SARM1 bi-allele k gene knockout
The bi-allele knockout of the SARM1 gene using CRISPR technology inhibits photoreceptor degeneration, offering a treatment for retinitis pigmentosa and age-related macular degeneration by inactivating the SARM1 gene in photoreceptor cells.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- EMENDOBIO INC
- Filing Date
- 2026-01-27
- Publication Date
- 2026-04-28
AI Technical Summary
The Sterile alpha and TIR motif-containing 1 (SARM1) gene promotes photoreceptor degeneration, contributing to conditions such as retinitis pigmentosa, photoreceptor degeneration, and age-related macular degeneration, for which there is a need for effective inhibition or prevention.
A bi-allele knockout of the SARM1 gene in photoreceptor cells is achieved using CRISPR nuclease and RNA molecules with guide sequences targeting the SARM1 gene, inducing double-strand breaks and subsequent inactivation.
This approach sustains photoreceptors, potentially treating or preventing retinitis pigmentosa, photoreceptor degeneration, and age-related macular degeneration by inhibiting SARM1-mediated cell death.
Smart Images

Figure 2026071272000010 
Figure 2026071272000011 
Figure 2026071272000012
Abstract
Description
Technical Field
[0001] Throughout this application, various publications are referenced, including those referenced in parentheses. The entire disclosure of all publications mentioned in this application is incorporated by reference into this application to provide additional explanation of the technology related to the present invention and the technical features that can be used with the present invention.
[0002] Sequence listing reference This application incorporates by reference the nucleotide sequences present in a file named "210527_91408-A-PCT_Sequence_Listing_AWG.txt", created on May 25, 2021, in the IBM-PC machine format, which has an operating system compatibility with MS-Windows and is included in a text file filed on May 27, 2021, as part of this application and is 2,585 kilobytes in size.
Background Art
[0003] The Sterile alpha and TIR motif-containing 1 (SARM1) gene is a NAD+ hydrolase that acts as a negative regulator of the MYD88- and TRIF-dependent toll-like receptor signaling pathway by promoting Wallerian degeneration, a damage-induced type of programmed cell death associated with the degeneration of axons distal to the site of injury. SARM1 can also activate neuronal cell death in response to stress and has a role in the structure and function of the retina (Molday et al., 2013).
Summary of the Invention
[0004] An approach has been disclosed to inhibit photoreceptor degeneration by knocking out the SARM1 gene, thereby sustaining photoreceptors in the eye. Accordingly, the bi-allele knockout of the SARM1 gene in photoreceptor cells described herein may be used to treat, inhibit, prevent, and / or improve any one of the following: retinitis pigmentosa, photoreceptor (rod and cone) degeneration, and age-related macular degeneration.
[0005] This disclosure also relates to a method for inactivating the alleles of the steryl alpha and TIR motif-containing 1 (SARM1) gene in cells. CRISPR nuclease or a sequence encoding a CRISPR nuclease; and RNA molecules containing a guide sequence portion having 17 to 50 nucleotides or a nucleotide sequence encoding it. The process involves introducing a composition containing the above into cells, This invention provides a method in which a complex of a CRISPR nuclease and an RNA molecule affects double-strand breaks in the allele of the SARM1 gene.
[0006] According to embodiments of the present invention, an RNA molecule is provided that includes a guide sequence portion having 17 to 50 consecutive nucleotides, including the nucleotides in the sequence described in any one of Sequence IDs 1 to 12105.
[0007] According to some embodiments of the present invention, a composition is provided comprising an RNA molecule and a CRISPR nuclease, the RNA molecule comprising a guide sequence portion having 17 to 50 consecutive nucleotides, including the nucleotide in the sequence described in any one of Sequence IDs 1 to 12105.
[0008] According to several embodiments of the present invention, a method is provided for inactivating the SARM1 allele in cells, the method comprising delivering to cells a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease. In some embodiments, the cells are rod cells. In some embodiments, the cells are cone cells. In some embodiments, the cells are photoreceptor cells. In some embodiments, delivery to cells is performed in vivo, ex vivo, or in vitro. In some embodiments, the method is performed ex vivo, and cells are provided / explanted from individual patients. In some embodiments, the method further comprises the step of introducing the resulting cells having the modified / knockout SARM1 allele into individual patients.
[0009] According to some embodiments of the present invention, a method is provided for treating and / or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, the method comprising delivering a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of Sequence ID No. 1 to 12105, and a CRISPR nuclease, to cells of interest that have or are at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0010] According to some embodiments of the present invention, there is a use for inactivating a SARM1 allele in a cell of a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105 and a CRISPR nuclease, comprising delivering the composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105 and a CRISPR nuclease to the cell.
[0011] According to embodiments of the present invention, a pharmaceutical is provided comprising an RNA molecule having a guide sequence portion comprising 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease, for use in inactivating the SARM1 allele in cells, wherein the pharmaceutical is administered by delivering a composition comprising an RNA molecule having a guide sequence portion comprising 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease to cells.
[0012] According to some embodiments of the present invention, there is a use provided for a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides including a nucleotide in the sequence described in any one of SEQ ID NOs: 1 to 12105 and a CRISPR nuclease, for treating, improving or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, comprising delivering the composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides including a nucleotide in the sequence described in any one of SEQ ID NOs: 1 to 12105 and a CRISPR nuclease to target cells having or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0013] In some embodiments, the method is performed in vivo, and the cells are photoreceptor cells in the retina of the eye in question.
[0014] According to some embodiments of the present invention, a pharmaceutical is provided comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides containing nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease, for use in treating, improving, or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, wherein the pharmaceutical is administered by delivering a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides containing nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease, to target cells having or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0015] According to some embodiments of the present invention, a kit is provided for inactivating the SARM1 allele in cells, comprising an RNA molecule, a CRISPR nuclease, and / or tracrRNA molecule, and an RNA molecule; a CRISPR nuclease, and / or tracrRNA molecule, comprising a guide sequence portion having 17 to 50 consecutive nucleotides including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105; and instructions for delivering the RNA molecule; the CRISPR nuclease, and / or tracrRNA to cells.
[0016] According to some embodiments of the present invention, a kit is provided for treating a target photoreceptor degeneration, comprising instructions for delivering an RNA molecule, a CRISPR nuclease, and / or tracrRNA molecule, to a target cell having or at risk of experiencing photoreceptor degeneration, the RNA molecule, the CRISPR nuclease, and / or tracrRNA, to a target cell having a guide sequence portion having 17 to 50 consecutive nucleotides, including a nucleotide in the sequence described in any one of SEQ ID NOs: 1 to 12105. [Brief explanation of the drawing]
[0017] [Figure 1A]Screening of the activity of RNA guide molecules targeting SARM1 in HeLa cells. Cells were harvested 72 hours after DNA transfection. Genomic DNA was extracted, the endogenous genomic region was amplified using on-target primers, and then used for capillary electrophoresis. The graph shows the edited % ± standard deviation (STDV) of the mean of three independent experiments. Plasmids encoding SpCas9 were co-transfected with plasmids expressing the indicated RNA guide molecules. [Figure 1B] Screening of the activity of RNA guide molecules targeting SARM1 in HeLa cells. Cells were harvested 72 hours after DNA transfection. Genomic DNA was extracted, and endogenous genomic regions were amplified using on-target primers, followed by capillary electrophoresis. The graph shows the edited % ± standard deviation (STDV) of the mean of three independent experiments. OMNI-50 or OMNI-79 CRISPR nucleases were co-transfected with the indicated RNA guide molecules.
[0018] [Figure 2] RNP activity was determined by electroporating Neuro-2a cells with RNPs of SpCas9 nuclease complexed with a specific RNA guide molecule. Cells were harvested 72 hours after DNA electroporation, genomic DNA was extracted, and then analyzed by next-generation sequencing (NGS). The graph shows the %±STDV of editing for two independent electroporations.
[0019] [Figure 3] Relative amount of edited SARM1 RNA. Neuro-2a cells were harvested 7 days after electroporation, RNA was extracted, and reverse transcribed. The relative amount of SARM1 RNA was quantified using the AriaMx system. mRNA levels were quantified compared to unedited, untreated cells.
[0020] [Figure 4]Editing activity of OMNI-103 CRISPR nuclease by RNA guide molecules targeting SARM1 in HeLa cells. Specific RNA guide molecules were co-transfected with OMNI-103 CRISPR nuclease, and their on-target activities were determined. Cells were harvested 72 hours after DNA transfection, genomic DNA was extracted, the regions of mutations were amplified, and analyzed by NGS. Transfection efficiency was measured by mCherry fluorescence. The graph represents %±STDV of editing of three independent transfections.
Mode for Carrying Out the Invention
[0021] Unless otherwise indicated, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of the present invention, exemplary methods and / or materials are described below. In case of conflict, including definitions, the present patent specification will control. Further, the materials, methods, and examples are illustrative only and not intended to be limiting necessarily.
[0022] It should be understood that the terms "a" and "an" as used herein above and elsewhere in this specification refer to "one or more" of the listed components. Unless specifically stated otherwise, the use of the singular form includes the plural. This will be apparent to those of ordinary skill in the art. Thus, the terms "a", "an", and "at least one" are used interchangeably in this application.
[0023] For the purpose of better understanding the present teachings and not in any way limiting the scope of the present teachings, unless otherwise indicated, all numbers expressing amounts, percentages or ratios, as well as other numerical values used in this specification and the claims, are to be understood as being modified in all instances by the term "about". Accordingly, unless the contrary is indicated, the numerical parameters set forth in the following specification and the appended claims are approximations that may vary depending upon the desired properties sought. At the very least, each numerical parameter should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.
[0024] Unless otherwise specified, adjectives such as "substantially" and "about" modifying the condition or relationship characteristics of one or more features of an embodiment of the present invention are to be understood to mean that the condition or characteristic is defined within an acceptable range that is acceptable for the operation of the embodiment for its intended use. Unless otherwise indicated, the word "or" in this specification and the claims is to be regarded as an inclusive "or" rather than an exclusive "or", indicating at least one of the relevant items, or any combination.
[0025] In the description and claims of the present application, each of the verbs "comprise", "include" and "have" and their conjugations are used to indicate that one or more of the objects of the verb are not necessarily a complete list of the components, elements or parts of one or more of the subjects of the verb. Other terms used in this specification are to be defined by their well-known meanings in the art.
[0026] In some embodiments of the present invention, DNA nucleases are utilized to act on the cleavage of DNA at a target site and induce a cellular repair mechanism, such as, but not limited to, non-homologous end joining (NHEJ). During classical NHEJ, the two ends of a double-strand break (DSB) site are ligated together in a rapid but inaccurate manner (i.e., frequently resulting in mutations in the DNA at the cleavage site in the form of small insertions or deletions).
[0027] As used herein, the term “modified cell” refers to a cell in which double-strand cleavage is acted upon by a complex of an RNA molecule and a CRISPR nuclease as a result of hybridization with a target sequence, i.e., on-target hybridization.
[0028] As used herein, the terms “targeting sequence” or “targeting molecule” refer to a nucleotide sequence or molecule that includes a nucleotide sequence that can hybridize to a particular target sequence, for example, a targeting sequence has a nucleotide sequence that is at least partially complementary to the sequence being targeted along the length of the targeting sequence. A targeting sequence or targeting molecule may be part of an RNA molecule that can form a complex with a CRISPR nuclease, either alone or in combination with other RNA molecules, with the targeting sequence functioning as the targeting portion of the CRISPR complex. When a molecule having a targeting sequence is present simultaneously with a CRISPR molecule, the RNA molecule can target the CRISPR nuclease to a particular target sequence, either alone or in combination with one or more additional RNA molecules (e.g., a tracrRNA molecule). As a non-limiting example, the guide sequence portion of a CRISPR RNA molecule or a single guide RNA molecule may function as a targeting molecule. Each possibility represents a distinct embodiment. Targeting sequences can be custom designed to target any desired sequence.
[0029] As used herein, the term “target” refers to the preferential hybridization of a targeted sequence of a targeted molecule to a nucleic acid having a targeted nucleotide sequence. The term “target” is understood to encompass variable hybridization efficiency, meaning that while preferential targeting of nucleic acids having a targeted nucleotide sequence exists, unintended off-target hybridization may also occur in addition to on-target hybridization. When an RNA molecule targets a sequence, the complex of the RNA molecule and a CRISPR nuclease molecule is understood to target a sequence for nuclease activity.
[0030] The "guide sequence portion" of an RNA molecule refers to a nucleotide sequence that can hybridize to a specific target DNA sequence. For example, the guide sequence portion has a nucleotide sequence that is partially or completely complementary to the targeted DNA sequence along the length of the guide sequence portion. In some embodiments, the guide sequence portion is 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides long, or approximately 17-50, 17-49, 17-48, 17-47, 17-46, 17-45, 17-44, 17-43, 17-42, 17-41, 17-40, 17-3 The length of the guide sequence is 9, 17-38, 17-37, 17-36, 17-35, 17-34, 17-33, 17-31, 17-30, 17-29, 17-28, 17-27, 17-26, 17-25, 17-24, 17-22, 17-21, 18-25, 18-24, 18-23, 18-22, 18-21, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-22, 18-20, 20-21, 21-22, or 17-20 nucleotides. The total length of the guide sequence portion is perfectly complementary to the DNA sequence targeted along the length of the guide sequence portion. The guide sequence portion may be part of an RNA molecule capable of forming a complex with a CRISPR nuclease, with the guide sequence portion functioning as the DNA targeting portion of the CRISPR complex. When the RNA molecule containing the guide sequence portion is present simultaneously with the CRISPR molecule, either alone or in combination with one or more additional RNA molecules (e.g., a tracrRNA molecule), the RNA molecule can target the CRISPR nuclease to a specific target DNA sequence. Thus, the CRISPR complex can be formed by the direct binding of the RNA molecule containing the guide sequence portion to the CRISPR nuclease, or by the binding of the RNA molecule containing the guide sequence portion and one or more additional RNA molecules to the CRISPR nuclease. Each possibility represents a distinct embodiment. The guide sequence portion can be custom designed to target any desired sequence.Therefore, a molecule containing a “guide sequence portion” is a type of targeted molecule. In some embodiments, the guide sequence portion is the same as the guide sequence described herein, for example, in any of SEQ ID NOs: 1 to 12105, or contains a sequence that differs by 1, 2, 3, 4, or 5 nucleotides or less. Each possibility represents a separate embodiment. In some of these embodiments, the guide sequence portion contains the same sequence as the sequence described in any of SEQ ID NOs: 1 to 12105. Throughout this application, the terms “guide molecule,” “RNA guide molecule,” “guide RNA molecule,” and “gRNA molecule” are synonymous with a molecule containing a guide sequence portion.
[0031] As used herein, the term “non-discriminative” refers to a guide sequence portion of an RNA molecule that targets a specific DNA sequence common to all alleles of a gene.
[0032] In embodiments of the present invention, the RNA molecule includes a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of Sequence IDs 1 to 12105.
[0033] RNA molecules and / or guide sequence portions of RNA molecules may contain modified nucleotides. Exemplary modifications to nucleotides / polynucleotides may be synthetic and include polynucleotides containing nucleotides other than naturally occurring adenine, cytosine, thymine, uracil, or guanine bases. Modifications to polynucleotides include polynucleotides containing synthetic, naturally occurring nucleosides, such as locked nucleic acids. Modifications to polynucleotides may be used to increase or decrease the stability of RNA. An example of a modified polynucleotide is mRNA containing 1-methylpseudridine. For modified polynucleotides and examples of their use, see U.S. Patent No. 8,278,036, PCT International Publication No. WO / 2015 / 006747, and Weissman and Kariko (2015), each of which is incorporated herein by reference.
[0034] As used herein, “consecutive nucleotides” as described in the SEQ ID NO: means nucleotides in a sequence of nucleotides in the order described in the SEQ ID NO: without any intervening nucleotides.
[0035] In embodiments of the present invention, the guide sequence portion may be 50 nucleotides long and may contain 20 to 22 consecutive nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105. In embodiments of the present invention, the guide sequence portion may be less than 22 nucleotides long. For example, in embodiments of the present invention, the guide sequence portion may be 17, 18, 19, 20, or 21 nucleotides long. In such embodiments, the guide sequence portion may consist of 17, 18, 19, 20, or 21 nucleotides, respectively, in the sequence of 17 to 22 consecutive nucleotides described in any one of SEQ ID NOs: 1 to 12105. For example, a guide sequence portion having 17 nucleotides in the sequence of 17 consecutive nucleotides described in SEQ ID NO: 12106 may consist of any one of the following nucleotide sequences (nucleotides excluded from the consecutive sequence are marked with a strikethrough): AAAAAAAUGUACUUGGUUCC (Sequence ID 12106) 17-nucleotide guide sequence 1: AAAAAAAUGUACUUGGUUCC (Sequence ID 12107) 17-nucleotide guide sequence 2: AAAAAAAUGUACUUGGUUCC (Sequence ID 12108) 17-nucleotide guide sequence 3: AAAAAAAUGUACUUGGUUCC (Sequence ID 12109) 17-nucleotide guide sequence 4: AAAAAAAUGUACUUGGUUCC (Sequence ID 12110)
[0036] In embodiments of the present invention, the guide sequence portion may be longer than 20 nucleotides. For example, in embodiments of the present invention, the guide sequence portion may be 21, 22, 23, 24, or 25 nucleotides long. In such embodiments, the guide sequence portion includes 17 to 50 nucleotides comprising a sequence of 20, 21, or 22 consecutive nucleotides as described in any one of Sequence IDs 1 to 12105, and additional nucleotides that are perfectly complementary to the nucleotides or sequences of nucleotides adjacent to the 3' end of the target sequence, the 5' end of the target sequence, or both.
[0037] In embodiments of the present invention, an RNA molecule containing a CRISPR nuclease and a guide sequence portion forms a CRISPR complex that binds to a target DNA sequence, resulting in cleavage of the target DNA sequence. A CRISPR nuclease, for example Cpf1, may form a CRISPR complex containing a CRISPR nuclease and an RNA molecule that does not contain further tracrRNA molecules. Alternatively, a CRISPR nuclease, for example Cas9, may form a CRISPR complex between a CRISPR nuclease, an RNA molecule, and a tracrRNA molecule. The guide sequence portion containing a nucleotide sequence that can hybridize to a specific target DNA sequence and the sequence portion involved in CRISPR nuclease binding, for example tracrRNA, may be located on the same RNA molecule. Alternatively, the guide sequence portion may be located on one RNA molecule, and the sequence portion involved in CRISPR nuclease binding, for example tracrRNA, may be located on a separate RNA molecule. A single RNA molecule comprising a guide sequence portion (e.g., a DNA-targeting RNA sequence) and at least one CRISPR protein-binding RNA sequence portion (e.g., a tracrRNA sequence portion) can form a complex with a CRISPR nuclease and function as a DNA-targeting molecule. In some embodiments, a first RNA molecule comprising a DNA-targeting RNA portion containing a guide sequence portion and a second RNA molecule comprising a CRISPR protein-binding RNA sequence interact by base pairing to form an RNA complex that targets the CRISPR nuclease to a DNA target site, or they fuse together to form an RNA molecule that complexes with a CRISPR nuclease and targets the CRISPR nuclease to a DNA target site.
[0038] In embodiments of the present invention, the RNA molecule containing the guide sequence portion may further contain the sequence of a tracrRNA molecule. Such embodiments may be designed as a synthetic fusion of the guide portion of the RNA molecule and transactivated crRNA (tracrRNA) (see Jinek et al., 2012). In such embodiments, the RNA molecule is a single guide RNA (sgRNA) molecule. Embodiments of the present invention may also form a CRISPR complex using a separate tracrRNA molecule and a separate RNA molecule containing the guide sequence portion. In such embodiments, the tracrRNA molecule may hybridize with the RNA molecule by base pairing, which may be advantageous in certain applications of the present invention described herein.
[0039] The term "tracrmate sequence" refers to a sequence that is sufficiently complementary to the tracrRNA molecule so as to hybridize to tracrRNA by base pairing and promote the formation of the CRISPR complex. (See U.S. Patent No. 8,906,616). In embodiments of the present invention, the RNA molecule may further include a portion having a tracrmate sequence.
[0040] For the purposes of this disclosure, “gene” includes DNA regions that encode a gene product, as well as all DNA regions that regulate the production of a gene product, whether or not such regulatory sequences are adjacent to the sequences encoded and / or transcribed. Thus, a gene includes, but is not limited to, promoter sequences, terminators, translational regulatory sequences (e.g., ribosome binding sites and internal ribosome entry sites), enhancers, silencers, insulators, boundary elements, origins of replication, matrix attachment sites, and locus regulatory regions.
[0041] Eukaryotic cells include, but are not limited to, fungal cells (such as yeast), plant cells, animal cells, mammalian cells, and human cells.
[0042] As used herein, the term “nuclease” refers to an enzyme capable of cleaving phosphodiester bonds between nucleotide subunits of nucleic acids. Nucleases may be isolated or derived from natural sources. Natural sources may be any organism. Alternatively, nucleases may be modified or synthetic proteins that retain phosphodiester bond cleavage activity. Genetic modification can be achieved using nucleases, such as CRISPR nucleases.
[0043] According to embodiments of the present invention, an RNA molecule is provided that includes a guide sequence portion (e.g., a targeting sequence) that includes a nucleotide sequence that is completely or partially complementary to a target sequence including an allele-related SNP site (REF / SNP sequence) located within or near the SARM1 gene. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments, the guide sequence portion is configured to target a CRISPR nuclease against the target sequence, and the CRISPR nuclease complexed with it is configured to induce a cleavage event, selected from double-strand breaks and single-strand breaks, within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the SARM1 target site. In some embodiments, the cleavage event enables nonsense mutation-dependent degradation of the SARM1 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.
[0044] In some embodiments, the target sequence of the SARM1 gene allele is modified by the introduction of an NHEJ-mediated indel (e.g., insertion or deletion), resulting in reduced or eliminated expression of the gene product encoded by the SARM1 gene allele. In some embodiments, the reduced or eliminated expression is due to nonsense mutation-dependent mRNA degradation, such as due to an immature stop codon. In some embodiments, the reduced or eliminated expression is due to the expression of a truncated form of the SARM1 gene product. In some embodiments, the guide sequence portion is complementary to the target sequence, including the SNP site. In some embodiments, the SNP site is rs782593684. In some embodiments, the guide sequence portion is the same as any of the sequences described in SEQ ID NOs. 1 to 103, or includes a sequence that differs by only 1, 2, or 3 nucleotides or less. In some embodiments, the guide sequence portion includes SEQ ID NOs. 3, 19 to 21, 26, 30, 32, 34, 37, 104 to 131, 40, 54, 60 to 61, 65 to 67, 1 The sequence is the same as any of the sequences described in sequence numbers 32-155, 69, 72, 76, 88, 94, 98, 100-102, or 156-181, or contains a sequence that differs by only one, two, or three nucleotides or less. Each possibility represents a distinct embodiment. In some embodiments, the SNP position is 17:28372349_C_CT. In some embodiments, the guide sequence portion is the same as any of the sequences described in sequence numbers 182-313, or contains a sequence that differs by only one, two, or three nucleotides or less. In several embodiments, the guide sequence portion is the same as the sequence described in any of sequence numbers 196, 203, 209, 211, 217, 219-221, 226, 228-229, 314-352, 246-247, 253-254, 259-262, 264, 266-267, 353-389, 271, 281, 287-288, 302-305, 310, 312-313, or 390-432, or contains a sequence that differs by only one, two, or three nucleotides or less. Each possibility represents a distinct embodiment.
[0045] According to embodiments of the present invention, an RNA molecule is provided that includes a guide sequence portion (e.g., a targeting sequence) containing a nucleotide sequence that is completely or partially complementary to a target sequence located within or near the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located within 30 to 30 base pairs upstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene. In some embodiments, the guide sequence portion is complementary to a target sequence located within 50 to 50 base pairs upstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene. Each possibility represents a distinct embodiment. In some embodiments, the target sequence of the SARM1 gene is modified by the introduction of an NHEJ-mediated indel (e.g., insertion or deletion), resulting in reduced or eliminated expression of the gene product encoded by the SARM1 gene. In some embodiments, the reduced or eliminated expression is due to nonsense mutation-dependent mRNA degradation. In some embodiments, the guide sequence portion of the RNA molecule consists of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, or more than 26 nucleotides. In some embodiments, the guide sequence The column portion is configured to target a CRISPR nuclease to a target sequence, and the CRISPR nuclease, complexed with it, is configured to initiate a cleavage event, selected from double-strand breaks and single-strand breaks, within 500, 400, 300, 200, 100, 50, 25, or 10 nucleotides of the SARM1 target site. In some embodiments, the cleavage event enables nonsense mutation-dependent degradation of the SARM1 gene. In some embodiments, the RNA molecule is a guide RNA molecule, such as a crRNA molecule or a single guide RNA molecule.
[0046] In some embodiments, the guide sequence portion is complementary to a target sequence located between 30 base pairs upstream and 30 base pairs downstream of the SARM1 gene exon. In some embodiments, the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of the SARM1 gene exon. In some embodiments, the guide sequence portion is complementary to a target sequence located between 7 base pairs upstream and 7 base pairs downstream of the SARM1 gene exon. In some embodiments, the exon is exon I, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs: 1-30, 32, 34, 36-37, 182-229, 1099-1838, 38-67, 230-238, 240-251, 253-257, 259-267, 1839-2531, 69-102, 268-293, 295-300, 302-313, or 2532-3227, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon II, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs: 3228-6803, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon III, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs: 6804-8007, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon IV, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8008 to 8487, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon V, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8488 to 9831, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon VI, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 9832 to 10377, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon VII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 10378 to 11445, or contains a sequence that differs by only 3 nucleotides or less.In some embodiments, the exon is exon VIII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 11446 to 12105, or contains a sequence that differs by only 3 nucleotides or less. In some embodiments, the exon is exon IX, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 433 to 1098, or contains a sequence that differs by only 3 nucleotides or less.
[0047] According to embodiments of the present invention, a method is provided for inactivating the alleles of steryl alpha and TIR motif-containing 1 (SARM1) genes in cells, the method being: At least one CRISPR nuclease or a sequence encoding a CRISPR nuclease; and RNA molecules containing guide sequences The process involves introducing a composition containing the above into cells, The complex of CRISPR nuclease and RNA molecule causes double-strand breaks in the allele of the SARM1 gene (affects), The guide sequence portion of the RNA molecule contains 17 to 50 consecutive nucleotides, including nucleotides from the sequence described in any one of sequence numbers 1 to 12105.
[0048] In some embodiments, the composition is introduced into target cells or cells in culture.
[0049] In some embodiments, the cells are photoreceptor cells, preferably rod cells or cone cells.
[0050] In some embodiments, the CRISPR nuclease and RNA molecules are introduced into the cells substantially simultaneously or at different times.
[0051] In some embodiments, the alleles of the cell's SARM1 gene undergo insertion or deletion mutations.
[0052] In some embodiments, insertion or deletion mutations create early stop codons.
[0053] In some embodiments, inactivation results in a cleaved protein encoded by the mutant allele.
[0054] Embodiments of the present invention provide a use for treating, improving, or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, comprising delivering one of the compositions described herein to a subject who is experiencing or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0055] According to embodiments of the present invention, a pharmaceutical product comprising any one of the compositions described herein for treating, improving, or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration is provided, the pharmaceutical product being administered by delivering the composition to a subject who is experiencing or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0056] According to embodiments of the present invention, a kit for inactivating the SARM1 allele in cells is provided, comprising one of the compositions described herein and instructions for delivering the compositions to cells.
[0057] According to embodiments of the present invention, a kit is provided for treating or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration in a subject, comprising one of the compositions described herein and instructions for delivering the composition to a subject who has experienced or is at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0058] According to embodiments of the present invention, a composition is provided that includes an RNA molecule containing 17 to 50 consecutive nucleotides, including a nucleotide in the sequence described in any one of Sequence IDs 1 to 12105.
[0059] In some embodiments, the composition further comprises a CRISPR nuclease.
[0060] In some embodiments, the composition further comprises tracrRNA molecules.
[0061] According to embodiments of the present invention, a gene editing composition is provided comprising an RNA molecule comprising a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of Sequence IDs 1 to 12105. In some embodiments, the RNA molecule further comprises a portion having a sequence that binds to a CRISPR nuclease. In some embodiments, the sequence that binds to a CRISPR nuclease is a tracrRNA sequence.
[0062] In some embodiments, the RNA molecule further includes a portion having a tracrmate sequence.
[0063] In some embodiments, the RNA molecule may further include one or more linker moieties.
[0064] According to embodiments of the present invention, RNA molecules may be up to 1000, 900, 800, 700, 600, 500, 450, 400, 350, 300, 290, 280, 270, 260, 250, 240, 230, 220, 210, 200, 190, 180, 170, 160, 150, 140, 130, 120, 110, or 100 nucleotides long. Each possibility represents a separate embodiment. In embodiments of the present invention, RNA molecules may be 17-300 nucleotides long, 100-300 nucleotides long, 150-300 nucleotides long, 100-500 nucleotides long, 100-400 nucleotides long, 200-300 nucleotides long, 100-200 nucleotides long, or 150-250 nucleotides long. Each possibility represents a separate embodiment.
[0065] According to some embodiments of the present invention, the composition further comprises a tracrRNA molecule.
[0066] According to some embodiments of the present invention, a method is provided for inactivating SARM1 expression in cells, the method comprising delivering to cells a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of SEQ ID NOs: 1 to 12105, and a CRISPR nuclease.
[0067] According to some embodiments of the present invention, a method is provided for preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, the method comprising delivering to target cells a composition comprising an RNA molecule having a guide sequence portion having 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of Sequence IDs 1 to 12105, and a CRISPR nuclease.
[0068] According to embodiments of the present invention, at least one CRISPR nuclease and one or more RNA molecules are delivered to a target and / or cell substantially simultaneously or at different times.
[0069] In some embodiments, the tracrRNA molecule is delivered to the target and / or cell substantially simultaneously with or at different times to a CRISPR nuclease and one or more RNA molecules.
[0070] The compositions and methods of this disclosure may be used for the treatment, prevention, improvement, or delay of the progression of retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
[0071] Any one or a combination thereof of the above strategies for inactivating SARM1 expression may be used in the context of the present invention.
[0072] In embodiments of the present invention, an RNA molecule is used to direct a CRISPR nuclease to an exon or splice site of the SARM1 allele to produce a double-strand break (DSB), thereby inducing a crippled non-homologous end-joining (NHEJ) mechanism and the formation of a frameshift mutation in the SARM1 allele, resulting in nucleotide insertion or deletion. The frameshift mutation may result in inactivation or knockout of the SARM1 allele, for example, by the generation of an early stop codon in the SARM1 allele, leading to the production of a cleaved protein or nonsense mutation-dependent mRNA degradation of the allele transcript. In further embodiments, a single RNA molecule is used to direct a CRISPR nuclease to the promoter of the SARM1 allele.
[0073] In some embodiments, the method is used to treat subjects at risk of retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, which are disease phenotypes resulting from the expression of the SARM1 gene. In such embodiments, the method results in improvement, amelioration, or prevention of the disease phenotype.
[0074] Embodiments of the compositions described herein include at least one CRISPR nuclease, RNA molecule(s), and tracrRNA molecule(s) that are simultaneously effective in a subject or cell. The at least one CRISPR nuclease, RNA molecule(s), and tracrRNA may be delivered substantially simultaneously or at different times, but will be simultaneously effective. For example, this includes delivering the CRISPR nuclease to the subject or cell(s) before the RNA molecule and / or tracrRNA(s) are substantially present in the subject or cell(s).
[0075] In some embodiments, the cells are rod cells. In some embodiments, the cells are cone cells. In some embodiments, the cells are photoreceptor cells.
[0076] SARM1 Editorial Strategy Many healthy individuals have knockouts of both SARM1 alleles in their genome. Therefore, the present invention provides a method for knocking out the SARM1 allele in target cells, preferably photoreceptor cells, thereby inhibiting photoreceptor degeneration without harming the target. The provided method for knocking out the SARM1 allele in cells can be used to treat, prevent, or improve any one of retinitis pigmentosa, photoreceptor degeneration, and age-related macular degeneration.
[0077] SARM1 editing strategies include, but are not limited to, the following: (1) bi-allele knockouts that target any one of exons 2-9, or a combination of exons 2-9, including adjacent splice donor and acceptor sites within 7 nucleotides upstream and downstream of the exon, so that a frameshift in these exons results in nonsense mutation-dependent degradation of a nonfunctionally cleaved SARM1 protein or mutant SARM1 transcript; and (2) cleavage of the SARM1 protein by eliminating a second methionine codon in the exon and thus preventing translational reinitiation by mediated by an indel in exon 1 upstream of or overlapping the second methionine codon in the exon, or by disrupting the splice donor by targeting the exon 1-intron 1 junction.
[0078] CRISPR nuclease and PAM recognition In some embodiments, the sequence-specific nuclease is selected from or a functional variant thereof of a CRISPR nuclease. In some embodiments, the sequence-specific nuclease is an RNA-guided DNA nuclease. In such embodiments, the RNA sequence guiding the RNA-guided DNA nuclease (e.g., Cpf1) binds to all SARM1 alleles in the cell and / or directs the RNA-guided DNA nuclease to all SARM1 alleles in the cell. In some embodiments, the CRISPR complex further does not contain tracrRNA. In non-limiting examples where the RNA-guided DNA nuclease is a CRISPR protein, at least one nucleotide differentiating between the dominant SARM1 allele and the functional allele may be located within and / or proximal to a PAM site in the region where the RNA molecule is designed to hybridize. Those skilled in the art will understand that the RNA molecule can be manipulated to bind to a selected target in the genome by methods generally known in the art.
[0079] As used herein, the term "PAM" refers to a nucleotide sequence of target DNA located adjacent to the targeted DNA sequence and recognized by the CRISPR nuclease complex. PAM sequences can vary depending on the properties of the nuclease. Furthermore, there are CRISPR nucleases that can target almost all PAMs. In some embodiments of the present invention, the CRISPR system utilizes one or more RNA molecules having a guide sequence portion to direct the CRISPR nuclease to the target DNA site by Watson-Crick base pairing between the guide sequence portion and the protospacer of the target DNA site adjacent to the protospacer-adjacent motif (PAM), which is a further requirement for target recognition. The CRISPR nuclease then creates a double-strand break within the protospacer by mediating the cleavage of the target DNA site. In non-limiting examples, type II CRISPR systems utilize a mature crRNA:tracrRNA complex that directs a CRISPR nuclease, such as Cas9, to target DNA through Watson-Crick base pairing between the guide sequence portion of the crRNA and the protospacer of the target DNA adjacent to the protospacer-adjacent motif (PAM). Those skilled in the art will know that each of the manipulated RNA molecules of the present invention has a protospacer-adjacent motif (PAM), for example, a sequence related to the type of CRISPR nuclease used, for example, in non-limiting examples, NGG or NAG (where "N" is any nucleic acid base) for Streptococcus pyogenes Cas9 WT (SpCAS9); NNGRRT for Staphylococcus aureus (SaCas9); and Jejuni Cas9 For WT variants, use NNNVRYM; for SpCas9-VQR variants, use NGAN or NGNG; for SpCas9-VRER variants, use NGCG; for SpCas9-EQR variants, use NGAG; for SpCas9-NRRH variants, use NRRH (where N is any nucleic acid base, R is A or G, and H is A, C, or T); for SpCas9-NRTH variants, use NRTH (where N is any nucleic acid base, R is A or G, and H is A, C, or T);For the SpCas9-NRCH variant, use NRCH (where N is any nucleic acid base, R is A or G, and H is A, C, or T); for the SpG variant of SpCas9, use NG (where N is any nucleic acid base); for the SpCas9-NG variant of SpCas9, use NG or NA (where N is any nucleic acid base); for the SpRY variant of SpCas9, use NR, NRN, or NYN (where N is any nucleic acid base, R is A or G, and Y is C or T); for the Cas9 variant of Streptococcus canis (ScCas9), use NNG (where N is any nucleic acid base); for the SaKKH-Cas9 variant of Staphylococcus aureus (SaCas9), use NNNRRT (where N is any nucleic acid base, R is A or G); for Neisseria meningitidis ( It will be understood that the RNA molecules of the present invention are further designed to associate with a target genomic DNA sequence adjacent to a PAM that matches NmCas9 of meningitidis (where N is any nucleic acid base); TTN of Cas12b of Alicyclobacillus acidiphilus (AacCas12b) (where N is any nucleic acid base); or TTTV of Cpfl (where V is A, C, or G). Each RNA molecule of the present invention is designed to form a complex in combination with one or more different CRISPR nucleases and is designed to target a target polynucleotide sequence using one or more different PAM sequences corresponding to each CRISPR nuclease utilized.
[0080] In some embodiments, RNA-guided DNA nucleases, such as CRISPR nucleases, can be used to induce DNA breaks at desired locations within the cell's genome, either naturally occurring double-stranded or single-stranded DNA. While the most commonly used RNA-guided DNA nucleases are derived from the CRISPR system, other RNA-guided DNA nucleases are also intended for use in the genome editing compositions and methods described herein. See, for example, U.S. Publication No. 2015 / 0211023, incorporated herein by reference.
[0081] The CRISPR systems that can be used in practice of the present invention vary considerably. The CRISPR system may be a type I, type II, or type III system. Non-limiting examples of suitable CRISPR proteins include Cas3, Cas4, Cas5, Cas5e (or CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9, Casl0, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (or CasA), Cse2 (or CasB), Cse3 (or This includes CasE), Cse4 (or CasC), Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, Csxl0, Csxl6, CsaX, Csx3, Cszl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966.
[0082] In some embodiments, the RNA-guided DNA nuclease is a CRISPR nuclease derived from the type II CRISPR system (e.g., Cas9). CRISPR nucleases are found in *Streptococcus pyogenes*, *Streptococcus thermophilus*, *Streptococcus sp.*, *Staphylococcus aureus*, *Neisseria meningitidis*, *Treponema denticola*, *Nocardiopsis dassonvillei*, *Streptomyces pristinaespiralis*, *Streptomyces viridochromogenes*, *Streptomyces viridochromogenes*, and *Streptosporangium roseum*. roseum), Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.), Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa, Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difjicile, Finegoldia magna, Natranaerobius thermophilus Thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium ebestigatum evestigatum), Anabaena variabilis, Nodularia spumigena, Nostoc sp.This may be derived from Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Acaryochloris marina, or any species encoding a CRISPR nuclease having a known PAM sequence. CRISPR nucleases encoded by uncultured bacteria may also be used in the context of this invention. (See Burstein et al., Nature, 2017). Variants of CRISPR proteins having known PAM sequences, such as the SpCas9 D1135E variant, SpCas9 VQR variant, SpCas9 EQR variant, or SpCas9 VRER variant, may also be used in the context of this invention.
[0083] Therefore, CRISPR-based RNA-guided DNA nucleases such as Cas9 protein or modified Cas9 or homologs or orthologues of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems such as Cpf1 and its homologs and orthologues, can be used in the compositions of the present invention. Further CRISPR nucleases, such as those described in PCT international application publication numbers WO2020 / 223514 and WO2020 / 223553, each of which is incorporated herein by reference, may also be used.
[0084] In certain embodiments, a CRISPR nuclease may be a “functional derivative” of a naturally occurring Cas protein. A “functional derivative” of a native sequence polypeptide is a compound that has qualitative biological properties in common with the native sequence polypeptide. “Functional derivatives” include, but are not limited to, fragments of the native sequence and derivatives and fragments of the native sequence polypeptide, provided that they have biological activity in common with the corresponding native sequence polypeptide. The biological activity intended herein is the ability of a functional derivative to hydrolyze a DNA substrate into fragments. The term “derivative” encompasses both amino acid sequence variants of a polypeptide, covalent modifiers, and fusions thereof. Suitable derivatives or fragments of a Cas polypeptide include, but are not limited to, variants, fusions, covalent modifiers, or fragments of the Cas protein. Cas proteins, including Cas proteins or fragments thereof, and Cas proteins containing derivatives or fragments thereof, can be obtained from cells, chemically, or by a combination of these two procedures. The cells may be cells that naturally produce the Cas protein, or cells that naturally produce the Cas protein and are genetically engineered to produce the endogenous Cas protein at higher expression levels, or to produce the Cas protein from exogenously introduced nucleic acids (the nucleic acids encoding the same or different Cas as the endogenous Cas). In some cases, cells do not naturally produce the Cas protein and are genetically engineered to produce it.
[0085] In some embodiments, the CRISPR nuclease is Cpf1. Cpf1 is a single RNA-guided endonuclease that utilizes a T-rich protospacer flanking motif. Cpf1 cleaves DNA by alternating double-strand breaks. Two Cpf1 enzymes from Acidaminococcus and Lachnospiraceae have been shown to exhibit efficient genome editing activity in human cells (see Zetsche et al., 2015).
[0086] Therefore, the present invention can use type II CRISPR RNA-guided DNA nucleases such as Cas9 protein, modified Cas9, or a homolog, ortholog, or variant of Cas9, or other RNA-guided DNA nucleases belonging to other types of CRISPR systems, such as Cpf1 and its homolog, ortholog, or variant.
[0087] In some embodiments, the guide molecule includes one or more chemical modifications that confer new or improved properties (e.g., improved stability from degradation, improved hybridization energy, or improved binding properties with RNA-guided DNA nucleases). Suitable chemical modifications include, but are not limited to, modified bases, modified sugar moieties, or modified nucleoside linkages.Non-limiting examples of appropriate chemical modifications include 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 2'-O-methylcytidine, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluridine, dihydrouridine, 2'-O-methylpseuduridine, "beta,D-galactosylqueusin", 2'-O-methylguanosine, inosine, N6-isopentenyladenosine, 1-methyladenosine, 1-methylseuthuridine Douridine, 1-methylguanosine, 1-methylinosine, "2,2-dimethylguanosine", 2-methyladenosine, 2-methylguanosine, 3-methylcytidine, 5-methylcytidine, N6-methyladenosine, 7-methylguanosine, 5-methylaminomethyluridine, 5-methoxyaminomethyl-2-thiouridine, "β,D-mannosylquosine", 5-methoxycarbonylmethyl-2-thiouridine, 5-methoxycarbonylmethyluridine, 5-meth Xyuridine, 2-methylthio-N6-isopentenyladenosine, N-((9-beta-D-ribofuranosyl-2-methylthiopurine-6-yl)carbamoyl)threonine, N-((9-beta-D-ribofuranosylpurine-6-yl)N-methylcarbamoyl)threonine, uridine-5-oxyacetate-methyl ester, uridine-5-oxyacetate, wibutoxosin, cuosin, 2-thiocytidine, 5-methyl-2-thiouridine, 2-thiouridine, 4- These include thiouridine, 5-methyluridine, N-((9-beta-D-ribofuranosylpurine-6-yl)-carbamoyl)threonine, 2'-O-methyl-5-methyluridine, 2'-O-methyluridine, wibutosin, "3-(3-amino-3-carboxypropyl)uridine, (acp3)u", 2'-O-methyl(M), 3'-phosphorothiothioate(MS), 3'-thioPACE(MSP), pseudouridine, or 1-methylpseudridine. Each possibility represents a distinct embodiment of the present invention.
[0088] In addition to targeting the SARM1 allele with RNA-guided CRISPR nucleases, other means of inhibiting SARM1 expression in target cells, preferably photoreceptor cells, include, but are not limited to, the use of gapmers, shRNA, siRNA, customized TALENs, meganucleases, or zinc finger nucleases, small molecule inhibitors, and any other methods known in the art for reducing or eliminating gene expression in target cells. For example, U.S. Publication Nos. 6,506,559, 7,560,438; 8,420,391; 8,552,171; 7,056,704; 7,078,196; 8,362,231; 8,372,968; 9,045,754; and PCT International Publication Numbers WO / 2004 / 067736; WO / 2006 / 097 See 853;WO / 2003 / 087341;WO / 2000 / 041566l;WO / 2003 / 080809;WO / 2010 / 079430;WO / 2010 / 079430;WO / 2011 / 072246;WO / 2018 / 057989;and WO / 2017 / 164230 (the full contents of each of these are incorporated herein by reference).
[0089] Advantageously, guide RNA molecules containing at least one of the guide sequence regions presented herein result in improved SARM1 knockout efficiency when complexed with cellular CRISPR nucleases compared to other guide RNA molecules. These specifically designed sequences may also be useful for identifying SARM1 target sites for other nucleotide-targeted gene editing or gene silencing methods, such as siRNA, TALEN, meganucleases, or zinc finger nucleases.
[0090] Delivery to cells Any one of the compositions described herein can be delivered to target cells by any suitable means. The RNA molecular compositions of the present invention can target any cell containing and / or expressing the SARM1 allele, such as mammalian photoreceptor cells (e.g., rod cells or cone cells). For example, in one embodiment, the RNA molecule specifically targets the SARM1 allele of the target cell, and the target cell is a photoreceptor cell. In some embodiments, the target cell is a rod cell. In some embodiments, the target cell is a cone cell. Delivery to cells can be carried out in vivo, ex vivo, or in vitro. Furthermore, the nucleic acid compositions described herein can be delivered to cells as one or more of DNA molecules, RNA molecules, ribonucleoproteins (RNPs), nucleic acid vectors, or any combination thereof.
[0091] In some embodiments, the RNA molecule includes chemical modifications. Non-limiting examples of suitable chemical modifications include 2'-O-methyl (M), 2'-O-methyl, 3'phosphorothioate (MS), or 2'-O-methyl, 3'thioPACE (MSP), pseudouridine, and 1-methylpseudridine. Each possibility represents a distinct embodiment of the present invention.
[0092] Nucleic acid compositions, such as the RNA molecular composition of the present invention, can be delivered using any suitable viral vector system. Nucleic acids and target tissues can be introduced using conventional viral and nonviral-based gene delivery methods. In certain embodiments, the nucleic acids are administered for in vivo or ex vivo gene therapy applications. Nonviral vector delivery systems include naked nucleic acids and nucleic acids complexed with delivery vehicles such as liposomes or poloxamers. For a review of gene therapy procedures, see Anderson (1992); Nabel & Felgner (1993); Mitani & Caskey (1993); Dillon (1993); Miller (1992); Van Brunt (1988); Vigne (1995); Kremer & Perricaudet (1995); Haddada et al. (1995); and Yu et al. (1994).
[0093] Nonviral delivery methods for nucleic acids and / or proteins include electroporation, lipofection, microinjection, bioristic methods, particle gun acceleration, virosomes, liposomes, immunoliposomes, lipid nanoparticles (LNPs), polycations or lipids: nucleic acid conjugates, artificial virions, and drug-enhancing uptake of nucleic acids, or delivery to plant cells by bacteria or viruses (e.g., Agrobacterium, Rhizobium sp. NGR234, Sinorhizoboium meliloti, Mesorhizobium loti, tobacco mosaic virus, potato virus X, cauliflower mosaic virus, cassava vein mosaic virus) (see, for example, Chung et al., 2006). For example, sonoporation using the Sonitron2000 system (Rich-Mar) can also be used for nucleic acid delivery. Cationic lipid-mediated delivery of proteins and / or nucleic acids is also envisioned as an in vivo, ex vivo, or in vitro delivery method. (See Zuris et al. (2015); Coelho et al. (2013); Judge et al. (2006); and Basha et al. (2011)).
[0094] Non-viral vectors, such as transposon-based systems, including recombinant Sleeping Beauty transposon systems or recombinant PiggyBac transposon systems, can also be delivered to target cells and used in those cells to transpose the polynucleotide sequence of the composition molecule or the polynucleotide sequence encoding the composition molecule.
[0095] Further exemplary nucleic acid delivery systems include those offered by Amaxa.RTM.Biosystems (Cologne, Germany), Maxcyte, Inc. (Rockville, Md.), BTX Molecular Delivery Systems (Holliston, Mass.), and Copernicus Therapeutics Inc. (see, for example, U.S. Patent No. 6,008,336). Lipofection is described, for example, in U.S. Patents No. 5,049,386, 4,946,787, and 4,897,355, and lipofection reagents are commercially available (e.g., Transfectam®, Lipofectin®, and Lipofectamine® RNAiMAX). Cationic and neutral lipids suitable for efficient receptor recognition lipofection of polynucleotides include those disclosed in PCT International Publication Numbers WO / 1991 / 017424 and WO / 1991 / 016024. Delivery may be to cells (ex vivo administration) or to target tissue (in vivo administration).
[0096] The preparation of lipid:nucleic acid complexes, including targeted liposomes such as immunolipid complexes, is well known to those skilled in the art (see, for example, Crystal, Science (1995); Blaese et al., (1995); Behr et al., (1994); Remy et al. (1994); Gao and Huang (1995); Ahmad and Allen (1992); U.S. Patents No. 4,186,183; No. 4,217,344; No. 4,235,871; No. 4,261,975; No. 4,485,054; No. 4,501,728; No. 4,774,085; No. 4,837,028; and No. 4,946,787).
[0097] Further delivery methods include packaging the nucleic acids to be delivered into EnGeneIC delivery vehicles (EDVs). These EDVs are delivered specifically to target tissues using bispecific antibodies, with one arm of the antibody specific to the target tissue and the other arm specific to the EDV. The antibody brings the EDV to the surface of target cells, where it is then delivered into the cells by endocytosis. Once inside the cells, the contents are released (see MacDiarmid et al., 2009).
[0098] The use of RNA or DNA virus-based systems for viral delivery of nucleic acids utilizes highly evolved methods to target viruses to specific cells in the body and transport the viral payload to the nucleus. Viral vectors can be administered directly to the patient (in vivo) or they can be used to treat cells in vitro, and modified cells are then administered to the patient (ex vivo). Conventional virus-based systems for nucleic acid delivery include, but are not limited to, retrovirus, lentivirus, adenovirus, adeno-associated, vaccinia, and herpes simplex virus vectors for gene transfer.
[0099] The directivity of retroviruses can be altered by incorporating foreign envelope proteins and amplifying a potential target population of target cells. Lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and typically produce high viral titers. The choice of retroviral gene transduction system depends on the target tissue. Retroviral vectors consist of cis-acting long terminal repeats with the ability to package foreign sequences up to 6–10 kb. A minimum amount of cis-acting LTRs is sufficient for vector replication and packaging, and these are used to incorporate therapeutic genes into target cells and achieve permanent transgene expression. Widely used retroviral vectors include those based on mouse leukemia virus (MuLV), gibbon leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, for example, Buchschacher et al. (1992); Johann et al. (1992); Sommerfelt et al. (1990); Wilson et al. (1989); Miller et al. (1991); PCT International Publication No. WO / 1994 / 026877A1).
[0100] At least six viral vector approaches are currently available for gene transfer in clinical trials, utilizing approaches that involve complementing defective vectors with genes inserted into helper cell lines to generate transduction agents.
[0101] pLASN and MFG-S are examples of retroviral vectors used in clinical trials (see Dunbar et al., 1995; Kohn et al., 1995; Malech et al., 1997). PA317 / pLASN was the first therapeutic vector used in gene therapy trials (Blaese et al., 1995). Transduction efficiencies of over 50% have been observed for the MFG-S package vector (Ellem et al., (1997); Dranoff et al., 1997).
[0102] Packaging cells are used to form viral particles that can infect host cells. Such cells include 293 cells, which package adenoviruses, AAV, and Psi-2 cells, or PA317 cells, which package retroviruses. Viral vectors used in gene therapy are typically produced by producer cell lines that package nucleic acid vectors into viral particles. The vector typically contains the minimum viral sequence necessary for packaging and subsequent integration into the host (if applicable), with other viral sequences replaced by expression cassettes encoding the proteins to be expressed. Missing viral functions are supplied trans by the packaging cell line. For example, AAV vectors used in gene therapy typically retain only the inverted end repeat (ITR) sequences derived from the AAV genome necessary for packaging and integration into the host genome. The viral DNA is packaged in a cell line containing helper plasmids that encode other AAV genes, namely rep and cap, but lack ITR sequences. The cell line is also infected with adenovirus as a helper. The helper virus facilitates the replication of the AAV vector and the expression of AAV genes from the helper plasmids. Helper plasmids are not packaged in significant quantities due to the lack of ITR sequences. Adenovirus contamination can be reduced, for example, by heat treatment, which makes the adenovirus more susceptible than AAV. Furthermore, AAV can be produced on a clinical scale using baculovirus systems (see U.S. Patent No. 7,479,554).
[0103] In many gene therapy applications, it is desirable that gene therapy vectors be delivered with high specificity to specific tissue types. Therefore, viral vectors can be modified to exhibit specificity to a given cell type by expressing a ligand as a fusion protein with a viral coat protein on the outer surface of the virus. The ligand is selected to have affinity for a receptor known to be present on the target cell type. For example, Han et al. (1995) reported that Moloney mouse leukemia virus could be modified to express human heregurin fused to gp70, and that the recombinant virus infected certain human breast cancer cells expressing the human epidermal growth factor receptor. This principle can be extended to other virus-target cell pairs where the target cell expresses the receptor and the virus expresses a fusion protein containing a ligand for the cell surface receptor. For example, filamentous phages can be manipulated to present antibody fragments (e.g., FAB or Fv) that have specific binding affinity to virtually any selected cell receptor. While the above description primarily applies to viral vectors, the same principle can be applied to non-viral vectors. Such vectors can be engineered to include specific uptake sequences that promote uptake by specific target cells.
[0104] Gene therapy vectors can be delivered in vivo by individual patient administration, such as systemic administration (e.g., intravitreous, intravenous, intraperitoneal, intramuscular, subcutaneous, or intracranial injection) or topical application, as described below. Preferably, delivery of any one of the compositions disclosed herein is delivered in vivo to photoreceptor cells in the target eye to knock out SARM1 expression in retinal photoreceptor cells. The compositions can be delivered to photoreceptor cells by several known means, including the use of a viral vehicle (e.g., lentivirus, adeno-associated virus (AAV), etc.), nanoparticles, or delivery of a naked RNA composition. The compositions can be delivered in vivo to ocular photoreceptor cells via subretinal, intravitreous, or choroidal injection.
[0105] Alternatively, the vector can be delivered ex vivo to cells, such as cells explanted from individual patients (e.g., lymphocytes, bone marrow aspirates, tissue biopsies) or pluripotent donor hematopoietic stem cells, and then, after selecting the cells incorporating the vector as needed, the cells can be re-implanted into the patient. Non-limiting exemplary ex vivo approaches may include the extraction of tissue from the patient for culture (e.g., peripheral blood, bone marrow, and spleen), the transfer of nucleic acids into the cultured cells (e.g., hematopoietic stem cells), and subsequent transplantation of the cells into the patient's target tissue (e.g., bone marrow and spleen). In some embodiments, the stem cells or hematopoietic stem cells may be further treated with a viability enhancer.
[0106] Ex vivo cell transfection for diagnostic, research, or gene therapy (e.g., via reinjection of transfected cells into a host organism) is well known to those skilled in the art. In preferred embodiments, cells are isolated from a target organism, transfected with a nucleic acid composition, and then reinjected back into the target organism (e.g., a patient). Various cell types suitable for ex vivo transfection are well known to those skilled in the art (for example, see Freshney, "Culture of Animal Cells, A Manual of Basic Technique and Specialized Applications (6th edition, 2010)" and the references cited therein, for a discussion of methods for isolating and culturing cells from a patient).
[0107] Vectors containing therapeutic nucleic acid compositions (e.g., retroviruses, liposomes, etc.) can also be administered directly to organisms for in vivo cell transduction. Administration is by any of the routes commonly used to introduce molecules to blood or tissue cells, including, but not limited to, injection, infusion, topical application (e.g., eye drops and creams), and electroporation. Suitable methods for administering such nucleic acids are available and well known to those skilled in the art, and a particular composition can be administered using two or more routes, although some particular routes often yield a faster and more effective response than others. According to some embodiments, the composition is delivered by IV injection.
[0108] Suitable vectors for introducing transgenes into immune cells (e.g., T cells) include non-integrated lentiviral vectors. See, for example, U.S. Publication No. 2009 / 0117617.
[0109] A pharmaceutically acceptable carrier is determined, in part, by the specific composition being administered, as well as the specific method used to administer the composition. Therefore, a wide variety of suitable formulations of available pharmaceutical compositions exist, as described below (see, for example, Remington's Pharmaceutical Sciences, Vol. 17, 1989).
[0110] The disclosed compositions and methods may also be used in the manufacture of pharmaceuticals for treating overt genetic disorders in patients.
[0111] Examples of RNA guide sequences that specifically target alleles in the SARM1 gene. Disclosures containing sequences that can interact with the SARM1 sequence in several forms include PCT International Publication Nos. WO2016 / 011080, WO2007 / 096854, WO2008 / 021290, WO2011 / 029914, and U.S. Publication No. 2018 / 0245164, each of which is incorporated herein by reference. While numerous guide sequences can be designed to target the SARM1 gene, the nucleotide sequences listed in Table 1 and identified by SEQ ID NOs. 1–12105 were specifically selected to effectively carry out the methods described herein.
[0112] Table 1 shows guide sequences designed for use as described in the embodiments above to associate with the SARM1 allele. Each manipulated guide molecule is further designed to associate with a target genomic DNA sequence of interest adjacent to a protospacer fringe motif (PAM), such as sequence NGG or NAG (where "N" is any nucleic acid base), which matches the PAM. Guide sequences are designed to work in combination with one or more different CRISPR nucleases, including, but are not limited to, SpCas9WT (PAM sequence: NGG), SpCas9.VQR.1 (PAM sequence: NGAN), SpCas9.VQR.2 (PAM sequence: NGNG), SpCas9.EQR (PAM sequence: NGAG), SpCas9.VRER (PAM sequence: NGCG), SaCas9WT (PAM sequence: NNGRRT), SpRY (PAM sequence: NRN or NYN), NmCas9WT (PAM sequence: NNNNGATT), Cpf1 (PAM sequence: TTTV), or JeCas9WT (PAM sequence: NNNVRYM). Each RNA molecule of the present invention is designed to form a complex with one or more different CRISPR nucleases, and is designed to target a desired polynucleotide sequence using one or more different PAM sequences corresponding to each CRISPR nuclease utilized. [Table 1] The locations listed in column 1 of Table 1 are based on the gnomAD v3 database and UCSC Genome Browser assembly ID: hg38, Sequencing / Assembly provider ID: Genome Reference Consortium Human GRCh38.p12 (GCA_000001405.27). Assembly date: Initial release December 2013; Patch release 12 December 2017.
[0113] To facilitate a more complete understanding of the present invention, examples are provided below. The following examples illustrate exemplary embodiments of carrying out and practicing the present invention. However, the scope of the present invention is not limited to the specific embodiments disclosed in these examples, which are for illustrative purposes only.
[0114] Experiment details Example 1: SARM1 Corrected Analysis Guide sequences containing 17 to 50 consecutive nucleotides, including a nucleotide from any one of the sequences described in SEQ ID NOs: 1 to 12105, are screened for high on-target activity in HeLa cells using SpCas9. On-target activity is determined by DNA capillary electrophoresis.
[0115] Example 2: Additional SARM1 editing analysis Steryl alpha and Toll / interleukin-1 receptor motif-containing 1 (SARM1) is an NAD+ hydrolase whose activity is associated with axonal degeneration. To select the optimal RNA guide molecule for knockout of both SARM1 alleles, 23 RNA guide molecules targeting SARM1 exons were screened in HeLa cells (Table 2). Briefly, a plasmid encoding SpCas9 (64 ng) was co-transfected with a DNA plasmid expressing the RNA guide molecule (20 ng) in a 96-well plate format using jetOPTIMUS® reagent (Polyplus). Cells were harvested 72 hours after DNA transfection, genomic DNA was extracted, and used for capillary electrophoresis with primers that amplified the endogenous genomic region. The graph in Figure 1A shows the edited % ± standard deviation (STDV) of the mean of three independent experiments. Analysis of the capillary electrophoresis data for all RNA guide molecules showed activity ranging from 10% to 90%.
[0116] Furthermore, screening was performed in HeLa cells using OMNI-50 (SEQ ID NO: 12119) and OMNI-79 (SEQ ID NO: 12120) CRISPR nucleases. The transfection conditions were the same as those described for SpCas9 transfection. Editing efficiency was measured by next-generation sequencing (NGS) analysis. For OMNI-50, the g13 editing efficiency was 43% (STDV=3.94). For OMNI-79, the g33 editing efficiency was 35% (STDV=4.2). See Figure 1B. The guide sequences of the RNA guide molecules are listed in Table 4.
[0117] To validate RNA guide molecules that induce Sarm1 knockout by nonsense mutation-dependent degradation (NMD), mouse Neuro-2a cells expressing SARM1 were used. To test the effectiveness of 10 of the most active guide RNA molecules targeting human SARM1 from HeLa screening, the inventors identified 10 mouse-specific guide RNA molecules that target mouse SARM1 DNA corresponding to human guide RNA molecules. The activity of the mouse RNA guide molecules was tested in mouse cells. In short, 150 × 10⁶ 3 Neuro-2a cells were mixed with pre-assembled RNP consisting of 105 pmole of SpCas9 protein and 120 pmole of sgRNA (see Table 3), mixed with 100 pmole of electroporation enhancer (IDT-1075916), and electroporated using the SF Cell 4D-Nucleofector X Kit S (PBC2-00675, Lonza) by applying the DS-134 program. Cell fractions were harvested 72 hours after electroporation, genomic DNA was extracted, and on-target activity was measured by NGS. NGS analysis revealed that all guide RNA molecules showed high insertion or deletion (indel) activity (Figure 2).
[0118] To evaluate the effect of editing on SARM1 transcript levels, total RNA was extracted from Neuro-2a cells 7 days after electroporation, and Sarm1 mRNA levels were measured by qRT-PCR. The results demonstrate a reduction of over 80% in Sarm1 mRNA levels due to nonsense mutation-dependent degradation (NMD) (Figure 3).
[0119] Next, we tested OMNI-103 (SEQ ID NO: 12121), a novel CRISPR nuclease exhibiting unique PAM requirements, for SARM1 editing. This nuclease was tested in HeLa cells as described above. For this purpose, OMNI-103 was transfected into HeLa cells using the corresponding OMNI-P2A-mCherry expression vector (pmOMNI, Table 7) along with an sgRNA molecule (guide sequence portion (gRNA) sequence listed in Table 5A) designed to target specific locations in the human genome. After 72 hours, the cells were harvested, and half of the cells were used for quantification of transfection efficiency by FACS using mCherry fluorescence as a marker. The remaining cells were lysed, and their genomic DNA content was used in PCR reactions to amplify the corresponding putative genomic targets. The amplicons were subjected to NGS, and the percentage of editing events at each target site was calculated using the resulting sequences. Short insertions or deletions (indels) around the cleavage site are typical results of DNA end repair after nuclease-induced DNA cleavage. Therefore, the editing percentage was estimated from the proportion of indel-containing sequences within each amplicon. See Table 5B and Figure 4. [Table 2] [Table 3] [Table 4] [Table 5] [Table 6] [Table 7] [Table 8]
Table 9
[0120] REFERENCES 1. Ahmad and Allen (1992) “Antibody-mediated Specific Binging and Cytotoxicity of Lipsome-entrapped Doxorubicin to Lung Cancer Cells in Vitro”, Cancer Research 52:4817 - 20. 2. Anderson (1992) “Human gene therapy”, Science 256:808 - 13. 3. Basha et al. (2011) “Influence of Cationic Lipid Composition on Gene Silencing Properties of Lipid Nanoparticle Formulations of siRNA in Antigen-Presenting Cells”, Mol. Ther. 19(12):2186 - 200. 4. Behr (1994) Gene transfer with synthetic cationic amphiphiles: Prospects for gene therapy”, Bioconjuage Chem 5:382 - 89. 5. Blaese (1995) “Vectors in cancer therapy: how will they deliver”, Cancer Gene Ther. 2:291 - 97. 6. Blaese et al. (1995) “T lympocyte-directed gene therapy for ADA-SCID: initial trial results after 4 years”, Science 270(5235):475 - 80. 7.Buchschacher and Panganiban(1992)”Human immunodeficiency virus vectors for inducible expression of foreign genes”,J.Virol.66:2731-39. 8.Burstein et al.(2017)”New CRISPR-Cas systems from uncultivated microbes”,Nature 542:237-41. 9.Chang and Wilson(1987)”Modification of DNA ends can decrease end-joining relative to homologous recombination in mammalian cells”,Proc.Natl.Acad.Sci.USA 84:4959-4963. 10.Chung et al.(2006)”Agrobacterium is not alone:gene transfer to plants by viruses and other bacteria”,Trends Plant Sci.11(1):1-4. 11.Coelho et al.(2013)”Safety and efficacy of RNAi therapy for transthyretin amyloidosis” N.Engl.J.Med.369,819-829. 12.Collias and Beisel(2021)”CRISPR technologies and the search for the PAM-free nuclease”,Nature Communications 12,555. 13.Crystal(1995)”Transfer of genes to humans:early lessons and obstacles to success”,Science 270(5235):404-10. 14.Dillon(1993)”Regulation gene expression in gene therapy” Trends in Biotechnology 11(5):167-173. 15.Dranoff et al.(1997)”A phase I study of vaccination with autologous,irradiated melanoma cells engineered to secrete human granulocyte macrophage colony stimulating factor”,Hum.Gene Ther.8(1):111-23. 16.Dunbar et al.(1995)”Retrovirally marked CD34-enriched peripheral blood and bone marrow cells contribute to long-term engraftment after autologous transplantation”,Blood 85:3048-57. 17.Ellem et al.(1997)”A case report:immune responses and clinical course of the first human use of ganulocyte / macrophage-colony-stimulating-factor-tranduced autologous melanoma cells for immunotherapy”,Cancer Immunol Immunother 44:10-20. 18.Gao and Huang(1995)”Cationic liposome-mediated gene transfer” Gene Ther.2(10):710-22. 19.Haddada et al.(1995)”Gene Therapy Using Adenovirus Vectors”,in:The Molecular Repertoire of Adenoviruses III:Biology and Pathogenesis,ed.Doerfler and Bohm,pp.297-306. 20.Han et al.(1995)”Ligand-directed retro-viral targeting of human breast cancer cells”,Proc Natl Acad Sci U.S.A.92(21):9747-51. 21.Hu et al.(2018)”Evolved Cas9 variants with broad PAM compatibility and high DNA specificity”,Nature 556(7699):57-63. 22.Jinek et al.(2012)”A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity,” Science 337(6096):816-21. 23.Johan et al.(1992)”GLVR1,a receptor for gibbon ape leukemia virus,is homologous to a phosphate permease of Neurospora crassa and is expressed at high levels in the brain and thymus”,J Virol 66(3):1635-40. 24.Judge et al.(2006)”Design of noninflammatory synthetic siRNA mediating potent gene silencing in vivo”,Mol Ther.13(3):494-505. 25.Kohn et al.(1995)”Engraftment of gene-modified umbilical cord blood cells in neonates with adnosine deaminase deficiency”,Nature Medicine 1:1017-23. 26.Kremer and Perricaudet(1995)”Adenovirus and adeno-associated virus mediated gene transfer”,Br.Med.Bull.51(1):31-44. 27.Macdiarmid et al.(2009)”Sequential treatment of drug-resistant tumors with targeted minicells containing siRNA or a cytotoxic drug”,Nat Biotehcnol.27(7):643-51. 28.Malech et al.(1997)”Prolonged production of NADPH oxidase-corrected granulocyes after gene therapy of chronic granulomatous disease”,PNAS 94(22):12133-38. 29.Miller et al.(1991)”Construction and properties of retrovirus packaging cells based on gibbon ape leukemia virus”,J Virol.65(5):2220-24. 30.Miller(1992)”Human gene therapy comes of age”,Nature 357:455-60. 31.Mitani and Caskey(1993)”Delivering therapeutic genes-matching approach and application”,Trends in Biotechnology 11(5):162-66. 32.Molday et al.(2013)”X-linked juvenile retinoschisis:Clinical diagnosis,genetic analysis,and molecular mechansims”,Prog Retin Eye Res.31(3):195-212. 33.Nabel and Felgner(1993)”Direct gene transfer for immunotherapy and immunization”,Trends in Biotechnology 11(5):211-15. 34.Nishimasu et al.(2018)”Engineered CRISPR-Cas9 nuclease with expanded targeting space”,Science 361(6408):1259-1262. 35.Remy et al.(1994)”Gene Transfer with a Series of Lipphilic DNA-Binding Molecules”,Bioconjugate Chem.5(6):647-54. 36.Sentmanat et al.(2018)”A Survey of Validation Strategies for CRISPR-Cas9 Editing”,Scientific Reports 8:888,doi:10.1038 / s41598-018-19441-8. 37.Sommerfelt et al.(1990)”Localization of the receptor gene for type D simian retroviruses on human chromosome 19”,J.Virol.64(12):6214-20. 38.Van Brunt(1988)”Molecular framing:transgenic animals as bioactors” Biotechnology 6:1149-54. 39.Vigne et al.(1995)”Third-generation adenovectors for gene therapy”,Restorative Neurology and Neuroscience 8(1,2):35-36. 40.Walton et al.(2020)”Unconstrained genome targeting with near-PAMless engineered CRISPR-Cas9 variants”,Science 368(6488):290-296. 41.Weissman and Kariko(2015)”mRNA:Fulfilling the promise of gene therapy”,Molecular Therapy(9):1416-7. 42.Wilson et al.(1989)”Formation of infectious hybrid virion with gibbon ape leukemia virus and human T-cell leukemia virus retroviral envelope glycoproteins and the gag and pol proteins of Moloney murine leukemia virus”,J.Virol.63:2374-78. 43.Yu et al.(1994)”Progress towards gene therapy for HIV infection”,Gene Ther.1(1):13-26. 44.Zetsche et al.(2015)”Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system” Cell 163(3):759-71. 45. Zuris et al. (2015) “Cationic lipid-mediated delivery of proteins enables efficient protein based genome editing in vitro and in vivo” Nat Biotechnol. 33(1):73-80. [Sequence Listing Free Text]
[0121] Sequence Listing 1-12105 <223> SARM1 target guide array portion Sequence Listing 12106 <223> Example: RNA guide sequence portion Sequence Listing 12107 <223> 17 Nucleotide Guide Sequence 1 Sequence Listing 12108 <223> 17-nucleotide guide sequence 2 Sequence Listing 12109 <223> 17 Nucleotide Guide Sequence 3 Sequence Listing 12110 <223> 17 Nucleotide Guide Sequence 4 Sequence Listing 12111 <223> G2 Mouse Sequence Listing 12112 <223> G6 Mouse Sequence Listing 12113 <223> G7 Mouse Sequence Listing 12114 <223> G8 Mouse Sequence Listing 12115 <223> g13 mouse Sequence Listing 12116 <223> g14 mouse Sequence Listing 12117 <223> g17 mouse Sequence Listing 12118 <223> G18 Mouse Sequence Listing 12119 <223> OMNI-50CRISPR Nuclease Sequence Listing 12120 <223> OMNI-79CRISPR Nuclease Sequence Listing 12121 <223> OMNI-103CRISPR Nuclease Sequence Listing 12122 <223> OMNI-50 sgRNA scaffold with g13 Sequence Listing 12123 <223> OMNI-79sgRNA scaffold with g33 Sequence Listing 12124 <223> OMNI-103 sgRNA scaffold with g42 Sequence Listing 12125 <223> OMNI-103 sgRNA scaffold with g43 Sequence Listing 12126 <223> OMNI-103 sgRNA scaffold with g44 Sequence Listing 12127 <223> OMNI-103 sgRNA scaffold with g45 Sequence Listing 12128 <223> HA-tag Sequence Listing 12129 <223> NLS Sequence Listing 12130 <223> P2A Sequence Listing 12131 <223> mCherry Sequence Listing 12132 <223> HA-tag Sequence Listing 12133 <223> NLS Sequence Listing 12134 <223> P2A Sequence Listing 12135 <223> mCherry
Claims
1. A method for inactivating the alleles of the steryl alpha and toll / interleukin-1 receptor motif-containing 1 (SARM1) gene in cells, comprising the following: At least one CRISPR nuclease, or a sequence encoding a CRISPR nuclease; and RNA molecule containing the guide sequence portion Introducing a composition containing into the cells, however, The complex of the CRISPR nuclease and the RNA molecule acts to break the double strand in the allele of the SARM1 gene. The guide sequence portion of the RNA molecule contains 17 to 50 consecutive nucleotides.
2. The method according to claim 1, wherein the composition is introduced into target cells or cells in culture.
3. The method according to any one of claims 1 to 2, wherein the cells are photoreceptor cells, preferably rod cells or cone cells.
4. The method according to any one of claims 1 to 3, wherein the CRISPR nuclease and the RNA molecule are introduced into the cell substantially simultaneously or at different times.
5. The method according to any one of claims 1 to 4, wherein an allele of the SARM1 gene in a cell undergoes an insertion or deletion mutation.
6. The method according to claim 5, wherein an insertion or deletion mutation produces an early stop codon.
7. The method according to any one of claims 1 to 6, wherein inactivation results in a cleaved protein encoded by the inactivated allele.
8. The method according to any one of claims 1 to 7, wherein the guide sequence portion is complementary to a target sequence located between 50 base pairs upstream and 50 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene.
9. The guide sequence is complementary to the target sequence located in the 7 base pairs upstream to 7 base pairs downstream of the exon of the SARM1 gene. a) The exon is exon I, and the guide sequence portion is the same as any of the sequences described in SEQ ID NOs: 1-30, 32, 34, 36-37, 182-229, 1099-1838, 38-67, 230-238, 240-251, 253-257, 259-267, 1839-2531, 69-102, 268-293, 295-300, 302-313, or 2532-3227, or contains a sequence that differs by only 3 nucleotides or less; b) The exon is exon II, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 3228 to 6803, or contains a sequence that differs by only 3 nucleotides or less; c) The exon is exon III, and the guide sequence portion is the same as the sequence described in any of sequence numbers 6804 to 8007, or contains a sequence that differs by only 3 nucleotides or less; d) The exon is exon IV, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8008 to 8487, or contains a sequence that differs by only 3 nucleotides or less; e) The exon is exon V, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8488 to 9831, or contains a sequence that differs by only 3 nucleotides or less; f) The exon is exon VI, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 9832 to 10377, or contains a sequence that differs by only 3 nucleotides or less; g) The exon is exon VII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 10378 to 11445, or contains a sequence that differs by only 3 nucleotides or less; h) The exon is exon VIII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 11446 to 12105, or contains a sequence that differs by only 3 nucleotides or less; or i) The exon is exon IX, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 433 to 1098, or contains a sequence that differs by only 3 nucleotides or less. The method according to any one of claims 1 to 8.
10. The method according to any one of claims 1 to 7, wherein the guide sequence portion comprises 17 to 50 consecutive nucleotides, including nucleotides in the sequence described in any one of sequence numbers 1 to 12105.
11. A composition comprising an RNA molecule having a guide sequence portion containing 17 to 50 consecutive nucleotides, wherein the guide sequence portion is complementary to a target sequence located from 50 base pairs upstream to 50 base pairs downstream of exon I, exon II, exon III, exon IV, exon V, exon VI, exon VII, exon VIII, or exon IX of the SARM1 gene.
12. The guide sequence is complementary to the target sequence located in the 7 base pairs upstream to 7 base pairs downstream of the exon of the SARM1 gene. a) The exon is exon I, and the guide sequence portion is the same as any of the sequences described in SEQ ID NOs: 1-30, 32, 34, 36-37, 182-229, 1099-1838, 38-67, 230-238, 240-251, 253-257, 259-267, 1839-2531, 69-102, 268-293, 295-300, 302-313, or 2532-3227, or contains a sequence that differs by only 3 nucleotides or less; b) The exon is exon II, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 3228 to 6803, or contains a sequence that differs by only 3 nucleotides or less; c) The exon is exon III, and the guide sequence portion is the same as the sequence described in any of sequence numbers 6804 to 8007, or contains a sequence that differs by only 3 nucleotides or less; d) The exon is exon IV, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8008 to 8487, or contains a sequence that differs by only 3 nucleotides or less; e) The exon is exon V, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 8488 to 9831, or contains a sequence that differs by only 3 nucleotides or less; f) The exon is exon VI, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 9832 to 10377, or contains a sequence that differs by only 3 nucleotides or less; g) The exon is exon VII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 10378 to 11445, or contains a sequence that differs by only 3 nucleotides or less; h) The exon is exon VIII, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 11446 to 12105, or contains a sequence that differs by only 3 nucleotides or less; or i) The exon is exon IX, and the guide sequence portion is the same as the sequence described in any of SEQ ID NOs. 433 to 1098, or contains a sequence that differs by only 3 nucleotides or less. The composition according to claim 11.
13. The composition according to claim 11, wherein the guide sequence portion comprises 17 to 50 consecutive nucleotides, each containing a nucleotide in the sequence described in any one of sequence numbers 1 to 12105.
14. The composition according to any one of claims 11 to 13, further comprising CRISPR nuclease.
15. The composition according to any one of claims 11 to 14, further comprising a trans-activated CRISPR RNA (tracrRNA) molecule.
16. The composition according to any one of claims 11 to 15, wherein a CRISPR nuclease and an RNA molecule, or a CRISPR nuclease, an RNA molecule, and a tracrRNA molecule form a complex.
17. A pharmaceutical product comprising a composition according to any one of claims 11 to 16 for use inactivating the SARM1 allele in cells, the pharmaceutical product being administered by delivering the composition according to any one of claims 11 to 16 to the cells.
18. Use of any of the compositions according to claims 11 to 16 for treating, improving or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, comprising delivering the composition according to any of the compositions according to claims 11 to 16 to a subject who is experiencing or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
19. A pharmaceutical product comprising a composition according to any one of claims 11 to 16 for use in treating, improving or preventing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, wherein the composition according to any one of claims 11 to 16 is administered by delivery to a subject who is experiencing or at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.
20. A kit for inactivating the SARM1 allele in cells, comprising a composition according to any one of claims 11 to 16, and instructions for delivering the composition to the cells.
21. A kit for treating or preventing a target retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration, comprising a composition according to any one of claims 11 to 16, and instructions for delivering the composition to a subject who has experienced or is at risk of experiencing retinitis pigmentosa, photoreceptor degeneration, or age-related macular degeneration.