Compositions for regulating tau expression
Antisense compounds targeting tau mRNA and protein expression provide a method to treat neurodegenerative diseases by reducing tau levels, addressing the lack of effective treatments for conditions like Alzheimer's and frontotemporal dementia.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- BIOGEN MA INC
- Filing Date
- 2026-01-23
- Publication Date
- 2026-04-23
AI Technical Summary
There is a lack of effective treatment options for neurodegenerative diseases associated with tauopathies, such as Alzheimer's disease, frontotemporal dementia, and progressive supranuclear palsy, due to the unclear impact of tau isoform changes and posttranslational modifications on microtubule stability and neuronal function.
The use of antisense compounds, specifically modified oligonucleotides, to regulate tau mRNA and protein expression, thereby reducing tau levels in a time- and dose-dependent manner, targeting specific neurodegenerative diseases.
The antisense compounds effectively inhibit tau expression, potentially slowing down or reversing the progression of tau-related diseases by reducing tau protein levels, thereby improving neuronal function and cognitive symptoms.
Smart Images

Figure 2026069566000001 
Figure 2026069566000002 
Figure 2026069566000003
Abstract
Description
[Technical Field]
[0001] Sequence List This application has been filed in electronic format along with the sequence listing. The sequence listing is provided as a file titled BIOL0227WOSEQ_ST25.txt, with a size of 916 KB, created on July 17, 2014. The information in electronic format of the sequence listing is incorporated herein by reference in its entirety.
[0002] Compositions and methods for reducing the expression of tau mRNA and protein in animals are provided. Such methods are useful for treating, preventing, or improving neurodegenerative diseases, including tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, and Dravet syndrome, by inhibiting tau expression in animals. [Background technology]
[0003] The primary function of tau is to bind to and stabilize microtubules, which are essential structural components of the cytoskeleton involved in mitosis, cytokinesis, and vesicular transport. Tau is found in several tissues, but is particularly abundant in the axons of nerve cells. In humans, there are six isoforms of tau produced by alternative splicing of exons 2, 3, and 10. Splicing of exons 2 and 3 at the N-terminus of the protein leads to the inclusion of zero, one, or two 29-amino acidic domains, called 0N, 1N, or 2N tau, respectively. The influence of these domains on tau function is not fully understood, but they may play a role in interactions with the cell membrane. Inclusion of exon 10 at the C-terminus leads to the inclusion of the microtubule-binding domain encoded by exon 10. Since there are three microtubule-binding domains somewhere in tau, this isoform of tau (containing exon 10) is called 4R tau, where "R" refers to the number of repeats of the microtubule-binding domain. Tau lacking exon 10 is called 3R tau. Since more microtubule-binding domains (4R compared to 3R) increase microtubule binding, 4R tau likely significantly increases microtubule binding and assembly. The 3R / 4R tau ratio is developmentally regulated by fetal tissue expressing only 3R tau and adult tissue expressing nearly equal levels of 3R / 4R tau. Deviations from the normal 3R / 4R tau ratio are characteristic of neurodegenerative FTD tauopathy. It is unknown how altering the 3R / 4R tau ratio in later stages of adult animals affects tau pathogenesis.
[0004] Serine-threonine-induced phosphorylation regulates tau's microtubule-binding ability. Hyperphosphorylation promotes tau dissociation from microtubules. Other posttranslational modifications of tau have been described; however, their significance remains unclear. Tau phosphorylation is also developmentally regulated by higher phosphorylation in fetal tissues and much lower phosphorylation in adults. One characteristic feature of neurodegenerative disorders is abnormally increased tau phosphorylation.
[0005] Microtubule networks are involved in many critical intracellular processes, including the structural integrity necessary to maintain cell morphology and activate transport mechanisms. Since tau binding to microtubules stabilizes them, tau may be a key mediator in some of these processes, and disruption of normal tau in neurodegenerative diseases may disrupt some of these critical cellular processes.
[0006] One early indicator that tau may be important in neurodegenerative syndromes was the recognition that tau is a key component of neurofibrillary inclusions in Alzheimer's disease. Indeed, neurofibrillary inclusions are aggregates of hyperphosphorylated tau protein. Along with amyloid-beta-containing plaques, neurofibrillary inclusions are characteristic of Alzheimer's disease and are significantly correlated with cognitive impairment. 95% of tau accumulation in AD is found in neural processes, known as neuritis dystrophy. The process by which this microtubule-associated protein is released from microtubules, leading to protein accumulation, and how this process relates to neurotoxicity, is not fully understood.
[0007] Neuronal tau inclusions are a pathological feature not only of Alzheimer's disease but also of subsets of frontotemporal dementia (FTD), PSP, and CBD. The link between tau and neurodegeneration was demonstrated by the discovery that mutations in the tau gene cause a subset of FTD. These genetic data also highlight the importance of the 3R:4R tau ratio. Many tau variants that cause FTD lead to changes in tau splicing, resulting in preferential inclusion of exon 10, and thus an increase in 4R tau. Overall tau levels are normal. It remains unclear whether tau isoform changes, amino acid changes, or both cause neurodegeneration. Recent data suggest that PSP may also be associated with an increased 4R:3R tau ratio.
[0008] To help understand the impact of the tau ratio on neurodegeneration, a mouse model based on one of the splicing tau mutants (N279K) has been generated using a minigene containing the tau promoter and the adjacent intron sequence of exon 10. Similar to humans, these mice exhibit increased levels of 4R tau compared to transgenic mice expressing WT tau, resulting in behavioral and motor abnormalities as well as the accumulation of aggregated tau in the brain and spinal cord.
[0009] The protein "tau" is associated with Alzheimer's disease, frontotemporal dementia, progressive supranuclear palsy, corticobasal ganglia degeneration, Boxer dementia, chromosome-related parkinsonism, Lytico-Bodig disease, and Tangle-dominant dementia. It is associated with several brain disorders, including ganglia, ganglion cell tumors, meningeal hemangiomatosis, subacute sclerosing panencephalitis, lead encephalopathy, tuberous sclerosis, Hallerholden-Spatz disease, Pick's disease, argyrophilic granulopathy, corticobasal degeneration or frontotemporal lobar degeneration, and others. Tau-related disorders such as Alzheimer's disease (AD) are the most common cause of early dementia. AD affects an estimated 15 million people worldwide, and 40% of the population is affected by age 85 and older. AD is characterized by two pathological features: tau neurofibrillary inclusions (NFTs) and amyloid-beta (Aβ) plaques.
[0010] There is currently a lack of acceptable treatment options for such neurodegenerative diseases. Therefore, the objective of this specification is to provide methods for the treatment of such diseases. [Overview of the Initiative]
[0011] This specification provides methods, compounds, and compositions for regulating the expression of tau mRNA and proteins. In certain embodiments, the compounds useful for regulating the expression of tau mRNA and proteins are antisense compounds. In certain embodiments, the antisense compounds are antisense oligonucleotides.
[0012] In certain embodiments, regulation may occur within cells or tissues. In certain embodiments, the cells or tissues are in animals. In certain embodiments, the animals are humans. In certain embodiments, tau mRNA levels are reduced. In certain embodiments, tau protein levels are decreased. Such decreases may occur in a time-dependent or dose-dependent manner.
[0013] Methods, compounds, and compositions useful for preventing, treating, and improving diseases, disorders, and conditions are also provided. In certain embodiments, such tau-related diseases, disorders, and conditions are neurodegenerative diseases. In certain embodiments, such neurodegenerative diseases, disorders, and conditions include tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, and Dravet syndrome.
[0014] These diseases, disorders, and conditions may share one or more common risk factors, causes, or outcomes. Specific risk factors and causes for the development of neurodegenerative disorders include age, personal or family history, or genetic predisposition. Specific symptoms and outcomes associated with the development of neurodegenerative disorders include, but are not limited to, the presence of hyperphosphorylated tau, the presence of neurofibrillary inclusions, decreased neuronal function, decreased memory, decreased motor function, decreased motor coordination, and confusion.
[0015] In certain embodiments, the treatment method includes administering a tau antisense compound to an individual in need. In certain embodiments, the treatment method includes administering a tau antisense oligonucleotide to an individual in need.
[0016] This disclosure provides the following non-limiting numbered embodiments:
[0017] Embodiment 1: Consists of 12 to 30 bound nucleosides, and SEQID NO: 20 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of -2443 and SEQ ID NO:2478-2483.
[0018] Embodiment 2: Consists of 12 to 30 bound nucleosides, and SEQID NO: 24 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of 44-2477 and SEQ ID NO:2484-2565.
[0019] Embodiment 3: Consists of 12 to 30 bound nucleosides, and SEQID NO: 20 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of -2565.
[0020] Embodiment 4: Consists of 12 to 30 bound nucleosides, and SEQID NO: 1 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135783-135980.
[0021] Embodiment 5: Consists of 12 to 30 bound nucleosides, and SEQID NO: 1 A compound comprising a modified oligonucleotide having a nucleic acid sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135853-135872.
[0022] Embodiment 6: Consists of 12 to 30 bound nucleosides, and SEQID NO: 1 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135783-135929.
[0023] Embodiment 7: Consists of 12 to 30 bound nucleosides, and SEQID NO: 1 A compound comprising a modified oligonucleotide comprising a nucleic acid sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of the nucleic acid sequence 135783-135914.
[0024] Embodiment 8: The nucleic acid base sequence of the modified oligonucleotide is SEQID NO: 1. The compounds according to Embodiments 4-7, which are at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary.
[0025] Embodiment 9: A compound according to any of the embodiments, comprising a single-strand modified oligonucleotide.
[0026] Embodiment 10: The compound according to any of the embodiments, wherein at least one nucleoside bond is a modified nucleoside bond.
[0027] Embodiment 11: At least one modified nucleoside bond is a phosphorothioate nucleoside bond. The compound according to Embodiment 10, which has an osidic bond.
[0028] Embodiment 12: The compound according to Embodiment 10, wherein each modified nucleoside bond is a phosphorothioate nucleoside bond.
[0029] Embodiment 13: The compound according to any of the embodiments, wherein at least one nucleoside bond is a phosphate diester nucleoside bond.
[0030] Embodiment 14: The compound according to any of the embodiments, wherein at least one nucleoside bond is a phosphorothioate nucleoside bond, and at least one nucleoside bond is a phosphate diester nucleoside bond.
[0031] Embodiment 15: The compound according to any of the embodiments, wherein at least one nucleoside comprises a modified nucleic acid base.
[0032] Embodiment 16: The compound according to Embodiment 15, wherein the modified nucleic acid base is 5-methylcytosine.
[0033] Embodiment 17: The compound according to any of the embodiments, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
[0034] Embodiment 18: The compound according to Embodiment 17, wherein the at least one modified sugar is a bicyclic sugar.
[0035] Embodiment 19: The compound according to Embodiment 18, wherein the bicyclic sugar contains a chemical bond between the 2' and 4' positions of the sugar 4'-CH2-N(R)-O-2' bridge, and R is independently H, C1-C12 alkyl, or a protecting group.
[0036] Embodiment 20: The compound according to Embodiment 18, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C12 alkyl, or a protecting group.
[0037] Embodiment 21: At least one modified sugar contains a 2'-O-methoxyethyl group, The compound described in Form 17.
[0038] Embodiment 22: The compound according to Embodiment 17, wherein the modified sugar contains a 2'-O(CH2)2-OCH3 group.
[0039] Embodiment 23: The modified oligonucleotide is: A gap segment consisting of 10 bound deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0040] Embodiment 24: The modified oligonucleotide is: A gap segment consisting of nine bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0041] Embodiment 25: The modified oligonucleotide is: A gap segment consisting of seven bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0042] Embodiment 26: The modified oligonucleotide is: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0043] Embodiment 27: The modified oligonucleotide is: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of four bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0044] Embodiment 28: The modified oligonucleotide is: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of six bonded nucleosides; and, A 3' wing segment consisting of four bonded nucleosides; Includes, The compound according to any of the embodiments, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0045] Embodiment 29: The compound according to any of the embodiments, wherein the modified oligonucleotide consists of 20 bound nucleosides.
[0046] Embodiment 30: The compound according to any of the embodiments, wherein the modified oligonucleotide consists of 19 bound nucleosides.
[0047] Embodiment 31: The compound according to any of the embodiments, wherein the modified oligonucleotide consists of 18 bound nucleosides.
[0048] Embodiment 32: A composition comprising the compound or composition thereof according to any of the embodiments, and at least one pharmaceutically acceptable carrier or diluent.
[0049] Embodiment 33: A method comprising administering the compound or composition described in any of the embodiments to an animal.
[0050] Embodiment 34: The method according to Embodiment 33, wherein the animal is a human.
[0051] Embodiment 35: The method according to Embodiment 33, wherein administration of the compound inhibits, treats, improves or delays the progression of tau-related diseases, disorders or conditions.
[0052] Embodiment 36: The method according to Embodiment 35, wherein the disease, disorder, or condition is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome.
[0053] Embodiment 37: Use of the compound or composition described in any of the embodiments for the manufacture of a pharmaceutical product for the treatment of neurodegenerative disorders.
[0054] Embodiment 38: A compound comprising ISIS613099.
[0055] Embodiment 39: A compound comprising ISIS613361.
[0056] Embodiment 40: A compound comprising ISIS613370.
[0057] Embodiment 41: A compound comprising ISIS623782.
[0058] Embodiment 42: A compound comprising ISIS623996.
[0059] Embodiment 43: A composition comprising the compound or a salt thereof described in any of Embodiments 38 to 42, and at least one pharmaceutically acceptable carrier or diluent.
[0060] Embodiment 44: A method comprising administering to an animal the compound or a salt thereof as described in any of Embodiments 38 to 43.
[0061] Embodiment 45: The method according to Embodiment 44, wherein the animal is a human.
[0062] Embodiment 46: The method according to Embodiment 44, wherein administration of the compound inhibits, treats, improves or delays the progression of tau-related diseases, disorders or conditions.
[0063] Embodiment 47: The method according to Embodiment 46, wherein the disease, disorder, or condition is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome.
[0064] Embodiment 48: Use of the compound or composition according to any one of Embodiments 38 to 43 for the manufacture of a pharmaceutical product for the treatment of neurodegenerative disorders. [Modes for carrying out the invention]
[0065] It should be understood that both the general description above and the detailed description below are illustrative and descriptive only, as stated in the claims, and do not limit the invention. In this specification, unless otherwise specifically stated, the use of the singular includes the plural. Where used herein, unless otherwise stated, "or" means "and / or". To taste. Where used herein, unless otherwise stated, "and" means "and / or" This means "including". Furthermore, the use of other forms of the terms "including," "includes," and "included" is not limited to these. The terms "element" or "component" also encompass both "elements" and "components," including a single unit containing multiple subunits and "elements" and "components," unless otherwise specifically stated.
[0066] Section headings used herein are for structural purposes only and should not be construed as limiting the subject matter described. Patents, patent applications, published patent applications, articles, books, papers, and GENBANK Accession Numbers and Na tional Center for Biotechnology Information All documents or parts of documents referenced herein, including but not limited to relevant sequence information available from databases such as n(NCBI) and other data referenced through the disclosure herein, are expressly incorporated herein by reference to parts of documents described herein, and likewise all of them are expressly incorporated herein. definition
[0067] Unless otherwise specified, the terms, procedures, and techniques used herein in relation to analytical chemistry, organic synthesis, and pharmaceuticals and medicinal chemistry are well-known and commonly used in the art. Standard techniques may be used for chemical synthesis and chemical analysis.
[0068] Unless otherwise specified, the following terms have the following meanings:
[0069] "2'-O-methoxyethyl" (also known as 2'-MOE, 2'-OCH2CH2-OCH3, and MOE) refers to the O-methoxyethyl modification at the 2' position of the furanosyl ring. 2'-O-methoxyethyl modified sugars are modified sugars.
[0070] "2'-MOE nucleoside" (also called 2'-O-methoxyethyl nucleoside) refers to a nucleoside that contains a 2'-MOE modified sugar moiety.
[0071] "2'-substituted nucleoside" refers to a nucleoside that contains a substituent at the 2' position of the furanose ring other than H or OH. In certain embodiments, 2'-substituted nucleosides include nucleosides having bicyclic sugar modifications.
[0072] "5-methylcytosine" refers to cytosine modified by a methyl group attached to the 5th position. 5-methylcytosine is a modified nucleic acid base.
[0073] "Approximately" means within ±7% of the value. For example, if it says "the compound affected at least approximately 70% inhibition of tau," it means that tau levels were inhibited within the range of 63% to 77%.
[0074] "Administered in combination" refers to the simultaneous administration of two pharmaceuticals in any manner in which both pharmacological effects manifest simultaneously in the patient. Simultaneous administration does not require that both pharmaceuticals be in a single pharmaceutical composition, in the same dosage form, or administered via the same route of administration. The effects of both pharmaceuticals do not need to manifest themselves simultaneously. The effects only need to overlap for a certain period, and do not need to have the same extent.
[0075] "Administering" means providing a drug to an animal, including, but not limited to, administration by a medical professional and self-administration.
[0076] "Improvement" refers to a reduction, slowdown, cessation, or reversal of at least one indicator of the severity of a condition or disease. The severity of an indicator may be determined by subjective or objective measures known to those skilled in the art.
[0077] "Animals" refers to humans or non-human animals, including but not limited to mice, rats, rabbits, dogs, cats, and pigs, as well as non-human primates, including but not limited to monkeys and chimpanzees.
[0078] An "antibody" refers to a molecule characterized by its specific reaction with an antigen in some way, and antibodies and antigens are defined in relation to each other. An antibody can refer to the complete antibody molecule or any fragment or region, such as the heavy chain, light chain, Fab region, and Fc region.
[0079] "Antisense activity" refers to any detectable or measurable activity resulting from the hybridization of an antisense compound with respect to its target nucleic acid. In certain embodiments, antisense activity is a reduction in the amount or expression of the target nucleic acid or protein encoded by such a target nucleic acid.
[0080] An "antisense compound" refers to an oligomeric compound that can undergo hybridization with a target nucleic acid via hydrogen bonding. Examples of antisense compounds include single-stranded and double-stranded compounds such as antisense oligonucleotides, siRNA, shRNA, ssRNA, and occupational compounds.
[0081] "Antisense inhibition" refers to a decrease in the level of the target nucleic acid in the presence of an antisense compound complementary to the target nucleic acid, compared to the level of the target nucleic acid in the absence of the antisense compound.
[0082] "Antisense mechanisms" are all these mechanisms relating to the hybridization of a compound with a target nucleic acid, and the result or effect of the hybridization is either targeted degradation or targeted occupation, which involves stalling of cellular mechanisms, including, for example, transcription or splicing.
[0083] An "antisense oligonucleotide" refers to a single-stranded oligonucleotide that has a nucleic acid base sequence that allows hybridization to the corresponding segment of a target nucleic acid.
[0084] "Base complementarity" refers to the ability of an antisense oligonucleotide to accurately pair (i.e., hybridize) the nucleic acid bases of the corresponding nucleic acid bases in a target nucleic acid, mediated by Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds between the corresponding nucleic acid bases.
[0085] A "bicyclic sugar" refers to a furanose ring modified by a bridge between two atoms. Bicyclic sugars are modified sugars.
[0086] A "bicyclic nucleoside" (also known as BNA) refers to a nucleoside having a sugar moiety that includes a bridge connecting two carbon atoms of a sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon atoms of the sugar ring.
[0087] "Cap structure" or "terminal cap portion" refers to a chemical modification incorporated into one of the ends of an antisense compound.
[0088] "cEt" or "limited ethyl" refers to a bicyclic nucleoside having a sugar moiety containing a bridge connecting the 4'-carbon and 2'-carbon atoms, the bridge having the formula: 4'-CH(CH3)-O-2'.
[0089] A "restricted ethyl nucleoside" (also called a cEt nucleoside) refers to a nucleoside containing a bicyclic sugar moiety including a 4'-CH(CH3)-O-2' bridge.
[0090] A "chemically distinct region" refers to a region of an antisense compound that is chemically distinct in some way from another region of the same antisense compound. For example, a region containing a 2'-O-methoxyethyl nucleotide is chemically distinct from a region containing a nucleotide without the 2'-O-methoxyethyl modification.
[0091] A "chimeric antisense compound" refers to an antisense compound having at least two chemically distinct regions, each of which has multiple subunits.
[0092] "Concurrent administration" means the administration of two or more pharmaceuticals to an individual. The two or more pharmaceuticals may be in a single pharmaceutical composition or in separate pharmaceutical compositions. Each of the two or more pharmaceuticals may be administered via the same or different route of administration. Concurrent administration includes parallel or sequential administration.
[0093] "Complementarity" refers to the ability of nucleic acid bases of a first nucleic acid and a second nucleic acid to pair up.
[0094] "Comprise," "comprises," and "contains" are understood to mean the inclusion of the described step or element or group of steps or elements, but not the exclusion of any other step or element or group of steps or elements.
[0095] "Continuous nucleic acid bases" refers to nucleic acid bases that are directly adjacent to each other.
[0096] "Designing" or "designed to" refers to the process of designing an oligomeric compound that specifically hybridizes with a selected nucleic acid molecule.
[0097] A "diluent" refers to a component in a composition that lacks pharmacological activity but is pharmaceutically necessary or desirable. For example, in a drug to be injected, the diluent may be a liquid such as saline solution.
[0098] "Dose" refers to a specific amount of a drug delivered in a single dose or over a specific period. In certain embodiments, the dose may be administered in one, two, or more boluses, tablets, or injections. For example, in certain embodiments where subcutaneous administration is desired, the desired dose requires a volume that cannot be readily accommodated by a single injection, and therefore two or more injections may be used to achieve the desired dose. In certain embodiments, the drug is administered by infusion over a long period or continuously. The dose may be expressed as the amount of the drug per hour, day, week, or month.
[0099] In relation to modulating activity or treating or preventing a disease, “effective dose” means the administration of that amount of the drug to a subject in need of such modification, treatment, or prevention, either as a single dose or as part of a series effective for modulating its effect or treating, preventing, or improving a disease. The effective dose may vary between individuals depending on the health and physical condition of the individual being treated, the taxonomic group of the individual being treated, the formulation of the composition, the assessment of the medical condition, and other relevant factors.
[0100] "Effectiveness" refers to the ability to produce the desired effect.
[0101] "Expression" encompasses all functions that translate the encoded information of a gene into structures that exist and function within the cell. Such structures include, but are not limited to, the products of transcription and translation.
[0102] "Completely complementary" or "100% complementary" means that each nucleic acid base of the first nucleic acid has a complementary nucleic acid base in the second nucleic acid. In certain embodiments, the first nucleic acid is an antisense compound, and the target nucleic acid is the second nucleic acid.
[0103] "Gapmer" is an internal structure containing multiple nucleosides that support RNase H cleavage. A chimeric antisense compound is defined as a region located between outer regions containing one or more nucleosides, where the nucleosides containing the inner region are chemically distinct from the nucleosides containing the outer regions. The inner region can be called a "gap," and the outer regions can be called a "wing."
[0104] "Narrow gap" refers to a chimeric antisense compound having a gap segment of 9 or fewer adjacent 2'-deoxyrobonucleosides located between and directly adjacent to the 5' and 3' wing segments, each containing 1 to 6 nucleosides.
[0105] "Large gap" refers to a chimeric antisense compound having a gap segment of 12 or more adjacent 2'-deoxyrobonucleosides located between and directly adjacent to the 5' and 3' wing segments, each containing 1 to 6 nucleosides.
[0106] "Hybridization" refers to the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense oligonucleotides and nucleic acid targets.
[0107] "Identification of animals with tau-related disease" means identifying animals that have been diagnosed with tau-related disease or have a predisposition to tau-related disease. Individuals with a predisposition to tau-related disease include individuals that have one or more risk factors for tau-related disease, including age, personal or family history, or a genetic predisposition to one or more tau-related diseases. Such identification can be achieved by any method, including evaluation of the individual's medical history and clinical tests or assessments such as genetic testing.
[0108] "Directly adjacent" means that there are no elements intervening between directly adjacent elements.
[0109] "Individual" refers to a human or non-human animal selected for treatment or therapy.
[0110] "Inhibiting tau" means reducing the level or expression of tau mRNA and / or protein. In certain embodiments, tau is inhibited in the presence of a tau-targeting antisense compound, including a tau-targeting antisense oligonucleotide, compared to the level of tau mRNA and / or protein expression in the absence of a tau antisense compound, such as an antisense oligonucleotide.
[0111] "Inhibiting expression or activity" refers to a reduction or blockage of expression or activity, and does not necessarily mean the complete elimination of expression or activity.
[0112] "Nucleoside bond" refers to the chemical bond between nucleosides.
[0113] A "bonded nucleoside" refers to an adjacent nucleoside that is bonded together by an internucleoside bond.
[0114] "Locked nucleic acid" or "LNA" or "LNA nucleoside" means a nucleic acid monomer having a bridge that connects two carbon atoms between the 4'-position and the 2'-position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars are, as shown below, A) α-L-methyleneoxy (4'-CH2-O-2 12 , 12 , 12 , 12 , 12 , 12 , 20 , 20 ) LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'-(CH2)2-O-2') LNA, (D) aminooxy (4'-CH2-O-N(R)-2') LNA, and (E) oxyamino (4'-CH2-N(R)-O-2') LNA, including but not limited to these.
[0115]
Chemical formula
[0116] As used herein, an LNA compound has at least one bridge between the 4'-position and the 2'-position of the sugar, and each of the bridges is -[C(R1)(R2)] n -,-C(R1)=C(R2)-,-C(R1)=N-,-C(=NR1)-,-C(=O)-,-C(=S)-,-O-,-Si(R1)2-,-S(=O) x - and -N(R1)-, and includes compounds independently containing 1 or 2 to 4 linking groups independently selected therefrom, including but not limited to these. Here, x is 0, 1 or 2, n is 1, 2, 3 or 4, and each of R1 and R2 is independently H, a protecting group, hydroxyl, C1-C 12 alkyl, substituted C1-C 12 alkyl, C2-C 12 alkenyl, substituted C2-C 12 alkenyl, C2-C 12 alkynyl, substituted C2-C 12 alkynyl, C5-C 20 aryl, substituted C5-C 20Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1) or sulfoxyl (S(=O)-J1), where J1 and J2 are independently H,C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl substitution C2-C 12 Alkinyl, C5-C 20 Aryl, substitution C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group.
[0117] An example of a 4'-2' bridging group included in the definition of LNA is given by formula: -[C(R1)(R2)] n -,-[C(R1)(R2)] n It includes, but is not limited to, one of the following: -O-, -C(R1R2)-N(R1)-O- or -C(R1R2)-ON(R1)-. Furthermore, other bridging groups included in the definition of LNA are 4'-CH2-2',4'-(CH2)2-2',4'-(CH2)3-2',4'-CH2-O-2',4'-(CH2)2-O-2',4'-CH2-ON(R1)-2' and 4'-CH2-N(R1)-O-2'- bridgings, where R1 and R2, independently, are H, protecting groups or C1-C 12 It is alkyl.
[0118] The definition of LNA according to the present invention also includes LNA in which the 2'-hydroxyl group of the ribosyl sugar ring is connected to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy(4'-CH2-O-2') bridge and creating a bicyclic sugar moiety. The bridge may also be a methylene(-CH2-) group connecting the 2' oxygen atom and the 4' carbon atom, in which case the term methyleneoxy(4'-CH2-O-2')LNA is used. Furthermore, in the case of a bicyclic sugar moiety having an ethylene bridge group at this position, the term ethyleneoxy(4'-CH2CH2-O-2')LNA is used. As used herein, isomers of α-L-methyleneoxy(4'-CH2-O-2') and methyleneoxy(4'-CH2-O-2')LNA are also included in the definition of LNA.
[0119] A "mismatch" or "non-complementary nucleic acid base" refers to a case where the nucleic acid base of the first nucleic acid cannot pair with the corresponding nucleic acid base of the second or target nucleic acid.
[0120] "Modified nucleoside bonds" refer to substitutions or any alterations to naturally occurring nucleoside bonds (i.e., phosphodiester nucleoside bonds).
[0121] "Modified nucleic acid bases" refer to any nucleic acid base other than adenine, cytosine, guanine, thymidine, or uracil. "Unmodified nucleic acid bases" refer to the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0122] "Modified nucleoside" independently refers to a nucleoside that has a modified sugar moiety and / or a modified nucleic acid base.
[0123] A "modified nucleotide" independently refers to a nucleotide that has a modified sugar moiety, a modified nucleoside bond, and / or a modified nucleic acid base.
[0124] "Modified oligonucleotide" means an oligonucleotide containing at least one modified nucleoside bond, a modified sugar, and / or a modified nucleic acid base.
[0125] "Modified sugar" means substitution and / or any alteration from the natural sugar portion.
[0126] A "monomer" refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
[0127] "Motif" refers to the pattern of unmodified and modified nucleosides in antisense compounds.
[0128] "Natural sugar portion" refers to the sugar portion found in DNA (2'-H) or RNA (2'-OH).
[0129] "Naturally occurring nucleoside bonds" refers to 3'-to-5' phosphodiester bonds.
[0130] "Non-complementary nucleic acid bases" refer to a pair of nucleic acid bases that do not form hydrogen bonds with each other or do not support separate hybridization.
[0131] "Nucleic acid" refers to a molecule composed of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acid, double-stranded nucleic acid, small interfering ribonucleic acid (siRNA), and microRNA (miRNA).
[0132] A "nucleic acid base" refers to the heterocyclic portion that can pair with bases of other nucleic acids.
[0133] "Nucleic acid base complementarity" refers to nucleic acid bases that can base-pair with other nucleic acid bases. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleic acid bases refer to nucleic acid bases of an antisense compound that can base-pair with the nucleic acid bases of the target nucleic acid. For example, if a nucleic acid base at a specific position in an antisense compound can hydrogen-bond with a nucleic acid base at a specific position in the target nucleic acid, the positions of the hydrogen bonds between the oligonucleotide and the target nucleic acid are considered complementary in this nucleic acid base pair.
[0134] "Nucleic acid base sequence" refers to the order of adjacent nucleic acid bases, independent of any sugars, bonds, and / or nucleic acid base modifications.
[0135] "Nucleoside" refers to a nucleic acid base that is bound to a sugar.
[0136] "Nucleoside mimetic" includes structures used to substitute sugars or sugars and bases, and does not necessarily include bonds at one or more positions in oligomeric compounds such as morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetic, such as nucleoside mimetic with a non-furanose sugar unit. Nucleotide mimetic includes structures used to substitute nucleosides and bonds at one or more positions in oligomeric compounds such as peptide nucleic acids or morpholino (-N(H)-C(=O)-O- or morpholino linked by other non-phosphodiester bonds). Sugar substitutes overlap slightly with the broader term nucleoside mimetic, but are intended to indicate substitution of sugar units (furanose rings) only. The tetrahydropyranyl ring provided herein illustrates an example of a sugar substitute in which a furanose sugar group is substituted with a tetrahydropyranyl ring system. "Mimetic" refers to a group that is substituted for sugars, nucleic acid bases, and / or nucleoside bonds. Generally, mimetic agents are used in place of sugars or sugar-nucleoside bond combinations, while nucleic acid bases are maintained for hybridization against a selected target.
[0137] A "nucleotide" refers to a nucleoside that has a phosphate group covalently bonded to the sugar portion of the nucleoside.
[0138] "Off-target effects" refer to undesirable or harmful biological effects associated with the regulation of RNA or protein expression of genes other than the intended target nucleic acid.
[0139] An "oligomeric compound" or "oligomer" refers to a polymer of bonded monomer subunits that can hybridize to at least one region of a nucleic acid molecule.
[0140] An "oligonucleotide" refers to a polymer of linked nucleosides, each of which may be independently modified or unmodified.
[0141] "Pareral administration" means administration by injection (e.g., bolus injection) or infusion. Parenteral administration includes subcutaneous, intravenous, intramuscular, intra-arterial, intraperitoneal, or intracranial administration, such as subarachnoid or intraventricular administration.
[0142] "Peptide" means a molecule formed by linking at least two amino acids by an amide bond. As used herein, "peptide" refers to, but is not limited to, polypeptides and proteins.
[0143] "Pharmaceuticals" refers to substances that provide therapeutic utility when administered to an individual. For example, in certain embodiments, antisense oligonucleotides targeting tau are pharmaceuticals.
[0144] "Pharmaceutical composition" means a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may include an antisense oligonucleotide and a sterile aqueous solution.
[0145] "Pharmacologically acceptable derivatives" include pharmaceutically acceptable salts, conjugates, prodrugs, or isomers of the compounds described herein.
[0146] A "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of an antisense compound, i.e., a salt that retains the desired biological activity of the parent oligonucleotide and does not impart undesirable toxic effects to the antisense compound.
[0147] A "phosphorothioate bond" refers to a nucleoside bond in which a phosphodiester bond is modified by substituting one of the non-bridged oxygen atoms with a sulfur atom. A phosphorothioate bond is a modified nucleoside bond.
[0148] A "part" refers to a specified number of adjacent (bound) nucleic acid bases of a nucleic acid. In certain embodiments, a part is a specified number of adjacent nucleic acid bases of the target nucleic acid. In certain embodiments, a part is a specified number of adjacent nucleic acid bases of the antisense compound.
[0149] "Prevention" or "preventing" refers to delaying or preventing the onset or development of a disease, disorder, or condition for a period of time ranging from minutes to days, weeks to months, or indefinitely.
[0150] "Prodrug" refers to a therapeutic agent that is prepared in an inactive form and converted into an active form (i.e., a drug) within the body or its cells by the action of endogenous enzymes or other chemicals and / or conditions.
[0151] "Prophylactic effective dose" refers to the amount of a drug that provides a preventive or protective benefit to an animal.
[0152] A "region" is defined as a portion of a target nucleic acid having at least one identifiable structure, function, or feature.
[0153] A "ribonucleotide" refers to a nucleotide that has a hydroxyl group at the 2' position of the sugar portion. Ribonucleotides may be modified with any of the following substituents.
[0154] "Salt" refers to a physiologically and pharmaceutically acceptable salt of an antisense compound, i.e., a salt that retains the desired biological activity of the parent oligonucleotide and does not impart undesirable toxic effects to the antisense compound.
[0155] A "segment" is defined as a smaller or sub-region within a target nucleic acid.
[0156] The “shortened” or “cleaved” forms of the antisense oligonucleotides taught herein have one, two, or more deleted nucleosides.
[0157] "Side effects" refer to physiological reactions resulting from treatment other than the desired effect. In certain embodiments, side effects include, but are not limited to, injection site reactions, abnormal liver function tests, abnormal kidney function, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, and myopathy.
[0158] "Single-stranded oligonucleotide" refers to an oligonucleotide that is not hybridized to a complementary strand.
[0159] As used herein, “site” is defined as a specific nucleic acid base location within a target nucleic acid.
[0160] "Slowing the progression" means reducing the incidence of the disease.
[0161] "Specifically hybridizing" refers to an antisense compound that has a sufficient degree of complementarity between the antisense oligonucleotide and the target nucleic acid to induce the desired effect, but exhibits minimal or no effect on the non-target nucleic acid under the conditions under which specific binding is desired, i.e., physiological conditions in in vivo assays and therapeutic treatments.
[0162] "Stringent hybridization conditions" or "stringent conditions" refer to conditions under which an oligomeric compound hybridizes to the target nucleic acid, but to a minimum number of other sequences.
[0163] "Subject" means a human or non-human animal selected for treatment or therapy.
[0164] The "target" refers to the protein whose regulation is desired.
[0165] A "target gene" refers to a gene that codes for a target.
[0166] "Targeting" or "targeted" refers to the process of designing and selecting antisense compounds that specifically hybridize to a target nucleic acid and induce a desired effect.
[0167] "Target nucleic acid," "target RNA," "target RNA transcript," and "nucleic acid target" all refer to nucleic acids that can be targeted by antisense compounds.
[0168] The "target region" refers to a portion of the target nucleic acid that is targeted by one or more antisense compounds.
[0169] The "target segment" refers to the nucleotide sequence of the target nucleic acid that the antisense compound is targeting. The "5' target site" refers to the 5' end of the target segment. The "3' target site" refers to the 3' end of the target segment.
[0170] "Tau" refers to mammalian microtubule-associated proteins (MAPT), including human microtubule-associated protein (MAPT).
[0171] "Tau-related disorders" means any disorder associated with any tau nucleic acid or its expression products. Such disorders may include neurodegenerative disorders, such as tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, and Dravet syndrome.
[0172] "Tau mRNA" refers to any messenger RNA expression product of a tau-coding DNA sequence.
[0173] "Tau nucleic acid" means any nucleic acid that codes for tau. For example, in certain embodiments, tau nucleic acid includes a DNA sequence that codes for tau, an RNA sequence transcribed from tau-coding DNA (including genomic DNA with introns and exons), and a tau-coding mRNA sequence. "Tau mRNA" means mRNA that codes for tau protein.
[0174] "Tau protein" refers to the polypeptide expression product of tau nucleic acid.
[0175] "Therapeutic dose" refers to the amount of a drug that provides therapeutic benefit to an individual.
[0176] "Treat," "treating," or "treatment" refers to administering a composition to bring about a change or improvement in a disease or condition.
[0177] "Unmodified nucleic acid bases" refers to the purine bases adenine (A) and guanine (G), as well as the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
[0178] "Unmodified nucleotide" refers to a nucleotide composed of naturally occurring nucleic acid bases, a sugar moiety, and a nucleoside bond. In certain embodiments, the unmodified nucleotide is an RNA nucleotide (i.e., a β-D-ribonucleoside) or a DNA nucleotide (i.e., a β-D-deoxyribonucleoside).
[0179] A "wing segment" refers to multiple nucleosides modified to impart properties to oligonucleotides, such as enhanced inhibitory activity, increased binding affinity to target nucleic acids, or resistance to degradation by in vivonucleases. Specific Embodiments
[0180] Specific embodiments provide methods, compounds, and compositions for inhibiting tau mRNA and protein expression. Specific embodiments also provide methods, compounds, and compositions for reducing tau mRNA and protein levels.
[0181] Certain embodiments provide antisense compounds that target tau nucleic acid. In certain embodiments, tau nucleic acid is cleaved from nucleotides 9240000 to 9381000. GENBANKAccessionNo.NT_010783.15(SEQID (Incorporated herein as NO:1), GENBANK Accession No. N M_001123066.3 (incorporated herein as SEQ ID NO:2), GENBANKAccessionNo.NM_016841.4, (SEQID NO:3) is a mutant mRNA sequence that skips exons 3, 4, 6, 8, 10, and 12. (as incorporated herein) GENBANK Accession No. NT_010783.14 (SEQ) cleaved from nucleotides 2624000~2761000 (Incorporated herein as ID NO:4), GENBANK Accession N o.DR002467.1 (incorporated herein as SEQ ID NO:5), GENBANK Accession No.NM_001203251.1 (SEQIDN (as incorporated herein as O:6), and GENBANK Accession No. This is the sequence shown as NM_016835.4 (incorporated herein as SEQ ID NO:7).
[0182] Certain embodiments provide methods for treating, preventing, or improving tau-related diseases, disorders, and conditions in individuals requiring such treatment. Methods for preparing pharmaceuticals for treating, preventing, or improving tau-related diseases, disorders, or conditions are also envisioned. Tau-related diseases, disorders, and conditions include neurodegenerative diseases. In certain embodiments, tau-related diseases include tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), cortical ganglion degeneration (CBD), epilepsy, and Dravet syndrome.
[0183] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of :20-2443 and SEQ ID NO:2478-2483.
[0184] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of :2444-2477 and SEQ ID NO:2484-2565.
[0185] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence between 20 and 2565.
[0186] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a modified oligonucleotide comprising a nucleic acid base sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135783-135980 of :1.
[0187] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a modified oligonucleotide comprising a nucleic acid base sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135853-135872 of :1.
[0188] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a modified oligonucleotide comprising a nucleic acid base sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135783-135929 of :1.
[0189] A particular embodiment consists of 12 to 30 bound nucleosides, and SEQID NO The present invention provides a modified oligonucleotide comprising a nucleic acid base sequence having at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of nucleic acid bases 135783-135914 of :1.
[0190] In a particular embodiment, the nucleic acid base sequence of the modified oligonucleotide is at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to SEQID NO:1.
[0191] In certain embodiments, the compound is a single-strand modified oligonucleotide.
[0192] In certain embodiments, at least one nucleoside bond of the modified oligonucleotide is a modified nucleoside bond.
[0193] In certain embodiments, at least one modified nucleoside bond is a phosphorothioate This is an internucleoside bond.
[0194] In certain embodiments, each modified nucleoside bond is a phosphorothioate nucleoside bond.
[0195] In certain embodiments, at least one nucleoside bond is a phosphate diester nucleoside bond.
[0196] In certain embodiments, at least one nucleoside bond is a phosphorothioate nucleoside bond, and at least one nucleoside bond is a phosphate diester nucleoside bond.
[0197] In certain embodiments, at least one nucleoside comprises a modified nucleic acid base.
[0198] In certain embodiments, the modified nucleic acid base is 5-methylcytosine.
[0199] In certain embodiments, at least one nucleoside of the modified oligonucleotide comprises a modified sugar.
[0200] In certain embodiments, at least one modified sugar is a bicyclic sugar.
[0201] In certain embodiments, the bicyclic sugar comprises a chemical bond between the 2' and 4' positions of a sugar 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C12 alkyl, or a protecting group.
[0202] In certain embodiments, the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C12 alkyl, or a protecting group.
[0203] In certain embodiments, at least one modified sugar comprises a 2'-O-methoxyethyl group.
[0204] In certain embodiments, the modified sugar comprises a 2'-O(CH2)2-OCH3 group.
[0205] In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 10 linked deoxynucleosides; a 5' wing segment consisting of 5 linked nucleosides; and a 3' wing segment consisting of 5 linked nucleosides; wherein the gap segment is positioned between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment comprises a modified sugar.
[0206] In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 9 linked deoxynucleosides; a 5' wing segment consisting of 5 linked nucleosides; and a 3' wing segment consisting of 5 linked nucleosides; wherein The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0207] In a particular embodiment, the modified oligonucleotide is: A gap segment consisting of seven bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0208] In a particular embodiment, the modified oligonucleotide is: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0209] In a particular embodiment, the modified oligonucleotide is: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of four bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar.
[0210] In certain embodiments, the modified oligonucleotide comprises: a gap segment consisting of 8 linked deoxynucleosides; a 5’ wing segment consisting of 6 linked nucleosides; and, a 3’ wing segment consisting of 4 linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment, and each nucleoside of each wing segment comprises a modified sugar.
[0211] In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.
[0212] In certain embodiments, the modified oligonucleotide consists of 19 linked nucleosides.
[0213] In certain embodiments, the modified oligonucleotide consists of 18 linked nucleosides.
[0214] In certain embodiments, it comprises any compound or salt thereof described herein, and at least one pharmaceutically acceptable carrier or diluent.
[0215] In certain embodiments, it comprises administration of any compound or composition described herein to an animal.
[0216] In certain embodiments, the animal is a human.
[0217] In certain embodiments, administration of the compound prevents, treats, ameliorates, or delays the progression of a tau-related disease, disorder, or condition.
[0218] In certain embodiments, the disease, disorder, or condition is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome.
[0219] Certain embodiments provide the use of any compound or composition described herein for the manufacture of a pharmaceutical for the treatment of neurodegenerative disorders.
[0220] A specific embodiment is a compound that conforms to the following formula (Ia):
[0221] [ka]
[0222] or a pharmaceutically acceptable salt thereof is provided. In certain embodiments, a pharmaceutical composition comprising a compound having formula (Ia) is provided.
[0223] A specific embodiment is a compound conforming to the following formula (IIa):
[0224] [ka]
[0225] or a pharmaceutically acceptable salt thereof is provided. In certain embodiments, a pharmaceutical composition comprising a compound having formula (IIa) is provided.
[0226] A specific embodiment is a compound conforming to the following formula (IIIa):
[0227] [ka]
[0228] or a pharmaceutically acceptable salt thereof is provided. In certain embodiments, a pharmaceutical composition comprising a compound having formula (IIIa) is provided.
[0229] A specific embodiment is a compound conforming to the following formula (IVa):
[0230] [ka]
[0231] or a pharmaceutically acceptable salt thereof is provided. In certain embodiments, a pharmaceutical composition comprising a compound having formula (IVa) is provided.
[0232] A specific embodiment is a compound that conforms to the following formula (Va):
[0233] [ka]
[0234] or a pharmaceutically acceptable salt thereof is provided. In certain embodiments, a pharmaceutical composition comprising a compound having formula (Va) is provided. Antisense compounds
[0235] Oligomer compounds include, but are not limited to, oligonucleotides, oligonucleosides, oligonucleotide analogs, oligonucleotide mimetic agents, antisense compounds, antisense oligonucleotides, and siRNA. Oligomer compounds may be "antisense" with respect to the target nucleic acid, meaning they can undergo hybridization with the target nucleic acid via hydrogen bonding.
[0236] In certain embodiments, the antisense compound has a nucleic acid base sequence that, when described in the 5' to 3' direction, includes the reverse complement of the target segment of the target nucleic acid it targets. In certain such embodiments, the antisense oligonucleotide has a nucleic acid base sequence that, when described in the 5' to 3' direction, includes the reverse complement of the target segment of the target nucleic acid it targets.
[0237] In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 12 to 30. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 12 to 25. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 12 to 22. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 14 to 20. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 15 to 25. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 18 to 22. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 19 to 21. In certain embodiments, the antisense compound has a bonded subunit length of 8-80, 12-50, 13-30, 13-50, 14-30, 14-50, 15-30, 15-50, 16-30, 16-50, 17-30, 17-50, 18-30, 18-50, 19-30, 19-50, or 20-30.
[0238] In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 12. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 13. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 14. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 15. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 16. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 17. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 18. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 19. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 20. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 21. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 22. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 23. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 24. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 25. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 26. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 27. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 28. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 29. In certain embodiments, the antisense compound targeting tau nucleic acid has a subunit length of 30.In certain embodiments, the antisense compound targeting tau nucleic acid is a binding subunit length of 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80, or a range defined by any two of the above values. In certain embodiments, the antisense compound is an antisense oligonucleotide, and the binding subunit is a nucleotide.
[0239] In certain embodiments, antisense oligonucleotides targeting tau nucleic acid may be shortened or cleaved. For example, a single subunit may be deleted from the 5' end (5'-cleaved type) or from the 3' end (3'-cleaved type). A shortened or cleaved antisense compound targeting tau nucleic acid may have two subunits deleted from the 5' end of the antisense compound or two subunits deleted from the 3' end. Alternatively, the deleted nucleoside may be dispersed throughout the antisense compound, for example, in an antisense compound having one nucleoside deleted from the 5' end and one nucleoside deleted from the 3' end.
[0240] If a single addition subunit is present in an extended antisense compound, the addition subunit may be located at the 5' or 3' end of the antisense compound. If two or more addition subunits are present, the added subunits may be adjacent to each other in an antisense compound having, for example, two subunits added (5'-addition) to the 5' end or (3'-addition) to the 3' end of the antisense compound. Alternatively, the added subunits may be dispersed throughout the antisense compound, for example, in an antisense compound having one subunit added at the 5' end and one subunit added at the 3' end.
[0241] It is possible to increase or decrease the length of antisense compounds such as antisense oligonucleotides, and / or introduce mismatched bases without eliminating activity. For example, Woolfetal. (Proc. Natl. Acad. Sci. USA) In 89:7305-7309, 1992, a series of antisense oligonucleotides with 13–25 nucleotide lengths were tested for their ability to induce target RNA cleavage in an oocyte injection model. Antisense oligonucleotides with 25 nucleotide lengths containing 8 or 11 mismatched bases near the ends were able to induce specific cleavage of target mRNA, even to a lesser extent than antisense oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13-nucleotide antisense oligonucleotides, including those with 1 or 3 mismatches.
[0242] Gautschi et al(J.Natl.Cancer Inst.93:463 -471, March 2001) was used in vitro and in vivo to treat bcl-2 and bcl -100% complementation for bcl-2 mRNA to reduce the expression of both xL oligonucleotides that have three mismatches with bcl-xL mRNA It demonstrated its capabilities. Furthermore, this oligonucleotide showed effective antitumor activity in vivo.
[0243] Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14-nucleotide antisense oligonucleotides, as well as 28- and 42-nucleotide antisense oligonucleotides composed of two or three sequences of tandem antisense oligonucleotides, for their ability to halt human DHFR translation in a rabbit reticulocyte assay. Despite being at moderate levels compared to the 28- or 42-nucleotide antisense oligonucleotides, each of the three 14-nucleotide antisense oligonucleotides was able to inhibit translation individually. Antisense compound motif
[0244] In certain embodiments, antisense compounds targeting tau nucleic acids have chemically modified subunits arranged in a pattern or motif to enhance antisense compound properties such as enhanced inhibitory activity, increased binding affinity to the target nucleic acid, or resistance to in vivo nuclease-mediated degradation.
[0245] Chimeric antisense compounds typically contain at least one region modified to impart increased resistance to nuclease degradation, increased cellular uptake, increased binding affinity to target nucleic acids, and / or increased inhibitory activity. The second region of the chimeric antisense compound may, selectively, serve as a substrate for cellular endonuclease RNaseH, which cleaves the RNA strand of RNA:DNA double helix.
[0246] Antisense compounds having a gapmer motif are considered to be chimeric antisense compounds. In a gapmer, the internal region having multiple nucleotides supporting RNaseH cleavage is located between the nucleoside of the internal region and the external region having multiple nucleotides chemically distinct from each other. In the case of antisense oligonucleotides having a gapmer motif, the gap segment generally serves as a substrate for endonuclease cleavage, while the wing segment contains a modified nucleoside. In certain embodiments, the regions of the gapmer are identified by the type of sugar moiety containing each distinct region. The types of sugar moieties used to identify the regions of the gapmer are, in some embodiments, β-D-ribonucleosides, β-D-deoxyribonucleosides, 2'-modified nucleosides (such 2'-modified nucleosides may include, among other things, 2'-MOE and 2'-O-CH3), and bicyclic sugar-modified nucleosides (such bicyclic sugar-modified nucleosides may include those having a 4'-(CH2)nO-2' bridge, where n It may include n=1 or n=2 and 4'-CH2-O-CH2-2'. In certain embodiments, the wings may include several modified sugar moieties, for example, 2'-MOE. In certain embodiments, the wings may include several modified and unmodified sugar moieties. In certain embodiments, the wings may include various combinations of 2'-MOE nucleoside and 2'-deoxynucleoside.
[0247] Each distinct region may contain a uniform sugar moiety, a variant, or alternating sugar moiety. The wing-gap-wing motif is frequently described as "XYZ," where "X" represents the length of the 5'-wing, "Y" represents the length of the gap, and "Z" represents the length of the 3'-wing. "X" and "Z" may contain uniform, variant, or alternating sugar moieties. In certain embodiments, "X" and "Y" may contain one or more 2'-deoxynucleosides. "Y" may contain a 2'-deoxynucleoside. As used herein, a gapmer described as "XYZ" has a configuration such that the gap is located in direct proximity to the 5'-wing and the 3'-wing, respectively. Thus, there are no nucleotides between the 5'-wing and the gap or between the gap and the 3'-wing. Any antisense compound described herein may have a gapmer motif. In certain embodiments, "X" and "Z" are the same; in other embodiments, they are different.
[0248] In certain embodiments, the gapmers provided herein include, for example, a 20-mer having a 5-10-5 motif.
[0249] In certain embodiments, the gapmer provided herein is, for example, a 5-9-5 mo Includes 19-Mar, who has a chief.
[0250] In certain embodiments, the gapmers provided herein include, for example, an 18-mer having a 5-8-5 motif.
[0251] In certain embodiments, the gapmers provided herein include, for example, an 18-mer having a 4-8-6 motif.
[0252] In certain embodiments, the gapmers provided herein include, for example, an 18-mer having a 6-8-4 motif.
[0253] In certain embodiments, the gapmers provided herein include, for example, an 18-mer having a 5-7-6 motif. Target nucleic acid, target region, and nucleotide sequence
[0254] The nucleotide sequences encoding tau include, but are not limited to, the following: GENBANK Accession No. 9240000-9381000. .NT_010783.15 (incorporated herein as SEQ ID NO:1), GENBANK Accession No.NM_001123066.3 (SEQID GENBANK AccessionNo.NM_, a mutant mRNA sequence that skips exons 3, 4, 6, 8, 10, and 12 (as incorporated herein as NO:2). 016841.4, (incorporated herein as SEQ ID NO:3), GENBANKAccession cleaved from nucleotides 2624000-2761000. No.NT_010783.14 (incorporated herein as SEQ ID NO:4), GENBANK Accession No.DR002467.1 (SEQIDNO (as incorporated herein as :5), GENBANK AccessionNo.NM_ 001203251.1 (incorporated herein as SEQ ID NO: 6), and GENBANK Accession No. NM_016835.4 (SEQID NO: (Incorporated herein as 7).
[0255] In the examples contained herein, the sequences indicated by each SEQ IDNO are sugars It is understood that this is independent of any modification to the moiety, nucleoside bond, or nucleic acid base. Therefore, an antisense compound defined by SEQ ID NO may independently contain one or more modifications to the sugar moiety, nucleoside bond, or nucleic acid base. An antisense compound described by Isis number (Isis No) is defined by the nucleic acid base sequence and This shows combinations of motifs.
[0256] In certain embodiments, the target region is a structurally defined region of the target nucleic acid. For example, the target region may encompass the 3'UTR, 5'UTR, exons, introns, exon / intron junctions, coding regions, translation start regions, translation termination regions, or other defined nucleic acid regions. Structurally defined regions for tau can be obtained by accession numbers from sequence databases such as NCBI, and such information is incorporated herein by reference. In certain embodiments, the target region may encompass the sequence from the 5' target site of one target segment within the target region to the 3' target site of another target segment within the same target region.
[0257] Targeting involves determining at least one target segment into which the antisense compound hybridizes to produce the desired effect. In certain embodiments, the desired effect is a reduction in the level of the target mRNA nucleic acid. In certain embodiments, the desired effect is a reduction in the level of the protein encoded by the target nucleic acid or a phenotypic change related to the target nucleic acid.
[0258] The target region may contain one or more target segments. Multiple target segments within the target region may overlap, or they may not overlap. In certain embodiments, the target segments within the target region are separated by approximately 300 or fewer nucleotides. In certain embodiments, the target segments within the target region are separated by many nucleotides. That is, nucleotides on the target nucleic acid that are 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10, or about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 or less, or about 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 or less, or a range defined by any two of the above values. In certain embodiments, the target segment within the target region is separated by 5 or fewer nucleotides on the target nucleic acid, or about 5 or fewer nucleotides. In certain embodiments, the target segments are adjacent. The target region is intended to be defined by a range having an initiating nucleic acid that is either a 5' target site or a 3' target site as described herein.
[0259] Appropriate target segments are 5'UTR, code region, 3'UTR, intron, and exc. They can be found within son or exon / intron junctions. Target segments containing start or stop codons are also suitable target segments. Suitable target segments can specifically exclude certain structurally defined regions, such as start or stop codons.
[0260] Determining an appropriate target segment may involve comparing the target nucleic acid sequence to other sequences throughout the genome. For example, the BLAST algorithm may be used to identify similar regions among different nucleic acids. This comparison can prevent the selection of antisense compound sequences that may non-specifically hybridize with sequences other than the selected target nucleic acid (i.e., non-target or off-target sequences).
[0261] Variations in the activity of antisense compounds within the active target region (defined, for example, by a percentage decrease in the target nucleic acid level) may exist. In certain embodiments, a decrease in tau mRNA levels is an indicator of tau expression inhibition. A decrease in tau protein levels is also an indicator of target mRNA expression inhibition. Furthermore, phenotypic changes are indicators of tau expression inhibition. Improved neuronal function is an indicator of tau expression inhibition. Improved memory and motor function are indicators of regulation of tau expression inhibition. A decrease in neurofibrillary inclusions is an indicator of tau expression inhibition. Hybridization
[0262] In some embodiments, hybridization occurs between the antisense compounds disclosed herein and tau nucleic acids. The most common mechanism of hybridization involves hydrogen bonding between complementary nucleic acid bases of the nucleic acid molecule (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonding).
[0263] Hybridization can occur under a variety of conditions. The stringent conditions are sequence-dependent and are determined by the properties and composition of the nucleic acid molecules being hybridized.
[0264] Methods for determining whether a sequence can specifically hybridize to a target nucleic acid are well known in the art. In certain embodiments, the antisense compounds provided herein are specifically hybridizable to tau nucleic acids. Complementarity
[0265] If a sufficient number of nucleic acid bases in the antisense compound can form hydrogen bonds with the corresponding nucleic acid bases of the target nucleic acid, the antisense compound and the target nucleic acid are complementary to each other, and the desired effect will occur (e.g., antisense inhibition of the target nucleic acid, such as tau nucleic acid).
[0266] Non-complementary nucleic acid bases between the antisense compound and the tau nucleic acid may be acceptable, provided that the antisense compound remains capable of specifically hybridizing to the target nucleic acid. Furthermore, the antisense compound can hybridize to one or more segments of the tau nucleic acid such that the segment it intervenes in or adjacent does not participate in hybridization events (e.g., loop structures, mismatches, or hairpin structures).
[0267] In certain embodiments, the antisense compounds or specific portions thereof provided herein are at least 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to tau nucleic acid, a target region, a target segment, or a specific portion thereof. The percentage complementarity of the antisense compound to the target nucleic acid may be determined using a predetermined method.
[0268] For example, an antisense compound in which 18 of its 20 nucleic acid bases are complementary to the target region and therefore will specifically hybridize represents 90 percent complementarity. In this example, the remaining non-complementary nucleic acid bases can form clusters with the complementary nucleic acid bases or be scattered among them, and do not need to be adjacent to each other or to the complementary nucleic acid bases. Thus, an antisense compound with an 18-nucleotide length having four non-complementary nucleic acid bases adjacent to two regions that are perfectly complementary to the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would therefore fall within the scope of the present invention. The % complementarity of an antisense compound with a region of the target nucleic acid can usually be determined using BLAST (Basic Local Alignment Search Tool) and PowerBLAST programs known in the art (Altschuletal., J.Mo). l. Biol., 1990, 215, 403 410; Zhang and Madden, G enome Res.,1997,7,649 656). The percentage of homology, sequence identity, or complementarity is calculated using the Gap program (Wisconsin Sequence Analysis Pack) with default settings, for example, using the algorithm of Smith and Waterman (Adv. Appl. Math.,1981,2,482489). age,Version 8 for Unix,Genetics Computer Group,University Research Park,MadisonWis. This can be determined by:
[0269] In certain embodiments, the antisense compounds or specific portions thereof provided herein are fully complementary (i.e., 100% complementary) to the target nucleic acid or specific portion thereof. For example, an antisense compound may be fully complementary to a tau nucleic acid or its target region, target segment, or target sequence. As used herein, “fully complementary” means that each nucleic acid base of the antisense compound can precisely base-pair with the corresponding nucleic acid base of the target nucleic acid. For example, a 20-nucleotide antisense compound is fully complementary to a target sequence that is 400 nucleic acid bases long, insofar as there is a corresponding 20-nucleotide portion of the target nucleic acid that is fully complementary to the antisense compound. “Fully complementary” may also be used in reference to specific portions of a first and / or second nucleic acid. For example, a 20-nucleotide portion of a 30-nucleotide antisense compound may be “fully complementary” to a target sequence that is 400 nucleic acid bases long. If the target sequence has a corresponding 20-nucleotide portion such that each nucleic acid base is complementary to the 20-nucleotide portion of the antisense compound, then the 20-nucleotide portion of the 30-nucleotide oligonucleotide is fully complementary to the target sequence. At the same time, the entire 30-nucleotide antisense compound may or may not be perfectly complementary to the target sequence, depending on whether the remaining 10 nucleotides of the antisense compound are also complementary to the target sequence.
[0270] The location of the non-complementary nucleic acid base may be at the 5' or 3' end of the antisense compound. Alternatively, the non-complementary nucleic acid base or non-complementary nucleic acid bases may be located inside the antisense compound. If two or more non-complementary nucleic acid bases are present, they may be adjacent (i.e., bonded) or non-adjacent. In one embodiment, the non-complementary nucleic acid base is located in the wing segment of the gapmer antisense oligonucleotide.
[0271] In certain embodiments, an antisense compound having a nucleic acid base length of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, or a nucleic acid base length up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20, contains 4 or fewer, 3 or fewer, 2 or fewer, or 1 or fewer non-complementary nucleic acid bases with respect to a target nucleic acid such as tau nucleic acid or a specific portion thereof.
[0272] In a specific embodiment, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 ,21,22,23,24,25,26,27,28,29 or 30 nucleic acid base lengths or 11,12,13,14,15,16,17,18,19,20,21,2 Antisense compounds with nucleic acid base lengths of 2, 23, 24, 25, 26, 27, 28, 29, or up to 30 contain target nucleic acids such as tau nucleic acids or 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 or fewer non-complementary nucleic acid bases relative to this particular portion.
[0273] The antisense compounds provided herein include those complementary to portions of the target nucleic acid. As used herein, “portion” refers to a defined number of adjacent (i.e., bound) nucleic acid bases within a region or segment of the target nucleic acid. “Portion” may also refer to a defined number of adjacent nucleic acid bases of the antisense compound. In certain embodiments, the antisense compound is complementary to at least eight nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least nine nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least ten nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least eleven nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least twelve nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least thirteen nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least fourteen nucleic acid base portions of the target segment. In certain embodiments, the antisense compound is complementary to at least fifteen nucleic acid base portions of the target segment. Antisense compounds that are complementary to at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more nucleic acid base parcels of the target segment, or to nucleic acid base parcels within a range defined by any two of these values, are also intended. identity
[0274] The antisense compounds provided herein are specific nucleotide sequences, SEQI Compounds represented by D NO, or a specific Isis number, or parts thereof. In contrast, they may have a defined % identity. When used herein, an antisense compound is identical to a sequence disclosed herein if it has the same nucleic acid base pairing ability. For example, an RNA containing uracil instead of thymidine in a disclosed DNA sequence is considered identical to the DNA sequence because both uracil and thymidine pair with adenine. The truncated and extended forms of the antisense compounds described herein are intended in the same way as compounds having non-identical bases to the antisense compounds provided herein. Non-identical bases may be adjacent to each other or may be dispersed throughout the antisense compound. The % identity of an antisense compound is calculated according to the number of bases that have identical base pairs to the sequence being compared.
[0275] In certain embodiments, the antisense compound or portion thereof is at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identical to one or more antisense compounds or SEQ ID NOs or portions thereof disclosed herein.
[0276] In certain embodiments, a portion of the antisense compound is compared to a portion of the target nucleic acid of equal length. In certain embodiments, portions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleic acid bases are compared to a portion of the target nucleic acid of equal length.
[0277] In certain embodiments, a portion of the antisense oligonucleotide is compared to a portion of the target nucleic acid of equal length. In certain embodiments, portions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleic acid bases are compared to a portion of the target nucleic acid of equal length. qualification
[0278] A nucleoside is a base-sugar combination. The nucleic acid base (also known as the base) portion of a nucleoside is usually a heterocyclic base portion. A nucleotide is a nucleoside that further contains a phosphate group covalently bonded to the sugar portion of the nucleoside. For these nucleosides containing pentofuranosyl sugars, the phosphate group may be bonded to the 2',3' or 5' hydroxyl portion of the sugar. Oligonucleotides are formed by the covalent bonds of adjacent nucleosides to form linear polymer oligonucleotides. Within the oligonucleotide structure, the phosphate group is generally said to form the internucleoside bond of the oligonucleotide.
[0279] Modifications to antisense compounds include substitutions or changes to nucleoside bonds, sugar moieties, or nucleic acid bases. Modified antisense compounds are often preferred over their natural forms due to desirable properties such as enhanced cellular uptake, increased affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.
[0280] Chemically modified nucleosides may be used to increase the binding affinity of shortened or cleaved antisense oligonucleotides to their target nucleic acids. As a result, equivalent results are often obtained with shorter antisense compounds having such chemically modified nucleosides. Inter-modified nucleoside bonding
[0281] The naturally occurring nucleoside-to-nucleoside bond in RNA and DNA is a 3'-to-5' phosphodiester bond. Antisense compounds with one or more modified, i.e., non-naturally occurring, nucleoside-to-nucleoside bonds are often preferred over antisense compounds with naturally occurring nucleoside-to-nucleoside bonds due to desirable properties such as enhanced cellular uptake, increased affinity for target nucleic acids, and increased stability in the presence of nucleases.
[0282] Oligonucleotides having modified nucleoside bonds include nucleoside bonds that retain a phosphorus atom and nucleoside bonds that do not contain a phosphorus atom. Typical phosphorus-containing nucleoside bonds include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates. Methods for preparing phosphorus-containing and phosphorus-free bonds are well known.
[0283] In certain embodiments, the antisense compound targeting tau nucleic acid contains one or more modified nucleoside bonds. In certain embodiments, the modified nucleoside bonds are scattered throughout the antisense compound. In certain embodiments, the modified nucleoside bonds are phosphorothioate bonds. In certain embodiments, each nucleoside bond in the antisense compound is a phosphorothioate nucleoside bond. modified sugar moiety
[0284] Antisense compounds may optionally include one or more nucleosides that are modified with sugar groups. Such sugar-modified nucleosides may impart to the antisense compound enhanced nuclease stability, enhanced binding affinity, or any other biological properties. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include the addition of substituents (including 5' and 2' substituents), bridging of non-geminal ring atoms to form a bicyclic nucleic acid (BNA), and substitution of ribosyl ring oxygen atoms by S,N(R), or C(R1)(R2) (R,R1 and R2 are independently H,C1-C 12 This includes, but is not limited to, alkyl or protecting groups, and combinations thereof. Examples of chemically modified sugars include 2'-F-5'-methyl substituted nucleosides (see PCT international application WO2008 / 101157 published on 8 / 21 / 08 for other disclosed 5',2'-bis substituted nucleosides), or 2 This includes substitution of the ribosyl ring oxygen atom with S further substituted at the ' position (see published U.S. Patent Application US2005-0130923, published June 16, 2005), or 5'-substitution of BNA (see PCT International Application WO2007 / 134181, published 11 / 22 / 07, in which LNA is substituted with, for example, a 5'-methyl or 5'-vinyl group).
[0285] Examples of nucleosides having a modified sugar moiety include, without limitation, nucleosides containing the substituents 5'-vinyl, 5'-methyl(R or S), 4'-S, 2'-F, 2'-OCH3, 2'-OCH2CH3, 2'-OCH2CH2F, and 2'-O(CH2)2OCH3. The substituent at the 2' position may be allyl, amino, azide, thio, O-allyl, or O-C1-C 10 Alkyl,OCF3,OCH2F,O(CH2)2SCH3,O(CH2)2-ON(R m )( R n ),O-CH2-C(=O)-N(R m )(R n ), and O-CH2-C(=O)-N(R l )-(CH2)2-N(R m )(R n ) can also be selected from, and here, R l ,R m and R n These are independently H or substituted or unsubstituted C1-C 10 It is alkyl.
[0286] As used herein, “bicyclic nucleoside” refers to a modified nucleoside containing a bicyclic sugar moiety. Examples of bicyclic nucleosides include, without limitation, nucleosides having a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense compounds provided herein include one or more bicyclic nucleosides having a bridge from 4' to 2'. Includes rheosides. Examples of such 4'-to-2' bridged bicyclic nucleosides include, but are not limited to, one of the following: 4'-(CH2)-O-2'(LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2'(ENA); 4'-CH(CH3)-O-2' and 4'-CH(CH2OCH3)-O-2' (and its analogues 20 See U.S. Patent No. 7,399,845 issued on 15 July 2008); 4'-C(CH3)(CH3)-O-2' (and its analogues in Published International Application WO / 200 issued on 8 January 2009) See 9 / 006478); 4'-CH2-N(OCH3)-2' (and its analogues, see published international application WO / 2008 / 150729 issued December 11, 2008); 4'-CH2 -ON(CH3)-2' (Published U.S. Patent Application US2004-, published September 2, 2004) See 0171570); 4'-CH2-N(R)-O-2', where R is H, C1-C 12 Alkyl or protecting group (U.S. Patent No. 7,427 issued September 23, 2008) See 672); 4'-CH2-C(H)(CH3)-2' (see Chattopadhyaya et al., J.Org.Chem., 2009, 74, 118-134); and 4'-CH2-C-(=CH2)-2' (and its analogues, see published international application WO2008 / 154401 issued December 8, 2008).
[0287] Further reports related to bicyclic nucleosides can be found in published literature (see, for example: Singh et al., Chem.Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54). ,3607-3630;Wahlestedt et al.,Proc.Natl.Acad.Sci.USA,2000,97,5633-5638;Kumaret al.,Bioorg.Med.Chem.Lett.,1998,8,2219-2222;Singh et al.,J.Org.Chem.,1998,63,10035-10039;Srivastavaetal.,J.Am.Chem.Soc.,2 007,129(26)8362-8379;Elayadiet al.,Curr. Opinion Invest.Drugs,2001,2,558-561;Braa sch et al., Chem. Biol., 2001, 8, 1-7; and Orume t al.,Curr.Opinion Mol.Ther.,2001,3,239-2 43; US Patent Publications 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; US Patent Publication No. US2008-0039618; US2009-0012281; US Patent Serial Numbers 60 / 989,574; 61 / 026,995; 61 / 026,998; 61 / 056,564; 61 / 086,231; 61 / 097,787; and 61 / 099,844; Published PC International applications WO1994 / 014226; WO 2004 / 106356; WO2005 / 021570; WO 2007 / 134181; WO2008 / 150729; WO 2008 / 154401; and WO2009 / 006478. For example, α-L-riboflavin. Each of the above bicyclic nucleosides having one or more stereochemical sugar structures including ribofuranose and β-D-ribofuranose can be prepared (as of 1999 WO 99 / 14226). (See PCT international application PCT / DK98 / 00393, published on March 25.)
[0288] In certain embodiments, the bicyclic sugar moiety of the BNA nucleoside includes, but is not limited to, a compound having at least one crosslink between the 4' and 2' positions of the pentofuranosyl sugar moiety, and such crosslinks include -[C(R a )(R b )] n -,C(R a )=C(R b )-,C(R a )=N-,-C(=O)-,-C(=NR a )-,-C(=S)-,-O-,-Si(R a )2-,-S(=O) x -, and -N(R a )- independently contains one or two to four bonding groups independently selected from; Here: x is 0, 1, or 2; n is 1, 2, 3, or 4; Each R a and R b These are independently H, protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl substitution C2-C 12 Alkinyl, C5-C 20 Aryl, substitution C5-C 20 Aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and Each of J1 and J2 is independently H,C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl substitution C2-C 12Alkinyl, C5-C 20 Aryl, substitution C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12 Aminoalkyl, substituted C1-C 12 It is an aminoalkyl group or a protecting group.
[0289] In certain embodiments, the crosslinking of the bicyclic sugar moiety is -[C(R a )(R b )] n -,-[C(R a )(R b )] n -O-,-C(R a R b )-N(R)-O-, or -C(R a R b )-ON(R)-. In certain embodiments, the crosslinks are 4'-CH2-2',4'-(CH2)2-2',4'-(CH2)3-2',4'-CH2-O-2',4'-(CH2)2-O-2',4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2'-, where each R is independently H, a protecting group, or C1-C 12 It is alkyl.
[0290] In certain embodiments, bicyclic nucleosides are further defined by their isomer configuration. For example, a nucleoside containing a 4'-2'-methylene-oxybridge may have either an α-L configuration or a β-D configuration. Previously, the configuration of α-L-methyleneoxy(4'-CH2-O-2')BNA was incorporated into antisense oligonucleotides exhibiting antisense activity (Friedenetal., Nucleic Acids Research, 2020). (03,21,6365-6372).
[0291] In certain embodiments, the bicyclic nucleoside is as follows: (A) α-L-methyleneoxy(4'-CH2-O-2')BNA, (B) β-D-methyleneoxy(4'-CH2-O-2')BNA, (C) ethyleneoxy(4'-(CH2)2-O-2')BNA, (D) aminooxy(4'-CH2-ON(R)-2')BNA, (E) oxyamino(4'-CH2-N(R)-O-2')B This includes, but is not limited to, NA, and (F) methyl(methyleneoxy)(4'-CH(CH3)-O-2')BNA, (G) methylene-thio(4'-CH2-S-2')BNA, (H) methylene-amino(4'-CH2-N(R)-2')BNA, (I) methyl carboncyclic(4'-CH2-CH(CH3)-2')BNA, and (J) propylene carboncyclic(4'-(CH2)3-2')BNA.
[0292] [ka]
[0293] Here, Bx is the base portion, and R is independently H, a protecting group, or C1-C 12 It is alkyl.
[0294] In certain embodiments, a bicyclic nucleoside having formula I is provided:
[0295] [ka]
[0296] Here: Bx is the heterocyclic base moiety; -Q a -Q b -Q c - is -CH2-N(R c )-CH2-,-C(=O)-N(R c )-CH2-,-CH2-ON(R c )-,-CH2-N(R c )-O-, or -N(R c It is )-O-CH2; Rc is a C1-C 12 alkyl or amino protecting group; T a and T b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond with a support.
[0297] In certain embodiments, bicyclic nucleosides having Formula II are provided:
[0298]
Chemical formula
[0299] where: Bx is a heterocyclic base moiety; T a and T b are each, independently, H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond with a support; Z a is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, substituted amide, thiol, or substituted thio.
[0300] In one embodiment, each of the substituents is independently mono- or polysubstituted with a substituent selected from halogen, oxo, hydroxyl, OJ c , NJ c J d , SJ c , N3, OC(=X)J c , and NJ e C(=X)NJ c J d and is mono- or polysubstituted with substituents selected independently from c , J d , and J e where each J c is independently H, C1-C6 alkyl, or substituted C1-C6 alkyl, and X is O or NJ
[0301] In certain embodiments, a bicyclic nucleoside having formula III is provided:
[0302] [ka]
[0303] Here: Bx is the heterocyclic base moiety; T a and T b Each of these is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond with a support; Z b These are C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, or substituted acyl (C(=O)-).
[0304] In certain embodiments, a bicyclic nucleoside having formula IV is provided:
[0305] [ka]
[0306] Here: Bx is the heterocyclic base moiety; T a and T b Each of these is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond with a support; R d These are C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; q a , q b , q c , and q dThese are independently H, halogen, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl or substituted C2-C6 alkynyl, C1-C6 alkoxyl, substituted C1-C6 alkoxyl, acyl, substituted acyl, C1-C6 aminoalkyl or substituted C1-C6 aminoalkyl.
[0307] In certain embodiments, a bicyclic nucleoside having formula V is provided:
[0308] [ka]
[0309] Here: Bx is the heterocyclic base moiety; T a and T b Each of these is independently H, a hydroxyl protecting group, a conjugate group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond with a support; q a ,q b ,q e , and q f These are, independently, hydrogen, halogen, and C1-C. 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl substitution C2-C 12 Alkinyl, C1-C 12 Alkyl, substituted C1-C 12 Alkoxy, OJ j SJ j ,SOJ j SO2J j ,NJ j J k ,N3,CN,C(=O)OJ j ,C(=O)NJ j J k ,C(=O)J j OC(=O)NJ j J k,N(H)C(=NH)NJ j J k ,N(H)C(=O)NJ j J k , or N(H)C(=S)NJ j J k Is it; Alternatively, q e and q f Both are = C(q g )(q h ) and; q g and q h These are H, halogen, and C1-C, respectively, independently. 12 Alkyl or substituted C1-C 12 It is alkyl.
[0310] The synthesis and preparation of methyleneoxy(4'-CH2-O-2')BNA monomers, adenine, cytosine, guanine, 5-methylcytosine, thymine, and uracil, along with their oligomerization and nucleic acid recognition properties, are described (Koshkinetal). (Tetrahedron, 1998, 54, 3607-3630). BNA and its preparation are also described in WO 98 / 39352 and WO 99 / 14226.
[0311] Analogues of methyleneoxy(4'-CH2-O-2')BNA and 2'-thio-BNA have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of locked nucleoside analogues containing oligodeoxyribonucleotide double helixes as substrates for nucleic acid polymerases has also been described (Wengeletal., WO 99 / 14226). Furthermore, conformationally fixed... The synthesis of 2'-amino-BNA, a high-affinity oligonucleotide analog, has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Furthermore, 2'-amino- and 2'-methylamino-BNA have been prepared, and the thermal stability of their double helix structures, which have complementary RNA and DNA strands, has been previously reported.
[0312] In certain embodiments, a bicyclic nucleoside having formula VI is provided:
[0313] [ka]
[0314] Here: Bx is the heterocyclic base moiety; T a and T b Each of these is independently H, a hydroxyl protecting group, a conjugated group, a reactive phosphorus group, a phosphorus moiety, or a covalent bond to a support; Each q i ,q j ,q k , and q l These are independently H, halogen, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl substitution C2-C 12 Alkinyl, C1-C 12 Alkoxyl, substituted C1-C 12 Alkoxyl, OJ j SJ j ,SOJ j SO2J j ,NJ j J k ,N3,CN,C(=O)OJ j ,C(=O)NJ j J k ,C(=O)J j OC(=O)NJ j Jk ,N(H)C(=NH)NJ j J k ,N(H)C(=O)NJ j J k , or N(H)C(=S)NJ j J k and q i and q j or q l and q k Both are = C(q g )(q h ) and q g and q h These are H, halogen, and C1-C, respectively, independently. 12 Alkyl or substituted C1-C 12 It is alkyl.
[0315] A single carbocyclic bicyclic nucleoside and an alkenyl analog bridged 4'-CH=CH-CH2-2' having a 4'-(CH2)3-2' bridge have been described (Freieret). (Albaek et al., Nucleic Acids Research, 1997, 25(22), 4429-4443 and Albaek et al., J. Org. Chem., 2006, 71, 7731-7740). The synthesis and preparation of carbocyclic and bicyclic nucleosides, along with their oligomerization and biochemical studies, are described (Srivastava et al., J. Am. Chem. Soc., 2007, 129(26), 8362-8379).
[0316] As used herein, “4'-2' bicyclic nucleoside” or “4'~2' bicyclic nucleoside” refers to a bicyclic nucleoside containing a furanose ring that includes a bridge connecting the two carbon atoms of the furanose ring that connects the 2' carbon atom of the sugar ring to the 4' carbon atom of the sugar ring.
[0317] As used herein, “monocyclic nucleoside” refers to a nucleoside containing a modified sugar moiety that is not a bicyclic sugar moiety. In certain embodiments, the sugar moiety of the nucleoside, or a sugar moiety analogue, may be modified or substituted at any position.
[0318] As used herein, “2'-modified sugar” means a furanosyl sugar modified at the 2' position. In certain embodiments, such modifications include, but are not limited to, substituents selected from: substituted and unsubstituted alkoxys, substituted and unsubstituted thioalkyls, substituted and unsubstituted aminoalkyls, substituted and unsubstituted alkyls, substituted and unsubstituted allyls, and substituted and unsubstituted alkynyls in halides. In certain embodiments, the 2' modification is selected from, but is not limited to, substituents including: O[(CH2) n O] m CH3,O(CH2) n NH2,O(CH2) n CH3,O(CH2) n F,O(CH2) n ONH2, OCH2C(=O)N(H)CH3, and O(CH2) n ON[(CH2) n CH3]2, where n and m are 1 to approximately 10. Other 2'-substituents can also be selected from: C1-C 12 Alkyl, substituted alkyl, alkenyl, alkynyl, alkalyl, aralkyl, O-alkalyl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, F, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkalyl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleavage group, reporter group, intercalator, group for improving pharmacodynamic properties, or group for improving the pharmacokinetic properties of antisense compounds, as well as other substituents having similar properties. In certain embodiments, the modified nucleoside includes a 2'-MOE side chain (Bakeretal., J. Biol. Chem). (1997, 272, 11944-12000). Such 2'-MOE substitutions have been reported to have improved binding affinity compared to unmodified nucleosides such as 2'-O-methyl, O-propyl, and O-aminopropyl, and other modified nucleosides. Oligonucleotides with 2'-MOE substituents have also been shown to be antisense inhibitors of gene expression with promising characteristics for in vivo use (Martin, Helv, Chim, Acta, 1995, 78, 486-504, Altmannet). al., Chimia, 1996, 50, 168-176, Altmannet al. ,Biochem.Soc.Trans.,1996,24,630-637, and Altmann et al.,Nucleosides Nucleotides,1997 ,16,917-926).
[0319] As used herein, “modified tetrahydropyran nucleoside” or “modified THP nucleoside” means a nucleoside having a six-membered tetrahydropyran “sugar” (sugar substitute) substituted in place of a pentofuranosyl residue in a normal nucleoside. Modified THP nucleosides include, but are not limited to, those referred to in the art as hexitol nucleic acid (HNA), anitol nucleic acid (ANA), mannitol nucleic acid (MNA) (see Leumann, Bioorg. Med. Chem., 2002, 10, 841-854), fluoroHNA (F-HNA), or those having formula VII:
[0320] [ka]
[0321] Here, with respect to each of the at least one tetrahydropyrannucleoside analogs of formula VII, independently: Bx is the heterocyclic base moiety; T a and T bEach of these is independently an internucleoside linking group that links a tetrahydropyrannucleoside analog to an antisense compound, or T a and T b One of them is an internucleoside linking group that links a tetrahydropyrannucleoside analog to an antisense compound, and T a and T b The other is H, a hydroxyl protecting group, a linking conjugated group, or a 5' or 3' terminal group; q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, and R1 and R2 are each selected from hydrogen, hydroxyl, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 are independently H or C1-C6 alkyl.
[0322] In certain embodiments, modified THP nucleosides of formula VII are provided, where q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is not H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, THP nucleosides of formula VII are provided, where one of R1 and R2 is fluoro. In certain embodiments, R1 is fluoro and R2 is H; R1 is methoxy and R2 is H; and R1 is H and R2 is methoxyethoxy.
[0323] As used herein, “2'-modified” or “2'-substituted” refers to a nucleoside containing a sugar with a substituent other than H or OH at the 2' position. A 2'-modified nucleoside is a bicyclic nucleoside in which a bridge connecting two carbon atoms of the sugar ring connects the 2' carbon of the sugar ring to another carbon; as well as allyl, amino, azide, thio, O-allyl, O-C1-C 10 Alkyl,-OCF3,O-(CH2)2-O-CH3,2'-O(CH2)2SCH3,R m and R n Each of these independently represents H or substituted or unsubstituted C1-C 10 The alkyl group O-(CH2)2-ON(R m )(R n ), or O-CH2-C(=O)-N(R m )(R n This includes, but is not limited to, nucleosides having non-crosslinked 2' substituents such as ). 2'-modified nucleosides may further include other modifications, for example, at other positions of the sugar and / or to the nucleic acid base.
[0324] As used herein, "2'-F" refers to a nucleoside containing a sugar with a fluoro group at the 2' position.
[0325] As used herein, "2'-OMe," "2'-OCH3," or "2'-O-methyl" each refer to a nucleoside containing a sugar with an -OCH3 group at the 2' position of the sugar ring.
[0326] As used herein, "MOE," "2'-MOE," "2'-OCH2CH2OCH3," or "2'-O-methoxyethyl" each refer to a nucleoside containing a sugar with an -OCH2CH2OCH3 group at the 2' position of the sugar ring.
[0327] As used herein, “oligonucleotide” refers to a compound comprising multiple linked nucleosides. In certain embodiments, one or more of the multiple nucleosides are modified. In certain embodiments, the oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA).
[0328] Many other bicyclic and tricyclic sugar substitute ring systems are also known in the art and can be used to modify nucleosides for incorporation into antisense compounds (see, e.g., review article: Leumann, Bioorg. Med. Chem., 2002, 10, 841-854). Such ring systems can undergo various further substitutions to improve their activity.
[0329] Methods for preparing modified sugars are well known to those skilled in the art.
[0330] In nucleotides containing a modified sugar moiety, the nucleic acid base moiety (natural, modified, or a combination thereof) is maintained for hybridization with a suitable nucleic acid target.
[0331] In certain embodiments, the antisense compound comprises one or more nucleosides having a modified sugar moiety. In certain embodiments, the modified sugar moiety is 2'-MOE. In certain embodiments, the 2'-MOE modified nucleoside is located in a gapmer motif. In certain embodiments, the modified sugar moiety is a bicyclic nucleoside having a (4'-CH(CH3)-O-2') crosslinking group. In certain embodiments, the (4'-CH(CH3)-O-2') modified nucleoside is located across the entire wing of the gapmer motif. Compositions and methods for formulating pharmaceutical compositions
[0332] Antisense oligonucleotides can be mixed with pharmaceutically acceptable active or inactive substances for the preparation of pharmaceutical compositions or pharmaceutical formulations. Compositions and methods for formulating pharmaceutical compositions depend on, but are not limited to, several criteria, including the route of administration, the severity of the disease, or the dose administered.
[0333] Antisense compounds targeting tau nucleic acids can be used in pharmaceutical compositions by combining the antisense compound with a suitable pharmaceutically acceptable diluent or carrier. A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS). PBS is a suitable diluent for use in compositions delivered parenterally. Therefore, in one embodiment, a pharmaceutical composition comprising a tau nucleic acid-targeting antisense compound and a pharmaceutically acceptable diluent is used in the method described herein. In a particular embodiment, the pharmaceutically acceptable diluent is PBS. In a particular embodiment, the antisense compound is an antisense oligonucleotide.
[0334] Pharmaceutical compositions comprising antisense compounds include pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotides that can (directly or indirectly) form biologically active metabolites or residues thereof upon administration to animals, including humans. Accordingly, this disclosure also relates, for example, to pharmaceutically acceptable salts, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents of antisense compounds. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.
[0335] The prodrug may include the introduction of additional nucleosides at one or both ends of an antisense compound, which are cleaved in the body by endogenous nucleases to form an active antisense compound. Conjugated antisense compounds
[0336] The antisense compound may be covalently bonded to one or more moieties or conjugates that improve the activity, cell distribution, or cell uptake of the resulting antisense oligonucleotide. Typical conjugate groups include cholesterol and lipid moieties. Further conjugate groups include carbohydrates, phospholipids, biotin, phenazine, folic acid, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, and pigments.
[0337] Antisense compounds may be modified to have one or more stabilizing groups attached to one or both ends of the antisense compound to improve properties such as nuclease stability. Stabilizing groups include cap structures. These terminal modifications can protect antisense compounds having terminal nucleic acids from exonuclease degradation and can assist in intracellular delivery and / or localization. The caps can be present at the 5'-terminus (5'-cap) or 3'-terminus (3'-cap), or at both ends. Cap structures are well known in the art and include, for example, reverse deoxydebase caps. Further 3' and 5'-stable groups that can be used to cap one or both ends of an antisense compound to confer nuclease stability are disclosed in WO03 / 004602, published on January 16, 2003. Includes. Cell culture and antisense compound treatment
[0338] The effects of antisense compounds on the level, activity, or expression of tau nucleic acid can be tested in vitro in various cell types. Cell types used for such analyses are commercially available (e.g., American Type Culture Coll). ection, Manassus, VA; Zen-Bio, Inc., Research Triangle Park,NC;Clonetics Corporation,Wa Lkersville, MD), commercially available reagents (e.g., InvitrogenLife) Using the manufacturer's instructions (Technologies, Carlsbad, CA) They are cultured according to the following. Exemplary cell types include, but are not limited to, HepG2 cells, Hep3B cells, and primary cultured hepatocytes. In vitro testing of antisense oligonucleotides
[0339] A method for treating cells with antisense oligonucleotides is described herein, and this can be appropriately modified for treatment with other antisense compounds.
[0340] When the cells reach approximately 60-80% confluence in the culture medium, they are treated with antisense oligonucleotides.
[0341] Other reagents commonly used to introduce antisense oligonucleotides into cultured cells include the cationic lipid transfection reagent LIPOFECTATIN (Invitrogen, Carlsbad, CA). Antisense oligonucleotides are transfected using LIPOFECTATIN in OPTI-MEM1 (Invitrogen, Carlsbad, CA). When mixed with FECTIN, the desired antisense oligonucleotide concentration and a lipofectin concentration, which may range from 2 to 12 μg / mL per 100 nM antisense oligonucleotide, are achieved.
[0342] Other reagents used to introduce antisense oligonucleotides into cultured cells include LIPOFECTAMINE (Invitrogen, Carlsbad, CA). The antisense oligonucleotide is mixed with LIPOFECTAMINE in OPTI-MEM1 low-serum medium (Invitrogen, Carlsbad, CA) to achieve the desired antisense oligonucleotide concentration and a LIPOFECTAMINE concentration that can range from 2 to 12 ug / mL per 100 nM antisense oligonucleotide. do.
[0343] Other techniques used to introduce antisense oligonucleotides into cultured cells include electroporation.
[0344] Cells are treated with antisense oligonucleotides by conventional methods. Cells are harvested 16–24 hours after antisense oligonucleotide treatment, and the RNA or protein levels of the target nucleic acid at that time are measured by methods well known in the art and by the methods described herein. Generally, when the treatment is performed on multiple replicas, the data are expressed as the average of the treatments of the replicas.
[0345] The concentration of antisense oligonucleotides used varies depending on the cell line. Methods for determining the optimal antisense oligonucleotide concentration for a particular cell line are well known in the art. Antisense oligonucleotides are typically used in concentrations ranging from 1 nM to 300 nM when transfected with LIPOFECTAMINE. When transfected using electroporation, antisense oligonucleotides are used in higher concentrations ranging from 625 to 20,000 nM. RNA isolation
[0346] RNA analysis can be performed on whole cell RNA or poly(A)+ mRNA. RN The isolation method for RNA is well known in the art. RNA is prepared using methods well known in the art, for example, by using TRIZOL reagent (Invitrogen, Carlsbad, CA) according to the manufacturer's recommended protocol. Analysis of inhibition at target levels or expression
[0347] Inhibition of tau nucleic acid levels or expression can be assayed using various methods known in the art. For example, target nucleic acid levels can be quantified by, for instance, Northern blotting, competitive polymerase chain reaction (PCR), or quantitative real-time PCR. RNA analysis can be performed on whole cellular RNA or poly(A)+ mRNA. RNA isolation methods are well known in this field. Northern blot analysis is also a common practice in this field. PE-Applied Biosystems, Foster City, C ABI PRISM 7600, 7700, or 7900Seq, commercially available from A. Use the usage detection system according to the manufacturer's instructions. This allows for convenient quantitative real-time PCR. Quantitative real-time PCR analysis of target RNA levels
[0348] ABI PRISM 7600, 7700, or 7900 Sequence Data For quantitative real-time PCR using the ction System (PE-Applied Biosystems, FosterCity, CA) according to the manufacturer's instructions. This allows for the quantification of target RNA levels. Methods for quantitative real-time PCR are well-known in this field.
[0349] Prior to real-time PCR, the isolated RNA is subjected to a reverse transcriptase (RT) reaction, which generates complementary DNA (cDNA) that is then used as a substrate for real-time PCR amplification. The RT and real-time PCR reactions are carried out sequentially in the same sample well. RT and real-time PCR reagents are available from Invitrogen (Carlsbad, CA). The RT and real-time PCR reactions are carried out by methods well known to those skilled in the art.
[0350] The amount of gene (or RNA) target obtained by real-time PCR is standardized by using the expression level of a gene with constant expression, such as cyclophyllin A, or by quantifying total RNA using RIBOGREEN (Invitrogen, Inc. Carlsbad, CA). Cyclophilin A expression is quantified by real-time PCR by simultaneous, multiplex, or separate expression with the target. Total RNA is quantified using RIBOGREEN RNA quantification reagent (Invitrogen, Inc. Eugen). Quantification is performed using e,OR). The RNA quantification method using RIBOGREEN is taught by Jones, LJ, et al (Analytical Biochemistry, 1998, 265, 368-374). CYTOFLUOR4000 instrument A PE Applied Biosystems (PE) is used to measure the fluorescence of RIBOGREEN.
[0351] The probes and primers are designed to hybridize with tau nucleic acid. Methods for designing probes and primers for real-time PCR are well known in the art, and PRIMEREXPRESS Software (AppliedBiosystems, This may include the use of software such as Foster City (CA). Protein level analysis
[0352] Antisense inhibition of tau nucleic acid can be evaluated by measuring tau protein levels. Tau protein levels can be evaluated or quantified by various methods well known in the art, such as immunoprecipitation, Western blotting, enzyme-linked immunosorbent assay (ELISA), quantitative protein assays, protein activity assays (e.g., caspase activity assays), immunohistochemistry, immunocytochemistry, or fluorescent cell sequencing (FACS). Antibodies against the target can be supplied by various sources, such as the MSRS antibody catalog (Aerie Corporation, Birmingham, MI). These antibodies can be identified and obtained from the outset, or they can be prepared by conventional monoclonal or polyclonal antibody production methods well known in the art. In vivo testing of antisense compounds
[0353] Antisense compounds, such as antisense oligonucleotides, are tested in animals to evaluate their ability to inhibit tau expression and produce phenotypic changes, such as improved cognitive and motor function. In certain embodiments, cognitive function is measured by novel object recognition and nestret constitutive activity. In certain embodiments, motor function is measured by gait initiation analysis, rotarod, grip strength, pole climbing, open field performance, balance beam, and hind leg footprint tests in animals. In certain embodiments, antisense compounds, such as antisense oligonucleotides, are tested to evaluate their ability to prevent and / or reduce seizure severity in pentylenetetrazole (PTZ)-induced seizure models.
[0354] The tests can be conducted in standard animals or experimental disease models. For administration to animals, antisense oligonucleotides are formulated in pharmaceutically acceptable diluents such as phosphate-buffered saline. Administration includes parenteral routes such as intraperitoneal, intravenous, and subcutaneous administration. Calculation of the dose and frequency of administration of antisense oligonucleotides is within the capabilities of those skilled in the art and depends on factors such as the route of administration and the animal's body weight. After a period of treatment with antisense oligonucleotides, RNA is isolated from CNS tissue or CSF, and changes in tau nucleic acid expression are measured. Specific indications
[0355] In certain embodiments, methods, compounds, and compositions for treating an individual are provided herein, comprising administering one or more pharmaceutical compositions described herein. In certain embodiments, the individual has a neurodegenerative disease. In certain embodiments, the individual is at risk of developing a neurodegenerative disease, including but not limited to tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive suprasinal palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroidal degeneration (CBD), epilepsy, and Dravet syndrome. In certain embodiments, the individual has been identified as having a tau-related disease. In certain embodiments, methods for prophylactically reducing tau expression in an individual are provided herein. Certain embodiments include treating an individual in need of treatment by administering a therapeutically effective amount of an antisense compound targeting tau nucleic acid to a solid.
[0356] In one embodiment, to determine an individual's response to the administration of an antisense compound, the administration of a therapeutically effective dose of a tau nucleic acid-targeted antisense compound is accompanied by monitoring of tau levels in the individual. The individual's response to the administration of the antisense compound can be used by a physician to determine the amount and duration of the therapeutic intervention.
[0357] In certain embodiments, administration of an antisense compound targeting tau nucleic acid is at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, This results in a reduction in tau nucleic acid expression to a range defined by 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or any two of these values. In certain embodiments, administration of antisense compounds targeting tau nucleic acid results in improved motor function in animals. In certain embodiments, the administration of the tau antisense compound is at least 15, 20, 25, 30, 35, 40, 45, 50, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, Improve motor function by a range defined by 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100%, or any two of these values.
[0358] In certain embodiments, pharmaceutical compositions comprising tau-targeting antisense compounds are used for the preparation of pharmaceuticals for treating patients suffering from or susceptible to neurodegenerative conditions, including tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroidal ganglion degeneration (CBD), epilepsy, and Dravet syndrome. Specific hotspot areas 1. Nucleic acid bases of SEQ IDNO:1 135783-135980
[0359] In certain embodiments, the antisense oligonucleotide is the nucleus of SEQID NO:1 The acid-base 135783-135980 (GENBANK Accession No. NT_010783.15, cleaved from nucleotides 9240000-9381000) is designed to be targeted. In certain embodiments, the nucleic acid base 135783-135980 is a hotspot region. In certain embodiments, the nucleic acid base 135783-135980 is targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleic acid bases long. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer, a 5-9-5 MOE gapmer, a 5-7-6 MOE gapmer, and a 5-8-5 MOE gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate and phosphodiester nucleotide bonds (for example, the antisense oligonucleotide has a "mixed backbone").
[0360] In certain embodiments, nucleic acid bases 135783-135980 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613120, 622096-622150, 623988-623996, 664511-664542, and 664661-664819.
[0361] In certain embodiments, nucleic acid bases 135783-135980 are the following SEQID NO Targeted by: 56, 57, 248, 462-467, 1668-1698, 2025-2048, 2301-2309, 2331-2443, and 2478-2483.
[0362] In a particular embodiment, antisense oligonucleotides targeting nucleic acid bases 135783-135980 are at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, At least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, less Achieve a reduction of 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93% in vitro and / or in vivo tau mRNA and / or protein levels. 2. Nucleic acid bases of SEQ IDNO:1 135853-135872
[0363] In certain embodiments, the antisense oligonucleotide is the nucleus of SEQID NO:1 The system is designed to target the acid-bases 135853-135872 (GENBANK Accession No. NT_010783.15, cleaved from nucleotides 9240000-9381000). In certain embodiments, the nucleic acid bases 135853-135872 are the hotspot region. In certain embodiments, the nucleic acid bases 135853-135872 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleic acid bases long. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer, a 5-9-5 MOE gapmer, a 5-7-6 MOE gapmer, or a 5-8-5 MOE gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate and phosphodiester nucleotide bonds (for example, the antisense oligonucleotide has a "mixed backbone").
[0364] In certain embodiments, nucleic acid bases 135853-135872 are targeted by the following ISIS numbers: 424879, 424880, 613117, 613118, 622114-622125, 623993-623996, 664522-664542, 664676-664713, 664729-664766, and 664783-664819.
[0365] In certain embodiments, nucleic acid bases 135853-135872 are subject to the following SEQID NO Targeted by: 56, 57, 248, 464-465, 1668-1673, 2039-2048, 2306-2309, 2345-2443, and 2478-2483.
[0366] In certain embodiments, antisense oligonucleotides targeting nucleic acid bases 135853-135872 are at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, at least 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, or at least 87 Achieve a % reduction in tau mRNA and / or protein levels in vitro and / or in vivo. 3. Nucleic acid bases of SEQ IDNO:1 135783-135929
[0367] In certain embodiments, the antisense oligonucleotide is the nucleus of SEQID NO:1 The system is designed to target the acid-base 135783-135929 (GENBANK Accession No. NT_010783.15, cleaved from nucleotides 9240000-9381000). In certain embodiments, the nucleic acid base 135783-135929 is a hotspot region. In certain embodiments, the nucleic acid base 135783-135929 is targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleic acid bases long. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer, a 5-9-5 MOE gapmer, a 5-7-6 MOE gapmer, or a 5-8-5 MOE gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate and phosphodiester nucleotide bonds (for example, the antisense oligonucleotide has a "mixed backbone").
[0368] In certain embodiments, nucleic acid bases 135783-135929 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622138, 623988-623996, 664511-664542, and 664661-664819.
[0369] In certain embodiments, nucleic acid bases 135783-135929 are classified as follows: SEQID NO Targeted by: 56, 57, 248, 462-466, 1668-1686, 2025-2048, 2301-2309, 2331-2443, and 2478-2483.
[0370] In a particular embodiment, antisense oligonucleotides targeting nucleic acid bases 135783-135929 are at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, At least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, less Achieve a reduction of 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93% in vitro and / or in vivo tau mRNA and / or protein levels. 4. Nucleic acid bases of SEQ IDNO:1 135783-135914
[0371] In certain embodiments, the antisense oligonucleotide is the nucleus of SEQID NO:1 Acid-base 135783-135914 (GENBANK Accession No. GENBANKAccessi, cleaved from nucleotides 9240000~9381000) Designed to target No.NT_010783.15). Specific implementation In this configuration, nucleic acid bases 135783-135914 are a hotspot region. In certain embodiments, nucleic acid bases 135783-135914 are targeted by an antisense oligonucleotide. In certain embodiments, the antisense oligonucleotide is 18, 19, or 20 nucleic acid bases long. In certain embodiments, the antisense oligonucleotide is a gapmer. In certain embodiments, the gapmer is a 5-10-5 MOE gapmer, a 5-9-5 MOE gapmer, a 5-7-6 MOE gapmer, or a 5-8-5 MOE gapmer. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate-nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphodiester-nucleoside bonds. In certain embodiments, the nucleosides of the antisense oligonucleotide are linked by phosphorothioate-phosphodiester nucleotide bonds (for example, the antisense oligonucleotide has a "mixed backbone").
[0372] In certain embodiments, nucleic acid bases 135783-135914 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622133, 623988-623996, 664511-664542, and 664661-664819.
[0373] In certain embodiments, nucleic acid bases 135783-135914 are subject to the following SEQID NO Targeted by: 56, 57, 248, 462-466, 1668-1681, 2025-2048, 2301-2309, 2331-2443, and 2478-2483.
[0374] In certain embodiments, nucleic acid bases 135783-135914 are targeted by the following ISIS numbers: 424879, 424880, 548937, 613114-613119, 622096-622133, and 623988-623996.
[0375] In certain embodiments, nucleic acid bases 135783-135914 are subject to the following SEQID NO Targeted by: 56, 57, 248, 462-466, 1668-1681, 2025-2048, and 2301-2309.
[0376] In a particular embodiment, antisense oligonucleotides targeting nucleic acid bases 135783-135914 are at least 12%, at least 13%, at least 14%, at least 15%, at least 16%, at least 17%, at least 18%, at least 19%, 20%, at least 21%, at least 22%, at least 23%, at least 24%, at least 25%, at least 26%, at least 27%, at least 28%, At least 29%, at least 30%, at least 31%, at least 32%, at least 33%, at least 34%, at least 35%, at least 36%, at least 37%, at least 38%, at least 39%, at least 40%, at least 41%, at least 42%, at least 43%, at least 44%, at least 45%, at least 46%, at least 47%, at least 48%, at least 49%, at least 50%, less Achieve a reduction of 51%, at least 52%, at least 53%, at least 54%, at least 55%, at least 56%, at least 57%, at least 58%, at least 59%, at least 60%, at least 61%, at least 62%, at least 63%, at least 64%, at least 65%, at least 66%, at least 67%, at least 68%, at least 69%, at least 70%, at least 71%, at least 72%, at least 73%, at least 74%, at least 75%, at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, or at least 93% in vitro and / or in vivo tau mRNA and / or protein levels. Examples Non-exclusive disclosure and incorporation by reference
[0377] While specific compounds, compositions, and methods described herein are specifically illustrated according to certain embodiments, the following examples are intended solely to illustrate the compounds described herein and are not intended to limit the compounds described herein. Each of the references cited herein is incorporated herein by reference in its entirety. Example 1: Antisense inhibition of human tau in HepG2 cells by MOE gapmer
[0378] Antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. Cultured HepG2 cells were transfected with 100 nM antisense oligonucleotides using lipofectin reagent. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. Human primer probe set RTS3104 (forward sequence A, indicated herein as SEQIDNO:10) AGATTGGGTCCCTGGACAAT; referred to as SEQID NO:11 in this specification. The reverse sequence AGCTTGTGGGTTTCAATCTTTTTATT (represented herein as SEQ ID NO:12) was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0379] The newly designed chimeric antisense oligonucleotides shown in the table below were designed as 5-10-5MOE gapmers. The gapmer is 20 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside bonds throughout each gapmer are phosphorothioate bonds. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" refers to the 5' nucleoside targeted by the gapmer in the human gene sequence. The "stop site" refers to the 3' nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in Table 1 below is SEQIDNO:1(nucleotide 924 GENBANKAccession No.N, cut from 0000 to 9381000 The human tau genome sequence designated herein as T_010783.15), or SEQ ID NO:2 (GENBANKAccession No.NM_00112306 6.3) Targets either of the human tau mRNAs specified herein. "n / a" indicates that the oligonucleotide does not target the gene sequence with 100% complementarity. The sequences shown in Table 2 target either SEQIDNO:1 or 2 with 100% complementarity. Instead of targeting it, use SEQ ID NO:3 (GENBANKAccession, a mutant mRNA sequence that skips exons 3, 4, 6, 8, 10, and 12). No.NM_016841.4) or SEQ ID NO:4 (GENBANK AccessionNo.NT_ cleaved from nucleotides 2624000~2761000) The target is 010783.14).
[0380] [Table 1-1]
[0381] [Table 1-2]
[0382] [Table 2]
[0383] Example 2: Dose-dependent antisense inhibition of human tau in HepG2 cells by 5-10-5MOE gapmer
[0384] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in HepG2 cells. As shown in the table below, cells were seeded at a density of 10,000 cells per well and transfected with lipofectin reagent containing antisense oligonucleotides at concentrations of 12.5 nM, 25.0 nM, 50.0 nM, 100.0 nM, or 200.0 nM. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0385] [Table 3]
[0386] Example 3: Antisense inhibition of human tau in SH-SY5Y cells by 5-10-5MOE gapmer
[0387] Further antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. Cultured SH-SY5Y cells were transfected with 7,000 nM antisense oligonucleotides using electroporation. After approximately 24 hours of treatment, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0388] The newly designed chimeric antisense oligonucleotides shown in the table below were designed as 5-10-5MOE gapmers. The gapmer is 20 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. Nucleoside-to-nucleoside bonds throughout each gapmer are phosphorothioate bonds. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" refers to the 5' end nucleoside targeted by the gapmer in the human gene sequence. The "stop site" refers to the 3' end nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in the table below corresponds to SEQIDNO:1(nucleotide 9240) GENBANK AccessionNo.NT, cut from 000 to 9381000 The human tau genome sequence designated herein as _010783.15), or SEQID NO:2 (GENBANK Accession No.NM_001123066 3) Targets one of the human tau mRNA sequences designated herein. "n / a" indicates that the oligonucleotide does not target that particular gene sequence with 100% complementarity.
[0389] [Table 4-1]
[0390] [Table 4-2]
[0391] [Table 4-3]
[0392] [Table 5-1]
[0393] [Table 5-2]
[0394] [Table 5-3]
[0395] Example 4: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells by 5-10-5MOE gapmer
[0396] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in SH-SY-5Y cells. As shown in the table below, cells were seeded at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 1.25 μM, 2.50 μM, 5.00 μM, 10.00 μM, and 20.00 μM. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0397] [Table 6]
[0398] Example 5: Antisense inhibition of human tau in SH-SY5Y cells by 5-10-5MOE gapmer
[0399] Further antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. Cultured SH-SY5Y cells were seeded at a density of 20,000 cells per well and transfected with 6,000 nM antisense oligonucleotides using electroporation. After a treatment period of approximately 24 hours, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0400] The newly designed chimeric antisense oligonucleotides shown in the table below were designed as 5-10-5MOE gapmers. The gapmer is 20 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. Nucleoside-to-nucleoside bonds throughout each gapmer are phosphorothioate bonds. All cytosine residues throughout each gapmer are 5-methylcytosine. The "start site" refers to the 5' end nucleoside targeted by the gapmer in the human gene sequence. The "stop site" refers to the 3' end nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in the table below corresponds to SEQIDNO:1(nucleotide 9240) GENBANK AccessionNo.NT, cut from 000 to 9381000 The target is the human tau genome sequence designated herein as _010783.15).
[0401] [Table 7-1]
[0402] [Table 7-2]
[0403] [Table 7-3]
[0404] [Table 7-4]
[0405] Example 6: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells by 5-10-5MOE gapmer
[0406] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in SH-SY-5Y cells. As shown in the table below, cells were seeded at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.625 μM, 1.25 μM, 2.500 μM, 5.00 μM, 10.00 μM, and 20.00 μM. After a treatment period of approximately 16 hours, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0407] [Table 8]
[0408] Example 7: Antisense inhibition of human tau in SH-SY5Y cells by MOE gapmer having phosphorothioate and phosphodiester nucleoside interlinking bonds.
[0409] Antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. Cultured SH-SY5Y cells were transfected with 8,000 nM antisense oligonucleotides using electroporation. Approximately 24 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0410] The newly designed chimeric antisense oligonucleotides in the table below were designed as 5-10-5MOE gapmers. The gapmer is 20 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside bonds throughout each gapmer are either phosphorothioate or phosphodiester bonds. All cytosine residues throughout each gapmer are 5-methylcytosine. The "Chemistry" column describes the internucleoside bonds of each oligonucleotide. "s" indicates a phosphorothioate bond, and "o" indicates a phosphodiester bond. "Start Site" refers to the 5' end nucleoside targeted by the gapmer in the human gene sequence. The "stopping site" refers to the 3' end nucleoside that gapmers target in human gene sequences.
[0411] Each gapmer shown in the table below is SEQ IDNO:1 (nucleotide 9 GENBANKAccession No. cut off from 240000~9381000 The human tau genome sequence designated herein as .NT_010783.15), SEQID NO:2 (GENBANK Accession No.NM_001123066.3) or SEQID NO:3 (GENBANK Accession No.NM_ It targets one of the human tau mRNAs designated herein as 016841.4). Several oligonucleotides shown in Tables 10, 12, and 16 are SEQID N O:5(GENBANKAccession No.DR002467.1),SEQ I D NO:6 (GENBANK Accession No.NM_001203251.1) or SEQ ID NO:7 (GENBANK Accession No.NM_016) The oligonucleotides target the mutant mRNA sequences designated herein as 835.4). Oligonucleotides are shown in various tables according to the main gene sequences they target with 100% complementarity. "n / a" indicates that the oligonucleotide does not target that particular gene sequence with 100% complementarity.
[0412] [Table 9-1]
[0413] [Table 9-2]
[0414] [Table 9-3]
[0415] [Table 10]
[0416] [Table 11-1]
[0417] [Table 11-2]
[0418] [Table 11-3]
[0419] [Table 12]
[0420] [Table 13-1]
[0421] [Table 13-2]
[0422] [Table 13-3]
[0423] [Table 14-1]
[0424] [Table 14-2]
[0425] [Table 14-3]
[0426] [Table 15-1]
[0427] [Table 15-2]
[0428] [Table 16]
[0429] Example 8: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells by a 5-10-5MOE gapmer having a phosphorothioate and phosphodiester nucleoside linkage.
[0430] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in SH-SY-5Y cells. As shown in the table below, cells were seeded at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 1.25 μM, 2.500 μM, 5.00 μM, 10.00 μM, and 20.00 μM. Approximately 16 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0431] [Table 17]
[0432] [Table 18]
[0433] Example 9: Antisense inhibition of human tau in SH-SY5Y cells by 5-10-5MOE, 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE gapmers.
[0434] Antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. ISIS613412 was also included in the assay. The results of each experiment are shown in separate tables below. SH-SY5Y cells cultured at a density of 20,000 cells per well were transfected with 8,000 nM antisense oligonucleotides using electroporation. Approximately 24 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0435] The newly designed chimeric antisense oligonucleotides shown in the table below are 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE gapmers. The 5-8-5MOE gapmer is 18 nucleosides long, with a central gap segment containing eight 2'-deoxynucleosides and flanked by 5' and 3' directional wing segments containing five nucleosides each. The 4-8-6MOE gapmer is 18 nucleosides long, with a central gap segment containing eight 2'-deoxynucleosides and flanked by 5' and 3' directional wing segments containing four and six nucleosides each. The 6-8-4MOE gapmer is 18 nucleosides long, with a central gap segment containing eight 2'-deoxynucleosides and flanked by 5' and 3' wing segments containing six and four nucleosides, respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside binding motif for each gapmer as a whole in the table below is ISIS Except for 613412, it is 5’-sooosssssssssooss-3’, where each “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage. The internucleoside linkage motif of ISIS613412 -ph is 5’-soooossssssssssooss-3’, where each “s” represents a phosphorothioate internucleoside linkage and “o” represents a phosphodiester internucleoside linkage. All cytosine residues in each gapmer as a whole are 5-methylcytosine. “Start site” refers to the most 5’-side nucleoside targeted by the gapmer in the human gene sequence. “Stop site” refers to the most 3’-side nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in the following table is SEQIDNO:1 (nucleotide 9240 000~9381000 cut from GENBANK AccessionNo.NT _010783.15), SEQ ID NO:4 (nucleotide 2624000~276 1000 cut from GENBANK AccessionNo.NT_010783 .14), SEQ ID NO:5 (GENBANK Accession No.DR00 2467.1), or SEQ ID NO:6 (GENBANK Accession N o.NM_001203251.1). “n / a” indicates that the oligonucleotide does not target that specific gene sequence with 100% complementarity.
[0436]
Table 19-1
[0437]
Table 19-2
[0438] Table 19-3
[0439] Table 20-1
[0440] Table 20-2
[0441] Table 20-3
[0442] Table 21-1
[0443] Table 21-2
[0444] Table 21-3
[0445] Table 22-1
[0446] Table 22-2
[0447] Table 22-3
[0448] Table 23-1
[0449] Table 23-2
[0450] Table 23-3
[0451] Table 24-1
[0452] Table 24-2
[0453] Table 24-3
[0454] Table 25-1
[0455] Table 25-2
[0456] Table 26-1
[0457] Table 26-2
[0458] Table 27-1
[0459] Table 27-2
[0460] Table 28-1
[0461] Table 28-2
[0462] Table 29-1
[0463] Table 29-2
[0464] Table 30-1
[0465] Table 30-2
[0466] Table 31-1
[0467] Table 31-2
[0468] Table 32-1
[0469] Table 32-2
[0470] Table 33-1
[0471] Table 33-2
[0472] Table 34-1
[0473] Table 34-2
[0474] Table 35-1
[0475] Table 35-2
[0476] Table 36-1
[0477] Table 36-2
[0478] Table 37-1
[0479] [Table 37-2]
[0480] [Table 38-1]
[0481] [Table 38-2]
[0482] [Table 39-1]
[0483] [Table 39-2]
[0484] Example 11: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells
[0485] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in SH-SY5Y cells. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. As shown in the table below, cells were seeded at a density of 20,000 cells per well and tested at 0.938 μM, 0.1,875 μM, 3.750 μM, and 7 Cells were transfected using electroporation with antisense oligonucleotides at concentrations of 0.500 μM and 15.00 μM. Approximately 16 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to the total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0486] [Table 40]
[0487] [Table 41]
[0488] [Table 42]
[0489] [Table 43]
[0490] [Table 44]
[0491] [Table 45]
[0492] [Table 46]
[0493] [Table 47]
[0494] Example 12: Antisense inhibition of human tau in HepG2 cells by 5-10-5MOE, 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE gapmers.
[0495] Antisense oligonucleotides targeting tau nucleic acid were designed and their effects on tau mRNA were tested in vitro. The antisense oligonucleotides were tested in a series of experiments under similar culture conditions. ISIS613412 was also included in the assay. The results of each experiment are shown in separate tables below. Cultured HepG2 cells at a density of 20,000 cells per well were transfected with 8,000 nM antisense oligonucleotides using electroporation. Approximately 24 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0496] The newly designed chimeric antisense oligonucleotides in the following table were designed as 5-8-5MOE, 4-8-6MOE, or 6-8-4MOE gapmers. The 5-8-5MOE gapmer is 18 nucleosides in length, with the central gap segment containing 8 2'-deoxynucleosides and flanked by wing segments in the 5' and 3' directions each containing 5 nucleosides. The 4-8-6MOE gapmer is 18 nucleosides in length, with the central gap segment containing 8 2'-deoxynucleosides and flanked by wing segments in the 5' and 3' directions each containing 4 and 6 nucleosides, respectively. The 6-8-4MOE gapmer is 18 nucleosides in length, with the central gap segment containing 8 2'-deoxynucleosides and flanked by wing segments in the 5' and 3' directions each containing 6 and 4 nucleosides, respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside linkage motif for each gapmer in the following table, except for ISIS613412, is 5'-sooosssssssssooss-3' where each "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. The internucleoside linkage motif of ISIS613412 is 5'-soooossssssssssooss-3', where each "s" represents a phosphorothioate internucleoside linkage and "o" represents a phosphodiester internucleoside linkage. All cytosine residues in each gapmer in its entirety are 5-methylcytosine. The "start site" refers to the most 5'-terminal nucleoside targeted by the gapmer in the human gene sequence. The "stop site" refers to the most 3'-terminal nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in the following table is SEQ ID NO:1 (nucleotide 924 0000~9381000 excised from GENBANK Accession No.N It is targeting T_010783.15).
[0497] [Table 48-1]
[0498] [Table 48-2]
[0499] [Table 48-3]
[0500] [Table 49-1]
[0501] [Table 49-2]
[0502] [Table 49-3]
[0503] Example 13: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells by MOE gapmer
[0504] Gapmers from the aforementioned studies demonstrating significant in vitro inhibition of tau mRNA were selected and tested at various doses in SH-SY5Y cells. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. As shown in the table below, cells were seeded at a density of 20,000 cells per well and tested at 0.938 μM, 0.1,875 μM, 3.750 μM, and 7 Cells were transfected using electroporation with antisense oligonucleotides at concentrations of 0.500 μM and 15.00 μM. Approximately 16 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0505] [Table 50]
[0506] [Table 51]
[0507] [Table 52]
[0508] [Table 53]
[0509] [Table 54]
[0510] [Table 55]
[0511] Example 14: 5-7-6MOE, 5-8-5MOE, 5-9-5MOE with phosphorothioate and phosphodiester nucleoside interbonding in the hotspot region of human tau. Design of E and 5-10-5 MOE gapmers
[0512] Antisense oligonucleotides were designed to target tau nucleic acid in the regions identified as "hot spots" in the above study.
[0513] The newly designed chimeric antisense oligonucleotides shown in the table below were designed as 5-7-6MOE, 5-8-5MOE, 5-9-5MOE, or 5-10-5MOE gapmers. The 5-7-6MOE gapmer is 18 nucleosides long, with a central gap segment containing 7 2'-deoxynucleosides and flanked by 5' and 3' directional wing segments containing 5 and 6 nucleosides, respectively. The 5-8-5MOE gapmer is 18 nucleosides long, with a central gap segment containing 8 2'-deoxynucleosides and flanked by 5' and 3' directional wing segments containing 5 nucleosides, respectively. The 5-9-5MOE gapmer is 19 nucleosides long, with a central gap segment containing 9 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. The 5-10-5MOE gapmer is 20 nucleosides long, with a central gap segment containing 10 2'-deoxynucleosides and flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. The internucleoside bonds in each gapmer are either phosphorothioate or phosphodiester bonds. The "Chemistry" column describes the internucleoside bonds of each oligonucleotide. "s" indicates a phosphorothioate bond, and "o" indicates a phosphodiester bond. All cytosine residues in each gapmer are 5-methylcytosine.
[0514] "Starting site" refers to the most 5'-side nucleoside targeted by the gapmer in the human gene sequence. "Stop site" refers to the most 3'-side nucleoside targeted by the gapmer in the human gene sequence. Each of the gapmers shown in the following table targets either the human tau genomic sequence designated herein as SEQ ID NO:1 (GENBANK Accession No. NT_010783.15 truncated from nucleotides 9240000 to 9381000), the human tau genomic sequence designated herein as SEQ ID NO:2 (GENBANK Accession N o.NM_001123066.3) or the human tau mRNA designated herein as SEQ ID NO:2 (GENBANK Accession No. NM_001123066.3). "n / a" indicates that the oligonucleotide does not target that specific gene sequence with 100% complementarity.
[0515]
Table 56-1
[0516]
Table 56-2
[0517]
Table 56-3
[0518]
Table 56-4
[0519]
Table 56-5
[0520]
Table 56-6
[0521] [Table 56-7]
[0522] Example 15: Intraventricular administration of antisense oligonucleotides against human tau mRNA in h tau mice
[0523] The selected compounds were tested for efficacy by ICV administration in human tau transgenic mice (Duff et al., Neurobiology of D (Isease 7:87-98, 2000). Treatment and surgery
[0524] Each of the four mouse groups received a 200 μg dose delivered by ICV bolus injection: ISIS 613255, ISIS 613329, ISIS613344, ISIS6 13361,ISIS 613369,ISIS 613370,ISIS613397 ,ISIS 613045,ISIS 613099,ISIS 613118,ISIS 613136 was administered. One of the two mice was a control group, ISIS424880. The mice were similarly processed, and one control group of four mice was similarly processed in PBS. All procedures were performed under isoflurane anesthesia according to IACUC standards. For ICV bolus injection in mice, antisense oligonucleotides were injected into the right ventricular region of human tau transgenic mice. 10 microliters of a solution containing 300 μg of oligonucleotide in PBS were injected over approximately 10 seconds. Tissue was collected 14 days after oligonucleotide administration. RNA analysis
[0525] Fourteen days after oligonucleotide administration, RNA was extracted from the hippocampus, spinal cord, and cortex for real-time PCR analysis of tau mRNA levels. Human tau mRNA levels were measured using the human primer probe set RTS3104. Results were calculated as a percentage inhibition of human tau mRNA expression compared to the control. All antisense oligonucleotides resulted in significant inhibition of human tau mRNA levels.
[0526] [Table 57]
[0527] Example 16: Antisense inhibition of human tau in SH-SY5Y cells by 5-7-6MOE, 5-8-5MOE, 5-9-5MOE, and 5-10-5MOE gapmers.
[0528] The antisense oligonucleotides described in the above examples, as well as the newly designed antisense oligonucleotides targeting human tau nucleic acid, were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. Cultured SH-SY5Y cells were transfected with 8,000 nM antisense oligonucleotides using electroporation. Approximately 24 hours after the treatment period, RNA was isolated from the cells, and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content, as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells.
[0529] The chimeric antisense oligonucleotides newly designed in the following table were designed as 5-7-6MOE, 5-8-5MOE, 5-9-5MOE, or 5-10-5MOE gapmers. The 5-7-6MOE gapmer is 18 nucleosides in length, and the central gap segment contains 7 2'-deoxynucleosides and is adjacent to wing segments in the 5' and 3' directions each containing 5 and 6 nucleosides, respectively. The 5-8-5MOE gapmer is 18 nucleosides in length, and the central gap segment contains 8 2'-deoxynucleosides and is adjacent to wing segments in the 5' and 3' directions each containing 5 nucleosides, respectively. The 5-9-5MOE gapmer is 19 nucleosides in length, and the central gap segment contains 9 2'-deoxynucleosides and is adjacent to wing segments in the 5' and 3' directions each containing 5 nucleosides, respectively. The 5-10-5MOE gapmer is 20 nucleosides in length, and the central gap segment contains 10 2'-deoxynucleosides and is adjacent to wing segments in the 5' and 3' directions each containing 5 nucleosides, respectively. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment have a 2'-MOE modification. The internucleoside linkage of each entire gapmer is either a phosphorothioate linkage or a phosphodiester linkage. The "Linkage Chemistry" column describes the internucleoside linkage of each oligonucleotide. "s" refers to a phosphorothioate linkage and "o" refers to a phosphodiester linkage. All cytosine residues of each entire gapmer are 5-methylcytosine.
[0530] "Start Site" refers to the most 5'-side nucleoside targeted by the gapmer in the human gene sequence. "Stop Site" refers to the most 3'-side nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in the following table is SEQ The human tau genome sequence designated herein as ID NO:1 (GENBANK Accession No. NT_010783.15, cleaved from nucleotides 9240000~9381000), or SEQIDNO:2 (GENBANK Accession No. The human tau mRN designated herein as n No.NM_001123066.3) It targets either of the A sequences. "n / a" indicates that the oligonucleotide does not target that particular gene sequence with 100% complementarity.
[0531] [Table 58-1]
[0532] [Table 58-2]
[0533] [Table 58-3]
[0534] [Table 59-1]
[0535] [Table 59-2]
[0536] [Table 59-3]
[0537] [Table 60-1]
[0538] [Table 60-2]
[0539] [Table 60-3]
[0540] [Table 61-1]
[0541] [Table 61-2]
[0542] [Table 61-3]
[0543] Example 17: Dose-dependent antisense inhibition of human tau in SH-SY5Y cells
[0544] Gapmers exhibiting significant in vitro inhibition of tau mRNA were selected from the aforementioned studies and tested at various doses in SH-SY5Y cells. Antisense oligonucleotides were tested in a series of experiments under similar culture conditions. The results of each experiment are shown in separate tables below. As shown in the table below, cells were seeded at a density of 20,000 cells per well and transfected using electroporation with antisense oligonucleotides at concentrations of 0.247 μM, 0.741 μM, 2.22 μM, 6.67 μM, and 20.00 μM. Approximately 16 hours after the treatment period, RNA was isolated from the cells and tau mRNA levels were measured by quantitative real-time PCR. The human primer probe set RTS3104 was used to measure mRNA levels. Tau mRNA levels were adjusted according to total RNA content as measured by RIBOGREEN®. Results are expressed as % inhibition of tau compared to untreated control cells. Tau mRNA levels were significantly reduced in a dose-dependent manner in cells treated with antisense oligonucleotides.
[0545] [Table 62]
[0546] [Table 63]
[0547] [Table 64]
[0548] Example 18: Intraventricular administration of antisense oligonucleotides against human tau mRNA in h tau mice
[0549] The selected compounds were tested for efficacy by ICV administration in human tau transgenic mice (Duff et al., Neurobiology of D (Isease 7:87-98, 2000). Treatment and surgery
[0550] Each of the four mouse groups received a 200 μg dose delivered by ICV bolus injection: ISIS 613099, ISIS 613361, ISIS613370, ISIS6 Two mice were administered either 23782 or ISIS 623996. One control group of two mice was used. The group of mice was treated similarly with ISIS 424880, and one control group of 4 mice was treated with P The same procedure was performed in BS. All procedures were carried out according to IACUC standards under isoflurane anesthesia. For ICV bolus injection in mice, antisense oligonucleotides were injected into the right ventricular ventricle of human tau transgenic mice. 10 microliters of a solution containing 200 μg of oligonucleotide in PBS were injected over approximately 10 seconds. Tissue was collected 14 days after oligonucleotide administration. RNA analysis
[0551] Fourteen days after oligonucleotide administration, RNA was extracted from the hippocampus, spinal cord, and cortex for real-time PCR analysis of tau mRNA levels. Human tau mRNA levels were measured using the human primer probe set RTS3104. Results were calculated as a percentage inhibition of human tau mRNA expression compared to the control. All antisense oligonucleotides resulted in significant inhibition of human tau mRNA levels in several tissues.
[0552] [Table 65]
[0553] Example 19: Design of an oligonucleotide targeting human tau
[0554] ISIS No. 603054 was designed to target human tau. The nucleic acid sequence and chain chemistry of ISIS No. 603054 are shown in Table 66 below. ISIS No. 603054 is a 5-10-5 MOE gapmer. ISIS No. 60 3054 is 20 nucleosides long, and the central gap segment contains 10 2'-deoxynucleosides and is flanked by 5' and 3' wing segments, each containing 5 nucleosides. Each nucleoside in the 5' wing segment and each nucleoside in the 3' wing segment has a 2'-MOE modification. All cytosine residues in each gapmer are 5-methylcytosine. The "start site" refers to the 5' end nucleoside targeted by the gapmer in the human gene sequence. The "stop site" refers to the 3' end nucleoside targeted by the gapmer in the human gene sequence. Each gapmer shown in Table 1 below is cleaved from SEQIDNO:1 (nucleotides 9240000~9381000). The human tau genome sequence designated herein as GENBANK Accession No. NT_010783.15), or SEQ ID NO:2 (GENBANKAcc Humans designated herein as ession No. NM_001123066.3) It targets either of the tau mRNA molecules.
[0555] [Table 66]
[0556] Example 20: In vivo analysis of human tau-targeting oligonucleotides in mice
[0557] As shown in the table below, oligonucleotides were designed to target tau. Human tau transgenic mouse "htau" (Duffet al., Neurob iology of Disease 7:87-98,2000;Davieset a Mice, either from the JNeurochem. (2003) 86, 582-590) or wild-type WTC57Bl6 mice, were divided into groups of 3 or 4 mice. Each mouse in each group was administered a single ICV dose of either 300 μg or 200 μg of the oligonucleotide listed in the table below. Three hours after injection, each mouse was evaluated according to seven different criteria: (1) the mouse was energetic, alert, and quick to react; (2) the mouse stood or hunched over without stimulation; (3) the mouse made any movement without stimulation; (4) the mouse moved forward after being lifted; (5) the mouse made any movement after being lifted; (6) the mouse responded to a pinch of the tail; and (7) regular breathing. For each of the seven different criteria, each mouse was given a subscore of 0 if it met the criterion, and 1 otherwise. After all seven criteria were evaluated, the subscores were summed for each mouse and then averaged for each group. For example, if a mouse is energetic, alert, responsive, and meets all other criteria 3 hours after administration of 300 μg ICV, the mouse will receive a total score of 0. If another mouse is lethargic, not alert, and not responsive 3 hours after administration of 300 μg ICV, but meets all other criteria, the mouse will receive a score of 1. Mice treated with physiological saline generally receive a score of 0. The results are presented in Table 67 below as the average score for each treatment group. "ND" means no data. These results are from ISIS613099, ISIS613361, ISIS613370, IS IS 623782, ISIS 623996, ISIS424880, and ISIS 6 This indicates that 03054 was fully acceptable.
[0558] [Table 67]
[0559] Example 20: In vivo analysis of human tau-targeting oligonucleotides in rats
[0560] Sprague Dolly rats were divided into groups of four rats each. Each rat in each group received either a single 1 mg intrathecal (IT) dose or a single 3 mg intrathecal (IT) dose of ISIS613099, ISIS613361, ISIS61337 0, ISIS 623782, ISIS 623996, ISIS424880, or ISIS 603054 was administered. Three hours after the injection, movement in seven different parts of the body was impaired. Each rat was evaluated. The seven body parts were: (1) the rat's tail; (2) the rat's posterior posture; (3) the rat's hind limbs; (4) the rat's hind feet; (5) the rat's forelegs; (6) the rat's anterior posture; and (7) the rat's head. For each of the seven different body parts, each rat was given a subscore of 0 if the body part was moving, or a subscore of 1 if the body part was paralyzed. After each of the seven body parts was evaluated, the subscores were summed for each mouse and then averaged for each group. For example, if a rat's tail, head, and all other evaluated body parts were moving 3 hours after administration of 3 mg IT, that rat would receive a total score of 0. If another rat's tail was not moving 3 hours after administration of 3 mg IT, but all other evaluated body parts were moving, that rat would receive a score of 1. Rats treated with saline generally receive a score of 0. Scores at the upper end of the range would suggest toxicity. The results are shown in Table 68 below, as the average scores for each treatment group.
[0561] [Table 68] The present invention provides, for example, the following items: (Item 1) It consists of 12 to 30 bonded nucleosides, and SEQID NO: 20-2443 and A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of SEQ ID NO: 2478-2483. (Item 2) The modified oligonucleotide contains at least 8, at least 9, and at least 2 of any nucleic acid base sequences of SEQ ID NO: 446, 313, 321, 1634, and 2309. The compound according to item 1, having a nucleic acid base sequence comprising 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases. (Item 3) The modified oligonucleotide is the compound described in item 1, having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases, with SEQ ID NO: 446. (Item 4) The modified oligonucleotide is the compound described in item 1, having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases, with SEQ ID NO:313. (Item 5) The modified oligonucleotide is the compound described in item 1, having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases, with SEQ ID NO:321. (Item 6) The modified oligonucleotide is the compound described in item 1, having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases, with SEQ ID NO: 1634. (Item 7) The modified oligonucleotide is the compound described in item 1, having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases, with SEQ ID NO: 2309. (Item 8) It consists of 12 to 30 bonded nucleosides, and SEQID NO: 2444-247 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence of 7 and SEQ ID NO:2484-2565. (Item 9) It consists of 12 to 30 bonded nucleosides, and has SEQID NO: 20-2565 A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases of any nucleic acid base sequence. (Item 10) It consists of 12 to 30 bonded nucleosides and has nucleic acid base 13 of SEQID NO:1. A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of 5783-135980. (Item 11) It consists of 12 to 30 bonded nucleosides and has nucleic acid base 13 of SEQID NO:1. A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of 5853-135872. (Item 12) It consists of 12 to 30 bonded nucleosides and has nucleic acid base 13 of SEQID NO:1. A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of 5783-135929. (Item 13) It consists of 12 to 30 bonded nucleosides and has nucleic acid base 13 of SEQID NO:1. A compound comprising a modified oligonucleotide having a nucleic acid base sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 consecutive nucleic acid bases complementary to equal-length portions of 5783-135914. (Item 14) The nucleic acid base sequence of the modified oligonucleotide is at least as shown in SEQID NO:1. Compounds described in items 4-7 that are 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary. (Item 15) A compound according to any of the above items, comprising a single-strand modified oligonucleotide. (Item 16) A compound according to any of the above items, wherein at least one nucleoside bond is a modified nucleoside bond. (Item 17) At least one modified nucleoside bond is a phosphorothioate nucleoside bond. A compound listed in item 16. (Item 18) The compounds described in item 16, wherein each nucleoside bond is either a phosphorothioate nucleoside bond or a phosphodiester nucleoside bond. (Item 19) A compound described in any of items 1 to 18, wherein at least one nucleoside bond is a phosphodiester nucleoside bond. (Item 20) The two nucleoside bonds are phosphodiester nucleoside bonds, as described in any of items 1-18. (Item 21) The three nucleoside bonds are phosphodiester nucleoside bonds, as described in any of items 1-18. (Item 22) The four nucleoside bonds are phosphodiester nucleoside bonds, as described in any of items 1-18. (Item 23) The five nucleoside bonds are phosphodiester nucleoside bonds, as described in any of items 1-18. (Item 24) The compounds listed in any of items 1-18, wherein the six nucleoside bonds are phosphodiester nucleoside bonds. (Item 25) A compound described in any of items 1-18, wherein at least six nucleoside bonds are phosphodiester nucleoside bonds. (Item 26) A compound according to any of the above items, wherein at least one nucleoside bond is a phosphorothioate bond and at least one nucleoside bond is a phosphodiester bond. (Item 27) Each modified nucleoside bond is a phosphorothioate nucleoside bond, and the compounds are those listed in any of items 1 to 17. (Item 28) A compound according to any of the above items, wherein at least one nucleoside contains a modified nucleic acid base. (Item 29) The modified nucleic acid base is 5-methylcytosine, as described in item 28. (Item 30) The compound according to any of the above items, wherein at least one nucleoside of the modified oligonucleotide contains a modified sugar. (Item 31) The compound according to item 30, wherein at least one of the modified sugars is a bicyclic sugar. (Item 32) The aforementioned bicyclic sugar contains a chemical bond between the 2' and 4' positions of a sugar 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C12 alkyl, or a protecting group, as described in item 31. (Item 33) The compound described in item 31, wherein the bicyclic sugar comprises a 4'-CH2-N(R)-O-2' bridge, where R is independently H, C1-C12 alkyl, or a protecting group. (Item 34) The compound described in item 31, in which at least one modified sugar contains a 2'-O-methoxyethyl group. thing. (Item 35) The modified sugar is a compound described in item 31, containing a 2'-O(CH2)2-OCH3 group. (Item 36) The modified oligonucleotides are: A gap segment consisting of 10 bound deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 37) The modified oligonucleotides are: A gap segment consisting of nine bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 38) The modified oligonucleotides are: A gap segment consisting of seven bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 39) The modified oligonucleotides are: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of 5 bonded nucleosides; and, A 3' wing segment consisting of five bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 40) The modified oligonucleotides are: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of four bonded nucleosides; and, A 3' wing segment consisting of six bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 41) The modified oligonucleotides are: A gap segment consisting of eight bonded deoxynucleosides; A 5' wing segment consisting of six bonded nucleosides; and, A 3' wing segment consisting of four bonded nucleosides; Includes, The compound according to any of the above items, wherein the gap segment is located between the 5' wing segment and the 3' wing segment, and each nucleoside of each wing segment contains a modified sugar. (Item 42) The modified oligonucleotide is a compound according to any of the above items, consisting of 20 bound nucleosides. (Item 43) The modified oligonucleotide is a compound according to any of the above items, consisting of 19 bonded nucleosides. (Item 44) The modified oligonucleotide is a compound according to any of the above items, consisting of 18 bound nucleosides. (Item 45) A composition comprising the compound or a salt thereof as described in any of the preceding items, and at least one pharmaceutically acceptable carrier or diluent. (Item 46) A method comprising administering to an animal the compound or composition described in any of the preceding items. (Item 47) The animal is a human, as described in item 46. (Item 48) The method according to item 46, wherein administration of the compound prevents, treats, improves or delays the progression of tau-related diseases, disorders or conditions. (Item 49) The disease, disorder, or condition described above is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroidal degeneration (CBD), epilepsy, or Dravet syndrome, as described in item 48. (Item 50) The disease, disorder, or condition is Alzheimer's disease, as described in item 48. (Item 51) Use of the compound or composition described in any of the preceding items for the manufacture of a pharmaceutical product for the treatment of neurodegenerative diseases, disorders or conditions. (Item 52) The aforementioned diseases, disorders, or conditions are tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome, as described in item 51. (Item 53) The aforementioned disease, disorder, or condition is Alzheimer's disease, as used in item 51. (Item 54) The compound or composition described in any of items 1 to 46, for use in the treatment of neurodegenerative diseases, disorders, or conditions. (Item 55) The aforementioned disease, disorder, or condition is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome, as described in item 54, the compound or composition. (Item 56) The disease, disorder, or condition is tauopathy, Alzheimer's disease, or the compound or composition described in item 54. (Item 57) A compound consisting of ISIS613099. (Item 58) A compound consisting of ISIS613361. (Item 59) A compound consisting of ISIS613370. (Item 60) A compound consisting of ISIS623782. (Item 61) A compound consisting of ISIS623996. (Item 62) A compound consisting of modified oligonucleotides following the following formula: GesAeo Teo AeoTeo Tds Ads Tds mCds mCds Tds Tds Tds GdsAd s Geo mCeo mCes Aes mCe; Here A = adenine, mC=5'-methylcytosine G = guanine, T = thymine, e=2'-O-methoxyethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester nucleoside bond, and s = phosphorothioate nucleoside interbonding. (Item 63) Compounds consisting of modified oligonucleotides following the following formula: AesmCeo Aeo mCeo Aeo mCds mCds Tds Tds mCds Ads Tds TdsTds Ads mCeo Teo Ges Tes mCe; Here A = adenine, mC=5'-methylcytosine G = guanine, T = thymine, e=2'-O-methoxyethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester nucleoside bond, and s = phosphorothioate nucleoside interbonding. (Item 64) A compound consisting of modified oligonucleotides following the following formula: GesGeo Teo TeoTeo Tds mCds Ads Ads Ads mCds Ads mCdsAds m Cds mCeo Teo Tes mCes Ae; Here A = adenine, mC=5'-methylcytosine G = guanine, T = thymine, e=2'-O-methoxyethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester nucleoside bond, and s = phosphorothioate nucleoside interbonding. (Item 65) Compounds consisting of modified oligonucleotides following the following formula: mCesmCeo GeoTeoTesTdsTdsmCdsTdsTdsAdsmCdsmCdsAeo mCeo mCes mCes Te; Here A = adenine, mC=5'-methylcytosine G = guanine, T = thymine, e=2'-O-methoxyethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester nucleoside bond, and s = phosphorothioate nucleoside interbonding. (Item 66) Compounds consisting of modified oligonucleotides following the following formula: AesAeo Teo TeoTes Gds mCds Tds mCds Tds Tds Ads mCdsTeo m Ceo mCes mCes Ae; Here A = adenine, mC=5'-methylcytosine G = guanine, T = thymine, e=2'-O-methoxyethyl modified nucleoside, d=2'-deoxynucleoside, and o = phosphodiester nucleoside bond, and s = phosphorothioate nucleoside interbonding. (Item 67) A composition comprising the compound or a salt thereof as described in any of items 57 to 66, and at least one pharmaceutically acceptable carrier or diluent. (Item 68) A method comprising administering to an animal the compound or composition described in any of items 57 to 66. (Item 69) The method described in item 68, wherein the animal is a human. (Item 70) The administration of the compound described above interferes with, treats, improves or delays the progression of tau-related diseases, disorders or conditions, as described in item 67 or 68. (Item 71) The disease, disorder, or condition described above is tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid degeneration (CBD), epilepsy, or Dravet syndrome, as described in item 70. (Item 72) The method according to item 71, wherein the disease, disorder, or condition is Alzheimer's disease. (Item 73) Use of the compound or composition described in any of items 57 to 66 for the manufacture of a pharmaceutical product for the treatment of neurodegenerative disorders. (Item 74) The aforementioned neurodegenerative disorders are tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome, as described in item 73. (Item 75) The aforementioned neurodegenerative disorder is Alzheimer's disease, as described in item 73. (Item 76) The compound or composition described in any of items 1-45 or 57-66, for use in the treatment of neurodegenerative disorders. (Item 77) The compound or composition described in any of items 1-45 or 57-66, for use in the treatment of a neurodegenerative disorder selected from tauopathy, Alzheimer's disease, frontotemporal dementia (FTD), FTDP-17, progressive supranuclear palsy (PSP), chronic traumatic encephalopathy (CTE), corticosteroid ganglion degeneration (CBD), epilepsy, or Dravet syndrome. (Item 78) The compound or composition described in any of items 1-45 or 57-66, for use in the treatment of Alzheimer's disease.
Claims
[Claim 1] The composition or method described in the specification.