Aptamers for use in the treatment of coronaviridae infections
Aptamers targeting the spike glycoprotein and RNA-dependent RNA polymerase of coronaviruses inhibit infection and replication, addressing the limitations of current therapies and providing anticoagulant benefits, effectively treating and preventing coronavirus infections and long COVID symptoms.
Patent Information
- Application Number
- JP2025179523
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2021-04-09
- Filing Date
- 2025-10-24
- Publication Date
- 2026-02-10
AI Technical Summary
Current therapies are inadequate for treating and preventing infections caused by coronaviruses, particularly SARS-CoV-2, and associated long COVID symptoms, with a need for new agents that can safely target the spike protein and interfere with viral replication and entry into host cells, while also addressing microthrombosis and autoimmune responses.
Development of aptamers with specific nucleic acid sequences, such as SEQ ID NO: 1 (GGT TGG TGT GGT TGG), that selectively bind to the spike glycoprotein's receptor-binding domain and RNA-dependent RNA polymerase of coronaviruses, inhibiting infection and replication, and exhibiting anticoagulant effects.
The aptamers effectively inhibit viral entry and replication, reduce clotting time, and mitigate long COVID symptoms by blocking autoantibody interactions, providing a dual-mode treatment for coronavirus infections and their sequelae.
Smart Images

Figure 2026021387000002 
Figure 2026021387000003 
Figure 2026021387000004
Abstract
Description
[Technical Field]
[0001] The present invention relates to novel aptamer molecules for use in the treatment of infections caused by viruses from the Coronaviridae family, methods for preventing infections caused by viruses from the Coronaviridae family in vitro / ex vivo, pharmaceutical compositions and kits comprising such aptamer molecules, and the use of aptamer molecules for preventing infection of somatic cells by viruses from the Coronaviridae family. The present invention also relates to affinity molecules that bind to specific newly identified epitopes within key enzymes of Coronaviridae viruses. [Background technology]
[0002] The emergence of a novel, highly pathogenic coronavirus (SARS-CoV-2) and its rapid international spread have created a severe global public health emergency. Similar to patients infected with other pathogenic coronavirus strains, such as the 2003 severe acute respiratory syndrome coronavirus (SARS-CoV) and the 2012 Middle East respiratory syndrome coronavirus (MERS-CoV), patients infected with SARS-CoV-2 present with a variety of symptoms, including dry cough, fever, headache, dyspnea, and pneumonia, with an estimated mortality rate of 3%–5%.
[0003] Since its initial outbreak in December 2019, SARS-CoV-2 has spread to 212 countries, regions, and territories worldwide. As of April 8, 2020, there have been 1,317,130 confirmed cases of the virus worldwide, with 74,304 confirmed deaths among infected patients (https: / / www.who.int / emergencies / diseases / novel-coronavirus-2019).
[0004] Currently, various cities and countries around the world are under varying degrees of lockdown to minimize the continued spread, and the WHO has declared a Public Health Emergency of International Concern (PHEIC) in response to the rapid global spread of SARS-CoV-2.
[0005] Phylogenetic analysis of coronavirus genomes has revealed that SARS-CoV-2 is a new member of the Betacoronavirus genus, which includes SARS-CoV, MERS-CoV, bat SARS-related coronavirus (SARSr-CoV), and others identified in humans and various animal species.
[0006] Each coronavirus contains four structural proteins, including the spike (S) protein, envelope (E) protein, membrane (M) protein, and nucleocapsid (N) protein. Among them, the spike glycoprotein, or S protein, plays the most important role in viral attachment, fusion, and entry, and serves as the most promising target for the development of antibodies, entry inhibitors, and vaccines. The S protein mediates viral entry into host cells by first binding to a host receptor via the receptor-binding domain (RBD) in the S1 subunit and then fusing the viral membrane with the host membrane via the S2 subunit (Non-Patent Document 1). Thus, the homotrimeric spike glycoprotein on the viral envelope (the S1 and S2 subunits of each spike monomer) is used to bind to their cellular receptors. Such binding triggers a cascade of events leading to fusion between the cellular and viral membranes for cell entry.
[0007] The RBDs of SARS-CoV and MERS-CoV recognize different receptors. SARS-CoV recognizes angiotensin-converting enzyme 2 (ACE2) as its receptor, while MERS-CoV recognizes dipeptidyl peptidase 4 (DPP4) as its receptor. Similar to SARS-CoV, SARS-CoV-2 also binds ACE2 to the viral S protein. It recognizes the virus as a host receptor (Non-Patent Document 2).
[0008] Previous cryo-EM studies of the SARS-CoV spike and its interaction with its cellular receptor ACE2 have shown that binding to the ACE2 receptor on target somatic cells is a critical first step for SARS-CoV to enter target cells. Recent studies have also pointed to the important role of ACE2 in mediating SARS-CoV-2 entry (Non-Patent Documents 3 and 4).
[0009] HeLa cells expressing ACE2 are susceptible to SARS-CoV-2 infection, whereas HeLa cells lacking the receptor are not. In vitro binding assays also show that the SARS-CoV-2 receptor-binding domain (RBD) binds to ACE2 with affinity in the low nM range, indicating that the RBD is a key functional component within the S1 subunit of the spike glycoprotein responsible for binding of SARS-CoV-2 by ACE2.
[0010] More recently, it was demonstrated that SARS-CoV-2 also uses heparan sulfate as a cofactor or cell adhesion factor, enabling subsequent successful ACE-2-mediated cell entry. The prior contact of the RBD with heparan sulfate may function as a "virus collector" necessary for subsequent cellular uptake. Here, positively charged amino acids in the RBD of SARS-CoV-2 have been investigated as potential binding partners for heparan sulfate and heparin (Non-Patent Document 5).
[0011] In summary, the spike protein of each coronavirus is crucial for and associated with the infectivity and pathogenicity of the virus. At this stage, active research and development efforts are underway to identify new and additional agents that can be directed against the coronavirus spike protein and thus disrupt the infection process. While antibodies that selectively target this moiety could be developed, it would be more advantageous to identify (small) molecules that can pass phase I clinical trials and thus be safely administered to patients.
[0012] Furthermore, viruses and viral infection cycles have more vulnerable sites that could theoretically be attacked by agents. In the case of oligonucleotide-based drugs, also known as aptamers, several such critical sites susceptible to interference by such molecules have previously been identified and described. Additional potential target sites for drugs, including small molecules, antibody-derived biologics, and aptamers, are enzymes involved in the replication process of RNA viruses. Characterization of such novel target sites and affinity molecules directed against them will complement the toolkit for combating coronavirus infections.
[0013] An overview of antiviral active aptamers is given by Gonzalez et al. and Zou et al. (Non-Patent Document 6) and non-patent document 7).
[0014] Indeed, anti-coronavirus therapies have been reported based on the isolation of inhibitory RNA and DNA aptamers against the severe acute respiratory syndrome (SARS) coronavirus NTPase / helicase, respectively. Among these antiviral active aptamers, it should be mentioned that the anti-influenza aptamer A22 (-AATTAACCCTCACTAAAGGGCTGAGTCTCAAAACCGCAATACACTGGTTGTATGGTCGAATAAGTTAA; SEQ ID NO: 6) blocks the receptor-binding domain of hemagglutinin. In addition to viral cell entry mediators as targets of the present invention, other viral target binding sites, such as the nucleoprotein of influenza virus, have also been identified (Non-Patent Document 8).
[0015] Recent publications based on newly collected data from COVID-19 patients have shown that SARS -Suggests or even proves that CoV-2 reaches the bloodstream and various regions of the body where it appears to cause microthrombosis, which is now considered one of the main causes of death in COVID-19 patients (Non-Patent Documents 9, 10, 11).
[0016] During the course of the pandemic, for example, an Italian study revealed that a high proportion of patients (>85%) exhibited persistent symptoms even after recovery from COVID-19 (Non-Patent Document 12). Similar results regarding the severity of post-COVID-19 symptoms were confirmed in a German study that showed that more than 75% of COVID-19 patients surveyed exhibited post-illness symptoms (Non-Patent Document 13).
[0017] The complex of persistent symptoms observed after active SARS-CoV-2 infection and disease, COVID-19, has subsided is commonly referred to as post-COVID syndrome, long COVID, PASC (post-acute sequelae of SARS-CoV-2 infection), CCS (chronic COVID syndrome), or long-haul COVID.
[0018] These symptoms can include one or more neurological disorders such as chronic fatigue syndrome, postural orthostatic tachycardia syndrome (PoTS), dysautonomia, transverse myelitis, acute necrotizing myelitis, and Guillain-Barré syndrome, as well as cardiovascular effects such as myocardial inflammation, arrhythmias, tachycardia, bradycardia, and atrioventricular (AV) block (which may even progress to cardiac arrest).
[0019] Therefore, new therapeutic agents are needed not only for the prevention and treatment of active SARS-CoV-2 infection, but also for the prevention and treatment of symptoms that follow such infection in the form of long COVID. Interestingly, a relationship between long COVID and autoimmunity has recently been suggested. In this regard, it has been suggested that the autoimmune response induced by SARS-CoV-2 may be an important factor in the severity and longevity of this disease (long COVID) (Non-Patent Document 14).
[0020] Both new compounds and compositions could theoretically be used in a number of short-term, clinically relevant applications, including the alleviation and cure of symptoms caused by coronaviruses in patients. [Prior art documents]
Non-licensed literature
[0021] [Non-licensed document 1] Lu, G. et al. Nature 500, 227-231 (2013). [Non-licensed document 2] Zhou, P., et al. Nature 579, 270-273 (2020). [Non-licensed document 3] Walls, AC et al. Cell S0092-8674(20)30262-2 (2020). https: / / doi.org / 10.1016 / j.cell.2020.02.058.
Non-licensed Document 4
Non-licensed Document 5
Non-licensed Document 6
Non-licensed Document 7
Non-licensed literature 9
Non-licensed literature 10
Non-licensed Document 11
Non-licensed Document 12
Non-licensed Document 13
Non-licensed Document 14
[0022] It is therefore an object of the present invention to provide new molecules for use in the treatment of subjects suffering from or who have overcome an infection with a virus from the Coronaviridae family.
[0023] Yet another object of the present invention is to provide a method for preventing infection of somatic cells by viruses from the Coronaviridae family.
[0024] It is also an object of the present invention to provide pharmaceutical compositions and kits that can be used against such viral infections.
[0025] A further object of the present invention is to provide the use of the novel molecules for preventing infection of somatic cells by viruses from the Coronaviridae family.
[0026] Considering the recently recognized relevance of microthrombosis in the course of COVID-19 disease, the aim is also to provide new molecules that are effective against infections with viruses from the Coronaviridae family and at the same time exhibit anticoagulant effects.
[0027] It is a further object of the present invention to provide affinity molecules directed against novel target sites within the coronavirus replication machinery. [Means for solving the problem]
[0028] The above-mentioned objects are solved by the aspects of the present invention specified below.
[0029] According to a first aspect of the present invention there is provided an aptamer for use in treating a subject by treating, curing or preventing further progression of an infection by a virus from the Coronaviridae family, wherein the aptamer comprises the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence which is at least 80% identical to SEQ ID NO: 1.
[0030] In a preferred embodiment of the first aspect of the invention, the subject is a mammal, preferably the subject is a human.
[0031] In one preferred embodiment of the first aspect of the invention, the infection is caused by a virus from the genus Betacoronavirus, preferably from the subgenus Sarbecovirus or Merbecovirus. Thus, more preferably, it is caused by a virus selected from the group comprising MERS-CoV, SARS-CoV and SARS-CoV-2.
[0032] In another preferred embodiment of the first aspect of the present invention, the infection is caused by a virus from the subgenus Sarbecovirus, preferably a virus from the species Severe Acute Respiratory Syndrome-Associated Coronavirus, even more preferably one of SARS-CoV and SARS-CoV-2.
[0033] In a particularly preferred embodiment of the first aspect of the invention, the infection is caused by SARS-CoV-2.
[0034] In one preferred embodiment of the first aspect of the present invention, the aptamer has anticoagulant activity, preferably the aptamer is capable of extending the clotting time, measured as partial thromboplastin time (PTT or alternatively aPTT), of human calibration plasma to 60 seconds or more at an aptamer concentration of 0.03 mg / ml, and / or the aptamer is capable of reducing the prothrombin time (Quick value) of human calibration plasma to 40% or less at an aptamer concentration of 0.03 mg / ml.
[0035] In another preferred embodiment of the first aspect of the present invention, the aptamer selectively interacts with or binds to human thrombin, preferably with a K D The value is less than 1 μM.
[0036] In preferred embodiments of the first aspect of the present invention, the aptamer interferes with infection of somatic cells by selectively interacting with the viral spike (S) glycoprotein, preferably with the receptor binding domain (RBD) of the spike (S) glycoprotein, more preferably by blocking or disrupting the interaction of the viral spike glycoprotein with angiotensin-converting enzyme 2 (ACE2) or dipeptidyl peptidase 4 (DPP4), even more preferably with ACE2, of the subject's host cells.
[0037] In more preferred embodiments of the previous embodiments of the first aspect of the invention, the receptor binding domain of the spike glycoprotein has the sequence of SEQ ID NO:2 (SARS-CoV-2 spike RBD) or SEQ ID NO:3 (SARS-CoV spike RBD) or SEQ ID NO:4 (MERS-CoV spike RBD), preferably the receptor binding domain of the spike glycoprotein has the sequence of SEQ ID NO:2 or SEQ ID NO:3, preferably the spike glycoprotein has the sequence of SEQ ID NO:2.
[0038] In one preferred embodiment of the invention, the aptamer is administered to the subject by systemic or pulmonary delivery, preferably by pulmonary delivery, more preferably by inhalation.
[0039] According to a second aspect of the present invention there is provided an aptamer for use in treating a subject by treating, curing or preventing disease symptoms associated with long COVID in patients who have survived infection with a virus from the Coronaviridae family, wherein the aptamer comprises the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence which is at least 80% identical to SEQ ID NO: 1.
[0040] In a preferred embodiment of the second aspect, the disease symptoms comprise one or more from the group comprising neurological symptoms such as chronic fatigue syndrome, postural orthostatic tachycardia syndrome (PoTS), dysautonomia, tremor, attention deficit, anomia, neuropathy, transverse myelitis, acute necrotizing myelitis, and Guillain-Barré syndrome; cardiovascular symptoms such as myocardial inflammation, arrhythmias, tachycardia, bradycardia, hypertension, and atrioventricular (AV) block; skin symptoms such as alopecia and eczema; or gastrointestinal disorders.
[0041] In another preferred embodiment of the second aspect of the invention, aptamers are used to inhibit the interaction of autoantibodies specific for G protein-coupled receptors with their target proteins.
[0042] In yet another preferred embodiment of the second aspect of the invention, the aptamer is for use in treating patients in which autoantibodies against G protein-coupled receptors can be detected.
[0043] In a preferred embodiment of the second aspect of the present invention, the patient exhibits functional autoantibodies against G protein-coupled receptors, preferably specific for any one of the human G protein-coupled receptors adrenergic alpha-1 receptor, adrenergic beta-2 receptor, endothelin 1 ETA receptor, muscarinic M2 receptor, angiotensin II AT1 receptor, MAS receptor and / or nociceptin receptor, more preferably specific for any one of adrenergic beta-2 receptor, muscarinic M2 receptor, angiotensin II AT1 receptor and MAS receptor, and particularly preferably the patient exhibits an antibody pattern comprising functional autoantibodies specific for each of the adrenergic beta-2 receptor, muscarinic M2 receptor, angiotensin II AT1 receptor and MAS receptor.
[0044] According to a third aspect of the present invention, there is provided a method for preventing infection of somatic cells by a virus from the Coronaviridae family using an aptamer, wherein the method is performed in vitro / ex vivo and the aptamer comprises the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence which is at least 80% identical to SEQ ID NO: 1.
[0045] In a preferred embodiment of the third aspect of the invention, the cell is a mammalian cell, preferably the cell is a human cell.
[0046] According to a fourth aspect of the present invention there is provided a pharmaceutical composition comprising an aptamer for use according to the first aspect of the present invention and at least one pharmaceutically acceptable excipient.
[0047] In a preferred embodiment of the fourth aspect of the present invention, the pharmaceutical composition for use according to the first aspect is for administration to a subject by systemic or pulmonary delivery, preferably pulmonary delivery, more preferably inhalation.
[0048] According to a fifth aspect of the present invention there is provided a kit comprising at least one aptamer for use according to the first aspect of the present invention and a container.
[0049] According to a sixth aspect of the present invention there is provided the use of an aptamer according to the first aspect of the present invention for preventing infection of somatic cells by viruses from the Coronaviridae family, wherein the aptamer is used in vitro / ex vivo.
[0050] According to a seventh aspect of the present invention, there is provided an affinity molecule that specifically binds to a peptide having the amino acid sequence Leu-Tyr-Arg-Asn-Arg-Asp-Val (LYRNRDV; SEQ ID NO: 9) and / or His-Arg-Phe-Tyr-Arg-Leu-Ala-Asn (HRFYRLAN; SEQ ID NO: 10) of severe acute respiratory syndrome coronavirus 2 RNA-dependent RNA polymerase.
[0051] In a preferred embodiment of the seventh aspect of the present invention, the affinity molecule has a maximum Preferably, the affinity molecule is a small molecule having a molecular weight of 900 Daltons, more preferably, the affinity molecule is selected from the University of Cincinnati Compound Collection, DiscoveryProbe™ Bioactive Compound Library Plus from ApexBio Technology LLC, and SARS-CoV-2 Scripps from Cayman Chemical. The small molecule is from any one of the collections of small molecules from the group comprising the Looking Library.
[0052] In another preferred embodiment of the seventh aspect of the invention, the affinity molecule is a peptide-based compound, more preferably an antibody or a binding fragment thereof.
[0053] In a preferred embodiment of the seventh aspect of the present invention, the affinity molecule is an aptamer or an oligonucleotide.
[0054] In an eighth aspect of the present invention, there is provided the affinity molecule of the seventh aspect for use as a medicament.
[0055] In a ninth aspect of the present invention there is provided an affinity molecule of the seventh aspect for use in treating a subject by treating, curing or preventing further progression of an infection with a virus from the Coronaviridae family. [Brief explanation of the drawings]
[0056] [Figure 1]Figure 1 shows NMR analysis of quadruplex formation of BC007 in the presence of peptide no. 4 (6 aa peptide sequence of SEQ ID NO: 5; YRLFRK) from the spike protein of SARS-CoV-2. Top spectrum: H-NMR spectrum of a 1:1 mixture of BC007 and peptide no. 4 with sequence YRLFRK; middle spectrum: spectrum of peptide no. 4 of SEQ ID NO: 5 in pure water; bottom spectrum: spectrum of quadruplex structure of BC007 in the presence of KCl. [Figure 2] This shows the same spectra as in Figure 1, but expanded to cover the range from 8.5 ppm to 6.0 ppm. Middle and bottom: The pure substances show fairly sharp signals, but the interaction of the two substances with each other broadens and shifts their position in the top spectrum. [Figure 3] FIG. 1 shows the inhibition of SARS-CoV-2 replication by BC007 in cell culture, based on the antiviral dose-response effect of BC007 in VeroFM and Calu-3 cells. [Figure 4] FIG. 1 shows an ELISA test of the binding of the aptamer BC007 (SEQ ID NO: 1) of the invention to immobilized human thrombin. [Figure 5] FIG. 1 shows the results of measurements of coagulation inhibition caused by aptamers BC007 (SEQ ID NO: 1) and AS1411 (SEQ ID NO: 7), measured as (A) partial thromboplastin time (PTT) and (B) prothrombin time (Quick) values, respectively. [Figure 6] Figure 1 shows NMR analysis of quadruplex formation of BC007 in the presence of peptide LYRNRDV (top; SEQ ID NO: 9) and peptide HRFYRLAN (bottom; SEQ ID NO: 10) of SARS-CoV-2 RNA-dependent RNA polymerase (full-length sequence of SEQ ID NO: 8), both peptides were able to induce quadruplex folding indicating successful and specific binding. [Figure 7] Figure 1 shows an ITC (Isothermal Titration Calorimetry) analysis of BC007 titrated with peptide HRFYRLAN (SEQ ID NO: 10) of the RNA-dependent RNA polymerase of SARS-CoV-2; top - thermogram; bottom - binding isotherm. [Figure 8] Figure 1 shows an ITC analysis of BC007 titrated with a comparative highly charged peptide control sequence NRKRISN (SEQ ID NO: 11), which is also present in the spike RBD of SARS-CoV-2; top - thermogram; bottom - binding isotherm. [Figure 9] FIG. 1 shows a comparison of the NMR analysis of BC007 in the presence of the control peptide NRKRISN (SEQ ID NO: 11) and peptide number 4 (SEQ ID NO: 5; YRLFRK) from the spike protein of SARS-CoV-2. [Figure 10] FIG. 1 shows an overview of long COVID symptoms and associated GPCR autoantibodies in patient serum. [Figure 11]Bioassay measurements of functionally active autoantibodies targeting G protein-coupled receptors from serum of patients suffering from post-COVID symptoms. A: Positive chronotropic autoantibodies against the beta2-adrenergic receptor (beta2-R), nociceptin receptor (nociceptin-R), angiotensin II AT1 receptor (AT1), and alpha1-adrenergic receptor (alpha1-R); these measurements were performed in the presence of the antagonists atropine, A779, and BQ123, which block antibodies that exert negative chronotropic effects; preincubation with aptamer BC007 abolished functional activity. Controls were samples from healthy donors. B: Negative chronotropic autoantibodies against the MAS receptor (MAS-R), muscarinic M2 receptor (M2-R), and endothelin receptor (ETA-R); here, the activity of positive chronotropic autoantibodies was blocked by ICI118.551, J113397, losartan, and urapidil; preincubation with the aptamer BC007 abolished functional activity. Controls were samples from healthy donors; Neuro* = neurological symptoms; Cardiovasc** = cardiovascular symptoms, na = not applicable, PoTS = postural orthostatic tachycardia syndrome; NOC-fAAB§ = functionally active autoantibodies against nociceptin receptors, β2-fAAB$ = autoantibodies targeting beta1-adrenergic receptors, α1-fAAB& = autoantibodies targeting alpha1-adrenergic receptors, ETA-fAAB+ = autoantibodies targeting endothelin receptors, M2-fAAB% = autoantibodies targeting muscarinic receptors, AT1-fAAB? = autoantibodies targeting angiotensin II AT1 receptors, MAS-fAAB# = autoantibodies targeting MAS receptors. DETAILED DESCRIPTION OF THE INVENTION
[0057] The present invention is based on the identification of novel compounds that can selectively interact with the spike proteins of coronavirus family viruses and are therefore expected to interfere with the infection of somatic cells by such viruses. Furthermore, the inventors have succeeded in recognizing that certain aptamer molecules can inhibit the infection activity and replication of such viruses in human cells.
[0058] The present inventors have intensively studied the interaction of the aptamer of SEQ ID NO: 1, commonly referred to as the thrombin-binding aptamer or BC007, with several binding partners, including thrombin. While investigating the specificity of the interaction between BC007 and thrombin using NMR techniques, we were able to detect that strong binding to BC007 does not require the entire full-length thrombin molecule, as evidenced by the adoption of an NMR-detectable quadruplex structure by BC007.
[0059] Indeed, it was recognized that much shorter peptide sequences derived from the binding moiety lead to the same results (data not shown). Indeed, peptides taken from full-length thrombin that trigger the quadruplex fold of BC007 were found to consist of or have sequence motifs containing several amino acids with positively charged side chains, preferably arginine. These peptides may represent solvent-facing surfaces due to their positive charge that can be selectively bound by the claimed aptamers on thrombin as well as other proteins, such as the spike proteins of viruses from the coronavirus family.
[0060] Faced with the problems posed by the current pandemic of SARS-CoV-2 and other coronavirus-related infections, the inventors investigated whether the claimed aptamer molecules could function as agents against coronavirus infections.
[0061] Surprisingly, the inventors learned that the spike proteins of different coronavirus strains, particularly sequences belonging to their receptor-binding domains, have sequence motifs containing several amino acids with positively charged side chains, such as arginine-rich clusters (see Non-Patent Document 4, supra).
[0062] Based on this information, together with substantial experience gained from studying the interaction of specific aptamers with thrombin, the inventors have succeeded in identifying representative clusters of positively charged amino acids and arginine-rich sequence sections (clusters etc.) within the receptor-binding domain of the spike protein of the SARS-CoV-2 virus, as well as previously unknown target peptides within the RNA-dependent RNA polymerase of coronavirus family viruses.
[0063] Peptide No. 4 (having the amino acid sequence YRLFRK; SEQ ID NO: 5), which is part of the receptor-binding domain of the S1 subunit of the spike protein of SARS-CoV-2, was selected as a representative peptide for binding studies with BC007. Surprisingly, we observed that there was indeed a strong interaction between Peptide No. 4 and BC007, which caused BC007 to adopt a quadruplex fold (see Figures 1 and 2, and Example 1 in the Examples section below).
[0064] Such a strong interaction is highly plausible and likely persists throughout the full-length molecule, the entire spike protein, and the entire virus particle, where the spike protein is responsible for infectivity and pathogenicity of coronaviruses. It is also believed that the present invention will be useful against other such viruses based on the presence of positively charged amino acid clusters in the spike proteins of other virus strains from the coronavirus family.
[0065] Starting from this evidence of a strong interaction between the aptamers of the present invention and the spike sequence motif of SARS-CoV-2, the inventors proceeded to analyze the inhibitory activity of the aptamers of the present invention against human cells infected with SARS-CoV-2.
[0066] Surprisingly, the aptamers of the present invention not only demonstrated highly efficient inhibition of SARS-CoV-2 viral activity, but actually appeared to outperform other antiviral agents currently under discussion as potential treatment options for COVID-19 (see Example 2).
[0067] These results clearly reflect the therapeutic efficacy on which the therapeutic application of the use of the aptamers of the present invention in the treatment, cure or prevention of infections with viruses of the coronavirus family is based.
[0068] In addition to the observed effects, G-quadruplex oligonucleotide structures have previously been reported to not only inhibit HIV entry into host cells (ISIS5320) but also inhibit HIV integrase itself (T30177 or AR177, the first integrase inhibitor in clinical trials), thereby causing the generation of antiviral effects in, for example, HIV infection (for review, see Roxo, C., et al., 2019. G-Quadruplex-Forming Aptamers - Characteristics, Applications, and Perspectives. Molecules 24. https: / / doi.org / 10.3390 / molecules24203781).
[0069] HIV, like SARS-CoV-2 and other members of the coronavirus family, is an ssRNA virus, meaning that the steps in viral replication are equivalent. Therefore, it is possible that HIV may adopt a G-quadruplex-like fold in interactions with binding partners. It is highly likely that the claimed aptamers may also inhibit SARS-CoV-2 integrase or other vulnerable sites in addition to directly interacting with the spike protein.
[0070] Furthermore, recent data indicate a significant association of microthrombosis in the mortality of patients with COVID-19, and molecules with antithrombotic and anticoagulant effects are being investigated in the context of coronavirus infections. The ability of the presently claimed aptamer molecules to combat infection by viruses from the coronavirus family and simultaneously exhibit anticoagulant effects makes the present invention even more suitable for use against COVID-19 and other coronavirus-related diseases.
[0071] This is a particular advantage of the aptamers of the present invention over other aptamers recently proposed as therapeutic agents against COVID-19, such as aptamer AS1411 (SEQ ID NO: 7). Such comparative aptamers lack any antithrombotic or anticoagulant effects and therefore lack the dual-mode attack of the present invention. AS1411 was originally developed as a synthetic DNA molecule that binds to a protein called nucleolin, which is found on the surface of cells. Based on this activity, AS1411 has previously been investigated as an investigational drug for the treatment of cancer.
[0072] According to one aspect of the present invention, there is provided an aptamer for use in treating a subject by treating, curing or preventing further progression of an infection with a virus from the Coronaviridae family, wherein the aptamer comprises the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1.
[0073] Within the scope of the present invention, use in the treatment of infection by a virus is also intended to mean that initial infection in a subject can be prevented by the aptamer for use according to the present invention, and more importantly, the aptamer for use according to the present invention is intended to be used to treat, cure or prevent further progression of infection in a subject identified as infected with a virus from the Coronaviridae family.
[0074] As discussed above, with respect to the new findings of [5], it is plausible that the aptamer of SEQ ID NO: 1 may also compete with the heparin-binding motif of the RBD. This aptamer has already been reported to selectively interact with the heparin-binding motif of thrombin (exosite 2; see Padmanabhan and Tulinsky, 1996 Acta Crystallogr D Biol Crystallogr 52:272-282), in addition to its well-known and investigated binding to exosite 1, the fibrinogen-binding site of thrombin. Due to the increased presence of negatively charged amino acids at such heparin-binding sites, binding of SEQ ID NO:1 at the heparin-binding site of the RBD of SARS-CoV-2 appears plausible, similar to the known binding of thrombin to the heparin-binding motif.
[0075] According to one embodiment of the invention, the aptamer further interferes with infection of somatic cells by selectively interacting with cellular heparan sulfate of the subject's host cells.
[0076] According to a preferred embodiment of the present invention, the subject to be treated, cured or prevented from further progression of a viral infection is a vertebrate, more preferably the subject is a mammal. Within the meaning of the present invention, the group of mammals includes, but is not limited to, rats, mice, ferrets, rabbits, cats, dogs, horses, cattle, cows, pigs, sheep, non-human primates and humans. Most preferably, the subject is a human.
[0077] In a preferred embodiment of the present invention, the aptamer of the present invention as disclosed and described herein has the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG), and / or comprises a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1. In another more preferred embodiment, the aptamer consists of the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGTGT GGT TGG).
[0078] The determination of percent identity between two sequences, according to the present invention, can be performed using the mathematical algorithm of Karlin and Altschul (Proc. Natl. Acad. Sci. USA (1993) 90: 5873-5877). Such an algorithm is the basis for the BLASTN and BLASTP programs of Altschul et al. (J. Mol. Biol. (1990) 215: 403-410). The fragment searches are performed with the BLASTN program. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described by Altschul et al. (Nucleic Acids Res. (1997) 25: 3389-3402). BLAST and Gapped When using BLAST programs, the default parameters of each program are used.
[0079] According to a more preferred embodiment of the present invention, aptamer sequences consisting of or comprising nucleic acid sequences that are at least 85% identical, even more preferably at least 90% identical, and particularly preferably at least 95% identical to the individual aptamer sequences disclosed herein form part of the present invention.
[0080] For the purposes of the present invention, the term "aptamer" refers to an oligonucleotide that specifically and with high affinity binds to a target molecule. Under defined conditions, aptamers can fold into specific three-dimensional structures. In one preferred embodiment of the present invention, the claimed aptamer interacts with target sequences specifically and with high affinity.
[0081] According to a preferred embodiment, the aptamer interacts with a sequence within the spike glycoprotein of a virus from the Coronaviridae family, preferably a sequence within the S1 subunit, more preferably a sequence within its receptor-binding domain. According to one embodiment of the invention, the aptamer binds to a region within the viral sequence that has two or more positively charged amino acids, more preferably arginines, within a stretch of seven amino acids.
[0082] Aptamers of the present invention are nucleic acid molecules, i.e., comprise or consist solely of a sequence of nucleotides. According to a preferred embodiment, aptamers of the present invention consist solely of the nucleotide sequences defined herein.
[0083] The aptamer of the present invention preferably comprises unmodified and / or modified D-nucleotides and / or L-nucleotides. According to the common single-letter notation of nucleic acid bases, if the nucleotide sequence is a DNA sequence, "C" represents cytosine, "A" represents adenine, "G" represents guanine, and "T" represents thymine, and if the nucleotide sequence is an RNA sequence, "T" represents a uracil nucleotide. Unless otherwise indicated below, the term "nucleotide" refers to ribonucleotides and desoxyribonucleotides.
[0084] The aptamers of the present invention comprise or consist of DNA or RNA nucleotide sequences, and therefore may be referred to as DNA or RNA aptamers, respectively. When the aptamers of the present invention comprise RNA nucleotide sequences, "T" is understood to represent uracil within the sequence motifs specified throughout the present invention.
[0085] For the sake of simplicity, only explicit DNA nucleotide sequences are mentioned throughout the present invention, however, it is understood that the respective RNA nucleotide sequences are also encompassed by the present invention.
[0086] According to one embodiment, DNA aptamer is preferred to be used.DNA aptamer is usually more stable than RNA aptamer in plasma.However, according to alternative embodiment, RNA aptamer is preferred.According to another embodiment, single-stranded nucleotide sequence is preferred.According to another alternative embodiment, double-stranded nucleotide sequence is preferred.
[0087] Aptamers of the invention can comprise nucleotide sequences having 2'-modified nucleotides, such as 2'-fluoro-modified nucleotides, 2'-methoxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, and / or 2'-amino-modified nucleotides. Aptamers of the invention can also comprise mixtures of desoxyribonucleotides, modified desoxyribonucleotides, ribonucleotides, and / or modified ribonucleotides. The terms "2'-fluoro-modified nucleotides," "2'-methoxy-modified nucleotides," "2'-methoxyethyl-modified nucleotides," and / or "2'-amino-modified nucleotides" refer to modified ribonucleotides and modified desoxyribonucleotides, respectively.
[0088] The aptamers of the present invention may contain modifications. Such modifications include, for example, alkylation, i.e., methylation, arylation, or acetylation, of at least one nucleotide, inclusion of an enantiomer, and / or fusion of the aptamer with one or more other nucleotides or nucleic acid sequences. Such modifications may include, for example, 5'-PEG and / or 3'-PEG modifications, or 5'-CAP and / or 3'-CAP modifications. Alternatively or additionally, the aptamers of the present invention may contain modified nucleotides, preferably selected from locked nucleic acids, 2'-fluoro-modified nucleotides, 2'-methoxy-modified nucleotides, and / or 2'-amino-modified nucleotides.
[0089] Locked nucleic acids (LNAs) represent conformationally locked analogs of individual RNA nucleotides. Locked nucleic acid oligonucleotides contain one or more bicyclic ribonucleosides, the 2'-OH group of which is linked to the C4 carbon atom via a methylene group. Locked nucleic acids exhibit improved nuclease stability compared to their unmodified RNA aptamer counterparts. They also exhibit improved hybridization properties, which allows for increased affinity and specificity of the aptamer.
[0090] Another preferred modification is the addition of so-called 3'-CAP structures, 5'-CAP structures, and / or modified guanosine nucleotides (e.g., 7-methyl-guanosine) to the 3'- and / or 5'-ends of the aptamer. Such modifications at the 3'- and / or 5'-ends have the effect of protecting the aptamer from rapid degradation by nucleases.
[0091] Alternatively or additionally, the aptamer of the present invention may exhibit a pegylated 3'- or 5'-terminus. The 3'- or 5'-PEG modification comprises the addition of at least one polyethylene glycol (PEG) unit, preferably the PEG group having 1 to 900 ethylene groups, more preferably 1 to 450 ethylene groups. In a preferred embodiment, the aptamer is HO-(CHCHO) n It has a linear PEG unit having —H (wherein n is an integer of 1 to 900, preferably n is an integer of 1 to 450).
[0092] The aptamers of the present invention may be configured in whole or in part as peptide nucleic acids (PNAs). Aptamers according to the present invention may further be described in detail in Keefe AD et al., Nat Rev Drug Discov. 2010 Jul;9(7):537-50, or Mayer G, Angew Chem Int Ed Engl. 2009;48(15):2672-89, or Mayer, G. and Famulok M., Pharmazie in unserer Zeit 2007;36:432-436. It can be modified so that
[0093] The term "oligonucleotide" generally refers to a polynucleoside containing a plurality of linked nucleoside units. Such oligonucleotides can be obtained from existing nucleic acid sources, including genomic DNA or cDNA, but are preferably produced by synthetic methods. In preferred embodiments, each nucleoside unit can contain various chemical modifications and substituents, including, but not limited to, modified nucleoside bases and / or modified sugar units, compared to wild-type oligonucleotides.
[0094] Examples of chemical modifications are known to those skilled in the art and are described, for example, in Uhlmann, E. et al. (1990) Chem. Rev. 90:543, "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed., Humana Press, Totowa, USA 1993, and Hunziker, J. et al. (1995) Mod. Syn. Methods 7:331-417, and Crooke, S. et al. (1996) Ann. Rev. Pharm. Tox. 36:107-129.
[0095] The nucleoside residues can be linked to one another by any of a number of known internucleoside linkages, including, but not limited to, phosphodiester, phosphorothioate, phosphorodithioate, alkylphosphonate, alkylphosphonothioate, phosphotriester, phosphoramidate, siloxane, carbonate, carboalkoxy, acetamidate, carbamate, morpholino, borano, thioether, bridged phosphoramidate, bridged methylene phosphonate, bridged phosphorothioate, and sulfone internucleoside linkages, particularly to improve the stability of the oligonucleotide against enzymatic degradation, e.g., by nucleases.
[0096] The term "oligonucleotide" also includes polynucleosides having one or more stereospecific internucleoside linkages (e.g., (Rr)- or (Sr)-phosphorothioate, alkylphosphonate, or phosphotriester linkages). As used herein, the terms "oligonucleotide" and "dinucleotide" are intended to include polynucleosides and dinucleosides having any such internucleoside linkages, whether or not the linkages contain phosphate groups. In certain preferred embodiments, these internucleoside linkages can be phosphodiester, phosphorothioate, or phosphorodithioate linkages, or combinations thereof; more preferably, the internucleoside linkages are phosphorothioates.
[0097] Furthermore, the aptamers can be encapsulated in a suitable vehicle to protect their structural integrity as well as to facilitate their delivery into cells. Preferred vehicles include liposomes, lipid vesicles, microparticles, and the like.
[0098] One advantage of modifying the aptamer of the present invention by one of the above-mentioned methods is that the aptamer can be stabilized against harmful influences, such as nucleases, present in the environment in which the aptamer is used.These modifications are also suitable for adjusting the pharmacological properties of the aptamer.These modifications preferably do not change the affinity or specificity of the aptamer.
[0099] The aptamers of the present invention can also be conjugated to carrier molecules and / or reporter molecules. Carrier molecules include molecules that, when conjugated to an aptamer, extend the plasma half-life of the conjugated aptamer in human plasma, for example, by improving stability and / or affecting the excretion rate. One example of a suitable carrier molecule is PEG.
[0100] Reporter molecules include molecules that allow for the detection of the conjugated aptamer. Examples of such reporter molecules are GFP, biotin, cholesterol, dyes, such as fluorescent dyes, electrochemically active reporter molecules, and / or radioactive moieties, in particular radionuclides suitable for PET (positron emission tomography) detection, such as 18 F, 11 C. 13 N, 15 O. 82 Rb, or 68 Compounds that contain a radionuclide such as Ga. Those skilled in the art will be familiar with suitable carrier and reporter molecules and how to conjugate them to the aptamers of the invention.
[0101] In a preferred embodiment of the first aspect of the present invention, the aptamer of the present invention has anticoagulant activity, which preferably means antithrombotic activity, and is preferably understood to prevent or reduce microthrombosis.
[0102] More preferably, the aptamers of the invention are capable of extending the clotting time, measured as partial thromboplastin time (PTT or alternatively aPTT), of human calibrator plasma by at least 60 seconds at an aptamer concentration of 0.03 mg / ml. According to one embodiment of the invention, the aptamers of the invention are capable of extending the clotting time, measured as partial thromboplastin time, of human calibrator plasma by at least 40 seconds, more preferably at least 50 seconds, at an aptamer concentration of 0.03 mg / ml. According to one preferred embodiment, the aptamers of the invention extend the partial thromboplastin time of human calibrator plasma more than aptamer AS1411 (SEQ ID NO: 7).
[0103] Even more preferably, the aptamer can reduce the prothrombin time (Quick value) of human calibration plasma by 40% or less at an aptamer concentration of 0.03 mg / ml. According to one embodiment of the present invention, the aptamer of the present invention can reduce the prothrombin time (Quick value) of human calibration plasma by 80% or less, more preferably 70% or less, even more preferably 60% or less, and particularly preferably 50% or less at an aptamer concentration of 0.03 mg / ml. According to one preferred embodiment, the aptamer of the present invention reduces the prothrombin time (Quick value) of human calibration plasma more than aptamer AS1411 (SEQ ID NO: 7).
[0104] According to one preferred embodiment, the PTT time is assessed by using the test described in the Examples section below. Alternatively, preferably, the PTT time and / or Quick value are assessed as commonly known in the art. As a calibration plasma, any human reference plasma from a healthy individual can be used, preferably HemosIL human calibration plasma (Instrumentation Laboratory, Werfen).
[0105] In another preferred embodiment of the first aspect of the present invention, the aptamer selectively interacts with or binds to human thrombin, preferably with a K of binding of the aptamer to human thrombin of less than 1000 kJ / s. DThe value is 1 μM or less, and more preferably, D The value is 100 nM or less, and even more preferably, D The value is less than 10 nM. D Values are preferably calculated using a dilution series of human thrombin (ranging from 1 pM to 1000 nM) in a dot blot binding assay and applying the formula (fraction of aptamer binding = amplitude) representing a 1:1 NA:protein complex to the resulting data. * ((thrombin) / (K D +(Thrombin)))(KaleidaGraph v.3.51, Synergy Software, Reading, PA).
[0106] Within the scope of the present invention, selective or specific binding or interaction between two molecules preferably means that the two recited molecules bind or interact with an affinity that is increased by at least 10-fold, more preferably at least 50-fold, and particularly preferably at least 100-fold, compared to unrelated non-interacting or non-binding molecules as binding partners. It can mean:
[0107] The aptamers of the present invention are useful for treating infections caused by virus strains from the Coronaviridae family. In the context of the present invention, the aptamers are considered to be useful not only for animal subjects but also for human subjects. According to one embodiment, the aptamers are intended for use in human subjects. According to another embodiment, the aptamers are intended for use in animal subjects.
[0108] By inhibiting infection by coronavirus, the potentially harmful effects of coronavirus infection may be neutralized and reduced, and any disease symptoms may be eliminated or reduced to normal levels. As a result, the extent and severity of disease caused by or associated with coronavirus infection may be significantly reduced. Thus, the present invention provides aptamers suitable for use in treating diseases or symptoms associated with coronavirus infection.
[0109] According to another embodiment of the present invention, there is provided a method for preventing infection of somatic cells by a virus from the Coronaviridae family by using an aptamer according to the present invention. In a preferred embodiment, the method for preventing infection comprises treating, curing, or preventing the progression of an infection by a virus from the Coronaviridae family in a subject.
[0110] In a preferred embodiment of the present invention, the method is carried out in vitro / ex vivo. More preferably, the cells to be contacted with the aptamer according to the method of the present invention are not part of a whole living organism. In one embodiment, the cells to be contacted can be cultured in a cell culture. Such culture of individual cells or cell groups can be carried out as is commonly done in the art.
[0111] In another preferred embodiment of the method of the present invention, the method can be performed in vivo and / or on cells that are part of a whole living organism. According to this embodiment, the contacted cells, tissues, or organs have previously been diagnosed as infected with a virus from the Coronaviridae family. Preferably, the cells treated according to the present invention belong to the gastrointestinal tract or the respiratory tract, more preferably belong to the respiratory tract, and more preferably lung cells are treated.
[0112] The present invention also relates to an aptamer for use in treating a subject by treating, curing or preventing disease symptoms associated with long COVID in patients who have survived infection with a virus from the Coronaviridae family, wherein the aptamer comprises the nucleic acid sequence of SEQ ID NO: 1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 1.
[0113] Long COVID is a condition or symptom complex observed in patients who have survived infection with a virus from the coronavirus family. While the associated symptom complex is still under investigation, it is increasingly clear that symptoms prevail even after symptoms of active infection have disappeared.
[0114] Based on the experimental data also contained herein, it has become clear that many of these symptoms observed in patients who have endured active SARS-CoV-2 infection are associated with the presence of functional autoantibodies (Figure 10). Because the aptamers of the present invention have previously been demonstrated to have inhibitory activity against such functional autoantibodies (also demonstrated in Figure 11 herein), it can be assumed that the aptamers of the present invention will have activity against such symptoms grouped as long COVID.
[0115] In any event, the symptoms summarized herein as long COVID are likely to be similar to those of SARS-CoV-2. - are considered late or delayed effects of infection with coronaviruses, such as CoV-2. In this regard, the particular effect of the aptamers of the invention against long COVID can be seen as part of the treatment of infection with viruses from the coronavirus family, such as SARS-CoV-2, as described and claimed herein.
[0116] In one embodiment, the disease symptoms comprise one or more from the group comprising neurological symptoms such as chronic fatigue syndrome, postural orthostatic tachycardia syndrome (PoTS), dysautonomia, tremor, attention deficit, anomia, neuropathy, transverse myelitis, acute necrotizing myelitis, and Guillain-Barré syndrome; cardiovascular symptoms such as myocardial inflammation, arrhythmias, tachycardia, bradycardia, hypertension, and atrioventricular (AV) block; skin symptoms such as alopecia and eczema; or gastrointestinal disorders.
[0117] Preferably, the aptamer is used to inhibit the interaction of an autoantibody specific to a G protein-coupled receptor with its target protein, and preferably, the aptamer is for use in treating patients in whom autoantibodies to a G protein-coupled receptor can be detected.
[0118] In one embodiment of the invention, the patient to be treated exhibits functional autoantibodies against G protein-coupled receptors, preferably specific for any one of the human G protein-coupled receptors adrenergic alpha-1 receptor, adrenergic beta-2 receptor, endothelin 1 ETA receptor, muscarinic M2 receptor, angiotensin II AT1 receptor, MAS receptor and / or nociceptin receptor, more preferably specific for any one of adrenergic beta-2 receptor, muscarinic M2 receptor, angiotensin II AT1 receptor, MAS receptor, and particularly preferably, the patient exhibits an antibody pattern comprising functional autoantibodies specific for each of the adrenergic beta-2 receptor, muscarinic M2 receptor, angiotensin II AT1 receptor, and MAS receptor.
[0119] The present invention also relates to a pharmaceutical composition comprising at least one aptamer of the invention and, optionally, at least one pharmaceutically acceptable excipient. The present invention also relates to a pharmaceutical composition comprising an aptamer of the invention or a mixture of different aptamers of the invention and a pharmaceutically acceptable excipient, such as a suitable carrier or diluent.
[0120] Preferably, the aptamer of the present invention constitutes the active ingredient of the pharmaceutical composition and / or is present in an effective amount. The term "effective amount" refers to an amount of the aptamer of the present invention that has a prophylactic, diagnostic, or therapeutically significant effect against a disease or condition. A prophylactic effect prevents the onset of the disease. A therapeutically significant effect alleviates one or more symptoms of the disease to some extent, or partially or completely normalizes one or more physiological or biochemical parameters associated with or causing the disease or condition.
[0121] The respective amounts for administering the aptamers of the present invention are sufficiently high to achieve the desired preventive, diagnostic, or therapeutic effect. Those skilled in the art will understand that the specific dose level, frequency, and duration of administration to any particular mammal will depend on a variety of factors, including the activity of the specific components used, age, body weight, general health, sex, diet, administration time, administration route, drug combination, and the strength of the specific therapy. Using well-known means and methods, those skilled in the art can determine the exact amount as a matter of routine experimentation.
[0122] According to one embodiment of the pharmaceutical composition of the present invention, at least 20%, preferably at least 50%, more preferably at least 75%, and most preferably at least 95% of the total aptamer content is composed of the aptamer of the present invention.
[0123] When used for treatment, the pharmaceutical composition will generally be administered as a formulation optionally combined with one or more pharmaceutically acceptable excipients. The term "excipient" is used herein to describe any component other than the aptamer of the present invention. The choice of excipient will largely depend on the specific mode of administration. The excipient may be a suitable carrier and / or diluent.
[0124] The pharmaceutical composition of the present invention can be preferably administered orally or intravenously. According to one preferred embodiment, the pharmaceutical composition is administered by inhalation. According to an alternative embodiment, the pharmaceutical composition is administered intravenously.
[0125] According to a preferred embodiment, the pharmaceutical composition is administered to the subject by systemic or pulmonary delivery, preferably by pulmonary delivery, more preferably by inhalation. Pharmaceutical compositions administered by inhalation are preferably in the form of a powder or spray.
[0126] For administration to human patients, the total daily dose of the aptamers of the invention and / or pharmaceutical compositions of the invention typically ranges from 0.001 mg to 8000 mg, depending, of course, on the mode of administration. For example, a daily intravenous dose may require only 0.001 mg to 40 mg. The total daily dose can be administered in single or divided doses and, at the physician's discretion, may fall outside the typical ranges given herein.
[0127] These dosages are based on an average human subject weighing approximately 75 kg to 80 kg. A physician can readily determine dosages for subjects whose weight falls outside this range, such as infants and the elderly.
[0128] In the context of the present invention, aptamers may be administered preferably in combination with one or more vaccines, antigens, antibodies, cytotoxic agents, allergens, antibiotics, antisense oligonucleotides, TLR antagonists, peptides, proteins, gene therapy vectors, DNA vaccines, adjuvants, kinase inhibitors, T cell therapeutics, or sulfated polyglycerol or similar sulfated polymers.
[0129] The invention also encompasses kits comprising an aptamer of the invention, a container, and optionally written instructions for use and / or administration means.
[0130] In the treatment of diseases caused by or associated with coronavirus infection, regardless of the route of administration, the aptamers of the present invention are administered at a total daily dose of 150 mg / kg body weight or less per treatment cycle, preferably 20 mg / kg body weight or less, more preferably 10 mg / kg body weight or less, even more preferably selected from the range of 1 μg / kg to 20 mg / kg body weight, and most preferably selected from the range of 0.01 mg / kg to 10 mg / kg body weight. In a preferred embodiment of the present invention, the aptamer is administered in multiple separate administration steps over the course of a day, preferably two to six times daily, e.g., four times daily. The aptamer may be administered in four doses of 1900 mg per day.
[0131] According to one aspect of the present invention, there is provided a use of the aptamer defined herein for preventing somatic cell infection by a virus from the coronavirus family. In a preferred embodiment of the present invention, the aptamer can be used in vitro / ex vivo. In an alternative preferred embodiment, the aptamer can be used in vivo.
[0132] The production or mass production of the aptamers of the present invention is well known in the art and is merely a routine activity.
[0133] According to one aspect of the present invention, there is provided an affinity molecule that specifically binds to a peptide having the amino acid sequence Leu-Tyr-Arg-Asn-Arg-Asp-Val (LYRNRDV; SEQ ID NO: 9) and / or His-Arg-Phe-Tyr-Arg-Leu-Ala-Asn (HRFYRLAN; SEQ ID NO: 10) of severe acute respiratory syndrome coronavirus 2 RNA-dependent RNA polymerase (SEQ ID NO: 8).
[0134] Within the scope of the present invention, an affinity molecule may be any molecule that has high affinity for a given target, for example the peptide of SEQ ID NO: 9 or SEQ ID NO: 10. Binding with high affinity preferably means binding to said target epitope with at least a 10-fold, preferably at least a 50-fold, more preferably at least a 100-fold increased affinity compared to an unrelated epitope, protein or protein region.
[0135] Further studies conducted by the present inventors surprisingly showed that the claimed aptamers specifically interact with and bind to two previously unknown, distinct epitopes of the enzyme SARS-CoV-2 RNA-dependent RNA polymerase (SEQ ID NO: 8; NCBI Reference Sequence Accession Number: YP_009725307.1). NMR studies and isothermal titration calorimetry confirmed the selective interaction between the aptamers of the present invention and the above-mentioned epitopes of RNA-dependent RNA polymerase (see Figures 6 and 7). The defined peptide stretches of this enzyme where specific binding was observed are amino acids 731-737 (LYRNRDV; SEQ ID NO: 9) and amino acids 650-657 (HRFYRLAN; SEQ ID NO: 10).
[0136] An equivalent target sequence has also been identified in the sequence of the RNA-dependent RNA polymerase of SARS-CoV, another member of the coronavirus family (data not shown). It is known from the prior art that the sequence of the RNA-dependent RNA polymerase shares very high amino acid sequence identity within the coronavirus family, but has very low sequence similarity with other viral RNA-dependent RNA polymerases and reverse transcriptases (see, e.g., Xu X et al. (2003) Molecular model of SARS coronavirus polymerase: implications for biochemical functions and drug design. Nucleic Acids Res 31:7117-7130, p. 7118, right column, 1st nucleotide). (See full paragraph 1, second sentence.) It is therefore possible that equivalent target sequences exist for the RNA-dependent RNA polymerases of other coronaviruses.
[0137] The strong interaction observed in the NMR studies is again highly plausible and likely persists in the full-length molecule as well as in active coronaviruses. Indeed, the additional activity of the claimed aptamers against the spike protein and viral RNA-dependent RNA polymerase could explain the superior results observed in cell culture assays compared to known drugs.
[0138] It has previously been reported that antivirals active against coronaviruses, such as remdesivir and galidesivir, may interact with sequences within the RNA-dependent RNA polymerase (see Wang Y, Anirudhan V, Du R, Cui Q, and Rong L (2020) RNA-dependent RNA polymerase of SARS-CoV-2 as a therapeutic target. J Med Virol, doi: 10.1002 / jmv.26264, for studies with galidesivir and the identification of amino acids Thr455, Arg553, Lys621, Arg624, Asp452, Ala554, Asp623, Asn691, Ser759, and Asp760 as target amino acids). Wu C, Liu Y, Yang Y, Zhang P, Zhong W, Wang Y, Wang Q, Xu Y, Li M, Li X, Zheng M, Chen L, and Li H (2020) Analysis of therapeutic targets for SARS-CoV-2 and discovery of potent (See Acta Pharm Sin B, doi: 10.1016 / j.apsb.2020.02.008.), the reported sequences are different and unrelated to the peptide stretches identified by the present inventors.
[0139] The target enzyme RNA-dependent RNA polymerase is a critical component of the viral replication machinery of coronaviruses. It will be apparent to those skilled in the art that specific binding of or to such enzymes will at least interfere with, impair, or even inhibit the accurate and efficient replication of viral RNA of coronaviruses. Thus, viral infectivity is reduced by affecting the viral life cycle in the host.
[0140] The identification of a novel epitope of this important enzyme represents an important contribution to the art, as it allows for the generation and identification of additional binding partners that may also lead to the disruption or inhibition of viral replication. Furthermore, because the newly identified epitope is distinct from any epitope of this important enzyme previously known as a suitable binding site for affinity molecules, any affinity molecule that binds to it will at least act to complement the inhibitory effect provided by any other molecule that specifically binds to RNA-dependent RNA polymerase.
[0141] Furthermore, it was recognized and demonstrated that the newly identified epitopes are positioned toward the outside of the enzyme, facing the solvent and readily accessible for specific interactions or binding (data not shown). It should also be mentioned that aptamer binders are in most cases capable of interfering with the function of their target proteins and have even been intentionally expressed in vivo for this purpose (Ulrich H (2005) DNA and RNA aptamers as modulators of protein function. Medicinal Chemistry (Shariqah (United Arab Emirates)) 1:199-208.).
[0142] Surprisingly, the aptamers of the present invention not only demonstrated highly efficient inhibition of SARS-CoV-2 viral activity, but actually appeared to outperform other antiviral agents currently under discussion as potential treatment options for COVID-19 (see Example 2), which may be due to the dual effects of the viral infection process and replication within the host.
[0143] By providing new epitopes of this important enzyme critical to the viral replication cycle, one skilled in the art can identify, generate, or create additional small molecules, antibodies or antibody-derived biologics, or oligonucleotides / aptamers with affinity to the newly identified epitopes using standard procedures commonly known in the art.
[0144] In a preferred embodiment of the sixth aspect of the present invention, the affinity molecule is a small molecule having a molecular weight of at most 900 Daltons. Preferably, the affinity molecule is selected from the compounds available from the University of Cincinnati Compound Collection, DiscoveryProbe™ Bioactive Compound Library Plus from ApexBio Technology LLC, and SARS-CoV-2 Screen Library from Cayman Chemical. The small molecule is from any one of the collections of small molecules from the group comprising the ing Library.
[0145] According to one preferred embodiment of the present invention, the affinity molecule is a small molecule present in the ZINC15 database (Sterling T and Irwin JJ, Journal of Chemical Information and Modeling 2015 55(11), 2324-2337; DOI: 10.1021 / acs.jcim.5b00559).
[0146] Alternatively, preferably, the affinity molecule is found to have potential activity against at least one viral target, more preferably at least two viral targets, as disclosed in Kowalewski J and Ray A (2020), Heliyon. 6. e04639. 10.1016 / j.heliyon.2020.e04639.
[0147] With regard to COVID-19 inhibition, previous publications have already screened existing drug or small molecule libraries for possible interactions / binding with proteins critical for SARS-CoV-2 infection or replication, using appropriate in silico methods (computer programs) that are able to identify, among other things, such interactions.
[0148] In such a screen, existing drugs were screened for their potential binding to known protein structures of SARS-CoV-2, thereby identifying the antiulcer drug famotidine as a potential 3CL protease blocker for SARS-CoV-2, in addition to known viral inhibitors (Wu C, Liu Y, Yang Y, Zhang P, Zhong W, Wang Y, Wang Q, Xu Y, Li M, Li X, Zheng M, Chen L, and Li H (2020) Analysis of therapeutic targets for SARS-CoV-2 and discovery of potential drugs by computational methods. Acta Pharm Sin B, doi: 10.1016 / j.apsb.2020.02.008.), and several antibiotics have been identified as potential blockers of RNA-dependent RNA polymerase (Pokhrel R, Chapagain P, and Siltberg-Liberles J (2020) Potential RNA-dependent RNA polymerase inhibitors as prospective therapeutics against SARS-CoV-2. J Med Microbiol, doi: 10.1099 / jmm.0.001203.), as well as other small molecules have been identified as blockers of RNA-dependent RNA polymerase (Aftab SO, Ghouri MZ, Masood MU, Haider Z, Khan Z, Ahmad A, and Munawar N (2020) Analysis of SARS-CoV-2 RNA-dependent RNA polymerase as a potential therapeutic drug target using a computational approach. Journal of Translational Medicine 18:275.).
[0149] Similarly, one skilled in the art can take any available collection or library of small molecules, either as a bulk library or subgrouped by specific affinity, characteristics, or requirements, and perform high-throughput analysis based on, for example, surface plasmon resonance against either the newly identified peptide epitope of SEQ ID NO: 9 or SEQ ID NO: 10 as a target. In doing so, novel small molecules that exhibit specific binding to the new epitope can be identified without undue burden using standard procedures commonly known in the art.
[0150] Exemplary collections of small molecules that are preferably used include the ChemBridge DIVERSet-CL collection and the ChemBridge DIVERSet-EXP collection from ChemBridge Corporation, San Diego, CA, USA; the Maybridge screening collection (in the form of Maybridge HitDiscover, Maybridge HitFinder or Maybridge HitCreator) from Thermo Fisher Scientific, Geel, Belgium; the antiviral screening library (supplier / manufacturer) from Cayman Chemical, Ann Arbor, MI, USA; or the SARS-CoV-2 Screening Library (Supplier / Product No. 30390-50) or the SARS-CoV-2 Screening Library (Supplier / Product No. 9003509), or any diversity set from the University of Cincinnati Compound Collection, or any other available collection or library of suitable small molecules deemed useful by one of skill in the art.
[0151] In another preferred embodiment of the sixth aspect of the present invention, the affinity molecule is a peptide-based compound, more preferably an antibody or a binding fragment thereof.
[0152] To generate novel antibodies or binding fragments of such antibodies, for example, It is easy, uncomplicated, and common practice to generate effective monoclonal antibodies using established and reliable hybridoma technology against newly identified peptide epitopes while immunizing animals with the peptide sequence. For the treatment of viral diseases, less than complete antibodies (approximately 150 kDa) may be administered, but fragments, such as Fab fragments, or even smaller portions derived from antibodies, can be used therapeutically to enable in vivo targeting.
[0153] Such binding fragments may consist solely of or comprise Fab, Fab', Fab'-SH, F(ab)2, Fv, diabodies, single-chain antibody fragments, or other fragments having specific affinity for the epitope. In this regard, in the present invention, an affinity molecule that specifically binds to or is directed against the newly discovered epitope of SEQ ID NO:9 or SEQ ID NO:10 means an affinity molecule that binds to said target epitope with an affinity that is increased by at least 10-fold, preferably at least 50-fold, more preferably at least 100-fold, compared to unrelated epitopes, proteins, or protein regions.
[0154] According to a preferred embodiment of the present invention, the specific binding of the affinity molecule to the isolated target epitope has a K of less than 500 μM, preferably less than 200 μM, and more preferably less than 100 μM, as measured by isothermal titration calorimetry, as further described below. D According to another preferred embodiment of the present invention, the specific binding of the affinity molecule to full-length RNA-dependent RNA polymerase has a K of less than 1 mM, preferably less than 100 μM, more preferably less than 10 μM, as measured by isothermal titration calorimetry, as further described below. D Alternatively, preferably, K D Affinity measurements to determine the affinity value may be performed using a Biacore™ assay from GE Healthcare Life Sciences according to Biacore Assay Handbook 29-0194-00 Edition AA, or other methods known in the art. The method may be performed using any other affinity measurement known in the art.
[0155] In another preferred embodiment of one of the sixth aspects of the invention, the affinity molecule is an aptamer or an oligonucleotide. As with antibodies, there are procedures to generate oligonucleotide molecules that specifically bind to targets that are accessible and can be easily used in such assays.
[0156] One of these techniques, SELEX, for finding novel oligonucleotide binders to known epitopes was used and described as early as 1990. Today, many different SELEX-based aptamer selection procedures have been developed and are in use (Ali MH, Elsherbiny ME, and Emara M (2019) Updates on Aptamer Research. International Journal of Molecular Sciences 20.), allowing the selection of aptamers against almost any possible target (Stoltenburg R, Nikolaus N, and Strehlitz B (2012) Capture-SELEX: Selection of DNA Aptamers for Aminoglycoside Antibiotics. Journal of Analytical Methods in Chemistry 2012:415697.).
[0157] Since the first description of aptamers in 1990, aptamers have been described for a wide variety of different classes of targets, ranging from small molecules such as nucleotides, cofactors, or amino acids, to peptides, polysaccharides, and proteins, to complex structures such as whole cells, viruses, and single-celled organisms (see, e.g., Zhang Y, Lai BS, and Juhas M (2019) Recent Advances in Aptamer Discovery and Applications. Molecules 24.).
[0158] In this regard, by providing novel epitopes within key enzymes of coronaviruses, one skilled in the art can generate additional affinity molecules, such as small molecules, antibody-derived compounds, and aptamers, using standard procedures generally known in the art. Such additional affinity molecules could be considered effective agents to combat SARS-CoV-2 infection, as they specifically bind to as yet unknown sites within key viral enzymes and disrupt the viral replication cycle.
[0159] It is contemplated that all embodiments of the present invention described herein can be combined in any combination unless a person skilled in the art would consider such combination to make no technical sense. [Example]
[0160] 1. NMR analysis of the interaction between BC007 and sequence motifs in the receptor binding domain (RBD) of SARS-CoV-2 All NMR spectra were acquired at 600 MHz on a Bruker AV600 spectrometer (Bruker Biospin, Rheinstetten, Germany) in 90 / 10 H2O / D2O at 298 K. Solvent signals were suppressed using the Watergate w5 pulse sequence included in the Bruker pulse program zggpw5. Acquisition parameters included: time domain = 65 K, number of scans = 512, sweep width = 24 ppm, and 90° high-power pulse = 13.8 μs.
[0161] The concentrations of BC007 and the peptide of SEQ ID NO: 5 were 1 mM. The substances were dissolved in 0.5 ml of pure H2O / D2O mixture without any additives.
[0162] The NMR spectrum (top spectrum) of Figure 1 of BC007 combined with peptide SEQ ID NO: 5 from the receptor binding domain of the spike protein of SARS-CoV-2 shows the formation of a quadruplex structure of BC007 induced by interaction with the peptide and clearly recognizable by eight imino signals at 12.5 ppm. The peptide signals in the spectrum are strongly shifted and broadened compared to potassium-induced folding, an effect caused by the interaction of the two molecules (peptide and BC007).
[0163] In the lower NMR spectrum of Figure 1, the imino signal in the 12 ppm range clearly indicates structure formation induced by the presence of potassium ions, although the chemical shifts of the imino protons are clearly different from those in the upper spectrum. No imino signal in the 12 ppm range is observed in the peptide alone (middle spectrum).
[0164] The aptamer of SEQ ID NO: 1 is characterized by its characteristic fold being stabilized in the presence of potassium ions (Schultze, P. et al., 1994. Three-dimensional solution structure of the thrombin-binding DNA aptamer d(GGTTGGTGTGGTTGG). J. Mol. Biol. 235, 1532-1547. https: / / doi.org / 10.1006 / jmbi.1994.1105) and existing primarily in a random coil structure in water (Weisshoff, H. et al., 2018. Characterization of Aptamer BC 007 Substance). and Product Using Circular Dichroism and Nuclear Magnetic Resonance Spectroscopy. J Pharm Sci. https: / / doi.org / 10.1016 / j.xphs.2018.04.003) have been previously reported.
[0165] The zoomed-in view in Figure 2 shows how the peaks present for each molecule alone are based on very sharp signals, which then broaden and shift in position in the upper spectrum due to the strong interaction between the aptamer of SEQ ID NO: 1, as an agent believed to be active against coronaviruses, and SEQ ID NO: 5, as a representative sequence from the receptor-binding domain of the spike protein of SARS-CoV-2.
[0166] Based on these results, it is possible to determine the role of spike proteins and their functions in cell entry and infection. The above interactions with intact viral material and other strains of the same family of coronaviruses that also use the receptor binding domain are expected to occur under in vivo conditions.
[0167] 2. Inhibition of SARS-CoV-2 replication by BC007 in human and primate cell lines The antiviral dose-response effect of BC007 was investigated in VeroFM and Calu-3 cells. The aptamer BC007 (SEQ ID NO: 1) was added to the virus at various concentrations and incubated at 4°C for 15 minutes. The mixture was then added to the cells (up to an MOI of 0.0005) and incubated at 37°C for 30 minutes to initiate viral attachment and entry.
[0168] After this 30-minute incubation, the supernatant was removed, the cells were washed once with PBS, and medium containing the same final concentration of BC007 was added after washing. After 24 hours of incubation at 37°C (duplicate), sample aliquots were taken for each concentration for plaque assay, which was performed as previously described (Herzog et al., Virology Journal 2008, 5:138).
[0169] BC007 demonstrated highly efficient inhibition of viral replication at low doses in Vero and Calu-3 cell lines (see Figure 3). The half-maximal effective concentrations (EC 50 , or half-maximal inhibitory concentration IC 50 The ATP-dependent agonist activity (referred to as ATP) was 3.74 μM in Calu-3 cells and 0.21 μM in Vero cells.
[0170] For a comparison with other antiviral agents related to the potential treatment of SARS-CoV-2, reference is made to the publication of Wang et al., Cell Research 2020, 30:269-271, where Vavirin, penciclovir, favipiravir, nitazoxanide, chloroquine, and remdesivir were tested in a similar experimental setting using Vero E6 cells and a starting MOI of 0.05.
[0171] In this report by Wang et al., EC 50 The concentrations were determined to be 109.50 μM for ribavirin, 95.96 μM for penciclovir, 61.88 μM for favipiravir, 2.12 μM for nitazoxanide, 1.13 μM for chloroquine, and 0.77 μM for remdesivir (see Wang et al., 2020, page 269, full paragraph spanning the left and right columns, and page 270, Figure 1 See a).
[0172] Based on the results obtained with remdesivir, it was concluded that remdesivir potently blocks viral infection at low micromolar concentrations. Furthermore, remdesivir lacked substantial cytotoxicity at the concentrations used to test its SARS-CoV-2 inhibitory efficacy.
[0173] Considering the results reported in Wang et al., 2020, the aptamer of the present invention can be used to It turns out that the results obtained in ro cells also demonstrate a potent blockade of viral infection that approaches or exceeds the efficiency observed with other antivirals currently being discussed as potential treatment options for coronavirus infections.
[0174] Importantly, the molecules identified as performing very well in Wang et al., 2020 Similarly, the aptamers of the present invention not only showed efficient inhibition of SARS-CoV-2 infectious activity against Vero cells and even human cells (Calu-3), but also without any toxicity at the doses intended and required for the inhibition of SARS-CoV-2 observed in human cells, as already demonstrated by the successful completion of a Phase I clinical trial (Becker et al., Clin Drug Investig 2020 May;40(5):433-447).
[0175] A distinct advantage of the aptamers of the present invention over Remdesivir as a currently discussed treatment option is the simplicity and ease of preparation of said aptamers. Remdesivir, for example, an antiviral drug proposed for the treatment of COVID-19, is reported to require approximately 70 raw materials, reagents, and catalysts, some of which are highly dangerous to humans (see Langreth, Robert (14 May 2020). "All Eyes on Gilead". Bloomberg Businessweek. Bloomberg, LP).
[0176] Furthermore, the synthesis appears to involve approximately 25 time-consuming chemical steps, and the original end-to-end manufacturing process would require a contract manufacturer to take 9-12 months from raw materials to finished product.
[0177] In contrast, the aptamers of the present invention, which can be used and administered as unmodified DNA molecules, can be produced at scale to kilogram quantities to meet global needs within weeks at a fraction of the cost of comparable antivirals such as remdesivir.
[0178] 3. Interaction between BC007 and human thrombin and the resulting coagulation inhibition Human thrombin (250 nM) was immobilized on Nunc Maxisorp ELISA plates in 0.1 M carbonate buffer overnight at 4 °C, followed by blocking with 1% BSA in phosphate-buffered saline (PBS), pH 7.4, for 1 h at room temperature. The 5'-biotinylated aptamer BC007 was then added at various concentrations (100 nM, 500 nM, and 100 nM). Thrombin-bound aptamer is added at a concentration of 0.000 nM and incubated for 2 hours at room temperature. The POD-bound aptamer is detected via POD-conjugated neutravidin, and the amount of POD is determined by the hydrogen peroxide / tetramethylbenzidine (TMB) reaction, with the readout performed on a plate reader at a wavelength of 450 nm (reference wavelength 650 nm). Washing is performed between each wash using regular ELISA wash buffer; a plastic plate without thrombin serves as a control. The results of the thrombin binding assay are shown in Figure 4.
[0179] To assess coagulation inhibition, partial thromboplastin time (PTT) was measured as follows: 50 μl of 1 mM aptamer solution (BC007 of SEQ ID NO: 1 or aptamer AS1411 of SEQ ID NO: 7 as reference aptamer) was diluted with 1 mL of HemosIL human calibration plasma (Instrumentation Laboratory, Werfen). This solution was then serially diluted 1:2 in HemosIL calibration plasma to concentrations of 0.083 mg / ml, 0.028 mg / ml, 0.009 mg / ml, 0.003 mg / ml, and 0.001 mg / ml.
[0180] These samples were incubated with phospholipids and buffer according to the manufacturer's protocol. After calcium addition, the time to clot was measured using the ACL TOP clotting system (Werfen). The results are shown in Figure 5A.
[0181] The Quick values for aptamer BC007 and the reference aptamer AS1411 of SEQ ID NO: 7 were determined as commonly known in the art, and the results are shown in Figure 5B (Quick values).
[0182] 4. Analysis of the interaction between BC007 and two sequence motifs of SARS-CoV-2 RNA-dependent RNA polymerase Two sequence sections derived from the severe acute respiratory syndrome coronavirus 2 RNA-dependent RNA polymerase (NCBI reference sequence: YP_009725307.1): HRFYRLAN (His 650-Arg 651 -Phe 652 -Tyr 653 -Arg 654 -Leu 655 -Ala 656 -Asn 657 ) and LYRNRDV (Leu 731 -Tyr 732 -Arg 733 -Asn 734 -Arg 735 -Asp 736 -Val 737 ) were analyzed for binding and interaction with BC007 by NMR spectroscopy. Both sequence sections (peptides) are able to induce BC007 to form its well-known tetraplex structure (Figure 6), which is a readout of successful and specific binding.
[0183] The top NMR spectrum of BC007 combined with LYRNRDV in Figure 6 shows the formation of a quadruplex structure of BC007 induced by molecular interactions with the peptide, which can be clearly recognized by the imino signals at 11.5 ppm to 12.5 ppm. The bottom spectrum shows the binding between BC007 and HRFYRLAN.
[0184] The material was dissolved in 0.5 ml of pure H2O / D2O mixture without any additives. NMR data investigating the interaction of BC007 with these sequence sections of SARS-CoV-2 proteins were acquired at 298 K in 90 / 10 H2O / D2O at 600 MHz on a Bruker AV600 spectrometer (Bruker Biospin, Rheinstetten, Germany). Solvent signals were suppressed using the Watergate w5 pulse sequence included in the Bruker pulse program zggpw5. Acquisition parameters included: time domain = 65 K, number of scans = 512, sweep width = 24 ppm, and 90° high-power pulse = 13.8 μs.
[0185] Further analysis of the binding between HRFYRLAN and BC007 was carried out by isothermal titration calorimetry (ITC). The results of this ITC analysis are shown in Figure 7, where the thermogram is on top and the binding isotherm is on the bottom.
[0186] ITC experiments were performed in a MicroCal PEAQ-ITC microcalorimeter (Malvern Panalytical GmbH, Germany). Both interaction partners were dissolved in 50 mM sodium phosphate, 150 mM NaCl buffer, pH 7.06. Experiments were performed at 25 °C. In a typical experiment, 2 μl of peptide (3.6 mM or 4 mM) was titrated into the aptamer solution (200 μM) in the colorimeter cell. The time interval between injections was adjusted to 200 s, sufficient time for the thermal signal to return to baseline. The reaction mixture was continuously stirred at 750 rpm.
[0187] The heat of dilution associated with the addition of peptide to the buffer (determined in a separate control experiment) was a small, constant value that was negligible relative to the measured heat of binding. Instrument software (MicroCal PEAQ-ITC Analysis) was used for baseline adjustment, peak integration, and normalization of the heat of reaction with respect to the molar amount of injected ligand, as well as for data fitting and binding parameter estimation.
[0188] This ITC analysis revealed a 1:1 stoichiometry between the two binding partners, BC007 and HRFYRLAN, which strongly supports true specific binding.
[0189] A control experiment for the ITC analysis was performed using a highly charged peptide from the spike RBD of SARS-CoV-2 with the sequence NRKRISN (SEQ ID NO: 11; theoretical pI value 12.01). The results are shown in Figure 8. This control clearly ruled out any possible nonspecific electrostatic interactions between BC007 and the RNA-dependent RNA polymerase binding peptides HRFYRLAN (theoretical pI value 10.84) and LYRNRDV (theoretical pI value 8.75).
[0190] The experiments were again carried out in a MicroCal PEAQ-ITC microcalorimeter (Malvern Panalytical GmbH, Germany). Both interaction partners were dissolved in 50 mM sodium phosphate, 150 mM NaCl buffer, pH 7.16. The experiments were carried out at 25 °C. In a typical experiment, peptide (3.6 mM or 4 mM) was titrated in 2 μl aliquots into the aptamer solution (200 μM) in the colorimeter cell. The time interval between injections was adjusted to 200 s, sufficient for the heat signal to return to baseline. The reaction mixture was continuously stirred at 750 rpm. The heat of dilution associated with the addition of peptide to the buffer (determined in a separate control experiment) was measured. The binding heat was negligibly small and constant. PEAQ-ITC Analysis) was used for baseline adjustment, peak integration, and normalization of the heat of reaction with respect to the molar amount of injected ligand, as well as for data fitting and binding parameter estimation.
[0191] Finally, we also performed NMR spectroscopy to analyze the potential binding of BC007 to the control peptide NRKRISN. The results are shown in Figure 9. The NMR spectrum of BC007 combined with NRKRISN shows that the quadruplex structure of BC007 is almost completely incomplete, as can be seen by the absence of imino signals between 11.5 ppm and 12.5 ppm. For comparison, the upper spectrum shows BC007 binding to the peptide sequence YRLFRK (a sequence from the spike protein of SARS-CoV-2, with a theoretical pI of 11.0).
[0192] The material was dissolved in 0.5 ml of pure H2O / D2O mixture without any additives. NMR data investigating the interaction of BC007 with this sequence section of the SARS-CoV-2 protein were acquired at 298 K in 90 / 10 H2O / D2O at 600 MHz on a Bruker AV600 spectrometer (Bruker Biospin, Rheinstetten, Germany). Solvent signals were suppressed using the Watergate w5 pulse sequence included in the Bruker pulse program zggpw5. Acquisition parameters included: time domain = 65 K, number of scans = 512, sweep width = 24 ppm, and 90° high-power pulse = 13.8 μs.
[0193] 5. Identification and characterization of GPCR autoantibodies in the sera of patients who have recovered from active SARS-CoV-2 infection Sera were obtained from 25 patients after recovery from acute illness, confirmed by PCR. Twenty-three patients suffered from post-COVID-19 symptoms, while two patients were asymptomatic.
[0194] As a safety precaution, serum from COVID-19 patients was heat-inactivated at 56°C for 30 min before use. Then, 0.4 mL of sample was dialyzed against 1 L of dialysis buffer (0.15 M NaCl, 10 mM phosphate buffer, pH 7.4; Membra-Cel MD 44, 14 kDa, Serva) for 24 h to remove low molecular weight bioactive compounds and peptides. Finally, 40 μL of the dialyzed sample was added to the bioassay (final dilution of 1:50).
[0195] Identification and characterization of GPCR-fAAB requires multiple GPCR- fFor parallel measurement of AAB, GPCR-fAAB against the beta-1 adrenergic receptor was performed as described by Davideit et al. (Davideit H et al (2019) Determination of Agonistically Acting Autoantibodies to the Adrenergic Beta-1 Receptor by Cellular Bioassay. Methods Mol Biol 1901:95-102. https: / / doi.org / 10.1007 / 978-1-4939-8949-2_8) and Wenzel et al. (Wenzel K, Schulze-Rothe S, Haberland A, et al (2017) Performance and in-house validation of a bioassay for the determination of beta-1-autoantibodies found in patients with cardiomyopathy. Heliyon 3:e00362). https: / / doi.org / 10.1016 / j.heliyon.2017.e00362), as well as other GP See also Wallukat et al. (2018) PLoS ONE 13:e0192778 for CR-fAAB. Bioassays were conducted.
[0196] After contact with each autoantibody, the change in the basal beating rate of spontaneously beating cardiomyocytes expressing GPCR was used as the measurement signal. Receptor specificity was confirmed by either the subsequent abrogation of this effect by the addition of a specific receptor blocker or by the addition of a corresponding receptor epitope-competing extracellular loop peptide. Details: To identify β2-fAAB, the receptor antagonist ICI118.551 (0.1 μM) was used to inhibit the activation of human β2-fAAB. Neutralizing peptides corresponding to the first or second extracellular loop of the adrenergic receptor were also used.
[0197] The effects of negative chronotropic muscarinic M2 receptor autoantibodies (M2-fAAB) were blocked by atropine (1 μM). Losartan (1 μM) blocked the effects of positive chronotropic AT1-fAAB, and A779 (1 μM) blocked the effects of negative chronotropic MAS-fAAB. For the identification of MAS-fAAB, additional competitor peptides corresponding to the first and second extracellular loops of the human MAS receptor were utilized.
[0198] ETA-fAABs were identified by blocking their negative chronotropic effects with the specific endothelin receptor antagonist BQ123 (0.1 μM) and by the addition of competing peptides corresponding to the first or second extracellular loop of the receptor, respectively.
[0199] The nociceptin receptor antagonist J113397 (0.1 μM) was used to block the positive chronotropic effect of NOC-fAAB, as were competitor peptides corresponding to the first or second extracellular loop. Addition of 1 μM urapidil or prazosin abolished the positive chronotropic effect of α1-fAAB. For all peptides, 2 μL of a 100 μg / mL stock solution was added to 40 μL of the corresponding GPCR-fAAB sample. After 30 minutes of incubation, the mixture was transferred to cells.
[0200] Several different GPCR-fAABs were identified in the sera of 25 recovered COVID-19 patients. All 25 patients surveyed had between two and seven different GPCR-fAABs (Figure 10).
[0201] The two functionally active autoantibodies found in almost all patients studied were directed against the β2-adrenergic receptor (β2-fAAB) and the muscarinic M2 receptor (M2-fAAB). These fAAB induced positive and negative chronotropic responses at their target receptors, respectively.
[0202] Two other fAABs, also present in 23 of the 25 post-COVID-19 patients (92%) studied, were directed against the angiotensin II AT1 receptor (fAT1-AAB) and the angiotensin 1-7 MAS receptor (MAS-AAB). These receptors belong to the renin-angiotensin system (RAS) and, when targeted by the respective fAABs, induce positive and negative chronotropic effects, respectively.
[0203] Post-infection hair loss (alopecia) was experienced by eight recovered patients. Three additional GPCR-fAABs were found in the serum of these patients: negative chronotropic ETA-fAAB (4 / 8), positive chronotropic NOC-fAAB (5 / 8), and positive chronotropic α1-AAB (3 / 8). Not all alopecia patients exhibited all three GPCR-fAABs. Instead, their occurrence varied, and no pattern has yet been detected. As shown in Figure 10, two of the 25 post-COVID-19 patients surveyed developed fAABs without showing symptoms.
[0204] Ongoing fatigue-like symptoms, persisting long after viral follow-up tests became negative, were a frequent (17 / 25) reported disturbance in patients in this study. The occurrence of β2-fAAB, M2-fAAB, and occasionally ETA-fAAB has previously been reported in patients suffering from classic coronavirus-independent fatigue syndrome.
[0205] Here, almost all of the serum samples examined contained β2-fAAB and M2-fAAB. The combination of β2-fAAB and M2-fAAB was associated with a decline in the serum sera of patients with PoTS and autonomic dysfunction. It has also been identified in sera from patients with COVID-19, both conditions currently observed in post-COVID-19 patients (3 / 25 and 2 / 25, respectively, non-overlapping).
[0206] Furthermore, this combination of β2-fAAB and M2-fAAB has also been previously identified by the inventors in patients with complex regional pain syndrome (CRPS), patients suffering from narcolepsy type 1 (which also has NOC-fAAB in 9 out of 10 cases), and patients with small fiber disease.
[0207] Two of the identified GPCR-fAABs, observed in over 90% (23 / 25) of COVID-19 patient sera examined, were directed against receptors in the RAS, namely the angiotensin II AT1 receptor and the angiotensin (1-7) MAS receptor. These vasoactive AT1-fAABs have previously been identified in patients with malignant hypertension, treatment-resistant hypertension, preeclampsia, and renal disease.
[0208] This data already indicates a critical role for GPCR-AABs in the development of long COVID disease symptoms. Therefore, as an established and effective agonist against the deleterious effects of such antibodies, BC007 appears to be a promising treatment option for patients suffering from long COVID symptoms.
[0209] 6. Characterization of GPCR-AAB activity in chronic COVID-19 serum samples before and after administration of aptamer BC007 (SEQ ID NO: 1) Sample preparation Serum from patients who had survived COVID-19 but suffered from persistent symptoms associated with long-term COVID was heat-inactivated at 56°C for 30 minutes before use as a safety measure. Then, 0.4 mL of the sample was dialyzed 24 times against 1 L of dialysis buffer (0.15 M NaCl, 10 mM phosphate buffer (pH 7.4); Membra-Cel MD 44, 14 kDa, Serva). The mixture was then dialyzed for 2 hours to remove low molecular weight bioactive compounds and peptides.
[0210] Neonatal rat spontaneously beating cardiomyocyte bioassay (cardiomyocyte beat rate assay, CBRA-LC) for measurement of GPCR-AAB activity in chronic COVID-19 serum samples For estimation of GPCR-AAB in serum from long-term COVID-19 patients, 40 μL of dialyzed sample was added to the bioassay (final dilution of 1:50). AA was determined according to the CBRA principle described by Wallukat G, and Wollenberger A (1987) Biomed Biochim Acta 46:S634-639. The chronotropic effect of b was measured.
[0211] To measure various GPCR-AAB combinations in one sample, we applied the measurement principles described in Wallukat G et al. (2018) PLoS ONE 13:e0192778, Wallukat G et al. (2019) Methods Mol Biol 1955:247-261, and Orjatsalo M et al. (2021) Sleep Med 77:82-87. It is used.
[0212] For this assay, monolayers of neonatal rat cardiomyocytes were prepared and 12. 5cm 2 Cardiomyocytes were cultured in Falcon flasks. The basal beating rates of six cardiomyocyte clusters were first visually confirmed and recorded. To measure GPCR-AABs expressing positive chronotropic responses, cells were preincubated with a cocktail of receptor blockers that block all negative chronotropic GPCR-AAB effects (1 μM atropine to block M2-AABs, 0.1 μM BQ123 to block ETA-AABs, and 1 μM A779 to block MAS-AABs).
[0213] 40 μL of dialyzed sample (1:50 dilution) was added and incubated at 37°C for 1 hour. The positive chronotropic response was measured again in the same clusters. The difference in basal rate was expressed as delta pulse rate [ΔPR / min]. Subsequently, receptor blockers that block the positive chronotropic effects of beta2-AAb (0.1 μM ICI118551), AT1-AAB (1 μM losartan), alpha1-AAB (1 μM urapidil or prazosin), and nociceptin-AAB (0.1 μM J113397) were added in stages to determine the contribution of each AAB to the total positive chronotropic GPCR-AAB activity.
[0214] To measure GPCR-AABs that exhibit a negative chronotropic response, the test was reversed. First, a cocktail of receptor blockers that block positive chronotropic responses (0.1 μM to block beta2-AABs) was administered. Cells were pretreated with ICI118551, 1 μM losartan to block AT1-AAB, 1 μM urapidil or prazosin to block alpha1-AAB, and 0.1 μM J113397 to block nociceptin-AAB) before adding 40 μL (1:50) of prepared patient serum.
[0215] If a negative chronotropic response is obtained, atropine (M2-AAB), BQ123 (ETA-AAB), and A779 (MAS-AAB) are then added stepwise to determine the contribution of each AAB to the total negative chronotropic GPCR-AAB activity.
[0216] Follow-up of Long-Term COVID Patients After Treatment with BC007 Patients were followed for a given period (6 hours, 2 days, 7 days, 30 days) after administration of BC007 to determine treatment success or efficacy. Again, patient samples were added to cardiomyocytes pre-treated with a receptor blocker cocktail for either all positive chronotropic GPCR-AABs or all negative chronotropic GPCR-AABs.
[0217] If it was possible to detect that no opposite chronotropic sample effect was caused by the patient serum (if the positive chronotropic response to cardiomyocytes was blocked for all negative chronotropic GPCR-AABs, or vice versa), this could be interpreted as indicating the absence of the corresponding GPCR-AABs in this sample.
[0218] However, in such cases, it becomes impossible to distinguish a single GPCR-AAB from each single receptor blocker.
[0219] [Table 1]
[0220] For values shown in the table above and based on the experimental conditions, any value above 1.17 is considered to indicate the presence of the tested autoantibody(s), and any value below this threshold is considered to indicate its absence.
[0221] This experiment demonstrates that the identified GPCR autoantibodies found in patients who survive COVID-19 but suffer from symptoms associated with long COVID that persist after infection do indeed have a direct and measurable effect on G protein-coupled receptors, as shown by rat cardiomyocyte assays.
[0222] Furthermore, it could be clearly demonstrated that administration of BC007 to long-COVID patients mitigates the effects of said GPCR autoantibodies, likely through specific binding and sustained neutralization of such autoantibodies.
[0223] This data represents experimental evidence for the core of the present invention, that BC007 (SEQ ID NO: 1) can neutralize GPCR autoantibodies that appear as one of the main causative agents of long COVID after overcoming SARS-CoV-2 infection. The inventors have made similar observations and published them in Hohberger et al. (2021) Front. Med. 8:754667.
[0224] Taken together, BC007 and its specific and efficient action against GPCR autoantibodies make it one of the most promising therapeutic options for patients suffering from persistent disease symptoms of long COVID syndrome after overcoming SARS-CoV-2 infection.
[0225] Even more intriguingly, the combined function of BC007 against SARS-CoV-2 infection and its progression, along with its function against long COVID symptoms, makes it even more suitable for treating not only ongoing infection but also symptoms that may persist after overcoming the infection.
Claims
1. 1. An aptamer for use in treating a subject by treating, curing or preventing disease symptoms associated with long-term COVID in patients who have survived infection with a virus from the Coronaviridae family, wherein the aptamer comprises the nucleic acid sequence of SEQ ID NO:1 (GGT TGG TGT GGT TGG) and / or a nucleic acid sequence that is at least 80% identical to SEQ ID NO:
1.
2. 2. The aptamer for use according to claim 1, wherein the disease symptoms comprise one or more from the group comprising neurological symptoms such as chronic fatigue syndrome, postural orthostatic tachycardia syndrome (PoTS), dysautonomia, tremor, attention deficit, anomia, neuropathy, transverse myelitis, acute necrotizing myelitis, and Guillain-Barré syndrome; cardiovascular symptoms such as myocardial inflammation, arrhythmia, tachycardia, bradycardia, hypertension, and atrioventricular (AV) block; skin symptoms such as alopecia and eczema; or gastrointestinal diseases.
3. 3. The aptamer for use according to claim 1 or 2, wherein the aptamer is used to inhibit the interaction of an autoantibody specific for a G protein-coupled receptor with its target protein.
4. 4. The aptamer for use according to any one of claims 1 to 3, wherein the aptamer is for use in the treatment of patients in which autoantibodies against a G protein-coupled receptor can be detected.
5. The patient has functional autoantibodies against G protein-coupled receptors, preferably human G protein-coupled receptors adrenergic alpha-1 receptor, adrenergic beta-2 receptor, endothelin 1 ETA receptor, muscarinic M receptor, 2 receptor, angiotensin II AT1 receptor, MAS receptor and / or nociceptin receptor, more preferably, adrenergic beta 2 receptor, muscarinic M 2 The patient exhibits functional autoantibodies specific for one of the following receptors: adrenergic beta-2 receptor, muscarinic M receptor, angiotensin II AT1 receptor, and MAS receptor. 2 5. The aptamer for use according to any one of claims 1 to 4, which exhibits an antibody pattern comprising functional autoantibodies specific for each of the angiotensin II AT1 receptor, the angiotensin II AT2 receptor and the MAS receptor.
6. A pharmaceutical composition comprising an aptamer for use according to any one of claims 1 to 5 and at least one pharmaceutically acceptable excipient.
7. A kit comprising at least one aptamer for use according to any one of claims 1 to 5 and a container.