is 5 or 7. In some embodiments, the ionizable lipid may comprise a sum of a and c 8, 9 or 10, do.

[0156] Another aspect of the present disclosure provides a compound of formula III-A' or a pharmaceutically acceptable salt thereof: do.

[0157] [ka] wherein a is 5 or 7, c is 3, 4 or 5, q is 2 or 3, and R 10 and R 12 is methyl or ethyl] In some embodiments, the ionizable lipid is a polyunsaturated polyene having two carbon atoms, wherein c is 3. In some embodiments, the ionizable lipid may comprise a and c. containing two polyunsaturated polyene hydrocarbon chains of formula III-A', the total of which is 8 or 10. In some embodiments, the ionizable lipid is a lipid in which q is 2 and a and c two polyunsaturated polyene hydrocarbon chains of formula III-A', wherein the sum of In some embodiments, the ionizable lipid is a lipid having q=2 and R 10 oh Yobi R 12 are each methyl, and the sum of a and c is 8 or 10; In some embodiments, the polyunsaturated polyene hydrocarbon chains A′ may be two. In the case of ionized lipids, q is 2 and R 10 and R 12 are methyl, and c and the polyunsaturated polyene hydrocarbon chain of formula III-A' is 3. .

[0158] In some embodiments, the compounds in Formulae I-III have a pKa of 6-7. In some embodiments, the lipid-based nanoparticle composition comprises a lipid and a nucleic acid, The nanoparticles may comprise a compound of Formula I, II, III, a combination thereof, or a pharmaceutically acceptable salt thereof. Contains acceptable salts.

[0159] In some embodiments, the LNP has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] and each R 22 are independently alkyl, alkenyl, alkynyl, or heteroalkynyl. Kill, and optionally RB is replaced by each R B is independently n is 1; is an integer between 10 and 10 (inclusive), [ka] indicates the point of attachment.

[0160] In some embodiments, Y is [ka] is.

[0161] In some embodiments, the compound of formula IV has a pKa of 6-7.

[0162] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, and In the middle, Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is the formula A, formula A', formula A'', or formula A''' is a polyene hydrocarbon chain, and R 10 and R 12 Each of these is independently Optionally, the alkyl is (C1-C4) substituted with hydroxyl. In an embodiment, R in formula (IV-A) 10 and R 12 are independently methyl, ethyl, Selected from -(CH2)(CH2)OH and -(CH2)2(CH2)OH.

[0163] In some embodiments, the ionizable lipid has formula (IV-A); [ka] or a pharmaceutically acceptable salt thereof, and In the middle, Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is the formula A, formula A', formula A'', or formula A''' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 and R 12 are independently methyl , ethyl, -(CH2)(CH2)OH and -(CH2)2(CH2)OH can be.

[0164] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, and In the middle, Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is the formula A, formula A', formula A'', or formula A''' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 and R 12 are independently methyl , ethyl, -(CH2)(CH2)OH and -(CH2)2(CH2)OH can be.

[0165] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, and In the middle, Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is the formula A, formula A', formula A'', or formula A''' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 and R 12 are independently methyl , ethyl, -(CH2)(CH2)OH and -(CH2)2(CH2)OH can be.

[0166] In some embodiments, the ionizable lipid has formula (IV-A): [ka] or a pharmaceutically acceptable salt thereof, and In the middle, Y is [ka] where n is an integer of 2, 3, or 4, and R 22 is the formula A, formula A', formula A'', or formula A''' or a polyene hydrocarbon chain of formula B, and R 10 and R 12 Each of and (C1-C4) alkyl optionally substituted with hydroxyl. In some embodiments, R in formula (IV-A) 10 and R 12 are independently methyl , ethyl, -(CH2)(CH2)OH and -(CH2)2(CH2)OH can be.

[0167] In some embodiments, the compound has the structure of a compound listed in Table 1 or Table 2. do.

[0168] Table 1A shows examples of cationic lipids. Table 2 shows examples of bioreducible cationic lipids. .

[0169] JPEG2026016373000098.jpg180170

[0170] JPEG2026016373000099.jpg162170

[0171] JPEG2026016373000100.jpg151170

[0172] JPEG2026016373000101.jpg163170

[0173] JPEG2026016373000102.jpg184170

[0174] JPEG2026016373000103.jpg141170

[0175] JPEG2026016373000104.jpg110170

[0176] In some embodiments, the ionizable lipid encapsulates the nucleic acid. In embodiments, ionizable lipids encapsulate nucleic acids in LNP formulations. In some embodiments, the nucleic acid is an siRNA molecule. In some embodiments, the nucleic acid is a DNA molecule.

[0177] In some embodiments, lipid nanoparticles are targeted to dendritic cells in a highly specific manner. In order to achieve this, compositions are provided that further comprise a ligand, such as an antibody complex, directed against a cell surface receptor. In some embodiments, the composition further comprises a targeting ligand, The ligand is oriented on the exterior of the nanoparticle. In some embodiments, the targeting ligand is an antibody.

[0178] In some embodiments, the lipid-based nanoparticles are in an aqueous medium.

[0179] In some embodiments, the nucleic acid comprises a compound of Formula I, II, III, IV or and encapsulating the compound disclosed herein in a lipid nanoparticle, including a combination of the compounds described above, The nucleic acid is either RNA or DNA. In some embodiments, the nucleic acid has the formula I, IA, II, II-A, II-B, III, III-A, IV, IV-A, IV- The present invention includes compounds B, V, VA, VI-A, VII, VIII or combinations thereof. The nucleic acid may be RNA or DNA, and may be encapsulated in lipid nanoparticles with the compounds disclosed herein. In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is a siRNA. It is NA.

[0180] In some embodiments, the lipid nanoparticles comprise phosphatidylcholine and sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the lipid nanoparticles may comprise phosphatidylcholine, ionized calcium. In some embodiments, the ICL comprises a membrane comprising a thiogenic lipid (ICL), , II, III or IV structure, and cholesterol, and the membrane is a lipid nanoparticle In some embodiments, the ICL separates the interior of the membrane from the aqueous medium. In some embodiments, the ICL has the structure shown in Table 1B. In some embodiments, the phosphatidylcholine comprises distearoyl phosphatidylcholine. The preferred phosphatidylcholine is hydrogenated soy phosphatidylcholine (DSPC) or hydrogenated soy phosphatidylcholine (HSPC). In some embodiments, the molar ratio of ionizable cationic lipid to cholesterol is: In some embodiments, the ratio of ICL to cholesterol is about 65:35 to 40:60. The molar ratio of the hydroxybenzoate to the alcohol is about 60:40 to about 45:55.

[0181] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is It is about 1:5 to about 1:2.

[0182] In some embodiments, the membrane further comprises a polymer-conjugated lipid.

[0183] In some embodiments, the lipid nanoparticles comprise ICL, DSPC, cholesterol and polymer-conjugated lipid in a molar ratio of about 49.5:10.3:39.6:2.5.

[0184] In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimylysine Dimyristylglycerol (PEG-DMG) or PEG (molecular weight 2,000)-dimyristylglycerol The compound is PEG-DMPE.

[0185] In some embodiments, the percentage of ionized lipid oxidative degradation products is: Less than 50% of the DLin-KC2-DMA or DLin-MC3-DMA control formulations .

[0186] In some embodiments, the composition is a liquid pharmaceutical formulation for parenteral administration.

[0187] In some embodiments, the composition is a liquid pharmaceutical for subcutaneous, intramuscular, or intradermal administration. It is a formulation.

[0188] In some embodiments, the composition is in the form of a lyophilized powder, and prior to administration, and reconstituted with an aqueous medium.

[0189] Another aspect of the present disclosure is a method for preventing bacterial or viral infections, comprising administering to a subject in need thereof administering to a subject an effective amount of a composition provided herein to generate an immune response. Some embodiments relate to a method for vaccinating a subject in need thereof, comprising: A method comprising administering a composition comprising a nucleic acid encoding an antigenic protein. to provide.

[0190] In some embodiments, the composition is administered subcutaneously, intramuscularly, or intradermally.

[0191] In some embodiments, the bacterial infection is Mycobacterium tuberculosis. In some embodiments, the bacterial infection is a Bacterial Infection with HIV. , nontuberculosis mycobacterium erium).

[0192] In some embodiments, the viral infection is a coronavirus. In embodiments, the coronavirus is SARS-CoV, MERS-CoV or SA It is RS-CoV-2.

[0193] In some embodiments, the viral infection is HIV / AIDs.

[0194] In some embodiments, the lipid nanoparticles are administered parenterally.

[0195] In some embodiments, the lipid-based nanoparticle composition is administered as part of a single dose. can be.

[0196] The present disclosure relates to nucleic acids, such as DNA, mRNA, siRNA, antisense oligonucleotides, and the like. a CRISPR component, such as a guide RNA (gRNA or sgRNA), and Lipid nanoparticles containing CRISPR-associated endonucleases (Cas proteins) and lipids The particles are characterized. Exemplary lipids include ionizable cationic lipids (ICLs), phospholipids, stearyl lipids, and PEG-based lipids. ol lipids, alkylene glycol lipids (e.g., polyethylene glycol lipids), sulfur Ingolipids, glycerolipids, glycerophospholipids, prenol lipids, glycolipids, fatty acids, and and polyketides. In some embodiments, the LNPs contain a single type of lipid. In some embodiments, the LNP comprises multiple (e.g., two or more) lipids. LNPs are composed of ionizable cationic lipids, phospholipids, sterols, or alkylene glycosyltransferases. The lipids may include one or more polyethylene glycol lipids.

[0197] In one embodiment, the LNP comprises an ionizable cationic lipid. When used interchangeably, "ionized cationic lipid," "ionized lipid," and "ICL" are used interchangeably. ICLs are used under specific conditions (e.g., physiological conditions, e.g., within a specific pH range). ions that can have a charge (e.g., a positive charge, e.g., cationic lipids) under The ionizable moiety may comprise an amine, preferably a substituted amine. The ionizable lipid may be a cationic lipid or an anionic lipid. In addition to the ionizable moiety, the ionizable lipids may be, for example, greater than 6 carbon atoms in length (e.g., greater than about 8 carbon atoms). carbon, 10 carbon, 12 carbon, 14 carbon, 16 carbon, 18 carbon, 2 The alkyl or alkenyl groups may be substituted or unsubstituted (0 or more carbons in length). Additional ionizable lipids that can be included in LNPs are described by Jayaraman et al. (An gew.Chem.Int.Ed.51:8529-8533(2012)),Semp le et al.Nature Biotechnol.28:172-176(20 10)), and U.S. Patent Nos. 8,710,200 and 8,754,062. No. 6,239,999, each of which is incorporated herein by reference.

[0198] In some embodiments, the LNP has formula (IV): [ka] or a pharmaceutically acceptable salt thereof, wherein Y is [ka] and each R 22 are independently alkyl, alkenyl, alkynyl, or heteroalkynyl. Kill, each of which can optionally be B Each R is replaced by B is, independently, alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl; n is an integer between 1 and 10 (inclusive); [ka] indicates the point of attachment.

[0199] In some embodiments, Y is [ka] is.

[0200] In some embodiments, the LNP comprises an ionizable lipid having the structure of formula (IV-A): or a pharmaceutically acceptable salt thereof.

[0201] [ka] [In the formula, R 10 and R 12 each of which is independently optionally substituted with a hydroxyl substituted (C1-C4) alkyl, v is 0 or 1, and q1 is 1 or 2 and Y is [ka] and R 22 teeth [ka] where a is 1, 2, 3, 4, or 5, and c is 4, 5, 6, 7, or 8.

[0202] In some embodiments, v of the compound of formula (IV-B) is equal to 0. In some embodiments, v in the compound of formula (IV-B) is equal to 1. In some embodiments, v is equal to 1 and q is equal to 1 in the compound of formula (IV-A). In this embodiment, v is equal to 1 and q is equal to 2 in the compound of formula (IV-B).

[0203] In some embodiments, R of the compound of formula (IV-B) 22 Sum of a and c is 6, 7, 8 or 9. In some embodiments, the compound of formula (IV-B) R 22 wherein the sum of a and c is 6. In some embodiments, the compound of formula (IV-B) R of the compound 22 wherein the sum of a and c is 7. In some embodiments, R of the compound IV-B) 22 In the middle, the sum of a and c is 9.

[0204] In some embodiments, R of the compound of formula (IV-B) 22 In the middle, v is equal to 0, The sum of a and c is 6, 7, 8, or 9. In some embodiments, the compound of formula (IV) -B) Compound R 22 In this case, v is equal to 0 and the sum of a and c is 6. In an embodiment, R of the compound of formula (IV-B) 22 In the middle, v is equal to 0, and a and c The sum is 7. In some embodiments, R of the compound of formula (IV-B) 22 medium, v is equal to 0, and the sum of a and c is 9.

[0205] In some embodiments, in compounds of formula (IV-B), R 10 and R 12 teeth, Independently, methyl, ethyl, -(CH2)(CH2)OH, and -(CH2)2(CH 2) OH. In some embodiments, R in the compound of formula (IV-B) is selected from: 2 2 Medium, R 10 and R 12 are methyl, and the sum of a and c is 6, 7, 8 or or 9. In some embodiments, R of the compound of formula (IV-B) 22 Medium, R1 0 and R 12 are methyl, v is 0, and the sum of a and c is 6, 7, It is either 8 or 9.

[0206] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0; R 22 teeth [ka] and the sum of a and c is 8. In some embodiments, In the compound, v is equal to 0 and R 22 teeth [ka] wherein a is 1 and c is 7. In some embodiments, the compound of formula (IV-B) In the compound, v is equal to 0 and R22 teeth [ka] where a is 2 and c is 4.

[0207] In some embodiments, in compounds of Formula (IV-B), v is equal to 1 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 1; R 22 teeth [ka] and the sum of a and c is 8. In some embodiments, In the compound, v is equal to 1 and R 22 teeth [ka] where a is 1 and c is 7.

[0208] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0; R 22 teeth [ka] and the sum of a and c is 7 or 9. In some embodiments, -B), v is equal to 0 and R 22 teeth [ka] wherein a is 4 and c is 5. In some embodiments, the compound of formula (IV-B) In the compound, v is equal to 0 and R 22 teeth [ka] wherein a is 1 and c is 8. In some embodiments, the compound of formula (IV-B) In the compound, v is equal to 0 and R 22 teeth [ka] where a is 2 and c is 5.

[0209] In some embodiments, in compounds of Formula (IV-B), v is equal to 0 and R 22 teeth [ka] In some embodiments, in compounds of formula (IV-B), v is equal to 0; R 2 2 is [ka] and the sum of a and c is 7 or 9. In some embodiments, -B), v is equal to 0 and R 22 teeth [ka] wherein a is 4 and c is 5. In some embodiments, the compound of formula (IV-B) In the compound, v is equal to 0 and R 22 teeth [ka] wherein a is 1 and c is 8. In some embodiments, the compound of formula (IV-B) In the compound, v is equal to 0 and R 22 teeth [ka] where a is 2 and c is 5.

[0210] The LNPs may contain ionized lipids, e.g., at a concentration greater than about 0.1 molar % of the total lipid content of the LNP. In one embodiment, the LNP may comprise, for example, about 1 mol % of the total lipid content of the LNP. , about 2 mol%, about 4 mol%, about 8 mol%, about 20 mol%, about 40 mol%, about 50 mol%, In one embodiment, the LN P comprises ionizable lipids at a concentration greater than about 20 mol%, about 40 mol%, or about 50 mol%. In one embodiment, the LNPs comprise, for example, from about 1 mol % to about 95 mol % of the total lipid content of the LNP. In one embodiment, the LNP comprises an ionizable lipid at a concentration of 1% of the total lipid content of the LNP, e.g., About 2 mol % to about 90 mol %, about 4 mol % to about 80 mol %, about 10 mol % to about 70 mol % of the molecular content Ionization concentrations of 0 mol%, about 20 mol% to about 60 mol%, and about 40 mol% to about 55 mol% In one embodiment, the LNPs contain ionic surfactants at a concentration of about 20 mol % to about 60 mol %. In one embodiment, the LNP comprises a hydroxylated lipid at a concentration of about 40 mol % to about 55 mol %. Contains ionized lipids.

[0211] In one embodiment, the LNP comprises a phospholipid. A phospholipid comprises a phosphate group and a small amount of A lipid containing at least one alkyl, alkenyl, or heteroalkyl chain. The lipids may be natural or non-natural (e.g., synthetic phospholipids). Amine, amide, ester, carboxyl, choline, hydroxyl, acetal, ether In some embodiments, the glycerol may include a hydroxyl group, a carbohydrate, a sterol, or glycerol. In this case, the phospholipids include phosphocholine, phosphosphingolipids, or plasmalogens. Exemplary phospholipids include 1,2-dioleoyl-sn-glycero-3-ol. phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine ( DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , hydrogenated soy phosphatidylcholine (HSPC), 1,2-dilauroyl-sn-glyceroyl -3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-3-phosphocholine Phospholin (DMPC), 1,2-distearoyl-sn-glycero-3-phosphoethanol Diolamine (DSPE), 1-myristoyl-2-oleoyl-sn-glycero-3-phosphatase phosphocholine (MOPC), 1,2-diarachidonoyl-sn-glycero-3-phosphocholine (DAPC), 1-palmitoyl-2-linoleoyl-sn-glycero-3-phosphatidylcholine Pyridylcholine (PLPC), 1-palmitoyl-2-oleoyl-glycero-3-phosphocholine Phosphorus (POPC), 1-stearoyl-2-myristoyl-sn-glycero-3-phospho Choline (SMPC), 1-palmitoyl-2-myristoyl-sn-glycero-3-phosphate Phosphoric acid (PMPC), bis(monoacylglycerol) phosphate (BMP), L- α-Phosphatidylcholine, 1,2-diheptadecanoyl-sn-glycero-3-phospho dihydrocholine (DHDPC), and 1-stearoyl-2-arachidonoyl-sn-glycine Sero-3-phosphocholine (SAPC) is an example of a phosphocholine that can be included in the LNPs described herein. Additional phospholipids are described in Li, J. et al.(Asian J.Pharm.Sci.10:81-98(2015)) It is disclosed in.

[0212] In some embodiments, the LNP has formula (V): [ka] or a pharmaceutically acceptable salt thereof, wherein each R 23 is German alkyl, alkenyl, or heteroalkyl, or heteroalkyl optionally represented by R C Each R is replaced by 25 independently, water is an alkyl or alkyl group; R 24 is absent, hydrogen, or alkyl, and each R C are independently alkyl, halo, hydroxy, amino, cycloalkyl, or heterocycloalkyl. krill, m is an integer from 1 to 4 (inclusive), and u is 2 or 3.

[0213] In some embodiments, each R 23 are independently alkyl (e.g., C2-C3 2 alkyl, C4-C 28 Alkyl, C8-C 24 Alkyl, C 12 ~C 22 Alkyl, or C 16 ~C 20 alkyl). In some embodiments, each R 23 is German and alkenyl (e.g., C2-C 32 Alkyl, C4-C28 Alkenyl, C8~ C 24 Alkenyl, C 12 ~C 22 Alkenyl, or C 16 ~C 20 alkenyl) In some embodiments, each R 23 are independently heteroalkyl (e.g., C 4~C 28 Heteroalkyl, C8-C 24 Heteroalkyl, C 12 ~C 22 Heteroarchitecture Lu, C 16 ~C 20 In some embodiments, each R 23 teeth , independently, C 16 ~C 20 In some embodiments, each R 23 teeth , independently, C 17 In some embodiments, each R 23 is independent and heptadecyl. In some embodiments, each R 23 are identical. In the embodiment, each R 23 In some embodiments, each R 23 is By choice, R C In some embodiments, R C is, independently, It is alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl.

[0214] In some embodiments, R 25 One of the groups is hydrogen. In some embodiments, Te, R 25 In some embodiments, one of R 25 One of them is methi In some embodiments, each R 25 are independently alkyl. In some embodiments, each R 25 is independently methyl. And each R 25 is independently methyl and u is 2. In some embodiments, Each R 25 are independently methyl and u is 3.

[0215] In some embodiments, R 24 does not exist, and the oxygen to which it is attached is negatively charged. In some embodiments, R 24 is hydrogen.

[0216] In some embodiments, m is an integer from 1 to 10, 1 to 8, 1 to 6, or 1 to 4. In some embodiments, m is 1, 2, 3, or 4. In some embodiments, m is 1. In some embodiments, m is 2. In the embodiment, m is 3.

[0217] In some embodiments, both cationic ionizable lipids and anionic phospholipids In some embodiments, compositions comprising anionic phosphorus targeting moieties are provided. The lipid is of the composition of formula (VA).

[0218] [ka] wherein a is 14 or 16 and z is an amide, glycol, or amidyl-alkenyl group. carboxyl-carboxylic acid moiety] In some embodiments, Z is [ka] wherein m is 2 or 3. In some embodiments, the anionic phospholipid The targeting moieties are DSPS (L isomer), DPPS (L isomer), and DMPS (L isomer). , DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu-D SPE, and N-Suc-DSPE.

[0219] In some embodiments, the phospholipid is 1,2-distearoyl-sn-glyceroyl In some embodiments, the phospholipid is 1-3-phosphocholine (DSPC). ,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). In one embodiment, the phospholipid is 1,2-dipalmitoyl-sn-glycero-3-phospholipid. In some embodiments, the phospholipid is 1,2-diphosphoric acid (DPPC). DOPE is dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE).

[0220] Phosphatidylserine uptake LNPs (e.g., as described herein) may contain from about 1 mol % to about 95 mol of the following components: % (or any value therebetween, e.g., about 20 mol % to about 80 mol %) of C1 6 alkyl or C16 alkenyl group or C18 alkyl or C18 alkenyl (ii) 0.1 mol% to about 20 mol% of an ionizable cationic lipid (ICL) containing a group; (or any value therebetween, e.g., about 2.5 mol % to about 10 mol %), phospholipids that also contain a C16 or C18 alkyl or alkenyl group; (iii) about 1 mole % to about 95 mol % (or any value therebetween, for example, about 20 mol % to about 80 mol %) (iv) cholesterol at a concentration of about 0.5 mol % to about 20 mol % of the total lipid content of the LNP; %, about 2.5 mol % to about 10 mol %, about 4 mol % to about 8 mol %, or any value therebetween Phosphatidylserine (PS) or phosphatidylserine (PS) was added to the LNP lipid formulation at any concentration. (v) about 0.1 mol% to about 5 mol% (any value therebetween) of phatidylglycerol (PG); Polyethylene glycol (PEG) at a concentration of any desired value, for example, about 1 mol % to about 2.5 mol % )-2000-containing lipids (e.g., DPG-PEG2000, DPPE-PEG2000, DMPE-PEG2000, DMG-PEG2000). In embodiments, the LNP comprises two of (i)-(v). The LNP comprises three of (i) to (v). In one embodiment, the LNP comprises (i) In one embodiment, the LNP comprises four of (i) to (v). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (v). P comprises (ii) and (iii). In some embodiments, the LNP comprises (i In some embodiments, the LNP comprises (iii) and (v). In some embodiments, the LNP comprises (iii) and (v). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (v). In some embodiments, the LNP comprises (ii), (iii), and (v). In an embodiment, the LNP comprises (ii), (iii), (iv) and (v). In one embodiment, the LNP consists of or consists essentially of four of (i)-(v). In one embodiment, the LNP consists of each of (i)-(v), or In some embodiments, the LNP consists essentially of (i) and (ii): In some embodiments, the LNP consists of, or consists essentially of, (i) and In some embodiments, the LNP consists of, or consists essentially of, (iii). In some embodiments, the compound comprises: (i) a hydroxy group; (ii) a hydroxy group; (iii) a hydroxy group; (iv) a hydroxy group; (v) a hydroxy group; (v) a hydroxy group; (vi) a hydroxy group; (vii ... , the LNP consists of, or consists essentially of, (ii) and (iii). In some embodiments, the LNP comprises (ii) and (v). and the LNP consists of or consists essentially of (iii) and (iv). In one embodiment, the LNP consists of or consists essentially of (iii) and (v). In some embodiments, the LNP consists of (i), (ii), and (iii). In some embodiments, the LNP comprises, or consists essentially of, (i), (i In some embodiments, L consists of or consists essentially of (i) and (v). The NP comprises (ii), (iii), and (v). In some embodiments, the LN P consists of or consists essentially of (ii), (iii), (iv) and (v). .

[0221] The LNPs may, for example, contain phospholipids at a concentration greater than about 0.1 molar % of the total lipid content of the LNP. In one embodiment, the LNPs may be, for example, about 0.5 moles of the total lipid content of the LNPs. mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol% , about 6 mol%, about 8 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 20 mol% In one embodiment, the LNP comprises a phospholipid concentration of greater than about 1 mol%. , about 5 mol%, or greater than about 10 mol% phospholipids. The NP may be, for example, a phospholipid at a concentration of about 0.1 mol % to about 50 mol % of the total lipid content of the LNP. In one embodiment, the LNPs comprise, for example, about 0.5 moles of the total lipid content of the LNP. mol% to about 40 mol%, about 1 mol% to about 30 mol%, about 5 mol% to about 25 mol%, about 10 ... mol% to about 20 mol%, about 10 mol% to about 15 mol%, or about 15 mol% to about 20 mol% In one embodiment, the LNP comprises about 5 mol % to about 25 mol % of phospholipids. In one embodiment, the LNPs contain phospholipids at a concentration of about 10 mol% to 20 mol%. Contains a certain amount of phospholipids.

[0222] In one embodiment, the LNPs comprise a sterol or an ionized sterol molecule. Terols are lipids containing polycyclic ring structures and optional hydroxyl or ether substituents. Sterols are lipids that can be natural or unnatural (e.g., synthetic sterols). , which may contain zero double bonds, a single double bond, or multiple double bonds Sterols are available in a variety of forms, including alkyl, alkenyl, halo, ester, ketone, hydroxyl, and amino groups. Sterols may further comprise diamine, polyether, carbohydrate, or cyclic moieties. It further contains a bioreducible disulfide bond between the alkylamino group and the polycyclic portion of the molecule. (See Table 2, compounds 35-38.) An exemplary list of sterols includes cholesterol, Sterols, dehydroergosterol, ergosterol, campesterol, β- Stigmasterol, lanosterol, dihydrolanosterol, desmo Sterols, brassicasterol, lathosterol, zymosterol, 7-dehydrodes Mosterol, avenasterol, campestanol, lupeol, and cycloarteol In some embodiments, the sterols include cholesterol, dehydrogenase, and the like. Droergosterol, ergosterol, campesterol, β-sitosterol, or or stigmasterol. Additional sterols that can be included in the LNPs described herein Fahy, E. et al. (J.Lipid.Res.46:839-862(2 005).

[0223] Ionized Sterols In some embodiments, the LNP has formula (VI): [ka] or a pharmaceutically acceptable salt thereof, wherein R 26 is water alkyl, heteroalkyl, or -C(O)R D and R 27 is hydrogen, alkyl -OR E and R D and R E each independently represents hydrogen, alkyl, Alkenyl, heteroalkyl, cycloalkyl, heterocyclyl, aryl or hetero aryl, and each of alkyl, alkenyl, heteroalkyl, cycloalkyl, heterocycloalkyl, The aryl, aryl or heteroaryl may optionally be alkyl, halo, or carboxyl. substituted with carbonyl, [ka] is either a single or double bond, and each carbon atom involved in the single or double bond is bonded to 0, 1, or 2 hydrogens, allowing for valence.

[0224] In some embodiments, [ka] is a single bond. [ka] is a double bond. [ka] are single bonds. In some embodiments, [ka] In some embodiments, two of [ka] is a single bond. In some embodiments, each [ka] is a double bond.

[0225] In some embodiments, the sterol is cholesterol. In some embodiments, the sterol is dehydroergosterol. In some embodiments, the sterol is ergosterol. In some embodiments, the sterol is β-sitosterol. In some embodiments, the sterol is stigmasterol. In some embodiments, the sterol is a corticosteroid (e.g., corticosterone , hydrocortisone, cortisone, or aldosterone).

[0226] In some embodiments, the LNP has formula (VI-A): [ka] or a pharmaceutically acceptable salt thereof, wherein q is 3 or 4 and R3 is [ka] is.

[0227] Another aspect of the present disclosure is a method for producing an anionic phospholipid of formula (VA) and a branched phospholipid of formula (VIII) The present invention provides a composition comprising a soluble ionizable lipid.

[0228] [ka] wherein d is 2, 3, or 4, and e and f are each independently 5, 6, or 7. Z1 and Z2 are each independently -OC(O)- or -C(O)-O - and R 14 and R 15 are each independently linear or branched (C 10 ~C 20 ) alkyl] In some embodiments, R in Formula VII 14 and R 15 are respectively, C 14 or C 16 In some embodiments, R 14 is C 11 Straight-chain alkyl and R 15 is C 14 or C 16 In some embodiments, R in Formula VII 14 is C 11 is a linear alkyl, and R 15 is C 14 or C 16 Straight chain In some embodiments, R in Formula VII is a cyclic alkyl. 14 and / or R 15 are each independently [ka] wherein g and h are each independently 5, 6, or 7. In the above, R in Formula VII 14 and R 15 are each independently [ka] where g and h are both the same and are 5, 6, or 7. In the above, R in Formula VII 14 is a linear C 11 alkyl, and R in Formula VII 15 teeth [ka] wherein g and h are both the same and are 5, 6, or 7.

[0229] In some embodiments, the ionizable lipids are ALC-0315 and SM-102 The branched ionizable lipid may be selected from:

[0230] [ka]

[0231] The LNPs may contain, for example, sterols at a concentration greater than about 0.1 molar % of the total lipid content of the LNPs. In one embodiment, the LNPs may contain, for example, about 0.5 of the total lipid content of the LNPs. mol%, about 1 mol%, about 5 mol%, about 10 mol%, about 15 mol%, about 20 mol%, about 25 mol%, about 35 mol%, about 40 mol%, about 45 mol%, about 50 mol%, about 55 mol%, about The sterol concentration is greater than 60 mole %, about 65 mole %, or about 70 mole %. In some embodiments, the LNP is present in an amount of about 10 mol%, about 15 mol%, about 20 mol%, or about 25 mol%. In one embodiment, the LNP comprises a sterol concentration of greater than 0.05 wt. In one embodiment, the sterols are present in a concentration of about 1 mol % to about 95 mol % of the total mass content. The LNP may contain, for example, about 5 mol % to about 90 mol %, or about 10 mol % to about 90 mol % of the total lipid content of the LNP. about 85 mol%, about 20 mol% to about 80 mol%, about 20 mol% to about 60 mol%, about 20 mol In one embodiment, the sterol concentration is from about 20 mol % to about 50 mol %, or from about 20 mol % to about 40 mol %. In some embodiments, the LNP contains a sterol at a concentration of about 20 mol % to about 50 mol %. In embodiments, the LNPs comprise a sterol concentration of about 30 mol % to about 60 mol %.

[0232] In some embodiments, the LNP comprises an alkylene glycol-containing lipid. The alkylene glycol-containing lipids contain at least one alkylene glycol moiety, e.g., methyl In some embodiments, the lipid comprises a ethylene glycol or ethylene glycol moiety. In the above, the alkylene glycol-containing lipid contains polyethylene glycol (PEG). The alkylene glycol-containing lipid may be a PEG-containing lipid. are poly(ethylene glycol)-conjugated (PEGylated) phospholipids (PEG-lipids), e.g., PE G (molecular weight 2,000) methoxy-poly(ethylene glycol)-1,2-distearoyl PEG-DSG, PEG (molecular weight 2,000) methoxy-poly Poly(ethylene glycol)-1,2-palmitoyl-sn-glycerol (PEG-DP G), PEG (molecular weight 2,000) 1,2-distearoyl-sn-glycero-3-phosphate Ethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG -DSPE) or N-palmitoyl-sphingosine-1-{succinyl[methoxy( Polyethylene glycol) 2000 (PEG-ceramide). PEG-lipid The molecular weight of the PEG moiety in the component is also 500 to 10,000 g / mol, 1,500 to 6 The molecular weight can vary from 0.000 g / mol, but is preferably about 2,000 MW. Other polymers used for conjugation include poly(2-methyl-2-oxazoline) (PMO Z), poly(2-ethyl-2-oxazoline) (PEOZ), poly-N-vinylpyrrolide Poly(hydroxyethyl L-asparagine) (PVP), polyglycerol, poly(hydroxyethyl L-asparagine) (PHE A), and poly(hydroxyethyl L-glutamine) (PHEG).

[0233] PEG-containing lipids include amine, amide, ester, carboxyl, phosphate, and choline. , hydroxyl, acetal, ether, heterocycle, or carbohydrate. PEG-containing lipids can, for example, contain, in addition to a PEG moiety, a PEG-containing lipid of, for example, more than 6 carbon atoms in length ( For example, more than about 8 carbons, 10 carbons, 12 carbons, 14 carbons, 16 carbons, At least one alkyl or alkene group of 18 carbons, 20 or more carbons in length In one embodiment, the PEG-containing lipid may contain at least 20 P EG monomers, e.g., at least 30 PEG monomers, 40 PEG monomers, 45 PEG monomers, 50 PEG monomers, 100 PEG monomers, 200 PEG monomers, 300 PEG monomers, 500 PEG monomers, 1000 PEG moieties containing 2000 PEG monomers. Examples of suitable PEG-containing lipids include PEG-DMG (e.g., DMG-PEG2k), PEG- c-DMG, PEG-DSG, PEG-DPG, PEG-DSPE, PEG-DMPE, PEG-DPPE, PEG-DOPE, and PEG-DLPE. In embodiments, the PEG-lipid may be PEG-DMG (e.g., DMG-PEG 2k), PEG-c-DMG, PEG-DSG, and PEG-DPG. Additional PEG-lipids that may be included in the LNPs described herein are incorporated by reference. Fahy, E. et al. (J. Lipid. Res. 46 :839-862(2005).

[0234] In some embodiments, the LNP has formula (VII): [ka] or a pharmaceutically acceptable salt thereof, In the formula, each R 28 are independently alkyl, alkenyl, or heteroalkyl, Each optionally has R FA is absent or is substituted with O, CH2, C(O), or NH, E is absent, alkyl, or heteroalkyl, and alkyl or heteroalkyl is optionally substituted with carbonyl, and each R F is independently , alkyl, halo, hydroxy, amino, cycloalkyl, or heterocyclyl , and z is an integer between 10 and 200 (inclusive).

[0235] In some embodiments, each R 28 are independently alkyl. In the embodiment, each R 28 is independently heteroalkyl. In some embodiments, In each R 28 is independently alkenyl.

[0236] In some embodiments, A is O or NH. , A is CH2. In some embodiments, A is carbonyl. In an embodiment, A is absent.

[0237] In some embodiments, E is alkyl. In some embodiments, A and E are both absent. In some embodiments, A is absent. In some embodiments, E is In some embodiments, either A or E is absent. In some embodiments, both A and E are independently absent.

[0238] In some embodiments, z is 10 to 200 (e.g., 20 to 180, 20 to 1 60, 20-120, 20-100, 40-80, 40-60, 40-50) In some embodiments, z is 45.

[0239] In some embodiments, the PEG-lipid is PEG-DMG (e.g., DMG-P In some embodiments, the PEG-lipid is α-(3'-{[1 ,2-Di(myristyloxy)propanoxy]carbonylamino}propyl)-ω-meth In some embodiments, the PEG-c-DMG is a hydroxyl group, a polyoxyethylene group, or a polyoxyethylene group. In some embodiments, the PEG-lipid is PEG-DSG. PEG-DPG.

[0240] The LNPs may contain, for example, alkylene glycols at a concentration greater than about 0.1 mol % of the total lipid content of the LNP. In one embodiment, the LNP may comprise a choline-containing lipid. About 0.5 mol%, about 1 mol%, about 1.5 mol%, about 2 mol%, about 3 mol%, about 4 mol%, about 5 mol%, about 6 mol%, about 8 mol%, about 10 mol%, about 12 mol%, about 15 mol%, about 20 mol%, and greater than about 50 mol% of alkylene glycol-containing lipids. In one embodiment, the LNPs are present at a concentration of greater than about 1 mol%, about 4 mol%, or about 6 mol%. In one embodiment, the LNP comprises an alkylene glycol-containing lipid. Alkylene glycol-containing lipids at a concentration of about 0.1 mol % to about 50 mol % of the total lipid content In one embodiment, the LNP comprises, for example, about 0.5 moles of the total lipid content of the LNP. % to about 40 mol%, about 1 mol% to about 35 mol%, about 1.5 mol% to about 30 mol%, about 2 mol ...40 mol%, about 1 mol% to about 40 mol%, about mol% to about 25 mol%, about 2.5 mol% to about 20 mol%, about 3 mol% to about 15 mol%, about 3 Alkylene glycol at a concentration of 0.5 mol % to about 10 mol %, or about 4 mol % to about 9 mol % In one embodiment, the LNPs contain an alcohol-containing lipid at a concentration of about 4 mol % to 9 mol %. Contains xylene glycol-containing lipids.

[0241] In some embodiments, the LNP comprises at least two types of lipids. In this study, LNPs consist of ionizable lipids, phospholipids, sterols, and alkylene glycols. In some embodiments, the LNP comprises at least three of the hydroxyl-containing lipids. In one embodiment, the LNPs comprise ionizable lipids, phospholipids, sterols, and the like. and alkylene glycol-containing lipids. In one embodiment, the LNP comprises at least four types of lipids. Contains each of hydroxylated lipids, phospholipids, sterols, and alkylene glycol-containing lipids. nothing.

[0242] LNPs (e.g., as described herein) may contain from about 1 mol % to about 95 mol of the following components: % (e.g., about 20 mol% to about 80 mol%) of an ionized cationic lipid; (ii) Phosphoric acid at a concentration of 0.1 mol % to about 50 mol % (for example, about 2.5 mol % to about 20 mol %) (iii) a concentration of about 1 mol % to about 95 mol % (e.g., about 20 mol % to about 80 mol %) (iv) about 0.1 mol % to about 50 mol % (e.g., about 2.5 mol % to about In one embodiment, the composition may comprise one or more of the PEG-containing lipids at a concentration of 20% by mole. In one embodiment, the LNP comprises one of (i) to (iv). In one embodiment, the LNP comprises three of (i) to (iv). In one embodiment, the LNP comprises each of (i) through (iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (ii) and (iv). In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (iii). In some embodiments, the LNP comprises (i), (ii), and (iv). In an embodiment, the LNP comprises (ii), (iii) and (iv).

[0243] LNPs (e.g., as described herein) may contain from about 1 mol % to about 95 mol of the following components: % (e.g., about 20 mol% to about 80 mol%) of an ionized cationic lipid; (ii) DSP at a concentration of 0.1 mol % to about 50 mol % (e.g., about 2.5 mol % to about 20 mol %) C; (iii) a concentration of about 1 mol % to about 95 mol % (for example, about 20 mol % to about 80 mol %) (iv) about 0.1 mol% to about 50 mol% (e.g., about 2.5 mol%) The composition may include one or more of DMG-PEG2k at a concentration of about 20% by mole. In one embodiment, the LNP comprises two of (i) to (iv). In one embodiment, the LNP comprises three of (i) to (iv). In some embodiments, the LNP comprises (i) and (ii). In some embodiments, the LNP comprises (i) and (iii). In some embodiments, the LNP comprises (i) and (iv). In some embodiments, the LNP comprises (ii) and (iii). P comprises (ii) and (iv). In some embodiments, the LNP comprises (ii) In some embodiments, the LNP comprises (iii) and (iv). In some embodiments, the LNP comprises (i), (ii), and (i In some embodiments, the LNP comprises (i), (ii), and (iv). In some embodiments, the LNP comprises (ii), (iii), and (iv). ) is included.

[0244] In one embodiment, the LNP is from about 50:1 to about 1:1 (e.g., 40:1, 32:3 , 6:1, 7:1, 5:1, 24:5, 26:5, 10:3, 15:2, 16:7, 18 The ratio of ionizable lipids to phospholipids is 1:1, 3:1, 3:2, or 1:1. In an embodiment, the LNPs have an ionizable lipid to phospholipid ratio of about 15:2. In embodiments, the LNPs have an ionizable lipid to phospholipid ratio of about 5:1. In the form, the LNP is about 10:1 to about 1:10 (e.g., 9:1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1:6, ionizable lipid to sterol ratios of 5:6, 7:6, 7:8, or 8:9). In one embodiment, the LNP is a 1:10 to 10:1 (e.g., 1:9, 1:8, 1:7) :8, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4:1, 4:3, 3 :1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1:5, 4:5, 1 ionizable lipids and alkylene-containing lipids (5:6, 5:6, 7:6, 7:8, or 8:9) In one embodiment, the LNP has a ratio of about 10:1 to about 1:10 (e.g., 9: 1, 8:1, 8:7, 7:1, 7:5, 7:3, 6:1, 6:5, 5:1, 5:3, 4: 1, 4:3, 3:1, 2:1, 1:1, 1:2, 1:3, 3:4, 1:4, 3:5, 1: phospholipids and alkylenes (e.g., 1:5, 4:5, 1:6, 5:6, 7:6, 7:8, or 8:9) In one embodiment, the LNPs have a lipid to lipid ratio of about 50:1 to about 1:1 (e.g., 40:1, 32:3, 6:1, 7:1, 5:1, 24:1, 22:1, 20:1, 2 2:5, 24:5, 26:5, 10:3, 15:2, 16:7, 18:1, 3:1, 3: 2, or 1:1) ratio of sterol to alkylene-containing lipid.

[0245] In one embodiment, the LNP (e.g., as described herein) comprises an ionizable lipid, a phospholipid, a sac of proteins, sterols, and alkylene glycol-containing lipids (e.g., PEG-containing lipids) In another embodiment, the LNP (e.g., as described herein) comprises two of the following: Polyvinyl lipids, phospholipids, sterols, and alkylene glycol-containing lipids (e.g., PE In one embodiment, the LNP (e.g., a lipid-containing lipid) comprises three of the glycerol-containing lipids described herein. The above-mentioned lipids are ionizable lipids, phospholipids, sterols, and alkylene glycol-containing lipids. (e.g., PEG-containing lipids).

[0246] In some embodiments, the LNPs described herein are sized to be between 5 and 500 nm, e.g., 10~400nm, 20~350nm, 25~325nm, 30~300nm, 50~2 50nm, 60~200nm, 75~190nm, 80~180nm, 100~200nm The diameters of LNPs are: Any method known in the art, such as dynamic light scattering, transmission electron microscopy (TEM), ) or scanning electron microscopy (SEM). In this study, LNPs were selected from the following groups: 50-100 nm, 70-100 nm, and 80-100 nm. In one embodiment, the LNPs have a diameter of about 90 nm. In embodiments, the LNPs described herein have a diameter of greater than about 30 nm. In embodiments, the LNPs are about 35 nm, about 40 nm, about 45 nm, about 50 nm, about 60nm, about 70nm, about 80nm, about 90nm, about 100nm, about 120nm, about 14 0nm, approx. 160nm, approx. 180nm, approx. 200nm, approx. 225nm, approx. 250nm, approx. In one embodiment, the LNPs have a diameter of about 7 nm or greater than about 300 nm. In one embodiment, the LNP has a diameter of greater than about 90 nm. In one embodiment, the LNP has a diameter greater than about 180 nm.

[0247] In some embodiments, the LNPs described herein are between about 40 nm and about 18 nm in size. In some embodiments, the multiple vesicles described herein have an average diameter in the range of 100 nm. The LNPs have an average diameter of about 50 nm to about 150 nm. Thus, the LNPs described herein have an average diameter of about 50 nm to about 120 nm. In some embodiments, the LNPs described herein are from about 60 nm to about 120 nm. In some embodiments, the LNPs have an average diameter of about 40 nm, Approx. 45nm, approx. 50nm, approx. 60nm, approx. 70nm, approx. 80nm, approx. 90nm, approx. 100 nm, about 120 nm, about 140 nm, about 160 nm, about 180 nm.

[0248] In some embodiments, the nanoparticle or nanoparticles described herein are: Less than -100mv, e.g., -90mv, -80mv, -70mv, -60mv, -50 Neutral to negative surface charge with averages below -40mv, -30mv, and -20mv In some embodiments, the nanoparticle or nanoparticles have a molecular weight of -100m. Neutral to negative voltages of v to 100mv, -75mv to 0, or -50mv to -10mv It has a surface charge.

[0249] In some embodiments, at least 5% (e.g., at least at least 10%, at least 15%, at least 20%, at least 25%, at least 3 0%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%) The nanoparticles have an average neutral to negative surface charge of less than -100 mV. In this state, the nanoparticle or nanoparticles have a pH of -20mv to +20 at pH 7.4, It has an average surface charge of -10mv to +10mv, or -5mv to +5mv. Charged LNPs have improved pharmacokinetics and biological performance compared to cationic LNPs It has.

[0250] Generation of lipid nanoparticles (LNPs) A method of producing LNPs can include mixing a first solution with a second solution. Mixing may be by propeller mixing, vortexing of the solution or preferably by microfluidic mixing or This can be achieved using standard liquid mixing techniques such as those using highly efficient T-mixing. In some embodiments, the first solution comprises one or more lipids and nucleic acids, all of which All ingredients are solubilized in a water / solvent system. The solvent can be any water-miscible solvent (e.g., ethanol). alcohol, methanol, isopropanol, acetonitrile, dimethylformamide, dimethyl Some examples include methyl methyl sulfoxide, dioxane, or tetrahydrofuran. In an embodiment, the first solution comprises a small proportion of water or pH buffered water. is at least 60% by volume water, for example, at least about 0.05% by volume, 0.1% by volume %, 0.5vol%, 1vol%, 2vol%, 3vol%, 4vol%, 5vol%, 10vol%, 15% by volume, 20% by volume, 25% by volume, 30% by volume, 35% by volume, 40% by volume, 45% by volume %, 50%, 55% or 60% by volume of water. In this case, the first solution is about 0.05% to 60% by volume of water, for example, about 0.05% to 60% by volume of water. 50% by volume, about 0.05% to 40% by volume, or about 5% to 20% by volume of water .

[0251] In some embodiments, the first solution contains a single type of lipid, e.g., ionized In some embodiments, the lipid may comprise a lipid, a phospholipid, a sterol, or a PEG-containing lipid. In some embodiments, the first solution comprises a plurality of lipids. In some embodiments, the lipid may comprise a lipid, a phospholipid, a sterol, or a PEG-containing lipid. Several lipids are present, including cholesterol, 1,2-distearoyl-sn-glycero-3-phosphate, Sulfocollin (DSPC), 1,2-dimyristoyl-rac-glycero-3-methylpoly Oxyethylene 2000 (DMG-PEG2k) or α-(3'-{[1,2-di(amino)methyl] (listyloxy)propanoxy]carbonylamino}propyl)-ω-methoxy, polio Polyethylene glycol (PEG2000-C-DMG), and ionizable lipids. can be present in any ratio. In one embodiment, the plurality of lipids is an ionizable lipid or sterols, phospholipids, sterols, PEG-containing lipids of the above lipids, or combinations thereof Included in a particular ratio (e.g., a ratio described herein).

[0252] In some embodiments, the second solution is water. The second solution is an aqueous buffer solution having a pH of 3 to 6 (e.g., a pH of about 3, about 4, about 5, or about 6). The second solution may contain a loading component, such as a nucleic acid (e.g., mRNA). The second solution may contain a small proportion of a water-miscible organic solvent. up to at least 60% by volume of at least one water-miscible organic solvent, e.g., at least about 0. 0.5%, 0.1%, 0.5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% , 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55% , 60%, or any volume percent therebetween of at least one organic solvent (e.g., water-miscible In one embodiment, the second solution may contain about 0.05% by volume to about 0.15% by volume of a soluble organic solvent. 60% by volume of an organic solvent, for example, about 0.05% by volume to 50% by volume, about 0.05% by volume to 4 0% by volume, or about 5% to 20% by volume of an organic solvent (e.g., a water-miscible organic solvent). The aqueous buffer solution may be an aqueous solution of citrate buffer. In this case, the aqueous buffer solution has a pH of 4 to 6 (e.g., a pH of about 4, about 5, or about 6). In one embodiment, the aqueous buffer solution is a citrate buffer having a pH of about 6. is.

[0253] In some embodiments, the method comprises a mixture of a first and a second solution comprising an LNP suspension. In some embodiments, the first and second solutions containing the LNP suspension may be diluted. The pH of the solution containing the mixture of the second solution can be adjusted. Adjustment of pH can be achieved by adding water, acids, bases, or aqueous buffers. In some embodiments, the LNP suspension is not diluted or pH adjusted. In some embodiments, the LNP suspension is both diluted and the pH adjusted.

[0254] In some embodiments, tangential flow filtration (TFF) (e.g., blood Diafiltration (diafiltration) removes excess reagents, solvents, and unencapsulated nucleic acids from the LNP suspension. Organic solvents (e.g., ethanol) and buffers can also be removed by TFF. In some embodiments, the LNP suspension can be removed by In some embodiments, the LNP suspension is subjected to dialysis and not TFF. In some embodiments, the LNP suspension undergoes dialysis and does not undergo dialysis. undergo both TFF.

[0255] In one aspect, the present disclosure provides a method for encapsulating and / or The nucleic acid-containing LNP sample is washed with a detergent (e.g., , Triton X-100, or anionic detergents (including but not limited to dodecyl sulfate, or non-ionic detergents, such as, but not limited to, sodium silsesquioxane sulfate (SDS). β-octylglucoside, etc.), or amphoteric detergents3-14). In one embodiment, the method comprises determining the presence, absence, and / or Further comprising analyzing the sample for the amount of released nucleic acid.

[0256] Ligand-containing LNPs Some aspects of the present disclosure include a ligand (such as the present invention) that has binding specificity for a cell surface antigen. and LNPs containing a targeting ligand (also referred to herein as a targeting ligand), wherein binding of the ligand to an antigen is Some embodiments relate to LNPs that induce internalization of a ligand. The present invention relates to a composition comprising an LNP comprising the above-described ligand.

[0257] In some embodiments, the targeting ligand is coupled to a lipid conjugate. For example, lipid conjugates include, but are not limited to, PEG(2000)-DSPE or PE The coupling agent may be a hydrophilic polymer-lipid conjugate such as G(2000)-DSG. can be achieved by a variety of chemistries known in the art (e.g. , Bioconjugates Techniques (Greg T. Hermans (See also: 2013, Elsevier, 3rd Edition). In embodiments, the targeting ligand is coupled to the lipid conjugate by a linker. The linker molecule is generally a lipid domain (phospholipid or stearyl) to which a PEG terminus is attached. It contains a hydrophilic polymer chain such as a thiol-reactive functional group such as maleimide at the end. Phosphatidylethanolamines (P) of various sizes and hydrocarbon chain lengths E) Lipid anchor and PEG spacer with terminal maleimide or iodoacetate groups Linkers containing the following are currently available from Avanti Polar Lipids (Alabama, USA) and NOF Corporation (Japan). One strategy used is to convert proteins to 1,2-distearoyl-sn-glycero-3- Phosphoethanolamine-N-[maleimide(polyethylene glycol)-2000]( Coupling to thiol-reactive lipopolymer linkers such as Mal-PEG-DSPE Preferably, the protein of interest is prepared by amplifying one cysteine ​​residue at the C-terminus. Alternatively, F(ab)2 or Fab' may be engineered to contain the Fab' from IgG to Mal-PEG-DSPE for coupling to cysteine ​​thiols. Dithiothreitol (DTT), mercaptoethylamine, (Tris Disulfide synthesis using a reducing agent such as (2-carboxyethyl)phosphine (TCEP-HCl) Mal-PEG can be generated enzymatically by reduction of the cysteine ​​bond. -DSPE reactions are performed at pH 5.5 to 7.5, e.g., pH 5.5, 6, 6.5, 7, 7. The reaction occurs in aqueous buffer at pH 5, preferably pH 6.0. The reaction typically occurs within 4 hours. Add a small amount of cysteine ​​or mercaptoethanol to remove any unreacted maleimides. The coupling reaction is quenched by reacting with the hydroxyl group. Although it is not necessary to remove the protein, the complex may be purified for storage purposes and further characterization. It is useful to enable the production of large-sized lipopolymer micelles (e.g., 850 kJ / cm). Da, Nellis et al., 2005a), size exclusion chromatography Characterization of such protein complexes can be performed in a variety of ways, including by SEC (Second-Order Self-Assembled Chemistry). This is achieved by a variety of techniques. For example, purity is determined by SEC and molecular weight is determined by dodecyl ether. By sodium sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), The melting point of the protein was determined by differential scanning calorimetry (DSC), and the isoelectric point was determined by capillary analysis. - by electrophoresis, and target binding affinity by surface plasmon resonance (BIAcore ) and quantified by biolayer interferometry (ForteBio).

[0258] Examples of target ligands are the Her2 receptor, epidermal growth factor receptor (EGFR), and ephrin A. 2 receptor, CLEC9A receptor, DEC205 receptor, CLEC4A receptor, XCR1 receptor receptor, CD141 receptor, HLA-DR receptor, transferrin receptor type 1, tra Insulin receptor type 2, VEGF receptor, PDGF receptor, integrin, NGF Receptors: CD19, CD20, CD22, CD33, CD43, CD38, CD56, C D69, prostate-specific membrane antigen (PSMA) or various other cell surface receptors, or Glycoconjugates, proteoglycans, glycoproteins, and asialoglycoprotein receptors (ASGs) Glycoconjugate N-acetylgalactosamine (GalNAc) ligands that bind PR These include glycolipids or small molecule conjugates such as folate PEG-DSPE that target the folate receptor. It may also be an antibody or antibody fragment against a cell surface receptor.

[0259] In one embodiment, the targeting ligand is an anti-DEC205 antibody. D205) is a type I cell surface protein expressed primarily by dendritic cells (DCs) This is due to the presence of interdigitating DCs in the T cell areas of lymphoid tissues, bone marrow-derived DCs, and Langerhans cells. It is found on cytoplasmic CD4+ cells, and at lower levels on macrophages and T cells, and significantly increases during DC maturation. The expression of DEC-205 is positively correlated with the expression of CD8a. Both are found at high levels on lymphoid DCs and at low levels on myeloid DCs. -205 is also expressed at moderate levels by B cells and is involved in the transition from pre-B cells to B cells. Recombinant anti-human DEC205 antibody was obtained from Creative Biosciences. It is commercially available from olabs.

[0260] In one embodiment, antigen-specific targeting on LNPs involves the binding of the LNPs to a targeting ligand-lipid complex. This is achieved by co-incubating with PEG to prepare ligand-targeted LNPs. The targeting ligand-lipid complex may be prepared prior to preparing the LNP (Nelli s et al.Biotechnol Prog.2005 Jan-Feb;21( 1):205-20).

[0261] In one embodiment, the LNP is an antibody or fragment-PEG-phospholipid micelle. or other ligand conjugates and heated at 37°C overnight to form antibody conjugates. promotes the insertion of the LNP into the outer membrane (Nellis et al. Biotechno l Prog. 2005 Jan-Feb;21(1):221-32). In this case, the insertion may be performed for a shorter period of time at elevated temperature, for example, 0.5 to 8 hours at 37°C, or preferably This can be achieved by heating at 37°C for 0.5-2 hours. Place the LNP on ice (it can then be stored in a refrigerator at 4°C) and rapidly The total amount of lipid complexes added can be stopped by lowering the temperature. 0.02% to 2%, or preferably 0.1% to 1%, or preferably 0.1% to 0 The efficiency of antibody-lipid complex uptake may be increased by adding SDS or other detergents. This can be measured by SDS-PAGE after LNP dissociation ( Compare with a standard curve) (Nellis et al. Biotechnol Prog. 2005 Jan-Feb;21(1):205-20). Uptake of other targeting ligands The efficiency was measured using ultra-high performance liquid chromatography (UPLC-EL) equipped with an evaporative light scattering detector. SD) can be measured (Gauthier et al., J Mol Sci.2019 Nov 12;20(22):5669).

[0262] Figure 2 shows the reduced C-terminal cysteine ​​of a Fab' antibody fragment and the maleimide-terminated poly(ethylene glycol) (ethylene glycol) 2000 derivatized distearoylphosphatidylethanolamine and The reaction is shown in Figure 1. R1 and R2 are stearic acid. The final antibody-lipopolymer complex is , an intermediate that subsequently inserts into the outer lipid layer of lipid nanoparticles for active targeting.

[0263] Targeting of LNPs can also be achieved by adding lipids to the formulation. For example, phosphatidylserine is known to redistribute to the outer surface of the plasma membrane during apoptosis. and is the molecular stimulus for phagocytic cell attraction (Fadok et al., Curr Biol.2003 Aug 19;13(16):R655-7). Phosphatidyl Serine (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells. LNPs can induce dendritic cell uptake and activation. This can also be achieved by adding anionic phospholipids to the formulation (Table 3). For example, phosphatidylserine redistributes to the outer surface of the plasma membrane during apoptosis. is known to be a molecular stimulus for phagocytic cell attraction (Fadok et al. rr Biol.2003 Aug 19;13(16):R655-7). Phosphatidylinositol Pseudomonas aeruginosa (PS) and phosphatidylglycerol (PG) are recognized by dendritic cells. It is recognized by dendritic cells and can induce their uptake and activation (Caronni et al., 2004). t al.,Nat Comm.2021 April 14;12:2237-225 3;Ischihashi et al., PLOS One 2013). Anionic Phospholipids have been used previously in the context of liposomes, but lipidic nucleic acids containing condensed nucleic acids are also used. The inclusion of the anionic head group in the nanoparticles allows the anionic head group to interact with the phosphate backbone of the mRNA via ionization. Inhibits intracellular escape by altering surface charge, which can compete for thionic lipid binding sites This is unexpected as it may cause aggregation of the LNP during formation or storage.

[0264] JPEG2026016373000148.jpg195170

[0265] In one embodiment, the anionic targeting ligand is phosphatidylserine (PS), Phosphatidylglycerol (PG), N-glutaryl-phosphatidylethanolamine (N-glu-PE), or N-succinyl-phosphatidylethanolamine (N- In one embodiment, the anionic The phospholipid is phosphatidylserine. In another embodiment, the dimyristoyl phosphatidylcholinesterase contains the L-isomer of serine. dipalmitoyl-L-serine (DMPS), dipalmitoylphosphatidyl-L-serine (DPPS ), or phosphatidyl-L-serine (DSPS), The acyl chains of phatidylserine are fully saturated. The PS used is the L-isomer of either DPPS or DSPS. Serine, for example, is a saccharide in which one acyl chain is stearic acid and the other is palmitic acid. , may also contain asymmetric acyl chain compositions.

[0266] In one embodiment, PS or PG is present in an amount ranging from about 0.1 mol % to about 10 mol % of the total lipid content of the LNP. 20 mol%, about 0.1 mol% to about 10 mol%, about 0.1 mol% to about 5 mol%, about 0.5 mol% % to about 20 mol%, about 0.5 mol% to about 10 mol%, about 0.5 mol% to about 5 mol%, about 1 mol % to about 20 mol %, about 1 mol % to about 10 mol %, or about 1 mol % to about 5 mol % In one embodiment, PS is added to the LNP lipid formulation at a concentration of 0.1% to 0.1% of the total lipid content of the LNP. about 1 mol % to about 20 mol %, about 2.5 mol % to about 10 mol %, about 3 mol % to about 9 mol %, or about 4 mol % to about 8 mol % to the LNP lipid formulation.

[0267] In one embodiment, the PS lipid is DODAP, AKG-OA-DM2, O-1176 9, DLin-MC3-DMA, DLin-KC2-DMA, DLin-KC3-DMA ions known in the art, including , ALC-0315, and SM-102 The LNP composition contains a methylated cationic lipid.

[0268] In another embodiment, the PS lipid is an ICL of formula I, II, III, a combination thereof, or or a pharmaceutically acceptable salt thereof. In this case, PS lipids are incorporated into the LNP composition using N / P ratios of 3-8, 4-7, or 5-6. Included.

[0269] In some embodiments, the method of delivering a nucleic acid to a cell comprises: a ligand (also referred to herein as a target ligand) that has binding specificity for and contacting the antigen with a composition comprising an LNP, wherein binding of the ligand to the antigen induces internalization of the ligand. In some embodiments, the targeting ligand is including, but not limited to, an internalizing antibody or fragment thereof, a small molecule conjugate, or a glycoconjugate. In some embodiments, binding of a targeting ligand to a specific cell surface antigen Induces internalization of LNPs, contacts them with cells under internalization conditions, and incubates them with cells. Upon completion of the assay, the number of target ligands bound to the cells will be at least 100,000 or less. Each expresses 1,000,000 antigen molecules.

[0270] JPEG2026016373000149.jpg212170

[0271] JPEG2026016373000150.jpg78170

[0272] composition In some embodiments, the lipidic nanoparticle composition comprises a lipid and a nucleic acid, The polymeric nanoparticles may comprise a compound of Formula I, II, III, a combination thereof, or a pharmaceutically acceptable salt thereof. Contains acceptable salts.

[0273] In some embodiments, the LNP comprises an ionizable lipid having the structure of formula (IV): nothing.

[0274] In some embodiments, the composition further comprises a pharmaceutical excipient.

[0275] In some embodiments, the lipid-based nanoparticles are in an aqueous medium.

[0276] In some embodiments, the nucleic acid comprises a compound of Formula I, II, III, IV or The nucleic acid is either RNA or DNA, and the nucleic acid is encapsulated in a lipid nanoparticle with a combination of these. In some embodiments, the nucleic acid is mRNA. In some embodiments, the nucleic acid is siRNA. In some embodiments, the nucleic acid is DNA.

[0277] In some embodiments, the lipid nanoparticles comprise phosphatidylcholine and sterol. In some embodiments, the sterol is cholesterol. In some embodiments, the lipid nanoparticles may comprise phosphatidylcholine, ionized calcium. In some embodiments, the ICL comprises a membrane comprising a thiogenic lipid (ICL), , II, III or IV structure and cholesterol, and the membrane is a lipid nanoparticle In some embodiments, the ICL is a polymeric polymer having a pH of 1.0 or higher, and separates the interior from the aqueous medium. 2. In some embodiments, the ICL has the structure shown in Table 1B. In some embodiments, the phosphatidylcholine is distearoylphosphatidylcholine. The main ingredients are desiccant phosphate (DSPC) or hydrogenated soy phosphatidylcholine (HSPC). In some embodiments, the molar ratio of ionizable cationic lipid to cholesterol is about In some embodiments, the ratio of ICL to cholesterol is 65:35 to 40:60. The molar ratio of the hydroxybenzoates to the hydroxybenzoates is about 60:40 to about 45:55.

[0278] In some embodiments, the molar ratio of phosphatidylcholine to cholesterol is It is about 1:5 to about 1:2.

[0279] In some embodiments, the membrane further comprises a polymer-conjugated lipid.

[0280] In some embodiments, the lipid nanoparticles comprise ICL, DSPC, cholesterol and polymer-conjugated lipid in a molar ratio of about 49.5:10.3:39.6:2.5.

[0281] In some embodiments, the polymer-conjugated lipid is PEG(2000)-dimylysine Dimyristoylglycerol (PEG-DMG) or PEG (molecular weight 2000)-dimyristoyl Phosphatidylethanolamine (PEG-DMPE).

[0282] The compositions of the present disclosure can be administered by a variety of routes, for example, intravenously, parenterally, intraperitoneally, or intravenously. The composition may be administered to a subject via a local route for systemic delivery. In some embodiments, the present disclosure provides methods for administering nucleic acids in vivo. A method for in vivo delivery to a subject is provided.

[0283] In some embodiments, the composition is a liquid pharmaceutical formulation for oral administration.

[0284] In some embodiments, the composition is a liquid pharmaceutical for subcutaneous, intramuscular, or intradermal administration. It is a formulation.

[0285] In some embodiments, the composition is in the form of a lyophilized powder, which is dried prior to administration. and subsequently reconstituted in an aqueous medium.

[0286] How to use Targeting dendritic cells Dendritic cells (DCs) are specialized antibodies that play a central role in initiating and regulating adaptive immunity. These cells are the primary antigen-presenting cells, and are responsible for their potent antigen (Ag) presentation and ability to generate unique T cell responses. By this force, efficient and specific delivery of Ag to DCs leads to the release of Ag-specific effectors and tumor It is the basis for generating memory cells against tumors or pathogens.

[0287] Dendritic cells secrete granulocyte-macrophage colony-stimulating factor (GM-CSF), IL-4, and and IFN-gamma, and differentiated monocyte-derived DCs in vitro. They can be generated from human blood monocytes. Cells in culture exhibit both dendritic and veiled morphologies. The former are adherent and the latter are suspended. Phenotypically, they are CD1a- / d im, CD11a+, CD11b++, CD11c+, CD14dim / -, CD16a - / dim, CD18+, CD32dim / -, CD33+, CD40+, CD45R0 +, CD50+, CD54+, CD64- / dim, CD68+, CD71+, CD80 dim, CD86+ / ++, MHC class I++ / , HLA-DR++ / , HLA-DP +, and HLA-DQ (Giseler et al. Dev Immuno l.1998;6(1-2):25-39).

[0288] Alternatively, human primary blood dendritic cell lines have been developed and are available from Creative Biolabs. It is commercially available.

[0289] CD8+ T cells are cytokines known to have important functions during Mycobacterium tuberculosis infection. Importantly, CD4+ cells are capable of producing IL2, IFN-γ, and TNF-α. 8+ T cells act through granule-mediated functions (perforin, granzymes, and granules) cytolytic or apoptotic function to kill cells infected with M. tuberculosis (through isoforms) Fas-Fas ligand interaction to induce cisplatin. In humans, CD8 + T cells can produce granulysin, which can directly kill tuberculosis bacteria. Therefore, antigen-generating mRNA LNPs delivered to DCs can stimulate CD8+ T cell responses. It is expected to stimulate and fight tuberculosis infection.

[0290] CD8+ T cells express M. tuberculosis (M. tuberculosis) antigens presented by classical and non-classical MHC molecules. It can recognize specific antigens (as peptides) of B. berculosis. Presented by antigen-presenting cells in the context of MHC Ia (HLA-A, B, C) molecules Classically restricted CD8+ T cells that recognize specific antigens have been identified. The CD8+ T cells associated with HLA-E molecules (non-MHC Ia), group 1 CD1 molecules MHC I-related molecules (MRs) such as glycolipids and mucosal-associated invariant T cells (MAITs) 1) contains CD8+ T cells that can recognize Mg antigens in the context of δT cells are CD8(+) T cells that have both innate and adaptive functions in response to M. tuberculosis infection. CD8+ T cells directly respond to M. tuberculosis infection. Although they have been shown to function, they have many different functions (e.g., most It also plays an important role in regulating the interactions that provide optimal CD4 T cell function. vinegar.

[0291] In one embodiment, LNPs are prepared at an appropriate concentration (e.g., 1-5 μg / mL mRNA). It may be added to cultured human dendritic cells at 1000 kJ / well. Some time is required for cellular uptake and antigen expression. After the time has elapsed, human T cells (HemaCare) can be added and Elis Cell culture medium for INF-γ by a (R&D Systems, DIF50C) Alternatively, cells may be sampled for CD8+ markers or intracellular IFN-γ production (PE anti-human IFN-γ antibody, Biolegend) was analyzed by flow cytometry. The results can be analyzed by chromatometry.

[0292] In one embodiment, LNP is administered at a dose of 0.01 to 5 mg / kg mRNA. The compound may be administered to a subject by any route of administration. For example, a certain proportion of LNPs are taken up by DC cells, but most accumulate in the liver and spleen. DC cells express antigenic peptides and process them for MHC I presentation. and lymph nodes to present to naive T cells, which induces education of memory T cells against the antigen. can be moved to.

[0293] In one embodiment, the antibody is modified with a targeting ligand such as anti-DEC205-PEG-DSPE. The LNP can be administered to a subject at a dose of 0.01 to 5 mg / kg mRNA. According to some embodiments, a higher percentage of LNPs may be taken up by DC cells, resulting in non-targeted Increased production of antigenic peptides compared to lysed LNPs, resulting in more effective vaccines against pathogens Additional targeting ligands for dendritic cells include, but are not limited to, CLE. C9A, CLEC4A, XCR1, CD141, and HLD-DR. Assessment of CD8+ reactivity to in vivo generated antigens was performed using species-specific IFN- Gamma Quantikine ELISA Kits (R&D Systems) This can be achieved by measuring INFγ plasma levels.

[0294] In some embodiments, the LNP compositions have an extended plasma half-life and mR The desired pharmacokinetic properties, such as encapsulation stability of NA, are provided. After intravenous injection into immunocompetent mice, the amount of injected mAb remaining in the blood was measured 6 or 24 hours later. It can be measured as a percentage of the injected dose (ID). The stability of NA encapsulation was evaluated by measuring the ratio of mRNA to lipid (mRNA) after intravenous administration to mice. In some embodiments, the change in the blood glucose level can be determined by the change in the blood glucose level (the ratio of glucose to 100). The percentage of encapsulated mRNA remaining is preferably greater than 20% of the injected amount at 6 hours. or more than 30%, and most preferably more than 40%. The cents are preferably greater than 10%, more preferably greater than 20% of the injected amount.

[0295] As used herein, mycobacterial infections, such as Mycobacterium tuberculosis, or methicillin-resistant yellow fever Gram-positive bacteria such as Staphylococcus aureus (MRSA) Methods for preventing mycobacteria and gram-positive bacteria are disclosed. including, but not limited to, Mycobacterium avium complex, Mycobacterium Mycobacterium leprae, Mycobacterium gol Mycobacterium gordonae, Mycobacterium gordonae Mycobacterium abscessus, Mycobacterium mucogenicum (M Mycobacterium mucogenicum, Streptococcus group (strepto cocci, vancomycin-resistant enterococci (VRE), Staphylococcus aureus Staphylococcus pneumoniae ), Enterococcus faecium, Streptococcus agalactiae e), Streptococcus pneumoniae niae), Streptococcus pyogenes enes) (Streptococcus pyogenes), viridans streptococci group p streptococci, Listeria monocytogenes (Listeria monocytogenes, Nocardia, and Corynebacterium Contains Corynebacterium.

[0296] Administration of the vaccine to induce a secondary immune response induces MHC-presented epitopes MHC capable of eliciting CD4+ helper T cell responses against cells expressing the antigen Alternatively, or in addition, a second immunogen may be used to provide a class II-presented epitope. Administration of a vaccine to induce an immune response involves expressing an antigen that induces MHC-presented epitopes. MHC class I-presented epitopes capable of eliciting CD8+ T cell responses against target cells Furthermore, administration of a vaccine to induce a secondary immune response can be The present invention relates to one or more neo-epitopes (including known neo-epitopes) and cancer-specific somatic cell lines. The mutation does not contain a gene that is expressed by cancer cells, and preferably inhibits an immune response to cancer cells, preferably or may provide one or more epitopes that elicit a cancer-specific immune response. In this case, administration of a vaccine to induce a second immune response involves administering an MHC class II-presented epitope. to cells expressing antigens that are MHC-presented epitopes and / or induce MHC-presented epitopes. Neo-epitopes and MHC clones that can induce CD4+ helper T cell responses expressing antigens that are rasI-presented epitopes and / or induce MHC-presented epitopes. containing cancer-specific somatic mutations capable of eliciting CD8+ T cell responses against the cells In one embodiment, the epitope is a cancer-specific somatic mutation. Does not contain.

[0297] "Cell-mediated immune response," "cellular response," "cellular response to an antigen," or synonyms directed against cells characterized by the presentation of antigens bearing class I or class II MHC The term "cellular response" is intended to include a cellular response mediated by "helper cells" or "killer cells." T cells or T-lymphocytes act as either T cells or T-lymphocytes. Helper T cells (also called CD4+ T cells) mediate the immune response by orchestrating it. They play a key role in the production of killer cells (cytotoxic T cells, cytolytic T cells, CD8+ T cells) These cells (also called CTLS or CTLS) kill abnormal cells, such as cancer cells, and allow more abnormal cells to grow. In a preferred embodiment, the present disclosure provides a method for preventing the production of one or more expressed antigens. and presenting said expressed antigen with an MHC class I. Stimulation of anti-tuberculosis CTL responses against the tuberculosis virus is required.

[0298] An "antigen" according to the present disclosure includes any substance that elicits an immune response. In particular, an "antigen" The antibody may be any substance, preferably a peptide, that reacts specifically with antibodies or T-lymphocytes (T cells). As used herein, the term "antigen" refers to at least one peptide or protein. Preferably, an antigen in the context of the present disclosure includes any molecule that contains at least one epitope. optionally, after processing, elicits an immune response, preferably specific for the antigen. According to the present disclosure, the immune response (preferably cellular) Any suitable antigen that is a candidate for a cellular immune response may be used. In the context of the present invention, the antigen is preferably detected by a cell, preferably a diseased cell, in particular a cancer cell. and induces immune responses to antigens in the context of MHC molecules. The antigen is preferably a product corresponding to or derived from a natural antigen. Such natural antigens may include tumor antigens.

[0299] As used herein, an "antigenic peptide" refers to a peptide that expresses an antigen, preferably an abnormal cell, an immune response against an antigen or cell characterized by the presentation of an antigen, particularly a cancer cell; Preferably relating to parts or fragments of antigens capable of stimulating a cellular response Preferably, the antigenic peptide is characterized by presentation of the antigen with class I MHC. The antigen-responsive cytotoxic agent is capable of stimulating a cellular response against the target cells, preferably an antigen-responsive cytotoxic agent. Preferably, the antigen peptide according to the present disclosure can stimulate cytokines (cytotoxic T lymphocytes). The peptides are MHC class I and / or class II presented peptides, or MHC can be processed to generate class I and / or class II presented peptides Preferably, the antigen peptide substantially corresponds to the amino acid sequence of a fragment of the antigen. Preferably, the fragment of the antigen comprises an amino acid sequence that binds to MHC class I and and / or class II-presented peptides. Preferably, the antigenic peptides according to the present disclosure are a fragment comprising an amino acid sequence substantially corresponding to the amino acid sequence of the fragment, i.e., to generate antigen-derived MHC class I and / or class II-presenting peptides. The peptide is processed directly, i.e., without processing, and is specifically cleaved. When presented without any modification, they have a length suitable for binding to MHC molecules, particularly class I MHC molecules. Preferably, the length is 7 to 20 amino acids, more preferably 7 to 12 amino acids. More preferably, 8 to 11 amino acids in length, especially 9 or 10 amino acids in length. is.

[0300] The main type of professional antigen-presenting cell is the dendritic cell, which has the broadest range of antigen presentation. Perhaps the most important antigen-presenting cells are macrophages, B cells, and certain activated epithelial cells. Dendritic cells (DCs) are cells that mediate antigen presentation to T cells via the MHC class II and I antigen presentation pathway. Dendritic cells are a population of white blood cells that present antigens to the immune system for capture in peripheral tissues. These cells are potent inducers of tumor growth and activation is a key step for the induction of antitumor immunity. It is well known that dendritic cells are conveniently classified into "immature" and "mature" cells. It can be used as a simple method to distinguish between two well-characterized phenotypes.

[0301] However, this nomenclature should be interpreted as excluding all possible intermediate stages of differentiation. Immature dendritic cells correlate with high expression of Fcγ receptors and mannose receptors. , are characterized as antigen-presenting cells with a high capacity for antigen uptake and processing. The mature phenotype is typically characterized by low expression of these markers, whereas the cytoplasmic High expression of cell surface molecules, including class I and class II MHC, adhesion molecules (e.g., CD5 4 and CD11) and costimulatory molecules (e.g., CD40, CD80, CD86 and Dendritic cell maturation is involved in T cell activation, such as immune responses to antigens expressed by immature dendritic cells. The antigen-presenting dendritic cells lead to T cell priming, whereas the antigen-presenting dendritic cells lead to tolerance. Dendritic cell maturation is mainly due to the binding of innate receptors (bacterial DNA, viral RNA, endotoxin, etc.), inflammatory cytokines (TNF, IL-1, IFN), CD Ligation of CD40 on the surface of dendritic cells by 40L and stressful cell death. Triggered by biomolecules with characteristics of microorganisms that are detected by substances released from the cells. Dendritic cells are stimulated in vitro by granulocyte-macrophage colony-stimulating factor ( Cultivating bone marrow cells with cytokines such as GM (CSF) and tumor necrosis factor alpha Non-professional antigen-presenting cells can be induced by interacting with naive T cells. They do not constitutively express MHC class II proteins required for immune responses, such as IFNγ. It is expressed only upon stimulation of non-professional antigen-presenting cells by certain cytokines. "Original presentation cells" refer to cells that contain nuclei encoding peptides or polypeptides, including the peptides to be presented. by transducing cells with a nucleic acid, preferably mRNA, e.g., encoding the antigen. and can be loaded with MHC class I-presented peptides.

[0302] In some embodiments, gene delivery targeting dendritic cells or other antigen-presenting cells is A pharmaceutical composition containing the delivery vehicle is administered to a patient, and transfection occurs in vivo. As used herein, "nucleic acid" refers to a deoxyribonucleotide. nucleic acid (DNA) or ribonucleic acid (RNA), more preferably RNA, most preferably in The nucleic acid may be in vitro transcribed RNA (IVT RNA) or synthetic RNA. According to the present disclosure, genomic DNA, cDNA, mRNA, recombinantly produced, and synthesized According to the present disclosure, nucleic acids include single-stranded or double-stranded linear or Nucleic acids can be isolated according to the present disclosure. The term "isolated nucleic acid," according to the present disclosure, refers to a nucleic acid that is (i) isolated from, e.g., a polymerase-linked (ii) amplified in vitro via polymerase chain reaction (PCR); and (iii) by cloning. recombinantly produced; (iii) cleavage and separation, e.g., by gel electrophoresis; or (iv) synthesized, e.g., by chemical synthesis. Nucleic acids include, in particular, RNA, which may be prepared by in vitro transcription from a DNA template. The vector can be used for introduction into cells, i.e., transfection of cells, in the form of a vector. Furthermore, RNA is modified prior to application by sequence stabilization, capping, and polyadenylation. It can be changed.

[0303] As used herein, the term "RNA" refers to a nucleic acid sequence that includes ribonucleotide residues, preferably "Ribo" refers to a molecule that is composed entirely or substantially of ribonucleotide residues. A "nucleotide" is a nucleotide having a hydroxyl group at the 2' position of a BD-ribofuranosyl group. The term "RNA" refers to double-stranded RNA, single-stranded RNA, isolated RNA (partially or totally purified RNA), essentially pure RNA, synthetic RNA, and recombinant RNA. Recombinantly produced RNA (addition, deletion, substitution of one or more nucleotides and and / or modified RNAs that differ from natural RNA due to modifications. Such modifications include: non-nucleotidic nucleotides, e.g., at the ends or within the RNA, e.g., at one or more nucleotides of the RNA Nucleotides in RNA molecules may also include non-natural nucleotides. or non-standard nucleotides such as chemically synthesized nucleotides or deoxynucleotides. These modified RNAs can be referred to as analogs or mimetics of natural RNA. .

[0304] As used herein, the term "RNA" includes "mRNA" and preferably "mRNA." The term "mRNA" refers to "messenger RNA" and is related to DNA. With respect to a "transcript" produced using a template, a gene encoding a peptide or polypeptide Typically, mRNA consists of a 5'-UTR, a protein coding region, and a 3'-UTR. Contains R. mRNA has only a limited half-life within cells and in vitro. In the context of this disclosure, mRNA is produced by in vitro transcription from a DNA template. The term "modification" in the context of RNA as used in this disclosure refers to the modification of said RNA. In one embodiment of the present disclosure, the present invention includes any modification of RNA that does not naturally occur in A. The RNA used in accordance with the disclosure does not have an uncapped 5'-triphosphate. Removal of uncapped 5'-triphosphates such as 5'-triphosphates is achieved by treating RNA with phosphatase. This can be achieved by improving the stability and / or The ribonucleotides may have modified ribonucleotides to reduce cytotoxicity. For example, in one embodiment, In the case of cytidine in RNA used in accordance with the present disclosure, 5-methylcytidine is Alternatively or additionally, one or more of the following may be partially or fully substituted, preferably fully substituted: In embodiments, in the case of uridine in RNA used in accordance with the present disclosure, pseudouridine The azine may be partially or fully substituted, preferably fully substituted.

[0305] In one embodiment, the term "modified" refers to a 5-cap or 5'-cap analog. The term "5-cap" refers to the production of RNA that is 5'-capped at the 5' end of an mRNA molecule. This refers to the cap structure present at the end of a molecule, typically a 5'-5 triphosphate that is not normally found. In one embodiment, the mRNA is comprised of a guanosine nucleotide connected to the mRNA via a bond. This guanosine is methylated at position 7. The term "conventional 5'-cap" refers to the naturally occurring This refers to the RNA 5'-cap, preferably the 7-methylguanosine cap (m'G). As used herein, the term "5'-cap" refers to a structure similar to an RNA cap structure, preferably Preferably, the nucleic acid has the ability to stabilize RNA in vivo and / or in cells and / or or 5'-kylated modified to enhance translation of RNA (when bound to RNA). Includes CHAP analogs.

[0306] According to the present disclosure, RNA stability and translation efficiency may be modified as needed. For example, one or more modifications that have an effect on RNA stabilization and / or improved translation efficiency. By using such a method, it is possible to stabilize the RNA and increase its translation. Modifications are, for example, as set forth in PCT / EP2020, which is incorporated herein by reference. 06 / 009448. To achieve this, it is preferable to increase the GC content and minimize the codon length to improve mRNA stability. The expressed peptide or tag is then optimized to enhance translation within the cell. The coding region, i.e., the expressed peptide or protein sequence, can be modified without altering the protein sequence. Modifications may be made within the sequence encoding the protein.

[0307] An aspect of the present disclosure is a method for preventing bacterial or viral infections in a person in need thereof. and administering to a subject an effective amount of a composition produced herein to induce an immune response. and

[0308] Aspects of the present disclosure include a nucleic acid encoding a polypeptide in an amount effective to vaccinate a subject. administering a single dose of a composition described herein containing the compound (e.g., mRNA) to a subject; In some embodiments, the nucleic acid is formulated in cationic lipid nanoparticles. In some embodiments, the lipid nanoparticles The nanoparticle composition is administered in a single injection.

[0309] In some embodiments, the bacterial infection is a Mycobacterium tuberculosis infection.

[0310] In some embodiments, the viral infection is a coronavirus. In embodiments, the coronavirus is SARS-CoV, MERS-CoV or SA It is RS-CoV-2.

[0311] In some embodiments, the viral infection is HIV / AIDS.

[0312] In some embodiments, the lipid nanoparticles are administered parenterally.

[0313] Generally, administration to patients can be by intradermal injection. However, injections can also be intramuscular. It may also be transmitted through the flesh into the lymph nodes (Maloy et al. (2001), Pr oc Natl Acad Sci USA 98:3299-3033). As a result The resulting cells present a complex of interest that is recognized by autologous cytotoxic T lymphocytes. , which then multiply.

[0314] In some embodiments, the composition is administered by inhalation. In embodiments, the compositions are formulated as a nasal spray and / or aerosol.

[0315] The actual dosage levels of the active agents in the pharmaceutical compositions disclosed herein may be adjusted to suit the patient. Achieving the desired therapeutic response for a particular patient, composition, and method of administration without toxicity The amount of active agent can be varied to obtain a substantially effective amount of active agent.

[0316] As used herein in the context of administration, "parenteral" refers to administration other than enteral and topical administration. This refers to any method of administration, usually by injection, including but not limited to intravenous, intramuscular, intravenous, or intravenous. Intravenous, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, intravenous These include intrathecal, intrathecal, intrathecal, epidural and intrasternal injection and infusion.

[0317] As used herein, the phrases "parenteral administration" and "administered parenterally" mean , other than enteral (i.e., via the digestive tract) and topical administration, usually by injection or infusion. refers to the method of administration of, including but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac , intradermal, intraperitoneal, transtracheal, subcutaneous, subcutaneous, intraarticular, inhalation, subcapsular, subarachnoid, respiratory mucosa Intravenous injections and infusions include: intrathecal, intrathecal, epidural, and intrasternal injections and infusions; Often (but not exclusively) liposomal drugs are used for administration.

[0318] Dosage regimens may be adjusted to provide the optimum desired response (e.g., therapeutic response). For example, one or more doses may be administered over time, or as required by the requirements of the therapeutic situation. The dose may be proportionally reduced or increased as indicated.

[0319] In some embodiments, the dose comprises 0.01 to 5 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 5 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 3 mg / kg of nucleic acid. In some embodiments, the dose comprises 0.01 to 3 mg / kg of mRNA. In some embodiments, the dose comprises 0.01 to 1 mg / kg of nucleic acid. In some embodiments, the dose is between 0.01 and 1 mg / kg of mRNA. In some embodiments, the dose is 0.01 to 0.5 mg / kg of nucleic acid. In some embodiments, the dose is 0.01 to 0.5 mg / kg of mRNA. In some embodiments, the dose is 0.01 to 1 mg / kg of mRNA. In some embodiments, the dose is 0.01 to 1 mg / kg of nucleic acid. In some embodiments, the dose is 0.01 In some embodiments, the dose is 0.01 to 0.1 mg / kg of nucleic acid. Contains 0.05mg / kg of mRNA.

[0320] Compound and / or its pharmaceutically acceptable salt or compound and / or its The dosage of LNPs, including pharmaceutically acceptable salts, can vary within a wide range and may be adjusted for each particular In these cases, the method should necessarily be adjusted to suit the individual conditions and pathogens being controlled. do.

[0321] Additional Embodiments 1. A compound of formula I or a pharmaceutically acceptable salt thereof.

[0322] 2. A compound of formula II or a pharmaceutically acceptable salt thereof:

[0323] 3. A compound of formula III or a pharmaceutically acceptable salt thereof:

[0324] 4. A compound of formula IV or a pharmaceutically acceptable salt thereof:

[0325] 5. Compounds having the structure in Table 1A.

[0326] 6. A bioreductive compound having the structure in Table 2.

[0327] 7. A compound having a pKa of 6 to 7, according to any one of the above embodiments 1 to 6. Compound.

[0328] 8. Ionizable lipids of formula I or pharmaceutically acceptable salts thereof, and lipidic compounds containing nucleic acids Nanoparticle compositions.

[0329] 9. A lipid comprising an ionizable lipid of formula II or a pharmaceutically acceptable salt thereof, and a nucleic acid Nanoparticle compositions.

[0330] 10. A method for preparing a nucleic acid comprising an ionizable lipid of formula III or a pharmaceutically acceptable salt thereof, and a nucleic acid. Lipid-based nanoparticle compositions.

[0331] 11. An ionizable lipid of formula IV or a pharmaceutically acceptable salt thereof, and a lipid comprising a nucleic acid. Porous nanoparticle compositions.

[0332] 12. Any one of the above embodiments 8-11, wherein the ionizable lipid encapsulates the nucleic acid. One composition.

[0333] 13. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is an siRNA.

[0334] 14. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is DNA.

[0335] 15. The composition of any one of embodiments 8 to 11, wherein the nucleic acid is mRNA.

[0336] 16. A method for producing a soluble fiber supplement comprising the steps of: 12. The composition of any one of embodiments 8 to 11.

[0337] 17. The composition of embodiment 16, wherein the sterol is cholesterol.

[0338] 18. The molar ratio of ionized lipid to cholesterol is about 65:35 to about 40:60. 18. The composition of embodiment 17,

[0339] 19. The molar ratio of ionized lipid to cholesterol is about 60:40 to about 45:55. 18. The composition of embodiment 17,

[0340] 20. The molar ratio of phosphatidylcholine to cholesterol is about 1:5 to about 1:2. 18. The composition of embodiment 17,

[0341] 21. The composition of embodiment 17, further comprising a polymer-conjugated lipid.

[0342] 22. Polymer-conjugated lipids are PEG(2000)-dimyristoylglycerol (P EG-DMG) or PEG (molecular weight 2,000)-dimyristoylphosphatidyl ethoxylate 22. The composition of embodiment 21, comprising diolamine (PEG-DMPE).

[0343] 23. The nanoparticle further comprises a targeting ligand, wherein the targeting ligand is oriented on the exterior of the nanoparticle. 12. The composition of any one of embodiments 8 to 11.

[0344] 24. The composition of embodiment 23, wherein the targeting ligand is an antibody.

[0345] 25. The composition of any one of embodiments 8 to 11, which is a liquid pharmaceutical formulation.

[0346] 26. The percentage of oxidative degradation products in the case of ionized lipids is 50% of the oxidative degradation products in the 2-DMA or DLin-MC3-DMA control formulations 12. The composition of any one of embodiments 8-11, wherein the composition is less than

[0347] 27. An effective amount of the composition of any one of embodiments 9 to 26 and a pharmaceutical excipient, wherein the administration induces an immune response. How to prevent bacterial or viral infections.

[0348] 28. The method of embodiment 27, wherein the composition is administered subcutaneously, intramuscularly, or intradermally.

[0349] 29. The method of embodiment 27, wherein the bacterial infection is a Mycobacterium tuberculosis infection.

[0350] 30. If the viral infection is SARS-CoV, MERS-CoV or SARS-C 28. The method of embodiment 27, wherein the infection is a OV-2 infection.

[0351] 31. The method of embodiment 27, wherein the viral infection is an HIV infection.

[0352] 32. The method of embodiment 27, wherein the infection is of a non-tuberculous form.

[0353] 33. A pair of 1-hydroxybenzoates covalently attached to a head group containing a dialkylamino group with a pKa of 6-7. Ionization with chemical structures consisting of linear polyunsaturated lipid tails of 6 or 18 carbons A lipid nanoparticle (LNP) composition comprising a lipid, The head group comprises a heterocyclyl or alkyl moiety covalently bonded to a dialkylamino group. and optionally further comprising a phosphate group; Each polyunsaturated lipid tail is linked to at least two methylene groups along the length of the lipid tail. and optionally, A composition comprising a single terminal acyl group covalently attached to a head group.

[0354] 34. Each lipid tail is identical and each lipid tail is unsubstituted ethylene, n-propyl or a total of two olefins separated only by n-butyl, Composition of 3.

[0355] 35. Each lipid tail contains an acyl group that bonds with the oxygen of the head group to form an ester. 35. The composition of embodiment 34, comprising:

[0356] 36. Each lipid tail has the formula A: [ka] [wherein, in formula A, a is 1, 2, 3 or 4, and b is 2, 3 or 4; , c is 3, 4, 5, 6, 7] or Formula B: [ka] [wherein, in formula B, a is 5, 6 or 7, and in formula B, c is 3, 4 or 5] 35. The composition of embodiment 34, having the chemical structure:

[0357] 37. The composition of embodiment 36, wherein b is 4.

[0358] 38. Ionized lipids are [ka] wherein R 22 is the first end of the lipid tail the law of nature, [ka] 37. The composition of claim 36, wherein indicates the attachment of the head group to the dialkylamino portion of the head group.

[0359] 39. The dialkylamino portion of the head group has formula (IV-A): [ka] In formula (IV-A), n is 2, 3 or 4, and in formula (IV-A), R 10 and R 12 each independently represents a group consisting of methyl, ethyl, and propyl and R is selected from alkyl groups selected from 10 and R 12 The alkyl in The composition of embodiment 38, wherein one or more hydroxyls are substituted by:

[0360] 40. R in formula (IV-A) 10 and R 12 are independently methyl, ethyl In embodiments, the compound is —(CH)(CH)OH, —(CH)(CH)OH, or —(CH)(CH)OH. 39 compositions.

[0361] 41. An ionizable lipid has the formula (IA): [ka] wherein a is 1, 2, 3, 4, 5, or 6 and b is 2, 3, or 4 and c is 3, 4, 5, 6, or 7, and the sum of a, b, and c is 10 or 12. Yes, R 10 and R 12 each independently optionally containing one or more hydroxyl groups. is (C1-C4) alkyl substituted with sil, and L is [ka] 34. The composition of embodiment 33, wherein v is 0 or 1 and q2 is 1 or 2. .

[0362] 42. The composition of claim 41, wherein v is 0.

[0363] 43. The composition of claim 41, wherein v is 1.

[0364] 44. An ionizable lipid has the formula II-A: [ka] wherein a is 1, 2, 3, 4, 5, or 6 and b is 2, 3, or 4 where c is 4, 5, 6, 7 or 8, and R2 is [ka] q and q' are each independently 1 or 2; R 10 and R 12 Gaso Each of these is (C1-C4) alkyl optionally substituted with hydroxyl. The composition of Form 33.

[0365] 45. An ionizable lipid has the formula II-A: [ka] wherein a is 5, 6, or 7, c is 3, 4, or 5, and R2 but [ka] q and q' are each independently 1 or 2; R 10 and R 12 Gaso Each of these is (C1-C4) alkyl optionally substituted with hydroxyl. The composition of Form 33. [Example]

[0366] The present disclosure has been described with reference to specific embodiments and numerous details have been set forth for purposes of illustration. However, the present disclosure includes additional embodiments, and some of the details described herein may deviate from the present disclosure. It will be apparent to those skilled in the art that the present disclosure may be varied considerably without departing from the spirit and scope of the present invention. In particular, the present disclosure includes various exemplary embodiments, modifications, and equivalents. The examples include any combination of features, terms, or elements of the components and examples.

[0367] Unless otherwise clearly stated, the isomers of the phosphatidylserine lipids used in the examples The body form is phosphatidyl-L-serine.

[0368] Specific examples are provided below to illustrate various embodiments of the embodiments disclosed herein. Those skilled in the art will appreciate that the various embodiments disclosed herein may be implemented using these specific examples. It will be appreciated that the invention is not limited to the illustrative examples.

[0369] [Example 1A] Synthesis of ionizable lipids Scheme 1. Synthesis of acid intermediates for AKG-UO-1 to AKG-UO-3

[0370] [ka]

[0371] The acid intermediates (6Z,12Z)-6,12-octadecadienoic acid and (6Z, 12Z)-6,12-Hexadecadienoic acid was prepared by general synthesis. (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-119 56) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11 955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-1240 1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-124 02) (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 'Z)-Bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0372] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0373] [ka] 5-Bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane ( 100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) To a solution of 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) at 0°C l) was added. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture The combined organics were washed with brine and then extracted with ethyl acetate (2 x 100 mL). It was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The oil was purified by silica gel chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography gave 2-((5-bromopentyl)oxy)tetrahydrofuran. rho-2H-pyran, 2 (4.5 g, 83%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H) , 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4 synthesis

[0374] [ka] 1,7-Octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphorazine To a solution of 16 mL (90.8 mmol) of methyl methyl ether in 100 mL of tetrahydrofuran, 2.5 M n-butyllithium in n-hexane (18 mL, 45.4 mmol) at 78 °C. l) was added dropwise. Upon completion of the addition, the solution was stirred at -78°C for 1 hour, then - The resulting solution was cooled again to -78°C, at which point 2 -((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 2 A solution of 2.7 mmol) in tetrahydrofuran (10 mL) was added. The mixture was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0° C. and water (100 mL) was added. The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran, followed by The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was extracted with 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography on silica gel was used to give 2-(trideca-6,12- Diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) clear Obtained as an oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2 .16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7 Synthesis of

[0375] [ka] 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, A solution of [n- Add 2.5 M n-butyllithium in hexane (41.3 mL, 103.4 mmol) dropwise. Once the addition was complete, the solution was stirred at -78°C for 1 hour and then cooled to -20°C. The resulting solution was cooled again to -78°C, at which point 1-iodo Dissolve propane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL). The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was The reaction mixture was then cooled to °C and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to give the The tetrahydrofuran was removed and then diluted with n-hexane. The organics were washed with water and brine. The organic layer was dried over magnesium sulfate, filtered, and the filtrate was purified. Concentration under reduced pressure gave a crude oil weighing 9 g. The crude oil was purified by elution with n-hexane. Purification by chromatography on silica using 5% ethyl acetate in water gave 2- (Hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7( 5.9 g, 72%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H) , 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1. 55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0376] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H) , 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1. 53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2Ni 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetramethyl Synthesis of hydro-2H-pyran 9

[0377] [ka] Sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) To the solution, nickel(II) acetate tetrahydrate (3.22 g, 12 Upon completion of the addition, the reaction was evacuated under vacuum and refrigerated with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyridinyl A solution of run 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then The crude mixture was filtered over Celite and the filtrate was concentrated in vacuo to give The crude oil was extracted with n-hexane for 5 to 10 minutes as an eluent. Purification by chromatography on silica using 100% diethyl ether gave 2-( ((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro -2H-pyran, 9 (4.67 g, 78% yield) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H ), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1 .57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 H z, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62 .43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98 , 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetradecanoate Hydro-2H-pyran 10

[0378] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H ), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1 .56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 H z, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26. 01, 25.59, 22.67, 19.78, 14.18. Representative procedure for the deprotection of tetrahydropyranyl ethers (THP) Synthesis of (6Z,12Z)-hexadeca-6,12-dien-1-ol 11

[0379] [ka] 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetradecanoate Dissolve 1H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL ) at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was diluted with acetic acid The combined organics were washed with water and then extracted with magnesium sulfate. The mixture was dried over ice, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The oil was separated on silica using 5-10% diethyl ether in n-hexane as the eluent. The compound was purified by chromatography on HCl to give (6Z,12Z)-hexadeca-6,12-diol. The en-1-ol, 11 (2.5 g, 72%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H ), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0380] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H ), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0381] [ka] (6Z,12Z)-Hexadeca-6,12-dien-1-ol, 11 (2.5 g, 1 0.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0° C. for 2 hours. The mixture was quenched with water. Extraction was performed with ethyl acetate (2 x 100 mL). The combined organics were dried over magnesium sulfate. The crude oil was extracted with 100 ml of ethyl acetate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Purification by chromatography on silica using 20% ​​ethyl acetate in n-hexane (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H ), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0382] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H ), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Synthesis of benzenesulfonate 16

[0383] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol A mixture of alcohol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added at 0 °C. -toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (1 40 mg, 1.14 mmol) was added and the reaction was stirred at room temperature overnight. The organic layer was diluted with 12 (500 mL) and washed with saturated NH4Cl, water, and brine. The solvent was evaporated and the crude residue was carried to the next step without purification. Used (43.8g, 85%). 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2 H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Synthesis of lethan-1-amine 19

[0384] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Dimethylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 1 A mixture of 7 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated and the crude residue was diluted with CH2Cl2 (500 mL) and saturated NaH The organic layer was dried over anhydrous Na2SO4. The solvent was evaporated. The crude residue was purified by flash chromatography (SiO2: CH2Cl2 = 1% N Purification with MeOH 100% to 10% in CH2Cl2 containing H4OH gave a colorless oil The product 19 was obtained (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H ), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H) ). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Lutethan-1-amine 20

[0385] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H ), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0386] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Mixture of ethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) To the mixture was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated to 80°C. Heated for 45 minutes. TLC (Rf=0.1, 10% in CH2Cl2 with 1% NH4OH) MeOH) indicated the reaction was complete. After concentrating the reaction mixture, the crude residue was The product was dissolved in water (5 mL) and lyophilized overnight. A viscous syrup-like product 21 (2.1 g, constant (quantitative) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m , 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0387] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m , 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Representative Procedure for Diesterification (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate) AKG-UO-1(O-1195 Synthesis of 6)

[0388] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added to (6Z,12Z)-octanol at 0°C. Tadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / Add dropwise to a solution in DMF (15 mL, 25 mL) and allow the reaction to warm to room temperature and stir for 1 hour. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was dissolved in dichloromethane (10 mL). Redissolve and add N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4- Dimethylaminopyridine (317 mg, 2.6 mmol) and (S)-4-(dimethylaminopyridine) Mixture of (amino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol) The resulting solution was stirred for 24 hours. After 24 hours, the reaction was cooled to 0°C and water was added. The reaction mixture was quenched with dichloromethane (2 x 100 mL). The organic layer was washed with water and brine (2 x 100 mL). The crude oil was dried at 40°C, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Chromatography on silica using 2% methanol in dichloromethane as the solvent This was further purified to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z ,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO- 1 (0.12 g, 30%) was obtained as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H) ), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate)AKG-UO-1A(O-119 55)

[0389] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12 .1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1 .19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(hexadeca-6,12-dienoate)AKG-UO-4(O-1240 1)

[0390] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H) ), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(hexadeca-6,12-dienoate)AKG-UO-4A(O-124 Synthesis of 02)

[0391] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1. 31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI+): 630.5 (M+1), i) 5-bromopentanol and corresponding First Wittig reaction of triphenylphosphonium ylides prepared from the corresponding aldehydes. ii) conversion of terminal alcohols to bromides by mesylation and substitution; iii) ylide synthesis and Wittig reaction, and finally iv) percolation of the terminal alcohol. The resulting acid intermediates are oxidized with iodate. was used for synthesis. Scheme 2. Synthesis of acid intermediate for AKG-UO-5

[0392] [ka] Acid intermediate (9Z,15Z)-9,15-octadeca used in the synthesis of AKG-UO-5 The dienoic acids were prepared by the general synthesis shown in Scheme 2, which includes i) (5Z)-1-bromo- Alkylation of silyl-protected 10-hydroxy-1-decyne with bromo-5-octene ii) catalytic hydrogenation of alkynes to cis-alkenes, iii) silyl groups on alcohols removal of protection, and finally iv) oxidation of the terminal alcohol to the desired acid. Scheme 3. Synthesis of acid intermediates for AKG-BDG-01 and AKG-BDG-02

[0393] [ka] Two disulfate intermediates used in the synthesis of AKG-BDG-1 and AKG-BDG-2 The synthesis is shown below. (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 Synthesis of (Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0394] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0395] [ka] 5-Bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane ( 100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) To a solution of 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) at 0°C l) was added. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture The combined organics were washed with brine and then extracted with ethyl acetate (2 x 100 mL). It was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The oil was purified by silica gel chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography gave 2-((5-bromopentyl)oxy)tetrahydrofuran. rho-2H-pyran, 2 (4.5 g, 83%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H) , 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 4a synthesis

[0396] [ka] 1,6-Heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphorazine To a solution of 19 mL (108 mmol) of methyl methyl ketone in 100 mL of tetrahydrofuran, 2.5 M n-butyllithium in n-hexane (21.7 mL, 54.3 mm ol) was added dropwise. Upon completion of the addition, the solution was stirred at -78°C for 1 hour, then The resulting solution was cooled again to -78°C, at which point it was cooled to -20°C for an additional hour. 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 2 A solution of 7.1 mmol) in tetrahydrofuran (10 mL) was added. The mixture was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0° C. and water (100 mL) was added. The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran, followed by The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by column chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography on a silica gel gave 2-(dodeca-6,11-diyn-1- (Iyloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil I got it. 1H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 6 Synthesis of a

[0397] [ka] 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4 a (4.1 g, 15.64 mmol) and hexamethylphosphoramide (11 mL, 6 A solution of [n-hexane (2.6 mmol)] in tetrahydrofuran (100 mL) was added at -78 °C. Add 2.5 M n-butyllithium in water (12.5 mL, 31.3 mmol) dropwise. Once the addition was complete, the solution was stirred at -78 °C for 1 h and then at -20 °C for an additional 1 h. The resulting solution was cooled again to -78°C, at which point 1-iodohexa A solution of amine 5a (9.5 mL, 62.6 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0°C. The reaction mixture was then concentrated in vacuo to give tetrahydrofuran. The furan was removed and then diluted with n-hexane. The organics were washed with water and brine (2x The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated under vacuum. Concentration gave a crude oil, which was purified by elution with 5% ethanol in n-hexane. Purification by chromatography on silica using ethyl acetate gave 2-(octadeca-6 ,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57 %) was obtained as a clear oil. 1HNMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H) , 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1. 66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetradecanoate Synthesis of hydro-2H-pyran 7a

[0398] [ka] Sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL) To the solution, add nickel(II) acetate tetrahydrate (1.55 g, 6. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (1.8 mL, 26.8 mmol), and 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyridinyl To the resulting mixture was added a solution of 6a (3.1 g, 8.93 mmol) in ethanol (10 mL). The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then The crude mixture was filtered over Celite and the filtrate was concentrated in vacuo to give The crude oil was extracted with n-hexane for 5 to 10 minutes as an eluent. Purification by chromatography on silica using 100% diethyl ether gave 2-( ((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetrahydro -2H-pyran, 7a (2.86 g, 92% yield) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H) , 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1. 83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dien-1-ol 8a

[0399] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H ), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0400] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06 -1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 Synthesis of (Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0401] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H) ), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) The general synthesis of the acid intermediate for AKG-BDG-1 is: i) 4-bromobutyric acid from 4- ii) Synthesis of 4-mercaptobutyric acid, ii) Reaction of 4-mercaptobutyric acid with DPS to give 4-(2-pyridyl) Preparation of cis-lysinyldisulfanylbutanoic acid, iii) from 3-decyn-1-ol - catalytic hydrogenation to alkenes, iv) tosylation of primary alcohols, v) using thiourea and finally vi) preparation of a terminal thiol by displacement of the tosyl group as described in step ii above. Coupling of terminal thiols with 4-(2-pyridinyldisulfanyl)butanoic acid prepared by Preparation of disulfides containing acid intermediates by polymerization. Following a similar synthetic sequence starting from The acid intermediate was obtained. Scheme 4 AKG-UO-1, AKG-UO-4, AKG-UO-5, AKG-BDG Synthesis of AKG-BDG-1 and AKG-BDG-2

[0402] [ka] Lipids AKG-UO-1, AKG-UO-4, AKG-UO-5, and A shown in Scheme 4 The general synthesis of KG-BDG-1 and AKG-BDG-2 involves the following steps: ) tosylation of the primary alcohol of commercially available chiral dioxolanes, ii) dimethyl Preparation of tertiary amines by displacement of the tosyl group using amines, iii) acid catalysis of diols deprotection, and finally iv) using the corresponding acid intermediates synthesized according to Schemes 1-3 As shown in Scheme 5 below, different dioxolanes and corresponding AKG-UO-2 is prepared following a similar synthetic sequence starting from the corresponding acid intermediate. Scheme 5. Synthesis of AKG-UO-2

[0403] [ka] The general synthesis of trialkyl phosphate containing lipid AKG-UO-3 shown in Scheme 6 is: The steps include: i) synthesizing the primary alcohol of a commercially available chiral dioxolane; Preparation of the corresponding dialkyl chlorophosphites by reaction with methyl dichlorophosphite, i i) Salts of dialkyl chlorophosphites by treatment with 3-bromopropanol iii) acid-catalyzed decomposition of diols to give the corresponding trialkyl phosphites; iv) esterification of the diol using the corresponding acid intermediate synthesized according to Scheme 1 and finally v) preparation of tertiary amines by substitution of the bromine group using dimethylamine. Made by. Scheme 6. Synthesis of AKG-UO-3

[0404] [ka] Alternatively, an acid intermediate having two methylene groups between the double bond positions in the hydrocarbon chain Caballeira et al.,Chem.Phys.Lipids,vo 100, pp. 33-40, 1999, or as described in D'yakon ov et al.(D'yakonov et al.,Med.Chem.Res. ,2016,vol.25,p.30-39;D'yakonov et al.,Ch em.Commun.2013,vol.49,p 8401-8403;D'yako nov et al., 2020, Phytochem. Rev. Synthesize as shown. (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-119 56) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11 955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-1240 1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-124 02) (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 'Z)-Bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0405] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0406] [ka] 5-Bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane ( 100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) To a solution of 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) at 0°C l) was added. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture The combined organics were washed with brine and then extracted with ethyl acetate (2 x 100 mL). It was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The oil was purified by silica gel chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography gave 2-((5-bromopentyl)oxy)tetrahydrofuran. rho-2H-pyran, 2 (4.5 g, 83%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H) , 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4 synthesis

[0407] [ka] 1,7-Octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphorazine To a solution of 16 mL (90.8 mmol) of methyl methyl ether in 100 mL of tetrahydrofuran, 2.5 M n-butyllithium in n-hexane (18 mL, 45.4 mmol) at 78 °C. l) was added dropwise. Upon completion of the addition, the solution was stirred at -78°C for 1 hour, then - The resulting solution was cooled again to -78°C, at which point 2 -((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 2 A solution of 2.7 mmol) in tetrahydrofuran (10 mL) was added. The mixture was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0° C. and water (100 mL) was added. The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran, followed by The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was extracted with 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography on silica gel was used to give 2-(trideca-6,12- Diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) clear Obtained as an oil. 1H NMR (300 MHz, d6.DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2 .16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7 Synthesis of

[0408] [ka] 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, A solution of [n- Add 2.5 M n-butyllithium in hexane (41.3 mL, 103.4 mmol) dropwise. Once the addition was complete, the solution was stirred at -78°C for 1 hour and then cooled to -20°C. The resulting solution was cooled again to -78°C, at which point 1-iodo Dissolve propane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL). The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was The reaction mixture was then cooled to °C and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to give the The tetrahydrofuran was removed and then diluted with n-hexane. The organics were washed with water and brine. The organic layer was dried over magnesium sulfate, filtered, and the filtrate was purified. Concentration under reduced pressure gave a crude oil weighing 9 g. The crude oil was purified by elution with n-hexane. Purification by chromatography on silica using 5% ethyl acetate in water gave 2- (Hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7( 5.9 g, 72%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H) , 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1. 55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0409] [ka] 1H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H) , 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1. 53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2 Ni 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetramethyl Synthesis of hydro-2H-pyran 9

[0410] [ka] Sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) To the solution, nickel(II) acetate tetrahydrate (3.22 g, 12 Upon completion of the addition, the reaction was evacuated under vacuum and refrigerated with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyridinyl A solution of run 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then The crude mixture was filtered over Celite and the filtrate was concentrated in vacuo to give The crude oil was extracted with n-hexane for 5 to 10 minutes as an eluent. Purification by chromatography on silica using 100% diethyl ether gave 2-( ((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro -2H-pyran, 9 (4.67 g, 78% yield) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H ), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1 .57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 H z, 3H). 13C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62 .43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98 , 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetradecanoate Hydro-2H-pyran 10

[0411] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H ), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1 .56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 H z, 3H). 13C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26. 01, 25.59, 22.67, 19.78, 14.18. Representative procedure for the deprotection of tetrahydropyranyl ethers (THP) Synthesis of (6Z,12Z)-hexadeca-6,12-dien-1-ol 11

[0412] [ka] 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetradecanoate Dissolve 1H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL ) at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was diluted with acetic acid The combined organics were washed with water and then extracted with magnesium sulfate. The mixture was dried over ice, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The oil was separated on silica using 5-10% diethyl ether in n-hexane as the eluent. The compound was purified by chromatography on HCl to give (6Z,12Z)-hexadeca-6,12-diol. The en-1-ol, 11 (2.5 g, 72%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H ), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0413] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H ), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0414] [ka] (6Z,12Z)-Hexadeca-6,12-dien-1-ol, 11 (2.5 g, 1 0.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0° C. for 2 hours. The mixture was quenched with water. Extraction was performed with ethyl acetate (2 x 100 mL). The combined organics were dried over magnesium sulfate. The crude oil was extracted with 100 ml of ethyl acetate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Purification by chromatography on silica using 20% ​​ethyl acetate in n-hexane (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) was obtained as a clear oil. 1H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H ), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0415] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H ), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Synthesis of benzenesulfonate 16

[0416] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol A mixture of alcohol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added at 0 °C. -toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (1 40 mg, 1.14 mmol) was added and the reaction was stirred at room temperature overnight. The organic layer was diluted with 12 (500 mL) and washed with saturated NH4Cl, water, and brine. The solvent was evaporated and the crude residue was carried to the next step without purification. Used (43.8g, 85%). 1H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2 H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Synthesis of lethan-1-amine 19

[0417] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Dimethylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 1 A mixture of 7 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated and the crude residue was diluted with CH2Cl2 (500 mL) and saturated NaH The organic layer was dried over anhydrous Na2SO4. The solvent was evaporated. The crude residue was purified by flash chromatography (SiO2: CH2Cl2 = 1% N Purification with MeOH 100% to 10% in CH2Cl2 containing H4OH gave a colorless oil The product 19 was obtained (2.1 g, 37%). 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H ), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H) ). MS (APCI+): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Lutethan-1-amine 20

[0418] [ka] 1H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H ), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI+): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0419] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Mixture of ethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) To the mixture was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated to 80°C. Heated for 45 minutes. TLC (Rf=0.1, 10% in CH2Cl2 with 1% NH4OH) MeOH) indicated the reaction was complete. After concentrating the reaction mixture, the crude residue was The product was dissolved in water (5 mL) and lyophilized overnight. A viscous syrup-like product 21 (2.1 g, constant (quantitative) was obtained as the HCl salt. 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m , 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI+): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0420] [ka] 1H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m , 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI+): 162.1 (M+1) Representative Procedure for Diesterification (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate) AKG-UO-1(O-1195 Synthesis of 6)

[0421] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added to (6Z,12Z)-octanol at 0°C. Tadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / Add dropwise to a solution in DMF (15 mL, 25 mL) and allow the reaction to warm to room temperature and stir for 1 hour. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was dissolved in dichloromethane (10 mL). Redissolve and add N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4- Dimethylaminopyridine (317 mg, 2.6 mmol) and (S)-4-(dimethylaminopyridine) Mixture of (amino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol) The resulting solution was stirred for 24 hours. After 24 hours, the reaction was cooled to 0°C and water was added. The reaction mixture was quenched with dichloromethane (2 x 100 mL). The organic layer was washed with water and brine (2 x 100 mL). The crude oil was dried at 40°C, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Chromatography on silica using 2% methanol in dichloromethane as the solvent This was further purified to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z ,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO- 1 (0.12 g, 30%) was obtained as a yellow oil. 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H) ), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI+): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate)AKG-UO-1A(O-119 55)

[0422] [ka] 1H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12 .1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1 .19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI+): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(hexadeca-6,12-dienoate)AKG-UO-4(O-1240 1)

[0423] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H) ), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91-0.86 (m, 6H). MS (APCI+): 602.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(hexadeca-6,12-dienoate)AKG-UO-4A(O-124 Synthesis of 02)

[0424] [ka] 1H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.12-5.11 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.54-2.43 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H), 2.11-1.96 (m, 16H), 1.74-1.65 (m, 2H), 1.65-1.59 (m, 4H), 1.39-1. 31 (m, 16H), 0.99 (t, J = 7.1 Hz, 6H), 0.91-0.89 (m, 6H). MS (APCI+): 630.5 (M+1) and finally v) using dimethylamine Preparation of tertiary amines by displacement of the bromide group. Scheme 7. Synthesis of AKG-UO-3

[0425] [ka] Alternatively, an acid intermediate having two methylene groups between the double bond positions in the hydrocarbon chain Caballeira et al.,Chem.Phys.Lipids,vo 100, pp. 33-40, 1999, or as described in D'yakon ov et al.(D'yakonov et al.,Med.Chem.Res. ,2016,vol.25,p.30-39;D'yakonov et al.,Ch em.Commun.2013,vol.49,p 8401-8403;D'yako nov et al., 2020, Phytochem. Rev. Synthesize as shown.

[0426] [Example 1B] Synthesis of ionizable lipids (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1, O-119 56) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(octadeca-6,12-dienoate) (AKG-UO-1A, O-11 955) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4, O-1240 1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-bis(hexadeca-6,12-dienoate, AKG-UO-4A, O-124 02) (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 'Z)-Bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0427] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0428] [ka] 5-Bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane ( 100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) To a solution of 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) at 0°C l) was added. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture The combined organics were washed with brine and then extracted with ethyl acetate (2 x 100 mL). It was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The oil was purified by silica gel chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography gave 2-((5-bromopentyl)oxy)tetrahydrofuran. rho-2H-pyran, 2 (4.5 g, 83%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H) , 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 4 synthesis

[0429] [ka] 1,7-Octadiyne 3 (6 mL, 45.4 mmol) and hexamethylphosphorazine To a solution of 16 mL (90.8 mmol) of methyl methyl ether in 100 mL of tetrahydrofuran, 2.5 M n-butyllithium in n-hexane (18 mL, 45.4 mmol) at 78 °C. l) was added dropwise. Upon completion of the addition, the solution was stirred at -78°C for 1 hour, then - The resulting solution was cooled again to -78°C, at which point 2 -((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (5.67 g, 2 A solution of 2.7 mmol) in tetrahydrofuran (10 mL) was added. The mixture was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0° C. and water (100 mL) was added. The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran, followed by The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was extracted with 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography on silica gel was used to give 2-(trideca-6,12- Diyn-1-yloxy)tetrahydro-2H-pyran, 4 (4.5 g, 72%) clear Obtained as an oil. 1 H NMR (300 MHz, d 6. DMSO): δ ppm 4.544.53 (m, 1H), 3.72-3.61 (m, 1H), 3.60-3.58 (m, 1H), 3.43-3.33 (m, 1H), 3.32-3.29 (m, 1H), 2.77-2.75 (t, J = 5.8 Hz, 1H), 2 .16-2.13 (m, 6H), 1.55-1.41 (m, 16H). Representative Procedure for Alkylation of Alkynes 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 7 Synthesis of

[0430] [ka] 2-(trideca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 4 (7.14 g, 25.86 mmol) and hexamethylphosphoramide (18 mL, A solution of [n- Add 2.5 M n-butyllithium in hexane (41.3 mL, 103.4 mmol) dropwise. Once the addition was complete, the solution was stirred at -78°C for 1 hour and then cooled to -20°C. The resulting solution was cooled again to -78°C, at which point 1-iodo Dissolve propane 5 (9.9 mL, 103.4 mmol) in tetrahydrofuran (20 mL). The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction mixture was The reaction mixture was then cooled to °C and quenched with water (100 mL). The reaction mixture was then concentrated in vacuo to give the The tetrahydrofuran was removed and then diluted with n-hexane. The organics were washed with water and brine. The organic layer was dried over magnesium sulfate, filtered, and the filtrate was purified. Concentration under reduced pressure gave a crude oil weighing 9 g. The crude oil was purified by elution with n-hexane. Purification by chromatography on silica using 5% ethyl acetate in water gave 2- (Hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran, 7( 5.9 g, 72%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.86-3.74 (m, 1H), 3.73-3.71 (m, 1H) , 3.50-3.39 (m, 1H), 3.37-3.36 (m, 1H), 2.16-2.11 (m, 8H), 1.59-1.56 (m, 2H), 1. 55-1.47 (m, 16H), 0.98-0.93 (t, J = 1.6 Hz, 3H). 2-(octadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyran 8

[0431] [ka] 1 H NMR (300 MHz, CDCl3): 4.57-4.55 (m, 1H), 3.85-3.74 (m, 1H), 3.73-3.70 (m, 1H) , 3.50-3.38 (m, 1H), 3.36-3.35 (m, 1H), 2.23-2.12 (m, 8H), 1.61-1.54 (m, 2H), 1. 53-1.48 (m, 16H), 1.47-1.46 (m, 4H), 0.90-0.85 (t, J = 1.6 Hz, 3H). Representative Procedure for the Reduction of Alkynes to Alkenes Using P-2 Ni 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetramethyl Synthesis of hydro-2H-pyran 9

[0432] [ka] Sodium borohydride (0.56 g, 14.8 mmol) in ethanol (80 mL) To the solution, nickel(II) acetate tetrahydrate (3.22 g, 12 Upon completion of the addition, the reaction was evacuated under vacuum and refrigerated with hydrogen. After stirring for 10 minutes, ethylenediamine (3.7 mL, 65.6 mmol) and 2-(hexadeca-6,12-diyn-1-yloxy)tetrahydro-2H-pyridinyl A solution of run 7 (5.9 g, 18.55 mmol) in ethanol (10 mL) was added. The reaction was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then The crude mixture was filtered over Celite and the filtrate was concentrated in vacuo to give The crude oil was extracted with n-hexane for 5 to 10 minutes as an eluent. Purification by chromatography on silica using 100% diethyl ether gave 2-( ((6Z,12Z)-Hexadeca-6,12-dien-1-yl)oxy)tetrahydro -2H-pyran, 9 (4.67 g, 78% yield) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.74 (m, 1H ), 3.73-3.71 (m, 1H), 3.51-3.39 (m, 1H), 3.36-3.35 (m, 1H), 2.03-1.98 (m, 8H), 1 .57-1.39 (m, 2H), 1.38-1.36 (m, 6H), 1.35-1.32 (m, 10H), 0.91-0.86 (t, J = 1.6 H z, 3H). 13 C NMR (300 MHz, CDCl3): 129.98, 129.85, 98.93, 77.53, 77.10, 76.68, 67.72, 62 .43, 30.86, 29.71, 29.70, 29.45, 29.46, 29.44, 27.20, 27.19, 26.01, 25.59, 22.98 , 19.78, 13.91. 2-(((6Z,12Z)-octadeca-6,12-dien-1-yl)oxy)tetradecanoate Hydro-2H-pyran 10

[0433] [ka] 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.76 (m, 1H) ), 3.74-3.68 (m, 1H), 3.51-3.41 (m, 1H), 3.39-3.36 (m, 1H), 2.14-1.97 (m, 8H), 1 .56-1.38 (m, 2H), 1.37-1.35 (m, 6H), 1.34-1.28 (m, 14H), 0.93-0.85 (t, J = 1.6 H z, 3H). 13 C NMR (300 MHz, CDCl3): 130.13, 129.97, 129.84, 129.71, 98.93, 77.53, 77.10, 76.68, 67.71, 62.42, 31.62, 30.86, 29.72, 29.71, 29.47, 29.46, 27.27, 27.18, 26. 01, 25.59, 22.67, 19.78, 14.18. Representative procedure for the deprotection of tetrahydropyranyl ethers (THP) Synthesis of (6Z,12Z)-hexadeca-6,12-dien-1-ol 11

[0434] [ka] 2-(((6Z,12Z)-hexadeca-6,12-dien-1-yl)oxy)tetradecanoate Dissolve 1H-pyran, 9 (4.67 g, 14.5 mmol) in methanol (20 mL ) at room temperature. The resulting solution was stirred at room temperature for 3 hours and then quenched with water. The mixture was diluted with acetic acid The combined organics were washed with water and then extracted with magnesium sulfate. The mixture was dried over ice, filtered, and the filtrate was concentrated in vacuo to give a crude oil weighing 4 g. The oil was separated on silica using 5-10% diethyl ether in n-hexane as the eluent. The compound was purified by chromatography on HCl to give (6Z,12Z)-hexadeca-6,12-diol. The en-1-ol, 11 (2.5 g, 72%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.34-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.00 (m, 8H ), 1.36-1.34 (m, 2H), 1.34-1.25 (m, 10H), 0.89-0.86 (t, J = 0.82 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dien-1-ol 12

[0435] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.65-3.61 (m, 2H), 2.02-2.01 (m, 8H ), 1.36-1.35 (m, 2H), 1.34-1.25 (m, 14H), 0.88-0.85 (t, J = 0.76 Hz, 3H). Representative Procedure for Oxidation of Alcohols to Carboxylic Acids Using Jones Reagent Synthesis of (6Z,12Z)-hexadeca-6,12-dienoic acid 13

[0436] [ka] (6Z,12Z)-Hexadeca-6,12-dien-1-ol, 11 (2.5 g, 1 0.5 mmol) and Jones reagent [2 M in sulfuric acid] (10.5 mL, 21 mmol) in acetone (20 mL) was stirred at 0° C. for 2 hours. The mixture was quenched with water. Extraction was performed with ethyl acetate (2 x 100 mL). The combined organics were dried over magnesium sulfate. The crude oil was extracted with 100 ml of ethyl acetate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Purification by chromatography on silica using 20% ​​ethyl acetate in n-hexane (6Z,12Z)-hexadeca-6,12-dienoic acid, 13 (1.7 g, 68%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.33 (m, 4H), 2.37-2.32 (t, 2H), 2.06-1.98 (m, 8H ), 1.64-1.39 (m, 2H), 1.37-1.32 (m, 8H), 0.91-0.87 (t, J = 0.91 Hz, 3H). (6Z,12Z)-Octadeca-6,12-dienoic acid 14

[0437] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 4H), 2.35-2.33 (t, 2H), 2.06-2.01 (m, 8H ), 1.64-1.42 (m, 2H), 1.34-1.28 (m, 12H), 0.90-0.85 (t, 3H). (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Synthesis of benzenesulfonate 16

[0438] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethan-1-ol A mixture of alcohol 15 (25 g, 171.1 mmol) in pyridine (30 mL) was added at 0 °C. -toluenesulfonyl chloride (35.8 g, 188.2 mmol) and DMAP (1 40 mg, 1.14 mmol) was added and the reaction was stirred at room temperature overnight. The organic layer was diluted with 12 (500 mL) and washed with saturated NH4Cl, water, and brine. The solvent was evaporated and the crude residue was carried to the next step without purification. Used (43.8g, 85%). 1 H NMR (300 MHz, CDCl3): δ ppm 7.77 (d, J = 8.2 Hz, 2H), 7.34 (d, J = 8.1 Hz, 2 H), 4.15-4.01 (m, 3H), 3.65-3.47 (m, 2H), 2.43 (s, 3H), 1.82-1.62 (m, 2H), 1.32 (s, 3H), 1.27 (s, 3H). Representative Procedure for Dialkylamine Substitution (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Synthesis of lethan-1-amine 19

[0439] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)ethyl 4-methyl Dimethylbenzenesulfonate 16 (10 g, 33.3 mmol) and dimethylamine solution 1 A mixture of 7 (166 mL, 333.3 mmol) (2 M in THF) was stirred at room temperature for 2 days. The mixture was concentrated and the crude residue was diluted with CH2Cl2 (500 mL) and saturated NaH The organic layer was dried over anhydrous Na2SO4. The solvent was evaporated. The crude residue was purified by flash chromatography (SiO2: CH2Cl2 = 1% N Purification with MeOH 100% to 10% in CH2Cl2 containing H4OH gave a colorless oil The product 19 was obtained (2.1 g, 37%). 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.52 (dd, J = 7.4, 7.4 Hz, 1H ), 2.41-2.23 (m, 2H), 2.21 (s, 6H), 1.82-1.62 (m, 2H), 1.39 (s, 3H), 1.33 (s, 3H) ). MS (APCI + ): 174.1 (M+1) (S)-2-(2,2-diethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Lutethan-1-amine 20

[0440] [ka] 1 H NMR (300 MHz, CDCl3): δ ppm 4.15-4.01 (m, 2H), 3.48 (dd, J = 7.4, 7.4 Hz, 1H ), 2.48-2.43 (m, 6H), 1.82-1.62 (m, 2H), 1.36 (s, 3H), 1.27 (s, 3H), 0.97 (t, J = 7.2 Hz, 6H). MS (APCI + ): 202.2 (M+1) Representative Procedure for Ketal Hydrolysis Synthesis of (S)-4-(dimethylamino)butane-1,2-diol hydrochloride 21

[0441] [ka] (S)-2-(2,2-dimethyl-1,3-dioxolan-4-yl)-N,N-dimethyl Mixture of ethylethan-1-amine 19 (2 g, 11.54 mmol) in MeOH (10 mL) To the mixture was added 1N aqueous HCl (17 mL, 17.3 mmol), and the reaction was heated to 80°C. Heated for 45 minutes. TLC (Rf=0.1, 10% in CH2Cl2 with 1% NH4OH) MeOH) indicated the reaction was complete. After concentrating the reaction mixture, the crude residue was The product was dissolved in water (5 mL) and lyophilized overnight. A viscous syrup-like product 21 (2.1 g, constant (quantitative) was obtained as the HCl salt. 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.29-3.22 (m , 2H), 2.85 (s, 6H), 1.92-1.79 (m, 2H). MS (APCI + ): 134.1 (M+1) (S)-4-(Diethylamino)butane-1,2-diol hydrochloride 22

[0442] [ka] 1 H NMR (300 MHz, D2O): δ ppm 3.77-3.72 (m, 1H), 3.54-3.46 (m, 2H), 3.22-3.15 (m , 6H), 1.92-1.74 (m, 2H), 1.24 (t, J = 7.4 Hz, 6H). MS (APCI + ): 162.1 (M+1) Representative Procedure for Diesterification (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate) AKG-UO-1(O-1195 Synthesis of 6)

[0443] [ka] Oxalyl chloride (0.33 mL, 3.9 mmol) was added to (6Z,12Z)-octanol at 0°C. Tadeca-6,12-dienoic acid, 14 (0.36 g, 1.3 mmol) in dichloromethane / To the solution in DMF (15 mL, 25 μL) was added dropwise and the reaction was allowed to warm to room temperature and stirred for 1 h. After 1 h, the reaction was concentrated to dryness in vacuo. The residue was dissolved in dichloromethane (10 mL). Redissolve and add N,N-diisopropylethylamine (2.3 mL, 10 mmol), 4- Dimethylaminopyridine (317 mg, 2.6 mmol) and (S)-4-(dimethylaminopyridine) Mixture of (amino)butane-1,2-diol hydrochloride, 21 (101 mg, 0.6 mmol) The resulting solution was stirred for 24 hours. After 24 hours, the reaction was cooled to 0°C and water was added. The reaction mixture was quenched with dichloromethane (2 x 100 mL). The organic layer was washed with water and brine (2 x 100 mL). The crude oil was dried at 40°C, filtered, and the filtrate was concentrated in vacuo to give a crude oil. Chromatography on silica using 2% methanol in dichloromethane as the solvent This was further purified to give (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z ,12Z,12'Z)-bis(octadeca-6,12-dienoate), AKG-UO- 1 (0.12 g, 30%) was obtained as a yellow oil. 1 H NMR (300 MHz, CDCl3): 5.40-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 12.1, 6.3 Hz, 1H), 2.32-2.26 (m, 6H), 2.20 (s, 6H) ), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.65-1.58 (m, 4H), 1.42-1.25 (m, 24H), 0.90-0.85 (m, 6H). MS (APCI + ): 658.5 (M+1) (S)-4-(diethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(octadeca-6,12-dienoate)AKG-UO-1A(O-119 55)

[0444] [ka] 1 H NMR (300 MHz, CDCl3): 5.37-5.29 (m, 8H), 5.12-5.10 (m, 1H), 4.25 (dd, J = 12 .1, 3.6 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.52-2.42 (m, 6H), 2.29 (t, J = 7.4 Hz, 4H)), 2.06-1.99 (m, 16H), 1.78-1.70 (m, 2H), 1.64-1.59 (m, 4H), 1.41-1 .19 (m, 24H), 0.99 (t, J = 7.1 Hz, 6H), 0.96-0.87 (m, 6H). MS (APCI + ): 686.6 (M+1) (S)-4-(dimethylamino)butane-1,2-diyl(6Z,6'Z,12Z,12 'Z)-Bis(hexadeca-6,12-dienoate)AKG-UO-4(O-1240 1)

[0445] [ka] 1H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.13-5.12 (m, 1H), 4.24 (dd, J = 11 .8, 3.3 Hz, 1H), 4.05 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.27 (m, 6H), 2.19 (s, 6H ), 2.01-1.99 (m, 16H), 1.75-1.72 (m, 2H), 1.65-1.58 (m, 4H), 1.36-1.31 (m, 16H), 0.91–0.86 (m, 6H). MS (APCI + ): 602.5 (M+1) (S)-4-(ジエチルアミノ)ブタン-1,2-ジイル(6Z,6'Z,12Z,12 'Z)-ビス(ヘキサデカ-6,12-ジエノエート)AKG-UO-4A(O-124 02) Synthesis

[0446]

change

[0447] [ka] Experimental procedure Synthesis of 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran 2

[0448] [ka] 5-Bromo-1-pentanol 1 (3.6 g, 21.6 mmol) in dichloromethane ( 100 mL) and pyridinium p-toluenesulfonate (40 mg, 0.16 mmol) To a solution of 3,4-dihydro-2H-pyran (6.54 mL, 71.8 mmol) at 0°C l) was added. The resulting solution was stirred at room temperature for 1 hour and then quenched with water. The mixture The combined organics were washed with brine and then extracted with ethyl acetate (2 x 100 mL). It was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The oil was purified by silica gel chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography gave 2-((5-bromopentyl)oxy)tetrahydrofuran. rho-2H-pyran, 2 (4.5 g, 83%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): δ ppm 4.55-4.54 (d, J = 4.3 Hz, 1H), 3.92-3.72 (m, 2H) , 3.42-3.38 (m, 3H), 1.88-1.55 (m, 3H), 1.52-1.50 (m, 10H). 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 4a synthesis

[0449] [ka] 1,6-Heptadiyne 3a (5 g, 54.3 mmol) and hexamethylphosphorazine To a solution of 19 mL (108 mmol) of methyl methyl ketone in 100 mL of tetrahydrofuran, 2.5 M n-butyllithium in n-hexane (21.7 mL, 54.3 mm ol) was added dropwise. Upon completion of the addition, the solution was stirred at -78°C for 1 hour, then The resulting solution was cooled again to -78°C, at which point it was cooled to -20°C for an additional hour. 2-((5-bromopentyl)oxy)tetrahydro-2H-pyran, 2 (6.8 g, 2 A solution of 7.1 mmol) in tetrahydrofuran (10 mL) was added. The mixture was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0° C. and water (100 mL) was added. The reaction mixture was then concentrated in vacuo to remove tetrahydrofuran, followed by The organics were washed with water and brine (2 x 100 mL). The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated in vacuo to give a crude oil. The crude oil was purified by column chromatography using 5-10% ethyl acetate in n-hexane as the eluent. Purification by chromatography on a silica gel gave 2-(dodeca-6,11-diyn-1- (Iyloxy)tetrahydro-2H-pyran, 4a (4.1 g, 58%) as a clear oil I got it. 1 H NMR (300 MHz, CDCl3): δ ppm 4.57-4.56 (m, 1H), 3.96-3.82 (m, 1H), 3.77-3.69 (m, 1H), 3.50-3.41 (m, 1H), 3.39-3.34 (m, 1H), 2.29-2.25 (m, 4H), 2.15-2.12 (m, 2H), 1.95-1.94 (t, J = 5.8 Hz, 1H), 1.73-1.43 (m, 14H). 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran 6 Synthesis of a

[0450] [ka] 2-(dodeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyran, 4 a (4.1 g, 15.64 mmol) and hexamethylphosphoramide (11 mL, 6 A solution of [n-hexane (2.6 mmol)] in tetrahydrofuran (100 mL) was added at -78 °C. Add 2.5 M n-butyllithium in water (12.5 mL, 31.3 mmol) dropwise. Once the addition was complete, the solution was stirred at -78 °C for 1 h and then at -20 °C for an additional 1 h. The resulting solution was cooled again to -78°C, at which point 1-iodohexa A solution of amine 5a (9.5 mL, 62.6 mmol) in tetrahydrofuran (20 mL) was added. The resulting solution was warmed to room temperature and stirred for 12 hours. After 12 hours, the reaction was cooled to 0°C. The reaction mixture was then concentrated in vacuo to give tetrahydrofuran. The furan was removed and then diluted with n-hexane. The organics were washed with water and brine (2x The organic layer was dried over magnesium sulfate, filtered, and the filtrate was concentrated under vacuum. Concentration gave a crude oil, which was purified by elution with 5% ethanol in n-hexane. Purification by chromatography on silica using ethyl acetate gave 2-(octadeca-6 ,11-diyn-1-yloxy)tetrahydro-2H-pyran, 6a (3.1 g, 57 %) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H), 3.77-3.69 (m, 1H) , 3.51-3.47 (m, 1H), 3.41-3.34 (m, 1H), 2.26-2.21 (m, 6H), 2.14-2.12 (m, 6H), 1. 66-1.26 (m, 18H), 0.93-0.85 (t, J = 6.5 Hz, 3H). 2-(((6Z,11Z)-octadeca-6,11-dien-1-yl)oxy)tetradecanoate Synthesis of hydro-2H-pyran 7a

[0451] [ka] Sodium borohydride (0.27 g, 14.8 mmol) in ethanol (50 mL) To the solution, add nickel(II) acetate tetrahydrate (1.55 g, 6. Upon completion of the addition, the reaction was evacuated under vacuum and flushed with hydrogen. After stirring for 10 minutes, ethylenediamine (1.8 mL, 26.8 mmol) and and 2-(octadeca-6,11-diyn-1-yloxy)tetrahydro-2H-pyra A solution of 6a (3.1 g, 8.93 mmol) in ethanol (10 mL) was added to the reaction mixture. The reaction mixture was stirred under a hydrogen balloon at room temperature for 4 hours. After 4 hours, the reaction mixture was evacuated with hydrogen and then Flush with nitrogen. Filter the crude mixture over Celite and concentrate the filtrate in vacuo to give A crude oil weighing 4 g was obtained. The crude oil was purified by elution with 5-10% n-hexane. Purification by chromatography on silica using diethyl ether gave 2-(( (6Z,11Z)-Octadeca-6,11-dien-1-yl)oxy)tetrahydro- 2H-pyran, 7a (2.86 g, 92% yield) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.4-5.34 (m, 4H), 4.58-4.55 (m, 1H), 3.86-3.82 (m, 1H) , 3.74-3.68 (m, 1H), 3.51-3.49 (m, 1H), 3.41-3.36 (m, 1H), 2.06-1.99 (m, 6H), 1. 83-1.67 (m, 2H), 1.59-1.51 (m, 6H),1.48-1.32 (m, 16H), 0.92-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dien-1-ol 8a

[0452] [ka] The procedure is described above. 1 H NMR (300 MHz, CDCl3): 5.37-5.33 (m, 4H), 3.65-3.61 (m, 1H), 2.06-1.99 (m, 6H ), 1.56-1.41 (m, 4H), 1.38-1.27 (m, 14H), 0.88-0.85 (t, J = 6.6 Hz, 3H). Synthesis of (6Z,11Z)-octadeca-6,11-dienoic acid 9a

[0453] [ka] The procedure is described above. 1H NMR (300 MHz, CDCl3): 5.38-5.33 (m, 4H), 2.37-2.33 (t, J = 5.6 Hz, 2H), 2.06 -1.99 (m, 6H), 1.67-1.59 (m, 2H), 1.41-1.25 (m, 14H), 0.89-0.85 (t, J = 6.6 Hz, 3H). (S)-4-(dimethylamino)butane-1,2-diyl (6Z,6'Z,11Z,11 Synthesis of (Z)-bis(octadeca-6,11-dienoate) (AKG-UO-1a)

[0454] [ka] The procedure is described above. 1 H NMR (300 MHz, CDCl3): 5.39-5.29 (m, 8H), 5.14-5.12 (m, 1H), 4.25 (dd, J = 11 .8, 3.3 Hz, 1H), 4.06 (dd, J = 11.8, 6.3 Hz, 1H), 2.32-2.28 (m, 6H), 2.20 (s, 6H) ), 2.03-2.01 (m, 16H), 1.74-1.64 (m, 2H), 1.62-1.60 (m, 6H), 1.38-1.27 (m, 22H), 0.89-0.85 (m, 6H). MS (APCI + ): 658.5 (M+1)

[0455] [Example 1C] Synthesis of KC-01 series ionizable lipids 2-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl) (Aminoethyl)-1,3-dioxolan-4-yl-N,N-dimethylethan-1-amine (AK Synthesis of G-KC2-01, O-12095 3-((S)-2,2-di((6Z,12Z)-octadeca-6,12-dien-1-yl) (I)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine (A KG-KC3-01, O-12096)

[0456] [ka] Synthesis of (6Z,12Z)-1-bromooctadeca-6,12-diene, 2

[0457] [ka] (6Z,12Z)-Octadeca-6,12-dien-1-ol, 1 (3.6 g, 13 To a solution of 1.0 ... amide (1.26 mL, 16.4 mmol) and triethylamine (3.6 mL, 20.5 mmol). The resulting solution was warmed to room temperature and stirred for 2 hours. The mixture was quenched with water. The combined organics were washed with brine and extracted with dichloromethane (2 x 100 mL). The filtrate was concentrated in vacuo to give a crude product. The obtained oil was dissolved in diethyl ether (50 mL) and heated at 0°C with Magnesium chloride ethyl etherate (7 g, 27.4 mmol) in diethyl ether (5 The reaction mixture was added to a stirred slurry in 0 mL of HCl. The mixture was allowed to warm to room temperature and stirred for 2 hours. The mixture was quenched with water and extracted with ethyl acetate (2 x 100 mL). The mixture was washed with ethyl acetate, then dried over magnesium sulfate, and filtered. The filtrate was concentrated in vacuo. The crude oil was purified by elution with 5-10% acetic acid in n-hexane. Purification by chromatography on silica using ethyl acetate gave (6Z,12Z)- 1-Bromooctadeca-6,12-diene, 3 (2.9 g, 8.89 mmol, 65%) was obtained as a yellow oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.33 (m, 4H), 3.42-3.37 (t, J = 7.5 Hz, 2H), 2.04 -1.97 (m, 8H), 1.83-1.83 (m, 2H), 1.37-1.28 (m, 14H), 0.90-0.86 (t, J = 6.6 Hz, 3H). (6Z,12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tet Synthesis of raen-19-ol, 3

[0458] [ka] (6Z,12Z)-1-bromooctadeca-6,12-diene, 2 (2 g, 6.08 m A solution of 16 mol of magnesium stearate in ether (10 mL) was added to magnesium turnings (16 mol) at room temperature under argon. 2 mg, 6.69 mmol) and iodine in ether (2 mL). The material was stirred at room temperature for 90 minutes (the magnesium turnings were consumed), at which point the ethyl formate was added. (0.24 mL, 3.04 mmol) was added. After stirring at room temperature for 1 hour, the reaction was diluted with 1N The mixture was quenched with HCl solution. The mixture was extracted with ethyl acetate (2×100 mL) and the combined The organics were washed with water and then brine. The organics were dried under magnesium sulfate and filtered. The filtrate was concentrated in vacuo to give a crude oil. The resulting oil was diluted with ethanol (10 ml). The mixture was dissolved in 1 mL of water and added to a solution of potassium hydroxide (260 mg) in water (3 mL). After stirring, the pH of the mixture was adjusted to 4 with 2N HCl. The aqueous solution was dissolved in dichloromethane ( The organics were washed with brine and then dried under magnesium sulfate. The filtrate was concentrated in vacuo to give a crude oil. Purification on silica using 10-30% ethyl acetate in n-hexane gave (6Z, 12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tetraene- The 19-ol, 3 (0.29 g, 0.55 mmol, 18%) was obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.57 (bs, 1H), 3.33-3.32, (m, 2H), 2.13-1.97 (m, 16H), 1.36-1.29 (m, 34H), 0.90-0.86 (t, J = 6.6 Hz, 6H). (6Z,12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tet Synthesis of raen-19-one, 4

[0459] [ka] (6Z,12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tetra A mixture of 3 (0.29 g, 0.55 mmol) and sodium carbonate ( 3 mg, 0.03 mmol) in dichloromethane at 0°C. bromate (236 mg, 1.1 mmol) was added. The mixture was allowed to warm to room temperature and stirred for 1 hour. After 1 hour, silica gel (1 g) was added to the reaction mixture and the mixture was filtered. The filtrate was concentrated. The resulting oil was purified by silica gel chromatography using 10-20% ethyl acetate in n-hexane as the eluent. The compound was purified on a silica gel column to give (6Z,12Z,25Z,31Z)-heptatriaconta-6,12, 25,31-tetraen-19-one, 4 (0.12 g, 0.23 mmol, 42%) Obtained as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 3.36-3.32, (m, 1H), 2.40-2.35 (t, J = 6.6 Hz, 3H), 2.14-2.00 (m, 16H), 1.58-1.54 (m, 4H), 1.34-1.29 (m, 28H), 0.90- 0.86 (t, J = 6.6 Hz, 6H). 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl) Synthesis of (1,3-dioxolan-4-yl)ethan-1-ol, 7

[0460] [ka] (6Z,12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tetra Tolaen-19-one, 4 (0.12 g, 0.23 mmol), (4S)-(+)-4- (2-hydroxyethyl)-2,2-dimethyl-1,3-dioxolane 5 (0.20 g, 1.38 mmol) and pyridinium p-toluenesulfonate (9 mg) in toluene The mixture was heated to reflux under a positive pressure of nitrogen (10 mL). After 12 h, the mixture was concentrated under vacuum. The crude oil was concentrated to give a crude oil. The crude oil was diluted with 20 ml of n-hexane as an eluent. Purification by chromatography on silica using ∼40% ethyl acetate gave 2-( (S)-2,2-Di((9Z,12Z)-octadeca-9,12-dien-1-yl)- 1,3-Dioxolan-4-yl)ethan-1-ol, 7 (0.11 g, 0.17 mm ol, 77%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 8H), 4.25-4.20 (m, 1H), 4.10-4.06 (m, 1H ), 3.82-3.77 (m, 1H), 3.54-3.49 (m, 1H), 2.23-2.19 (t, J = 6.6 Hz, 3H), 2.14-2.0 0 (m, 16H), 1.84-1.78 (m, 2H), 1.62-1.51 (m, 6H), 1.34-1.29 (m, 28H), 0.90-0.86 (t, J = 6.6 Hz, 6H). 3-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl) Synthesis of (1,3-dioxolan-4-yl)propan-1-ol, 8

[0461] [ka] (6Z,12Z,25Z,31Z)-Heptatriaconta-6,12,25,31-tetra traen-19-one, 4 (0.50 g, 0.95 mmol), (S)-(3)-(2, 2-Dimethyl-1,3-dioxolan-4-yl)propanol 6 (0.76 g, 4.7 5 mmol) and pyridinium p-toluenesulfonate (36 mg) in toluene (1 The mixture was heated to reflux under a positive pressure of nitrogen. After 12 hours, the mixture was concentrated in vacuo. The crude oil was extracted with n-hexane for 20-40 min. Purification by chromatography on silica using 0% ethyl acetate gave 3-((S )-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl)-1, 3-Dioxolan-4-yl)propan-1-ol, 8 (0.48 g, 0.76 mmol) 1, 80%) as a clear oil. 1 H NMR (300 MHz, CDCl3): 5.34-5.29 (m, 8H), 4.06-4.02 (m, 2H), 3.67-3.47 (m, 2H ), 3.45-3.43 (m, 1H), 2.12-2.01 (m, 16H), 1.65-1.62 (m, 8H), 1.34-1.29 (m, 32H), 0.89-0.85 (t, J = 6.6 Hz, 6H). 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl) (Aminoethyl)-1,3-dioxolan-4-yl-N,N-dimethylethan-1-amine (AK Synthesis of G-KC2-01, O-12095

[0462] [ka] 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-diene-1- yl)-1,3-dioxolan-4-yl)ethan-1-ol, 7 (0.49 g, 0. To a solution of 79 mmol) in dichloromethane (10 mL) was added methanesulfonyl chloride at 0°C. amide (73 μL, 0.95 mmol) and triethylamine (0.26 mL, 1.2 mmol) ol) was added. The solution was warmed to room temperature and stirred for an additional hour. The reaction was quenched with water. The organics were washed with brine and then extracted with dichloromethane (2 x 100 mL). The mixture was dried over magnesium sulfate and filtered. The filtrate was concentrated in vacuo to give a crude oil. A solution of M dimethylamine (10 mL) was added to the resulting crude oil and stirred for 24 hours. The mixture was then quenched with water and extracted with dichloromethane (2 x 100 mL). The combined organics were washed with brine, then dried over magnesium sulfate, and then filtered. The solution was concentrated in vacuo to give a crude oil, which was purified by elution with n-hexane. Purification by chromatography on silica using 5-100% ethyl acetate in 2-((S)-2,2-di((9Z,12Z)-octadeca-9,12-dien-1-yl) (Aminoethyl)-1,3-dioxolan-4-yl-N,N-dimethylethan-1-amine (AK G-KC2-01, O-12095) (206 mg, 0.32 mmol, 41%) Obtained as an oil. 1 H NMR (300 MHz, CDCl3): 5.35-5.32 (m, 8H), 4.08-4.03 (m, 2H), 3.47 (t, J = 6.8 Hz, 1H), 2.36-2.27 (m, 2H), 2.21 (s, 6H), 2.01-1.99 (m, 16H), 1.88-1.77 (m, 2H) , 1.68-1.53 ​​(m, 6H), 1.42-1.19 (m, 34H), 0.96-0.86 (t, J = 3.7 Hz, 6H). C 43 H 79 MS(APCI) of NO2: 642.6 3-((S)-2,2-di((6Z,12Z)-octadeca-6-12-dien-4-yl) (yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine, A Synthesis of KG-KC3-01, O-12096

[0463] [ka] The procedure is described above. 3-((S)-2,2-di((6Z,12Z)-octadeca-6- 12-dien-4-yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropane Pan-1-amine (AKG-KC3-01, O-12096) (255 mg, 0.39 m mol, 51%). 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 8H), 4.06-4.02 (m, 2H), 3.48-3.44 (m, 1H ), 2.35-2.30 (m, 2H), 2.25 (s, 6H), 2.01-1.98 (m, 16H), 1.70-1.51 (m, 12H), 1.35 -1.25 (m, 32H), 0.90-0.85 (t, J = 6.6 Hz, 6H). C 44 H 81 MS(APCI) of NO2: 656.6 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol xolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, Synthesis of O-11880 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-diol Xolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, O-11879) 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol Xolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA , O-11957)

[0464] [ka] Experimental Procedure (see synthesis of AKG-KC2-01 above) Synthesis of (Z)-1-bromooctadec-9-ene 3

[0465] [ka] The procedure is described above. (Z)-1-Bromooctadec-9-ene (6.4 g, 19.33 mL) as a clear oil mmol). 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.41 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 22H), 0.87 (t, J = 6.6 Hz, 3H). (Z)-16-Bromohexadec-7-ene 4

[0466] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.32 (m, 2H), 3.42 (t, J = 7.5 Hz, 2H), 2.01-1.99 (m, 4H), 1.87-1.82 (m, 2H), 1.44-1.26 (m, 18H), 0.89 (t, J = 6.6 Hz, 3H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-ol 5

[0467] [ka] The procedure is described above. (9Z,28Z)-heptatriaconta-9,28-dien-19-ol as a solid le (1.2 g, 2.25 mmol, 47%). 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1 .42-1.26 (m, 53H), 0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-Tritriaconta-7,26-dien-17-ol 6

[0468] [ka] 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 3.57 (bs, 1H), 2.01-1.97 (m, 8H), 1 .42-1.26 (m, 45H), 0.89 (t, J = 6.6 Hz, 6H). Synthesis of (9Z,28Z)-heptatriaconta-9,28-dien-19-one 7

[0469] [ka] The procedure is described above. (9Z,28Z)-heptatriaconta-9,28-diene-19 as a clear oil -on (0.89 g, 1.67 mmol, 74%). 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 52 H), 0.90-0.89 (t, J = 6.6 Hz, 6H). (7Z,26Z)-tritriaconta-7,26-dien-17-one 8

[0470] [ka] 1H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 2.03-1.98 (m, 8H), 1.42-1.26 (m, 44 H), 0.90-0.89 (t, J = 6.6 Hz, 6H). 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol Synthesis of xolan-4-yl)ethan-1-ol 9

[0471] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-octadec-9-ene-1-yl)-2-methyl-2-oxo-1,2-dipropanol as a clear oil (1,3-dioxolan-4-yl)ethan-1-ol (0.39g, 0.63 mmol, 74%). 1 H NMR (300 MHz, CDCl3): 5.36-5.28 (m, 4H), 4.22-4.10 (m, 1H), 4.08-4.05 (m, 1H ), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.24-2.21 (m, 1H), 2.01-1.99 (m, 8H), 1.81-1.80 (m, 2H), 1.59-1.54 (m, 6H), 1.34-1.26 (m, 45H), 0.87 (t, J = 6.3 Hz, 6H). 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-diol Synthesis of (xolan-4-yl)ethan-1-ol, 10

[0472] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-ene-1-yl)-2-methyl-2-propanol as a clear oil (1,3-dioxolan-4-yl)ethan-1-ol (1.02g, 1.65 mmol, 51%). 1 H NMR (300 MHz, CDCl3): 5.36-5.29 (m, 4H), 4.23-4.10 (m, 1H), 4.07-4.05 (m, 1H ), 3.82-3.79 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.24-2.12 (m, 1H), 2.01-1.97 (m, 8H), 1.84-1.78 (m, 2H), 1.57-1.55 (m, 8H), 1.34-1.29 (m, 35H), 0.87 (t, J = 6.3 Hz, 6H). 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol Synthesis of (xolan-4-yl)propan-1-ol, 11

[0473] [ka] The procedure is described above. 3-((S)-2,2-di((Z)-octadec-9-ene-1-yl)-2,2-diisopropyl-2,2-dibenzofuran-2-yl)-2,2-dione as a clear oil (1,3-dioxolan-4-yl)propan-1-ol (0.41 g, 0.6 5mmol, 76%). 1 H NMR (300 MHz, CDCl3): 5.39-5.32 (m, 4H), 4.06-4.03 (m, 2H), 3.71-3.67 (m, 2H ), 3.47-3.46 (m, 1H), 2.01-1.99 (m, 10H), 1.66-1.59 (m, 4H), 1.56-1.54 (m, 6H), 1.34-1.26 (m, 44H), 0.87 (t, J = 6.3 Hz, 6H). 2-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol xolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-OA, Synthesis of O-11880

[0474] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-ene-1-yl)-2-methyl-2-propanol as a clear oil (yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (A KG-KC2-OA, O-11880) (200 mg, 0.31 mmol, 49%). 1 H NMR (300 MHz, CDCl3): 5.38-5.28 (m, 4H), 4.08-4.01 (m, 2H), 3.48 (t, J = 6.8 Hz, 1H), 2.39-2.24 (m, 2H), 2.21 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 (m, 2H), 1.68-1.52 (m, 6H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 43 H 83 MS(APCI) of NO2: 646.7 2-((S)-2,2-di((Z)-hexadec-9-en-1-yl)-1,3-diol Xolan-4-yl)-N,N-dimethylethan-1-amine (AKG-KC2-PA, Synthesis of O-11879

[0475] [ka] The procedure is described above. 2-((S)-2,2-di((Z)-hexadec-9-ene-1-yl)-2-methyl-2-propanol as a clear oil (yl)-1,3-dioxolan-4-yl)-N,N-dimethylethan-1-amine (A KG-KC2-PA, O-11879) (195 mg, 0.33 mmol, 18%). 1 H NMR (300 MHz, CDCl3): 5.35-5.28 (m, 4H), 4.08-4.02 (m, 2H), 3.48 (t, J = 6.6 Hz, 1H), 2.38-2.27 (m, 2H), 2.20 (s, 6H), 2.01-1.99 (m, 8H), 1.97-1.80 (m, 2H), 1.77-1.52 (m, 6H), 1.34-1.29 (m, 38H), 0.87 (t, J = 6.3 Hz, 6H). C 39 H 75 MS(APCI) of NO2: 590.6 3-((S)-2,2-di((Z)-octadec-9-en-1-yl)-1,3-diol Xolan-4-yl)-N,N-dimethylpropan-1-amine (AKG-KC3-OA Synthesis of O-11957

[0476] [ka] The procedure is described above. 3-((S)-2,2-di((Z)-octadec-9-ene-1-yl)-2,2-diisopropyl-2,2-dibenzofuran-2-yl)-2,2-dione as a clear oil (yl)-1,3-dioxolan-4-yl)-N,N-dimethylpropan-1-amine( AKG-KC3-OA, O-11957) (160 mg, 0.24 mmol, 37%). 1 H NMR (300 MHz, CDCl3): 5.39-5.28 (m, 4H), 4.06-4.01 (m, 2H), 3.44 (t, J = 6.8 Hz, 1H), 2.26 (t, J = 6.8 Hz, 2H), 2.20 (s, 6H), 2.01-1.97 (m, 8H), 1.82-1.77 ( m, 2H), 1.60-1.43 (m, 8H), 1.34-1.26 (m, 46H), 0.87 (t, J = 6.3 Hz, 6H). C 44 H 85 MS(APCI) of NO2: 660.6

[0477] Example 2: In vitro analysis of cytotoxicity in human hepatocytes or cancer cells The LNPs were tested in vitro with a series of 10 dilutions and were compared with human hepatocytes / liver cells. The IC50 in liver (HepG2; ATCC #HB8065) ​​cells can be determined. These formulations are generally considered non-toxic and are therefore suitable for use with Lipofectamine™ 30 00 (ThermoFisher #L3000015) complex mRNA (2 μL of reagent / 1 A positive control of 1 μg of mRNA was included in all studies. ap FLuc, EGFP, or MCherry reporter gene mRNA (5 moU ;Trilink #L-7202, #L-7201, or #L-7203). Data is recorded from cell viability curves and actual IC50 values ​​calculated for each compound.

[0478] Grow adherent cells to approximately 80% confluency with 0.25% trypsin-E. Add DTA (Gibco #25200-072) and then allow the cells to settle. Add 100 ml of growth medium (MEM medium; Corning #10010CM) to disperse the cells. The cells are trypsinized by centrifugation. The cell density is determined using a hemocytometer. Growth medium (MEM medium containing 10% FBS; Corning #35015CV) was added to the cells. Add 200 μL of cells (5,000 cells) to the PBS and adjust to the appropriate cell concentration. cells / well) were added to a 96-well clear flat-bottom plate (Costar #9804) Incubate in plates for 24 hours at 37°C in a humidified incubator with 5% CO2. To bet.

[0479] Serial dilutions of the LNP formulations are prepared using growth medium as the solvent. It is produced as a sterile aqueous solution with a concentration of 1 mg / mL mRNA. To prepare the LNP stocks, warm them to room temperature. These were further diluted 4-fold in growth medium. This resulted in the highest mRNA concentration tested of 250 ug / mL.

[0480] Aspirate the old medium and replace it with 200 μL of LNP-containing medium. Therefore, the LNPs were serially diluted 1:3 from an initial concentration of 250 μg / mL for each LNP. The plate is incubated in a humidified incubator at 37°C with 5% CO2 for 7 min. At the end of the LNP incubation period, the medium in each well was Add 100 μL of 1X PrestoBlue Cell Viability Reagent (T Replace with HermoFisher Catalog #A13261. Humidified Incubator Incubate the plate in 37°C with 5% CO2 for 30 minutes to 2 hours. Read at 0, 60, and 120 minutes. SpectraMax M5 plate reader ( Molecular Devices) at 560 nm excitation and 590 nm From all sample readings, the control containing only culture medium is read. Correct for background by subtracting the RFU (from background control wells) Calculate the percentage of cytotoxicity using the following formula: %Cytotoxicity=[(RFU 培地 -RFU 処置 ) / RFU 培地 ]×100% IC50 was determined using GraphPad Prism using the following formula: Y=100 / (1+10^((LogIC50-X)*HillSlope)))

[0481] Lipofectamine™ 3000 (ThermoFisher #L3000015) The cytotoxicity of the combined mRNA (2 μL reagent / 1 μg mRNA) positive control was measured using several In embodiments, they may be 5 to 100 times more toxic than the compounds disclosed herein. This indicates that the disclosed compounds are more potent than commercially available transgenic mice in an in vitro hepatotoxicity assay. In some embodiments, the present invention provides a method for the preparation of a medicament for the treatment of pulmonary arthritis, which is less toxic than a conventional medicament for the treatment of pulmonary arthritis. The compounds described in this paper have been shown to produce LNPs with lower toxicity than commercially available transfection reagents. Formed with ivo.

[0482] [Example 3] Determination of pKa of ionized lipids The pKa of an ionizable cationic lipid can be calculated in several ways. The membrane structure and adjacent lipids in the membrane can affect the dissociation properties of the amino groups. This is sometimes difficult because it can give inaccurate values. As part of this, the apparent pKa of the ionized lipid is measured while the lipid is in its intended environment. In situ measurements are ideal (Jayaraman 2012, Sabins 2018).

[0483] For each LNP formulation, 2-(p-toluidino)-6-naphthalene was titrated from pH 3 to 12. Determining pKa values ​​of amino lipids by measuring the fluorescence of thalene sulfonic acid (TNS) TNS does not fluoresce in solution, but its fluorescence increases when it associates with cationic lipid membranes. It is an anionic molecule, and this property has traditionally been used to investigate the surface charge of membranes. A matrix used to prepare buffers of various pH values ​​for determining apparent pKa. Star buffer stock (10 mM sodium phosphate, 10 mM sodium borate, 10 mM Prepare 1 M sodium citrate, 150 mM sodium chloride, and 1 M sodium hydroxide. and 1 M HCl to prepare various pH values ​​from a master buffer stock ranging from approximately 3 to 12. Approximately 20 unique buffer solutions are prepared. 300 mM 6-(p-toluidino)-2-naphthalenesulfonic acid sodium salt (TNS The LNP was prepared and purified to a final mRNA concentration of 0.0 Use a 96-well plate to obtain a buffer solution of the desired pH at 4 mg / mL. The mRNA-containing solution was inserted in advance so that the final concentration of mRNA was 0.7 μg / mL. Add LNP. Add TNS to each well so that the DMSO concentration becomes 1% (v / v). After mixing, measure the fluorescence of TNS in each well (Ex / Em = 331 nm / 445 nm). m) and sigmoidal best fit analysis. ) is applied to the fluorescence data. The pKa is determined as the pH that results in a half-maximum fluorescence intensity The apparent pKa values ​​measured for compounds 1-36 were in the pH range of 6.0-7.0. do.

[0484] [Example 4] Measurement of cellular uptake of LNP Measurement of cellular uptake of LNPs by fluorescence imaging and / or fluorescence quantification 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocalcium Boscyanine perchlorate (DiI), 3,3'-dilinoleyloxacarbocyanine perchlorate Dioctadecyl-3,3,3',3'-tetramethylindodecyl ester (DiO), Dicarbocyanine perchlorate (DiD) and 1,1'-dioctadecyl-3,3 iodide ,3',3'-tetramethylindotricarbocyanine (DiR) (Thermo), etc. Many suitable fluorescent tracers are available. These lipids exhibit some fluorescence in water. However, when incorporated into lipid membranes such as those present in LNPs, they exhibit high fluorescence. It is important that the selected lipid is photostable and has a high extinction coefficient.

[0485] LNPs containing these types of lipids are visualized under a fluorescent microscope. In this case, the LNP lipid formulation contains 0.1-0.5 mol% of the total lipids containing 1,1'-dioctadecyl- 3,3,3',3'-Tetramethylindodicarbocyanine-5,5'-disulfonic acid ( The cells of interest are placed in a 24-well plate containing a fluorescent lipid tracer such as DiI5-DS. The cells are grown in suitable cell culture dishes such as 100°C (Corning). Cells were seeded the day before the uptake study in the laboratory and incubated under appropriate conditions, e.g., 37°C, 5% CO₂ Incubate overnight under O2 and 90-100% humidity. RNA is added to cell culture medium and allowed to interact with cells for a certain period of time (4 to 24 hours). The cells are then washed three times with medium to remove non-internalized LNPs before observation. Observe the cells using a microscope equipped with light detection capabilities. Untreated cells were used as background controls. Using the cells, the relative extent of LNP cellular uptake was determined from the fluorescence intensity signal obtained from the cells. Alternatively, cells can be pelleted and washed with a detergent such as Triton-X100. Solubilize it using HCl and quantify the fluorescence by spectrofluorometer or by HPLC. Achieving quantitative measurements of fluorescent cellular lipids by quantifying fluorescent lipid tracers can be done.

[0486] In a similar manner, quantification of fluorescently labeled mRNA is achieved, e.g., dye-labeled enhanced green Both fluorescent protein (EGFP) and firefly luciferase (FLuc) mRNA were expressed in 1 The transcripts were prepared using a ratio of 5-UTP:5-methoxy-UTP of 3, and were then transcribed using Trilin Cyanine 5 is available from K Biotechnologies. The mRN obtained by substitution at this ratio has an excitation maximum at 670 nm and an emission maximum at 670 nm. A captures fluorescently labeled mRNA that is easily visualized and can still be translated in cell culture. By this method, intracellular transport of mRNA can be visualized.

[0487] Intracellular LNP uptake can be achieved by endogenous methods, such as ApoE-mediated uptake, or by active targeting. This can be achieved by exogenous methods such as L containing ionizable cationic lipids. The NP system adsorbs apolipoprotein E (ApoE) in the blood (Cullis et al. al 2017), and then hepatocytes are stimulated by numerous receptors containing ApoE-binding ligands. "natural" targets that are actively incorporated into the It was found that the use of non-overlapping fluorophores allows for the efficient synthesis of fluorophores. Independently track the subcellular distribution and organelle accumulation kinetics of mRNA and LNP It is possible.

[0488] mRNA cellular expression levels were obtained from Trilink Biotechnologies. Use readily available reporter systems such as EGFP, FLuc, or mCherry. In one embodiment, EGFP mRNA can be quantified in LNPs. and added to cells of interest at 0.1-100µg / mL mRNA. After 4–24 hours, the medium may be replaced to wash away any non-internalized LNP from the cells. Quantify GFP signal by fluorescence microscopy or flow cytometry at 4 hours In this way, a panel of LNP formulations can be identified based on reporter protein expression levels. It is possible to distinguish between

[0489] [Example 5] Transfection selectivity index Transfection selection index (TSI) was calculated to measure relative transfection selectivity in mammalian cells. Determine the transfection efficiency (compared to the relative toxicity in the same cells). The selectivity index is calculated as follows: It was calculated using the formula: TSI=EF 哺乳類 / I C 50、哺乳類

[0490] In the formula, EF 哺乳類 is expressed in terms of protein (ng) / million cells is the infection efficiency, IC 50、哺乳類 is the half-maximum inhibitory concentration of the same formulation Related to cell survival.

[0491] LNPs using compounds (1-36) described herein were prepared using a control molecule DL as an ICL. LNPs made using identical LNPs but made with in-MC3-DMA It has a 50% higher TSI.

[0492] [Example 6] Analysis of lipid peroxidation The degree of oxidation was measured by treating LNP samples with 3% H2O2 at 25°C on days 0, 1, 3, and 5. It can be determined using a forced degradation assay in which lipid oxidation products are sampled (B Lessy et al. (2014) Journal of Pharmaceuti Cal Analysis 4,159-165). 0.1M butylated hydroxybenzoates in ethanol The oxidation reaction was quenched by adding hydroxytoluene (BHT) and the temperature was kept at -8°C until the measurement. The lipid oxidation products can be oxidized by 2-thiobarbituric acid (TBA). ) Reactivity Assay (Gutteridge (1982) FEBS Letters 15 0,454-458) was measured to determine the end product of lipid peroxidation, malondialdehyde. It can detect hydrides (MDA) or evaporative light scattering detection (ELSD) or charged Detection may be by an HPLC assay with aerosol detection (CAD). Lipid oxidation and isomerization impurity structures can be assigned based on known literature precedent. , is expected to be a mixture of isomers.

[0493] Generally, in the art, lipids with multiple unsaturations in the acyl chain are oxidized to form It is known that the iochim Biophys Acta 1818,2374-2387).

[0494] Compounds 1-36 described herein were compared with control L containing DLin-KC2-DMA lipid. NPs or compared with control LNPs containing DLin-MC3-DMA It is assumed that when In embodiments, the compounds provided herein reduce the amount of oxidative by-products when compared to control LNPs. More than 30%, 50%, 75%, 90%, and 95% less product.

[0495] Example 7 Preparation of Ligand-Targeted LNPs Antibody Fab', which directs the specific uptake of LNP into target cells such as immune cells Antibody ligands in the form of fragments or single chain Fv fragments are well known in the art. and the like. They may be prepared by any method known in the art (e.g., those incorporated herein by reference). Drummond et al., U.S. Patent Application No. 201802719 No. 98; Zhou et al. U.S. Patent No. 10,406,225; Marks et al. (See U.S. Patent No. 8,974,792 to I. et al.) To provide this function, the ligand must contain a C-terminal sequence (CAA or G) with a cysteine ​​residue. The ligand is expressed in a bacterial or eukaryotic cell, Standards such as protein affinity chromatography or metal chelation chromatography It is isolated from the cell mass or growth medium using standard methods. To activate the amine groups, the ligand was added to 10 mM quercetin containing 140 mM NaCl. Incubation for 1 hour in the presence of 15 mM cysteine ​​in phosphate buffer (pH 6.0-6.2) and eluted on a Sephadex G-25 or similar column in 140 mM NaCl The gel was analyzed using 10 mM citrate buffer (pH 6.0-6.2) containing HCl as the eluent. Purify the purified cysteine-activated ligand solution by column chromatography. Protein concentration is determined using UV spectrophotometry at 280 nm. The antibody ligand was treated with a maleimide-terminated PEG-DSPE derivative (maDSPE) at 1-10 mg / mL in water. l-PEG(2000)-DSPE, Cat. No. 880126, Avanti Pol ar Lipids, AL, USA, or Sunbright® DSPE -020MA, NOF Corporation, Japan) and protein / lipid The distance between the LNP surface and the ligand moiety is preferably long. If not available, use a 3,400 molecular weight (Sunbr) polymer available from NOF Corporation. Sunbright (registered trademark) DSPE-034MA) or 5,000 (Sunbright ( Mal-PEG-lipid with a PEG spacer (registered trademark) DSPE-050MA The solution is incubated at ambient temperature for 2 hours and then diluted with 0.5 mM cis- The unreacted maleimide groups were blocked by adjusting the PEG-DSP to form a micellar ligand. The E complex was then incubated on Ultrogel AcA34 (if the ligand was Fab) or Ultrogel AcA34. On gel AcA44 (when the ligand is scFv), 10 mM HEPES (pH Gel chromatography using 144 mM NaCl buffered at 7.0-7.4 as the eluent. The conjugated protein was quantified by UV spectrophotometry and purified by S Purity is determined by DS gel electrophoresis.

[0496] Ligands are attached to the surface of the LNPs by one of the following methods.

[0497] Method 1: Preformed LNPs (incorporated herein by reference) (obtained as described in Hope et al. US 10,653,780) in HEPES-buffered saline (10 mM HEPES, 140 mM NaCl, pH 7.0 ~7.2) Mix with the micellar solution of the ligand-PEG-DSPE conjugate to form LNP particles A ligand / lipid ratio in the range of 5-100 (typically 15-30) is required per The mixture is slowly heated at 37-40°C for 2 hours or at 2-8°C overnight. The mixture is then incubated with stirring, during which time the complexes are incorporated into the outer lipid layer of the LNP. Ligand-conjugated LNPs were separated from unincorporated ligand-PEG-DSPE by Sep. hydrophilic size exclusion media with the same molecular weight cutoff. (available) and purified by gel chromatography around the void volume collected. The LNP fraction emerges. The amount of ligand conjugated to the particles can be determined by Coomassie blue or fluorescent dye. Determined by SDS gel electrophoresis with color and co-run ligand standards.

[0498] Method 2: In 10 mM Na-citrate buffer (pH 4.0) containing the nucleic acid component of the LNP The solution of the ligand-PEG-DSPE conjugate was mixed with the ethanol solution of the LNP lipids. Semple et al., U.S. Pat. No. 6,229,693, which is incorporated herein by reference. A final ethanol concentration of 40% by volume as described in Patent No. 8,021,686. Alternatively, Hope et al., U.S. Pat. No. 10,653,780 (herein incorporated by reference). The LNP preparation protocol of the Ligand-PEG-DS The amount of PE is 0.1-1 mol% of the lipid. The mixture is dissolved in HEPES-buffered saline (10 mM Dialyze against HEPES, 140 mM NaCl, pH 7.0 to remove ethanol The ligand-PEG-DSPE is incorporated into the resulting LNPs. Gel using halo CL-4B or CL-2B, eluent HEPES-buffered saline or by polysulfone membrane with a molecular weight cutoff of 500 kD. of HEPES-buffered saline by tangential flow filtration (on flat or hollow fiber cartridges) Any residual ligand-PEG-DSPE is removed by buffer exchange.

[0499] Method 3 Mal-PEG-DSPE was prepared in the same manner as Ligand-PEG-DSPE in Method 1. In this method, citrate buffered saline (10 mM citrate) was added in an amount of 0.1 to 1 mol% relative to the LNP lipid. Preformed L in sodium phosphate buffer (pH 6.0-6.2, 140 mM NaCl) The LNPs with incorporated mal-PE-DSPE were mixed with the unincorporated mal-PE-DSPE. The resulting mal-PEG-DSPE was then separated on Sepharose CL-4B in the same buffer. The thiol-activated antibody ligand (LNP particle equivalent) was purified by gel chromatography. The resulting mixture is incubated with 5 to 100 different ligands for 2 to 24 hours. The resulting ligand-conjugated LNPs were separated from the unconjugated ligands using HEPES-buffered saline (PBS) as eluent. by Sepharose CL-4B gel chromatography using H7.0 Refine.

[0500] Method 4: Mal-PEG-DSP was synthesized in the same manner as Ligand-PEG-DSPE in Method 2. E is incorporated into LNPs at 0.1-1 mol% of the LNP lipids. Conjugated LNPs were incubated with thiol-activated ligands as described in Method 3. Refine.

[0501] Method 5: Instead of mal-PEG-DSPE, a PEG spacer (mal-DSPE , Coatsome® FE-808MA3, NOF Corporation The protocol for Method 4 was the same as that for Method 4 except that no maleimide-conjugated lipid was added to the lipid solution. The resulting maleimide-LNPs are then subjected to thiol-LNP synthesis as per Method 3. Conjugated to a phospholipid-activating ligand.

[0502] Method 6: A small molecule ligand (e.g., mannose) is added to mannose-PEG-DSPE ( Biochempeg Scientific, Massachusetts, USA, Cat. no. 12169) is replaced with antibody ligand-PEG-DSPE by method 1 or 2. Conjugate to LNP.

[0503] Example 8: Determining the optimal ligand density for ligand-targeted LNPs Using any of the methods in Example 7, a given range (2-200 species per LNP particle) was obtained. LNPs with increased ligand density (5–100 ligands per ligand or LNP particle) Prepare a P panel. Fluorescently labeled lipids or fluorescently labeled nucleic acids are prepared as described in Example 4. The LNPs are fluorescently labeled by incorporating the labeled ligand-conjugated LNPs into the fluorophore according to Example 4. Cellular uptake was tested and the ligand specific uptake corresponding to the maximum LNP specific cellular uptake was determined. Determine nucleic acid content. Use the intracellular function of nucleic acids (e.g., mRNA expression) as the analytical output. (Example 4), in which case the presence of a detectable label on the lipid or nucleic acid is not necessary. do not have.

[0504] [Example 9] Preparation of lipid nanoparticles (LNP) It was modified with 5-methoxyuridine (5moU) and synthesized using mCherry (Catalog #L-72 The mRNA encoding 03 was obtained from Trilink Biotechnologies All uridine nucleosides were N1-methyl. The mRNA sequence was coded for by replacing the thiamin-pseudouridine with thiamin-pseudouridine. The synthetic gene was cloned into a DNA plasmid. , 5' untranslated region, mCherry protein coding sequence, 3' untranslated region, and The poly(A) tail region of approximately 120 As was found to be composed of TriLink (catalog Open reading frame sequence of mCherry mRNA derived from (#L-7203) is SEQ ID NO:1: AUGGUGAGCAAGGGCGAGGAGGACAACAUGGCCAUCAUCAAGGAGUUCAUGCGGUUCAAGGUGCACAUGGAGGGCAGCGU GAACGGCCACGAGUUCGAGAUCGAGGGCGAGGGCGAGGCCGGCCCUACGAGGGCACCCAGACCGCCAAGCUGAAGGUGA CCAAGGGCGGCCCCCUGCCCUUCGCCUGGGACAUCCUGAGCCCCCAGUUCAUGUACGGCAGCAAGGCCUACGUGAAGCAC CCCGCCGACAUCCCGGACUACCUGAAGCUGAGCUUCCCCGAGGGCUUCAAGUGGGAGCGGGUGAUGAACUUCGAGGACGG CGGCGUGGUGACCGUGACCCAGGACAGCAGCCUGCAGGACGGCGAGUUCAUCUACAAGGUGAAGCUGCGGGGCACCAACU UCCCCAGCGACGGCCCCGUGAUGCAGAAGAAGACCAUGGGCUGGAGGCCAGCAGCGAGCGGAUGUACCCCGAGGACGGC GCCCUGAAGGGCGAGAUCAAGCAGCGGCUGAAGCUGAAGGACGGCGGCCACUACGACGCCGAGGUGAAGACCACCUACAA GGCCAAGAAGCCCGUGCAGCUGCCCGGCGCCUACAACGUGAACAUCAAGCUGGACAUCACCAGCCACAACGAGGACUACA CCAUCGUGGAGCAGUACGAGCGGGCCGAGGGCCGGCACAGCACCGGCGGCAUGGACGAGCUGUACAAGAGCGGCAACUGA is equivalent to

[0505] A stock solution of each lipid was prepared. Ionized lipids were placed in a 4 mL glass bottle (Thermo B7999-2) and ethanol (Sigma-Aldrich 200 standard strength) DSPS, cholesterol (RNase-free) to a final concentration of 10 mM. Weigh out other lipids, such as PEG-DMG, and dissolve them in ethanol to a concentration of 1 mM. DSPS was dissolved in methanol (Sulpelco, Omnisolve) at a concentration of 1 mM. and gently heated to 70°C to complete dissolution.

[0506] Add the desired volume of each lipid stock solution to a new bottle and add ethanol if necessary. Lipid mixtures for each individual LNP were prepared by adding 10 mL of 10 ... For example, AKG-UO-1 / DSPC / DSPS / Chol / PEG- The LNP formulation of DMG (50 / 2.5 / 7.5 / 38.5 / 1.5 mol%) was For each mRNA used, 1500 nmol of AKG-UO-1 and 75 nmol of D SPC, 225 nmol DSPS, 1155 nmol Chol and 45 nmol It contained PEG-DMG.

[0507] Thaw a bottle of frozen mRNA (mCherry mRNA, Trilink) and extract the mRNA. Diluted in 6.25 mM sodium acetate (pH 5.0) to a final concentration of 0.033 mg / m To prepare LNPs, the mRNA solution was prepared by adding NanoA ssemblr Benchtop Microfluidic Device (Precision Nan When the LNP contained DSPS, the temperature was set to 70°C. A heating block accessory was used, otherwise the LNP was mixed at room temperature. Fill a 3 mL disposable syringe (BD309656) with 1 mL of mRNA solution and inject 1 mL of lipid The mixture was loaded into a 1 mL syringe (BD309659) and added to the NanoAssembler. After placing in a heat block for 4 minutes, the mixture was mixed in a 3:1 water:aqueous mixture at a mixing rate of 6 mL / min. By pumping a liquid stream of alcohol volume ratio through a disposable microfluidic cassette, Thus, the formation of LNPs was achieved. After mixing, 3.6 mL of the LNP mixture was collected and the initial 0 The 0.35 mL mixed volume and the final 0.05 mL of the mixture were discarded. SpectraPor dialysis tubing (12-14k M via SH30256.01) by buffer exchange using WCO) or Amino Ultra-4 centrifugal concentration The ethanol was removed by successive concentration and dilution using a vessel.

[0508] LNPs are typically exchanged into PBS at pH 7.4, followed by 15 mM Tris( pH 7.4) and then exchanged into 20% sucrose, concentrating the mRNA to 20-50 μg / mL. After bacterial filtration (Thermo Nalgene 0.2um#720-1320), They were frozen by immersion in liquid nitrogen for 5 minutes and stored long term at -20°C.

[0509] Example 10: Characterization of LNPs A. Determination of mRNA concentration and relative encapsulation efficiency with fluorescent conjugated dyes Materials: RiboGreen reagent (Thermo #11491), 3 x 96-well plates with lids Plates, PBS, dissociation buffer (PBS with 10% DMSO and 1% (wt / wt) Zw ittergent3~14(Sigma-Aldrich#693017)), mRN A. General pipette tips & repeater pipette tips 1. 5 mL of 2 μg / mL mRNA stock was prepared in DPBS or PBS. 2. Diluted standards were mixed in a single well in a 96-well plate (Plate A) as follows: Prepared in wells.

[0510] JPEG2026016373000266.jpg561703. Using the various wells on Plate A, dilute the samples to fall within the range of the standard curve. (One well is required per sample.) For example, the approximate mRNA concentration is The sample should be approximately 30 ug / mL, and a 20-fold dilution was performed (dilution factor). (0 μL of sample was added to 380 μL of PBS in one well). No lid was used on Plate A. The sample was mixed by gently pipetting up and down. Example of Plate A

[0511] JPEG2026016373000267.jpg641704. Two more plates, plates B and C, were used. Multichannel pipettor Using a syringe, pipette 60 μL of each standard into each well (in duplicate). and each well was sampled in triplicate. Examples of Plates B and C

[0512] JPEG2026016373000268.jpg651705. Count the number of wells used on each plate and add 4 to this number. PBS was prepared with a 1:100 dilution of RiboGreen. In the wells, 44 was used as the number. 44 x 60 μL = 2.64 mL of RiboGreen n solution, thus 2.61 mL with 26.4 μL of RiboGreen It is likely to be PBS. 6. In Plate C, add 2.61 mL of dissociation buffer and 26.4 uL of RiboGre en was pipetted in. 7. Using a 60 μL repeater pipette set, pipette PBS + RiboGreen Add 60 µL of dissociation buffer + RiboGreen to each well of Plate B. Mix both plates B and C on an orbital mixer (120 rpm) for 1 minute. Plate B was placed in the dark for 15 minutes. Plate C was placed in the dark at 37°C for 10 minutes, followed by and incubated at room temperature for 5 minutes. 8. Both plates were read alternately using excitation at 465 nm and emission at 530 nm. 9. Using the standard curve, calculate the slope and intercept and, by extrapolation, find the values ​​for Plates B and C. The mRNA concentrations of the above samples were calculated (mean and standard deviation). 10. Encapsulation efficiency of [mRNA] Plate B / [mRNA] Plate C × 100 The percent of EE (%EE) was calculated. 11. Total [mRNA] was calculated by [mRNA] plate C x dilution factor. B. LNP particle size 1. Dispense 30 μL of LNP into a polystyrene cuvette (Sarstedt, #67.7 Mix with 1.5 mL of PBS in a 54°C (200°F) flask and analyze with the ZS Xplorer software (version 54). ZetaSizer Pro (Malvern) with version number 1.4.0.105 was used. The size was analyzed using the Z-average size and polydispersity index values ​​were recorded. Measurements of LNP size were performed after LNP mixing, buffer exchange, and bacterial filtration. C. LNP Zeta Potential 1. Mix 30 µL of LNP with 1.5 mL of PBS and inject it into a disposable pleated capillary Injected into cells (Malvern Nanoseries DTS1070) and Zeta Zeta potential was measured at 25°C on a Sizer Pro.

[0513] [Example 11] Transfection of LNP in mouse dendritic cells using mCherry mRNA Determination of transfection efficiency A. Cell Growth, Transfection, Harvesting, and Staining Protocols 1. MutuDC1940 cells (ABM) were cultured in T75 flasks according to the supplier's instructions. If necessary, these cells were grown in PBS prior to transfection. were plated in 24-well plates at 180,000 cells / well on day 1. 2. 1 μg of LNP in 1 mL of medium was added to each well in triplicate, and after 24 hours, the cells were The cells were washed once with DPBS (VWR02-0119-1000). 3. Then, add 0.2 mL of DPBS (plus 5 mM EDTA (pH 7.4)) was added to facilitate the separation. 4. The cells were placed at 37°C for 3 minutes until detached. 5. Add 0.5 mL of DPBS to each well and transfer the liquid into flow cytometry tubes (Fa The tube was transferred to a 5mL tube (Lcon #352054). 6. The tube was centrifuged at 1100 rpm for 3-5 minutes and the liquid was discarded. 7. Add 100 μL of Zombie Violet (Biolegend) in PBS (1: A 500x dilution) was added to each tube. 8. The tube was gently tapped to resuspend the cells and allowed to stand at room temperature in the dark for 15 minutes. 9. Add 0.5 mL of 4% paraformaldehyde to the cells in 1:1 PBS:DPBS. ) was added, the cells were gently tapped to resuspend, and the mixture was placed on ice for 30 minutes. PBS was added. 10. Pellet the cells as above and resuspend in 0.5 mL of DPBS with 5% BSA. and place in the refrigerator until needed. B. Cell analysis 1. VL1 and Y for Live / Dead and mCherry Fluorescence Signals, Respectively Cell suspensions were analyzed using an Attune NxT flow cytometer with L2. Gating analysis was performed with FloJo software.

[0514] [Example 12] Dendritic cells using LNPs containing KC2 as an ionized cationic lipid Effect of DSPS on transfection efficiency of The purpose of this study was to evaluate the transfection efficiency of mouse dendritic cells using DSPS. The purpose of this study was to investigate the effect of phosphatidylserine targeting on LNPs as described in Example 9. and characterized for particle size and zeta potential as described in Example 10. The transfection efficiency in mouse dendritic cells was then measured as described in Example 11. All LNPs were prepared using a constant DLin-KC at an N / P ratio of 5 and 50 mol% of total lipids. With 2-DMA, PS lipids varied from 0 to 2.5 mol% of the initial, and DSPC phospholipids was varied from 0 to 7.5 mol% (total mol% of DSPC and DSPS was constant at 10 mol%) Cholesterol was constant at 38.5 mol% (total mol% of total lipids). The particle size, polydispersity index (PDI), and encapsulation efficiency of the formulations are shown in Tables 5 and 6 below.

[0515] JPEG2026016373000269.jpg45170

[0516] JPEG2026016373000270.jpg51170

[0517] The initial set of LNPs containing DLin-KC2-DMA and 0–2.5 mol% Various phosphatidylserines in the form of DSPS were prepared with 0 mol % or 0.5 mol % DSP. Although some transfection was observed with S, when DSPS was introduced at 2.5 mol %, The second LN prepared with 0 to 7.5 mol% DSPS showed an 18-fold increase (Figure 3A). The P series was evaluated at 0.1, 0.3, and 1 μg / mL mRNA concentrations (Figure 3B , Figure 3C, and Figure 3D). As the mole % of DSPS increased beyond 2.5 mole %, The transfection efficiency increased, reaching a maximum of 7.5 mo at 1 μg / mL mRNA. mol%, and 5 mol% at both 0.1 and 0.3 μg / mL mRNA. These data suggest that the inclusion of phosphatidyl-L-serine significantly inhibits the transcription of mRNA-containing LNPs. Transfection efficiency can be dramatically increased, and the maximum uptake is achieved by using DSPS (total lipids). It has been demonstrated that this occurs at 5 to 7.5 mol % of the cations (as a percentage of the total cations).

[0518] [Example 13] ICL and anionic surfactants for mRNA transfection of dendritic cells Effects of phospholipid-targeting ligands The purpose of this study was to determine whether other anionic phospholipids could also enhance the transfection efficiency of LNPs. We also investigated how LNPs prepared with different ICL and PS targets can be dendritic. The purpose of the LNP was to confirm whether the cells could be transfected. Prepared as described in Example 9 and characterized for particle size and zeta potential as described in Example 10 The transfection efficiency in mouse dendritic cells was evaluated as described in Example 11. LNPs were evaluated at an N / P ratio of 5 and 50 mol% of total lipids with various ICLs ( DLin-KC2-DMA, KC2-OA, KC3-OA, or SM-102), The PS lipid was kept constant at 5 mol%, DSPC was kept constant at 5 mol%, and cholesterol was also kept constant at 5 mol%. The particle size, P The DI and encapsulation efficiency are shown in Table 7 below.

[0519] JPEG2026016373000271.jpg70170

[0520] The results of transfection are shown in Figure 4. ICLs from three different KC lines (KC2, KC3, KC4, KC5, KC6, KC7, KC8, KC9, KC10, KC11, KC12, KC13, KC14, KC15, KC16, KC17, KC18, KC19, KC20, KC21, KC22, KC23, KC2 C2-OA, and KC3-OA), and branched ICL prepared using SM-102 The results show high transfection rates with the LNPs containing alternative anionic phospholipids (S All formulations, including those prepared with uc-DSPE or Glu-DSPE The encapsulation efficiency was high and the particle size was less than 100 nm. N-glutaryl-distearoylphosphatidylethanolamine (Glu-D SPE or N-succinyl-distearoylphosphatidylethanolam...

Claims

1. It has a chemical structure consisting of a pair of linear polyunsaturated lipid tails covalently attached to a head group A lipid nanoparticle (LNP) composition comprising an ionizable lipid, wherein the head group is a 6-7 p containing a dialkylamino group having Ka, The head group is a heterocyclyl or alkyl group covalently bonded to the dialkylamino group. a phosphate group; Each polyunsaturated lipid tail has at least two methylene groups along the length of the lipid tail. and optionally, A composition comprising a single acyl group at the terminus of said lipid tail covalently attached to said head group.

2. each lipid tail is identical and each lipid tail is unsubstituted ethylene, n-propyl, or 10. The composition of claim 1 having a total of two olefins separated only by n-butyl. Finished product.

3. Each lipid tail further comprises an acyl group attached to the oxygen of the head group to form an ester.

3. The composition of claim 2, having a total of 16 or 18 carbon atoms including the acyl group. Finished product.

4. a. The dialkylamino portion of the head group has the chemical structure of formula (IV-A): 【Chemistry 1】 [where: In formula (IV-A), n is 2, 3, or 4; R in formula (IV-A) 10 and R 12 are each independently methyl, ethyl, and and propyl; R 10 and R 12 During wherein the alkyl is optionally substituted with one or more hydroxyl groups; b. The ionizable lipid has a head group distal to the dialkylamino moiety of formula (IV-A): Chemical structure containing the acyl group of each lipid tail covalently attached to part of the lipid tail 【Chemistry 2】 wherein: 【Transformation 3】 indicates the linkage to formula IV-A in the head group, and R 22 is covalently bonded to the acyl group and represents a portion of each lipid tail, and Formula A: 【Chemistry 4】 wherein in Formula A: 【Transformation 5】 is the formula A and R in each lipid tail 22 indicates the connection with a is 4, 1, 2, or 3; b is 4, 2, or 3; c is 4, 3, 5, 6, or 7; provided that the sum of a, b, and c in Formula A is 12, 10, 11, or 13; The composition of claim 2.

5. R in formula (IV-A) 10 and R 12 are each independently methyl, ethyl, -( CH 2 ) (CH 2 )OH, or -(CH 2 ) 2 (CH 2 )OH according to claim 4 Composition of.

6. b is 4, and R in formula (IV-A) 10 and R 12 are each methyl, Item 6. The composition according to item 5.

7. The ionizable lipid is represented by formula (IA): 【Transformation 6】 [In the formula, a is 4, 1, 2, 3, 5 or 6; b is 4, 3 or 2; c is 4, 3, 5, 6, or 7; the sum of a, b, and c is 12 or 10; q is 1, 2, 3 or 4; R 10 and R 12 are each independently optionally one or more hydroxyl groups; Substituted (C 1 ~C 4 ) alkyl, L is, 【Transformation 7】 where v is 0 or 1, and q2 is 2 or 1. The composition of claim 1 having the chemical structure:

8. 8. The composition of claim 7, wherein v is 0 and q is 1, 2, or 3.

9. The ionizable lipid is AKG-UO-1, AKG-UO-1A, AKG-UO-1B, AKG-UO-2, AKG-UO-4, AKG-UO-4A, AKG-UO-5, AKG -UO-6, AKG-UO-7, AKG-UO-7, AKG-UO-8, AKG-UO- 9, and AKG-UO-10: 【Transformation 8】 【change】 The composition of claim 8 selected from the group consisting of:

10. a. nucleic acid, b. an ionizable lipid according to any one of claims 1 to 9; c. sterols, d. one or more phospholipids, including phosphatidylserine (PS) lipids; e. optionally further comprising a complex lipid; Compositions 1 to 9.

11. The composition of claim 10 , wherein the nucleic acid is mRNA.

12. The composition of claim 11 , wherein the sterol is cholesterol.

13. The one or more phospholipids a. One or more phospholipids selected from the group consisting of DSPC, DPPC, and DOPC Quality, and b. PS lipids selected from the group consisting of DPPS, DSPS, and DOPS The composition of claim 12, consisting of:

14. The one or more phospholipids a. DSPS, and b. (L-serine)DPPS and (L-serine)DSPS One or more PS lipids The composition of claim 13, consisting of:

15. 13. The composition according to claim 12, wherein the PS lipids are present in a total amount of 2.5 to 10 mol % of the total lipids in the composition. The composition described in

16. 16. The composition of claim 15, wherein the complex lipid comprises PEG.

17. a. nucleic acid, b. Ionized cationic lipids in a total amount of 40-65 mol % of the total lipid content of the LNP composition quality, c. a total amount of sterols ranging from 25 to 45 mol% of the total lipid content of the LNP composition; d. one or more phospholipids in a total amount of 5 to 25 mol% of the total lipid content of the LNP composition phospholipids in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition. one or more phospholipids, including sphatidylserine (PS), e. optionally, a total amount of 0.5 to 2.5 mol% of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) composition further comprising a conjugated lipid.

18. The composition of claim 17, wherein the nucleic acid is mRNA.

19. 19. The composition of claim 18, wherein the sterol is cholesterol.

20. 20. The method according to claim 19, wherein the one or more phospholipids consist of DSPC and L-serine PS. The composition described above.

21. 21. The method according to claim 20, wherein the PS is contained in a total amount of 5.0 to 7.5 mol% of the total lipids in the composition. The composition described.

22. 22. The composition of any one of claims 17 to 21, wherein the complex lipid comprises PEG.

23. 23. The composition of claim 22, wherein the conjugated lipid is PEG-DMG.

24. The LNPs are complexed in a total amount of 0.5 to 1.5 mol % of the total lipid content of the LNP composition.

24. The composition of claim 23, comprising a lipid.

25. The LNP contains a total amount of complex lipids that is less than 1 mol% of the total lipid content of the LNP composition. The composition of claim 24.

26. a. the nucleic acid is mRNA; b. the total amount of the ionized cationic lipids is 45% of the total lipid content of the LNP composition up to 55 mol %, c. Sterols comprise a total amount of 35 to 45 mol% of the total lipid content of the LNP composition. It is cholesterol, d. the total amount of phospholipids is 7-15 mol% of the total lipid content of the LNP composition; e. The one or more phospholipids are DSPC and the PS lipids are DPPS and one or more lipids selected from the group consisting of L-serine type DSPS; f. The total amount of the PS lipids is 3 to 9 mol% of the total lipid content of the LNP composition.

18. The composition of claim 17.

27. The PS lipid is present in an amount of 1.25 mol%, 2.5 mol%, or 27. The method of claim 26, wherein the total amount of the hydroxybenzoates is selected from the group consisting of 5 mol%, 7.5 mol%, and 10 mol%. The composition described above.

28. a. a nucleic acid that is mRNA; b. Ionized cationic lipids in a total amount of 45-55 mol % of the total lipid content of the LNP composition quality, c. A total amount of cholesterol of 35-45 mol% of the total lipid content of the LNP composition Certain sterols, d. The total amount of phospholipids is 10 mol% of the total lipid content of the LNP composition, The NP composition contains phosphatidylserine (PS) in a total amount of 3-9 mol% of the total lipid content. , one or more phospholipids; e. Complex lipids in a total amount of 0.5 to 1.5 mol % of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) composition comprising:

29. The PS lipid is DSPS (L isomer), DPPS (L isomer), DMPS (L isomer ), DOPS (L isomer), DSPS (D isomer), DSPG, DPPG, N-Glu- DSPE, and N-Suc-DSPE. The composition according to any one of the preceding claims.

30. a. The conjugated lipid is PEG-DMG; b. the PS lipid is selected from the group consisting of DSPS (L isomer) and DPPS; 30. The composition of claim 29.

31. The ionizable cationic lipids are compounds 1 to 28 (Table 1), compounds 29 to 38 (Table 2), , AKG-UO-1, AKG-UO-1A, AKG-UO-1B, AKG-UO-1B, AKG-UO-2, AKG-UO-3, AKG-UO-4, AKG-UO-4A, AKG -UO-5, AKG-BDG-01, AKG-BDG-02, AKG-UO-6, AKG -UO-7, AKG-UO-8, AKG-UO-9, and AKG-UO-10 29. The compound according to any one of claims 17 to 28, wherein the compound is one or more compounds selected from the group composition.

32. The ionizable cationic lipid is selected from the group consisting of compounds 1 to 3, 5 to 8, 9 to 12, and 14 to 28.

29. The compound according to any one of claims 17 to 28, wherein the compound is one or more compounds selected from the group consisting of: Composition of.

33. The ionizable cationic lipid is one or more selected from the group consisting of compounds 29 to 38.

29. The composition of any one of claims 17 to 28, wherein the compound is

34. The ionizable cationic lipid is KC2-OA, KC3-OA, Dlin-KC2-D MA, DlinKC3-DMA, KC2-PA, DODAP, AKG-OA-DM2, A KG-OA-DM3, O-11769, Dlin-MC3-DMA, ALC-0315 and SM-102.

9. The composition according to any one of claims 8 to 8.

35. a. nucleic acid, b. ionized cationic lipids in a total amount of 50 mol% of the total lipid content of the LNP composition 、 c. 38.5 mol% total cholesterol of the total lipid content of the LNP composition; d. one or more phospholipids in a total amount of 7 to 15 mol % of the total lipid content of the LNP composition phosphatidylserine in a total amount of 3 to 9 mol% of the total lipid content of the LNP composition one or more phospholipids, including polyphosphorylsiloxane (PS) lipids, and e. PEG-containing lipids in a total amount of 0.5 to 1.5 mol% of the total lipid content of the LNP composition quality 18. The nucleic acid-lipid nanoparticle (LNP) composition of claim 17, comprising:

36. The phospholipid is one selected from the group consisting of DSPC, DPPC, and DOPC. The composition according to claim 34, consisting of the above phospholipids.

37. The PS lipid is one or more L-selenium lipids selected from the group consisting of DPPS and DSPS.

37. The composition of claim 36, which is a phospholipid.

38. The one or more phospholipids are at least two phospholipids (L-celery, L-paraffin, L-glucan, L-isoleucine ...

18. The composition of claim 17, comprising a PS lipid.

39. 39. The composition of claim 38, wherein the PS lipids are DPPC and DSPS.

40. The DPPC and DSPS each contribute to the total fat content of the LNP composition.

40. The composition of claim 39, wherein each of said polyisoprene is present in a total amount of 5 mole % based on the total mass content.

41. Nucleic acid, ionizable cationic lipid AKG-UO-1, and (L-serine) PS lipid, A nucleic acid-lipid nanoparticle (LNP) containing 2.5 to 10 mol% of the total lipid content of the LNP composition. NP) composition.

42. The nucleic acid is mRNA, and the PS lipid is (L-serine)DSPS, (L-serine ) DPPS, or a mixture thereof, and the LNP composition is and further comprising a second phospholipid selected from the group consisting of DSPC, DPPC, and DOPC.

42. The composition of claim 41, comprising:

43. The LNP composition has a lipid content of 0.5 to 1.5 mol relative to the total lipid content of the LNP composition. % PEG-DMG or PEG-DSG.

44. nucleic acid, KC2OA, KC2, KC2-01, ALC0315, and SM102 The selected ionizable cationic lipid and (L-serine) PS lipid are added to the LNP composition. A nucleic acid-lipid nanoparticle (LNP) composition comprising a total amount of 2.5 to 10 mol% of the total lipid content.

45. 45. The composition of claim 44, wherein the LNP composition has an N / P ratio of 3 to 8.

46. 46. ​​The composition of claim 45, having an N / P ratio of 5 to 7.

47. 46. ​​The composition of claim 45 having an N / P ratio of 5.

48. 48. Any one of claims 44 to 47, wherein the ionizable cationic lipid is KC2OA. The composition described in

49. 48. The method of any one of claims 44 to 47, wherein the ionizable cationic lipid is KC2. The composition described above.

50. 48. Any one of claims 44 to 47, wherein the ionizable cationic lipid is KC2-01. The composition according to item .

51. 48. Any of claims 44 to 47, wherein the ionizable cationic lipid is ALC0315.

2. The composition described in claim 1.

52. 48. Any one of claims 44 to 47, wherein the ionizable cationic lipid is SM102. The composition described in

53. Nucleic acid, ionized cationic lipid selected from AKG-UO-6 and AKG-UO-7 The lipid content of the LNP composition was 2.5 to 10% of the total lipid content of the LNP composition. A nucleic acid-lipid nanoparticle (LNP) composition comprising, in a total amount of 1%.

54. Claims 17 to 21, 26 to 28, 35 to 44, wherein the N / P ratio is 3 to 8; or 53. The composition of any one of claims 53.

55. 55. The composition of claim 54, wherein the N / P ratio is from 5 to 7.

56. 56. The composition of claim 55, wherein the N / P ratio is 5.

57. 56. The composition of claim 55, wherein the N / P ratio is 7.

58. the nucleic acid is an mRNA encoding the SARS-CoV-2 spike protein; 54. The method of claim 17, 21, 26, 28, 35, 47, or 53, composition.

59. a. mRNA nucleic acids with an N / P ratio of 3 to 8; b. ALC-0315 ion in a total amount of 40-65 mol% of the total lipid content of the LNP composition cationized cationic lipids, c. a total amount of cholesterol of 25-40 mol% of the total lipid content of the LNP composition; d. (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, e. DSPC phospholipids in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and f. PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) vaccine composition comprising:

60. a. mRNA nucleic acids with an N / P ratio of 3 to 8; b. Dlin-KC2-D in a total amount of 40-65 mol% of the total lipid content of the LNP composition MA ionizable cationic lipid, c. a total amount of cholesterol of 25-40 mol% of the total lipid content of the LNP composition; d. (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, e. DSPC phospholipids in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and f. PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) vaccine composition comprising:

61. a. mRNA nucleic acids with an N / P ratio of 3 to 8; b. KC3-OA ionized in a total amount of 40-65 mol% of the total lipid content of the LNP composition cationic lipids, c. a total amount of cholesterol of 25-40 mol% of the total lipid content of the LNP composition; d. (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, e. DSPC phospholipids in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and f. PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) vaccine composition comprising:

62. a. mRNA nucleic acids with an N / P ratio of 3 to 8; b. Ionized cationic lipids in a total amount of 40-65 mol % of the total lipid content of the LNP composition quality, c. a total amount of cholesterol of 25-40 mol% of the total lipid content of the LNP composition; d. (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, e. DSPC phospholipids in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and f. PEG-DMG in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition A nucleic acid-lipid nanoparticle (LNP) vaccine composition comprising:

63. 63. The method of any one of claims 59 to 62, wherein the nucleic acid is the mRNA of SEQ ID NO:

2. Composition of.

64. For targeting of LNPs to dendritic cells, 2.5 to 10 molar equivalents of the total lipid content of the LNP composition are used. The use of (L-serine) PS lipids in the LNPs in a total amount of 1%.

65. 65. The use of claim 64, wherein the LNP comprises mRNA.

66. 66. The use of claim 64 or 65, wherein the LNP further comprises cholesterol.

67. 67. The method of claim 66, wherein the LNP further comprises an ionizable cationic lipid (ICL). use.

68. 68. The LNP further comprises one or more additional phospholipids, including DSPC. Use as described in.

69. 69. The use of claim 68, wherein the LNP further comprises a conjugated lipid.

70. The LNP is a. mRNA nucleic acids with an N / P ratio of 3 to 8; b. a total amount of ionized cations of 40-65 mol % of the total lipid content of said LNP composition sexual lipids (ICL), c. a total amount of cholesterol of 25-40 mol% of the total lipid content of the LNP composition; d. (L-serine) in a total amount of 2.5 to 10 mol% of the total lipid content of the LNP composition PS lipid, e. DSPC phospholipids in a total amount of 5-25 mol% of the total lipid content of the LNP composition; and f. Complex lipids in a total amount of 0 to 2.5 mol % of the total lipid content of the LNP composition 70. The use of claim 69, comprising:

71. The ICL is selected from the compounds of any one of claims 1 to 9.

70. Use according to claim 70.