Bremia lactucae resistance SG01

The SG01 lettuce plant, with a dominant Bremia resistance trait from Lactuca serriola, addresses the rapid loss of race-specific resistance by using specific SNP markers on chromosome 2, offering enhanced and durable resistance to Bremia lactucae.

JP2026063356AActive Publication Date: 2026-04-10SYNGENTA CROP PROTECITON AG
View PDF 6 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-01-23
Publication Date
2026-04-10

AI Technical Summary

Technical Problem

The high variability of Bremia lactucae, a fungal pathogen, leads to rapid loss of race-specific resistance in cultivated lettuce, necessitating a broad and durable resistance mechanism.

Method used

A novel lettuce plant, designated SG01, with a dominant Bremia resistance trait conferred by a gene transfer sequence from Lactuca serriola, providing enhanced resistance through specific SNP markers on chromosome 2, including SL1831, SL1847, SL1887, and SL1883.

Benefits of technology

The SG01 lettuce plant offers improved resistance to Bremia lactucae, delaying the loss of resistance against emerging races and providing a broader range of protection, enhancing economic and commercial efficiency in cultivation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026063356000001
    Figure 2026063356000001
  • Figure 2026063356000002
    Figure 2026063356000002
  • Figure 2026063356000003
    Figure 2026063356000003
Patent Text Reader

Abstract

To provide novel lettuce plants, etc., that exhibit resistance to Bremia lactucae. [Solution] Providing a novel lettuce plant exhibiting resistance to Bremia lactucae, seeds and parts of the plant, such as leaves and flower heads, methods for producing and using such seeds and plants, and a novel gene sequence associated with the resistance to Bremia lactucae and a molecular marker associated with the novel gene sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a novel lettuce plant that exhibits resistance to Bremia lactucae. The present invention also relates to seeds and parts of said plants, such as leaves and capitula. The present invention further relates to methods for creating and using such seeds and plants. The present invention also relates to novel gene sequences associated with said resistance to Bremia lactucae and molecular markers associated with said novel gene sequences.

Background Art

[0002] Plant pathogens are known to cause significant damage to important crops and to result in notable agricultural losses that widely affect both food supply and other industries that depend on plant materials. Therefore, there has long been a need to reduce the occurrence and / or impact of agricultural pests on crop production.

[0003] An example of such a pathogen is Bremia lactucae, a fungus that causes downy mildew. B. lactucae occurs worldwide and represents a major problem for both the yield and quality of cultivated lettuce (Lactuca sativa). This fungus can infect lettuce plants at any stage of growth, after which the initial symptoms of downy mildew become visible as chlorotic yellow spots on the leaf surface. Within 24 to 48 hours, the growth of white, cottony fungus becomes visible on the underside of the leaf as a sign of sporulation. During infection, the lesions grow larger and the chlorosis progresses until the leaf becomes completely brown.

[0004] Bremia lactucae belongs to the Oomycetes group, a relatively primitive fungal classification. Other species in this group include, for example, the genera Pythium and Phytophthora. B. lactucae is an extremely diverse pathogen, containing different physiological species ("physios"), and is also host-specific. New physios arise relatively frequently through mutations in non-pathogenic genes during spore formation, which precedes the proliferation of B. lactucae.

[0005] In the genus Lactucae, to which cultivated lettuce (L. sativa) belongs, resistance to B. lactucae is widely known. These resistances are generally race-specific and based on qualitative genes known as Dm (downy mildew) resistance genes. The resistance mechanism is known to be a gene-versus-gene mechanism based on specific interactions (HR reactions) between the products of the Dm resistance gene and the pathogen-specific non-pathogenic gene that confer resistance to lettuce plants.

[0006] Due to the high variability of B. lactucae and the frequent emergence of new physiosids, race-specific resistance mediated by various Dm resistance genes may be quickly lost to newly emerging physiosids of Bremia pathogens. [Overview of the Initiative] [Problems that the invention aims to solve]

[0007] This represents a novel resistance to the fungal pathogen Bremia lactucae, and there remains a continuing demand for broad resistance to this fungal pathogen in particular. [Means for solving the problem]

[0008] The present invention addresses the need for additional, improved resistance to Bremia lactucae by providing a novel lettuce plant having a Bremia resistance trait designated as "SG01," as well as its parts and seeds. Nucleic acid markers for identifying and generating Bremia-resistant lettuce plants (e.g., L. sativa plants), as well as their parts and seeds, are also provided. In certain embodiments, the present invention discloses a novel source of Bremia resistance: CGN23091, a wild Lactuca serriola strain. Qualitative Bremia resistance was conferred to cultivated lettuce plants (e.g., L. sativa) by gene transfer of a Bremia resistance-constituting sequence from the wild source into cultivated lettuce plants. The gene transfer sequence for conferring Bremia resistance, located on chromosome 2, is dominant; therefore, a single copy of this sequence yields the Bremia resistance phenotype.

[0009] Overall, the characteristics of Bremia-resistant lettuce plants disclosed in this invention provide lettuce growers with a novel solution that enhances economic and commercial efficiency when deploying lettuce varieties in fields under pressure from Bremia. Furthermore, as is well understood by those skilled in the art, novel Bremia resistance can be stacked with other Bremia resistances in a single plant, providing an improved resistance range against multiple races / isoleads, offering protection against newly emerging races / isoleads, and delaying the loss of existing Bremia resistance.

[0010] In a first embodiment, the present invention provides a Bremia lactucae-resistant lettuce plant (e.g., a cultivated lettuce plant such as Lactuca sativa) containing a gene transfer sequence derived from Lactuca serriola that confers qualitative and dominant resistance to Bremia lactucae, wherein the gene transfer sequence is contained in Lactuca serriola strain CGN23091 or Lactuca sativa strain 18LEN002364, and the gene transfer sequence is located on chromosome 2 and contains the following SNP marker: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 Includes one or more of the following.

[0011] In a further embodiment, the present invention provides a lettuce plant (e.g., a cultivated lettuce plant such as Lactuca sativa) having enhanced resistance to Bremia lactucae, comprising a gene transfer sequence derived from Lactuca serriola that confers qualitative and dominant resistance to Bremia lactucae, wherein the gene transfer sequence is contained in Lactuca serriola strain CGN23091 or Lactuca sativa strain 18LEN002364, the gene transfer sequence is located on chromosome 2, and has the following SNP marker: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 The plants contain one or more of the above, and the resistance of the lettuce plants to B. lactucae is enhanced compared to control lettuce plants (e.g., lettuce (L. sativa) plants) that do not contain the gene transfer sequence.

[0012] In a typical embodiment, a) The G genotype of marker SL1831 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 2) and reverse primer (SEQ ID NO: 5) and probe (SEQ ID NO: 3); b) The A genotype of the SNP marker SL1847 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 10) and probe (SEQ ID NO: 8); c) The G genotype of the SNP marker SL1887 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primers of SEQ ID NO: 12 and reverse primers of SEQ ID NO: 15, and probe of SEQ ID NO: 13; and d) The C genotype of the SNP marker SL1883 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 17) and reverse primer (SEQ ID NO: 20) and probe (SEQ ID NO: 18).

[0013] In an embodiment, the plant according to the present invention is a cultivated plant.

[0014] In an embodiment, the gene transfer sequence of the present invention includes one or more sequences of Sequence ID No. 1 having a resistance marker allele represented by nucleotide G at position 112, Sequence ID No. 6 having a resistance marker allele represented by nucleotide A at position 112, Sequence ID No. 11 having a resistance marker allele represented by nucleotide G at position 99 and / or Sequence ID No. 16 having a resistance marker allele represented by nucleotide C at position 41, or one or more of the aforementioned sequences, which are identical by at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, and which include a resistance marker allele.

[0015] In embodiments, the plant according to the present invention is heterozygous for one or more SNP markers (for example, heterozygous for gene transfer sequences and SG01 Bremia resistance).

[0016] In embodiments, the plant according to the present invention is homozygous for one or more SNP markers (for example, homozygous for gene transfer sequences and SG01 Bremia resistance).

[0017] In embodiments, the plant according to the present invention contains two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883 (each in a heterozygous or homozygous form).

[0018] In a typical embodiment, the plant according to the present invention includes at least the following SNP markers (either or both heterozygous or homozygous markers): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; ·SL1847 and SL1887; or SL1883 and SL1887.

[0019] For example, markers SL1883 and SL1887 can be used together, and optionally other markers can be added. As another example, markers SL1847 and SL1887 can be used in combination, and optionally other markers can be added.

[0020] In an embodiment, the transgene sequence of the present invention confers resistance to at least Bremia lactucae race Bl 16-36EU.

[0021] In an embodiment, a plant according to the present invention is obtained by crossing Lactuca serriola line CGN23091 or lettuce 18LEN002364 with a second lettuce plant that does not contain the transgene sequence conferring resistance to Bremia lactucae (for example, does not contain SG01 Bremia resistance).

[0022] In an embodiment, a plant according to the present invention is an inbred line, a di-genomic haploid or a hybrid plant. Generally, the plants of the present invention are diploid.

[0023] As a further aspect, the present invention provides a plant of lettuce (Lactuca sativa) line 18LEN002364.

[0024] Without being particularly limited thereto, a plant part, organ or tissue obtained from a lettuce plant according to any of the embodiments described herein, including a head, leaf, core, stem, root, flower or flower part, shoot, gametophyte, sporophyte, pollen, anther, microspore, egg cell, zygote, embryo, growth region, callus tissue, seed, cutting, cell or tissue culture or any other part or product of a plant, including a transgene sequence. In an embodiment, the plant part, organ or tissue exhibits Bremia resistance according to the present invention, particularly when grown into a lettuce plant that yields lettuce leaves and / or heads.

[0025] Seeds for producing plants according to the present invention are further provided.

[0026] Seeds produced by plants according to the present invention are further provided.

[0027] In other embodiments, the use of a lettuce plant, plant part, or seeds according to any embodiment of the present invention for producing and harvesting lettuce flower heads and / or leaves is considered.

[0028] In other embodiments, the present invention relates to the use of lettuce plants, plant parts (e.g., flower heads or leaves) or seeds according to any of the embodiments described herein to obtain further lettuce plants, plant parts or seeds having Bremia resistance according to the present invention.

[0029] In other embodiments, the present invention relates to the use of a lettuce plant, plant part, or seed according to any embodiment of the present invention, wherein the lettuce plant, plant part, or seed is lettuce (L. sativa) 18LEN002364 or its descendants or ancestors.

[0030] In a further embodiment, the present invention relates to the use of a lettuce plant, plant part, or seed according to any embodiment of the present invention, wherein the lettuce plant, plant part, or seed is the spiny lettuce (L. serriola) strain CGN23091 or its descendants or ancestors.

[0031] In another embodiment, the present invention provides a method for producing lettuce plants that are resistant to Bremia lactucae and have enhanced resistance (e.g., compared to a control plant), the method being: a) A step of producing offspring plants by crossing a lettuce plant according to the present invention with a second lettuce plant that does not contain the gene transfer sequence that confers resistance to Bremia lactucae; b) A step of selecting offspring plants containing the gene transfer sequence that confers resistance to Bremia lactucae, the following SNP markers: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes of heterozygous or homozygous states relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A step including detecting one or more of the following (for example, by genotyping) It contains, thereby producing plants with enhanced resistance to Bremia lactucae.

[0032] Optionally, this method is, c) A step in which the selected offspring are allowed to self-distribute, or the selected offspring plants are crossbred with another lettuce plant to produce further offspring. This further includes the following. In embodiments, further offspring are selected and self-pollinate / cross-bred over 2 to more than 10 generations.

[0033] In an embodiment, the selecting step in b) includes detecting two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883 (e.g., by genotyping). Optionally, the selecting step includes at least the following SNP markers (either or both of heterozygous or homozygous forms): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; ·SL1847 and SL1887; or • SL1883 and SL1887 The step includes detecting [something].

[0034] In this embodiment, markers SL1883 and SL1887 can be used together, and other markers can be added as desired. As another example, markers SL1847 and SL1887 can be used in combination, and other markers can be added as desired.

[0035] In this embodiment, the first and / or second lettuce plant is a lettuce (L. sativa) plant.

[0036] Further embodiments provide a method for producing lettuce plants with enhanced resistance to Bremia lactucae (e.g., compared to a control plant), the method being: a) A step of producing offspring plants by crossing a plant of the spiny lettuce (Lactuca serriola) strain CGN23091 with a second lettuce plant (e.g., a lettuce (L. sativa) plant) that does not contain a gene transfer sequence derived from the spiny lettuce (L. serriola) strain CGN23091 that confers resistance to Bremia lactucae; b) A step of selecting offspring plants that confer resistance to Bremia lactucae, comprising a gene transfer on chromosome 2 from the L. serriola strain CGN23091, wherein the following SNP markers: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes of heterozygous or homozygous states relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A step including detecting one or more of the following (for example, by genotyping) The process includes the step of including a lettuce plant that is resistant to Bremia lactucae.

[0037] Optionally, this method is, c) The step of allowing the selected offspring plants to self-distribute, or crossing the selected offspring with another lettuce plant (e.g., lettuce (L. sativa) plant) to produce further offspring. This further includes the following. In embodiments, further offspring are selected and self-pollinate / cross-bred over 2 to more than 10 generations.

[0038] In an embodiment, the selecting step in b) includes detecting two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883 (e.g., by genotyping). Optionally, the selecting step includes at least the following SNP markers (either or both of heterozygous or homozygous forms): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; ·SL1847 and SL1887; or • SL1883 and SL1887 The step includes detecting [something].

[0039] In this embodiment, markers SL1883 and SL1887 can be used together, and other markers can be added as desired. As another example, markers SL1847 and SL1887 can be used in combination, and other markers can be added as desired.

[0040] In a further embodiment, the present invention provides a method for producing F1 hybrid lettuce plants having enhanced resistance to Bremia lactucae (e.g., compared to a control plant), the method comprising the step of crossing a plant according to the present invention, which is an inbred lettuce plant (e.g., lettuce (Lactuca sativa)), with a different inbred lettuce plant (e.g., lettuce (L. sativa)) to produce F1 hybrid lettuce offspring. According to the method, the second inbred lettuce plant may or may not contain a gene transfer sequence according to the present invention that confers Bremia resistance.

[0041] In embodiments, the present invention provides a method for identifying lettuce plants (e.g., lettuce (L. sativa) plants) that have enhanced resistance to Bremia lactucae (e.g., compared to a control plant), the method comprising the following SNP markers: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 The process includes a step of detecting one or more of the following (for example, by genotyping): identifying lettuce plants that have enhanced resistance to Bremia lactucae.

[0042] In embodiments, the method described above further includes the steps of selecting a lettuce plant containing one or more SNP markers, and crossing the selected lettuce plant with a second lettuce plant (e.g., a lettuce (L. sativa) plant) which may be the same or different lettuce plant, to produce offspring lettuce plants containing one or more molecular markers and having enhanced resistance to Bremia lactucae. In embodiments, the detection step includes detecting two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1887, and / or SL1883 by genotyping. Optionally, the detection step includes detecting at least the following SNP markers (either or both of heterozygous or homozygous forms of markers): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; ·SL1847 and SL1887; or • SL1883 and SL1887 The step includes detecting [something].

[0043] In this embodiment, markers SL1883 and SL1887 can be used together, and other markers can be added as desired. As another example, markers SL1847 and SL1887 can be used in combination, and other markers can be added as desired.

[0044] In yet another embodiment, the present invention provides a method for producing lettuce seeds (for example, lettuce (L. sativa) seeds), the method comprising the steps of growing a lettuce plant from seeds according to the present invention, causing the plant to produce further lettuce seeds, and optionally, collecting further lettuce seeds.

[0045] In other embodiments, the present invention relates to a method for providing a lettuce plant, plant part (e.g., leaves and / or flower heads) or seeds having enhanced resistance to the genus Bremia, wherein the method is: a) A step of crossing a first lettuce plant (e.g., a lettuce (L.sativa) plant) that does not contain the Bremia resistance-conferring gene transfer sequence of the present invention with a second lettuce plant (e.g., a lettuce (L.sativa) plant) according to any embodiment of the present invention, b) Steps to obtain offspring lettuce plants, c) Optionally, the step of selecting the offspring plants characterized by exhibiting enhanced resistance to the genus Bremia. Includes.

[0046] According to the embodiments described above, the second lettuce plant may optionally be a plant of the spiny lettuce (L. serriola) strain CGN23091 or lettuce (L. sativa) 18LEN002364 or its descendants or ancestors.

[0047] In another embodiment, the present invention relates to a method for identifying a lettuce plant (e.g., a lettuce (L. sativa) plant) containing the Bremia resistance-constituting gene transfer sequence of the present invention, wherein the method is a) Providing a segregated population of lettuce (e.g., lettuce (L. sativa)) relating to the Bremia genus resistance trait; b) A step of screening a segregation of plants exhibiting resistance to the genus Bremia, wherein the resistance trait can be identified by the presence of the Bremia resistance-constituting gene transfer sequence of the present invention; c) A step of selecting a plant from a segregated population, wherein the plant includes the Bremia resistant trait, and Includes.

[0048] These and other aspects of the present invention will be described in more detail below. [Modes for carrying out the invention]

[0049] This description is not intended to be a detailed catalog of all different ways in which the present invention can be carried out or all features that may be added to the present invention. For example, features illustrated in one embodiment may be incorporated into other embodiments, and features illustrated in a particular embodiment may be omitted from that embodiment. Thus, it is anticipated that in some embodiments of the present invention, any or combination of features defined herein may be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be obvious to those skilled in the art from the viewpoint of this disclosure and will not depart from the present invention. Accordingly, the following description is intended to illustrate some specific embodiments of the present invention and not to exhaustively define all permutations, combinations and variations thereof.

[0050] All publications, patent applications, patents, and other documents cited herein are incorporated by reference in their entirety with respect to the teachings relating to the texts and / or paragraphs in which the references are presented.

[0051] The nucleotide sequences provided herein are shown from left to right in a 5' to 3' direction and are represented using standard codes for nucleotide bases as defined in Sections 1.821–1.825 of the U.S. Patent Law Enforcement Regulations and World Intellectual Property Organization (WIPO) Standard ST.25 (e.g., adenine (A), cytosine (C), thymine (T), and guanine (G)).

[0052] Amino acids are similarly denoted using WIPO standard ST.25, for example, alanine (Ala;A), arginine (Arg;R), asparagine (Asn;N), aspartic acid (Asp;D), cysteine ​​(Cys;C), glutamine (Gln;Q), glutamic acid (Glu;E), glycine (Gly;G), histidine (His;H), isoleucine (Ile;1), leucine (Leu;L), lysine (Lys;K), methionine (Met;M), phenylalanine (Phe;F), proline (Pro;P), serine (Ser;S), threonine (Thr;T), tryptophan (Trp;W), tyrosine (Tyr;Y), and valine (Val;V).

[0053] Unless otherwise stated in the context, the various features of the present invention described herein are particularly intended to be usable in any combination. Furthermore, it is anticipated that in some embodiments of the present invention, any feature or combination of features defined herein may be excluded or omitted. For illustrative purposes, where a composition is defined herein as comprising components A, B, and C, it is particularly intended that A, B, C, or any combination thereof may be omitted and discarded individually or in any combination.

[0054] definition The technical terms and expressions used within the scope of this application should generally be given the meanings that apply to them in the arts related to plant breeding and cultivation, unless otherwise specifically indicated herein.

[0055] As used herein and in the appended claims, the singular forms “a,” “an,” and “it” include multiple referents unless otherwise specified in the context. Thus, for example, a reference to “plant” includes one or more plants, and a reference to “cell” includes a mixture of cells, tissues, etc.

[0056] Where used herein, the term “about” means, when referring to a quantity, weight, time, volume, concentration, or percentage of a value or mass, to include variations from a particular quantity of ±20%, ±10%, ±5%, ±1%, ±0.5%, and ±0.1% in some embodiments (as such variations are appropriate for carrying out the methods of the disclosure).

[0057] As used herein, the term "lettuce" refers to, but is not limited to, any plant belonging to the genus Lactuca, including, but not limited to, lettuce (L. sativa), L. saligna, wild lettuce (L. virosa), and spiny lettuce (L. serriola). In embodiments, the lettuce plant is lettuce (L. sativa). In embodiments, the lettuce plant is a cultivated variety.

[0058] Within the scope of this invention, "cultivated lettuce" plants refer to plants that no longer exist in their natural state and have been developed and cultivated by humans for agricultural use and / or human consumption, and wild lettuce varieties such as the spiny lettuce (L. serriola) variety CGN23091 are understood to be excluded. As an example, in embodiments, the stems and / or leaves of cultivated lettuce plants are spineless and have closed flowers. Alternatively or additionally, cultivated lettuce plants are hybrid plants. Alternatively or additionally, cultivated lettuce plants are lettuce (L. sativa) plants. In relation to interspecific hybridization between lettuce (L. sativa) plants and wild lettuce species, the offspring plants of the interspecific hybridization are considered "cultivated lettuce" plants if the offspring plants have been backcrossed with lettuce (L. sativa) plants at least three times.

[0059] Within the scope of this invention, "allele" is understood to refer to a substitute or variant of a gene or other genetic element. Such substitutes or variants may result from single nucleotide polymorphisms, insertions, inversions, translocations, or deletions, or from gene regulation caused, for example, by chemical or structural modifications, transcriptional regulation, or post-translational modification / regulation. In diploid cells or organisms, two alleles of a given gene or genetic element typically occupy corresponding loci on a pair of homologous chromosomes.

[0060] "Bremia lactucae". An oomycete that causes downy mildew in lettuce, especially in cold growing regions.

[0061] As used herein, the terms “resistance” and “resistant” (and similar terms) refer to the ability of a plant to limit the growth and occurrence of a particular pathogen and / or damage caused by the pathogen, compared to a susceptible plant under similar environmental conditions and pathogenic pressure. Resistance may be qualitative or quantitative. In embodiments, a “resistant” plant exhibits reduced, substantially no, or even no symptoms in response to a particular pathogen. In some embodiments, a “resistant” plant exhibits some symptoms but is capable of producing a marketable product at an acceptable yield, which may be lower than, for example, the yield and / or growth in the absence of the pathogen, and / or the plant may be stunted. In embodiments, the lettuce plant according to the present invention is at least resistant to Bremia lactucae race Bl 16-36EU, characterized and classified according to the SEXTET code by the International Bremia Evaluation Board (IBEB). In embodiments, the Bremia-resistant lettuce plants of the present invention, for example, when any Bremia race Bl 16-36EU is sown, show no or little necrosis with no or little spore formation under standard test conditions such as the test conditions defined in Example 1 below. In embodiments, the Bremia resistance of the present invention is dominant. In embodiments, the Bremia resistance is qualitative. In embodiments, the Bremia resistance of the present invention exhibits monosexual inheritance.

[0062] The term “enhanced Bremia resistance” (and similar terms) is understood herein to mean that a plant is more resistant to at least one Bremia race or isolate (e.g., a statistically significant improvement in Bremia resistance compared to a control lettuce plant without the gene transfer sequence of the present invention, using Student’s test, p<0.1, p<0.05, or p<0.01) and / or has a broader range of Bremia resistance compared to a control lettuce plant without the gene transfer sequence of the present invention (e.g., resistance to one or more additional Bremia races / isotope). In embodiments, “enhanced Bremia resistance” refers to providing additional resistance to one or more Bremia races or isolates that the plant may have already had (i.e., resistance stacking), thereby reducing the risk of Bremia resistance being broken compared to a plant without the gene transfer sequence (i.e., as a form of resistance management).

[0063] Within the scope of the present invention, "control lettuce plant" is understood to mean a lettuce plant of the same species as the lettuce plant of the present invention (e.g., lettuce (L. sativa)) and that does not contain the gene transfer sequence of the present invention associated with Bremia resistance (e.g., one of the parent lettuce plants that does not contain the gene transfer sequence of the present invention). In embodiments, the control lettuce plant is a plant belonging to the same plant variety that has the same genetic background as the lettuce plant of the present invention and optionally does not contain the gene transfer sequence of the present invention. In this specification, plant variety is understood according to the definition of UPOV. Therefore, the control lettuce plant may be a near-isogenic line, an inbred line, or a hybrid, but has the same genetic background as the lettuce plant of the present invention, except that the control plant does not contain the gene transfer sequence of the present invention associated with Bremia resistance. The control lettuce plant is cultivated for the same period and under the same conditions as the lettuce plant of the present invention.

[0064] The term "trait" refers to a characteristic or phenotype (e.g., disease resistance such as Bremia resistance). Traits can be dominant or recessive, or partially or incompletely dominant. In relation to the present invention, Bremia resistance is a dominant trait. The lettuce plants of the present invention may therefore be homozygous or heterozygous for the trait. Furthermore, the trait may be monogenic or polygenic, or may result from the interaction of one or more genes with the environment. In relation to the present invention, the Bremia resistance-constituting gene transfer sequence located on chromosome 2 exhibits monosexual inheritance and is sufficient to confer the Bremia resistance trait.

[0065] The terms "hybrid," "hybrid plant," and "hybrid offspring" refer to individuals produced from genetically different parents (for example, individuals that are genetically heterozygous or nearly heterozygous).

[0066] The term "inbred line" refers to a population that is genetically homozygous or nearly homozygous. Inbred lines can be obtained, for example, through several cycles of sibling breeding or self-pollination, or by digenomic haploid generation.

[0067] The term "dicogeneic haploid lineage" refers to a stable inbred lineage derived from another culture. Several pollen grains (haploids) cultivated in a specific culture medium and environment can develop embryos containing n chromosomes. These embryos are then "doubled," containing 2n chromosomes. The offspring of these embryos are called "dicogeneic haploids" and are essentially no longer segregated (stable).

[0068] The terms "cultivar" or "variety" refer to varieties created for horticultural purposes, distinct from wild varieties. In one embodiment of the present invention, the cultivar or variety is commercially available.

[0069] The term "genetically fixed" refers to genetic elements that are stably incorporated into the genome of plants that do not normally contain genetic elements. When genetically fixed, genetic elements can be transmitted to other plants in an easily predictable manner through sexual mating.

[0070] The terms "plant" or "plant part" in this specification refer to, but are not limited to, plant parts, organs, or tissues obtained from a plant according to the present invention, including leaves, stems, roots, flowers or flower parts, fruits, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, growth regions, callus tissue, seeds, cuttings, capitulums, cores, cell or tissue cultures (including callus cultures), or any other part or product of a plant. In embodiments, the plant part includes the gene transfer sequence of the present invention. In embodiments, the plant part exhibits the Bremia genus tolerance trait according to the present invention, particularly when grown into a plant producing lettuce leaves and / or capitulums.

[0071] "Plant" refers to any plant at any stage of development.

[0072] A plant "seed" is a seed that will grow into a plant as described in any of the embodiments.

[0073] A "plant cell" is a structural and physiological unit of a plant, including its protoplast and cell wall. A plant cell may be in the form of an isolated single cell or a cultured cell, or it may be part of a more organized unit, such as plant tissue, a plant organ, or the entire plant.

[0074] "Plant cell cultures" refer to cultures of plant units such as protoplasts, cultured cells, cells in plant tissue, pollen, pollen tubes, embryo strains, embryo sacs, zygotes, and embryos at various developmental stages.

[0075] "Plant organs" are distinct, visually structured, differentiated parts of a plant, such as roots, stems, leaves, flower buds, or embryos.

[0076] As used herein, “plant tissue” means a group of plant cells organized into structural and functional units. This includes any plant tissue in a plant or culture. The term includes, but is not limited to, whole plants, plant organs, plant seeds, tissue cultures, and any group of plant cells organized into structural and / or functional units. The use of this term, in conjunction with or without any particular type of plant tissue listed above or encompassed by this definition, is not intended to exclude any other type of plant tissue.

[0077] Within the scope of this invention, "processed food" is understood to mean food that has been altered from its natural state. Methods used to process food include, but are not limited to, cutting, slicing, dicing, polishing, canning, freezing, refrigeration, dehydration, heating, and preservation.

[0078] Within the scope of this invention, "fresh cut market" is understood to mean vegetables that have been processed to the minimum extent possible in the market.

[0079] As used herein, the terms “marker allele” or “allele of a marker locus” (and similar terms) refer to alleles at polymorphic loci (as defined herein) used as markers to locate and / or indicate the presence of one or more genetically related loci (e.g., the Bremia resistance locus) that contribute to the variability of a phenotypic trait.

[0080] As used herein, “marker locus” refers to a region in a chromosome containing a nucleotide or polynucleotide sequence that is genetically associated with one or more loci of interest that are present in the genome of an organism and may contain genes that contribute to a trait or any other genetic determinants or factors. “Marker locus” also refers to a region in a chromosome containing a polynucleotide sequence that is complementary to a genomic sequence, such as a nucleic acid sequence used as a probe. Marker loci can be used, for example, to track the presence of a second linked locus, such as a linked locus that codes for or contributes to the expression of a phenotypic trait. For example, marker loci can be used to monitor allele segregation at a locus, such as a QTL or a single gene that is genetically or physically associated with the marker locus.

[0081] As used herein, the term “breeding” and its grammatical variations refer to any process that produces offspring individuals. Breeding can be sexual, asexual, or any combination thereof. Exemplary, non-limiting types of breeding include crossbreeding, self-pollination, derivative production of doubling haploids, and combinations thereof.

[0082] As used herein, the term “established breeding population” refers to a set of potential breeding partners generated by and / or used as parents in a breeding program, such as a commercial breeding program. Members of an established breeding population are typically well-characterized genetically and / or phenotypically. For example, several phenotypic traits of interest may be evaluated, for example, under different environmental conditions, in multiple locations, and / or at different times. Alternatively or in addition, one or more loci associated with the expression of phenotypic traits may be identified, and one or more members of the breeding population may be genotyped with respect to one or more loci and one or more genetic markers associated with one or more loci.

[0083] As used herein, the term “diploid” plant refers to a plant having two sets of chromosomes, typically one from each of its two parents. However, in some embodiments, it is understood that a diploid plant may inherit its “mother” and “father” sets of chromosomes from the same single organism, for example, when the plant self-pollinates to produce the next generation of the plant.

[0084] Within the scope of this invention, "homozygous" is understood to refer to similar alleles at one or more corresponding gene loci on homologous chromosomes.

[0085] Within the scope of this invention, "heterozygous" is understood to refer to different alleles at one or more corresponding gene loci on homologous chromosomes.

[0086] Within the scope of this invention, the "dominant" allele is understood to refer to the allele that determines the phenotype when present in a heterozygous or homozygous state.

[0087] A "recessive" allele refers to an allele that determines the phenotype only when present in a homozygous state.

[0088] Within the scope of this invention, "backcrossing" is understood to refer to the process by which the offspring of a hybrid are repeatedly crossed with one of the original parents (repeating parent). Different repeating parents may be used in subsequent backcrossings.

[0089] Within the scope of this invention, "gene locus" is understood to refer to a region on a chromosome that contains any other genetic element or factor contributing to a gene or trait.

[0090] Within the scope of this invention, "genetic linkage" is understood to refer to the relationship between traits in inheritance based on the location of adjacent genes on the same chromosome, as measured by the recombination rate between gene loci (centimorgan, cM).

[0091] For the purposes of this invention, the term "cosegregation" refers to the tendency for alleles for a trait and alleles for a marker to be transmitted together due to their physical proximity on the same chromosome (i.e., reduced recombination between them due to their physical proximity), resulting in non-random associations of the alleles as a result of these proximitys on the same chromosome. The term "associated" can be used interchangeably.

[0092] As used herein, the term “genetic structure at quantitative / qualitative trait loci” refers to a genomic region that is statistically correlated with and represents the underlying genetic basis of the phenotypic trait of interest.

[0093] As used herein, the terms “genetic marker” or “molecular marker” refer to genomic features of an individual associated with one or more loci of interest (e.g., nucleotide or polynucleotide sequences present in the individual’s genome). In some embodiments, a genetic marker is, depending on the context, a locus that is polymorphic or occupied by polymorphism in the population of interest. Examples of genetic markers include, among many others, single nucleotide polymorphisms (SNPs), indels (i.e., insertions / deletions), simple repeat sequences (SSRs), restriction fragment length polymorphisms (RFLPs), randomly amplified polymorphic DNA (RAPDs), cleavage-amplified polymorphic sequence (CAPS) markers, diversity array technology (DArT) markers, and amplified fragment length polymorphisms (AFLPs). Genetic markers can be used, for example, to locate loci containing alleles on a chromosome that contribute to phenotypic variability. The term “genetic marker” may also refer to polynucleotide sequences complementary to genomic sequences, such as nucleic acid sequences used as probes. In embodiments, the gene marker may be physically located on a chromosome at a position within or outside the associated gene locus (i.e., intragenetic or extragenetic, respectively).

[0094] As used herein, the term “genotype” refers to the genetic makeup of a cell or organism. An individual’s “genotype for a set of genetic markers” includes specific alleles for one or more genetic marker loci present in the individual’s haplotype. As is known in the art, a genotype may be associated with a single locus or multiple loci, whether the loci are related or not, and / or linked or unlinked. In some embodiments, an individual’s genotype is associated with one or more genes that are related in that one or more genes are involved in the expression of a phenotype of interest (e.g., a quantitative trait as defined herein). Thus, in some embodiments, a genotype includes one or more alleles present in the individual at one or more loci. In some embodiments, a genotype is expressed with respect to a haplotype (as also defined herein).

[0095] As used herein, the term “genetic resources” refers to the entirety of genotypes of a population or other population (e.g., a species). The term “genetic resources” may also refer to plant material, such as a group of plants that function as a repository of various alleles. The phrase “adapted genetic resources” refers to plant material for which genetic superiority has been demonstrated for a given environmental or geographical area, while the phrases “non-adapted genetic resources,” “proto-genetic resources,” and “foreign genetic resources” refer to plant material for which the genetic value for a given environmental or geographical area is unknown or has not been demonstrated. Accordingly, the phrase “non-adapted genetic resources” refers, in some embodiments, to plant material that is not part of an established breeding population and has no known relationship to members of an established breeding population.

[0096] A "haplotype" is an individual genotype at multiple loci, i.e., combinations of alleles. Typically, the loci that define a haplotype are physically and genetically related, i.e., multiple loci along the same chromosomal segment.

[0097] As used herein, the terms “gene transfer,” “gene transfer,” and “gene transfer” (and their grammatical variations) refer to both the natural and artificial transfer of a desired allele, or a desired allele containing one or more loci, from one genetic background to another. For example, a desired allele at a particular locus can be transferred to at least one offspring through sexual mating between two parents, with at least one parent having the desired allele in its genome (the “donor” parent). Alternatively, for example, allele transfer can occur, for example, by recombination between two donor genomes in a fused protoplasm, with at least one donor protoplasm having the desired allele in its genome. Offspring containing the desired allele can be repeatedly backcrossed with a recurrent parent to form a line that has the desired genetic background and is selected for the desired allele, thereby fixing the desired allele to the desired genetic background. For example, a marker associated with enhanced Bremia resistance can be transferred from a donor parent to a recurrent parent that does not contain the gene transfer sequence. The resulting offspring can be arbitrarily backcrossed with the recurrent parent, and selection is possible until the offspring have a gene transfer sequence in the background of the recurrent parent that confers Bremia resistance.

[0098] As used herein, the term “linkage” and its grammatical variations refer to the tendency of alleles to separate at different loci on the same chromosome at a higher frequency than would be unintentionally assumed if transmission were independent, and in some embodiments is a result of physical proximity.

[0099] As used herein, the term “nucleic acid” refers to any physical chain of monomeric units that can correspond to a chain of nucleotides, including polymers of nucleotides (e.g., typical DNA, cDNA, or RNA polymers), modified oligonucleotides (e.g., oligonucleotides containing bases not typical of biological RNA or DNA, such as 2'-O-methylated oligonucleotides), and so on. In some embodiments, nucleic acids may be single-stranded, double-stranded, multi-stranded, or a combination thereof. Unless otherwise specified, specific nucleic acid sequences of the subject matter of this disclosure may optionally include and / or encode sequences complementary to any explicitly shown sequence.

[0100] As used herein, the term “multiple” refers to two or more. Thus, “multiple individuals” refers to at least two individuals. In some embodiments, the term “multiple” refers to more than half of the whole. For example, in some embodiments, “multiple groups” refers to more than half of the members of those groups. These uses of the term “multiple” will be apparent to those skilled in the art depending on the context.

[0101] As used herein, the term “offspring” refers to the offspring of a particular cross. Typically, offspring result from the breeding of two individuals, although some species (particularly some plants and hermaphroditic animals) can self-pollinate (i.e., the same plant can act as a donor for both male and female gametes). Offspring can be of any generation, e.g., F1, F2, or any subsequent generation.

[0102] As used herein, the term “qualitative trait” refers to a phenotypic trait controlled by one or more genes that exhibit a primary phenotypic effect. Therefore, qualitative traits are typically simply inherited. Examples in plants, but not limited to, include flower color and numerous known disease resistances, such as the Bremia resistance described herein.

[0103] As used herein, the term “quantifiable trait” refers to a phenotypic trait that can be described numerically (i.e., quantified or measured). Quantifiable traits typically exhibit continuous variation among individuals in a population; that is, the numerical differences in phenotypic traits are small and stepwise relative to each other. Frequently, the frequency distribution of a quantitative phenotypic trait in a population exhibits a bell-shaped curve (i.e., a normal distribution between two extremes). “Quantifiable traits” are typically the result of a locus interacting with the environment, or of multiple loci interacting with each other and / or the environment. Examples of quantitative traits include plant height and yield.

[0104] As used herein, the terms “quantitative trait locus” (QTL) and “marker trait association” refer to an association between a genetic marker and a chromosomal region and / or gene that influences the phenotype of a trait of interest. Typically, this is determined statistically based on one or more methods published, for example, in the literature. A QTL may be a chromosomal region and / or locus that has at least two alleles that differently influence a phenotypic trait (either a quantitative or qualitative trait).

[0105] The term “recipient plant” is used herein to refer to a plant that receives DNA obtained from a donor plant containing a gene transfer sequence relating to a trait of interest (e.g., Bremia resistance). The “recipient plant” may or may not already contain one or more native or gene transfer sequences for Bremia resistance, in which case the term refers to a plant that receives additional gene transfer sequences at different loci.

[0106] The term “natural genetic background” is used herein to indicate the original genetic background of a gene sequence of interest. Such a genetic background may be, for example, the genome of a wild strain. For example, the gene sequence of the present invention was found at a specific location on chromosome 2 of the plant L. serriola. Conversely, in a method that includes, for example, breeding, the transfer of DNA containing this gene sequence from, for example, chromosome 2 of L. serriola to the same location on chromosome 2 of another lettuce species (e.g., L. sativa), the gene sequence would not be in a natural genetic background. When the gene sequence of the present invention is transferred from a L. serriola background to another lettuce species (e.g., L. sativa), these are referred to as “transferred gene sequences” or “transferred gene sequences” (or similar terms).

[0107] Within the scope of this invention, "donor plant" is understood to mean a plant that provides at least one sequence for enhanced Bremia resistance (i.e., a plant into which the gene is transferred to a recipient plant).

[0108] Within the scope of the present invention, “selection by markers” is understood to refer to the use of genetic markers that detect, for example, one or more nucleic acids of plant origin, where the nucleic acids are related to the desired trait so as to identify plants having alleles that confer the desired (or undesirable) trait, so that those plants can be used (or avoided) in a selective breeding program.

[0109] Single nucleotide polymorphisms (SNPs), which are mutations at a single site in DNA, are the most common type of genomic variation. SNPs are DNA sequence variations that occur when a single nucleotide (A, T, C, or G) in the genome (or other shared sequence) differs between members of a biological species or between paired chromosomes of individuals. For example, two sequenced DNA fragments from different individuals, AAGCCTA and AAGCTTA, contain a single nucleotide difference. In this case, there are two alleles: C and T. The basic principle of SNP arrays is the same as that of DNA microarrays. These are a combination of DNA hybridization, fluorescence microscopy, and DNA capture. The three components of an SNP array are an array containing nucleic acid sequences (e.g., amplified sequences or targets), one or more labeled allele-specific oligonucleotide probes, and a detection system that records and interprets the hybridization signal. The presence or absence of a desired allele can be determined, for example, by real-time PCR using double-stranded DNA dyes or fluorescent reporter probes.

[0110] Within the scope of this invention, "PCR (polymerase chain reaction)" is understood to refer to a method for generating a relatively large amount of a specific region or subset of DNA from a genome, thereby enabling various analyses based on those regions.

[0111] Within the scope of this invention, "PCR primer" is understood to refer to a relatively short fragment of single-stranded DNA used in PCR amplification of a specific region of DNA.

[0112] Within the scope of this invention, "phenotype" is understood to refer to a distinguishable characteristic of a genetically controlled trait.

[0113] As used herein, the term “phenotypic trait” refers to the physical appearance or other detectable characteristics of an individual resulting from the interaction of its genome, proteome, and / or metabolome with its environment.

[0114] Within the scope of this invention, "polymorphism" is understood to mean the existence of two or more different forms of genes, genetic markers, or inherited traits, or a population of gene products that can be obtained by, for example, alternative splicing or DNA methylation.

[0115] As used herein, “probe” refers to a group of atoms or molecules that can recognize and bind to a specific target molecule or cellular structure, thereby enabling the detection of the target molecule or structure. In embodiments, “probe” refers to a labeled DNA or RNA sequence that can be used to detect and quantify the presence of a complementary sequence by molecular hybridization.

[0116] Where used herein, the terms “sexual mating” and “sexual reproduction” refer to the fusion of gametes that produce offspring (e.g., by fertilization, such as the production of seeds by pollination in plants). “Sexual mating” or “hybridization” is, in some embodiments, the fertilization of one organism with another (e.g., cross-pollination in plants).

[0117] Within the scope of this invention, "selective breeding" is understood to refer to a breeding program that uses plants that possess or exhibit desirable traits as parents.

[0118] In some embodiments, the term "self-pollination" refers to the production of seeds by self-fertilization or self-pollination, i.e., the pollen and ovules originate from the same plant.

[0119] Within the scope of this invention, the “tester” plant is understood to refer to a plant of the genus Solanum used to genetically characterize traits in the plant being tested. Typically, the plant being tested is crossed with the “tester” plant, and the segregation ratio of traits in the offspring of the cross is scored.

[0120] As used herein, the term “hybridize” refers to conventional hybridization conditions, preferably using 5×SSPE, 1% SDS, and 1×Denhart solution as the solution, and / or a hybridization temperature of 35°C to 70°C, preferably 65°C. After hybridization, washing is preferably performed first with 2×SSC and 1% SDS, and then with 0.2×SSC, at a temperature of 35°C to 75°C, particularly 45°C to 65°C, but especially 59°C (see Sambrook et al. for definitions of SSPE, SSC, and Denhart solution). For example, the high-stringency hybridization conditions described in Sambrook et al. (above) are particularly preferred. Particularly preferred stringent hybridization conditions exist, for example, when hybridization and washing are performed at 65°C as shown above. For example, non-stringent hybridization conditions using hybridization and washing performed at 45°C are less preferable, and 35°C is even less preferable.

[0121] According to the present invention, the term "position corresponding to position X" (where X is any number found in the respective context of this application) includes not only each position in the sequence numbers described below, but also any sequence encoding the gene sequence of the present invention, and after alignment with the reference sequence number, each position may have a different but corresponding number to that shown for the reference sequence number. Gene sequence alignment can be performed by applying various alignment tools known to those skilled in the art.

[0122] "Stringent hybridization conditions" and "stringent hybridization washing conditions" for nucleic acid hybridization experiments, such as Southern and Northern hybridization, are sequence-dependent and differ under different environmental parameters. Longer sequences hybridize specifically at higher temperatures. Extensive guidelines for nucleic acid hybridization can be found in Tijssen (1993), Laboratory Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Acid Probes part I chapter 2, “Overview of principles of hybridization and the strategy of nucleic acid probe assays,” Elsevier, New York. Generally, highly stringent hybridization and washing conditions are selected so that the temperature is approximately 5°C below the thermal melting point for a particular sequence at specified ionic strength and pH. Typically, under "stringent conditions," a probe hybridizes to its target subsequence but not to other sequences.

[0123] The "thermal melting point" is the temperature at which 50% of the target sequence hybridizes to a probe that perfectly matches (at specified ionic strength and pH). Very stringent conditions are the melting temperature (T) of a particular probe. m) is selected to be equal to ). An example of stringent hybridization conditions for hybridization of complementary nucleic acids having more than 100 complementary residues on the filter in Southern or Northern blotting is 50% formamide containing 1 mg of heparin at 42°C, with hybridization performed overnight. An example of highly stringent washing conditions is 0.15 M NaCl at 72°C for about 15 minutes. An example of stringent washing conditions is a 0.2x SSC wash at 65°C for 15 minutes (see Sambrook (below) for a description of SSC buffer). Often, a low-stringency wash is performed to remove background probe signals before a high-stringency wash. For example, an example of a moderate-stringency wash for a double helix of more than 100 nucleotides is a 1x SSC at 45°C for 15 minutes. For example, a low-stringency wash for double hemispheres of more than 100 nucleotides is a 4-6x SSC at 40°C for 15 minutes. For short probes (e.g., about 10-50 nucleotides), stringent conditions typically involve a sodium ion salt concentration of less than about 1.0 M at pH 7.0-8.3, typically about 0.01-1.0 M (or other salt), and a temperature of at least about 30°C. Stringent conditions can also be achieved by adding destabilizers such as formamide. Generally, a signal-to-noise ratio of twice (or more) that is observed for an unrelated probe in a particular hybridization assay indicates the detection of a particular hybridization. Nucleic acids that do not hybridize to one another under stringent conditions remain substantially identical if the proteins they encode are substantially identical. This occurs, for example, when copies of nucleic acids are formed using the largest codon degeneracy permitted by the gene code.

[0124] plants, seeds and products. In a first embodiment, the present invention provides a lettuce plant (e.g., a lettuce (Lactuca sativa) plant) having enhanced resistance to Bremia lactucae (e.g., compared to a control plant), comprising a gene transfer sequence derived from Lactuca serriola that confers resistance to Bremia lactucae, wherein the gene transfer sequence is contained in a Lactuca serriola strain (e.g., catalog CGN23091) or a deposited Lactuca sativa strain 18LEN002364, and the gene transfer sequence is located on chromosome 2. In this embodiment, the resistance is qualitative resistance. In this embodiment, the resistance is qualitative resistance. In this embodiment, the resistance exhibits monosexual inheritance.

[0125] In embodiments, the plant of the present invention is a cultivated plant, optionally a cultivated lettuce (L. sativa) plant.

[0126] In this embodiment, the gene transfer sequence confers resistance to at least the Bremia lactucae race Bl 16-36EU.

[0127] In embodiments, the gene transfer sequence includes one or more SNP markers shown in Table 3 herein. In embodiments, the gene transfer includes the following SNP markers: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 This includes one or more, two or more, three or more, or all four of them.

[0128] In a further embodiment, a) The G genotype of marker SL1831 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 2) and reverse primer (SEQ ID NO: 5) and probe (SEQ ID NO: 3); b) The A genotype of the SNP marker SL1847 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 10) and probe (SEQ ID NO: 8); c) The G genotype of the SNP marker SL1887 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primers of SEQ ID NO: 12 and reverse primers of SEQ ID NO: 15, and probe of SEQ ID NO: 13; and d) The C genotype of the SNP marker SL1883 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 17) and reverse primer (SEQ ID NO: 20) and probe (SEQ ID NO: 18).

[0129] In a typical embodiment, the plant of the present invention has at least the following SNP markers (each individual marker exists in a heterozygous or homozygous form): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; SL1847 and SL1887; • SL1883 and SL1887; SL1831, SL1847, and SL1883; SL1831, SL1847, and SL1887; ·SL1847, SL1883 and SL1887; or SL1831, SL1847, SL1883 and SL1887 Includes.

[0130] For example, markers SL1883 and SL1887 can be used together, and other markers can be added as needed. Another example is the combination of markers SL1847 and SL1887, and other markers can be added as needed.

[0131] In a typical embodiment, the gene transfer sequence is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical to one or more of the aforementioned sequences: Sequence ID No. 1, which has a resistance marker allele represented by nucleotide G at position 112; Sequence ID No. 6, which has a resistance marker allele represented by nucleotide A at position 112; Sequence ID No. 11, which has a resistance marker allele represented by nucleotide G at position 99; and / or Sequence ID No. 16, which has a resistance marker allele represented by nucleotide C at position 41; or one or more of the aforementioned sequences.

[0132] In a further embodiment, the present invention provides a plant relating to any of the embodiments described herein, the plant comprising at least one copy (e.g., a heterozygote) of the Bremia resistance-constituting gene transfer sequence.

[0133] In a further embodiment, the present invention provides a plant according to any of the above embodiments, the plant comprising two copies of the Bremia resistance-constituting gene transfer sequence (for example, the plant is homozygous).

[0134] In further embodiments, the plant of the present invention is an inbred, digenomic haploid, or hybrid plant.

[0135] In one embodiment, the present invention provides a plant of deposited lettuce (Lactuca sativa) strain 18LEN002364.

[0136] In a further embodiment, the present invention provides seeds for producing plants according to the present invention.

[0137] In a further embodiment, the present invention provides seeds produced by a plant according to the present invention.

[0138] In a further embodiment, the lettuce plant of the present invention is a lettuce plant according to any embodiment described herein, and the lettuce (L. sativa) line 18LEN002364 or its offspring or ancestor is the source of the Bremia resistance-constituting gene transfer sequence.

[0139] In a further embodiment, the lettuce plant of the present invention is a lettuce plant according to any of the embodiments described above, and the spiny lettuce (L. serriola) strain CGN23091 or its descendants or ancestors is the source of the Bremia resistance-constituting gene transfer sequence.

[0140] In a further embodiment, the lettuce plant of the present invention is a lettuce plant according to any of the embodiments described above, and the plant is obtained by crossing a spiny lettuce (L. serriola) strain CGN23091 or lettuce (L. sativa) 18LEN002364 or its offspring or ancestor with a lettuce plant that does not contain the Bremia resistance-constituting gene transfer sequence.

[0141] A further embodiment provides a plant part, organ, or tissue obtained from a lettuce plant according to any of the above embodiments, which is not particularly limited, but includes leaves, cores, capitulums, stems, roots, flowers or flower parts, shoots, gametophytes, sporophytes, pollen, anthers, microspores, egg cells, zygotes, embryos, growth regions, callus tissue, seeds, cuttings, cell or tissue cultures, or any other part or product of the plant. In the embodiment, the plant part, organ, or tissue includes a gene transfer sequence that confers Bremia resistance. In the embodiment, the plant part, organ, or tissue exhibits Bremia resistance according to the present invention, in particular when grown into a plant that produces lettuce capitulums and / or leaves.

[0142] In other embodiments, the use of a lettuce plant, plant part, or seed according to any of the above embodiments is considered for producing and optionally harvesting lettuce flower heads and / or leaves.

[0143] In other embodiments, the present invention relates to the use of a lettuce plant, plant part, or seed according to any embodiment of the present invention, wherein the lettuce plant, plant part, or seed is lettuce (L. sativa) 18LEN002364 or its descendants or ancestors.

[0144] In further embodiments, the present invention relates to the use of lettuce plants, plant parts, or seeds according to any embodiment of the present invention for sowing in a field, greenhouse, or plastic greenhouse.

[0145] In another embodiment, the plant according to the present invention is male-sterile.

[0146] In another embodiment, the plant according to the present invention grows mature lettuce flower heads and / or leaves.

[0147] In one embodiment, the present invention provides lettuce leaves and flower heads produced by a lettuce plant according to any embodiment of the present invention.

[0148] The present invention further relates to lettuce plant seeds, more particularly to cultivated lettuce plant seeds (e.g., lettuce (L. sativa) seeds), which grow into lettuce plants according to any embodiment of the present invention.

[0149] The present invention further relates to the use of lettuce plants according to any embodiment for introducing (e.g., gene transfer) the Bremia resistance trait of the present invention into lettuce plants (e.g., lettuce (L. sativa) plants) that do not possess the Bremia resistance trait.

[0150] Genetic sequences, markers. The present invention further relates to a gene sequence that directs or controls the expression of Bremia resistance traits in lettuce plants. In a further embodiment, the gene sequence of the present invention is located on chromosome 2. In a further embodiment of the present invention, the gene sequence is available from a donor plant having the genetic background of lettuce (L. sativa) 18LEN002364, or its offspring or ancestors, and includes the said gene sequence.

[0151] In a further embodiment, the gene sequence of the present invention is genetically or physically associated with one or more marker loci that cosegregate with the Bremia resistance trait.

[0152] In other embodiments, the gene sequence of the present invention may be one or more of the SNP markers listed in Table 3, for example, a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 Characterized by one or more, two or more, three or more, or all four of the SNP markers SL1831, SL1847, SL1883, and SL1887, including [specific marker].

[0153] In a typical embodiment, a) The G genotype of marker SL1831 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 2) and reverse primer (SEQ ID NO: 5) and probe (SEQ ID NO: 3); b) The A genotype of the SNP marker SL1847 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 7) and reverse primer (SEQ ID NO: 10) and probe (SEQ ID NO: 8); c) The G genotype of the SNP marker SL1887 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primers of SEQ ID NO: 12 and reverse primers of SEQ ID NO: 15, and probe of SEQ ID NO: 13; and d) The C genotype of the SNP marker SL1883 can be identified by PCR amplification of a nucleic acid fragment accompanied by oligonucleotide primer pairs of forward primer (SEQ ID NO: 17) and reverse primer (SEQ ID NO: 20) and probe (SEQ ID NO: 18).

[0154] In a further embodiment, the present invention discloses a kit for detecting the Bremia resistance trait locus of the present invention in lettuce plants, optionally cultivated lettuce (L. sativa) lettuce plants (e.g., by genotyping), the kit comprising: i. A pair of primers represented by the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 5, and the probe of SEQ ID NO: 3; ii. A pair of primers represented by the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 10, as well as the probe of SEQ ID NO: 8; iii. A pair of primers represented by the forward primer of SEQ ID NO: 12 and the reverse primer of SEQ ID NO: 15, and the probe of SEQ ID NO: 13; and / or iv. A pair of primers represented by the forward primer of SEQ ID NO: 17 and the reverse primer of SEQ ID NO: 20, and the probe of SEQ ID NO: 18. It includes a pair of at least one PCR oligonucleotide primers and a probe selected from the following.

[0155] The present invention also discloses the use of SNP markers according to the present invention for diagnostic selection and / or genotyping of Bremia resistance trait loci in lettuce plants, particularly cultivated lettuce plants (e.g., lettuce (L. sativa)).

[0156] The present invention further discloses the use of some or all of these DNA markers to identify the presence of the Bremia resistance trait locus in lettuce plants, particularly cultivated lettuce plants, and more specifically in the lettuce (L. sativa) lettuce plants according to the present invention, and / or to monitor gene transfer of the Bremia resistance trait locus in lettuce plants, particularly cultivated lettuce plants, and particularly the lettuce (L. sativa) lettuce plants according to the present invention and herein.

[0157] The present invention further discloses polynucleotides (amplified products) that are available in PCR reactions involving at least one oligonucleotide primer as disclosed herein: SEQ ID NO: 2, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 15, SEQ ID NO: 17, or SEQ ID NO: 20, and reacting with probes of SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 13, and / or SEQ ID NO: 18, respectively. The present invention also provides polynucleotides (amplified products) that are available in PCR reactions involving pairs of PCR oligonucleotide primers selected from SEQ ID NO: 2 and SEQ ID NO: 5; SEQ ID NO: 7 and SEQ ID NO: 10; SEQ ID NO: 12 and SEQ ID NO: 15; or SEQ ID NO: 17 and SEQ ID NO: 20, and reacting with probes of SEQ ID NO: 3, SEQ ID NO: 8, SEQ ID NO: 13, or SEQ ID NO: 18, respectively.

[0158] Polynucleotides having at least 90%, particularly at least 95%, particularly at least 96%, particularly at least 97%, particularly at least 98%, and particularly at least 99% sequence identity with respect to the sequence of the amplification product and / or polynucleotide that exhibits a nucleotide sequence that hybridizes to the nucleotide sequence of the amplification product available in the above PCR reaction are also anticipated herein.

[0159] In embodiments, the amplified product corresponds to, or is at least 90%, 95%, 96%, 97%, 98%, or 99% identical to, the amplified product using the same primer / primer pair available from lettuce (L. sativa) 18LEN002364 or its offspring or ancestors containing the Bremia resistance-conferring gene transfer sequence of the present invention.

[0160] The present invention, wherein the amplification products described herein, can be used to generate or develop novel primers and / or probes that can be used to identify the Bremia resistance trait locus of the present invention.

[0161] The present invention, therefore, in one embodiment, further relates to derivative markers, particularly derivative primers or probes, developed from amplification products described herein and by methods known in the art, wherein the derivative markers are genetically associated with the Bremia resistance trait locus of the present invention.

[0162] Breeding methods. The present invention also provides a method for producing lettuce plants with enhanced resistance (e.g., compared to a control) to Bremia lactucae. In embodiments, this method is used. a) A step of producing offspring plants by crossing a first lettuce plant according to the present invention (for example, a lettuce (L. sativa) plant, particularly a cultivated lettuce (L. sativa) plant) with a second lettuce plant that does not contain the gene transfer sequence of the present invention that confers resistance to Bremia lactucae; b) A step of selecting a progeny plant containing the gene transfer sequence that confers resistance to Bremia lactucae. It contains, thereby producing plants with enhanced resistance to Bremia lactucae.

[0163] In one embodiment, the selection step involves the following SNP markers: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes of heterozygous or homozygous states relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 The process includes detecting one or more, two or more, three or more, or all four of the following (for example, by genotyping).

[0164] In one embodiment, the first lettuce plant is a cultivated lettuce plant. In another embodiment, the first lettuce plant is a lettuce (L. sativa) plant. In yet another embodiment, the second lettuce plant is a lettuce (L. sativa) plant.

[0165] In embodiments of the method according to the present invention, this method uses the following SNP markers (each individual marker exists in a heterojunction or homojunction form): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; SL1847 and SL1887; • SL1883 and SL1887; SL1831, SL1847, and SL1883; SL1831, SL1847, and SL1887; ·SL1847, SL1883 and SL1887; or SL1831, SL1847, SL1883 and SL1887 The process includes the step of detecting resistance-related genotypes (as described herein) (for example, by genotyping).

[0166] For example, markers SL1883 and SL1887 can be used together, and other markers can be added as needed. Another example is the combination of markers SL1847 and SL1887, and other markers can be added as needed.

[0167] In further embodiments, the present invention relates to any one of the embodiments described herein, wherein the first lettuce plant in step a) is a L. serriola strain CGN23091 containing the gene transfer sequence of the present invention or its offspring or ancestor, and the second lettuce plant does not contain the gene transfer sequence of the present invention that confers resistance to Bremia lactucae.

[0168] In further embodiments, the present invention relates to any one of the embodiments described herein, wherein the first lettuce plant in step a) is lettuce (L. sativa) 18LEN002364 or its offspring or ancestor containing the gene transfer sequence of the present invention, and the second lettuce plant does not contain the gene transfer sequence of the present invention that confers resistance to Bremia lactucae.

[0169] In some embodiments of the present invention, this method is, c) A step in which the selected offspring plants are allowed to self-distribute or are crossbred with other lettuce plants to produce further offspring. This further includes the following. In embodiments, further offspring are selected and self-pollinate / cross-bred over 2 to more than 10 generations.

[0170] In a further embodiment, the present invention provides a method for producing F1 hybrid lettuce plants having enhanced resistance to Bremia lactucae (e.g., compared to a control plant), the method comprising the step of crossing an inbred (including digenomic haploid) lettuce plant of the present invention with a different inbred lettuce plant to produce F1 hybrid offspring. According to this method, the second lettuce plant may or may not contain a gene transfer sequence that confers Bremia resistance of the present invention.

[0171] In one embodiment, the first lettuce plant is a cultivated lettuce plant. In another embodiment, the first lettuce plant is a lettuce (L. sativa) plant. In yet another embodiment, the second lettuce plant is a lettuce (L. sativa) plant.

[0172] Selection method. In a further embodiment, the present invention provides a method for identifying lettuce plants that are resistant to Bremia lactucae and contain at least one copy of the gene transfer sequence of the present invention (i.e., the plants are heterozygous or homozygous), wherein the method uses the following SNP markers: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 in Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) C genotype in a heterozygous or homozygous state related to the SNP marker SL1883 of Sequence ID No. 16; The process includes a step of detecting one or more, two or more, three or more, or all four of the following (for example, by genotyping): thereby identifying lettuce plants resistant to Bremia lactucae.

[0173] In this embodiment, the plant is a cultivated plant (for example, cultivated lettuce (L. sativa)).

[0174] In embodiments, the method further includes the steps of selecting a lettuce plant containing one or more SNP markers, and crossing the selected lettuce plant with a second lettuce plant to produce offspring lettuce plants containing one or more molecular markers and resistant to Bremia lactucae (for example, including the gene transfer sequence of the present invention that confers Bremia resistance). In embodiments, the second lettuce plant is different from the selected lettuce plant. In embodiments, the second lettuce plant is lettuce (L. sativa). In embodiments, the second lettuce plant does not contain the gene transfer sequence that confers Bremia resistance. In embodiments, the second lettuce plant does not contain the gene transfer sequence.

[0175] In another embodiment, the present invention relates to a method for identifying lettuce plants containing the Bremia resistance-constituting gene transfer sequence of the present invention, wherein the method is a) A step of providing a segregated population related to the Bremia genus resistance trait; b) A step of screening a segregated population for components exhibiting resistance to the genus Bremia, wherein the trait can be identified by the presence of the Bremia resistance-constituting gene transfer sequence of the present invention; c) A step of selecting one component of a segregated population, wherein the component includes a Bremia resistance trait, and Includes.

[0176] In another embodiment, the present invention relates to a method for identifying lettuce plants containing the Bremia resistance-constituting gene transfer sequence of the present invention, wherein the method is a) A step of providing an isolated population related to the Bremia genus resistance trait, b) A step of screening a segregated population for components exhibiting resistance to the genus Bremia, wherein the trait can be identified by the presence of the Bremia resistance-constituting gene transfer sequence of the present invention, the gene transfer sequence of the present invention can be identified by detecting one or more, two or more, three or more or all four Bremia resistance-associated alleles of the markers SL1831, SL1847, SL1883 and / or SL1883 (as described herein) (e.g., by genotyping); c) A step of selecting one component of a segregated population, wherein the component includes a Bremia resistance trait, and Includes.

[0177] In a further embodiment, the present invention provides a method for identifying lettuce plants (e.g., lettuce (L. sativa), particularly cultivated lettuce (L. sativa)) containing a gene transfer sequence on chromosome 2, wherein the gene transfer sequence confers resistance to the genus Bremia, and the method is as follows: a) A step of providing a segregated population with resistance to the genus Bremia; b) Below: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes of heterozygous or homozygous states relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A step of screening the population using a kit that detects (for example, by genotyping); c) Identifying plants containing one or more of the genotypes in (b) Includes.

[0178] In a further embodiment, the present invention relates to a method for identifying a wild lettuce source resistant to the genus Bremia on chromosome 2, a) The step of providing a wild lettuce variety or multiple wild lettuce varieties; b) Below: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 (SEQ ID NO: 1); ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes of heterozygous or homozygous states relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 The steps include: screening the lettuce strain or multiple wild lettuce strains using a kit that detects (for example, by genotyping); c) The step of identifying wild lettuce strains that contain one or more of the genotypes in (b) and This provides a method that includes [something].

[0179] In yet another embodiment, the present invention relates to the use of DNA markers amplified by PCR amplification from the genome of a lettuce plant according to any of the above embodiments, preferably lettuce (L. sativa) 18LEN002364 or its offspring or ancestor, with oligonucleotide primer pairs: forward primer of SEQ ID NO: 2 and reverse primer of SEQ ID NO: 5 and probe of SEQ ID NO: 3; forward primer of SEQ ID NO: 7 and reverse primer of SEQ ID NO: 10 and probe of SEQ ID NO: 8; forward primer of SEQ ID NO: 12 and reverse primer of SEQ ID NO: 15 and probe of SEQ ID NO: 13; or forward primer of SEQ ID NO: 17 and reverse primer of SEQ ID NO: 20 and probe of SEQ ID NO: 18, wherein the DNA fragment indicates the presence of a Bremia resistance trait in the lettuce plant, and is used to identify lettuce plants that contain and express the Bremia resistance trait.

[0180] In embodiments of the method according to the present invention, this method uses the following SNP markers (each individual marker exists in a heterojunction or homojunction form): • SL1831 and SL1847; • SL1831 and SL1883; • SL1831 and SL1887; • SL1847 and SL1883; SL1847 and SL1887; • SL1883 and SL1887; SL1831, SL1847, and SL1883; SL1831, SL1847, and SL1887; ·SL1847, SL1883 and SL1887; or SL1831, SL1847, SL1883 and SL1887 The process includes the step of detecting resistance-related genotypes (as described herein) (for example, by genotyping).

[0181] For example, markers SL1883 and SL1887 can be used together, and other markers can be added as needed. Another example is the combination of markers SL1847 and SL1887, and other markers can be added as needed.

[0182] use. The present invention also relates to the use of Bremia-resistant plant propagation material, obtainable from lettuce plants according to any embodiment of the present invention, for growing lettuce plants to produce Bremia-resistant lettuce plants, seeds, flower heads and / or leaves, wherein the Bremia resistance can be evaluated in a standard assay, particularly the assay described in Example 1 below.

[0183] In an embodiment, the present invention provides a method for producing lettuce seeds, the method comprising the steps of growing a lettuce plant from the seeds described in claim 13, causing the plant to produce further lettuce seeds, and optionally, collecting the seeds.

[0184] The present invention also relates to the use of Bremia-tolerant plant propagation material, which is available from lettuce plants according to any embodiment of the present invention, for producing lettuce flower heads and / or leaves.

[0185] The present invention also intends to utilize the Bremia resistance gene sequence of the present invention in relation to other gene sequences related to Bremia resistance, for example, the gene sequence disclosed in International Publication No. 2011 / 003783.

[0186] Based on the description of the present invention, it is easy for a person skilled in the art who possesses lettuce (L. sativa) 18LEN002364 or its offspring or ancestors containing the gene-transferred gene sequence as described herein to transfer the gene-transferred gene sequence of the present invention into various types of other lettuce plants using breeding techniques known in the art, for example, by using the SNP marker loci disclosed herein.

[0187] Seed deposit information On June 12, 2020, the applicant deposited at least 2,500 seeds of lettuce (Lactuca sativa) strain 18LEN002364 with NCIMB (NCIMB Limited, Ferguson Building, Craibstone Estate, Bucksburn, Aberdeen AB21 9YA, Scotland) under NCIMB Accession No. NCIMB43625.

[0188] The applicant chooses an expert solution and requests that, until the public notice of the grant of this patent is published, or if this application is rejected, withdrawn, or deemed withdrawn, for a period of 20 years from the filing date, the deposited materials be made available only to experts in accordance with EPC Rule 32(1) or the corresponding laws or treaties of other countries (expert witness provisions).

[0189] The deposit of this lettuce (Lactuca sativa) strain 18LEN002364 will be maintained with the NCIMB Depository, a public depositary, for 30 years, 5 years from the most recent request, or the term of the patent, whichever is longer, and any of the deposited seeds that become unviable during this period will be replaced. The applicant has also met all requirements under Sections 1.801-1.809 of the U.S. Patent Law Enforcement Regulations, including providing an indication of the germination potential of the samples. The deposit will be available upon request to the Director during the continuation of this application. Upon patenting of this variety, the variety will be irrevocably and unrestrictedly published by providing access to the deposit of at least 2,500 seeds of this variety with the NCIMB. The applicant does not restrict the availability of the deposited material from the NCIMB, however, the applicant does not have the power to exempt any restrictions imposed by laws relating to the commercial transport or delivery of biological material. The applicant does not waive any rights to infringe upon this patent or any plant variety protection rights (for example, rights granted under the U.S. Plant Variety Protection Act (see U.S. Federal Code 2321 et seq.)).

[0190] The present invention is described here with reference to the following embodiments. Those skilled in the art will understand that these embodiments are not intended to limit the scope of the claims of the present invention, but rather to illustrate certain embodiments. Other embodiments of the present invention may be carried out without departing from the spirit and scope of the invention, which is defined by the present disclosure and the appended claims. [Examples]

[0191] Example 1. Disease test against Bremia lactucae Bremia lactucae disease tests are conducted in a high-humidity climate chamber. The day length is 16 hours, the daytime temperature is 18°C, and the relative humidity (RH) is approximately 85%. The nighttime temperature is 15°C, and the RH is approximately 100%. Before sowing the test seeds, bremia pathogen spores are propagated in varieties susceptible to specific isolates. Disease tests for bremia resistance were performed using various bremia isolates and races.

[0192] Bremia isolates are characterized and classified according to the C-set Sextet code established by the IBEB (International Bremia Evaluation Board; see Table 1).

[0193] [Table 1]

[0194] Before sowing the test material, harvest leaves containing spores and rinse the spores off the leaves with water. Adjust the concentration of the spore suspension to 100,000 spores / ml. Spray the spore suspension onto one-week-old plants (on the cotyledons). Observation / selection can be performed 7-10 days after sowing. Normally, the cotyledons of susceptible plants are completely covered with spores. Depending on the Bremia isolate used, the cotyledons of resistant plants will show no or low levels of necrosis, with or without spore formation.

[0195] Example 2. Breeding history of lettuce (Lactuca sativa) containing resistance to the genus Bremia, derived from wild spiny lettuce (Lactuca serriola). The inventors confirmed that the wild spiny lettuce (Lactuca serriola) strain CGN23091 possesses broad resistance to Bremia lactucae, which is referred to as "SG01" resistance. An initial backcross cycle was performed to introduce SG01 Bremia resistance from the wild spiny lettuce (L. serriola) strain into a susceptible lettuce (Lactuca sativa). This was followed by backcrossing, self-pollination, four further backcrosses, and finally three self-pollinations with the lettuce (L. sativa) Dm0 cultivar. The resulting line was designated 18LEN002364 and deposited with NCIMB on June 12, 2020, under deposit number NCIMB43625. The complete breeding history of the deposited B6F4 breeding line is shown in Table 2 below. This strain has fixed resistance to the genus Bremia derived from a wild spiny lettuce (L. serriola) source; specifically, strain 18LEN002364 contains the SG01 Bremia resistance-conferring gene transfer sequence derived from a wild spiny lettuce (L. serriola) strain in a homozygous state.

[0196] [Table 2]

[0197] Example 3. Phenotypic determination of Bremia resistance derived from wild spiny lettuce (L. serriola) introduced into lettuce (L. sativa). The lettuce (L. sativa) B6F4 line described in Example 2 included a gene transfer from the wild spiny lettuce (L. serriola) line CGN23091, which contains the SG01 Bremia resistance locus, and showed resistance to all tested races and isolates of Bremia lactucae.

[0198] Testing SG01 resistance on approximately 400 field isolates over a period of at least six years revealed that it provided protection to all isolates evaluated. In addition, SG01 resistance also provided protection to all currently official European Bremia isolates (Bl:16-36EU).

[0199] The tolerance to the aforementioned B. lactucae isolates and races conferred by SG01 is rapid, high-level tolerance that does not cause observable necrosis in the plants. Furthermore, the tolerance is characterized as dominant (high tolerance observed in both heterozygotes and homozygotes), segregated as a monogenic trait, and qualitative.

[0200] Example 4. SG01 Bremia resistance is fixed and provides protection in other genetic backgrounds. The SG01 Bremia resistance derived from the spiny lettuce (L. serriola) strain CGN23091 has been fixed from BC6 and subsequent generations, as shown in Table 1 above. The SG01 resistance has been successfully introduced into other lettuce (L. sativa) genetic backgrounds. The deposited lines were further backcrossed with commercially available butterhead varieties, followed by two final autocrosses. The final backcross lines were used as the source to introduce Bremia resistance into multiple lettuce segments (including baby leaf, multileaf, romaine, iceberg, and indoor and outdoor butterhead). At each step of the breeding process, plants selected for the next generation were tested (by genotyping and phenotyping) to confirm the presence of resistance against a panel of Bremia isolates. Rapid, high-level qualitative Bremia resistance was maintained in a subset of tested isolates across all genetic backgrounds and under all environmental conditions evaluated. These results confirm the inheritable genetic basis for SG01 resistance.

[0201] Example 5. Mapping and genotyping of the SG01 Bremia resistance locus from Lettuce (L. serriola). The SG01 Bremia resistance gene from spiny lettuce (L. serriola) was backcrossed to the Dm0 cultivar of lettuce (L. sativa) up to the B6 generation (Table 1 above). This B6 line was shown to possess Bremia resistance under field conditions (Example 2) without the involvement of linkage drugs.

[0202] Materials and methods A: Assay development Step 1: Microarray Development We developed an array consisting of 2500 SNPs scattered throughout the lettuce (L. sativa) genome. Varieties were identified by comparing sequences obtained from reduced sequencing of a panel of 17 lettuce (L. sativa) varieties / lines related to different segments (including Batavia, Butterhead, Cos, Iceberg, and Multileaf).

[0203] The array was used to fingerprint backcross (BC) lines and recurrent parents derived from the Bremia genus program.

[0204] Step 2: Fingerprinting method: Identification of gene transfer Fingerprint screens showed that the BC line (CGN23091:B7F2) was 96-98% identical to the recurrent parent. SG01 Bremia resistance was associated with gene transfer regions found in the BC line derived from CGN23091.

[0205] The initial estimate of the gene transfer size was 33 MB in linkage group 2 at position 4119137–37019114 bp using a physical map of reference lettuce (Lactuca sativa) v5 (Reyes-Chin-Wo et al., (2017) Nat.Commun.8, 14953). This region is considered to be at the same position as the main resistance gene cluster containing Dm3, but SG01 is at a different locus than Dm3 and has a different resistance spectrum.

[0206] Step 3: Development of a Bremia-specific resistance marker on chromosome 2, SG01. Using next-generation sequencing (Mardis, (2008) Annual Review of Genomics and Human Genetics 9:387), whole-genome DNA sequencing (WGS) or reduced-genome sequencing (RGS) was performed on a panel of repeating Dm0 parents and commercial varieties, as well as on wild spiny lettuce (L. serriola) strains with Bremia resistance gene transfer on chromosome 2.

[0207] Alignment of the reference lettuce (Lactuca sativa) v5 sequence with the repetitive-sensitive Dm0 parent identified 147,465 mutations in linkage group 2 (LG2) between 4,119,137 nt and 1,078,767 nt. Furthermore, 94,376 mutations reflected different allele states between the sensitive Dm0 repetitive parent and the resistant backcross line in the gene transfer region of interest.

[0208] Step 4: Mapping and Fine-Mapping Varieties from Step 3, which involved SG01 gene transfer, were selected from resistant backcross lines and susceptible DM0 repeat parents with different allele states, and these were converted to Taqman® PCR assays for SNP detection. To complement phenotypic determination for Bremia resistance, markers were used to test a large CGN23091 B7F4 population (295 individuals) derived from repeat Dm0 parents. From 37 putative SNP candidates, two SNPs, SL1847 and SL1831, showed 100% cosegregation with Bremia resistance as calculated by JoinMap® (Table 3). SNP markers SL1883 and SL1887 were also closely associated with resistance. The specificity of the markers can be further enhanced by using a haplotype consisting of two or more markers from Table 3 (e.g., approximately 1 cM away from the resistance locus) (e.g., any two or any three of the markers SL1887, SL1883, SL1847, and SL1831, or all four of these markers).

[0209] These markers can be used individually or in combination to identify lettuce plants with SG01 Bremia resistance and to track resistance related to gene transfer to new lines. For example, markers SL1883 and SL1887 can be used together, and other markers can be added as needed. Another example is the combination of markers SL1847 and SL1887, and other markers can be added as needed.

[0210] [Table 3]

[0211] The physical locations of SNP markers SL1831, SL1847, SL1883, and SL1887, as well as the PCR primers / probes for detecting these SNPs, are shown below. SNP SL1831 at 9,490,680 bp in LG2 (based on the reference lettuce (L. sativa) v5 sequence) Target sequence (SEQ ID NO: 1): [ka] >Resistance allele: G >Forward primer (underlined) AGATACAGGGCAGGGAGGAATG (Sequence No. 2) > Probe (double underlined) [ka] Reverse primer (underlined) TGATGTGGATGGCTTCATGGAAT (Sequence No. 5) SNP SL1847 at 8,893,684 bp in LG2 (based on the reference lettuce (L. sativa) v5 sequence) Target sequence (SEQ ID NO: 6): [ka] > Resistance allele: A > Forward primer (underlined) CGCAGTGAAAGCCTTGGAGAT (SEQ ID NO: 7) > Probe (double underlined)

Chemical formula

Chemical formula

Chemical formula

Chemical formula

Chemical formula

[0212] The above information is summarized in Table 4 below.

[0213] [Table 4]

[0214] While the present invention has been described with reference to specific details of certain embodiments, such details are not intended to be considered limitations on the claimed scope of the invention, except as are included in the appended claims. [Sequence Listing] SEQUENCE LISTING <110> Syngenta Crop Protection AG de Lange, Michel Norbert Alexander Lokossou, Anoma Akuvi <120> BREMIA LACTUCAE RESISTANCE SG01 <130> 82134-EP-REG-ORG-X-1 <160> 20 <170> PatentIn version 3.5 <210> 1 <211> 155 <212> DNA <213> Lactuca sativa <220> <221> misc_feature <222> (2) (2) <223> n is A, T, C, or G <220> <221> misc_feature <222> (51)..(51) <223> n is A, T, C, or G <220> <221> misc_feature <222> (90)..(90) <223> n is A, T, C, or G <220> <221> misc_feature <222> (101)..(101) <223> n is A, T, C, or G <220> <221> misc_feature <222> (112)..(112) <223> r is A or G <400> 1 tntaaagatt agatacaggg cagggaggaa tgcctttgag ataaatgagg ngatcgacag 60 tgtcatgaga cgatacaaag agatcaaccn ggcagatcat ncaattcctc crggaagggt 120 tgattccatg aagccatcca catcaacacc atcag 155 <210> 2 <211> 22 <212> DNA <213> Synthetic <400> 2 agatacaggg cagggaggaa tg 22 <210> 3 <211> 15 <212> DNA <213> Synthetic <400> 3 acccttcccg gagga 15 <210> 4 <211> 16 <212> DNA <213> Synthetic <400> 4 caacccttcc tggagg 16 <210> 5 <211> 23 <212> DNA <213> Synthetic <400> 5 tgatgtggat ggcttcatgg aat 23 <210> 6 <211> 157 <212> DNA <213> Lactuca sativa <220> <221> misc_feature <222> (101)..(101) <223> n is A, T, C, or G <220> <221> misc_feature <222> (104)..(104) <223> n is A, T, C, or G <220> <221> misc_feature <222> (112)..(112) <223> r is A or G <400> 6 ggtacacgct cgcagtgaaa gccttggaga taactcagga gatcgatcat gccatgaaac 60 aactctctca gatagaatgg actgatgatt cagttccttt nggnagaaat grttccacaa 120 aggcatccac ctctacacca tcaagtgatt acaatga 157 <210> 7 <211> 21 <212> DNA <213> Synthetic <400> 7 cgcagtgaaa gccttggaga t 21 <210> 8 <211> 19 <212> DNA <213> Synthetic <400> 8 tgccttgtg gaatcattt 19 <210> 9 <211> 18 <212> DNA <213> Synthetic <400> 9 cctttgtgga accatttc 18 <210> 10 <211> 22 <212> DNA <213> Synthetic <400> 10 cacttgatgg tgtagaggtg 22 times <210> 11 <211> 138 <212> DNA <213> Lactuca sativa <220> <221> misc_feature <222> (41)..(41) <223> n is A, T, C, or G <220> <221> misc_feature <222> (62)..(62) <223> n is A, T, C, or G <220> <221> misc_feature <222> (99)..(99) <223> r is A or G <400> 11 gcacttgcaa gcatgagaca gctcgaagag ttaactataa natattgcaa ggccttgaaa gngattgtga slow slow tcatcatcnt slow ggttgtggtc ttgcctcatc taaagtcc 138 <210> 12 <211> 21 <212> DNA <213> Synthetic <400> 12 gcatgagaca gctcgaagag t 21 <210> 13 <211> 18 <212> DNA <213> Synthetic <400> 13 ccttcgatga cgatgatg 18 <210> 14 <211> 19 <212> DNA <213> Synthetic <400> 14 tccttcgatg atgatgatg 19 <210> 15 <211> 18 <212> DNA <213> Synthetic <400> 15 tgaggcaaga ccacaacc 18 <210> 16 <211> 80 <212> DNA <213> Lactuca sativa <220> <221> misc_feature <222> (6)..(6) <223> n is A, T, C, or G <220> <221> misc_feature <222> (6)..(6) <223> m is A or C <220> <221> misc_feature <222> (41)..(41) <223> n is a, c, g, or t <400> 16 agacgnttta acgacctggc ccaacattcc atgaaccacc ngactggttt tgggcaattt 60 agtcgggtac ctgcctttgc 80 <210> 17 <211> 20 <212> DNA <213> Synthetic <400> 17 acgacctggc ccaacattcc 20 <210> 18 <211> 15 <212> DNA <213> Synthetic <400> 18 tgaaccaccc gactg 15 <210> 19 <211> 16 <212> DNA <213> Synthetic <400> 19 tgaaccacca gactgg 16 <210> 20 <211> 22 <212> DNA <213> Synthetic <400> 20 gtacccgact aaattgccca aa 22

Claims

1. A lettuce (Lactuca sativa) plant having enhanced resistance to Bremia lactucae, comprising a gene transfer sequence derived from Lactuca serriola that confers qualitative and dominant resistance to Bremia lactucae, wherein the gene transfer sequence is derived from Lactuca serriola strain CGN23091 or Lactuca sativa The sativa strain 18LEN002364 contains representative seeds of lettuce (L. sativa) 18LEN002364, which are deposited with NCIMB under receipt number NCIMB43625. The gene transfer sequence is located on chromosome 2 and has the following SNP markers: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 of Sequence ID No. 1; b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A lettuce (Lactuca sativa) plant comprising one or more of the above, wherein the resistance of the plant to Bremia lactucae is enhanced compared to a lettuce (L. sativa) plant that does not contain the gene transfer sequence.

2. a) The G genotype of marker SL1831 can be identified by PCR amplification of a nucleic acid fragment accompanied by an oligonucleotide primer pair of the forward primer of SEQ ID NO: 2 and the reverse primer of SEQ ID NO: 5, and the probe of SEQ ID NO: 3; b) The A genotype of the SNP marker SL1847 can be identified by PCR amplification of a nucleic acid fragment accompanied by an oligonucleotide primer pair of the forward primer of SEQ ID NO: 7 and the reverse primer of SEQ ID NO: 10, and the probe of SEQ ID NO: 8; c) The G genotype of the SNP marker SL1887 can be identified by PCR amplification of a nucleic acid fragment accompanied by a pair of oligonucleotide primers for forward primer of SEQ ID NO: 12 and reverse primer of SEQ ID NO: 15, and the probe of SEQ ID NO: 13; and d) The plant according to claim 1, wherein the C genotype of the SNP marker SL1883 can be identified by PCR by amplification of a nucleic acid fragment accompanied by a pair of oligonucleotide primers, a forward primer of SEQ ID NO: 17 and a reverse primer of SEQ ID NO: 20, and a probe of SEQ ID NO:

18.

3. A cultivated plant, as described in claim 1 or 2.

4. The plant according to any one of claims 1 to 3, wherein the gene transfer sequence is at least 95% identical to one or more of the sequences described above, including Sequence ID No. 1 which has a resistance marker allele represented by nucleotide G at position 112, Sequence ID No. 6 which has a resistance marker allele represented by nucleotide A at position 112, Sequence ID No. 11 which has a resistance marker allele represented by nucleotide G at position 99 and / or Sequence ID No. 16 which has a resistance marker allele represented by nucleotide C at position 41, or one or more of the sequences described above, and includes a sequence containing the resistance marker allele.

5. The plant according to any one of claims 1 to 4, wherein it is a heterozygote with respect to one or more SNP markers.

6. The plant according to any one of claims 1 to 5, wherein it is homozygous for one or more SNP markers.

7. A plant according to any one of claims 1 to 6, comprising two or more of the SNP markers SL1831, SL1847, SL1887 and / or SL1883.

8. At least the following SNP markers: SL1831 and SL1847; SL1831 and SL1883; SL1831 and SL1887; SL1847 and SL1883; SL1847 and SL1887; or SL1883 and SL1887 The plant according to claim 7, including

9. The plant according to any one of claims 1 to 8, wherein the gene transfer sequence confers resistance to at least Bremia lactucae race Bl 16-36EU.

10. A plant according to any one of claims 1 to 9, obtained by crossing a spiny lettuce (Lactuca serriola) strain CGN23091 or a lettuce (L. sativa) strain 18LEN002364 with a second lettuce plant that does not contain the gene transfer sequence that confers resistance to Bremia lactucae.

11. A plant according to any one of claims 1 to 10, which is an inbred plant, a digenomic haploid, or a hybrid plant.

12. This plant is of the lettuce (Lactuca sativa) strain 18LEN002364, and the representative seed of lettuce (L. sativa) strain 18LEN002364 is deposited with NCIMB under receipt number NCIMB43625.

13. Seeds that produce the plant according to any one of claims 1 to 12.

14. A plant part of a plant according to any one of claims 1 to 12.

15. A method for producing lettuce plants with enhanced resistance to Bremia lactucae, a) A step of producing offspring plants by crossing a lettuce (Lactuca sativa) plant according to any one of claims 1 to 12 with a second lettuce plant that does not contain the gene transfer sequence that confers resistance to Bremia lactucae; b) A step of selecting offspring plants containing the gene transfer sequence that confers resistance to Bremia lactucae, wherein the following SNP markers: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 of Sequence ID No. 1; ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A step including the step of detecting one or more of the following A method for producing plants that have enhanced resistance to Bremia lactucae, comprising the above.

16. The method according to claim 15, wherein the lettuce (L. sativa) plant is lettuce (L. sativa) strain 18LEN002364.

17. A method for producing lettuce plants with enhanced resistance to Bremia lactucae, a) A step of producing offspring plants by crossing a plant of the spiny lettuce (L. serriola) strain CGN23091 with a second lettuce plant derived from the spiny lettuce (L. serriola) strain CGN23091 that does not contain a gene transfer sequence that confers resistance to Bremia lactucae; b) A step of selecting offspring plants that confer resistance to Bremia lactucae, comprising gene transfer on chromosome 2 from the L. serriola strain CGN23091, wherein the following SNP markers: i) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 of Sequence ID No. 1; ii) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; iii) G genotypes in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or iv) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A step including the step of detecting one or more of the following A method for producing lettuce plants that have enhanced resistance to Bremia lactucae, comprising the above.

18. c) The step of allowing the selected offspring to self-distribute, or crossbreeding the selected offspring with another lettuce plant to generate further offspring. The method according to any one of claims 15 to 17, further comprising:

19. The method according to claim 18, wherein further offspring are selected over 2 to more than 10 generations and are self-pollinated and / or crossbred.

20. The method according to any one of claims 15 to 19, wherein the selecting step in (b) includes the step of detecting two or more of the SNP markers SL1831, SL1847, SL1887 and / or SL1883.

21. The aforementioned selection step includes at least the following SNP markers: SL1831 and SL1847; SL1831 and SL1883; SL1831 and SL1887; SL1847 and SL1883; SL1847 and SL1887; or SL1883 and SL1887 The method according to claim 20, comprising the step of detecting

22. A method for producing F1 hybrid lettuce plants having enhanced resistance to Bremia lactucae, comprising the step of crossing an inbred lettuce (Lactuca sativa) plant, which is the plant described in any one of claims 1 to 12, with a different inbred lettuce (L. sativa) plant to produce F1 hybrid offspring.

23. A method for identifying lettuce plants with enhanced resistance to Bremia lactucae, comprising the following SNP markers: a) G genotype in a heterozygous or homozygous state related to the SNP marker SL1831 of Sequence ID No. 1; b) Heterozygous or homozygous A genotype related to the SNP marker SL1847 of Sequence ID No. 6; c) G genotype in a heterozygous or homozygous state relating to the SNP marker SL1887 of Sequence ID No. 11; and / or d) Heterozygous or homozygous C genotype related to the SNP marker SL1883 of Sequence ID No. 16 A method for identifying lettuce plants having enhanced resistance to Bremia lactucae, comprising the step of detecting one or more of the following.

24. The method according to claim 23, further comprising the steps of selecting a lettuce plant containing one or more SNP markers, and crossing the selected lettuce plant with a second lettuce plant to produce offspring lettuce plants containing one or more molecular markers and having enhanced resistance to Bremia lactucae.

25. The method according to claim 23 or 24, wherein the detection step includes detecting two or more of the SNP markers SL1831, SL1847, SL1887 and / or SL1883.

26. The above detection step includes at least the following SNP markers: SL1831 and SL1847; SL1831 and SL1883; SL1831 and SL1887; SL1847 and SL1883; SL1847 and SL1887; or SL1883 and SL1887 The method according to claim 25, comprising the step of detecting

27. A method for producing lettuce seeds, comprising the steps of growing a lettuce plant from the seeds described in claim 13, and causing the plant to produce further lettuce seeds.

Citation Information

Patent Citations

  • Production of hybrid Lactuca sativa seeds

    JP2010519923A

  • Pathogen-resistant plants

    JP2012531920A

  • Bremia lactucae resistant SG01

    JP2023532747A

  • R-genes in coupling phase

    US20130269066A1

  • Lactuca sativa with Bremia lactucae (Downy Mildew) resistance

    US20160007552A1