Subcutaneous telomerase inhibitor compositions and methods for their use

Abstract

To provide subcutaneous telomerase inhibitor compositions and methods for using the same.SOLUTION: Aspects of the present disclosure include telomerase inhibitor compositions formulated for subcutaneous administration. Compositions according to certain embodiments comprise a hyaluronidase enzyme and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety conjugated to the 5' and / or 3' end of the oligonucleotide. Methods for subcutaneously administering telomerase inhibitor compositions, such as in the treatment of tumors, are also described. Kits with or without hypodermic syringes are also provided.SELECTED DRAWING: None

Description

[Technical Field]

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 63 / 053,455, filed July 17, 2020, and U.S. Provisional Patent Application No. 63 / 128,708, filed December 21, 2020, the disclosures of which are incorporated herein by reference in their entireties. [Background technology]

[0002] Introduction Hematologic malignancies are forms of cancer that begin in the cells of blood-forming tissues, such as the bone marrow, or in the cells of the immune system. Examples of blood cancers are acute and chronic leukemia, lymphoma, multiple myeloma, and myelodysplastic syndromes.

[0003] Myeloproliferative neoplasms (MPNs) are a group of blood disorders that occur when the body produces too many white or red blood cells or platelets. This overproduction of blood cells in the bone marrow can cause problems with blood flow and lead to a variety of symptoms. MPNs can arise from myeloid lineage precursors in the bone marrow. MPNs are characterized by myeloproliferation without dysplasia, myeloid hyperplasia, and a predisposition to thrombosis, bleeding, and myelofibrosis. There are various types of chronic myeloproliferative disorders. The MPN disease spectrum includes essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), myelofibrosis (MF), chronic eosinophilic leukemia, and acute myeloid leukemia (AML). Myelodysplastic syndromes (MDS) are a group of conditions that include cancers of the blood and bone marrow. Myelodysplastic syndromes (MDS) include diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polylineage dysplasia, refractory cytopenia with monolineage dysplasia, and chronic myelomonocytic leukemia (CMML).

[0004] Imetelstat or imetelstat sodium is a telomerase inhibitor that binds with high affinity to the template region of the RNA component of telomerase. Studies have shown that imetelstat or imetelstat sodium inhibits telomerase activity and is effective against cell proliferation in many different cancer cell lines and human tumors (e.g., those described in U.S. Patent No. 7,494,982). Imetelstat or imetelstat sodium has been used in clinical trials for patients with hematological malignancies, including myelodysplastic syndromes and myeloproliferative neoplasms, as well as solid tumors. Clinical trials for patients with lower-risk myelodysplastic syndromes have shown that intravenously administered imetelstat or imetelstat sodium can achieve sustained transfusion independence in certain patients. In addition, clinical trials for patients with myelofibrosis have shown that intravenously administered imetelstat or imetelstat sodium can achieve improved overall survival and myelofibrosis, which correlate with a reduction in the mutational burden and cytogenetic abnormalities of the malignant clone.

[0005] For subcutaneous administration, a large volume of a liquid composition of a telomerase inhibitor is administered to achieve an effective dose. The term "subcutaneous" refers to the subcutaneous layer of skin, such as the subcutaneous tissue layer. The subcutaneous stromal matrix is ​​composed of fibrous proteins in a viscoelastic gel of glycosaminoglycans. Glycosaminoglycans in the subcutaneous tissue include glycohyaluronan (HA), a non-sulfated repeating linear disaccharide. Delivering large volumes of liquid into the subcutaneous tissue can be restrictive and / or painful. Hyaluronidase enzymes (e.g., soluble hyaluronidase glycoproteins) promote rapid depolymerization of hyaluronan in the subcutaneous extracellular space, reducing the viscosity of the interstitium and increasing hydraulic conductance, allowing for the administration of larger volumes of liquid into the subcutaneous tissue. Summary of the Invention [Means for solving the problem]

[0006] Aspects of the present disclosure include telomerase inhibitor compositions formulated for subcutaneous administration. The compositions, according to certain embodiments, comprise a hyaluronidase enzyme, an oligonucleotide, and a telomerase inhibitor comprising a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. Methods for subcutaneously administering telomerase inhibitor compositions for the treatment of cancer and alleviation of symptoms associated with cancer are described. Methods for subcutaneously administering telomerase inhibitor compositions in the treatment of hematologic malignancies are also described. Methods for subcutaneously administering telomerase inhibitor compositions in the treatment of myelodysplastic syndromes (MDS), including diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polycythemia dysplasia, refractory cytopenia with monocythemia dysplasia, and chronic myelomonocytic leukemia (CMML), are also described. Also described are methods for subcutaneously administering telomerase inhibitor compositions in the treatment of myeloproliferative neoplasms, such as essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), myelofibrosis (MF), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). Also described are methods for subcutaneously administering telomerase inhibitor compositions in the treatment of lymphoid tumors. Also described are methods for subcutaneously administering telomerase inhibitor compositions in the treatment of solid tumors. Liquid or lyophilized unit dosage forms comprising a hyaluronidase enzyme and a telomerase inhibitor are described. Kits having a combination of a telomerase inhibitor and a hyaluronidase enzyme are also provided. A kit containing a telomerase inhibitor and a hyaluronidase enzyme and a subcutaneous syringe is also provided. Kits having combinations with the injector are also provided.

[0007] In some embodiments, the hyaluronidase enzyme is recombinant human hyaluronidase. In certain embodiments, the hyaluronidase enzyme is rHuPH20. In some embodiments, the telomerase inhibitor subcutaneous composition comprises one or more soluble hyaluronidase glycoproteins. In embodiments, the hyaluronidase enzyme is present in the composition in an amount of 100 U to 50,000 U. In some cases, the hyaluronidase enzyme is present in the composition in an amount of 100 U / mL to 50,000 U / mL. In some cases, the hyaluronidase enzyme is present in the composition in an amount of 100 U / mL to 2,000 U / mL. In some embodiments, the hyaluronidase enzyme (e.g., a soluble hyaluronidase glycoprotein) is present in an amount that facilitates subcutaneous administration of the telomerase inhibitor composition to a subject. In some cases, the hyaluronidase enzyme is present in an amount that promotes rapid depolymerization of hyaluronan in the extracellular space of the subcutaneous tissue, thereby reducing the viscosity of the interstitium and increasing its water permeability, allowing a larger amount of the telomerase inhibitor composition to be administered to the subcutaneous tissue.

[0008] In some embodiments, the hyaluronidase enzyme is a variant of recombinant human hyaluronidase. In certain embodiments, the hyaluronidase enzyme is a variant of hyaluronidase PH20 having one or more amino acid residues added, deleted, or substituted in the amino acid sequence of wild-type PH20, for example, a variant of hyaluronidase PH20 having one or more amino acid residues added, deleted, or substituted in the amino acid sequence of mature wild-type PH20. In certain embodiments, the hyaluronidase enzyme is a fragment of wild-type hyaluronidase PH20. In certain embodiments, the hyaluronidase enzyme is a fragment of wild-type hyaluronidase PH20 having one or more amino acid residues added, deleted, or substituted in the amino acid sequence of wild-type hyaluronidase PH20.

[0009] The composition may include one or more pharmaceutically acceptable excipients. In some embodiments, the composition includes one or more saccharides. In some cases, the saccharides include one or more monosaccharides. The monosaccharides may be present in the composition in an amount of 1 mM to 1000 mM (e.g., 10 mM to 500 mM). In some cases, the saccharides include one or more polysaccharides. In some cases, the polysaccharides include sucrose. In other cases, the polysaccharides include trehalose. The polysaccharides may be present in the composition in an amount of 1 mM to 1000 mM (e.g., 10 mM to 500 mM). In certain cases, the polysaccharides are present in the composition in an amount of 100 mM to 300 mM.

[0010] In some embodiments, the composition comprises one or more amino acids. In certain embodiments, the composition comprises an amount of methionine. In other embodiments, the composition comprises an amount of histidine. In these embodiments, the amino acid may be present in the composition in an amount of 1 mM to 200 mM (e.g., 1 mM to 100 mM). In certain embodiments, the amino acid is present in the composition in an amount of 1 mM to 50 mM.

[0011] The composition may also include one or more buffers. In some cases, the buffer is present in the composition in an amount that maintains the composition at a predetermined pH. For example, one or more buffers may be present in the composition to maintain the composition at a pH of 3.0 to 9.0 (e.g., a pH of 5.5 to 7.5). In some embodiments, the buffer is present in the composition in an amount that includes 1 mM to 250 mM (e.g., 1 to 100 mM, and 1 mM to 50 mM). In certain cases, the buffer is a histidine buffer. In certain cases, the composition includes methionine and polysorbate 80 or polysorbate 20.

[0012] In any of the embodiments herein, the telomerase inhibitor comprises an oligonucleotide. In some embodiments, the oligonucleotide is complementary to the RNA component of telomerase. In some embodiments, the oligonucleotide is 10-20 base pairs in length. In some embodiments, the oligonucleotide comprises the sequence TAGGGTTAGACAA. In some embodiments of any of the embodiments herein, the oligonucleotide comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. In some embodiments of any of the embodiments herein, the oligonucleotide comprises all N3'→P5' thiophosphoramidate internucleoside linkages. According to certain embodiments, the telomerase inhibitor is an oligonucleotide comprising a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. In certain embodiments, the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. In some cases, the linker is a glycerol or aminoglycerol linker. In certain cases, the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. In some embodiments, the composition of the present invention is imetelstat or a pharmaceutically acceptable salt thereof, hi certain embodiments, the composition comprises imetelstat sodium.

[0013] In some embodiments, the amount of telomerase inhibitor in the subcutaneous composition is about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, about 450 to about 500 mg, about 500 mg to about 600 mg, about 600 mg to about 750 mg, about 600 mg to about 800 mg, about 800 mg to about 900 mg, about 900 mg to about 1000 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, about 450 to about 500 mg, about 500 mg to about 600 mg, about 600 mg to about 10 00mg to about 700mg, about 700mg to about 800mg, about 800mg to about 900mg, about 900mg to about 1000mg, about 1100mg to about 1200mg, about 1200mg to about 1300mg, about 1300mg to about 1400mg, about 1400mg to about 1500mg, about 1500mg to about 1600mg, about 1600mg to about 1700mg, about 1700mg to about 1800mg, about 1800mg to about 1900mg, about 1900mg to about 2000mg, about 2000mg to about 2100mg, about 2100mg to about 2200mg, about 2200mg to about 2300mg, about 2300mg to about 2400mg, and about 2400mg to about 2500mg.

[0014] In some embodiments, the amount of the telomerase inhibitor is in a unit dosage form ranging from about 5 mg to about 1000 mg, 5 mg to about 500 mg, e.g., about 30 mg to about 300 mg, or about 50 mg to about 200 mg. In some embodiments, the amount of the telomerase inhibitor is in a unit dosage form ranging from about 500 mg to about 3000 mg, 750 mg to about 2500 mg, e.g., about 1000 mg to about 2000 mg, or about 50 mg to about 200 mg. The unit dosage form may be liquid or lyophilized.

[0015] In some embodiments, the concentration of the telomerase inhibitor in the composition is a dilute solution (about 0.1 mg / ml) or a concentrated solution (about 300 mg / ml), for example, about 0.1 to about 300 mg / ml, about 0.1 to about 200 mg / ml, about 0.1 to about 180 mg / ml, about 0.1 to about 160 mg / ml, about 0.1 to about 140 mg / ml, about 0.1 to about 120 mg / ml, about 0.1 to about 100 mg / ml, about 0.1 to about 80 mg / ml, about 0.1 to about 60 mg / ml, about 0.1 to about 40 mg / ml, about 0.1 to about 20 mg / ml, about 0.1 to about 10 mg / ml, about 2 to about 40 mg / ml, about 4 to about 35 mg / ml, about 6 to about 30 mg / ml, about 8 about 25 mg / ml, about 10 to about 20 mg / ml, about 12 to about 15 mg / ml, or about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, 2 mg / ml, 2.1 mg / ml, 2.2 mg / ml, 2.3 mg / ml, 2.4 mg / ml, or 2.5 mg / ml.In some embodiments, the concentration of the telomerase inhibitor is at least about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 1.3 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 4 mg / ml, 5 mg / ml, 6 mg / ml, 7 mg / ml, 8 mg / ml, 9 mg / ml, 10 mg / ml, 11 mg / ml, 12 mg / ml, 13 mg / ml, 14 mg / ml, 15 mg / ml, 16 mg / ml, 17 mg / ml, 18 mg / ml, 19 mg / ml, 20 mg / ml, 21 mg / ml, 22 mg / ml, 23 mg / ml, 24 mg / ml, 25 mg / ml, 26 mg / ml, 27 mg / ml, 28 mg / ml, 29 mg / ml, 30 mg / ml, 31 mg / ml l, 32mg / ml, 33mg / ml, 33.3mg / ml, 34mg / ml, 35mg / ml, 36mg / ml, 37mg / ml, 38mg / ml, 39mg / ml, 40mg / ml, 50mg / ml, 60mg / ml, 70mg / ml, 80mg / ml, 90mg / ml, 100mg / ml, 110mg / ml, 120mg / ml, 130mg / ml, 140 mg / ml, 150mg / ml, 160mg / ml, 170mg / ml, 180mg / ml, 190mg / ml, 200mg / ml, 210mg / ml, 220mg / ml, 230 mg / ml, 240 mg / ml, 250 mg / ml, 260 mg / ml, 270 mg / ml, 280 mg / ml, 290 mg / ml, or 300 mg / ml. In certain embodiments, the composition is formulated to contain a telomerase inhibitor, such as imetelstat or imetelstat sodium, at a dosage of about 2.0 mg / kg to about 20.0 mg / kg, about 3.0 mg / kg to about 15.0 mg / kg (e.g., about 4.0 mg / kg to about 10 mg / kg, about 7.5 mg / kg to 9.4 mg / kg, about 9 mg / kg to about 11 mg / kg, and about 11 mg / kg to about 14 mg / kg).In certain embodiments, the composition comprises 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6.0 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg, 7.0 mg / kg, 7.1 mg / kg, 7.2 mg / kg, 7.3 mg / kg, 7.4 mg / kg, 7.5 mg / kg, 7.6 mg / kg, 7.7 mg / kg, 7.8 mg / kg, 7.9 mg / kg, 8.0 mg / kg, 8.1 mg / kg, 8.2 mg / kg, 8.3 mg / kg, 8.4 mg / kg, 8.5 mg / kg, 8.6 mg / kg, 8.7 mg / kg, 8.8 mg / kg, 8.9 mg / kg, 9.0 mg / kg, 9.1 mg / kg, 9.2 mg / kg, 9.3 mg / kg, 9.4 mg / kg, 9.5 mg / kg, 9.6 mg / kg, 9.7 mg / kg, 9.8 mg / kg, 9.9 mg / kg, 10.0 mg / kg, 10.1 mg / kg, 10.2 mg mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7.0mg / kg, 7.1mg / kg, 7.2mg / kg , 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8.0mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4m g / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9.0mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg , 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10.0mg / kg, 10.5mg / kg, 11.0mg / kg, 11.5mg / kg, 12.0mg / kg, 12.5mg / kg, 13.0mg / kg and 20.0 mg / kg, 13.5 mg / kg, 14.0 mg / kg, 14.5 mg / kg, 15.0 mg / kg, 15.5 mg / kg, 16.0 mg / kg, 16.5 mg / kg, 17.0 mg / kg, 17.0 mg / kg, 17.5 mg / kg, 18.0 mg / kg, 18.5 mg / kg, 19.0 mg / kg, 19.5 mg / kg, or 20.0 mg / kg, and formulated to contain a telomerase inhibitor, such as imetelstat or imetelstat sodium.

[0016] Aspects of the present disclosure also include methods for subcutaneously administering a telomerase inhibitor composition to a subject. In certain embodiments, a composition comprising a telomerase inhibitor and a hyaluronidase enzyme is administered subcutaneously to a subject. In some embodiments, the composition is administered to a subject by subcutaneous injection. In other embodiments, the composition may be administered to a subject from an implanted device, such as a subcutaneously implanted catheter. In certain embodiments, the telomerase inhibitor composition is administered to a subject using a subcutaneous bolus injector configured to subcutaneously deliver a predetermined amount of the composition to the subject. In certain embodiments, the telomerase inhibitor and hyaluronidase enzyme are administered simultaneously. For example, the telomerase inhibitor and hyaluronidase enzyme may be mixed together prior to administration. In some cases, the telomerase inhibitor and hyaluronidase enzyme are administered sequentially. For example, the hyaluronidase enzyme may be administered before the telomerase inhibitor. In some cases, the hyaluronidase enzyme is administered first, followed by the telomerase inhibitor. For example, a hyaluronidase enzyme can be administered immediately after administration of the telomerase inhibitor.

[0017] In certain embodiments, the methods of the present disclosure include treating a tumor. In some embodiments, the tumor may be a solid tumor cancer. Examples of cancers for treatment with embodiments of the present disclosure include, for example, adrenocortical carcinoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratoma / rhabdoid tumor, basal cell carcinoma, bile duct cancer (extrahepatic), bladder cancer, bone cancer (e.g., Ewing's sarcoma, osteosarcoma, and malignant fibrous histiocytoma, etc.), brain stem glioma, brain tumor (e.g., astrocytoma, central nervous system embryonal tumor, central nervous system germ cell tumor, craniopharyngioma, epithelioma, etc.), breast cancer (e.g., female breast cancer, male breast cancer, pediatric breast cancer, etc.), bronchial tumor, carcinoid tumor (e.g., pediatric, gastrointestinal, etc.), and tumors of the gastrointestinal tract. etc.), cancer of unknown primary site, cardiac (heart) tumor, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, duct (e.g., bile duct, extrahepatic, etc.), ductal carcinoma in situ (DCIS), embryonal tumor, endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumor, extragonadal germ cell tumor, extrahepatic bile duct cancer, eye cancer (e.g., intraocular melanoma, retinoblastoma, etc.), fibrous histiocytoma of bone (e.g., malignant, osteosarcoma, etc.), gallbladder cancer, stomach (gastric) cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (GIST), germ cell tumor (e.g., extracranial, extragonadal, ovarian, etc.) tumors, testes, etc.), gestational trophoblastic disease, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma (liver) cancer, histiocytosis (e.g., Langerhans cell, etc.), hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumors (e.g., pancreatic neuroendocrine tumors, etc.), kidney cancer (e.g., renal cell, Wilms' tumor, childhood kidney tumors, etc.), Langerhans cell histiocytosis, laryngeal cancer, lip and oral cavity cancer, liver cancer (primary), lobular carcinoma in situ (LCIS), lung cancer (e.g., non-small cell, small cell, etc.), malignant fibrous histiocytoma of bone and osteosarcoma, Melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous cell neck cancer of occult primary, oral cancer, occult primary oral cancer, multiple endocrine neoplasia syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-small cell lung cancer, oral cancer, oral cancer (e.g., lip), oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian cancer (e.g., epithelial, germ cell tumor, low-grade tumor), pancreatic cancer, pancreatic neuroendocrine tumor (islet cell tumor), papilloma, paraganglioma, paranasal sinus cancer and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor,Cancers of the present invention include, but are not limited to, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sézary syndrome, skin cancer (e.g., pediatric, melanoma, Merkel cell carcinoma, non-melanoma, etc.), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell cervical cancer (e.g., occult primary, metastatic, etc.), gastric (stomach) cancer, testicular cancer, pharyngeal cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, ureter and pelvis cancer, urethral cancer, uterine cancer (e.g., endometrium, etc.), uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, Wilms' tumor, etc. In certain embodiments, the method comprises treating a subject with a tumor described in U.S. Pat. No. 7,494,982.

[0018] In some embodiments, the tumor may be a hematological tumor. In certain embodiments, the methods of the present invention include treating a subject with a myeloproliferative neoplasm. In some cases, the myeloproliferative neoplasm is myelofibrosis (MF), e.g., primary myelofibrosis, or myelofibrosis after prior ET or PV (post-ET MF or post-PV MF). In other embodiments, the myeloproliferative neoplasm includes essential thrombocythemia (ET), polycythemia vera (PV), chronic myelogenous leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). In other cases, the hematological neoplasm is myelodysplastic syndrome (MDS). In yet other embodiments, the myeloproliferative neoplasm is myelodysplastic syndrome (MDS) without isolated del(5q). Myelodysplastic syndromes (MDS) include diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polycythemia versicolor, refractory cytopenia with monocytic dysplasia, and chronic myelomonocytic leukemia (CMML). In certain embodiments, the method also includes diagnosing a subject with a myeloproliferative neoplasm. In one example, the method includes diagnosing a subject with myelofibrosis (MF), such as primary myelofibrosis. In some embodiments, the subject has not previously received a telomerase inhibitor (e.g., is telomerase inhibitor naive). In some embodiments, the subject has lower-risk transfusion-dependent MDS that is relapsed or refractory to an erythropoietin-stimulating agent (ESA). In some embodiments, the subject has not previously been treated with a hypomethylating agent (HMA). In some embodiments, the subject has not been treated with lenalidomide. In some embodiments, the subject is a non-5q subject. In some embodiments, the subject is a subject who is relapsed or refractory to a Janus kinase (JAK) inhibitor. In some embodiments, the methods of the invention include treating a subject with a myeloproliferative neoplasm as described in U.S. Pat. No. 9,375,485 and International Patent Publication Nos. 2019 / 023667 and 2020 / 028261, the disclosures of which are incorporated herein by reference.

[0019] In certain embodiments, the methods of the invention include treating a subject having a lymphoid tumor. In some embodiments, the lymphoid tumor (e.g., lymphoma) is a B-cell tumor. In some embodiments, the lymphoid tumor (e.g., lymphoma) is a T-cell tumor and / or a putative NK-cell tumor.

[0020] In certain embodiments, the telomerase inhibitor and hyaluronidase enzyme are administered subcutaneously to a subject. The telomerase inhibitor composition and hyaluronidase enzyme can be administered subcutaneously to a subject one or more times per day (e.g., two or more times per day, e.g., three or more times per day, e.g., four or more times per day, and five or more times per day). In some embodiments, the composition is administered subcutaneously to a subject for one or more days, two or more days, three or more days, four or more days, five or more days, six or more days, seven or more days, e.g., ten or more days, e.g., fourteen or more days, e.g., twenty-one or more days. Dosing can be administered in administration cycles of the telomerase inhibitor composition and hyaluronidase enzyme. In some embodiments, the cycle is once every day. In some embodiments, the cycle is once every other day (i.e., once every two days). In some embodiments, the cycle is once every three days. In some embodiments, the cycle is once every four days. In some embodiments, the cycle is once every 5 days. In some embodiments, the cycle is once every 6 days. In some embodiments, the cycle is once every 7 days. In some embodiments, the cycle is once every 14 days, in some cases, the cycle is once every 21 days, and in other cases, the cycle is once every 28 days or more. The administration cycle of the telomerase inhibitor composition can be repeated for 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosing cycles for a total period of 6 months, or 1 year, or 2 years, or 3 years, or 4 years, or 5 years, or 6 years, or 7 years, or 8 years, or 9 years, or 10 years or more. For example, an administration cycle can be performed, followed by one or more days without administering the composition, and then a subsequent administration cycle can be performed. The time between dosing cycles can be 1 day or more, 2 days or more, 3 days or more, 4 days or more, 5 days or more, 6 days or more, 7 days or more, 10 days or more, 14 days or more, 21 days or more, or 28 days or more.

[0021] Without wishing to be bound by theory, the present invention provides compositions, unit dosage forms, and kits comprising both a telomerase inhibitor and a hyaluronidase enzyme as defined herein, which are suitable and stable for use in methods of treating tumor-bearing subjects by subcutaneous administration. The present invention also provides such compositions formulated for subcutaneous administration, which compositions are safe and tolerable to the treated subject and, when co-formulated with the hyaluronidase enzyme, enable an effective pharmacokinetic profile for the telomerase inhibitor. The present invention further provides dosage forms with an appropriate liquid volume containing a sufficient dose of the telomerase inhibitor for subcutaneous administration. [Brief explanation of the drawings]

[0022] [Figure 1] 1 shows the plasma concentration time profile of imetelstat sodium after subcutaneous injection and intravenous delivery in rats, according to certain embodiments. [Figure 2] 1 shows the inhibition (%) of telomerase activity versus therapeutic concentration (μM) of various sample formulations, according to certain embodiments.

[0023] Select a definition The term "nucleoside" refers to a nucleotide with the general structure: [ka] where B represents a nucleobase, and the 2' carbon can be substituted as described below. When incorporated into an oligomer or polymer, the 3' carbon is further linked to an oxygen or nitrogen atom. Nucleosides can include 2'-deoxy and 2'-hydroxyl (i.e., deoxyribose and ribose) forms, as well as analogs thereof. In certain cases, the 5'-NH group can be substituted for the 5'-oxygen. "Analog," with respect to nucleosides, includes synthetic nucleosides having modified nucleobase moieties (see definition of "nucleobase" below) and / or modified sugar moieties, such as 2'-fluorosugars, among other analogs. Such analogs are typically designed to affect binding properties, such as stability, specificity, etc. The term "nucleoside" includes naturally occurring nucleosides, including 2'-deoxy and 2'-hydroxy forms, as well as analogs, e.g., as described in Komberg and Baker, DNA Replication, 2nd Ed. (Freeman, San Francisco, 1992). "Analog," with respect to nucleosides, includes synthetic nucleosides having modified nucleobase moieties (see definition of "nucleobase" below) and / or modified sugar moieties, generally as described by Scheit, Nucleotide Analogs (John Wiley, New York, 1980). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., stability, specificity, etc., as disclosed, e.g., by Uhlmann and Peyman, Chemical Reviews 90:543-584, 1990). Oligonucleotides containing such nucleosides, typically containing synthetic nuclease-resistant internucleoside linkages, may themselves be referred to as "analogs."

[0024] "Polynucleotide" or "oligonucleotide" refers to a ribose and / or deoxyribose nucleoside subunit polymer or oligomer having from about 2 to about 200 consecutive subunits. The nucleoside subunits can be linked by a variety of intersubunit linkages, including, but not limited to, phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoamidate, and phosphorothioate linkages. The term also includes such polymers or oligomers with modifications to the sugar (e.g., 2' substitutions), bases, and 3' and 5' termini. In embodiments where an oligonucleotide moiety contains multiple intersubunit linkages, each linkage may be formed using the same chemical, or a mixture of linkage chemistries may be used. When an oligonucleotide is represented by a series of letters, such as "ATGUCCTG," it will be understood that the nucleotides are in 5'→3' order from left to right. Representing the base sequence of an oligonucleotide in this manner does not imply the use of any particular type of internucleoside subunit in the oligonucleotide.

[0025] "Nucleobase" includes (i) natural DNA and RNA nucleobases (uracil, thymine, adenine, guanine, and cytosine), (ii) modified nucleobases or nucleobase analogs (e.g., 5-methylcytosine, 5-bromouracil, or inosine), and (iii) nucleobase analogs. Nucleobase analogs are compounds whose molecular structure mimics that of a typical DNA or RNA base.

[0026] The term "lipid" is used broadly herein to encompass substances that are soluble in organic solvents but sparingly soluble in water. The term lipid includes, but is not limited to, hydrocarbons, oils, fats (such as fatty acids and glycerides), sterols, steroids, and derivative forms of these compounds. In some embodiments, lipids are fatty acids and their derivatives, hydrocarbons and their derivatives, and sterols such as cholesterol. Fatty acids typically contain an even number of carbon atoms in a straight chain (generally 12-24 carbons), may be saturated or unsaturated, and can contain or be modified to contain various substituents. For simplicity, the term "fatty acid" also encompasses fatty acid derivatives, such as fats or esters. In some embodiments, the term "lipid" also includes amphipathic compounds containing both a lipid portion and a hydrophilic portion.

[0027] An "individual" or "patient" or "subject" can be a mammal, such as any common laboratory model organism. Mammals include, but are not limited to, humans and non-human primates, farm animals, sport animals, pets, mice, rats, and other rodents. In some embodiments, the individual or patient or subject is human. In certain embodiments, the subject or patient has not previously received telomerase inhibitor therapy prior to the particular embodiment; such a patient is "telomerase inhibitor naive."

[0028] An "effective amount" or "therapeutically effective amount" or "clinically effective amount" refers to the amount of a telomerase inhibitor administered to a mammalian subject, either in a single dose or as part of a series, that is effective to produce the desired therapeutic effect.

[0029] As used herein, the terms "tumor," "tumor formation," or "neoplastic" refer to abnormal new cell growth. Unlike hyperplasia, neoplastic growth continues even in the absence of the original stimulus. "Tumor cells" refer to cells that exhibit relatively autonomous growth, such that they exhibit an abnormal growth phenotype characterized by a marked loss of control over cell proliferation. Tumor cells include cells that can actively replicate or be in a transient, non-replicative quiescent state (G1 or G0); similarly, tumor cells can include cells with a well-differentiated phenotype, a less differentiated phenotype, or a mixture of both types of cells. Thus, not all tumor cells are replicating cells at a given time. "Tumor cells" encompass such cells in benign tumors and cells in malignant tumors. "Neoplastic progenitor cells" refer to cells of a cellular composition that have the potential to become neoplastic.

[0030] A "proliferative disorder" is any cellular disorder in which cells proliferate more rapidly than normal tissue growth. Thus, a "proliferative cell" is a cell that is proliferating more rapidly than normal cells. Proliferative disorders include, but are not limited to, tumors. A "tumor" is an abnormal tissue growth, generally forming a distinct mass that grows faster by cell proliferation than normal tissue growth. Tumors exhibit partial or total structural organization and a lack of functional coordination with normal tissue. They can be broadly classified into three types: malignant tumors arising from epithelial structures are called carcinomas; malignant tumors arising from connective tissue (e.g., muscle, cartilage, fat, or bone) are called sarcomas; and malignant tumors affecting hematopoietic structures (structures involved in the formation of blood cells), including components of the immune system, are called leukemias and lymphomas. A tumor is a neoplastic growth of a cancerous disease. As used herein, neoplasm, also referred to as "tumor," is intended to encompass hematopoietic tumors as well as solid tumors. Other proliferative disorders include, but are not limited to, neurofibromatosis.

[0031] As used herein, the singular forms "a," "an," and "the" include plural references unless otherwise indicated.

[0032] Every maximum numerical limitation given throughout this specification is intended to include every lower numerical limitation, as if such lower numerical limitation were expressly written herein. Every minimum numerical limitation given throughout this specification will include every upper numerical limitation, as if such upper numerical limitations were expressly written herein. Every numerical range given throughout this specification will include every narrower numerical range that falls within such broader numerical range, as if such narrower numerical ranges were all expressly written herein.

[0033] Before further describing the present invention, it is to be understood that this invention is not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0034] Where a range of values ​​is provided, unless the context clearly dictates otherwise, it is understood that each intervening value between the upper and lower limits, and to one-tenth of the unit of any other value or lower limit of that intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0035] It will be understood that, for clarity, certain features of the invention that are described in the context of separate embodiments may also be provided in combination in a single embodiment. Conversely, for brevity, various features of the invention that are described in the context of a single embodiment may also be provided separately or in any suitable subcombination. All combinations of embodiments related to the present invention are specifically embraced by the present invention and are disclosed herein as if each and every combination were individually and explicitly disclosed, to the extent that such combinations include subject matter that is, for example, a stable compound (i.e., a compound that can be made, isolated, characterized, and tested for biological activity). In addition, all subcombinations of various embodiments and elements thereof (e.g., elements of chemical groups listed in embodiments describing such variables) are also specifically embraced by the present invention and are disclosed herein as if each and every such subcombination were individually and explicitly disclosed herein.

[0036] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention, the methods and materials of interest are described below. All publications mentioned herein are incorporated by reference to disclose and describe the methods and / or materials related to the cited publications.

[0037] It should be noted that as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. Accordingly, this statement is intended to serve as a predicate for the use of exclusive terminology such as "solely," "only," or the use of a "negative" limitation in connection with the recitation of claim elements.

[0038] It will be appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0039] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein should be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual dates of publication, which may need to be independently confirmed.

[0040] The compounds described herein can be purified by any of the methods known in the art, including chromatographic methods such as high performance liquid chromatography (HPLC), preparative thin-layer chromatography, flash column chromatography, and ion exchange chromatography. Any suitable stationary phase can be used, including normal phase and reverse phase, and ionic resin. For example, see "Introduction to Modern Liquid Chromatography," 2nd Edition, ed. L.S. Snyder and J.J. Kirkland, John Wiley and Sons, 1979, and "Thin Layer Chromatography," ed. E. Stahl, Springer-Verlag, New York, 1969.

[0041] The compounds described herein may contain one or more chiral centers and / or double bonds and therefore may exist as stereoisomers, such as double bond isomers (i.e., geometric isomers), enantiomers, or diastereomers. Accordingly, all possible enantiomers and stereoisomers of the compounds, including stereoisomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure), as well as mixtures of enantiomers and stereoisomers, are included in the description of the compounds herein. Mixtures of enantiomers and stereoisomers can be resolved into their component enantiomers or stereoisomers using separation or chiral synthesis techniques well known to those skilled in the art. Compounds may also exist in several tautomeric forms, including enol forms, keto forms, and mixtures thereof. Thus, the chemical structures depicted herein encompass all possible tautomeric forms of the exemplified compounds. The compounds described also include isotopically labeled compounds, where one or more atoms have an atomic mass different from the atomic mass conventionally found in nature. Examples of isotopes that can be incorporated into compounds disclosed herein include, but are not limited to, 2 H, 3 H, 11 C. 13 C. 14 C. 15 N, 18 O. 17 O and the like. Compounds can exist in unsolvated forms as well as solvated forms, including hydrated forms. In general, compounds can be hydrated or solvated. Certain compounds can exist in multiple crystalline or amorphous forms. In general, all physical forms are equivalent for the uses contemplated herein and are intended to be within the scope of the present disclosure. The present invention provides, for example, the following items. (Item 1) 1. A composition formulated for subcutaneous administration, comprising: a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide; and a hyaluronidase enzyme. (Item 2) 2. The composition of claim 1, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. (Item 3) 2. The composition of claim 1, wherein the composition comprises a variant or fragment of a PH20 hyaluronidase enzyme. (Item 4) 4. The composition of claim 3, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. (Item 5) 5. The composition of claim 4, wherein the truncation is located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted. (Item 6) 6. The composition of claim 5, wherein the truncation is located before the N-terminal amino acid residue L36, N37, F38, R39, A40, P41, or P42 such that one or more residues at the N-terminus are deleted. (Item 7) 7. The composition according to item 6, wherein the truncation is located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 8) 8. The composition of claim 7, wherein the truncation is located after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 9) 9. The composition of any one of items 4 to 8, wherein the variant or fragment of PH20 comprises a polypeptide selected from the group represented as amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 10) 10. The composition according to any one of items 4 to 9, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5, MAAHLLPICALFLTLLDMAQG. (Item 11) 3. The composition of claim 2, wherein the hyaluronidase enzyme is rHuPH20. (Item 12) 11. The composition according to any one of items 4 to 10, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 90% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 13) 11. The composition according to any one of items 4 to 10, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 95% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 14) 14. The composition of any one of items 1 to 13, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. (Item 15) 15. The composition according to any one of items 1 to 14, wherein the composition further comprises one or more pharmaceutically acceptable excipients. (Item 16) 16. The composition according to any one of items 1 to 15, wherein the composition further comprises one or more sugars. (Item 17) 17. The composition according to item 16, wherein the one or more sugars are present in the composition in an amount of 10 mM to 500 mM. (Item 18) 18. The composition according to any one of items 1 to 17, wherein the composition further comprises one or more amino acids. (Item 19) 19. The composition according to item 18, wherein the amino acid is selected from methionine and histidine. (Item 20) 20. The composition according to item 18 or 19, wherein the one or more amino acids are present in the composition in an amount of 1 mM to 100 mM. (Item 21) 21. The composition according to any one of items 1 to 20, wherein the composition further comprises a buffer. (Item 22) 22. The composition according to item 21, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0. (Item 23) 23. The composition according to item 21 or 22, wherein the buffer is present in the composition in an amount of 1 to 100 mM. (Item 24) 24. The method of any one of items 1 to 23, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 25) 25. The composition of any one of items 1 to 24, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 26) 26. The composition of claim 25, wherein the linker is a glycerol or aminoglycerol linker. (Item 27) 27. The composition of any one of items 1 to 26, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 28) 28. The composition according to any one of items 1 to 27, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 29) 29. The composition of claim 28, wherein the telomerase inhibitor is imetelstat sodium. (Item 30) The telomerase inhibitor is present in the composition. (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The composition according to any one of items 1 to 29, wherein the composition is present in a dosage of from about 11 mg / kg to about 14 mg / kg. (Item 31) The telomerase inhibitor is present in the composition. (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The composition according to any one of items 1 to 29, which is present in a dosage of from about 500 mg to about 2000 mg. (Item 32) 32. The composition according to any one of items 1 to 31, wherein the composition is lyophilized. (Item 33) 1. A method of treating a subject having a tumor, comprising subcutaneously administering to said subject a composition comprising: a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide; a hyaluronidase enzyme. (Item 34) 34. The method of item 33, wherein the tumor is a hematological tumor selected from myelofibrosis (MF), myelodysplastic syndrome (MDS), essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). (Item 35) 35. The method of item 33 or 34, further comprising diagnosing the subject as having a hematological tumor. (Item 36) 36. The method of any one of items 33 to 35, wherein the composition is administered subcutaneously to the subject once every seven days. (Item 37) 36. The method of any one of items 33 to 35, wherein the composition is administered subcutaneously to the subject once every 21 days. (Item 38) 36. The method of any one of items 33 to 35, wherein the composition is administered subcutaneously to the subject once every 28 days. (Item 39) 39. The method according to any one of items 33 to 38, wherein the method is repeated one or more times. (Item 40) The telomerase inhibitor is administered to the subject: (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The method according to any one of items 33 to 39, wherein the therapeutic agent is administered at a dosage of about 11 mg / kg to about 14 mg / kg. (Item 41) The telomerase inhibitor is administered to the subject: (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The method according to any one of items 33 to 39, wherein the dose is about 500 mg to about 2000 mg. (Item 42) 42. The method of any one of items 38 to 41, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. (Item 43) 42. The method of any one of paragraphs 38 to 41, wherein the composition comprises a variant or fragment of a PH20 hyaluronidase enzyme. (Item 44) 44. The method of claim 43, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. (Item 45) Item 45. The method of item 44, wherein the truncation is located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted. (Item 46) 46. ​​The method of claim 45, wherein the truncation is located before the N-terminal amino acid residue L36, N37, F38, R39, A40, P41, or P42 such that one or more residues at the N-terminus are deleted. (Item 47) Item 45. The method of claim 44, wherein the truncation is located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 48) 48. The method of claim 47, wherein the truncation is after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 49) 49. The method of any one of items 43 to 48, wherein the variant or fragment of PH20 comprises a polypeptide selected from the group set forth as amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 50) 50. The method according to any one of Items 43 to 49, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5, MAAHLLPICALFLTLLDMAQG. (Item 51) 43. The method of claim 42, wherein the hyaluronidase enzyme is rHuPH20. (Item 52) 51. The method according to any one of Items 43 to 50, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 90% sequence identity with amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 53) 51. The method according to any one of Items 43 to 50, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 95% sequence identity with amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 54) 54. The method of any one of items 33 to 53, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. (Item 55) 54. Any of items 33 to 53, wherein the composition further comprises one or more pharmaceutically acceptable excipients. The method according to any one of claims 1 to 4. (Item 56) 55. The method according to any one of items 33 to 54, wherein the composition further comprises one or more sugars. (Item 57) 57. The method of claim 56, wherein the one or more sugars are present in the composition in an amount of 10 mM to 500 mM. (Item 58) 58. The method according to any one of items 33 to 57, wherein the composition further comprises one or more amino acids. (Item 59) 59. The method of claim 58, wherein the amino acid is selected from methionine and histidine. (Item 60) 59. The method of claim 57, wherein the one or more amino acids are present in the composition in an amount of 1 mM to 100 mM. (Item 61) 61. The method according to any one of items 33 to 60, wherein the composition further comprises a buffer. (Item 62) Item 62. The method of item 61, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0. (Item 63) 63. The method according to item 61 or 62, wherein the buffer is present in the composition in an amount of 1 to 100 mM. (Item 64) 64. The method of any one of items 33 to 63, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 65) 65. The method of any one of items 33 to 64, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 66) Item 66. The method of item 65, wherein the linker is a glycerol or aminoglycerol linker. (Item 67) 67. The method of any one of items 33 to 66, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 68) 68. The method according to any one of items 33 to 67, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 69) Item 69. The method of item 68, wherein the telomerase inhibitor is imetelstat sodium. (Item 70) A unit dosage form comprising a hyaluronidase enzyme and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. (Item 71) 71. The unit dosage form of item 70, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. (Item 72) 71. The unit dosage form of item 70, wherein the composition comprises a variant or fragment of a PH20 hyaluronidase enzyme. (Item 73) 73. The unit dosage form of any one of items 70 to 72, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. (Item 74) 74. The unit dosage form of item 73, wherein the truncation is located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted. (Item 75) 75. The unit dosage form of item 74, wherein the truncation is located before the N-terminal amino acid residue L36, N37, F38, R39, A40, P41, or P42 such that one or more residues at the N-terminus are deleted. (Item 76) 76. The unit dosage form of item 75, wherein the truncation is located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 77) 77. The unit dosage form of item 76, wherein the truncation is located after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 78) 78. The unit dosage form of any one of items 72 to 77, wherein the variant or fragment of PH20 comprises a polypeptide selected from the group set forth as amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 79) 79. The unit dosage form according to any one of items 70 to 78, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5, MAAHLLPICALFLTLLDMAQG. (Item 80) 71. The unit dosage form of item 70, wherein the hyaluronidase enzyme is rHuPH20. (Item 81) 80. The unit dosage form of any one of items 72 to 79, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 90% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 82) 80. The unit dosage form of any one of items 72 to 79, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 95% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 83) 83. The unit dosage form of any one of items 70 to 82, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. (Item 84) 84. The unit dosage form of any one of items 70 to 83, wherein the composition further comprises one or more pharmaceutically acceptable excipients. (Item 85) 85. The unit dosage form of item 84, wherein the composition further comprises one or more sugars. (Item 86) 86. The unit dosage form of item 85, wherein the one or more sugars are present in the composition in an amount of 10 mM to 500 mM. (Item 87) 87. The unit dosage form of any one of items 84 to 86, wherein the composition further comprises one or more amino acids. (Item 88) 88. The unit dosage form of item 87, wherein the amino acid is selected from methionine and histidine. (Item 89) 89. The unit dosage form according to item 87 or 88, wherein the one or more amino acids are present in the composition in an amount of 1 mM to 100 mM. (Item 90) 90. The unit dosage form of any one of items 84 to 89, wherein the composition further comprises a buffer. (Item 91) 91. The unit dosage form of item 90, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0. (Item 92) 92. The unit dosage form according to item 90 or 91, wherein the buffer is present in the composition in an amount of 1 to 100 mM. (Item 93) 93. The unit dosage form of any one of items 70 to 92, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 94) 94. The unit dosage form of any one of items 70 to 93, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 95) 95. The unit dosage form of item 94, wherein the linker is a glycerol or aminoglycerol linker. (Item 96) 96. The unit dosage form of any one of items 70 to 95, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 97) 97. The unit dosage form of any one of items 70 to 96, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 98) 98. The unit dosage form of item 97, wherein the telomerase inhibitor is imetelstat sodium. (Item 99) The telomerase inhibitor is present in the composition. (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The unit dosage form according to any one of items 70 to 98, which is present in a dosage of from about 11 mg / kg to about 14 mg / kg. (Item 100) The telomerase inhibitor is present in the composition in an amount of about (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The unit dosage form according to any one of items 70 to 98, which is present in a dosage of from about 500 mg to about 2000 mg. (Item 101) 101. The unit dosage form according to any one of items 70 to 100, wherein the composition is a liquid. (Item 102) a composition comprising a hyaluronidase enzyme; and a composition comprising an oligonucleotide and a telomerase inhibitor comprising a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. (Item 103) 103. The kit of item 102, further comprising a syringe. (Item 104) 104. The kit of claim 102 or 103, wherein the composition comprising the telomerase inhibitor is lyophilized. (Item 105) 105. The kit according to any one of items 102 to 104, wherein the kit further comprises a buffer for producing a reconstituted liquid composition. (Item 106) 106. The kit of any one of items 102 to 105, wherein the hypodermic injection device comprises a needle and a syringe. (Item 107) 106. The kit of any one of items 102 to 105, wherein the subcutaneous syringe is a bolus syringe configured to subcutaneously deliver a predetermined amount of the composition. (Item 108) 108. The kit of any one of items 102 to 107, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. (Item 109) 109. The kit of any one of paragraphs 102 to 108, wherein the composition comprises a variant or fragment of the PH20 hyaluronidase enzyme. (Item 110) 110. The kit of claim 109, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. (Item 111) Item 111. The kit according to Item 110, wherein the truncation is located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted. (Item 112) 112. The kit of claim 111, wherein the truncation is located before the N-terminal amino acid residue L36, N37, F38, R39, A40, P41, or P42 such that one or more residues at the N-terminus are deleted. (Item 113) Item 111. The kit according to Item 110, wherein the truncation is located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 114) 14. The kit of claim 113, wherein the truncation is after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. (Item 115) 109. The kit of claim 108, wherein the hyaluronidase enzyme is rHuPH20. (Item 116) 116. The kit according to any one of Items 108 to 115, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5, MAAHLLPICALFLTLLDMAQG. (Item 117) 15. The kit according to any one of Items 108 to 114, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 90% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 118) 15. The kit according to any one of Items 108 to 114, wherein the variant or fragment of PH20 is a sequence of amino acids set forth in SEQ ID NO: 1 or a peptide having at least 95% sequence identity to amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1. (Item 119) 119. The kit of any one of items 102 to 118, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. (Item 120) 119. The kit of any one of items 102 to 119, wherein the composition further comprises one or more pharmaceutically acceptable excipients. (Item 121) 121. The kit according to any one of items 102 to 120, wherein the composition further comprises one or more sugars. (Item 122) Item 122. The kit of item 121, wherein the one or more saccharides are present in the composition in an amount of 10 mM to 500 mM. (Item 123) 123. The kit according to any one of items 102 to 122, wherein the composition further comprises one or more amino acids. (Item 124) 124. The kit of claim 123, wherein the composition comprises an amino acid selected from methionine or histidine. (Item 125) 125. The kit according to item 123 or 124, wherein the one or more amino acids are present in the composition in an amount of 1 mM to 100 mM. (Item 126) 126. The kit according to any one of items 102 to 125, wherein the composition further comprises a buffer. (Item 127) Item 127. The kit of item 126, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0. (Item 128) 128. The kit according to item 126 or 127, wherein the buffer is present in the composition in an amount of 1 to 100 mM. (Item 129) 129. The kit according to any one of items 102 to 128, wherein the oligonucleotide of the telomerase inhibitor comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. (Item 130) 129. The kit according to any one of items 102 to 129, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. (Item 131) Item 131. The kit of item 130, wherein the linker is a glycerol or aminoglycerol linker. (Item 132) 132. The kit according to any one of items 102 to 131, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. (Item 133) 133. The kit according to any one of items 102 to 132, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof. (Item 134) Item 134. The kit of item 133, wherein the telomerase inhibitor is imetelstat sodium. (Item 135) The telomerase inhibitor is present in the composition. (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The kit according to any one of items 102 to 134, wherein the kit is present in a dosage of about 11 mg / kg to about 14 mg / kg. (Item 136) The telomerase inhibitor is present in the composition. (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The kit according to any one of items 102 to 134, wherein the kit is present in a dosage of about 500 mg to about 2000 mg. DETAILED DESCRIPTION OF THE INVENTION

[0042] Subcutaneous telomerase inhibitor compositions Embodiments of the present disclosure include telomerase inhibitor compositions formulated for subcutaneous administration. The term "subcutaneous" is used herein in its conventional sense to refer to the subcutaneous layer of skin, such as the subcutaneous tissue layer. The subcutaneous interstitial matrix is ​​composed of fibrous proteins in a viscoelastic gel of glycosaminoglycans. Glycosaminoglycans in the subcutaneous tissue include glycohyaluronan (HA), a non-sulfated repeating linear disaccharide.

[0043] The compositions of the present disclosure comprise a hyaluronidase enzyme. In some embodiments, the hyaluronidase enzyme is a mammalian-type hyaluronidase, such as an endo-β-N-acetylhexosaminidase, which has tetrasaccharides and hexasaccharides as its primary end products. In some cases, the mammalian hyaluronidase has both hydrolytic and transglycosidase activity and can degrade hyaluronan and chondroitin sulfate. In other embodiments, the hyaluronidase enzyme is a bacterial hyaluronidase, such as an endo-β-N-acetylhexosaminidase, which generates disaccharide end products by beta-elimination. In yet other embodiments, the hyaluronidase enzyme is an endo-β-glucuronidase, which generates tetrasaccharide and hexasaccharide end products through the hydrolysis of β-1-3 bonds. In some embodiments, the hyaluronidase enzyme in the telomerase inhibitor compositions of the present disclosure comprises a mammalian hyaluronidase with a neutral or acidic active site. In certain embodiments, the compositions of interest comprise a recombinant human hyaluronidase enzyme. In certain instances, the recombinant human hyaluronidase enzyme is PH20 recombinant human hyaluronidase enzyme (rHuPH20). In some embodiments, the telomerase inhibitor subcutaneous composition comprises one or more soluble hyaluronidase glycoproteins (sHASEGPs). In some embodiments, the hyaluronidase enzyme (e.g., soluble hyaluronidase glycoproteins) facilitate subcutaneous administration of the compositions of the invention. In some instances, the hyaluronidase enzyme is present in an amount that promotes rapid depolymerization of hyaluronan in the extracellular space, reduces interstitial viscosity, increases hydraulic conductance, and allows for larger doses to be administered to the subcutaneous tissue. In certain embodiments, the increased hydraulic conductance induced by the hyaluronidase enzyme via reduced interstitial viscosity allows for greater dispersion and increases the systemic bioavailability of the subcutaneously administered telomerase inhibitors described herein.

[0044] In certain embodiments, the compositions comprise one or more hyaluronidase enzymes (e.g., soluble hyaluronidase glycoproteins), such as those described in International Patent Publication Nos. 2004 / 078140 and 2006 / 091871, and U.S. Patent No. 7,767,429, the disclosures of which are incorporated herein by reference.

[0045] In some embodiments, the hyaluronidase enzyme is a variant or fragment of recombinant human hyaluronidase that is active and capable of degrading hyaluronan. The sequence of the wild-type human PH20 hyaluronidase enzyme (SEQ ID NO: 1) is shown in Table 1 below. Table 1 - Amino acid sequence of the precursor, including the signal sequence, of the wild-type human PH20 hyaluronidase enzyme (SEQ ID NO: 1) [Table 1]

[0046] In certain embodiments, the hyaluronidase is a soluble hyaluronidase. Soluble hyaluronidases include any hyaluronidase that exists in a soluble form when expressed and secreted from a cell. Such soluble hyaluronidases include, but are not limited to, non-human soluble hyaluronidase, bacterial soluble hyaluronidase, bovine PH20, ovine PH20, and variants thereof. Soluble hyaluronidases include human PH20 polypeptides that have been modified to be soluble. For example, hyaluronidases, such as human PH20, that contain a glycophosphatidylinositol (GPI) anchor can be made soluble by cleavage and removal of all or a portion of the GPI anchor. In one example, human hyaluronidase PH20 is typically membrane-anchored via a GPI anchor and is made soluble by cleavage and removal of all or a portion of the GPI anchor at its C-terminus.

[0047] Soluble hyaluronidases also include neutral-active hyaluronidases, such as soluble human PH20 polypeptides. In particular examples, the hyaluronidase for use in the compositions, combinations, and methods herein is a soluble neutral-active hyaluronidase. Exemplary forms of hyaluronidase include soluble forms of PH20 from any species, such as soluble forms of PH20. Soluble forms of PH20 are known in the art and include ovine and bovine PH20 polypeptides, as well as soluble forms of human PH20 of SEQ ID NO: 1. Soluble forms of human PH20 of SEQ ID NO: 1. Such soluble forms include truncated forms thereof lacking all or a portion of the C-terminal GPI anchor, so long as the hyaluronidase is soluble (secreted upon expression) and retains hyaluronidase activity. Such forms are also typically mature forms lacking the signal peptide when expressed in a cell. Full-length mature human PH20 (residues 36-509 of SEQ ID NO: 1) occurs as a GPI-anchored polypeptide. As is known in the art, solubility is achieved by truncation at the C-terminus. Such truncation can remove all of the GPI-anchor attachment sequence, or only a portion of the GPI-anchor attachment sequence. However, the resulting polypeptide is soluble. If a soluble hyaluronidase retains a portion of the GPI-anchor attachment signal sequence, one, two, three, four, five, six, seven, or more amino acid residues of the GPI-anchor attachment signal sequence can be retained, so long as the polypeptide is soluble. Polypeptides that contain one or more amino acids of the GPI anchor are referred to as extended soluble hyaluronidases. One of skill in the art can determine whether a polypeptide is GPI-anchored using methods well known in the art. Such methods include, but are not limited to, using known algorithms to predict the presence and location of GPI anchor attachment signal sequences and ω sites, and performing solubility analyses before and after digestion with phosphatidylinositol-specific phospholipase C (PI-PLC) or D (PI-PLD).

[0048] An example of a soluble hyaluronidase is soluble human PH20. Soluble forms of recombinant human PH20 have been produced and can be used in the compositions, combinations, and methods described herein. Descriptions and production of such soluble forms of PH20 are found, for example, in U.S. Patent Nos. 7,767,429, 8,202,517, 8,431,380, 8,431,124, 8,450,470, 8,765,685, 8,772,246, 7,871,607, 7,846,431, 7,829,081, 8,105,586, 8,187,855, 8,257,699, 8,580,252, 9,677,061, and 9,677,062, which are incorporated herein by reference.

[0049] Recombinant soluble forms of human PH20 have been generated and can be used in the compositions, combinations, and methods provided herein. For example, with reference to SEQ ID NO: 1, which sets forth the sequence of full-length precursor PH20 including the signal sequence (residues 1-35), soluble forms include, but are not limited to, those derived from the C-terminal amino acid residues 467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, 483, 484, 485, 486, 487, 488, 489, 490, 491, 492, 493, 494, 495, 496, 497, 498, 499, 500, 501, 502, 503, 504, 505, 506, 507, 508, 509, 510, 511, 512, 513, 514, 515, 516, 517, 518, 519, 520, 521, 522, 523, 524, 525, 526, 527, 528, 529, 530, 531, 532, 533, 534, 535, 536, 537, 538, 539, 540, 541, 542, 543, 544, 545, 546, 547, 548, 549 C-terminal truncated polypeptides of human PH20 as set forth in SEQ ID NO: 1, or polypeptides showing at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity thereto, are active at neutral pH and soluble (secreted into the medium when expressed in mammalian cells). Soluble forms of human PH20 generally include those containing amino acids 36-464 as set forth in SEQ ID NO: 1. For example, when expressed in mammalian cells, the 35-amino acid N-terminal signal sequence is cleaved during processing, resulting in secretion of the mature form of the protein. Thus, mature soluble polypeptides include those containing amino acids 36-467, 468, 469, 470, 471, 472, 473, 474, 475, 476, 477, 478, 479, 480, 481, 482, and 483 of SEQ ID NO:1.Examples of soluble hyaluronidases include soluble human PH20 polypeptides that are 442, 443, 444, 445, 446, or 447 amino acids in length, such as soluble PH20 polypeptides having the amino acid sequences set forth as amino acid residues 36-482, 36-477, 366-478, 36-479, 36-480, 36-481, and 36-483 of SEQ ID NO: 1, and soluble PH20 polypeptides that exhibit hyaluronidase activity. and variants thereof that retain the above structure and have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with the sequence of amino acids set forth as amino acid residues 36-482, 36-477, 366-478, 36-479, 36-480, 36-481, and 36-483 of SEQ ID NO: 1, for example. Such soluble forms of recombinant human PH20 are described, for example, in U.S. Patent Nos. 7,767,429, 8,202,517, 8,431,380, 8,431,124, 8,450,470, 8,765,685, 8,772,246, 7,871,607, 7,846,431, 7,829,081, 8,105,586, 8,187,855, 8,257,699, 8,580,252, 9,677,061, and 9,677,062, which are incorporated herein by reference. Generally, soluble forms of PH20 are produced using protein expression systems that promote correct N-glycosylation to ensure that the polypeptide retains activity, as glycosylation is important for the catalytic activity and stability of hyaluronidase. Such cells include, for example, Chinese hamster ovary (CHO) cells (e.g., DG44CHO cells).

[0050] Soluble recombinant human PH20 can be recombinantly produced, including recombinant forms of human PH20. One such product is referred to as rHuPH20, which generally refers to the composition produced when a nucleic acid encoding residues 36-482 of SEQ ID NO:1 linked to a native or heterologous signal sequence (residues 1-35 of SEQ ID NO:1) is expressed in cells, such as CHO cells. rHuPH20 is produced by expression of a nucleic acid molecule encoding amino acids 1-482 (as shown in SEQ ID NO:1), etc. Post-translational processing removes the 35-amino acid signal sequence, leaving a polypeptide or mixture of polypeptides. When produced in culture, heterogeneity exists at the C-terminus such that the product referred to as rHuPH20 contains a mixture of species terminating at residues 477, 478, 479, 480, 481, and 482, with reference to SEQ ID NO:1, in varying abundance. Hyaluronidase rHuPH20 is selected from the group consisting of polypeptides corresponding to amino acid residues 36-477, 36-478, 36-479, 36-480, 36-481, and 36-482, with reference to SEQ ID NO: 1. Generally, the most abundant species is the 446 amino acid polypeptide corresponding to residues 36-481 of SEQ ID NO: 1.

[0051] Soluble human PH20 polypeptides include those referred to as extended soluble hyaluronidases. Extended soluble hyaluronidases can be produced by C-terminal truncation of any native GPI-anchored hyaluronidase such that the resulting polypeptide is soluble and contains one or more amino acid residues from the GPI-anchor attachment signal sequence (see, e.g., U.S. Patent No. 8,927,249). Extended soluble human PH20 polypeptides include those terminating at any of about residues 495-500 of SEQ ID NO:1. The mature form begins at residue 36. Extended soluble human PH20 polypeptides are neutral, active, and soluble. They can contain amino acid substitutions and have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, or 95% similarity to extended soluble PH20 polypeptides.

[0052] Hyaluronidase can be recombinantly produced or purified or partially purified from natural sources, such as, for example, testis extracts. Methods for producing recombinant proteins, including recombinant hyaluronidase, are well known in the art. Soluble PH20 is produced in cells such as CHO cells (e.g., DG44 CHO cells), which facilitate correct N-glycosylation to retain activity.

[0053] Glycosylation, including N- and O-linked glycosylation, of some hyaluronidases, including soluble PH20 hyaluronidase, can be important for their catalytic activity and stability. In the case of some hyaluronidases, removal of N-linked glycosylation can result in almost complete inactivation of hyaluronidase activity. N-linked oligosaccharides are classified into several major types (oligomannose, complex, hybrid, and sulfated), all of which have a (Man)3-GlcNAc-GlcNAc-core and are attached via the amide nitrogen of an Asn residue within an -Asn-Xaa-Thr / Ser- sequence (where Xaa is not Pro). Glycosylation at -Asn-Xaa-Cys sites has been reported for coagulation protein C. In some cases, hyaluronidases, such as PH20 hyaluronidase, can contain both N- and O-glycosidic linkages. For example, PH20 has O-linked as well as N-linked oligosaccharides. There are six potential N-linked glycosylation sites at N82, N166, N235, N254, N368, and N393 of human PH20, as exemplified by SEQ ID NO:1.

[0054] In certain embodiments, the hyaluronidase enzyme is a variant or fragment of hyaluronidase PH20 having one or more amino acid residue additions, deletions, or substitutions in the amino acid sequence of wild-type PH20, for example, a variant or fragment of hyaluronidase PH20 having one or more amino acid residue additions, deletions, or substitutions in the amino acid sequence of mature wild-type PH20. In some embodiments, the variant or fragment hyaluronidase PH20 comprises one or more amino acid substitutions, additions, or deletions located in the alpha helix 8 region of PH20. In some embodiments, the variant or fragment hyaluronidase PH20 comprises one or more amino acid substitutions, additions, or deletions located in the linker region between alpha helix 7 and alpha helix 8 of PH20. In certain embodiments, the variant or fragment hyaluronidase PH20 comprises the amino acid sequence from L36 to S490 of wild-type PH20 (i.e., L36 to S490 of SEQ ID NO: 1).

[0055] In embodiments, a PH20 variant or fragment thereof has at least 80% amino acid sequence homology to the amino acid sequence of the wild-type PH20 enzyme of SEQ ID NO:1, including, for example, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and at least 99%.

[0056] In some embodiments, the variant or fragment Hyaluronidase PH20 comprises a substitution of one or more amino acid residues at one or more positions selected from among T341-N363, such as, but not limited to, one or more positions selected from T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, L354, D355, N356, E359, I361, and N363. For example, the substitution of an amino acid residue at one or more positions selected from T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, L354, D355, N356, E359, I361, and N363 may be, but is not limited to, a substitution of one or more amino acid residues selected from T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, D355K, E359D, I361T, and N363G. In embodiments, amino acid residue substitutions are described by code number and letter, for example, "T455S" means that the amino acid residue threonine ("T") at numerical position 455 of a given SEQ ID NO: is substituted with the amino acid residue serine ("S"). In particular embodiments, the variant or fragment Hyaluronidase PH20 comprises a substitution of one or more amino acid residues selected from T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. In certain embodiments, the variant or fragment Hyaluronidase PH20 comprises a substitution of one or more amino acid residues selected from M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and may further comprise a substitution of one or more amino acid residues selected from the group consisting of, but not limited to, T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, and N363G.

[0057] In some embodiments, the variant or fragment Hyaluronidase PH20 comprises substitutions of one or more amino acid residues selected from: (a) T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T; (b) L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L361T; 54I, D355K, N356E, E359D, and I361T, (c) M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, I361T, and N363G, ( d) T341G, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (e) T341A, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (f) T341C, L342W, S343E, I344N, M 345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (g)T341D, L342W, S343E, I344N, M345T, S347T, M3 48K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (h) I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and (i) S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T.

[0058] In some embodiments, the variant or fragment Hyaluronidase PH20 comprises a truncation of the amino acid sequence of SEQ ID NO: 1 before F38 at the N-terminus. In some cases, the variant or fragment of Hyaluronidase PH20 comprises a truncation of the amino acid sequence of SEQ ID NO: 1 before an amino acid residue selected from M1 through P42. For example, the variant or fragment of Hyaluronidase PH20 comprises a truncation before N-terminal amino acid residue L36, N37, F38, R39, A40, P41, or P42, such that one or more amino acid residues are deleted at the N-terminus. In embodiments, the phrase truncation before an N-terminal amino acid residue selected from M1 through P42 means that the amino acid residue immediately preceding the N-terminal amino acid residue M1 through P42 is truncated and deleted.

[0059] In some embodiments, the variant or fragment Hyaluronidase PH20 comprises a truncation of the amino acid sequence of SEQ ID NO: 1 after an amino acid selected from V455 through S490. For example, the variant or fragment of Hyaluronidase PH20 comprises a truncation of the amino acid sequence of SEQ ID NO: 1 after amino acid residues V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490, such that one or more amino acid residues at the C-terminus are deleted. In an embodiment, the phrase cleavage after an amino acid residue selected from V455 to S490 at the C-terminus means that the amino acid residues immediately following the C-terminal amino acid residues V455 to S490 are cleaved and deleted.

[0060] In some embodiments, a variant or fragment of Hyaluronidase PH20 may have the amino acid sequence of SEQ ID NO: 1 and may include substitutions of one or more amino acid residues selected from T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and a truncation at the N-terminus before F38 and at the C-terminus after F468 (HP46, SEQ ID NO: 99, see Table 2 below). In some examples, a variant or fragment of Hyaluronidase PH20 can have the amino acid sequence of SEQ ID NO: 1 and can include one or more amino acid residue substitutions selected from T341A, T341C, T341G, S343E, M345T, K349E, L353A, L354I, N356E, and I361T. In certain cases, the one or more amino acid residue substitutions are located in the α helix 8 region (S347-C381) and / or the linker region between α helix 7 and α helix 8 (A333-R346). For example, amino acid substitutions in the linker region between α-helix 7 and α-helix 8 may include substitutions of one or more amino acid residues in the region consisting of amino acid residues T341 to N363, T341 to I361, L342 to I361, L342 to I361, S343 to I361, I344 to I361, M345 to I361, or M345 to N363.

[0061] In some embodiments, the variant or fragment of hyaluronidase PH20 comprises a substitution of one or more amino acid residues located in the α-helix 8 region (S347-C381) and / or the linker region between α-helix 7 and α-helix 8 (A333-R346) of wild-type PH20 (e.g., mature wild-type PH20), and may be substituted with several amino acid residues in the amino acid sequence of the region of human HYAL1 having SEQ ID NO: 2, as shown in Tables 2 and 3. Table 2 - Amino acid sequence of wild-type human HYAL1 (SEQ ID NO: 2) [Table 2] Table 3 - Comparison of α-helix and amino acid sequences between PH20 and HYAL1 [Table 3]

[0062] In certain embodiments, the variant or fragment of Hyaluronidase PH20 has an amino acid sequence selected from SEQ ID NOs: 60-115, as shown in Table 4. Table 4 [Table 4-1] [Table 4-2] [Table 4-3] [Table 4-4] [Table 4-5] [Table 4-6] [Table 4-7] [Table 4-8] [Table 4-9] [Table 4-10] [Table 4-11] [Table 4-12] [Table 4-13] [Table 4-14] Table 4-15 Table 4-16 Table 4-17 Table 4-18 Table 4-19 Table 4-20 Table 4-21 Table 4-22 Table 4-23 Table 4-24 Table 4-25 Table 4-26 Table 4-27

[0063] In some embodiments, the N-terminus of a hyaluronidase variant or fragment further comprises, but is not limited to, a human growth hormone signal peptide having the amino acid sequence of SEQ ID NO: 3 (MATGSRTSLLLAFGLLCLPWLQEGSA), a human serum albumin signal peptide having the amino acid sequence of SEQ ID NO: 4 (MKWVTFISLLFLFSSAYS), or a human Hyal1 signal peptide having the amino acid sequence of SEQ ID NO: 5 (MAAHLLPICALFLTLLDMAQG), as shown in Table 5 below, instead of the signal peptide of wild-type PH20 consisting of residues M1 to T35. In embodiments, the signal peptide of wild-type PH20 (amino acid residues M1 to T35) is partially or completely deleted. In some embodiments, a portion of the N-terminus is further deleted, for example, before residues N37, F38, R39, A40, P41, or P42, thereby resulting in further deletions at the N-terminus along with the deletion of the wild-type PH20 signal peptide. Table 5 - Amino acid sequences of the signal peptides of human growth hormone, human serum albumin, or human Hyal1 [Table 5]

[0064] In some embodiments, hyaluronidase variants or fragments include variants with a C-terminus attached to a 6xHis tag (designated as HM), variants without a 6xHis tag (designated as HP), mature wild-type PH20 (L36-S490) with a C-terminus attached to a 6xHis tag (designated as WT), and mature wild-type PH20 (L36-Y482) with a C-terminus without a 6xHis tag and cleavage occurring after Y482 (designated as HW2).

[0065] In certain embodiments, the compositions comprise one or more variants or fragments of hyaluronidase enzymes, such as those described in European Patent Publication No. EP 3636752 A1 and International Patent Publication No. WO 2020 / 197230, the disclosures of which are incorporated herein by reference.

[0066] In embodiments, the amount of hyaluronidase enzyme present in the composition can vary and can include 100 U or more, such as 250 U or more, for example, 500 U or more, for example, 750 U or more, such as 1000 U or more, for example, 1500 U or more, such as 2000 U or more, for example, 2500 U or more, such as 3000 U or more, for example, 3500 U or more, such as 4000 U or more, for example, 4500 U or more, such as 5000 U or more, for example, 10,000 U or more, such as 20,000 U or more, for example, 30,000 U or more, such as 40,000 U or more, and 50,000 U or more of hyaluronidase enzyme. In some embodiments, the composition comprises about 500 U of hyaluronidase enzyme, about 600 U, about 700 U, about 800 U, about 900 U, about 1,000 U, about 1,100 U, about 1,200 U, about 1,300 U, about 1,400 U, about 1,500 U, about 1,600 U, about 1,700 U, about 1,800 U, about 1,900 U, about 2,000 U, about 2,100 U, about 2,200 U, about 2,300 U, about 2,400 U, about 2,500 U, about 2,600 U, about 2,700 U , about 2,800 U, about 2,900 U, about 3,000 U, about 3,100 U, about 3,200 U, about 3,300 U, about 3,400 U, about 3,500 U, about 3,600 U, about 3,700 U, about 3,800 U, about 3,900 U, about 4,000 U, about 4,100 U, about 4,200 U, about 4,300 U, about 4,400 U, about 4,500 U, about 4,600 U, about 4,700 U, about 4,800 U, about 4,900 U, or about 5,000 U of hyaluronidase enzyme. For example, the amount of hyaluronidase enzyme in the composition can be in the range of 50 U to 50,000 U, such as 100 U to 45,000 U, for example, 250 U to 40,000 U, for example, 500 U to 35,000 U, for example, 750 U to 30,000 U, for example, 1000 U to 25,000 U, for example, 1500 U to 20,000 U, for example, 2000 U to 15,000 U, for example, 2500 U to 10,000 U, and 3000 U to 5000 U of hyaluronidase enzyme.For example, the amount of hyaluronidase enzyme in the composition can be in the range of hyaluronidase enzyme, including 50 U to 50,000 U, such as 100 U to 40,000 U, for example, 300 U to 30,000 U, for example, 500 U to 20,000 U, for example, 700 U to 10,000 U, for example, 800 U to 5,000 U, for example, 900 U to 4,000 U, for example, 1,000 U to 3,000 U, for example, 1,500 U to 2,500 U, and 1,700 U to 2,200 U.

[0067] In certain embodiments, the concentration of the hyaluronidase enzyme in the composition is 50 U / mL or more, such as 100 U / mL or more, for example, 250 U / mL or more, for example, 500 U / mL or more, for example, 750 U / mL or more, such as 1000 U / mL or more, for example, 2000 U / mL or more, for example, 2500 U / mL or more, such as 3000 U / mL or more, for example, 3500 U / mL or more, for example, 4000 U / mL or more, such as 4500 U / mL or more, for example, 5000 U / mL or more. In some cases, the concentration of the hyaluronidase enzyme is about 100 U / mL, 200 U / mL, 300 U / mL, 400 U / mL, 500 U / mL, about 600 U / mL, about 700 U / mL, about 800 U / mL, about 900 U / mL, about 1,000 U / mL, about 1,100 U / mL, about 1,200 U / mL, about 1,300 U / mL, about 1,400 U / mL, about 1,500 U / mL, about 1,600 U / mL, about 1,700 U / mL, about 1,800 U / mL, about 1,900 U / mL, about 2,000 U / mL, about 2,100 U / mL, about 2,200 U / mL, about 2,300 U / mL, about 2,400 U / mL, about 2,500 U / mL, about 2,600U / mL, approximately 2,700U / mL, approximately 2,800U / mL, approximately 2,900U / mL, approximately 3,000U / mL, approximately 3,100U / mL, approximately 3,2 00U / mL, approx. 3,300U / mL, approx. 3,400U / mL, approx. 3,500U / mL, approx. 3,600U / mL, approx. 3,700U / mL, approx. 3,800U / mL, about 3,900 U / mL, about 4,000 U / mL, about 4,100 U / mL, about 4,200 U / mL, about 4,300 U / mL, about 4,400 U / mL, about 4,500 U / mL, about 4,600 U / mL, about 4,700 U / mL, about 4,800 U / mL, about 4,900 U / mL, or about 5,000 U / mL. For example, the concentration of the hyaluronidase enzyme in the composition can be in the range of 50 U / mL to 5000 U / mL, such as 100 U / mL to 4500 U / mL, such as 250 U / mL to 4000 U / mL, such as 500 U / mL to 3500 U / mL, such as 750 U / mL to 3000 U / mL, including 1000 U / mL to 2000 U / mL, and including 1500 U / mL to 2500 U / mL.

[0068] Compositions according to embodiments also include telomerase inhibitors comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. In embodiments, the term telomerase inhibitor, as used herein, refers to a compound capable of reducing or inhibiting the activity of telomerase reverse transcriptase in mammalian cells. Telomerase inhibitors of interest, in some cases, include hTR template inhibitors, which comprise oligonucleotides. An "hTR template inhibitor" is a compound capable of blocking the template region of the RNA component of human telomerase and inhibiting the activity of the enzyme. In some embodiments, the oligonucleotide comprises a sequence effective to hybridize to a more specific portion of this region, having the sequence 5'-CUAACCCUAAC-3'.

[0069] A contemplated telomerase inhibitor comprises an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. In some embodiments, the telomerase inhibitor comprises an oligonucleotide having a "nuclease-resistant linkage," which has a backbone with subunit linkages that are substantially resistant to nuclease cleavage by extracellular and intracellular nucleases in either an unhybridized or hybridized form. In some cases, the oligonucleotide exhibits little or no nuclease cleavage under physiological conditions.

[0070] In some embodiments, the region of therapeutic oligonucleotide that targets hTR sequence is complementary to the corresponding hTR sequence.In certain embodiments, the base sequence of oligonucleotide comprises a sequence of 5 or more nucleotides that are complementary to hTR target, such as 8 or more nucleotides, such as 10 or more nucleotides, such as 12 or more nucleotides, such as 15 or more nucleotides that are complementary to hTR target.In certain embodiments, the oligonucleotide in the telomerase inhibitor of the present disclosure is completely complementary to the hTR target sequence, for example, the entire length of the oligonucleotide is complementary to the hTR target sequence.

[0071] Telomerase inhibitors include internucleoside linkages such as phosphodiester, phosphotriester, methylphosphonate, P3'→N5' phosphoramidate, N3'→P5' phosphoramidate, N3'→P5' thiophosphoamidate, and phosphorothioate linkages. In certain embodiments, the telomerase inhibitor of interest contains at least one N3'→P5' phosphoramidate (NP) or N3'→P5' thiophosphoamidate (NPS) linkage, which can be represented by the structure: 3'-(-NH--P(=O)(--XR)--O-)-5', where X is O or S, R is selected from the group consisting of hydrogen, alkyl, and aryl, and when XR is OH or SH, it is a pharmaceutically acceptable salt thereof. In other embodiments, the oligonucleotide contains all NP linkages, or in some embodiments, all NPS linkages.In one embodiment, the sequence of the hTR template inhibitor oligonucleotide is complementary to nucleotides 42-54 of SEQ ID NO: 6 (GGGUUGCGGAGGGUGGGCCUGGGAGGGGUGGUGGCCAUUU UUUGUCUAACCCUAACUGAGAAGGGCGUAGGCGCCGUGCUUUUGCUCCCC GCGCGCUGUUUUUCUCGCUGACUUUCAGCGGGCGGAAAAGCCUCGGCCUG CCGCCUUCCACCGUUCAUUCUAGAGCAAACAAAAAAUGUCAGCUGCUGGC CCGUUCGCCUCCCGGGGACCUGCGGCGGGUCGCCUGCCCAGCCCCCGAAC CCCGCCUGGAGCCGCGGUCGGCCCGGGGCUUCUCCGGAGGCACCCACUGC CACCGCGAAGAGUUGGGCUCUGUCAGCCGCGGGUCUCUCGGGGGCGAGGG CGAGGUUCACCGUUUCAGGCCGCAGGAAGAGGAACGGAGCGAGUCCCGCC GCGGCGCGAUUCCCUGAGCUGUGGGACGUGCACCCAGGACUCGGCUCACA CAUGCAGUUCGCUUUCCUGUUGGUGGGGGGAACGCCGAUCGUGCGCAUCC GUCACCCCUCGCCGGCAGUGGGGGCUUGUGAACCCCCAAACCUGACUGAC UGGGCCAGUGUGCU). In certain embodiments, the oligonucleotide comprises a sequence complementary or nearly complementary to a portion of an 11-nucleotide region having the sequence 5'-CUAACCCUAAC-3'. An oligonucleotide having this sequence (TAGGGTTAGACAA, SEQ ID NO: 17) and an N3'→P5' thiophosphoramidate (NPS) linkage is referred to herein as GRN163. See, e.g., Asai et al., Cancer Research 63:3931-3939 (2003) and Gryaznov. See, e.g., Pruzan et al., Nucleosides Nucleic Acids 22(5-8):577-81 (2003). Another target region is the region spanning nucleotides 137-179 of hTR (see, e.g., Pruzan et al., Nucl. Acids Research, 30:559-568, 2002). Within this region, the sequence spanning 141-153 is a preferred target. PCT Publication No. WO 98 / 28442 describes the use of oligonucleotides at least 7 nucleotides in length to inhibit telomerase, where the oligonucleotides are designed to be complementary to accessible portions of the hTR sequence outside the template region, including nucleotides 137-196, 290-319, and 350-380 of hTR. Preferred hTR target sequences are shown below and identified by SEQ ID NOs: 7-27. In certain embodiments, the telomerase inhibitor oligonucleotides have sequences that target human telomerase RNA (hTR), including but not limited to the following sequences: [Table 6]

[0072] The telomerase inhibitors of the present disclosure include a lipid moiety attached to the 5' and / or 3' end of an oligonucleotide. In some cases, the structural group provides superior cellular uptake properties, such that a comparable biological effect can be achieved using a smaller amount of conjugated oligonucleotide compared to the unmodified form. The lipid moiety can be an aliphatic hydrocarbon or fatty acid, such as a hydrocarbon or fatty acid derivative. For example, the lipid moiety can be a saturated linear compound having 14 to 20 carbon atoms, such as myristic acid (tetradecanoic acid), palmitic acid (hexadecanoic acid), and stearic acid (octadecanoic acid), and their corresponding aliphatic hydrocarbon forms, tetradecane, hexadecane, and octadecane. Other examples of lipid moieties include sterols, such as cholesterol, and substituted fatty acids and hydrocarbons, particularly polyfluorinated forms of these groups. In certain embodiments, the lipid moiety includes one or more derivatives, such as amine, amide, ester, and carbamate derivatives of the lipid moiety. In one example, the lipid moiety is a palmitoyl (C16) moiety, such as palmitoylamide. The lipid moiety can be conjugated to the oligonucleotide through a linker, such as a glycerol or aminoglycerol linker.

[0073] In some embodiments, the telomerase inhibitor is a compound described in U.S. Patent No. 9,375,485, the disclosure of which is incorporated herein by reference. In certain embodiments, the telomerase inhibitor is imetelstat (a 5' palmitoylated 13-mer thiophosphoramidate oligonucleotide consisting of the sequence 5'-TAGGGTTAGACAA-3', SEQ ID NO: 17) or imetelstat sodium: [ka] and the like.

[0074] In some embodiments, the amount of telomerase inhibitor, such as imetelstat or imetelstat sodium, in the subcutaneous composition is about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 50 .... 00mg to about 600mg, about 600mg to about 700mg, about 700mg to about 800mg, about 800mg to about 900mg, about 900mg to about 1000mg, about 1100 mg ~ about 1200mg, about 1200mg - about 1300mg, about 1300mg - about 1400mg, about 1400mg - about 1500mg, about 1500mg - about 1600mg , about 1600 mg to about 1700 mg, about 1700 mg to about 1800 mg, about 1800 mg to about 1900 mg, about 1900 mg to about 2000 mg, about 2000 mg to about 2100 mg, about 2100 mg to about 2200 mg, about 2200 mg to about 2300 mg, about 2300 mg to about 2400 mg, and about 2400 mg to about 2500 mg.

[0075] In some embodiments, the amount of the telomerase inhibitor is in the unit dosage form in an amount ranging from about 5 mg to about 1000 mg, 5 mg to about 500 mg, e.g., about 30 mg to about 300 mg, or about 50 mg to about 200 mg. In some embodiments, the amount of the telomerase inhibitor is in the unit dosage form in an amount ranging from about 200 mg to about 3000 mg, 750 mg to about 2500 mg, e.g., about 1000 mg to about 2000 mg, or about 500 mg to about 2000 mg. The unit dosage form may be liquid or lyophilized.

[0076] In some embodiments, the concentration of the telomerase inhibitor administered to an individual is a diluted solution (about 0.1 mg / ml) or a concentrated solution (about 300 mg / ml), for example, about 0.1 to about 300 mg / ml, 0.1 to about 200 mg / ml, about 0.1 to about 180 mg / ml, about 0.1 to about 160 mg / ml, about 0.1 to about 140 mg / ml, about 0.1 to about 120 mg / ml, about 0.1 to about 100 mg / ml, about 0.1 to about 80 mg / ml, about 0.1 to about 60 mg / ml, about 0.1 to about 40 mg / ml, about 0.1 to about 20 mg / ml, about 0.1 to about 10 mg / ml, about 2 to about 40 mg / ml, about 4 to about 35 mg / ml, about 6 to about 30 mg / ml, The concentration may be any of about 8 to about 25 mg / ml, about 10 to about 20 mg / ml, about 12 to about 15 mg / ml, or any of about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, 2 mg / ml, 2.1 mg / ml, 2.2 mg / ml, 2.3 mg / ml, 2.4 mg / ml, or 2.5 mg / ml.In some embodiments, the concentration of the telomerase inhibitor is at least about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 1.3 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 4 mg / ml, 5 mg / ml, 6 mg / ml, 7 mg / ml, 8 mg / ml, 9 mg / ml, 10 mg / ml, 11 mg / ml, 12 mg / ml, 13 mg / ml, 14 mg / ml, 15 mg / ml, 16 mg / ml, 17 mg / ml, 18 mg / ml, 19 mg / ml, 20 mg / ml, 21 mg / ml, 22 mg / ml, 23 mg / ml, 24 mg / ml, 25 mg / ml, 26 mg / ml, 27 mg / ml, 28 mg / ml, 29 mg / ml, 30 mg / ml, 31 mg / ml l, 32mg / ml, 33mg / ml, 33.3mg / ml, 34mg / ml, 35mg / ml, 36mg / ml, 37mg / ml, 38mg / ml, 39mg / ml, 40mg / ml, 50mg / ml, 60mg / ml, 70mg / ml, 80mg / ml, 90mg / ml, 100mg / ml, 110mg / ml, 120mg / ml, 130mg / ml, 140 mg / ml, 150mg / ml, 160mg / ml, 170mg / ml, 180mg / ml, 190mg / ml, 200mg / ml, 210mg / ml, 220mg / ml, 230 mg / ml, 240 mg / ml, or 250 mg / ml, 260 mg / ml, 270 mg / ml, 280 mg / ml, 290 mg / ml, 300 mg / ml.

[0077] In certain embodiments, the composition is formulated to contain a telomerase inhibitor, such as imetelstat or imetelstat sodium, at a dosage range of about 2.0 mg / kg to about 20.0 mg / kg, e.g., about 3.0 mg / kg to about 15.0 mg / kg, e.g., about 4.0 mg / kg to about 10 mg / kg, e.g., about 6 mg / kg to about 14 mg / kg, e.g., about 7 mg / kg to about 13 mg / kg, e.g., about 8 mg / kg to about 12 mg / kg, e.g., about 7.5 mg / kg to 9.4 mg / kg, about 9 mg / kg to about 11 mg / kg, and about 11 mg / kg to about 14 mg / kg. In some embodiments, the composition is formulated to contain a telomerase inhibitor, such as imetelstat or imetelstat sodium, at a dosage range of about 7.5 mg / kg to about 9.4 mg / kg. For example, the dosage of the telomerase inhibitor may be 4.0mg / kg, 4.1mg / kg, 4.2mg / kg, 4.3mg / kg, 4.4mg / kg, 4.5mg / kg, 4.6mg / kg, 4.7mg / kg, 4.8mg / kg, 4.9mg / kg, 5.0mg / kg, 5.1mg / kg, 5.2mg / kg, 5.3mg / kg, 5.4mg / kg, 5.5mg / kg, 5.6mg / kg, 5.7mg / kg, 5.8mg / kg, 5.9mg / kg, 6.0mg / kg, 6.1mg / kg, 6.2mg / kg, 6.3mg / kg, 6.4mg / kg, 6.5mg / kg, 6.6mg / kg, 6.7mg / kg, 6.8mg / kg, 6.9mg / kg, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8.0mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9.0mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10.0mg / kg, 10.1mg / kg, mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2 mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8.6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1 mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 1 0mg / kg, 10.1mg / kg, 10.2mg / kg, 10.3mg / kg, 10.4mg / kg, 10.5mg / kg, 10.6mg / kg, 10.7mg / kg, 10.8mg / kg, 10.9mg / kg, 11mg / kg, 11.1mg / kg, 11.2mg / kg, 11.3mg / kg, 11.4mg / kg, 11.5mg / kg, 11.6mg / kg, 11.7mg / kg, 11.8mg / kg, 11.9 mg / kg, 12mg / kg, 12.1mg / kg, 12.2mg / kg, 12.3mg / kg, 12.4mg / kg, 12.5mg / kg, 12.6mg / kg, 12.7mg / kg, 12.8mg / kg, 12.9mg / kg, 13mg / k The dose may be 10.5 mg / kg, 11.0 mg / kg, 11.5 mg / kg, 12.0 mg / kg, 12.5 mg / kg, 13.0 mg / kg, 13.5 mg / kg, 14.0 mg / kg, 14.5 mg / kg, 15.0 mg / kg, 15.5 mg / kg, 16.0 mg / kg, 16.5 mg / kg, 17.0 mg / kg, 17.0 mg / kg, 17.5 mg / kg, 18.0 mg / kg, 18.5 mg / kg, 19.0 mg / kg, 19.5 mg / kg, or 20.0 mg / kg.

[0078] In some embodiments, the subcutaneous telomerase inhibitor composition also includes one or more pharmaceutically acceptable carriers. Exemplary pharmaceutically acceptable carriers may include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, aqueous or non-aqueous carriers, or combinations thereof. In certain embodiments, the composition may further include one or more pharmaceutically acceptable excipients as part of the pharmaceutical composition. Excipients may include, but are not limited to, carbohydrates, inorganic salts, antibacterial agents, stabilizers, antioxidants, surfactants, amino acids, buffers, acids, bases, and combinations thereof. For example, suitable excipients for subcutaneous injection compositions may include one or more of water, alcohol, polyols, monosaccharides, polysaccharides, stabilizers, buffers, amino acids, and surfactants. The amount of each pharmaceutically acceptable excipient or carrier may vary and may range from 1 mM to 1000 mM, for example, 2 mM to 900 mM, for example, 3 mM to 800 mM, for example, 4 mM to 700 mM, for example, 5 mM to 600 mM, for example, 6 mM to 500 mM, for example, 7 mM to 400 mM, for example, 8 mM to 300 mM, for example, 9 mM to 200 mM, and 10 mM to 100 mM.

[0079] In some embodiments, the composition includes a buffer. Examples of buffers that can be used include acetic acid, citric acid, formic acid, succinic acid, phosphate, carbonate, malic acid, aspartic acid, histidine, boric acid, Tris buffer, HEPPSO, and HEPES. In some cases, the buffer is present in the composition in an amount that maintains the composition at a predetermined pH. For example, one or more buffers can be present in the composition to maintain the composition at a pH of 3.0 to 9.0, e.g., a pH of 3.5 to 8.5, e.g., a pH of 4.0 to 8.0, e.g., a pH of 4.5 to 7.5, e.g., a pH of 5.0 to 7.0, and a pH of 5.5 to 7.5. For example, the compositions may have a pH of 3.0, a pH of 3.1, a pH of 3.2, a pH of 3.3, a pH of 3.4, a pH of 3.5, a pH of 3.6, a pH of 3.7, a pH of 3.8, a pH of 3.9, a pH of 4.0, a pH of 4.1, a pH of 4.2, a pH of 4.3, a pH of 4.4, a pH of 4.5, a pH of 4.6, a pH of 4.7, a pH of 4.8, a pH of 4.9, a pH of 5.0, a pH of 5.1, a pH of 5.2, a pH of 5.3, a pH of 5.4, a pH of 5.5, a pH of 5.6, a pH of 5.7, a pH of 5.8, a pH of 5.9, a pH of 6. The compound may have a pH of 0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, or 9.0. The buffer may be present in the composition in an amount including from 1 mM to 1000 mM, such as from 2 mM to 900 mM, for example, from 3 mM to 800 mM, for example, from 4 mM to 700 mM, for example, from 5 mM to 600 mM, for example, from 6 mM to 500 mM, for example, from 7 mM to 400 mM, for example, from 8 mM to 300 mM, for example, from 9 mM to 200 mM, and from 10 mM to 100 mM.For example, the buffer may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 730 mM, about 740 mM, about 750 mM, about The soluble ...

[0080] In some embodiments, the composition comprises a carbohydrate such as a sugar. Exemplary sugars include monosaccharides, disaccharides, trisaccharides, polysaccharides, sugar alcohols, reducing sugars, and non-reducing sugars (e.g., glucose, sucrose, trehalose, lactose, fructose, maltose, dextran, glycerin, dextran, erythritol, glycerol, arabitol, sylitol, sorbitol, mannitol, melibiose, melezitose, raffinose, mannotriose, stachyose, maltose, lactulose, maltulose, glucitol, maltitol, lactitol, or isoiso-maltulose). In some instances, the composition comprises sucrose. In other instances, the composition comprises trehalose. The carbohydrate (e.g., a sugar such as sucrose or trehalose) may be present in the composition in an amount including from 1 mM to 1000 mM, such as from 2 mM to 900 mM, for example, from 3 mM to 800 mM, for example, from 4 mM to 700 mM, such as from 5 mM to 600 mM, for example, from 6 mM to 500 mM, such as from 7 mM to 400 mM, for example, from 8 mM to 300 mM, for example, from 9 mM to 200 mM, and from 10 mM to 100 mM. For example, carbohydrates (e.g., sugars such as sucrose or trehalose) may be present in concentrations of about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 73 It may be present at a concentration of about 60 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, or about 500 mM.

[0081] In some embodiments, the composition comprises one or more amino acids. Exemplary amino acids include histidine, isoleucine, methionine, glycine, arginine, lysine, L-leucine, tri-leucine, alanine, glutamic acid, L-threonine, and 2-phenylamine. In some cases, the composition comprises methionine. In other cases, the composition comprises histidine. The amino acid (e.g., methionine or histidine) may be present in the composition in an amount including 0.1 mg / mL to about 5 mg / mL, such as 0.1 mg / mL to about 2.5 mg / mL, such as 1 mg / mL to about 2 mg / mL, such as 4 mM to 700 mM, such as 5 mM to 600 mM, such as 6 mM to 500 mM, such as 7 mM to 400 mM, such as 8 mM to 300 mM, such as 9 mM to 200 mM, and 10 mM to 100 mM. For example, an amino acid (e.g., methionine or histidine) can be present in the composition at a concentration of about 0.5 mg / mL, about 1 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, about 2.0 mg / mL, about 2.1 mg / mL, about 2.2 mg / mL, about 2.3 mg / mL, about 2.4 mg / mL, about 2.5 mg / mL, about 2.6 mg / mL, about 2.7 mg / mL, about 2.8 mg / mL, about 2.9 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, or about 5 mg / mL. In certain embodiments, the composition comprises histidine in an amount of about 0.5 mg / mL, about 1 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, about 2.0 mg / mL, about 2.1 mg / mL, about 2.2 mg / mL, about 2.3 mg / mL, about 2.4 mg / mL, about 2.5 mg / mL, about 2.6 mg / mL, about 2.7 mg / mL, about 2.8 mg / mL, about 2.9 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, or about 5 mg / mL.In other embodiments, the composition comprises methionine in an amount of about 0.5 mg / mL, about 1 mg / mL, about 1.1 mg / mL, about 1.2 mg / mL, about 1.3 mg / mL, about 1.4 mg / mL, about 1.5 mg / mL, about 1.6 mg / mL, about 1.7 mg / mL, about 1.8 mg / mL, about 1.9 mg / mL, about 2.0 mg / mL, about 2.1 mg / mL, about 2.2 mg / mL, about 2.3 mg / mL, about 2.4 mg / mL, about 2.5 mg / mL, about 2.6 mg / mL, about 2.7 mg / mL, about 2.8 mg / mL, about 2.9 mg / mL, about 3 mg / mL, about 3.5 mg / mL, about 4 mg / mL, about 4.5 mg / mL, or about 5 mg / mL.

[0082] In some embodiments, the composition comprises one or more surfactants. Examples of surfactants include polysorbates (e.g., polysorbate 20 or polysorbate 80), poloxamers (e.g., poloxamer 188), triton, sodium octyl glycoside, lauryl-, myristyl-, linoleyl-, or stearyl-sulfobetaine, lauryl-, myristyl-, linoleyl-, or stearyl-sarcosine, linoleyl-, myristyl-, or cetyl-betaine, lauroamidopropyl-, cocamidopropyl-, linoleamidopropyl-, myristamidopropyl-, palmidopropyl-, or isosteramidopropyl-betaine (e.g., lauroamidopropyl), myristamidopropyl-, palmidopropyl-, or isosteramidopropyl-dimethylamine, sodium cocoyl methyl taurate or disodium oleyl methyl taurate, and the MONAQUA™ series (Mona Polysorbate surfactants include those from Polysorbate Industries, Inc., Paterson, NJ), polyethyl glycol, polypropyl glycol, and copolymers of ethylene glycol and propylene glycol (e.g., PLURONICS™, PF68, etc.). In some cases, the composition includes a polysorbate surfactant. The surfactant may be present in the composition in an amount including from 1 mM to 1000 mM, such as from 2 mM to 900 mM, for example, from 3 mM to 800 mM, for example, from 4 mM to 700 mM, for example, from 5 mM to 600 mM, for example, from 6 mM to 500 mM, for example, from 7 mM to 400 mM, for example, from 8 mM to 300 mM, for example, from 9 mM to 200 mM, and from 10 mM to 100 mM.For example, the surfactant may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 730 mM, about 740 mM, about 750 mM, about The soluble ...

[0083] The composition may include one or more pharmaceutically acceptable salts. Pharmaceutically acceptable salts include (1) acid addition salts formed with inorganic acids (e.g., hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc.) or organic acids (e.g., acetic acid, propionic acid, hexanoic acid, cyclopentanepropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, 3(4-hydroxybenzoic acid)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1,2 ethanedisulfonic acid, 2-hydroxyethanesulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphor acid, etc.). The salt may be (1) an acid addition salt formed with an acid such as benzoyl sulfonic acid, 4-methylbicyclo[2.2.2]oct-2-ene-1-carboxylic acid, glucoheptonic acid, 3-phenylpropionic acid, trimethylacetic acid, tertiary butylacetic acid, lauryl sulfonic acid, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid, muconic acid, or (2) a salt formed when an acidic proton present in the compound is replaced with a metal ion (e.g., an alkali metal ion, an alkaline earth ion, or an aluminum ion), or a coordination with an organic base (e.g., ethanolamine, diethanolamine, triethanolamine, N-methylglucamine, etc.). In certain embodiments, the composition comprises a sodium chloride salt or other pharmaceutically acceptable salt (e.g., magnesium sulfate). The pharmaceutically acceptable salt may be present in the composition in an amount including from 1 mM to 1000 mM, such as from 2 mM to 900 mM, for example, from 3 mM to 800 mM, for example, from 4 mM to 700 mM, for example, from 5 mM to 600 mM, for example, from 6 mM to 500 mM, for example, from 7 mM to 400 mM, for example, from 8 mM to 300 mM, for example, from 9 mM to 200 mM, and from 10 mM to 100 mM.For example, the pharmaceutically acceptable salt may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about It may be present at a concentration of about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, or about 500 mM.

[0084] Acids or bases may also be present in the compositions of the present invention.For example, acids may include, but are not limited to, hydrochloric acid, acetic acid, phosphoric acid, citric acid, malic acid, lactic acid, formic acid, trichloroacetic acid, nitric acid, perchloric acid, phosphoric acid, sulfuric acid, fumaric acid, and any combination thereof.Examples of bases include, but are not limited to, sodium hydroxide, sodium acetate, ammonium hydroxide, potassium hydroxide, ammonium acetate, potassium acetate, sodium phosphate, potassium phosphate, sodium carbonate monohydrate, sodium citrate, sodium formate, sodium sulfate, potassium sulfate, potassium fumarate, and any combination thereof. The acid or base may be present in the composition at a concentration including 1 mM to 1000 mM, such as 2 mM to 900 mM, for example, 3 mM to 800 mM, for example, 4 mM to 700 mM, for example, 5 mM to 600 mM, for example, 6 mM to 500 mM, such as 7 mM to 400 mM, for example, 8 mM to 300 mM, for example, 9 mM to 200 mM, and 10 mM to 100 mM. For example, the acid or base may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 730 mM, about 740 mM, about 750 mM, The soluble ...

[0085] In some embodiments, the composition includes one or more antioxidants. Antioxidants can reduce or prevent oxidation and therefore deterioration of the composition, and can include, for example, ascorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, low phosphate, methionine, monothioglycerol, propyl gallate, sodium bisulfite, sodium formaldehyde sulfoxylate, sodium metabisulfite, and any combination thereof. The antioxidant can be present in the composition at a concentration including, for example, 1 mM to 1000 mM, for example, 2 mM to 900 mM, for example, 3 mM to 800 mM, for example, 4 mM to 700 mM, for example, 5 mM to 600 mM, for example, 6 mM to 500 mM, for example, 7 mM to 400 mM, for example, 8 mM to 300 mM, for example, 9 mM to 200 mM, and 10 mM to 100 mM. For example, the antioxidant may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 730 mM, about 740 mM, about 750 mM, about The soluble ...

[0086] In some embodiments, the composition includes one or more preservatives. Preservatives can reduce or prevent degradation of the composition, such as by microbial growth, and can include, for example, antioxidants, antibacterial agents, and chelating agents, such as methyl, ethyl, propyl, and butyl parabens, aryl and alkyl acids, citric acid, sorbic acid, sodium, potassium, and calcium sorbate, benzoic acid, sodium, potassium, and calcium benzoate, benzyl alcohol, sodium metabisulfite, bronopol, propylene glycol (15-30%), BHT (butylated hydroxytoluene), BHA (butylated hydroxyanisole), propyl gallate, EDTA, chlorobutanol, benzaldehyde, phenol, meta-cresol, chlorocresol, benzylkonium chloride, benzethonium chloride, and mercury compounds (e.g., thimerosal, phenylmercuric nitrate), and any combination thereof. The preservative may be present in the composition at a concentration including from 1 mM to 1000 mM, such as from 2 mM to 900 mM, for example, from 3 mM to 800 mM, for example, from 4 mM to 700 mM, for example, from 5 mM to 600 mM, such as from 6 mM to 500 mM, for example, from 7 mM to 400 mM, for example, from 8 mM to 300 mM, for example, from 9 mM to 200 mM, and from 10 mM to 100 mM. For example, the preservative may be present in the composition at about 10 mM, about 20 mM, about 30 mM, about 40 mM, about 50 mM, about 75 mM, 100 mM, about 110 mM, about 120 mM, about 130 mM, about 140 mM, about 150 mM, about 160 mM, about 170 mM, about 180 mM, about 190 mM, about 200 mM, about 210 mM, about 220 mM, about 230 mM, about 240 mM, about 250 mM, about 260 mM, about 270 mM, about 280 mM, about 290 mM, about 300 mM, about 310 mM, about 320 mM, about 330 mM, about 340 mM, about 350 mM, about 360 mM, about 370 mM, about 380 mM, about 390 mM, about 400 mM, about 410 mM, about 420 mM, about 430 mM, about 440 mM, about 450 mM, about 460 mM, about 470 mM, about 480 mM, about 490 mM, about 500 mM, about 510 mM, about 520 mM, about 530 mM, about 540 mM, about 550 mM, about 560 mM, about 570 mM, about 580 mM, about 590 mM, about 600 mM, about 610 mM, about 620 mM, about 630 mM, about 640 mM, about 650 mM, about 660 mM, about 670 mM, about 680 mM, about 690 mM, about 700 mM, about 710 mM, about 720 mM, about 730 mM, about 740 mM, about 750 mM, The soluble ...

[0087] Pharmaceutical excipients, along with other excipients that may be used in the telomerase inhibitor compositions of the present invention, are described in A. Gennaro (2000) "Remington: The Science and Practice of Pharmacy", 20th edition, Lippincott, Williams, & Wilkins, Pharmaceutical Dosage Forms and Drug Delivery Systems (1999) H.C. Cansel et al., eds. 7th ed., Lippincott, Williams, & Wilkins, and Handbook of Pharmaceutical Excipients (2000) A.H. Kibber et al., eds., 3rd ed. Amer. Pharmaceutical Assoc., the disclosure of which is incorporated herein by reference.

[0088] Methods for subcutaneous administration of telomerase inhibitor compositions Aspects of the present disclosure also include methods for subcutaneously administering a telomerase inhibitor composition to a subject. In certain embodiments, one or more compositions described herein having a telomerase inhibitor and a hyaluronidase enzyme are administered subcutaneously to a subject. In some embodiments, the composition is administered to a subject by subcutaneous injection or subcutaneous infusion. In other embodiments, the composition may be administered to a subject from an implanted device, such as a subcutaneously implanted catheter. In certain embodiments, the telomerase inhibitor composition is administered to a subject using a subcutaneous bolus syringe configured to subcutaneously deliver a predetermined amount of the composition to the subject.

[0089] In some embodiments, the method includes subcutaneously administering to a subject one or more compositions described herein comprising a telomerase inhibitor and a hyaluronidase enzyme to treat a tumor. In some embodiments, the tumor can be a solid tumor cancer. Examples of cancers for treatment with embodiments of the present disclosure include, for example, adrenocortical carcinoma, anal cancer, appendiceal cancer, astrocytoma, atypical teratoma / rhabdoid tumor, basal cell carcinoma, bile duct carcinoma (extrahepatic), bladder cancer, bone cancer (e.g., Ewing's sarcoma, osteosarcoma, and malignant fibrous histiocytoma), brain stem glioma, brain tumor (e.g., astrocytoma, central nervous system embryonal tumor, central nervous system germ cell tumor, craniopharyngioma, epithelioma, etc.), breast cancer (e.g., female breast cancer, male breast cancer, pediatric breast cancer, etc.), bronchial tumor, and carcinoid. Tumors (e.g., childhood, gastrointestinal, etc.), cancer of unknown primary origin, cardiac (heart) tumors, cervical cancer, colon cancer, colorectal cancer, craniopharyngioma, ducts (e.g., bile duct, extrahepatic, etc.), ductal carcinoma in situ (DCIS), embryonal tumors, endometrial cancer, ependymoma, esophageal cancer, esthesioneuroblastoma, Ewing's sarcoma, extracranial germ cell tumors, extragonadal germ cell tumors, extrahepatic bile duct cancer, eye cancers (e.g., intraocular melanoma, retinoblastoma, etc.), fibrous histiocytoma of bone (e.g., malignant, osteosarcoma, etc.), gallbladder cancer, gastric (stomach) cancer, gastrointestinal carcinoid tumors, gastrointestinal stromal tumors ( GIST), germ cell tumors (e.g., extracranial, extragonadal, ovarian, testicular, etc.), gestational trophoblastic disease, glioma, hairy cell leukemia, head and neck cancer, heart cancer, hepatocellular carcinoma (liver) cancer, histiocytosis (e.g., Langerhans cell, etc.), hypopharyngeal cancer, intraocular melanoma, pancreatic islet cell tumors (e.g., pancreatic neuroendocrine tumors, etc.), kidney cancer (e.g., renal cell, Wilms tumor, pediatric kidney tumors, etc.), Langerhans cell histiocytosis, laryngeal cancer, lip and oral cavity cancer, liver cancer (primary), lobular carcinoma in situ (LCIS) ), lung cancer (e.g., non-small cell, small cell, etc.), malignant fibrous histiocytoma of bone and osteosarcoma, melanoma, Merkel cell carcinoma, mesothelioma, metastatic squamous cell neck cancer of unknown primary, oral cancer, occult primary oral cancer, multiple endocrine neoplasia syndrome, nasal cavity and paranasal sinus cancer, nasopharyngeal carcinoma, neuroblastoma, non-small cell lung cancer, oral cancer, oral cancer (e.g., lip, etc.), oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian cancer (e.g., epithelial, germ cell tumor, low-grade tumor, etc.), pancreatic cancer, pancreatic neuroendocrine tumor (pancreatic islet cell tumor),These include, but are not limited to, papilloma, paraganglioma, paranasal sinus and nasal cavity cancer, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pituitary tumor, pleuropulmonary blastoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, transitional cell carcinoma, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, Sezary syndrome, skin cancer (e.g., pediatric, melanoma, Merkel cell carcinoma, non-melanoma, etc.), small cell lung cancer, small intestine cancer, soft tissue sarcoma, squamous cell carcinoma, squamous cell neck cancer (e.g., unknown primary, metastatic, etc.), gastric (stomach) cancer, testicular cancer, pharyngeal cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell carcinoma of the renal pelvis and ureter, ureter and renal pelvis cancer, urethral cancer, uterine cancer (e.g., endometrium, etc.), uterine sarcoma, vaginal cancer, vulvar cancer, Waldenstrom's macroglobulinemia, and Wilms' tumor. In certain embodiments, the method includes treating a subject having a tumor described in U.S. Patent No. 7,494,982.

[0090] In some embodiments, the method includes subcutaneously administering to a subject one or more compositions described herein comprising a telomerase inhibitor and a hyaluronidase enzyme to treat a hematological tumor. In some cases, treating the hematological tumor includes inducing apoptosis of hematological tumor cells, such as inducing apoptosis of hematological tumor cells in vitro. In other cases, treating the hematological tumor includes inducing apoptosis of hematological tumor cells in the subject. In some embodiments, the hematological tumor cells are malignant hematopoietic stem cells (HSCs). In other embodiments, the hematological tumor cells are malignant hematopoietic progenitor cells (HPCs).

[0091] In some embodiments, the method comprises subcutaneously administering to a subject one or more compositions described herein comprising a telomerase inhibitor and a hyaluronidase enzyme to treat a myeloproliferative neoplasm. In some cases, treating a myeloproliferative neoplasm comprises inducing apoptosis of myeloproliferative neoplasm cells, such as inducing apoptosis of myeloproliferative neoplasm cells in vitro. In other cases, treating a myeloproliferative neoplasm comprises inducing apoptosis of myeloproliferative neoplasm cells in the subject. In some embodiments, the myeloproliferative neoplasm cells are malignant hematopoietic stem cells (HSCs). In other embodiments, the myeloproliferative neoplasm cells are malignant hematopoietic progenitor cells (HPCs). Myeloproliferative neoplasms treated according to the method can include, for example, myelofibrosis (MF), such as primary myelofibrosis, or myelofibrosis after a previous ET or PV (post-ET MF or post-PV MF). In other embodiments, myeloproliferative neoplasms include essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML).

[0092] In another embodiment, the myeloproliferative neoplasm is a myelodysplastic syndrome (MDS). In yet another embodiment, the myeloproliferative neoplasm is a myelodysplastic syndrome (MDS) without isolated del(5q). Myelodysplastic syndromes (MDS) include diseases such as refractory anemia, refractory anemia with excess blasts, refractory cytopenia with polycythemia vera, refractory cytopenia with monocythemia vera, and chronic myelomonocytic leukemia (CMML). In yet another embodiment, the hematological neoplasm is a lymphoid neoplasm.

[0093] Methods according to certain embodiments also include diagnosing the tumor. In some embodiments, the method includes diagnosing the subject as having a solid tumor. In some embodiments, the method includes diagnosing the subject as having a hematological tumor. In some embodiments, the method includes diagnosing the subject as having a myeloproliferative neoplasm. In one example, the method includes diagnosing the subject as having myelofibrosis, such as primary myelofibrosis. In some embodiments, the subject has not previously been administered a telomerase inhibitor (e.g., is telomerase inhibitor naive). In some embodiments, the subject is a subject with lower-risk transfusion-dependent MDS who is relapsed or refractory to an erythropoietin-stimulating agent (ESA). In some embodiments, the subject has not previously been treated with a hypomethylating agent (HMA). In some embodiments, the subject has not been treated with lenalidomide. In some embodiments, the subject is a non-5q subject. In some embodiments, the subject is a subject who is relapsed or refractory to a Janus kinase (JAK) inhibitor. In some embodiments, the methods of the invention include treating a subject having a myeloproliferative neoplasm as described in U.S. Pat. No. 9,375,485 and International Patent Publication Nos. 2019 / 023667 and 2020 / 028261, the disclosures of which are incorporated herein by reference.

[0094] In some embodiments, the lymphoid neoplasm (e.g., lymphoma) is a B-cell neoplasm. Examples of B-cell neoplasms include, but are not limited to, precursor B-cell neoplasms (e.g., precursor B-lymphoblastic leukemia / lymphoma), and peripheral B-cell neoplasms (e.g., B-cell chronic lymphocytic leukemia, prolymphocytic leukemia, small lymphocytic lymphoma (small lymphocytic (SL) NHL), lymphoplasmacytic lymphoma / immunocytoma, Mantel cell lymphoma, follicle center lymphoma, follicular lymphoma (e.g., cytological grade: I (small cell), II (mixed small cell and large cell), III (large cell), and / or subtype: diffuse and predominantly small cell), non-Hodgkin's lymphoma (NHL), low-grade / follicular non-Hodgkin's lymphoma (NHL), intermediate-grade / follicular NHL, marginal zone B-cell neoplasms, and peripheral B-cell neoplasms (e.g., B-cell chronic lymphocytic leukemia, prolymphocytic leukemia, small lymphocytic lymphoma (SL ... These include follicular lymphoma (e.g., extranodal (MALT type + / - monocytic B cell) and / or nodal (e.g., + / - monocytic B cell)), splenic marginal zone lymphoma (e.g., + / - choriolymphocytes), hairy cell leukemia, plasmacytoma / plasma cell myeloma (e.g., myeloma and multiple myeloma), diffuse large B-cell lymphoma (e.g., primary mediastinal (thymic) B-cell lymphoma), intermediate-grade diffuse NHL, Burkitt lymphoma, high-grade B-cell lymphoma, Burkitt-like, high-grade immunoblastic NHL, high-grade lymphoblastic NHL, high-grade small non-cleaved cell NHL, bulky disease NHL, AIDS-related lymphoma, and Waldenstrom's macroglobulinemia.

[0095] In some embodiments, the lymphoid neoplasm (e.g., lymphoma) is a T-cell neoplasm and / or a putative NK-cell neoplasm. Examples of T-cell and / or putative NK-cell neoplasms include, but are not limited to, precursor T-cell neoplasms (precursor T-lymphoblastic lymphoma / leukemia) and peripheral T-cell and NK-cell neoplasms (e.g., T-cell chronic lymphocytic leukemia / prolymphocytic leukemia, and large granular lymphocytic leukemia (LGL) (e.g., T-cell and / or NK-cell types), cutaneous T-cell lymphoma (e.g., mycosis fungoides / Sézary syndrome), unspecified primary T-cell lymphoma (e.g., cytologic categories (e.g., medium cell type, These include mixed medium and large cell subtypes), large cell, lymphoepithelioid, subtype hepatosplenic gamma T-cell delta lymphoma, and subcutaneous panniculitis-like T-cell lymphoma), angioimmunoblastic T-cell lymphoma (AILD), angiocentric lymphoma, intestinal T-cell lymphoma (e.g., + / - enteropathy associated), T-cell lymphoma, adult T-cell leukemia / lymphoma (ATL), anaplastic large cell lymphoma (ALCL), (e.g., CD30+, T and null cell subtypes), anaplastic large cell lymphoma, and Hodgkin's lymphoma.

[0096] In some embodiments, the lymphoid neoplasm (e.g., lymphoma) is Hodgkin's disease. For example, Hodgkin's disease can be lymphocyte-predominant, nodular sclerosis, mixed cellularity, lymphopenic, and / or lymphocyte-rich.

[0097] In some embodiments, the cancer is leukemia. In some embodiments, the leukemia is chronic leukemia. Examples of chronic leukemia include, but are not limited to, chronic myeloid I (granulocytic) leukemia, chronic myelogenous leukemia, and chronic lymphocytic leukemia (CLL). In some embodiments, the leukemia is acute leukemia. Examples of acute leukemia include, but are not limited to, acute lymphoblastic leukemia (ALL), acute myeloid leukemia, acute lymphocytic leukemia, and acute myelocytic leukemia (e.g., myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemic).

[0098] In some embodiments, the cancer is a liquid tumor or a plasmacytoma. Plasmacytomas include, but are not limited to, myeloma. Myelomas include, but are not limited to, extramedullary plasmacytoma, solitary myeloma, and multiple myeloma. In some embodiments, the plasmacytoma is multiple myeloma.

[0099] In some embodiments, the cancer is multiple myeloma. Examples of multiple myeloma include, but are not limited to, IgG multiple myeloma, IgA multiple myeloma, IgD multiple myeloma, IgE multiple myeloma, and non-secretory multiple myeloma. In some embodiments, the multiple myeloma is IgG multiple myeloma. In some embodiments, the multiple myeloma is IgA multiple myeloma. In some embodiments, the multiple myeloma is smoldering multiple myeloma or asymptomatic multiple myeloma. In some embodiments, the multiple myeloma is progressive multiple myeloma. In some embodiments, the multiple myeloma may be resistant to drugs such as, but not limited to, bortezomib, dexamethasone (Dex-), doxorubicin (Dox-), and melphalan (LR).

[0100] In describing the methods of the present invention, the term "subject" refers to a person or organism to which a telomerase inhibitor composition is subcutaneously administered. Thus, subjects of the present invention may include, but are not limited to, mammals, such as humans and other primates (e.g., chimpanzees and other ape and monkey species). In certain embodiments, the subject is a human. The subject may be a subject diagnosed with a myeloproliferative neoplasm, or the subject may be a subject diagnosed by a medical professional as having the condition.

[0101] The dose of a telomerase inhibitor, such as imetelstat or imetelstat sodium, administered subcutaneously to a subject can vary from about 2.0 mg / kg to about 20.0 mg / kg, e.g., about 3.0 mg / kg to about 15.0 mg / kg, e.g., about 4.0 mg / kg to about 10 mg / kg, e.g., about 6 mg / kg to about 14 mg / kg, e.g., about 7 mg / kg to about 13 mg / kg, e.g., about 8 mg / kg to about 12 mg / kg, e.g., about 7.5 mg / kg to about 9.4 mg / kg, and about 9 mg / kg to about 11 mg / kg, including, and including, about 11 mg / kg to about 14 mg / kg. In some embodiments, the dose of the telomerase inhibitor administered to a subject is about 7.5 mg / kg to about 9.4 mg / kg. In some embodiments, the dose of the telomerase inhibitor administered to a subject is about 9 mg / kg to about 11 mg / kg. In some embodiments, the dosage of the telomerase inhibitor administered to a subject is from about 11 mg / kg to about 14 mg / kg. For example, the dosage of the telomerase inhibitor may be 4.0 mg / kg, 4.1 mg / kg, 4.2 mg / kg, 4.3 mg / kg, 4.4 mg / kg, 4.5 mg / kg, 4.6 mg / kg, 4.7 mg / kg, 4.8 mg / kg, 4.9 mg / kg, 5.0 mg / kg, 5.1 mg / kg, 5.2 mg / kg, 5.3 mg / kg, 5.4 mg / kg, 5.5 mg / kg, 5.6 mg / kg, 5.7 mg / kg, 5.8 mg / kg, 5.9 mg / kg, 6.0 mg / kg, 6.1 mg / kg, 6.2 mg / kg, 6.3 mg / kg, 6.4 mg / kg, 6.5 mg / kg, 6.6 mg / kg, 6.7 mg / kg, 6.8 mg / kg, 6.9 mg / kg g, 7mg / kg, 7.1mg / kg, 7.2mg / kg, 7.3mg / kg, 7.4mg / kg, 7.5mg / kg, 7.6mg / kg, 7.7mg / kg, 7.8mg / kg, 7.9mg / kg, 8mg / kg, 8.1mg / kg, 8.2mg / kg, 8.3mg / kg, 8.4mg / kg, 8.5mg / kg, 8 .6mg / kg, 8.7mg / kg, 8.8mg / kg, 8.9mg / kg, 9mg / kg, 9.1mg / kg, 9.2mg / kg, 9.3mg / kg, 9.4mg / kg, 9.5mg / kg, 9.6mg / kg, 9.7mg / kg, 9.8mg / kg, 9.9mg / kg, 10mg / kg, 10.1mg / kg, 10.2mg / kg, 10.3mg / kg, 10.4mg / kg, 10.5mg / kg, 10.6mg / kg, 10.7mg / kg, 10.8mg / kg, 10.9mg / kg, 11mg / kg, 11.1mg / kg, 11.2mg / kg, 11.3 mg / kg, 11.4mg / kg, 11.5mg / kg, 11.6mg / kg, 11.7mg / kg, 11.8mg / kg, 11.9mg / kg, 12mg / kg, 12.1mg / kg, 12.2mg / kg, 12.3mg / kg, 12.4mg The telomerase inhibitor may be administered at a dose of about 9.4 mg / kg, 12.5 mg / kg, 12.6 mg / kg, 12.7 mg / kg, 12.8 mg / kg, 12.9 mg / kg, 13 mg / kg, 13.5 mg / kg, 14.0 mg / kg, 14.5 mg / kg, 15.0 mg / kg, 15.5 mg / kg, 16.0 mg / kg, 16.5 mg / kg, 17.0 mg / kg, 17.0 mg / kg, 17.5 mg / kg, 18.0 mg / kg, 18.5 mg / kg, 19.0 mg / kg, 19.5 mg / kg, or 20.0 mg / kg. In certain embodiments, the dosage of the telomerase inhibitor administered to the subject is about 9.4 mg / kg.

[0102] Doses of telomerase inhibitors, such as imetelstat or imetelstat sodium, can be administered to a subject in cycles of once every two days, once every week, once every two weeks (14 days), once every three weeks (21 days), or once every four weeks (28 days), once every six weeks, once every eight weeks, once every ten weeks, or once every twelve weeks. In certain embodiments of the method, imetelstat is administered in 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosage cycles, each cycle comprising subcutaneous administration of about 2-11 mg / kg of imetelstat once every 3 weeks, about 2-11 mg / kg of imetelstat once every 4 weeks, about 2-11 mg / kg of imetelstat once every 2 weeks, or about 7.5-9.4 mg / kg of imetelstat once every 3 weeks. In certain instances, each dosage cycle comprises subcutaneous administration of about 7.5-9.4 mg / kg of imetelstat once every 4 weeks. In some instances, each dosage cycle comprises subcutaneous administration of about 9.4 mg / kg of imetelstat once every 3 weeks. In some instances, each dosage cycle comprises subcutaneous administration of about 7.5 mg / kg of imetelstat about once every four weeks. In certain embodiments of the method, imetelstat is administered in 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosage cycles, each cycle comprising subcutaneous administration of about 5-14 mg / kg of imetelstat once every three weeks, subcutaneous administration of about 5-14 mg / kg of imetelstat once every four weeks, subcutaneous administration of about 5-14 mg / kg of imetelstat once every two weeks, or subcutaneous administration of about 7.5-14 mg / kg of imetelstat once every three weeks. In certain instances, each dosage cycle comprises subcutaneous administration of about 7.5-14 mg / kg of imetelstat once every four weeks. In some instances, each dosage cycle comprises subcutaneous administration of about 14 mg / kg of imetelstat about once every three weeks, hi some instances, each dosage cycle comprises subcutaneous administration of about 12 mg / kg of imetelstat about once every four weeks.

[0103] In some embodiments, the amount of telomerase inhibitor, such as imetelstat or imetelstat sodium, administered to an individual is about 0.5 to about 5 mg, about 5 to about 10 mg, about 10 to about 15 mg, about 15 to about 20 mg, about 20 to about 25 mg, about 20 to about 50 mg, about 25 to about 50 mg, about 50 to about 75 mg, about 50 to about 100 mg, about 75 to about 100 mg, about 100 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 500 mg, about 50 to about 600 mg, about 600 to about 750 mg, about 750 to about 800 mg, about 850 to about 900 mg, about 950 to about 1000 mg, about 950 to about 1100 mg, about 115 to about 125 mg, about 125 to about 150 mg, about 150 to about 175 mg, about 175 to about 200 mg, about 200 to about 225 mg, about 225 to about 250 mg, about 250 to about 300 mg, about 300 to about 350 mg, about 350 to about 400 mg, about 400 to about 450 mg, or about 450 to about 500 mg. 00mg to about 600mg, about 600mg to about 700mg, about 700mg to about 800mg, about 800mg to about 900mg, about 900mg to about 1000mg, about 1100 mg ~ about 1200mg, about 1200mg - about 1300mg, about 1300mg - about 1400mg, about 1400mg - about 1500mg, about 1500mg - about 1600mg , about 1600 mg to about 1700 mg, about 1700 mg to about 1800 mg, about 1800 mg to about 1900 mg, about 1900 mg to about 2000 mg, about 2000 mg to about 2100 mg, about 2100 mg to about 2200 mg, about 2200 mg to about 2300 mg, about 2300 mg to about 2400 mg, and about 2400 mg to about 2500 mg.

[0104] In some embodiments, the amount of the telomerase inhibitor administered to an individual in an effective amount (e.g., a unit dosage form) ranges from about 5 mg to about 1000 mg, about 5 mg to about 500 mg, e.g., about 30 mg to about 300 mg, or about 50 mg to about 200 mg. In some embodiments, the amount of the telomerase inhibitor is in a unit dosage form having an amount ranging from about 500 mg to about 3000 mg, 750 mg to about 2500 mg, e.g., about 1000 mg to about 2000 mg, or about 50 mg to about 200 mg. The unit dosage form may be liquid or lyophilized. In certain embodiments of the method, imetelstat is administered in 1, 2, 3, 4, 5, 6, 7, 8, or more than 8 dosage cycles, each cycle comprising subcutaneous administration of about 200-3000 mg / kg of imetelstat once every 3 weeks, subcutaneous administration of about 200-3000 mg / kg of imetelstat once every 4 weeks, subcutaneous administration of about 750-2500 mg / kg of imetelstat once every 3 weeks, or subcutaneous administration of about 750-2500 mg / kg of imetelstat once every 4 weeks.

[0105] In some embodiments, the concentration of the telomerase inhibitor administered to an individual is a diluted solution (about 0.1 mg / ml) or a concentrated solution (about 300 mg / ml), for example, about 0.1 to about 300 mg / ml, 0.1 to about 200 mg / ml, about 0.1 to about 180 mg / ml, about 0.1 to about 160 mg / ml, about 0.1 to about 140 mg / ml, about 0.1 to about 120 mg / ml, about 0.1 to about 100 mg / ml, about 0.1 to about 80 mg / ml, about 0.1 to about 60 mg / ml, about 0.1 to about 40 mg / ml, about 0.1 to about 20 mg / ml, about 0.1 to about 10 mg / ml, about 2 to about 40 mg / ml, about 4 to about 35 mg / ml, about 6 to about 30 mg / ml, The concentration may be any of about 8 to about 25 mg / ml, about 10 to about 20 mg / ml, about 12 to about 15 mg / ml, or any of about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 0.6 mg / ml, 0.7 mg / ml, 0.8 mg / ml, 0.9 mg / ml, 1 mg / ml, 1.1 mg / ml, 1.2 mg / ml, 1.3 mg / ml, 1.4 mg / ml, 1.5 mg / ml, 1.6 mg / ml, 1.7 mg / ml, 1.8 mg / ml, 1.9 mg / ml, 2 mg / ml, 2.1 mg / ml, 2.2 mg / ml, 2.3 mg / ml, 2.4 mg / ml, or 2.5 mg / ml.In some embodiments, the concentration of the telomerase inhibitor is at least about 0.1 mg / ml, 0.2 mg / ml, 0.3 mg / ml, 0.4 mg / ml, 0.5 mg / ml, 1.3 mg / ml, 1.5 mg / ml, 2 mg / ml, 3 mg / ml, 4 mg / ml, 5 mg / ml, 6 mg / ml, 7 mg / ml, 8 mg / ml, 9 mg / ml, 10 mg / ml, 11 mg / ml, 12 mg / ml, 13 mg / ml, 14 mg / ml, 15 mg / ml, 16 mg / ml, 17 mg / ml, 18 mg / ml, 19 mg / ml, 20 mg / ml, 21 mg / ml, 22 mg / ml, 23 mg / ml, 24 mg / ml, 25 mg / ml, 26 mg / ml, 27 mg / ml, 28 mg / ml, 29 mg / ml, 30 mg / ml, 31 mg / ml l, 32mg / ml, 33mg / ml, 33.3mg / ml, 34mg / ml, 35mg / ml, 36mg / ml, 37mg / ml, 38mg / ml, 39mg / ml, 40mg / ml, 50mg / ml, 60mg / ml, 70mg / ml, 80mg / ml, 90mg / ml, 100mg / ml, 110mg / ml, 120mg / ml, 130mg / ml, 140 mg / ml, 150mg / ml, 160mg / ml, 170mg / ml, 180mg / ml, 190mg / ml, 200mg / ml, 210mg / ml, 220mg / ml, 230 mg / ml, 240 mg / ml, 250 mg / ml, 260 mg / ml, 270 mg / ml, 280 mg / ml, 290 mg / ml, or 300 mg / ml.

[0106] In embodiments, each dose of the telomerase inhibitor composition is administered subcutaneously to a subject once every 7 days or more, including once every 10 days or more, for example, once every 14 days or more, for example, once every 21 days or more, for example, once every 28 days or more, and once every 35 days or more. In some embodiments, the telomerase inhibitor composition is administered to a subject once every 2 days. In some embodiments, the telomerase inhibitor composition is administered to a subject once every week. In some embodiments, the telomerase inhibitor composition is administered to a subject once every 2 weeks. In other embodiments, the telomerase inhibitor composition is administered to a subject once every 3 weeks. In still other embodiments, the telomerase inhibitor composition is administered to a subject once every 4 weeks.

[0107] kit Kits are also provided, comprising at least one or more (e.g., a plurality) of subcutaneous telomerase inhibitor compositions of the present invention, as described above. In certain embodiments, the subcutaneous telomerase inhibitor compositions of the present invention in the kit may be provided in a package. For example, each composition of the kit may be presented in an individual pouch, bottle, or similar container to store the composition until use. The kit may further include other components for practicing the methods of the present invention, such as an administration device or fluid for flushing the skin before administering one or more of the compositions of the present invention. In certain embodiments, the kit includes a hypodermic syringe and is configured to deliver a therapeutically effective amount of the composition to a subject. In some cases, the syringe includes a syringe and a needle. In other embodiments, the syringe is a bolus syringe and is configured to deliver a predetermined amount of the composition subcutaneously. In certain embodiments, the telomerase inhibitor composition is pre-loaded into the hypodermic syringe. The kit may also include a gauze pad or other device for cleaning the injection site, which may be useful for practicing the methods of the present invention. In some embodiments, the telomerase inhibitor composition is formulated as a solid or lyophilized product, and the kit may further comprise one or more buffer compositions or solvents for reconstituting the composition of the invention for subcutaneous injection.

[0108] Additionally, the kit may include instructions for using the telomerase inhibitor composition of the present invention, which may include information regarding administration methods, dosing schedules, and record-keeping devices for implementing the treatment regimen. The instructions are recorded on a suitable recording medium. For example, the instructions may be printed on a substrate (e.g., paper or plastic). Thus, the instructions may be present in the kit as a package insert, on a label on the container of the kit or its components (i.e., associated with the packaging or subpackaging), or the like. In other embodiments, the instructions are present as an electronic storage data file present on a suitable computer-readable storage medium (e.g., CD-ROM, diskette, etc.). In yet other embodiments, the actual instructions are not present in the kit, but means for retrieving the instructions from a remote source, e.g., via the Internet, are provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and / or downloaded. Similar to the instructions, a protocol for retrieving the instructions can be recorded on a suitable substrate. [Example]

[0109] The following examples are presented to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention, nor are they intended to represent that the following experiments are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperature, etc.), but some experimental error and deviation should be accounted for. Unless otherwise indicated, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at about atmospheric. "Average" means the arithmetic mean. Standard abbreviations may be used, such as bp, base pairs; kb, kilobase; pl, picoliter; s or sec, seconds; min, minutes; h or hr, hours; aa, amino acid; kb, kilobase; bp, base pairs; nt, nucleotide; im, intramuscular; ip, intraperitoneal; sc, subcutaneous, etc.

[0110] Example 1: Bioavailability study of imetelstat sodium by subcutaneous and intravenous routes in rats Materials and Methods Imetelstat sodium was administered intravenously (IV volume 37.5 μL, 30 mg / kg) to four male Sprague-Dawley rats (approximately 250 g-260 g) and subcutaneously (SC volume 113 μL, 90 mg / kg) to four male Sprague-Dawley rats (approximately 250 g-260 g). Imetelstat sodium is a 5'-palmitoylated 13-mer thiophosphoramidate oligonucleotide consisting of the sequence 5'-TAGGGTTAGACAA-3'. Imetelstat sodium was dissolved in water immediately before administration.

[0111] Blood was collected from each rat at 0.083 hours (approximately 5 minutes), 0.25 hours (15 minutes), 1 hour, 2 hours, 4 hours, 8 hours, and 24 hours. Volumes of 1.5 to 2.0 mL of whole blood were collected, yielding approximately 700 to 1000 μL of plasma. Blood was collected through a secondary catheter in IV-dosed rats (different from the one used for IV administration).

[0112] Blood samples were collected in EDTA tubes and immediately centrifuged. The collected plasma samples were transferred to separate vials. The plasma concentrations of imetelstat sodium were analyzed by LC / MS / MS.

[0113] result Figure 1 shows the plasma concentrations of imetelstat sodium analyzed over a 24-hour period. The plasma concentrations of imetelstat sodium were analyzed by non-compartmental PK analysis. The subcutaneous (sc) bioavailability was calculated based on the following formula: F = (AUC(sc) / dose(sc)) / (AUC(iv) / dose(iv)) × 100%. The calculated subcutaneous bioavailability of imetelstat is approximately 95.8%. In a repeat experiment, the calculated subcutaneous bioavailability of imetelstat in rats was approximately 81.5%.

[0114] conclusion The results shown in Figure 1 demonstrate that imetelstat sodium was absorbed into the systemic circulation after subcutaneous administration and showed approximately 80-95% bioavailability compared to IV administration. This supports the use of imetelstat compositions for subcutaneous administration. Example 2 - Compatibility and Stability of Imetelstat Sodium Incubated with Hyaluronidase [Table 7]

[0115] Pre-test: Demonstration of compatibility of imetelstat co-formulated with rHuPH20 Data generated from an initial feasibility study conducted as a preliminary to the following primary compatibility and stability studies showed that the results of the imetelstat + rHuPH20 co-formulations, represented by Formulations D, F, and G (as defined below) prepared for this preliminary study, were similar to the results of the rHuPH20-free imetelstat drug substance lots used to prepare the co-formulations, providing support for the compatibility of imetelstat co-formulated with rHuPH20 (see table below).

[0116] The following formulations were prepared: [Table 8] [Table 9] 1 Data reflect the most recent stability data available for the imetelstat drug substance lot used to prepare the imetelstat + rHuPH20 co-formulation. [Table 10] 1Data reflect the most recent stability data available for the imetelstat drug substance lot used to prepare the imetelstat + rHuPH20 co-formulation.

[0117] Main exams: the purpose The objective of this study is to demonstrate the compatibility and stability of rHuPH20 co-formulated with imetelstat sodium under various storage conditions. material Imetelstat sodium rHuPH20 Enhanze formulation (EDP): 1 mg / mL, 110,000 U / mL, stored at 5°C 0.9% sodium chloride L-histidine (≥99% (TLC)) L-Methionine (reagent grade, ≥98% (HPLC)) Polysorbate 80 NaCl (ACS grade) Concentrated hydrochloric acid (ACS reagent, 37%) ·water Nylon 47mm filtration membrane (0.2μm) [Table 11] [Table 12]

[0118] Preparation of rHuPH20 Enhanced Preparation (EDP) Buffer Add approximately 450 mL of water to a 500 mL volumetric flask. Add approximately 776 mg (± 15 mg) of L-histidine, approximately 3.80 g of NaCl (± 75 mg), and approximately 746 mg (± 15 mg) of L-methionine to the volumetric flask. Use a stir bar to completely dissolve the ingredients. Use visual inspection to ensure the ingredients are dissolved.

[0119] To the solution, add 1 mL of a 10.0% polysorbate 80 composition to a volumetric flask. Mix the composition using a stir bar. Adjust the pH to a final pH of 6.5±0.3 using concentrated HCl. Bring the final volume to 500 mL. Filter the composition through a nylon 47 mm filter membrane (0.2 μm) and store at 5° C. (stable for at least 2 weeks).

[0120] The compositions are stored in 20 mL borosilicate glass scintillation vials at 5° C. in an upright orientation, 25° C. in an upright orientation, and 37° C. in an upright orientation. Stability Protocol Schedule The following table summarizes the number of samples set per interval / condition / formulation (initial interval samples are stored at -20°C): [Table 13]

[0121] Stability Pull and Testing Protocol To evaluate the compatibility and stability of the imetelstat + rHuPH20 co-formulation, tests are performed on selected samples at specified time intervals and under specified conditions (see table below). Test methods include evaluation of appearance, pH, oligo concentration (UV), purity by HPLC, assay by LC / MS, rHuPH20 enzyme activity, and telomerase activity of imetelstat by TRAP assay (Mender and Shay, Bio Protoc. 2015:5(22)). [Table 14] One aliquot of the T=0 samples for conditions A, D, and F that will be evaluated by TRAP assay upon collection; a second aliquot that will be retained for possible future analysis along with samples from other conditions and / or time points. A = rHuPH20 appearance, pH, oligo concentration (UV), RP-HPLC, enzyme activity assay B=LC / MS C = Imelstat telomerase activity (TRAP) assay R = Sample to be tested as needed

[0122] To test whether mixing rHuPH20 with imetelstat has any effect on the telomerase inhibitory activity of imetelstat, three formulations shown in the sample formulation table above, i.e., imetelstat sodium alone (Formulation A) or imetelstat sodium mixed with rHuPH20 (Formulations D and F), were tested for imetelstat activity in a TRAP (telomerase repeat amplification protocol) assay. Briefly, cancer cell line HeLa cells were treated in vitro in triplicate with seven different concentrations (0.1, 1, 5, 7.5, 10, 25, and 50 μM) of each test formulation, as well as one no-drug control, for 24 hours. Cell pellets were lysed for protein extraction and quantification, and the same amount of protein from cells treated with each formulation concentration was tested by the TRAP assay. The relative telomerase activity (RTA) for each quantitative polymerase chain reaction (qPCR) result was determined from a standard curve. The standard curve was generated by TRAP assay of serial dilutions of protein lysate from untreated Hela cells. The average RTA from replicates was calculated for a given formulation at each concentration and compared to the average RTA value of the no-drug control to generate a percent (%) of telomerase activity inhibition, plotted against treatment concentration, and the drug concentration for each formulation was determined to achieve 50% inhibition of telomerase activity (IC 50 The results in Figure 2 show that IC values ​​for all three formulations were 50 The values ​​were very similar and close to the logarithm of 1 (10 μM), indicating that mixing imetelstat sodium with rHuPH20 does not affect the telomerase inhibitory activity of imetelstat.

[0123] Example 3 - Assay of rHuPH20 Activity in Formulations of Imetelstat and rHuPH20 overview In an additional feasibility study conducted as a preliminary test to the main compatibility and stability studies described in Example 2 above, formulations containing imetelstat mixed with rHuPH20 were tested for rHuPH20 activity. Results of an assay based on the reaction of rHuPH20 with biotinylated hyaluronic acid (HA) are provided, demonstrating that rHuPH20 activity can be measured in the presence of imetelstat in co-mixed samples.

[0124] result Biotinylated hyaluronic acid was used to determine the activity of rHuPH20 in the presence and absence of imetelstat. Compositions containing 2000 U / mL rHuPH20 in saline were assayed with biotinylated hyaluronic acid to measure the level of hyaluronic acid degradation by rHuPH20 and compared to compositions containing 100 mg / mL imetelstat and 2000 U / mL rHuPH20. For each imetelstat + rHuPH20 composition, the amount of rHuPH20 activity detected in the samples was close to the amount based on the activity seen in the rHuPH20-alone sample (Table below). [Table 15]

[0125] Example 4 - Bioavailability and local tolerance study of a single subcutaneous dose of imetelstat with or without rHuPH20 in rats the purpose The purpose of this study is to evaluate the systemic uptake (in terms of plasma levels) and local (injection site) tolerability of imetelstat in rats following a single subcutaneous (SC) injection of imetelstat alone or in combination with rHuPH20 (a recombinant human hyaluronidase enzyme product co-formulated with imetelstat). The subcutaneous bioavailability of imetelstat will be determined by including a group receiving an intravenous dose of this test sample. This study is designed to demonstrate that imetelstat co-formulated with rHuPH20 is tolerable and provides a pharmacokinetic profile of imetelstat that is indicative of the clinical use of imetelstat co-formulated with rHuPH20 to deliver a required fluid volume containing a sufficient dose of imetelstat via the subcutaneous route of administration.

[0126] animal Each Sprague-Dawley rat is of a normal age at the start of the study.

[0127] Test sample Imelstat will be tested in the presence or absence of rHuPH20.

[0128] Study design / administration Imelstat is administered as a single dose on Day 1 by either slow-push intravenous injection (Group 1) or subcutaneous (single-dose) injection (Group 2). Imetelstat co-formulated with rHuPH20 is administered as a single dose on Day 1 by SC injection (Groups 3a and 3b). A vehicle for imetelstat is administered simultaneously to animals in Group 2 at a separate SC site (control injection site). Similarly, a vehicle for imetelstat co-formulated with rHuPH20 is administered to animals in Groups 3a and 3b at a separate control injection site.

[0129] The table below shows the group assignments. [Table 16] SC: Subcutaneous *: Vehicle control sample of imetelstat administered at a different SC site than the dose of imetelstat (at the same dose as imetelstat alone) **: Vehicle control sample for imetelstat / rHuPH20 co-formulation is administered at a different SC site than the dose of imetelstat / rHuPH20 co-formulation.

[0130] Observation and sampling Clinical Observations: Study observations include standard clinical observations, local injection site evaluations, food intake and body weight. PK samples: Blood samples are collected from all animals into K2EDTA-containing tubes at various times post-dose, ranging from 5 minutes to 8 hours. Samples are processed to plasma under refrigerated conditions, and the resulting plasma is stored deep-frozen.

[0131] Bioanalysis of PK samples and data interpretation: Rat plasma samples are analyzed for imetelstat concentrations using a validated hybridization ELISA method. AUC 0-t , AUC 0-inf , C max , T max , K. el , C.L., V. d , and t 1 / 2 Calculate PK parameters such as:

[0132] Example 5 - Pharmacokinetic and local tolerance study of a single subcutaneous dose in monkeys the purpose The purpose of this study is to evaluate the systemic uptake (in terms of plasma levels) and local (injection site) tolerability of imetelstat following a single subcutaneous injection of imetelstat alone or in combination with rHuPH20 (a recombinant human hyaluronidase enzyme product co-formulated with imetelstat) in cynomolgus monkeys. The study is designed to demonstrate that imetelstat co-formulated with rHuPH20 is tolerable and to provide a pharmacokinetic profile of imetelstat that is indicative of the clinical use of imetelstat co-formulated with rHuPH20 to deliver a required fluid volume containing a sufficient dose of imetelstat via the subcutaneous administration route.

[0133] animal Cynomolgus monkeys of normal age and weight at the start of the study.

[0134] Test sample Imelstat will be tested in the presence or absence of rHuPH20.

[0135] Study design / administration Imelstat is administered as a single dose by SC injection on Day 1 (Group 1), and Imelstat co-formulated with rHuPH20 is administered as a single dose by subcutaneous injection on Day 1 (Group 2). The vehicle for imetelstat is administered simultaneously to animals in Group 1 at a different subcutaneous site (control injection site). Similarly, the vehicle for the co-formulation of imetelstat and rHuPH20 is administered to animals in Group 2 at a separate control site.

[0136] The table below shows the group assignments. [Table 17] SC: Subcutaneous *: Vehicle control sample for imetelstat administered at a different SC site than the dose of imetelstat. **: Vehicle control sample for imetelstat / rHuPH20 co-formulation is administered at a different SC site than the dose of imetelstat / rHuPH20 co-formulation.

[0137] Observation and sampling Clinical Observations: Study observations include standard clinical observations, local injection site evaluation (including histopathological examination), food intake and body weight.

[0138] PK samples: Blood samples are collected from all animals into K2EDTA-containing tubes at various times post-dose, ranging from 5 minutes to 24 hours. Samples are processed to plasma under refrigerated conditions, and the resulting plasma is stored under deep freezing.

[0139] Bioanalysis of PK samples and data interpretation: Monkey plasma samples are analyzed for imetelstat concentrations using a validated hybridization ELISA method. AUC 0-t , AUC 0-inf , C max , T max , K. el , C.L., V. d , and t 1 / 2 Calculate PK parameters such as:

[0140] Example 6 - Safety and Pharmacokinetic Studies in Healthy Volunteers or Patients the purpose The purpose of this study is to evaluate the safety, tolerability, and pharmacokinetics of imetelstat following subcutaneous (SC) and intravenous (IV) administration. The study is designed to demonstrate that the co-formulation of imetelstat and rHuPH20 provides subcutaneous delivery of the necessary fluid volume containing a sufficient dose of imetelstat to demonstrate an acceptable safety, tolerability, and pharmacokinetic profile of imetelstat via the SC route of administration.

[0141] Study design overview The study will be conducted in two parts. Part 1 will be a dose-escalation phase involving subcutaneous administration of imetelstat. Up to approximately four cohorts are planned for Part 1. Subjects will participate in only one cohort. In each cohort, subjects will receive a single subcutaneous dose of imetelstat on Day 1. Part 2 will be an open-label, randomized, two-treatment, crossover, or parallel design. The dose for Part 2 will be selected after review of the safety and pharmacokinetic data from Part 1.

[0142] If Part 2 is a crossover design, alternating subcutaneous or intravenous doses of imetelstat will be administered according to a randomization schedule on Day 1 of Period 1 and Period 2, followed by 48-hour pharmacokinetic sampling. In a crossover design, there will be a planned washout period between imetelstat doses in Part 2. If Part 2 is a parallel design, patients will be randomized to receive either a subcutaneous or intravenous dose of imetelstat on Day 1, followed by 48-hour pharmacokinetic sampling.

[0143] Dosage, Form, Route, and Dosage Regimen Subcutaneous imetelstat is formulated as a co-mixture with hyaluronidase (rHuPH20) in an appropriate vehicle. Intravenous imetelstat is hyaluronidase-free and formulated in 0.9% sodium chloride.

[0144] Part 1: A single subcutaneous dose administered in Part 1. Cohort doses will be selected based on review of safety and pharmacokinetic data from preclinical pharmacokinetic and local tolerance studies in rats and monkeys.

[0145] Part 2: Subjects will receive imetelstat subcutaneously or intravenously in one of the following sequences: Sequence A (crossover design): A single subcutaneous dose of imetelstat administered on day 1, followed by a single intravenous dose of imetelstat after an appropriate washout period, or Sequence B (crossover design): A single intravenous dose of imetelstat administered on day 1, followed by a single subcutaneous dose of imetelstat after an appropriate washout period, or Sequence C (Parallel Design): Subjects in one cohort will receive a single subcutaneous dose of imetelstat on day 1, and subjects in another cohort will receive a single intravenous dose of imetelstat on day 1.

[0146] The subcutaneous dose is given as a single injection at one site, and the intravenous dose is given as a 2-hour infusion.

[0147] evaluation Pharmacokinetics: Blood samples for imetelstat plasma concentrations are collected pre-dose and at various times from 0.5 to 48 hours after subcutaneous administration or initiation of infusion.

[0148] If necessary, the following PK parameters of imetelstat in plasma will be calculated: AUC 0-t , AUC 0-inf , AUC% extrap , C max , T max , K. el , C L , C L / F , and t 1 / 2 .

[0149] Safety: Safety and tolerability assessments will be monitored through standard procedures, including electrocardiogram (ECG), physical examination, vital sign measurements, laboratory tests, and adverse events. Summary statistics may be calculated where deemed clinically appropriate.

[0150] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those skilled in the art in light of the teachings of the invention that certain changes and modifications can be made therein without departing from the spirit or scope of the appended claims.

[0151] Thus, the foregoing merely illustrates the principles of the invention. It will be understood that those skilled in the art will be able to devise various configurations, not explicitly described or shown herein, which embody the principles of the invention and are within its spirit and scope. Furthermore, all examples and conditional language recited herein are intended primarily to aid the reader in understanding the principles of the invention and concepts contributed by the inventors to further the art, and should be construed as including no limitations to such specifically recited examples and conditions. Furthermore, all statements herein reciting principles, aspects, and embodiments of the invention, as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, such equivalents are intended to include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. Furthermore, nothing disclosed herein is intended to be offered to the public, regardless of whether such disclosure is expressly recited in the claims.

[0152] Accordingly, the scope of the present invention is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims. The claims expressly define that 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is invoked for a feature in a claim only if the precise phrase "means for" or the precise phrase "step for" is recited at the beginning of such feature in the claim; if such precise phrase is not used for a feature in the claim, 35 U.S.C. 112(f) or 35 U.S.C. 112(6) is not invoked.

[0153] Other embodiments of the present invention may include: 1. A composition formulated for subcutaneous administration, comprising: a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide; and a hyaluronidase enzyme. 2. The composition of paragraph 1, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. 3. The composition of paragraph 2, wherein the hyaluronidase enzyme is rHuPH20. 4. The composition of paragraph 1, wherein the composition comprises a variant or fragment of the PH20 hyaluronidase enzyme. 5. The composition of paragraph 4, comprising a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341G, S343E, M345T, K349E, L353A, L354I, N356E, and I361T in wild-type PH20 having the amino acid sequence of SEQ ID NO:1. 6. The composition of paragraph 5, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, L354I, and N356E. 7. The composition of paragraph 4, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues in a region corresponding to the alpha helix region or linker region of wild-type PH20 having the amino acid sequence of SEQ ID NO:1. 8. The composition of paragraph 7, wherein the α-helix region is an α-helix 8 region comprising amino acid residues S347 to C381, and the linker region is a linker region comprising amino acid residues A333 to R346 between α-helix 7 and α-helix 8. 9. The composition of paragraph 7, wherein the α-helical region and the linker region comprise amino acid residues T341 to N363, T341 to 1361, L342 to 1361, S343 to 1361, 1344 to 1361, M345 to 1361, or M345 to N363. 10. The composition of paragraph 7, wherein the α-helix 8 region and the linker region between α-helix 7 and α-helix 8 are substituted with one or more amino acid residues from the corresponding regions of Hyal1. 11. The composition of paragraph 4, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues at one or more positions selected from the group consisting of T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, D355, E359, I361, and N363. 12. A variant or fragment of PH20, Substitution of one or more of the amino acid residues L354I and N356E, and 12. The composition of paragraph 11, comprising a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, D355K, E359D, I361T, and N363G. 13. A variant or fragment of PH20, (i) substitutions M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T; (ii) substitutions T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, and N363G, or (iii) the following amino acid residue substitutions: (a) T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (b) L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (c) M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, I361T, and N363G, (d) T341G, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (e) T341A, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (f) T341C, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (g) T341D, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (h) I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and 13. The composition of paragraph 12, comprising (i) a substitution of any one amino acid residue selected from S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. 14. The composition of any one of paragraphs 4 to 13, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. 15. Disconnection (i) located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted; or (ii) located before the N-terminal amino acid residues L36, N37, F38, R39, A40, P41, or P42, such that one or more residues at the N-terminus are deleted; (iii) located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus, such that one or more amino acid residues at the C-terminus are deleted; or (iv) The composition of paragraph 14, wherein the C-terminal amino acid residue is located after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490, such that one or more amino acid residues at the C-terminus are deleted. 16. The composition of any one of paragraphs 4 to 15, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3 MATGSRTSLLLAFGLLCLPWLQEGSA, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4 MKWVTFISLLFLFSSAYS, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5 MAAHLLPICALFLTLLDMAQG. 22. A variant or fragment of PH20, (i) a peptide having at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (ii) a peptide having at least 95% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (iii) consisting of an amino acid sequence selected from SEQ ID NOs: 60 to 115; (iv) The composition of any one of paragraphs 4 to 21, having the amino acid sequence of SEQ ID NO: 99. 23. The composition of any one of paragraphs 1 to 22, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. 24. The composition of any one of paragraphs 1 to 23, wherein the hyaluronidase is present in the composition in an amount of 100 U / mL to 50,000 U / mL. 25. The composition of any one of paragraphs 1 to 24, wherein the composition further comprises one or more pharmaceutically acceptable excipients. 26. The composition of any one of paragraphs 1 to 25, wherein the composition further comprises one or more sugars. 27. The composition of paragraph 26, wherein the one or more sugars comprise a monosaccharide. 28. The composition of paragraph 26 or 27, wherein the one or more sugars comprises a polysaccharide. 29. The composition of paragraph 28, wherein the one or more polysaccharides are selected from the group consisting of trehalose and sucrose. 30. The composition of any one of paragraphs 26 to 29, wherein the one or more sugars are present in the composition in an amount of from 10 mM to 500 mM. 31. The composition of any one of paragraphs 1 to 30, wherein the composition further comprises one or more amino acids. 32. The composition according to paragraph 31, wherein the amino acid is selected from methionine and histidine. 33. The composition of paragraph 31 or 32, wherein the one or more amino acids are present in the composition in an amount between 1 mM and 100 mM, optionally between 1 mM and 50 mM. 34. The composition of any one of paragraphs 1 to 33, wherein the composition further comprises a buffer. 35. The composition of paragraph 34, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0, and optionally in an amount sufficient to maintain the composition at a pH of 5.5 to 7.5. 36. The composition of paragraph 34 or 35, wherein the buffer is present in the composition in an amount of 1 to 100 mM, optionally in an amount of 1 mM to 50 mM. 37. The composition of any one of paragraphs 1-36, wherein the telomerase inhibitor oligonucleotide comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. 38. The composition of any one of paragraphs 1 to 37, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker, optionally wherein the linker is a glycerol or aminoglycerol linker. 39. The composition of any one of paragraphs 1-38, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. 40. The composition of any one of paragraphs 1 to 39, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof, optionally wherein the telomerase inhibitor is imetelstat sodium. 41. The telomerase inhibitor is present in the composition: (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The composition of any one of paragraphs 1 to 40, wherein the composition is present in a dosage of from about 11 mg / kg to about 14 mg / kg. 42. The composition of any one of paragraphs 1 to 41, wherein the composition is lyophilized. 43. A method of treating a subject having a tumor, comprising subcutaneously administering to the subject a composition, wherein the composition comprises: a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide; a hyaluronidase enzyme. 44. The method of paragraph 43, wherein the tumor is a hematological tumor selected from myelofibrosis (MF), myelodysplastic syndrome (MDS), essential thrombocythemia (ET), polycythemia vera (PV), chronic myeloid leukemia (CML), chronic neutrophilic leukemia, chronic eosinophilic leukemia, and acute myeloid leukemia (AML). 45. The method of paragraph 43 or 44, further comprising diagnosing the subject as having a hematological tumor. 46. ​​The composition is administered to a subject. (i) Once every other day; (ii) once every seven days; (iii) Once every 21 days; or (iv) The method of any one of paragraphs 43 to 45, administered subcutaneously once every 28 days. 47. The method of any one of paragraphs 43-46, wherein the method is repeated one or more times, optionally five or more times. 48. A telomerase inhibitor is administered to a subject. (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The method of any one of paragraphs 43 to 47, wherein the compound is administered at a dosage of about 11 mg / kg to about 14 mg / kg. 49. The method of any one of paragraphs 43-48, wherein the hyaluronidase enzyme is recombinant human hyaluronidase, optionally rHuPH20. 50. The method of any one of paragraphs 43 to 48, wherein the composition comprises a variant or fragment of the PH20 hyaluronidase enzyme. 51. The method of paragraph 50, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341G, S343E, M345T, K349E, L353A, L354I, N356E, and I361T in wild-type PH20 having the amino acid sequence of SEQ ID NO:1, optionally wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, L354I, and N356E. 52. The method of paragraph 50, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues in a region corresponding to the alpha helix region or linker region of wild-type PH20 having the amino acid sequence of SEQ ID NO:1. 53. (i) the α-helix region is an α-helix 8 region including amino acid residues S347 to C381, and the linker region is a linker region including amino acid residues A333 to R346 between α-helix 7 and α-helix 8; (ii) the α-helical region and the linker region comprise amino acid residues T341 to N363, T341 to 1361, L342 to 1361, S343 to 1361, 1344 to 1361, M345 to 1361, or M345 to N363; or (iii) The method of paragraph 52, wherein the α-helix 8 region and the linker region between α-helix 7 and α-helix 8 are substituted with one or more amino acid residues from the corresponding regions of Hyal1. 54. The method of paragraph 50, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues at one or more positions selected from the group consisting of T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, D355, E359, I361, and N363. 55. A variant or fragment of PH20, Substitution of one or more of the amino acid residues L354I and N356E, and a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, D355K, E359D, I361T, and N363G; 55. The method of paragraph 54, optionally wherein the variant or fragment of PH20 comprises substitutions M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. 56. A variant or fragment of PH20, (i) substitutions T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, and N363G, or (ii) the following amino acid residue substitutions: (a) T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (b) L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (c) M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, I361T, and N363G, (d) T341G, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (e) T341A, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (f) T341C, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (g) T341D, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (h) I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and 56. The method of paragraph 55, comprising (i) a substitution of any one amino acid residue selected from S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. 57. The method of any one of paragraphs 50 to 56, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. 58. Disconnection (i) located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus such that one or more residues at the N-terminus are deleted; or (ii) located before the N-terminal amino acid residues L36, N37, F38, R39, A40, P41, or P42, such that one or more residues at the N-terminus are deleted; (iii) located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus, such that one or more amino acid residues at the C-terminus are deleted; or (iv) The method of paragraph 57, wherein one or more amino acid residues at the C-terminus are deleted after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus. 59. The method of any one of paragraphs 50 to 58, wherein the N-terminus comprises a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3 MATGSRTSLLLAFGLLCLPWLQEGSA, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4 MKWVTFISLLFLFSSAYS, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5 MAAHLLPICALFLTLLDMAQG. 60. A variant or fragment of PH20, (i) a peptide having at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (ii) a peptide having at least 95% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (iii) consisting of an amino acid sequence selected from SEQ ID NOs: 60 to 115; or (iv) The method of any one of paragraphs 50 to 59, having the amino acid sequence of SEQ ID NO: 99. 61. The method of any one of paragraphs 43 to 60, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. 62. The method of any one of paragraphs 43 to 61, wherein the hyaluronidase is present in the composition in an amount of 100 U / mL to 50,000 U / mL. 63. The method of any one of paragraphs 43 to 62, wherein the composition further comprises one or more pharmaceutically acceptable excipients. 64. The method of any one of paragraphs 43 to 63, wherein the composition further comprises one or more sugars. 65. The method of paragraph 64, wherein the one or more sugars comprise monosaccharides. 66. The method of paragraph 64 or 65, wherein the one or more sugars comprises a polysaccharide. 67. The method of paragraph 66, wherein the one or more polysaccharides are selected from the group consisting of trehalose and sucrose. 68. The method of any one of paragraphs 64 to 67, wherein the one or more sugars are present in the composition in an amount of 10 mM to 500 mM, optionally in an amount of 100 mM to 300 mM. 69. The method of any one of paragraphs 43 to 68, wherein the composition further comprises one or more amino acids. 70. The method of paragraph 69, wherein the amino acid is selected from methionine and histidine. 71. The method of paragraph 69 or 70, wherein the one or more amino acids are present in the composition in an amount between 1 mM and 100 mM, optionally between 1 mM and 50 mM. 72. The method of any one of paragraphs 43 to 71, wherein the composition further comprises a buffer. 73. The method of paragraph 72, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0, and optionally in an amount sufficient to maintain the composition at a pH of 5.5 to 7.5. 74. The method of paragraph 72 or 73, wherein the buffer is present in the composition in an amount of 1 to 100 mM, optionally in an amount of 1 mM to 50 mM. 75. The method of any one of paragraphs 72 to 74, wherein the buffer comprises histidine. 76. The method of any one of paragraphs 43-75, wherein the telomerase inhibitor oligonucleotide comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. 77. The method of any one of paragraphs 43 to 76, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. 78. The method of paragraph 77, wherein the linker is a glycerol or aminoglycerol linker. 79. The method of any one of paragraphs 43 to 78, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. 80. The method of any one of paragraphs 43 to 79 and 158, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof, optionally imetelstat sodium. 81. A unit dosage form comprising a hyaluronidase enzyme and a telomerase inhibitor comprising an oligonucleotide and a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. 82. The unit dosage form of paragraph 81, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. 83. The unit dosage form of paragraph 82, wherein the hyaluronidase enzyme is rHuPH20. 84. The unit dosage form of paragraph 83, wherein the composition comprises a variant or fragment of the PH20 hyaluronidase enzyme. 85. A variant or fragment of PH20, (i) a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341G, S343E, M345T, K349E, L353A, L354I, N356E, and I361T in wild-type PH20 having the amino acid sequence of SEQ ID NO: 1; (ii) a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, L354I, and N356E; or (iii) a substitution of one or more amino acid residues in a region corresponding to the alpha helix region or linker region of wild-type PH20 having the amino acid sequence of SEQ ID NO:1. 86. The unit dosage form of paragraph 85, wherein the α-helical region is an α-helix 8 region comprising amino acid residues S347 to C381, and the linker region is a linker region comprising amino acid residues A333 to R346 between α-helix 7 and α-helix 8. 87. The unit dosage form of paragraph 85, wherein the α-helical region and linker region comprise amino acid residues T341 to N363, T341 to 1361, L342 to 1361, S343 to 1361, 1344 to 1361, M345 to 1361, or M345 to N363. 88. The unit dosage form according to paragraph 86, wherein the α-helix 8 region and the linker region between α-helix 7 and α-helix 8 are substituted with one or more amino acid residues from the corresponding regions of Hyal1. 89. A variant or fragment of PH20, (i) substitution of one or more amino acid residues at one or more positions selected from the group consisting of T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, D355, E359, I361, and N363; (ii) Substitution of one or more of the amino acid residues L354I and N356E, and a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, D355K, E359D, I361T, and N363G, optionally wherein the variant or fragment of PH20 comprises the substitutions M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T; (iii) substitutions T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, and N363G, or (iv) the following amino acid residue substitutions: (a) T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (b) L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (c) M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, I361T, and N363G, (d) T341G, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (e) T341A, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (f) T341C, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (g) T341D, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (h) I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and 85. The unit dosage form of paragraph 84, comprising (i) a substitution of any one amino acid residue selected from S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. 90. The unit dosage form of any one of paragraphs 84 to 89, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. 91. Disconnection (i) located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus, such that one or more residues at the N-terminus are deleted; (ii) located before the N-terminal amino acid residues L36, N37, F38, R39, A40, P41, or P42, such that one or more residues at the N-terminus are deleted; (iii) located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus, such that one or more amino acid residues at the C-terminus are deleted; (iv) The unit dosage form of paragraph 90, wherein the amino acid residues are located after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus such that one or more amino acid residues at the C-terminus are deleted. 92. A unit dosage form according to any one of paragraphs 84 to 91, comprising at its N-terminus a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3 MATGSRTSLLLAFGLLCLPWLQEGSA, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4 MKWVTFISLLFLFSSAYS, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5 MAAHLLPICALFLTLLDMAQG. 93. A variant or fragment of PH20, (i) a peptide having at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (ii) a peptide having at least 95% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (iii) consisting of an amino acid sequence selected from SEQ ID NOs: 60 to 115; or (iv) The unit dosage form of any one of paragraphs 84 to 92, having the amino acid sequence of SEQ ID NO: 99. 94. The unit dosage form of any one of paragraphs 81 to 93, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. 95. The unit dosage form of any one of paragraphs 81-94, wherein the hyaluronidase is present in the composition in an amount of 100 U / mL to 50,000 U / mL. 96. The unit dosage form of any one of paragraphs 81 to 95, wherein the composition further comprises one or more pharmaceutically acceptable excipients. 97. The unit dosage form of any one of paragraphs 81-96, wherein the composition further comprises one or more sugars. 98. The unit dosage form of paragraph 97, wherein the one or more sugars comprises a monosaccharide. 99. The unit dosage form of paragraph 97 or 98, wherein the one or more saccharides comprises a polysaccharide. 100. The unit dosage form of paragraph 99, wherein the one or more polysaccharides are selected from the group consisting of trehalose and sucrose. 101. The unit dosage form of any one of paragraphs 97 to 100, wherein the one or more sugars are present in the composition in an amount of from 10 mM to 500 mM. 102. The unit dosage form of any one of paragraphs 81-100, wherein the composition further comprises one or more amino acids. 103. The unit dosage form according to paragraph 102, wherein the amino acid is selected from methionine and histidine. 104. The unit dosage form of paragraph 102 or 103, wherein the one or more amino acids are present in the composition in an amount of 1 mM to 100 mM, optionally in an amount of 1 mM to 50 mM. 105. The unit dosage form of any one of paragraphs 81 to 104, wherein the composition further comprises a buffer. 106. The unit dosage form of paragraph 105, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0, and optionally in an amount sufficient to maintain the composition at a pH of 5.5 to 7.5. 107. The unit dosage form of paragraph 105 or 106, wherein the buffer is present in the composition in an amount of 1 to 100 mM, optionally in an amount of 1 mM to 50 mM. 108. The unit dosage form of any one of paragraphs 81-107, wherein the telomerase inhibitor oligonucleotide comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. 109. The unit dosage form of any one of paragraphs 81 to 108, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. 110. The unit dosage form of paragraph 109, wherein the linker is a glycerol or aminoglycerol linker. 111. The unit dosage form of any one of paragraphs 81 to 110, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. 112. The unit dosage form of any one of paragraphs 81 to 111, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof, optionally imetelstat sodium. 113. The telomerase inhibitor is contained in the composition: (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The unit dosage form of any one of paragraphs 81 to 112, wherein the unit dosage form is present in a dosage amount of from about 11 mg / kg to about 14 mg / kg. 114. The unit dosage form of any one of paragraphs 81 to 113, wherein the composition is a liquid. 115. A composition comprising a hyaluronidase enzyme; and a composition comprising an oligonucleotide and a telomerase inhibitor comprising a lipid moiety attached to the 5' and / or 3' end of the oligonucleotide. 116. The kit of paragraph 115, further comprising a syringe. 117. The kit of paragraph 115 or 116, wherein the composition comprising the telomerase inhibitor is lyophilized. 118. The kit of any one of paragraphs 115-117, wherein the kit further comprises a buffer for producing a reconstituted liquid composition. 119. The kit of any one of paragraphs 115 to 118, wherein the hypodermic injection device includes a needle and a syringe. 120. The kit of any one of paragraphs 115-119, wherein the subcutaneous syringe is a bolus syringe configured to deliver a predetermined amount of the composition subcutaneously. 121. The kit of any one of paragraphs 115-120, wherein the hyaluronidase enzyme is recombinant human hyaluronidase. 122. The kit of paragraph 121, wherein the hyaluronidase enzyme is rHuPH20. 123. The kit of any one of paragraphs 115 to 121, wherein the composition comprises a variant or fragment of the PH20 hyaluronidase enzyme. 124. A variant or fragment of PH20, (i) a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341G, S343E, M345T, K349E, L353A, L354I, N356E, and I361T in wild-type PH20 having the amino acid sequence of SEQ ID NO: 1; (ii) a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, L354I, and N356E; (iii) a substitution of one or more amino acid residues in a region corresponding to the alpha helix region or linker region of wild-type PH20 having the amino acid sequence of SEQ ID NO:1. 125. The kit of paragraph 124, wherein the α-helix region is an α-helix 8 region comprising amino acid residues S347 to C381, and the linker region is a linker region comprising amino acid residues A333 to R346 between α-helix 7 and α-helix 8. 126. The kit of paragraph 124, wherein the α-helical region and the linker region comprise amino acid residues T341 to N363, T341 to I361, L342 to I361, S343 to I361, I344 to I361, M345 to I361, or M345 to N363. 127. The kit according to paragraph 124, wherein the α-helix 8 region and the linker region between α-helix 7 and α-helix 8 are substituted with one or more amino acid residues from the corresponding regions of Hyal1. 128. The kit of paragraph 123, wherein the variant or fragment of PH20 comprises a substitution of one or more amino acid residues at one or more positions selected from the group consisting of T341, L342, S343, I344, M345, S347, M348, K349, L352, L353, D355, E359, I361, and N363. 129. A variant or fragment of PH20, (i) substitution of one or more amino acid residues of L354I and N356E; and a substitution of one or more amino acid residues selected from the group consisting of T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, D355K, E359D, I361T, and N363G; (ii) substitutions M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T; (iii) substitutions T341A, T341C, T341D, T341G, T341S, L342W, S343E, I344N, and N363G, or (iv) the following amino acid residue substitutions: (a) T341S, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (b) L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (c) M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, I361T, and N363G, (d) T341G, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (e) T341A, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (f) T341C, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (g) T341D, L342W, S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, (h) I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T, and 129. The kit of paragraph 128, comprising (i) a substitution of any one amino acid residue selected from S343E, I344N, M345T, S347T, M348K, K349E, L352Q, L353A, L354I, D355K, N356E, E359D, and I361T. 130. The kit of any one of paragraphs 123 to 129, wherein one or more of the N-terminal or C-terminal amino acid residues of the variant or fragment of PH20 are deleted. 131. The kit of paragraph 130, wherein the truncation is located before an amino acid residue selected from the group consisting of M1 to P42 at the N-terminus, such that one or more residues at the N-terminus are deleted. 132. Disconnection (i) located before the N-terminal amino acid residues L36, N37, F38, R39, A40, P41, or P42 such that one or more residues at the N-terminus are deleted; or (ii) located after an amino acid residue selected from the group consisting of V455 to L509 at the C-terminus, such that one or more amino acid residues at the C-terminus are deleted; or (iii) The kit of paragraph 131, wherein one or more amino acid residues at the C-terminus are deleted after an amino acid residue selected from V455, C458, D461, C464, I465, D466, A467, F468, K470, P471, P472, M473, E474, T475, E476, E477, P478, Q479, I480, F481, Y482, N483, A484, P486, T488, or S490 at the C-terminus. 133. A kit according to any one of paragraphs 123 to 132, comprising at its N-terminus a human growth hormone-derived signal peptide having the amino acid sequence of SEQ ID NO: 3 MATGSRTSLLLAFGLLCLPWLQEGSA, a human serum albumin-derived signal peptide having the amino acid sequence of SEQ ID NO: 4 MKWVTFISLLFLFSSAYS, or a human Hyal1-derived signal peptide having the amino acid sequence of SEQ ID NO: 5 MAAHLLPICALFLTLLDMAQG. 134. A variant or fragment of PH20, (i) a peptide having at least 90% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (ii) a peptide having at least 95% sequence identity with the amino acid sequence set forth in SEQ ID NO: 1 or amino acid residues 36 to 482, 36 to 477, 366 to 478, 36 to 479, 36 to 480, 36 to 481, and 36 to 483 of SEQ ID NO: 1; (iii) consisting of an amino acid sequence selected from SEQ ID NOs: 60 to 115; or (iv) The kit of any one of paragraphs 123 to 133, having the amino acid sequence of SEQ ID NO: 99. 135. The kit of any one of paragraphs 115 to 134, wherein the hyaluronidase is present in the composition in an amount of 100 U to 50,000 U. 136. The kit of any one of paragraphs 115 to 135, wherein the hyaluronidase is present in the composition in an amount of 100 U / mL to 50,000 U / mL. 137. The kit of any one of paragraphs 115 to 136, wherein the composition further comprises one or more pharmaceutically acceptable excipients. 138. The kit of any one of paragraphs 115-137, wherein the composition further comprises one or more sugars. 139. The kit of paragraph 138, wherein the one or more sugars comprise monosaccharides. 140. The kit of paragraph 138 or 139, wherein the one or more saccharides comprises a polysaccharide. 141. The kit of paragraph 140, wherein the one or more polysaccharides are selected from the group consisting of trehalose and sucrose. 142. The kit of paragraph 140 or 141, wherein the one or more polysaccharides are present in the composition in an amount of 10 mM to 500 mM, optionally in an amount of 100 mM to 300 mM. 143. The kit of any one of paragraphs 115-142, wherein the composition further comprises one or more amino acids. 144. The kit of paragraph 143, wherein the composition comprises methionine. 145. The kit of paragraph 143 or 144, wherein the one or more amino acids are present in the composition in an amount between 1 mM and 100 mM, optionally between 1 mM and 50 mM. 146. The kit of any one of paragraphs 115-145, wherein the composition further comprises a buffer. 147. The kit of paragraph 146, wherein the buffer is present in the composition in an amount sufficient to maintain the composition at a pH of 3.0 to 9.0, and optionally in an amount sufficient to maintain the composition at a pH of 5.5 to 7.5. 148. The kit of paragraph 146 or 147, wherein the buffer is present in the composition in an amount of 1 to 100 mM, optionally in an amount of 1 mM to 50 mM. 149. The kit of any one of paragraphs 146-148, wherein the buffer comprises histidine. 150. The kit of any one of paragraphs 115-149, wherein the telomerase inhibitor oligonucleotide comprises at least one N3'→P5' thiophosphoramidate internucleoside linkage. 151. The kit of any one of paragraphs 115 to 150, wherein the lipid moiety of the telomerase inhibitor is attached to the 5' and / or 3' end of the oligonucleotide via a linker. 152. The kit according to paragraph 151, wherein the linker is a glycerol or aminoglycerol linker. 153. The kit of any one of paragraphs 115-152, wherein the lipid moiety of the telomerase inhibitor is a palmitoyl (C16) moiety. 154. The kit of any one of paragraphs 115 to 153, wherein the telomerase inhibitor is imetelstat or a pharmaceutically acceptable salt thereof, optionally imetelstat sodium. 155. The telomerase inhibitor is contained in the composition: (i) about 2.0 mg / kg to 20.0 mg / kg, (ii) about 3 mg / kg to about 15 mg / kg, (iii) about 9 mg / kg to about 11 mg / kg, or (iv) The kit of any one of paragraphs 115 to 154, wherein the kit is present in a dosage of about 11 mg / kg to about 14 mg / kg. 156. The telomerase inhibitor is contained in the composition: (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The kit of any one of paragraphs 115 to 154, wherein the kit is present in a dosage of from about 500 mg to about 2000 mg. 157. The telomerase inhibitor is contained in the composition: (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The composition of any one of paragraphs 1 to 40, wherein the composition is present in a dosage of from about 500 mg to about 2000 mg. 158. The telomerase inhibitor is contained in the composition: (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) the method of any one of paragraphs 43 to 47, wherein the compound is present in a dosage of from about 500 mg to about 2000 mg. 159. The telomerase inhibitor is contained in the composition: (i) Approximately 200mg to 3000mg, (ii) about 750mg to about 2500mg, (iii) about 1000 mg to about 2000 mg, or (iv) The method of any one of paragraphs 81 to 112, wherein the compound is present in a dosage of from about 500 mg to about 2000 mg.

Claims

[Claim 1] The invention described in the specification.

Images