RNAi construct for inhibiting ASGR1 expression and method for its use

Abstract

To provide further therapeutic drugs for the treatment of cardiovascular diseases. [Solution] The present invention provides compositions and methods for regulating the expression of asialoglycoprotein receptor 1 (ASGR1) in the liver. More specifically, the present invention provides nucleic acid-based therapeutics for reducing ASGR1 expression via RNA interference, and methods for using such nucleic acid-based therapeutics to treat or prevent cardiovascular disease.

Description

[Technical Field]

[0001] Cross-reference of related applications This application claims the benefits of U.S. Provisional Patent Application No. 62 / 380,216, filed on 26 August 2016, which is incorporated herein by reference in its entirety.

[0002] Description of the electronically submitted text file This application incorporates a sequence listing submitted electronically in ASCII format, which is incorporated herein by reference in its entirety. A computer-readable copy of the sequence listing, created on 25 July 2017, is named A-2094-WO-PCT_ST25 and has a size of 1.49 megabytes.

[0003] The present invention relates to compositions and methods for regulating the expression of asialoglycoprotein receptor 1 (ASGR1) in the liver. More specifically, the present invention relates to nucleic acid-based therapeutics for reducing ASGR1 expression via RNA interference, and to methods for using such nucleic acid-based therapeutics to treat or prevent cardiovascular disease. [Background technology]

[0004] Despite numerous advances and new treatments emerging in recent years, cardiovascular disease remains a leading cause of death worldwide. In the United States, one in three adults has some form of cardiovascular disease, including coronary artery disease, myocardial infarction, angina pectoris, heart failure, and stroke (Heart disease and stroke statistics - 2016 update: a report from the American Heart Association. Circulation, Vol. 133: e38-e360, 2016). In 2013, 17.3 million people worldwide and 1.4 million in the United States died from some form of cardiovascular disease, accounting for 31% of all deaths worldwide and 54% of all deaths in the United States that year (Heart disease and stroke statistics - 2016 update). Currently, cardiovascular disease claims more lives each year than cancer and chronic lower respiratory tract disease combined, which are the next two leading causes of death (Heart disease and stroke statistics - 2016 update). Therefore, there remains a need for further treatments for cardiovascular disease. The asialoglycoprotein receptor is a calcium-dependent receptor expressed on the surface of hepatocytes that contributes to the removal and degradation of desialylated glycoproteins from serum by binding to ligands having terminal galactose and N-acetylgalactosamine residues (Weigel, Bioessays, Vol.16:519-524, 1994; Stockert, Physiol. Rev., Vol.75:591-609, 1995). The heterooligomeric asialoglycoprotein receptor is composed of two distinct proteins: the 48 kDa asialoglycoprotein receptor 1 (ASGR1) main subunit and the 40 kDa asialoglycoprotein receptor 2 (ASGR2) sub-subunit (see, for example, Stockert, 1995). The asialoglycoprotein receptor has been shown to be involved in the clearance of low-density lipoproteins and chylomicron remnants, suggesting a role for the receptor in lipoprotein metabolism (Windler et al., Biochem J., Vol.276(Pt 1):79-87, 1991; Ishibashi et al., J Biol Chem., Vol.271:22422-22427, 1996). Recently, it has been reported that human carriers of a functionally deficient variant allele of the ASGR1 subunit of the asialoglycoprotein receptor have lower serum levels of non-high-density lipoprotein (HDL) cholesterol and a lower risk of coronary artery disease and myocardial infarction compared to non-carriers (Nioi et al., New England Journal of Medicine, Vol.374(22):2131-2141, 2016). Therefore, therapeutic agents targeting ASGR1 function offer a new approach to reducing non-HDL cholesterol levels and treating cardiovascular disease, particularly coronary artery disease. [Prior art documents] [Non-patent literature]

[0005] [Non-Patent Document 1] Heart disease and stroke statistics-2016 update:a report from the American Heart Association.Circulation,Vol.133:e38-e360,2016 [Non-Patent Document 2] Weigel,Bioessays,Vol.16:519-524,1994 [Non-Patent Document 3] Stockert,Physiol.Rev.,Vol.75:591-609,1995 [Non-Patent Document 4] Windler et al.,Biochem J.,Vol.276(Pt 1):79-87,1991 [Non-Patent Document 5] Ishibashi et al.,J Biol Chem.,Vol.271:22422-22427,1996 [Non-Patent Document 6] Nioi et al.,New England Journal of Medicine,Vol.374(22):2131-2141,2016 [Overview of the project] [Means for solving the problem]

[0006] The present invention is partially based on the design and generation of RNAi constructs that target the ASGR1 gene and reduce ASGR1 expression in liver cells. Sequence-specific inhibition of ASGR1 expression is useful for treating or preventing conditions associated with ASGR1 expression, such as cardiovascular disease. Accordingly, in one embodiment, the present invention provides an RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region having a sequence complementary to the mRNA sequence of ASGR1. In certain embodiments, the antisense strand comprises a region having at least 15 consecutive nucleotides from antisense sequences listed in Table 1, Table 6, or Table 8.

[0007] In some embodiments, the sense strand of the RNAi construct described herein contains a sequence that is sufficiently complementary to the sequence of the antisense strand, which forms a double-stranded region of about 15 to about 30 base pairs in length. In these and other embodiments, each of the sense strand and the antisense strand is about 15 to 30 nucleotides in length. In some embodiments, the RNAi construct contains at least one blunt end. In other embodiments, the RNAi construct contains at least one nucleotide overhang. Such a nucleotide overhang may contain 1 to 6 unpaired nucleotides and may be located at the 3' end of the sense strand, the 3' end of the antisense strand, or the 3' ends of both the sense and antisense strands. In certain embodiments, the RNAi construct contains two unpaired nucleotide overhangs at the 3' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNAi construct contains two unpaired nucleotide overhangs at the 3' end of the antisense strand and a blunt end at the 3' end of the sense strand / 5' end of the antisense strand.

[0008] The RNAi construct of the present invention may comprise one or more modified nucleotides, including nucleotides having modifications to a ribose ring, a nucleic acid base, or a phosphodiester backbone. In some embodiments, the RNAi construct comprises one or more 2'-modified nucleotides. Such 2'-modified nucleotides may include 2'-fluoromodified nucleotides, 2'-O-methylmodified nucleotides, 2'-O-methoxyethyl modified nucleotides, 2'-O-allyl modified nucleotides, bicyclic nucleic acids (BNAs), or combinations thereof. In a particular embodiment, the RNAi construct comprises one or more 2'-fluoromodified nucleotides, 2'-O-methylmodified nucleotides, or combinations thereof. In some embodiments, all nucleotides in the sense and antisense strands of the RNAi construct are modified nucleotides.

[0009] In some embodiments, the RNAi construct includes at least one skeletal modification, such as a modified bond between nucleotides or between nucleosides. In certain embodiments, the RNAi construct described herein includes at least one phosphorothioate nucleotide bond. In certain embodiments, the phosphorothioate nucleotide bond may be located at the 3' or 5' end of the sense strand and / or antisense strand.

[0010] In some embodiments, the antisense and / or sense strands of the RNAi construct of the present invention may include or consist of sequences from the antisense and sense sequences listed in Tables 1, 6, or 8. In certain embodiments, the RNAi construct may be one of the double-stranded compounds listed in any one of Tables 1 to 10. In one embodiment, the RNAi construct may be D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-1815, D-1983, D-2000, D-2045, D-2142, D-2143, D-1438, D- These are 1494, D-2357, D-2359, D-2361, D-2365, D-2461, D-3036, D-3037, D-3051, D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799, or D-3800. In another embodiment, the RNAi construct is D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176, D-3779, D-3782, D-3788, D-3799, or D-3800. In yet another embodiment, the RNAi construct is D-2359. In yet another embodiment, the RNAi construct is D-1815. In yet another embodiment, the RNAi construct is D-1235. In yet another embodiment, the RNAi construct is D-2143. In yet another embodiment, the RNAi construct is D-2361. In some embodiments, the RNAi construct is D-3782. In other embodiments, the RNAi construct is D-3799.

[0011] The RNAi construct may further include ligands that facilitate the delivery or uptake of the RNAi construct to specific tissues or cells, such as hepatocytes. In certain embodiments, the ligand targets the delivery of the RNAi construct to hepatocytes. In these and other embodiments, the ligand may include galactose, galactosamine, or N-acetyl-galactosamine (GalNAc). In certain embodiments, the ligand includes a polyvalent galactose or polyvalent GalNAc moiety, such as a trivalent or tetravalent galactose or GalNAc moiety. The ligand may be covalently bound to the 5' or 3' end of the sense strand of the RNAi construct, optionally via a linker. In some embodiments, the RNAi construct includes ligands and linkers having a structure according to any of the formulas I to XXIX described herein. In certain embodiments, the RNAi construct includes ligands and linkers having a structure according to formulas VII, VIII, XVI, XXVI, or XXIX. In one embodiment, the RNAi construct comprises a ligand and a linker having a structure according to formula XVI (wherein n=1 and k=3).

[0012] In certain embodiments, the ligand may include an antibody or its antigen-binding fragment that specifically binds to ASGR1. The 5' or 3' end of the sense strand of the RNAi construct may be covalently bound to the antibody or antigen-binding fragment via a side chain of an amino acid residue in the light or heavy chain of the antibody or antigen-binding fragment. In some embodiments, the sense strand of the RNAi construct is covalently bound to a side chain of a cysteine ​​residue present in the heavy or light chain of the antibody or its antigen-binding fragment, optionally via a linker. In one embodiment, the anti-ASGR1 antibody-RNA molecule conjugate includes at least one copy of the interfering RNA molecule (e.g., siRNA or shRNA). In another embodiment, the anti-ASGR1 antibody-RNA molecule conjugate includes two copies of the interfering RNA molecule (e.g., siRNA or shRNA).

[0013] The present invention also provides pharmaceutical compositions comprising the RNAi construct described herein and any pharmaceutically acceptable carrier, excipient, or diluent. Such pharmaceutical compositions are particularly useful for reducing ASGR1 expression in the cells of patients (e.g., liver cells) where this is necessary. Patients who may be administered the pharmaceutical compositions of the present invention may include patients with a history of myocardial infarction, patients diagnosed with or at risk of coronary artery disease or other forms of cardiovascular disease, and patients with elevated levels of non-HDL cholesterol. Accordingly, the present invention includes methods for treating or preventing cardiovascular disease in patients where it is necessary by administering the RNAi construct or pharmaceutical composition described herein. In certain embodiments, the present invention provides methods for reducing non-HDL cholesterol in patients where it is necessary by administering the RNAi construct or pharmaceutical composition described herein.

[0014] The use of an ASGR1-targeting RNAi construct for the preparation of a pharmacopoeia for administration by any of the methods described herein or by any of the methods described herein is specifically considered. For example, the present invention includes an ASGR1-targeting RNAi construct for use in a method for treating or preventing cardiovascular disease, including coronary artery disease or myocardial infarction, in patients in need thereof. The present invention also includes an ASGR1-targeting RNAi construct for use in a method for reducing non-HDL cholesterol in patients in need thereof. In some embodiments, the present invention provides an ASGR1-targeting RNAi construct for use in a method for reducing the risk of myocardial infarction in patients in need thereof.

[0015] The present invention also encompasses the use of an RNAi construct targeting ASGR1 in the preparation of a medicament for treating or preventing cardiovascular diseases including coronary artery disease or myocardial infarction in patients who need it. In certain embodiments, the present invention provides the use of an RNAi construct targeting ASGR1 in the preparation of a medicament for reducing non-HDL cholesterol in patients who need it. In certain other embodiments, the present invention provides the use of an RNAi construct targeting ASGR1 in the preparation of a medicament for reducing the risk of myocardial infarction in patients who need it. In certain embodiments, for example, the following are provided: (Item 1) An RNAi construct comprising a sense strand and an antisense strand, wherein the antisense strand comprises a region having a sequence complementary to the mRNA sequence of ASGR1, and the region comprises at least 15 consecutive nucleotides from the antisense sequences listed in Table 1, Table 6 or Table 8. (Item 2) The RNAi construct according to Item 1, wherein the sense strand comprises a sequence sufficiently complementary to the sequence of the antisense strand that forms a double-stranded region about 15 to about 30 base pairs in length. (Item 3) The RNAi construct according to Item 2, wherein the double-stranded region is about 17 to about 24 base pairs in length. (Item 4) The RNAi construct according to Item 2, wherein the double-stranded region is about 19 to about 21 base pairs in length. (Item 5) The RNAi construct according to any one of Items 2 to 4, wherein the sense strand and the antisense strand are each about 15 to about 30 nucleotides in length. (Item 6) The RNAi construct according to Item 5, wherein the sense strand and the antisense strand are each about 19 to about 27 nucleotides in length. (Item 7) The RNAi construct described in item 5, wherein the sense strand and the antisense strand are each approximately 21 to approximately 25 nucleotides long. (Item 8) An RNAi construct described in any one of items 1-7, including at least one blunt end. (Item 9) An RNAi construct as described in any one of items 1 to 7, comprising at least one nucleotide overhang of 1 to 4 unpaired nucleotides. (Item 10) The nucleotide overhang is an RNAi construct as described in item 9, having two unpaired nucleotides. (Item 11) The RNAi construct according to item 9 or 10, comprising a nucleotide overhang at the 3' end of the sense strand, the 3' end of the antisense strand, or at the 3' ends of both the sense strand and the antisense strand. (Item 12) The nucleotide overhang comprises a 5'-UU-3' dinucleotide or a 5'-dTdT-3' dinucleotide, as described in any one of items 9 to 11 of the RNAi construct. (Item 13) An RNAi construct described in any one of items 1-12, comprising at least one modified nucleotide. (Item 14) The modified nucleotide is a 2'-modified nucleotide, as described in item 13 of the RNAi construct. (Item 15) The modified nucleotide is a 2'-fluoromodified nucleotide, a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-O-allyl modified nucleotide, a bicyclic nucleic acid (BNA), or a combination thereof, as described in item 13 of the RNAi construct. (Item 16) The modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-O-methoxyethyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof, as described in item 15 of the RNAi construct. (Item 17) The RNAi construct described in item 13, wherein all nucleotides in the sense strand and the antisense strand are modified nucleotides. (Item 18) The modified nucleotide is a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, or a combination thereof, as described in item 17 of the RNAi construct. (Item 19) An RNAi construct as described in any one of items 1 to 18, comprising at least one phosphorothioate nucleotide interlink. (Item 20) The RNAi construct described in item 19, comprising two consecutive phosphorothioate nucleotide interlinks at the 3' end of the antisense strand. (Item 21) The RNAi construct according to item 19, wherein the antisense strand comprises two consecutive phosphorothioate nucleotide links at both the 3' and 5' ends, and the sense strand comprises two consecutive phosphorothioate nucleotide links at the 5' end. (Item 22) The antisense strand comprises a sequence selected from the antisense sequences listed in Table 1, Table 6, or Table 8, as described in any one of items 1 to 21 of the RNAi construct. (Item 23) The RNAi construct described in item 22, wherein the antisense strand includes a sequence selected from SEQ ID NO: 1606, SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 1754, SEQ ID NO: 1881, SEQ ID NO: 1897, SEQ ID NO: 2321, SEQ ID NO: 2323, SEQ ID NO: 2491, SEQ ID NO: 2508, SEQ ID NO: 2553, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 1946, SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, SEQ ID NO: 4634, SEQ ID NO: 4638, or SEQ ID NO: 4639. (Item 24) The sense strand is an RNAi construct as described in item 22 or item 23, comprising a sequence selected from the sense sequences listed in Table 1, Table 6, or Table 8. (Item 25) The RNAi construct described in item 24, wherein the sense strand contains a sequence selected from SEQ ID NO: 103, SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 251, SEQ ID NO: 378, SEQ ID NO: 394, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 988, SEQ ID NO: 1005, SEQ ID NO: 1050, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 443, SEQ ID NO: 499, SEQ ID NO: 1362, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 1466, SEQ ID NO: 3050, SEQ ID NO: 3051, SEQ ID NO: 3065, SEQ ID NO: 3067, SEQ ID NO: 3071, SEQ ID NO: 4443, SEQ ID NO: 4444, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4455, SEQ ID NO: 4459, SEQ ID NO: 4463, or SEQ ID NO: 4464. (Item 26) (a) The sense strand includes the sequence of sequence number 181, and the antisense strand includes the sequence of sequence number 1684, (b) The sense strand includes the sequence of sequence number 205, and the antisense strand includes the sequence of sequence number 1708, (c) The sense strand includes the sequence of sequence number 211, and the antisense strand includes the sequence of sequence number 1714, (d) The sense strand includes the sequence of sequence number 240, and the antisense strand includes the sequence of sequence number 1743, (e) The sense strand includes the sequence of sequence number 820, and the antisense strand includes the sequence of sequence number 2323, (f) The sense strand includes the sequence of sequence number 1147, and the antisense strand includes the sequence of sequence number 2650, (g) The sense strand includes the sequence of sequence number 1148, and the antisense strand includes the sequence of sequence number 2651, (h) The sense strand includes the sequence of sequence number 1364, and the antisense strand includes the sequence of sequence number 2867, (i) The sense strand includes the sequence of sequence number 1366, and the antisense strand includes the sequence of sequence number 2869, or (j) The RNAi construct according to any one of items 22 to 25, wherein the sense strand comprises the sequence of SEQ ID NO: 1370 and the antisense strand comprises the sequence of SEQ ID NO: 2873. (Item 27) An RNAi construct described in any of items 1 to 26, which is one of the double-stranded compounds listed in any of Tables 1 to 10. (Item 28) D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-18 15, D-1983, D-2000, D-2045, D-2142, D-2143, D-1438, D-1494, D-2357, D-2359, D- The RNAi constructs listed in item 27, which are 2361, D-2365, D-2461, D-3036, D-3037, D-3051, D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799, or D-3800. (Item 29) RNAi constructs listed in item 28, which are D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176, D-3779, D-3782, D-3788, D-3799, or D-3800. (Item 30) An RNAi construct according to any one of items 1 to 29, which reduces the ASGR1 expression level in liver cells after incubation with the RNAi construct compared to the ASGR1 expression level in liver cells incubated with a control RNAi construct. (Item 31) The liver cells are Hep3B cells, HepG2 cells, or human primary hepatocytes, according to the RNAi construct described in item 30. (Item 32) An RNAi construct described in any one of items 1-29 that inhibits at least 45% of ASGR1 expression at 5 nM in in vitro Hep3B cells. (Item 33) An RNAi construct described in any one of items 1-29 that inhibits ASGR1 expression in Hep3B cells with an IC50 of less than approximately 10 nM. (Item 34) An RNAi construct described in any one of items 1-29 that inhibits ASGR1 expression in Hep3B cells with an IC50 of less than approximately 1 nM. (Item 35) An RNAi construct described in any one of items 1 to 34, further comprising a ligand. (Item 36) The ligand comprises a cholesterol moiety, a vitamin, a steroid, a bile acid, a folic acid moiety, a fatty acid, a carbohydrate, a glycoside, or an antibody or its antigen-binding fragment, as described in item 35. (Item 37) The ligand is the RNAi construct described in item 35, which targets the delivery of the RNAi construct to hepatocytes. (Item 38) The ligand is an RNAi construct according to item 37, comprising a monoclonal antibody or its antigen-binding fragment that specifically binds to human ASGR1. (Item 39) The RNAi construct according to item 38, wherein the monoclonal antibody or its antigen-binding fragment comprises the substitution of at least one amino acid by a cysteine ​​amino acid, and the sense chain is covalently bound to the monoclonal antibody or its antigen-binding fragment via the side chain of the cysteine ​​amino acid. (Item 40) The ligand is an RNAi construct as described in item 35, comprising galactose, galactosamine, or N-acetyl-galactosamine. (Item 41) The ligand is an RNAi construct as described in item 40, comprising a polyvalent galactose moiety or a polyvalent N-acetyl-galactosamine moiety. (Item 42) The RNAi construct described in item 41, wherein the polyvalent galactose moiety or the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent. (Item 43) The ligand is covalently bound to the sense strand via a linker, as required, in the RNAi construct according to any one of items 35 to 42. (Item 44) The ligand is covalently bound to the 3' or 5' end of the sense strand in the RNAi construct as described in item 43. (Item 45) A pharmaceutical composition comprising an RNAi construct described in any one of items 1 to 44 and a pharmaceutically acceptable carrier, excipient, or diluent. (Item 46) A method for reducing ASGR1 expression in a patient in need thereof, comprising administering an RNAi construct described in any one of items 1 to 44 to the patient. (Item 47) The method according to item 46, wherein the expression level of ASGR1 in hepatocytes is reduced in the patient after administration of the RNAi construct compared to the ASGR1 expression level in the patient who has not received the RNAi construct. (Item 48) The patient described above is diagnosed with coronary artery disease or is at risk of coronary artery disease, as described in item 46. (Item 49) The patient described above has elevated levels of non-HDL cholesterol, as described in item 46. (Item 50) The patient has a history of myocardial infarction, as described in item 46. (Item 51) A method for reducing non-HDL cholesterol in a patient in need thereof, comprising administering an RNAi construct described in any one of items 1 to 44 to the patient. (Item 52) The method according to item 51, wherein the non-HDL cholesterol is LDL cholesterol. (Item 53) A method for treating or preventing cardiovascular disease in a patient in need thereof, comprising administering an RNAi construct described in any one of items 1 to 44 to the patient. (Item 54) The method according to item 53, wherein the cardiovascular disease is coronary artery disease or myocardial infarction. (Item 55) A method for reducing the risk of myocardial infarction in a patient in need thereof, comprising administering an RNAi construct described in any one of items 1 to 44 to the patient. (Item 56) The patient is diagnosed with coronary artery disease, as described in item 55. (Item 57) The patient described above has elevated levels of non-HDL cholesterol, as described in item 55. (Item 58) The method according to any one of items 46 to 57, wherein the RNAi construct is administered to the patient via a parenteral route of administration. (Item 59) The method according to item 58, wherein the parenteral administration route is intravenous or subcutaneous. (Item 60) An RNAi construct described in any one of items 1 to 44 for use in a method of reducing non-HDL cholesterol in patients in need thereof. (Item 61) The aforementioned non-HDL cholesterol is LDL cholesterol, as described in item 60 of the RNAi construct. (Item 62) An RNAi construct described in any one of items 1 to 44 for use in methods of treating or preventing cardiovascular disease in patients in need thereof. (Item 63) The cardiovascular disease is coronary artery disease or myocardial infarction, as described in item 62 of the RNAi construct. (Item 64) An RNAi construct described in any one of items 1 to 44 for use in a method of reducing the risk of myocardial infarction in patients in need thereof. (Item 65) The aforementioned patient is diagnosed with coronary artery disease and has an RNAi construct in item 64. (Item 66) The patient has elevated levels of non-HDL cholesterol and is an RNAi construct as described in item 64. (Item 67) Use of an RNAi construct described in any one of items 1 to 44 in the preparation of a pharmaceutical product for reducing non-HDL cholesterol in patients in need thereof. (Item 68) The aforementioned non-HDL cholesterol is LDL cholesterol, as used in item 67. (Item 69) Use of any one of items 1 to 44 in the preparation of a pharmaceutical product for the treatment or prevention of cardiovascular disease in a patient in need thereof. (Item 70) The cardiovascular disease is coronary artery disease or myocardial infarction, as described in item 69. (Item 71) The use of any one of items 1 to 44 in the preparation of a pharmaceutical product for reducing the risk of myocardial infarction in patients in need thereof. (Item 72) The aforementioned patient is diagnosed with coronary artery disease, as described in item 71. (Item 73) The patient described above has elevated levels of non-HDL cholesterol, and the use described in item 71 applies. [Brief explanation of the drawing]

[0016] [Figure 1A] The nucleotide sequence of human ASGR1 transcript variant 1 is shown (NCBI reference sequence number NM_001671.4; sequence number 1). The transcript sequence is shown as a complementary DNA (cDNA) sequence in which uracil bases are replaced with thymine bases. [Figure 1B] The nucleotide sequence of human ASGR1 transcript variant 2 is shown (NCBI reference sequence number NM_001197216.2; SEQ ID NO: 2). The transcript sequence is shown as a cDNA sequence in which uracil bases are replaced with thymine bases. [Figure 2] The nucleotide sequence of mouse Asgr1 transcript variant 1 is shown (NCBI reference sequence number NM_009714.2; sequence number 3011). The transcript sequence is shown as a complementary DNA (cDNA) sequence in which uracil bases are replaced with thymine bases. [Figure 3] The nucleotide sequence of the rat Asgr1 transcript is shown (SEQ ID NO: 3012). The transcript sequence is shown as a complementary DNA (cDNA) sequence in which uracil bases are replaced with thymine bases. [Figure 4]The nucleotide sequence of the transcript of macaque (Cynomolgus monkey (Macaca fascicularis)) ASGR1 is shown (NCBI reference sequence number XM_005582698.1; SEQ ID NO: 3013). The transcript sequence is shown as a complementary DNA (cDNA) sequence in which uracil bases are replaced with thymine bases. [Figure 5] A synthesis scheme for a tetravalent GalNAc moiety that can be incorporated into any of the RNAi constructs of the present invention is shown. [Figure 6A] This bar graph shows the expression levels of human ASGR1 in the liver of ASGR1 knockout mice that were injected with an AAV encoding human ASGR1 and then subcutaneously treated with 5 mg / kg of the indicated GalNAc-ASGR1 siRNA conjugate. Human ASGR1 expression was measured by qPCR and reported as the expression level compared to control animals that received only the AAV encoding human ASGR1 but were not treated by another method. Expression levels are shown at 8 days (d8) and 15 days (d15) after administration of the GalNAc-siRNA conjugate. Wild-type (WT) mice and ASGR1 knockout (KO) animals were included as controls. [Figure 6B] Figure 6A shows a bar graph of serum alkaline phosphatase (ALP) levels from animals. Serum was obtained on day 8 (d8) and day 15 (d15) after administration of the GalNAc-siRNA conjugate shown. [Figure 7A] This is a schematic diagram showing the reaction in which a bromoacetyl linker is added to the 3' end of the sense strand of an siRNA double helix. [Figure 7B] This is a schematic diagram showing the conjugation reaction in which an siRNA double-strand is attached to an anti-ASGR1 antibody. [Figure 8]This bar graph shows dose-dependent mRNA knockdown of ASGR1 in human primary hepatocytes observed with 3549 (RNA-to-Ab ratio of 1) and 3550 (RNA-to-Ab ratio of 2) anti-ASGR1 mAb-siRNA conjugates. A non-conjugated anti-ASGR1 cys mAb (PL-53515) was used as a control. [Figure 9A] This bar graph shows the mRNA levels of ASGR1 in the livers of wild-type mice in all dose groups, measured at the indicated time points (days 2, 4, 8, and 15). The same siRNA (compound 1418) conjugated to the GalNAc portion was used as a positive control. The amount of siRNA in 5 mpk of compound 1418 is equivalent to the amount of siRNA in 30 mpk of compound 3550, which has two siRNA / mAb. [Figure 9B] This line graph shows the protein expression of ASGR1 in the liver of wild-type mice in all dose groups measured at the indicated time points (days 2, 4, 8, and 15). The same siRNA (compound 1418) conjugated to the GalNAc portion was used as a positive control. The amount of siRNA in 5 mpk of compound 1418 is equivalent to the amount of siRNA in 30 mpk of compound 3550, which has two siRNA / mAb. [Figure 10] This bar graph shows serum alkaline phosphatase (ALP) levels from wild-type mice in all dose groups measured at the indicated time points (days 2, 4, 8, and 15). The same siRNA (compound 1418) conjugated to the GalNAc portion was used as a positive control. The amount of siRNA in compound 1418 at 5 mpk is equivalent to the amount of siRNA in compound 3550 at 30 mpk with two siRNA / mAb. [Modes for carrying out the invention]

[0017] The present invention relates to compositions and methods for regulating the expression of asialoglycoprotein receptors in cells or mammals. In some embodiments, the compositions of the present invention include RNAi constructs that target ASGR1 mRNA and reduce ASGR1 expression in cells or mammals. Such RNAi constructs are useful in treating or preventing various forms of cardiovascular disease, for example, by reducing serum levels of non-HDL cholesterol and reducing the risk of developing coronary artery disease or myocardial infarction.

[0018] As used herein, the term “RNAi construct” refers to a drug comprising an RNA molecule that, upon introduction into a cell, can downregulate the expression of a target gene (e.g., ASGR1) via an RNA interference mechanism. RNA interference is a process in which a nucleic acid molecule induces the cleavage and degradation of a target RNA molecule (e.g., a messenger RNA or mRNA molecule) in a sequence-specific manner, for example, via the RNA-induced silencing complex (RISC) pathway. In some embodiments, an RNAi construct comprises a double-stranded RNA molecule comprising two antiparallel strands of contiguous nucleotides that are sufficiently complementary to each other and hybridize to form a double-stranded region. “Hybridizing” or “hybridization” typically refers to the pairing of complementary polynucleotides via hydrogen bonds between complementary bases in two polynucleotides (e.g., Watson-Crick, Hoogsteen, or reverse Hoogsteen hydrogen bonds). The strand containing a region having a sequence substantially complementary to the target sequence (e.g., target mRNA) is referred to as the “antisense strand.” The "sense strand" refers to a strand containing a region substantially complementary to the antisense strand. In some embodiments, the sense strand may contain a region having a sequence substantially identical to the target sequence.

[0019] Double-stranded RNA molecules may include chemical modifications to ribonucleotides, including modifications to ribose sugars, bases, or ribonucleotide backbone components, such as those described herein or known in the art. Any such modifications used in double-stranded RNA molecules (e.g., siRNA, shRNA, etc.) are encompassed by the term “double-stranded RNA” for the purposes of this disclosure.

[0020] As used herein, a polynucleotide containing a first sequence is considered "complementary" to a second sequence if, under certain conditions such as physiological conditions, the first sequence can hybridize to a polynucleotide containing a second sequence to form a double-stranded region. Other such conditions may include moderate or stringent hybridization conditions known to those skilled in the art. A polynucleotide containing a first sequence is considered 100% complementary to a second sequence if it forms base pairs with the second sequence over the entire length of one or both nucleotide sequences without mismatching. A sequence is considered "substantially complementary" to a target sequence if it is at least about 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% complementary to the target sequence. The complementarity percentage can be calculated by dividing the number of bases in the first sequence that are complementary to the bases at the corresponding positions in the second sequence or target sequence by the total length of the first sequence. When two sequences hybridize, if there are 5, 4, 3, or 2 or fewer mismatches across a 30-base-pair double-stranded region, the sequences may be said to be substantially complementary to the other sequence. In general, if any nucleotide overhangs as defined herein exist, the sequences of such overhangs are not considered in determining the degree of complementarity between the two sequences. As an example, a 21-nucleotide sense strand and a 21-nucleotide antisense strand that hybridize to form a 19-base-pair double-stranded region with a 2-nucleotide overhang at the 3' end of each strand are considered perfectly complementary when this term is used herein.

[0021] In some embodiments, the antisense strand region includes a sequence that is fully complementary to the region of the target RNA sequence (e.g., the mRNA of ASGR1). In such embodiments, the sense strand may include a sequence that is fully complementary to the sequence of the antisense strand. In other such embodiments, the sense strand may include a sequence that is substantially complementary to the sequence of the antisense strand, for example, a sequence having 1, 2, 3, 4, or 5 mismatches in the double-stranded region formed by the sense and antisense strands. In certain embodiments, it is preferable that any mismatches occur within the terminal region (e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' ends of the strand). In one embodiment, any mismatches in the double-stranded region formed by the sense and antisense strands occur within 6, 5, 4, 3, or 2 nucleotides of the 5' end of the antisense strand.

[0022] In certain embodiments, the sense and antisense strands of a double-stranded RNA may hybridize to form a double-stranded region, but may be two separate molecules that are not linked apart except for this region. Such a double-stranded RNA molecule formed from two separate strands is referred to as "small interfering RNA" or "short interfering RNA" (siRNA). Therefore, in some embodiments, the RNAi construct of the present invention includes siRNA.

[0023] In other embodiments, the sense and antisense strands that hybridize to form a double-stranded region may be part of a single RNA molecule, i.e., the sense and antisense strands are part of the self-complementary region of the single RNA molecule. In such cases, the single RNA molecule includes a double-stranded region (also referred to as the stem region) and a loop region. The 3' end of the sense strand is joined to the 5' end of the antisense strand by an adjacent sequence of unpaired nucleotides that will form the loop region. The loop region is usually long enough to allow the RNA molecule to fold on its own, so that the antisense strand can base-pair with the sense strand to form a double-stranded or stem region. The loop region can contain about 3 to about 25, about 5 to about 15, or about 8 to about 12 unpaired nucleotides. Such RNA molecules having at least partially self-complementary regions are referred to as "small hairpin RNA" (shRNA). In certain embodiments, the RNAi construct of the present invention includes shRNA. The length of a single, at least partially self-complementary RNA molecule may be approximately 35 to 100 nucleotides, approximately 45 to 85 nucleotides, or approximately 50 to 60 nucleotides, and may include double-stranded and loop regions having the lengths listed herein, respectively.

[0024] In some embodiments, the RNAi construct of the present invention comprises a sense strand and an antisense strand, the antisense strand comprising a region having a sequence substantially or completely complementary to the messenger RNA (mRNA) sequence of ASGR1. As used herein, “mRNA sequence of ASGR1” refers to any messenger RNA sequence including a splice variant encoding the ASGR1 protein, including a variant or isoform of the ASGR1 protein from any species (e.g., mouse, rat, non-human primate, human). The ASGR1 protein (also known as HL-1, ASGPR H1, ASGPR1, and CLEC4H1) refers, as used herein, to the main subunit of the asialoglycoprotein receptor. In humans, ASGR1 is found on chromosome 17p13.2 and is expressed as two distinct isoforms: a long isoform of about 291 amino acids (H1a or isoform A) and a short soluble isoform of about 252 amino acids (H1b or isoform B).

[0025] The mRNA sequence of ASGR1 also includes the transcript sequence expressed as its complementary DNA (cDNA) sequence. The cDNA sequence refers to the mRNA transcript sequence expressed as DNA bases (e.g., guanine, adenine, thymine, and cytosine) rather than RNA bases (e.g., guanine, adenine, uracil, and cytosine). Therefore, the antisense strand of the RNAi construct of the present invention may include a region having a sequence substantially or completely complementary to the mRNA sequence of target ASGR1 or the cDNA sequence of ASGR1. The mRNA or cDNA sequence of ASGR1 may include, but is not limited to, any ASGR1 mRNA or cDNA sequence selected from the NCBI reference sequences NM_001671.4 (human; Figure 1A, SEQ ID NO: 1), NM_001197216.2 (human; Figure 1B, SEQ ID NO: 2), NM_009714.2 (mouse; Figure 2, SEQ ID NO: 3011), and XM_005582698.1 (cynomolgus monkey; Figure 4, SEQ ID NO: 3013), or the rat sequence in Figure 3 (SEQ ID NO: 3012). In one embodiment, the mRNA sequence of ASGR1 is human transcript variant 1, which is listed in the NCBI database as reference sequence NM_001671.4 (Figure 1A; see SEQ ID NO: 1). In another embodiment, the mRNA sequence of ASGR1 is human transcript variant 2, which is listed in the NCBI database as reference sequence NM_001197216.2 (Figure 1B; see Sequence ID 2).

[0026] The antisense strand region may be substantially complementary or fully complementary to at least 15 consecutive nucleotides of the ASGR1 mRNA sequence. In some embodiments, the target region of the ASGR1 mRNA sequence containing the complementary region of the antisense strand may range from about 15 to about 30 consecutive nucleotides, about 16 to about 28 consecutive nucleotides, about 18 to about 26 consecutive nucleotides, about 17 to about 24 consecutive nucleotides, about 19 to about 25 consecutive nucleotides, about 19 to about 23 consecutive nucleotides, or about 19 to about 21 consecutive nucleotides. In certain embodiments, the antisense strand region containing a sequence substantially or fully complementary to the ASGR1 mRNA sequence may, in some embodiments, include at least 15 consecutive nucleotides from the antisense sequences listed in Table 1, Table 6, or Table 8. In other embodiments, the antisense sequence includes at least 16, at least 17, at least 18, or at least 19 consecutive nucleotides from the antisense sequences listed in Table 1, Table 6, or Table 8. For example, in some embodiments, a region of the antisense strand containing a sequence substantially or completely complementary to the mRNA sequence of ASGR1 includes SEQ ID NOs: 1606, 1684, 1708, 1714, 1743, 1754, 1881, 1897, 2321, 2323, 2491, 2508, 2553, 2650, 2651, and 1946. It contains at least 15 consecutive nucleotides selected from SEQ ID NO: 2002, SEQ ID NO: 2865, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 2969, SEQ ID NO: 3701, SEQ ID NO: 3702, SEQ ID NO: 3716, SEQ ID NO: 3718, SEQ ID NO: 3722, SEQ ID NO: 4618, SEQ ID NO: 4619, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4630, SEQ ID NO: 4634, SEQ ID NO: 4638, or SEQ ID NO: 4639.

[0027] The sense strand of an RNAi construct typically contains a sequence sufficiently complementary to the antisense strand such that the two strands hybridize under physiological conditions to form a double-stranded region. A “double-stranded region” refers to a region of two complementary or substantially complementary polynucleotides that base-pair each other by either Watson-Crick base pairing or other hydrogen bonding interactions to generate a double helix between the two polynucleotides. The double-stranded region of an RNAi construct should be long enough to allow the RNAi construct to enter the RNA interference pathway, for example, by binding to a Dicer enzyme and / or RISC complex. For example, in some embodiments, the double-stranded region is about 15 to about 30 base pairs long. Other lengths of the double-stranded region within this range are also suitable, for example, about 15 to about 28 base pairs, about 15 to about 26 base pairs, about 15 to about 24 base pairs, about 15 to about 22 base pairs, about 17 to about 28 base pairs, about 17 to about 26 base pairs, about 17 to about 24 base pairs, about 17 to about 23 base pairs, about 17 to about 21 base pairs, about 19 to about 25 base pairs, about 19 to about 23 base pairs, or about 19 to about 21 base pairs. In one embodiment, the double-stranded region is about 17 to about 24 base pairs long. In another embodiment, the double-stranded region is about 19 to about 21 base pairs long.

[0028] In embodiments where the sense and antisense strands are two separate molecules (e.g., the RNAi construct contains siRNA), the sense and antisense strands do not need to be the same length as the double-stranded region. For example, one or both strands may be longer than the double-stranded region and may have one or more unpaired nucleotides or mismatches adjacent to the double-stranded region. Thus, in some embodiments, the RNAi construct includes at least one nucleotide overhang. As used herein, “nucleotide overhang” refers to an unpaired nucleotide at the end of a strand or a nucleotide that extends beyond the double-stranded region. Nucleotide overhangs are typically generated when the 3' end of one strand extends beyond the 5' end of the other strand, or when the 5' end of one strand extends beyond the 3' end of the other strand. Nucleotide overhang lengths are generally 1–6 nucleotides, 1–5 nucleotides, 1–4 nucleotides, 1–3 nucleotides, 2–6 nucleotides, 2–5 nucleotides, or 2–4 nucleotides. In some embodiments, the nucleotide overhang comprises 1, 2, 3, 4, 5, or 6 nucleotides. In certain embodiments, the nucleotide overhang comprises 1 to 4 nucleotides. In some embodiments, the nucleotide overhang comprises 2 nucleotides. The nucleotides in the overhang may be ribonucleotides, deoxyribonucleotides, or modified nucleotides as described herein. In some embodiments, the overhang comprises a 5'-uridine-uridine-3'(5'-UU-3') dinucleotide. In such embodiments, the UU dinucleotide may comprise a ribonucleotide or a modified nucleotide, such as a 2'-modified nucleotide. In other embodiments, the overhang comprises a 5'-deoxythymidine-deoxythymidine-3'(5'-dTdT-3') dinucleotide.

[0029] Nucleotide overhangs can be present at the 5' or 3' ends of one or both strands. For example, in one embodiment, the RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the antisense strand. In another embodiment, the RNAi construct includes nucleotide overhangs at the 5' and 3' ends of the sense strand. In some embodiments, the RNAi construct includes nucleotide overhangs at the 5' end of the sense strand and the 5' end of the antisense strand. In yet another embodiment, the RNAi construct includes nucleotide overhangs at the 3' end of the sense strand and the 3' end of the antisense strand.

[0030] An RNAi construct may contain a single nucleotide overhang at one end of a double-stranded RNA molecule and a blunt end at the other end. “Blunt end” means that the sense and antisense strands are fully base-paired at the ends of the molecule, and there are no unpaired nucleotides extending beyond the double-stranded region. In some embodiments, the RNAi construct contains a nucleotide overhang at the 3' end of the sense strand and blunt ends at the 5' end of the sense strand and the 3' end of the antisense strand. In other embodiments, the RNAi construct contains a nucleotide overhang at the 3' end of the antisense strand and blunt ends at the 5' end of the antisense strand and the 3' end of the sense strand. In certain embodiments, the RNAi construct contains blunt ends at both ends of a double-stranded RNA molecule. In such embodiments, the sense and antisense strands are of equal length, and the double-stranded region is of equal length to the sense and antisense strands (i.e., the molecule is double-stranded over its entire length).

[0031] The sense strand and antisense strand may independently be about 15–30 nucleotides long, about 18–28 nucleotides long, about 19–27 nucleotides long, about 19–25 nucleotides long, about 19–23 nucleotides long, about 21–25 nucleotides long, or about 21–23 nucleotides long. In certain embodiments, the sense strand and antisense strand are about 18, about 19, about 20, about 21, about 22, about 23, about 24, or about 25 nucleotides long, respectively. In some embodiments, the sense strand and antisense strand form a double-stranded region that is the same length but shorter than these strands, such that the RNAi construct has two nucleotide overhangs. For example, in one embodiment, the RNAi construct includes (i) a sense strand and an antisense strand that are each 21 nucleotides long, (ii) a double-stranded region that is 19 base pairs long, and (iii) nucleotide overhangs of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In another embodiment, the RNAi construct includes (i) a sense strand and an antisense strand, each 23 nucleotides long, (ii) a double-stranded region 21 base pairs long, and (iii) nucleotide overhangs of two unpaired nucleotides at both the 3' end of the sense strand and the 3' end of the antisense strand. In yet another embodiment, the sense strand and antisense strand are of equal length and form a double-stranded region over their entire length, so that there are no nucleotide overhangs at either end of the double-stranded molecule. In one such embodiment, the RNAi construct is blunt-ended and includes (i) a sense strand and an antisense strand, each 21 nucleotides long, and (ii) a double-stranded region 21 base pairs long. In another such embodiment, the RNAi construct is blunt-ended and includes (i) a sense strand and an antisense strand, each 23 nucleotides long, and (ii) a double-stranded region 23 base pairs long.

[0032] In other embodiments, the sense strand or antisense strand is longer than the other strand so that the RNAi construct includes at least one nucleotide overhang, and these two strands form a double-stranded region having a length equal to the length of the shorter strand. For example, in one embodiment, the RNAi construct includes (i) a sense strand that is 19 nucleotides long, (ii) an antisense strand that is 21 nucleotides long, (iii) a double-stranded region that is 19 base pairs long, and (iv) a single nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand. In another embodiment, the RNAi construct includes (i) a sense strand that is 21 nucleotides long, (ii) an antisense strand that is 23 nucleotides long, (iii) a double-stranded region that is 21 base pairs long, and (iv) a single nucleotide overhang of two unpaired nucleotides at the 3' end of the antisense strand.

[0033] The antisense strand of the RNAi construct of the present invention may include any one of the antisense sequences listed in Table 1, Table 6, or Table 8, the sequences of nucleotides 1-19 of any of these antisense sequences, or the sequences of nucleotides 2-19 of any of these antisense sequences. Each of the antisense sequences listed in Table 1, Table 6, or Table 8 includes a 2-nucleotide overhang sequence, in addition to a sequence of at least 19 consecutive nucleotides (the first 19 nucleotides counting from the 5' end) complementary to the mRNA sequence of ASGR1. Thus, in some embodiments, the antisense strand includes the sequences of nucleotides 1-19 of any one of SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In other embodiments, the antisense strand includes the sequences of nucleotides 2-19 of any one of SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In yet another embodiment, the antisense strand includes a sequence selected from SEQ ID NOs: 1508-3010, 3665-4315, or 4513-4687. In certain embodiments, the antisense chain includes or consists of sequences selected from SEQ ID NOs: 1606, 1684, 1708, 1714, 1743, 1754, 1881, 1897, 2321, 2323, 2491, 2508, 2553, 2650, 2651, 1946, 2002, 2865, 2867, 2869, 2873, 2969, 3701, 3702, 3716, 3718, 3722, 4618, 4619, 4621, 4627, 4630, 4634, 4638, or 4639.In some embodiments, the antisense chain includes or consists of sequences selected from SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 4618, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4638, or SEQ ID NO: 4639. In other embodiments, the antisense chain includes or consists of SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 4621, or SEQ ID NO: 4638.

[0034] In these and other embodiments, the sense strand of the RNAi construct of the present invention may include any one of the sense sequences listed in Table 1, Table 6, or Table 8, the sequences of nucleotides 1-19 of any of these sense sequences, or the sequences of nucleotides 2-19 of any of these sense sequences. Each of the sense sequences listed in Table 1, Table 6, or Table 8 includes a 2-nucleotide overhang sequence, in addition to a sequence of at least 19 consecutive nucleotides (the first 19 nucleotides counted from the 5' end) that are identical to and complementary to the antisense sequence of the ASGR1 mRNA sequence. Thus, in some embodiments, the sense strand includes the sequence of nucleotides 1-19 of any one of sequence numbers 5-1507, 3014-3664, or 4319-4512. In other embodiments, the sense strand includes the sequence of nucleotides 2-19 of any one of sequence numbers 5-1507, 3014-3664, or 4319-4512. In yet another embodiment, the sense strand includes sequences selected from SEQ ID NOs: 5-1507, 3014-3664, or 4319-4512. In certain embodiments, the sense strand includes or consists of sequences selected from SEQ ID NOs: 103, 181, 205, 211, 240, 251, 378, 394, 818, 820, 988, 1005, 1050, 1147, 1148, 443, 499, 1362, 1364, 1366, 1370, 1466, 3050, 3051, 3065, 3067, 3071, 4443, 4444, 4446, 4452, 4455, 4459, 4463, or 4464.In certain other embodiments, the sense strand includes or consists of sequences selected from SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 4443, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4463, or SEQ ID NO: 4464. In some embodiments, the sense strand includes or consists of SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 4446, or SEQ ID NO: 4463.

[0035] In certain embodiments of the present invention, the RNAi construct includes (i) a sense strand comprising a sequence selected from any one of the following: nucleotides 1-19 of sequence numbers 5-1507, 3014-3664 or 4319-4512, or nucleotides 2-19 of sequence numbers 5-1507, 3014-3664 or 4319-4512; and (ii) an antisense strand comprising a sequence comprising any one of the following: nucleotides 1-19 of sequence numbers 1508-3010, 3665-4315 or 4513-4687, or nucleotides 2-19 of sequence numbers 1508-3010, 3665-4315 or 4513-4687.In some embodiments, the RNAi construct is a sense strand comprising (i) a sequence selected from (i) SEQ ID NO: 103, SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 251, SEQ ID NO: 378, SEQ ID NO: 394, SEQ ID NO: 818, SEQ ID NO: 820, SEQ ID NO: 988, SEQ ID NO: 1005, SEQ ID NO: 1050, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 443, SEQ ID NO: 499, SEQ ID NO: 1362, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 1466, SEQ ID NO: 3050, SEQ ID NO: 3051, SEQ ID NO: 3065, SEQ ID NO: 3067, SEQ ID NO: 3071, SEQ ID NO: 4443, SEQ ID NO: 4444, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4455, SEQ ID NO: 4459, SEQ ID NO: 4463 or SEQ ID NO: 4464. , and (ii) an antisense strand comprising or consisting of sequences selected from SEQ ID NOs: 1606, 1684, 1708, 1714, 1743, 1754, 1881, 1897, 2321, 2323, 2491, 2508, 2553, 2650, 2651, 1946, 2002, 2865, 2867, 2869, 2873, 2969, 3701, 3702, 3716, 3718, 3722, 4618, 4619, 4621, 4627, 4630, 4634, 4638 or 4639.In other embodiments, the RNAi construct includes (i) a sense strand containing or consisting of a sequence selected from SEQ ID NO: 181, SEQ ID NO: 205, SEQ ID NO: 211, SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1147, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 1370, SEQ ID NO: 4443, SEQ ID NO: 4446, SEQ ID NO: 4452, SEQ ID NO: 4463 or SEQ ID NO: 4464, and (ii) an antisense strand containing or consisting of a sequence selected from SEQ ID NO: 1684, SEQ ID NO: 1708, SEQ ID NO: 1714, SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2650, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 2873, SEQ ID NO: 4618, SEQ ID NO: 4621, SEQ ID NO: 4627, SEQ ID NO: 4638 or SEQ ID NO: 4639. In yet another embodiment, the RNAi construct includes (i) a sense strand containing or comprising a sequence selected from SEQ ID NO: 240, SEQ ID NO: 820, SEQ ID NO: 1148, SEQ ID NO: 1364, SEQ ID NO: 1366, SEQ ID NO: 4446, or SEQ ID NO: 4463, and (ii) an antisense strand containing or comprising a sequence selected from SEQ ID NO: 1743, SEQ ID NO: 2323, SEQ ID NO: 2651, SEQ ID NO: 2867, SEQ ID NO: 2869, SEQ ID NO: 4621, or SEQ ID NO: 4638.

[0036] In certain embodiments, the RNAi construct includes (a) a sense strand containing the sequence of SEQ ID NO: 181 and an antisense strand containing the sequence of SEQ ID NO: 1684, (b) a sense strand containing the sequence of SEQ ID NO: 205 and an antisense strand containing the sequence of SEQ ID NO: 1708, (c) a sense strand containing the sequence of SEQ ID NO: 211 and an antisense strand containing the sequence of SEQ ID NO: 1714, (d) a sense strand containing the sequence of SEQ ID NO: 240 and an antisense strand containing the sequence of SEQ ID NO: 1743, and (e) a sense strand containing the sequence of SEQ ID NO: 820 and an antisense strand containing the sequence of SEQ ID NO: 2323. (f) an antisense strand containing the sequence of SEQ ID NO: 1147 and an antisense strand containing the sequence of SEQ ID NO: 2650, (g) a sense strand containing the sequence of SEQ ID NO: 1148 and an antisense strand containing the sequence of SEQ ID NO: 2651, (h) a sense strand containing the sequence of SEQ ID NO: 1364 and an antisense strand containing the sequence of SEQ ID NO: 2867, (i) a sense strand containing the sequence of SEQ ID NO: 1366 and an antisense strand containing the sequence of SEQ ID NO: 2869, or (j) a sense strand containing the sequence of SEQ ID NO: 1370 and an antisense strand containing the sequence of SEQ ID NO: 2873.

[0037] The RNAi construct of the present invention may be any of the double-stranded compounds (including nucleotide sequences and / or chemical modifications of compounds) listed in Tables 1 to 10. In some embodiments, the RNAi construct is any of the double-stranded compounds listed in Table 1. In other embodiments, the RNAi construct is any of the double-stranded compounds (including nucleotide sequences and / or chemical modifications of compounds) listed in Table 6. In yet another embodiment, the RNAi construct is any of the double-stranded compounds (including nucleotide sequences and / or chemical modifications of compounds) listed in Table 8. In certain embodiments, the RNAi construct is D-1098, D-1176, D-1200, D-1206, D-1235, D-1246, D-1373, D-1389, D-1813, D-1815, D-1983, D-2000, D-2045, D-2142, D-2143, D-1438, D These are -1494, D-2357, D-2359, D-2361, D-2365, D-2461, D-3036, D-3037, D-3051, D-3053, D-3057, D-3779, D-3780, D-3782, D-3788, D-3791, D-3795, D-3799, or D-3800. In some embodiments, the RNAi construct is D-1200, D-1206, D-1235, D-1815, D-2143, D-2359, D-2361, D-2365, D-2142, D-1176, D-3779, D-3782, D-3788, D-3799, or D-3800. In one particular embodiment, the RNAi construct is D-1235. In another particular embodiment, the RNAi construct is D-2143. In yet another embodiment, the RNAi construct is D-2361. In yet another embodiment, the RNAi construct is D-1815. In yet another embodiment, the RNAi construct is D-2359. In yet another embodiment, the RNAi construct is D-3782. In yet another embodiment, the RNAi construct is D-3799.

[0038] In certain embodiments, the antisense strand of the RNAi construct of the present invention may target a specific region of the ASGR1 mRNA sequence. For example, in some embodiments, the antisense strand of the RNAi construct of the present invention includes sequences substantially complementary or fully complementary to nucleotides 692-721, nucleotides 692-716, or nucleotides 692-710 of the human ASGR1 mRNA transcript described in SEQ ID NO: 1. In such embodiments, the RNAi construct may include a sense strand substantially complementary or fully complementary to the antisense strand that targets this region. Therefore, in these embodiments, the sense strand may include sequences identical to nucleotides 692-721, nucleotides 692-716, or nucleotides 692-710 of SEQ ID NO: 1.

[0039] In other embodiments, the antisense strand of the RNAi construct of the present invention includes sequences substantially complementary or fully complementary to nucleotides 396-425, nucleotides 396-420, or nucleotides 396-414 of the human ASGR1 mRNA transcript described in SEQ ID NO: 1. In such embodiments, the RNAi construct may include a sense strand substantially complementary or fully complementary to the antisense strand that targets this region. Thus, in these embodiments, the sense strand may include sequences identical to nucleotides 396-425, nucleotides 396-420, or nucleotides 396-414 of SEQ ID NO: 1.

[0040] In further embodiments, the antisense strand of the RNAi construct of the present invention includes sequences substantially complementary or fully complementary to nucleotides 886-915, nucleotides 886-910, or nucleotides 886-904 of the human ASGR1 mRNA transcript described in SEQ ID NO: 1. In such embodiments, the RNAi construct may include a sense strand substantially complementary or fully complementary to the antisense strand that targets this region. Thus, in these embodiments, the sense strand may include sequences identical to nucleotides 886-915, nucleotides 886-910, or nucleotides 886-904 of SEQ ID NO: 1.

[0041] The RNAi construct of the present invention may include one or more modified nucleotides. “Modified nucleotide” refers to a nucleotide having one or more chemical modifications to a nucleoside, nucleic acid base, pentose ring, or phosphate group. As used herein, modified nucleotides do not include ribonucleotides containing adenosine monophosphate, guanosine monophosphate, uridine monophosphate, and cytidine monophosphate, nor deoxyribonucleotides containing deoxyadenosine monophosphate, deoxyguanosine monophosphate, deoxythymidine monophosphate, and deoxycytidine monophosphate. However, RNAi constructs may include combinations of modified nucleotides, ribonucleotides, and deoxyribonucleotides. Incorporation of modified nucleotides into one or both strands of a double-stranded RNA molecule can improve the in vivo stability of the RNA molecule, for example, by reducing the molecule's sensitivity to nucleases and other degradation processes. The efficacy of RNAi constructs in reducing the expression of target genes can also be enhanced by the incorporation of modified nucleotides.

[0042] In certain embodiments, the modified nucleotide has a ribose sugar modification. Such sugar modifications can include modifications at the 2' and / or 5' positions of the pentose ring, as well as bicyclic sugar modifications. A 2'-modified nucleotide refers to a nucleotide having a pentose ring with a substituent other than H or OH at the 2' position. Such 2'-modifications include 2'-O-alkyl (e.g., O-C1-C) 10 or O-C1-C 10 Modifications at the 5' position of the pentose ring include, but are not limited to, 5'-methyl (R or S), 5'-vinyl, and 5'-methoxy.

[0043] "Bicyclic sugar modification" refers to the modification of a pentose ring, in which case the bridge connects two atoms of the ring to form a second ring resulting in a bicyclic sugar structure. In some embodiments, the bicyclic sugar modification includes a bridge between the 4' and 2' carbon atoms of the pentose ring. A nucleotide containing a sugar moiety having a bicyclic sugar modification is referred to herein as a bicyclic nucleic acid or BNA. Exemplary bicyclic sugar modifications include α-L-methyleneoxy(4'-CH2-O-2') bicyclic nucleic acid (BNA); β-D-methyleneoxy(4'-CH2-O-2')BNA (also called locked nucleic acid or LNA); ethyleneoxy(4'-(CH2)2-O-2')BNA; aminooxy(4'-CH2-ON(R)-2')BNA; oxyamino(4'-CH2-N(R)-O-2')BNA; methyl(methyleneoxy)(4'-CH(CH3)-O-2')BNA (restricted ethyl (constrained) This includes, but is not limited to, ethyl (also called cEt); methylene-thio(4'-CH2-S-2')BNA; methylene-amino(4'-CH2-N(R)-2')BNA; methyl carboncyclic(4'-CH2-CH(CH3)-2')BNA; propylene carboncyclic(4'-(CH2)3-2')BNA; and methoxy(ethyleneoxy)(4'-CH(CH2OMe)-O-2')BNA (also called constrained MOE or cMOE). These and other glycosylated nucleotides that can be incorporated into the RNAi construct of the present invention are described in U.S. Patent No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and Biology, Vol. 19:937-954, 2012, all of which are incorporated herein by reference in their entirety.

[0044] In some embodiments, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-O-allyl-modified nucleotides, bicyclic nucleic acids (BNAs), or combinations thereof. In certain embodiments, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, 2'-O-methoxyethyl-modified nucleotides, or combinations thereof. In a particular embodiment, the RNAi construct comprises one or more 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or combinations thereof.

[0045] Both the sense and antisense strands of an RNAi construct can contain one or more modified nucleotides. For example, in some embodiments, the sense strand contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more modified nucleotides. In certain embodiments, all nucleotides in the sense strand are modified nucleotides. In some embodiments, the antisense strand contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more modified nucleotides. In other embodiments, all nucleotides in the antisense strand are modified nucleotides. In certain other embodiments, all nucleotides in the sense strand and all nucleotides in the antisense strand are modified nucleotides. In these and other embodiments, the modified nucleotides may be 2'-fluoro-modified nucleotides, 2'-O-methyl-modified nucleotides, or a combination thereof.

[0046] In some embodiments, all pyrimidine nucleotides preceding the adenosine nucleotide in the sense strand, antisense strand, or both strands are modified nucleotides. For example, if the sequence 5'-CA-3' or 5'-UA-3' appears in either strand, the cytidine and uridine nucleotides are modified nucleotides, preferably 2'-O-methyl-modified nucleotides. In certain embodiments, all pyrimidine nucleotides in the sense strand are modified nucleotides (e.g., 2'-O-methyl-modified nucleotides), and all 5' nucleotides of the sequence 5'-CA-3' or 5'-UA-3' present in the antisense strand are modified nucleotides (e.g., 2'-O-methyl-modified nucleotides). In other embodiments, all nucleotides in the double-stranded region are modified nucleotides. In such embodiments, the modified nucleotides are preferably 2'-O-methyl-modified nucleotides, 2'-fluoro-modified nucleotides, or a combination thereof.

[0047] In embodiments where the RNAi construct includes a nucleotide overhang, the nucleotide in the overhang may be a ribonucleotide, a deoxyribonucleotide, or a modified nucleotide. In one embodiment, the nucleotide in the overhang is a deoxyribonucleotide, such as deoxythymidine. In another embodiment, the nucleotide in the overhang is a modified nucleotide. For example, in some embodiments, the nucleotide in the overhang is a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-methoxyethyl modified nucleotide, or a combination thereof.

[0048] The RNAi construct of the present invention may also include one or more modified nucleotide bonds. As used herein, the term “modified nucleotide bond” refers to a nucleotide bond other than the naturally occurring 3'-5' phosphodiester bond. In some embodiments, the modified nucleotide bond is a phosphorus-containing nucleotide bond such as phosphotriesters, aminoalkyl phosphotriesters, alkylphosphonates (e.g., methylphosphonate, 3'-alkylenephosphonate), phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidates and aminoalkylphosphoramidates), phosphorothioates (P=S), chiral phosphorothioates, phosphorodithioates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates. In one embodiment, the modified nucleotide bond is a 2'-5' phosphodiester bond. In other embodiments, modified nucleotide bonds are phosphorus-free nucleotide bonds and are therefore sometimes referred to as modified nucleoside bonds. Such phosphorus-free bonds include, but are not limited to, morpholino bonds (partially formed from the sugar moiety of a nucleoside); siloxane bonds (-O-Si(H)2-O-); sulfide, sulfoxide, and sulfone bonds; formacetyl and thioformacetyl bonds; alkene-containing skeletons; sulfamate skeletons; methylene methylimino (-CH2-N(CH3)-O-CH2-) and methylene hydrazino bonds; sulfonate and sulfonamide bonds; amide bonds; and others having mixed N, O, S, and CH2 constituent parts. In one embodiment, the modified nucleoside bond is a peptide-based bond (e.g., aminoethylglycine) for generating peptide nucleic acids or PNAs, such as those described in U.S. Patent No. 5,539,082; No. 5,714,331; and No. 5,719,262.Other suitable modified nucleotide-nucleotide and nucleoside-nucleotide bonds that may be used in the RNAi construct of the present invention are described in U.S. Patent No. 6,693,187, U.S. Patent No. 9,181,551, U.S. Patent Application Publication No. 2016 / 0122761, and Deleavey and Damha, Chemistry and. This is described in Biology, Vol.19:937-954, 2012, and all of these references are incorporated herein by reference in their entirety.

[0049] In certain embodiments, the RNAi construct includes one or more phosphorothioate nucleotide interbonds. These phosphorothioate nucleotide interbonds may be present in the sense strand, antisense strand, or both strands of the RNAi construct. For example, in some embodiments, the sense strand includes one, two, three, four, five, six, seven, or eight or more phosphorothioate nucleotide interbonds. In other embodiments, the antisense strand includes one, two, three, four, five, six, seven, or eight or more phosphorothioate nucleotide interbonds. In yet another embodiment, both strands include one, two, three, four, five, six, seven, or eight or more phosphorothioate nucleotide interbonds. The RNAi construct may include one or more phosphorothioate nucleotide interbonds at the 3' end, 5' end, or both the 3' and 5' ends of the sense strand, antisense strand, or both strands. For example, in certain embodiments, the RNAi construct includes about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, or 6 or more) consecutive phosphorothioate nucleotide bonds at the 3' ends of the sense strand, antisense strand, or both strands. In other embodiments, the RNAi construct includes about 1 to about 6 or more (e.g., about 1, 2, 3, 4, 5, or 6 or more) consecutive phosphorothioate nucleotide bonds at the 5' ends of the sense strand, antisense strand, or both strands. In one embodiment, the RNAi construct includes a single phosphorothioate nucleotide bond at the 3' end of the sense strand and a single phosphorothioate nucleotide bond at the 3' end of the antisense strand. In another embodiment, the RNAi construct includes two consecutive phosphorothioate nucleotide bonds at the 3' end of the antisense strand (i.e., phosphorothioate nucleotide bonds in the first and second nucleotide bonds at the 3' end of the antisense strand). In another embodiment, the RNAi construct includes two consecutive phosphorothioate nucleotide interlinks at both the 3' and 5' ends of the antisense strand.In yet another embodiment, the RNAi construct includes two consecutive phosphorothioate nucleotide bonds at both the 3' and 5' ends of the antisense strand, and two consecutive phosphorothioate nucleotide bonds at the 5' end of the sense strand. In yet another embodiment, the RNAi construct includes two consecutive phosphorothioate nucleotide bonds at both the 3' and 5' ends of the antisense strand, and two consecutive phosphorothioate nucleotide bonds at both the 3' and 5' ends of the sense strand (i.e., phosphorothioate nucleotide bonds in the first and second nucleotide bonds at the 5' and 3' ends of the antisense strand, and phosphorothioate nucleotide bonds in the first and second nucleotide bonds at the 5' and 3' ends of the sense strand). In any embodiment in which one or both strands include one or more phosphorothioate nucleotide bonds, the remaining nucleotide bonds in the strand may be pre-existing 3'-5' phosphodiester bonds. For example, in some embodiments, each nucleotide bond in the sense strand and antisense strand is selected from phosphodiesters and phosphorothioates, with at least one nucleotide bond being a phosphorothioate.

[0050] In embodiments where the RNAi construct includes a nucleotide overhang, two or more unpaired nucleotides in the overhang may be linked by phosphorothioate nucleotide linkages. In certain embodiments, all unpaired nucleotides in the nucleotide overhang at the 3' end of the antisense strand and / or sense strand are linked by phosphorothioate nucleotide linkages. In other embodiments, all unpaired nucleotides in the nucleotide overhang at the 5' end of the antisense strand and / or sense strand are linked by phosphorothioate nucleotide linkages. In yet another embodiment, all unpaired nucleotides in any nucleotide overhang are linked by phosphorothioate nucleotide linkages.

[0051] In certain embodiments, the modified nucleotides incorporated into one or both strands of the RNAi construct of the present invention have modifications to nucleic acid bases (also referred to herein as “bases”). “Modified nucleic acid bases” or “modified bases” refers to bases other than the naturally occurring purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleic acid bases can be synthetically modified or naturally occurring, and include universal bases, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine (X), hypoxanthine (I), 2-aminoadenine, 6-methyladenine, 6-methylguanine, and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine This may include, but is not limited to, n and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thio, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosine, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine (daazaadenine), and 3-deazaguanine and 3-deazaadenine.

[0052] In some embodiments, the modified base is a universal base. A “universal base” refers to a base analog that indiscriminately forms base pairs with all of the native bases of RNA and DNA without altering the double helix structure of the resulting double-stranded region. Universal bases are known to those skilled in the art and include, but are not limited to, inosine, C-phenyl, C-naphthyl and other aromatic derivatives, azole carboxamides and nitroazole derivatives such as 3-nitropyrrole, 4-nitroindole, 5-nitroindole and 6-nitroindole.

[0053] Other suitable modified bases that can be incorporated into the RNAi construct of the present invention include those described in Herdewijn, Antisense Nucleic Acid Drug Dev., Vol.10:297-310, 2000 and Peacock et al., J.Org.Chem., Vol.76:7295-7300, 2011, both of which are incorporated herein by reference in their entirety. Those skilled in the art will be well aware that guanine, cytosine, adenine, thymine, and uracil can be substituted with other nucleic acid bases, such as the modified nucleic acid bases described above, without substantially altering the base-pair properties of polynucleotides containing nucleotides having such substituted nucleic acid bases.

[0054] In some embodiments, the sense and antisense strands of an RNAi construct may contain one or more debasalized nucleotides. A “debasalized nucleotide” or “debasalized nucleoside” is a nucleotide or nucleoside that lacks a nucleic acid base at the 1' position of a ribose sugar. In certain embodiments, the debasalized nucleotide is incorporated into the ends of the sense and / or antisense strands of the RNAi construct. In one embodiment, the sense strand contains the debasalized nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In another embodiment, the antisense strand contains the debasalized nucleotide as a terminal nucleotide at its 3' end, its 5' end, or both its 3' and 5' ends. In such embodiments where the debasalized nucleotide is a terminal nucleotide, it may be bound to an adjacent nucleotide via a 3'-3' nucleotide bond (i.e., a reverse nucleotide) rather than a natural 3'-5' nucleotide bond.

[0055] In some embodiments of the RNAi construct of the present invention, the 5' ends of the sense strand, antisense strand, or both the antisense and sense strands include a phosphate moiety. As used herein, the term “phosphate moiety” refers to terminal phosphate groups including unmodified phosphates (-OP=O)(OH)OH) and modified phosphates. Modified phosphates include phosphates in which one or more of the O and OH groups are substituted with H, O, S, N(R) or alkyl, where R is H, an amino protecting group, or an unsubstituted or substituted alkyl group. Exemplary phosphate moieties include, but are not limited to, 5'-monophosphates; 5'-diphosphates; 5'-triphosphates; 5'-guanosine caps (7-methylated or unmethylated); 5'-adenosine caps or any other modified or unmodified nucleotide cap structures; 5'-monothiophosphates (phosphorothioates); 5'-monodhithiophosphates (phosphorodithioates); 5'-α-thiotriphosphates; 5'-γ-thiotriphosphates; 5'-phosphoamidates; 5'-vinyl phosphates; 5'-alkylphosphonates (e.g., alkyl=methyl, ethyl, isopropyl, propyl, etc.); and 5'-alkyletherphosphonates (e.g., alkylether=methoxymethyl, ethoxymethyl, etc.).

[0056] Modified nucleotides that can be incorporated into the RNAi construct of the present invention may have two or more chemical modifications as described herein. For example, a modified nucleotide may have modifications to a ribose sugar and modifications to a nucleic acid base. For example, a modified nucleotide may include a 2' sugar modification (e.g., 2'-fluoro or 2'-methyl) and a modified base (e.g., 5-methylcytosine or pseudouracil). In other embodiments, a modified nucleotide may include a sugar modification combined with a modification to a 5' phosphate, which will create modified internucleotide or internucleoside bonds when the modified nucleotide is incorporated into a polynucleotide. For example, in some embodiments, a modified nucleotide may include sugar modifications such as a 2'-fluoro modification, a 2'-O-methyl modification, or a bicyclic sugar modification and a 5' phosphorothioate group. Thus, in some embodiments, one or both strands of the RNAi construct of the present invention may include a combination of a 2' modified nucleotide or a BNA and a phosphorothioate nucleotide interbond. In certain embodiments, both the sense and antisense strands of the RNAi construct of the present invention include a combination of 2'-fluoromodified nucleotides, 2'-O-methylmodified nucleotides, and phosphorothioate nucleotide interlinks. Exemplary RNAi constructs including modified nucleotides and interlinks are shown in Tables 6 and 8.

[0057] Preferably, the RNAi constructs of the present invention reduce or inhibit ASGR1 expression within cells, particularly within hepatocytes. Therefore, in one embodiment, the present invention provides a method for reducing intracellular ASGR1 expression by contacting cells with any RNAi construct described herein. The cells may be in vitro or in vivo. ASGR1 expression can be assessed by measuring the amount or level of another biomarker associated with ASGR1 expression, such as ASGR1 mRNA, ASGR1 protein, or serum levels of alkaline phosphatase. The reduction in ASGR1 expression in cells or animals treated with the RNAi construct of the present invention can be determined by comparing it to ASGR1 expression in cells or animals not treated with the RNAi construct or treated with a control RNAi construct. For example, in some embodiments, the reduction in ASGR1 expression is evaluated by (a) measuring the amount or level of ASGR1 mRNA in hepatocytes treated with the RNAi construct of the present invention, (b) measuring the amount or level of ASGR1 mRNA in hepatocytes treated with a control RNAi construct (e.g., an RNAi agent targeting RNA molecules that are not expressed in hepatocytes or RNAi constructs having nonsense or scrambled sequences) or without the construct, and (c) comparing the ASGR1 mRNA level measured from the cells treated in (a) with the ASGR1 mRNA level measured from the control cells in (b). Before comparison, the ASGR1 mRNA levels in the treated and control cells can be normalized to the RNA level relative to a control gene (e.g., 18S ribosomal RNA or housekeeping gene). ASGR1 mRNA levels can be measured by a variety of methods, including Northern blotting, nuclease protection assays, fluorescence in situ hybridization (FISH), reverse transcriptase (RT)-PCR, real-time RT-PCR, quantitative PCR, and droplet digital PCR.

[0058] In other embodiments, reduction in ASGR1 expression is assessed by (a) measuring the amount or level of ASGR1 protein in hepatocytes treated with the RNAi construct of the present invention, (b) measuring the amount or level of ASGR1 protein in hepatocytes treated with a control RNAi construct (e.g., an RNAi agent targeting RNA molecules that are not expressed in hepatocytes or RNAi constructs having nonsense or scrambled sequences) or without the construct, and (c) comparing the ASGR1 protein level measured from cells treated in (a) with the ASGR1 protein level measured from control cells in (b). Methods for measuring ASGR1 protein levels are known to those skilled in the art and include Western blotting, immunoassays (e.g., ELISA) and flow cytometry. Exemplary immunoassay-based methods for evaluating ASGR1 protein expression are described in Examples 2 and 7. Example 3 describes an exemplary method for measuring ASGR1 mRNA using RNA FISH, and Example 8 describes an exemplary method for evaluating ASGR1 mRNA using droplet digital PCR. The effectiveness of the RNAi construct of the present invention can be evaluated using any method capable of measuring ASGR1 mRNA or protein.

[0059] In some embodiments, methods for evaluating ASGR1 expression levels are performed in vitro in cells that naturally express ASGR1 (e.g., liver cells) or cells that have been engineered to express ASGR1. In certain embodiments, these methods are performed in vitro in liver cells. Preferred liver cells include, but are not limited to, primary hepatocytes (e.g., human, non-human primate, or rodent liver cells), HepAD38 cells, HuH-6 cells, HuH-7 cells, HuH-5-2 cells, BNLCL2 cells, Hep3B cells, or HepG2 cells. In one embodiment, the liver cells are Hep3B cells. In another embodiment, the liver cells are human primary hepatocytes.

[0060] In other embodiments, methods for evaluating ASGR1 expression levels are performed in vivo. The RNAi construct and any control RNAi construct can be administered to animals (e.g., rodents or non-human primates), and ASGR1 mRNA or protein levels can be evaluated in liver tissue collected from the treated animals. Alternatively, or in addition, biomarkers or functional phenotypes associated with ASGR1 expression can be evaluated in the treated animals. For example, elevated serum alkaline phosphatase levels correlate with reduced serum non-HDL cholesterol levels in individuals with functional loss mutations in the ASGR1 gene (Nioi et al., New England Journal of Medicine, Vol. 374(22): 2131-2141, 2016, the entire work incorporated herein by reference). Therefore, serum levels of alkaline phosphatase or non-HDL cholesterol can be measured in animals treated with the RNAi constructs of the present invention to evaluate the functional effectiveness of reducing ASGR1 expression. Exemplary methods for these analyses are described in Examples 6, 9, and 10.

[0061] In certain embodiments, ASGR1 expression is reduced by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, or at least 50% in liver cells by the RNAi construct of the present invention. In some embodiments, ASGR1 expression is reduced by at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, or at least 85% in liver cells by the RNAi construct of the present invention. In other embodiments, ASGR1 expression is reduced by about 90% or more in liver cells by the RNAi construct of the present invention, for example, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, or about 99% or more. The percentage reduction in ASGR1 expression can be measured by any of the methods described herein and other methods known in the art. For example, in certain embodiments, the RNAi construct of the present invention inhibits at least 45% of ASGR1 expression at 5 nM in in vitro Hep3B cells. In related embodiments, the RNAi construct of the present invention inhibits at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75% of ASGR1 expression at 5 nM in in vitro Hep3B cells. In other embodiments, the RNAi construct of the present invention inhibits at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, or at least 98% of ASGR1 expression at 5 nM in in vitro Hep3B cells.

[0062] In some embodiments, the IC50 value is calculated to evaluate the efficacy of the RNAi construct of the present invention in inhibiting ASGR1 expression in hepatocytes. The "IC50 value" is the dose / concentration required to achieve 50% inhibition of biological or biochemical function. The IC50 value of any particular substance or antagonist can be determined by creating a dose-response curve and testing the effect of different concentrations of the substance or antagonist on expression levels or functional activity in any assay. The IC50 value can be calculated for a given antagonist or substance by determining the concentration required to inhibit half of the maximum biological response or the intrinsic expression level. Thus, the IC50 value can be calculated for any RNAi construct by determining the concentration of the RNAi construct required to inhibit half of the intrinsic ASGR1 expression level in hepatocytes (e.g., the ASGR1 expression level in control hepatocytes) in any assay such as the immunoassays, RNA FISH assays, qPCR, or droplet digital PCR described in the examples. The RNAi construct of the present invention can inhibit ASGR1 expression in hepatocytes (e.g., Hep3B cells) with an IC50 of less than approximately 10 nM, less than approximately 5 nM, or less than approximately 1 nM. For example, the RNAi construct inhibits ASGR1 expression in liver cells with an IC50 of approximately 0.5nM to 10nM, 0.8nM to 8nM, 1nM to 5nM, 0.8nM to 3nM, 0.001nM to 1nM, 0.001nM to 0.50nM, 0.001nM to 0.1nM, 0.001nM to 0.01nM, 0.01nM to 0.50nM, 0.02nM to 0.80nM, 0.01nM to 1.0nM, 0.1nM to 0.9nM, or 0.05nM to 0.5nM. In certain embodiments, the RNAi construct inhibits ASGR1 expression in hepatocytes (e.g., Hep3B cells) with an IC50 of approximately 0.5 nM to approximately 5 nM. In other embodiments, the RNAi construct inhibits ASGR1 expression in hepatocytes (e.g., Hep3B cells) with an IC50 of approximately 0.01 nM to approximately 0.9 nM.

[0063] The RNAi constructs of the present invention can be readily prepared using methods known in the art, such as conventional solid-phase nucleic acid synthesis. The polynucleotides of the RNAi constructs can be constructed on suitable nucleic acid synthesizers utilizing standard nucleotide or nucleoside precursors (e.g., phosphoramidites). Automated nucleic acid synthesizers are commercially available from several vendors, including DNA / RNA synthesizers from Applied Biosystems (Foster City, CA), MerMade synthesizers from BioAutomation (Irving, TX), and OligoPilot synthesizers from GE Healthcare Life Sciences (Pittsburgh, PA).

[0064] Oligonucleotides can be synthesized via phosphoramidite chemistry using a 2'-silyl protecting group along with an acid-dissociable dimethoxytrityl (DMT) at the 5' position of a ribonucleoside. The final deprotection conditions are known to not significantly degrade the RNA product. All synthesis can be performed on large, medium, or small scales using any automated or manual synthesizer. Synthesis can also be carried out in multi-well plates, columns, or glass slides.

[0065] The 2'-O-silyl group can be removed by exposure to fluoride ions, which can be any source of fluoride ions, such as salts containing fluoride ions paired with inorganic counterions, such as cesium fluoride and potassium fluoride, or salts containing fluoride ions paired with organic counterions, such as tetraalkylammonium fluoride. Crown ether catalysts can be used in combination with inorganic fluorides in the deprotection reaction. Preferred sources of fluoride ions are tetrabutylammonium fluoride or amine hydrofluorides (e.g., triethylamine combined with aqueous HF in a dipolar aproton solvent, such as dimethylformamide).

[0066] The stability of tryesters with respect to fluorides can be altered by selecting the appropriate protecting group for use with phosphite tryesters and phosphotryesters. Methyl protection of phosphotryesters or phosphite tryesters can stabilize their binding to fluoride ions and improve process yields.

[0067] Because ribonucleosides have a reactive 2'-hydroxyl substituent, it is sometimes desirable to protect the reactive 2' position in RNA with a protecting group that is orthogonal to the 5'-O-dimethoxytrityl protecting group, such as one that is stable to acid treatment. Silyl protecting groups satisfy this condition and can be easily removed in the final fluoride deprotection step, which can result in minimal RNA degradation.

[0068] Tetrazole catalysts can be used in standard phosphoramidite coupling reactions. Preferred catalysts include, for example, tetrazole, S-ethyl-tetrazole, benzylthiotetrazole, and p-nitrophenyltetrazole.

[0069] As can be understood by those skilled in the art, further methods for synthesizing the RNAi constructs described herein are obvious to them. In addition, various synthetic steps can be carried out in alternative order or sequence to obtain the desired compounds. Other synthetic chemical transformations, protecting group techniques (for example, for hydroxyl, amino, etc. present in bases), and methods for protecting and deprotecting the RNAi constructs described herein that are useful in the synthesis of the RNAi constructs described herein are known in the art, for example, R. Larock, Comprehensive Organic Transformations, VCH Publishers (1989); TW. Greene and PG. W. Mutts, Protective Groups in Organic Synthesis, 2nd Ed., John Wiley and Sons (1991); L. Fieser and M. Fieser, Fieser and Fieser's Reagents for Organic Synthesis, John Wiley and Sons (1994); and L. Paquette, ed., Encyclopedia of Reagents. This includes those described in *for Organic Synthesis*, John Wiley and Sons (1995) and subsequent editions thereof. Custom synthesis of RNAi drugs is also available from several private vendors, including Dharmacon, Inc. (Lafayette, CO), AxoLabs GmbH (Kulmbach, Germany), and Ambion, Inc. (Foster City, CA).

[0070] The RNAi constructs of the present invention may include ligands. As used herein, “ligand” means any compound or molecule that can interact directly or indirectly with another compound or molecule. The interaction between another compound or molecule and a ligand may induce a biological response (e.g., triggering a signaling cascade, inducing receptor-mediated endocytosis) or may be a physical association. A ligand can modify one or more properties of the double-stranded RNA molecule it binds to, such as the pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, intracellular uptake, charge, and / or clearance properties of the RNA molecule.

[0071] Ligands include serum proteins (e.g., human serum albumin, low-density lipoprotein, globulin), cholesterol moieties, and vitamins (biotin, vitamin E, vitamin B). 12Ligands may include folic acid moieties, steroids, bile acids (e.g., cholic acid), fatty acids (e.g., palmitic acid, myristic acid), carbohydrates (e.g., dextran, pullulan, chitin, chitosan, inulin, cyclodextrin, or hyaluronic acid), glycosides, phospholipids, or antibodies or their binding fragments (e.g., antibodies or binding fragments that target RNAi constructs against specific cell types such as liver). Other examples of ligands include dyes, inserts (e.g., acridine), crosslinkers (e.g., psoralen, mitomycin C), porphyrins (TPPC4, texaphylline, saffrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., adamantane acetate, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecyl It contains glycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, 03-(oleoyl)lithocholic acid, 03-(oleoyl)cholenic acid, dimethoxytrityl or phenoxazine), peptides (e.g., Antennapedia peptide, Tat peptide, RGD peptide), alkylating agents, polymers (e.g., polyethylene glycol (PEG) (e.g., PEG-40K)), polyamino acids and polyamines (e.g., spermine, spermidine).

[0072] In certain embodiments, the ligand has endosomal destabilizing properties. The endosomal destabilizing ligand promotes the lysis of endosomes and / or the transport of the RNAi construct or its components from endosomes to the cytoplasm of cells. The endosomal destabilizing ligand may be a polycationic peptide or peptide mimetic exhibiting pH-dependent membrane activity and membrane fusion properties. In one embodiment, the endosomal destabilizing ligand adopts its active conformation at the pH of endosomes. The "active" conformation is the conformation in which the endosomal destabilizing ligand promotes the lysis of endosomes and / or the transport of the RNAi construct or its components from endosomes to the cytoplasm of cells. Exemplary endosomal destabilizing ligands include GALA peptides (Subbarao et al., Biochemistry, Vol. 26:2964-2972, 1987), EALA peptides (Vogel et al., J.Am.Chem.Soc., Vol.118:1581-1586, 1996), and their derivatives (Turk et al., Biochem.Biophys.Acta, Vol.1559:56-68, 2002). In one embodiment, the endosomal destabilizing component may contain a chemical group (e.g., an amino acid) that undergoes a change in charge or protonation in response to a change in pH. The endosomal destabilizing component may be linear or branched.

[0073] In some embodiments, the ligand comprises a lipid or other hydrophobic molecule. In one embodiment, the ligand comprises a cholesterol moiety or other steroid. Cholesterol-conjugated oligonucleotides have been reported to be more active than their unconjugated counterparts (Manoharan, Antisense Nucleic Acid Drug Development, Vol. 12: 103-228, 2002). Ligands comprising cholesterol moieties and other lipids for conjugation to nucleic acid molecules are also described in U.S. Patent Nos. 7,851,615; 7,745,608; and 7,833,992, all of which are incorporated herein by reference in their entirety. In another embodiment, the ligand comprises a folate moiety. Polynucleotides conjugated with a folate moiety can be taken up by cells via receptor-mediated endocytosis pathways. Such folate-polynucleotide conjugates are described in U.S. Patent No. 8,188,247, which is incorporated herein by reference in its entirety.

[0074] Given that ASGR1 is expressed on the surface of liver cells (e.g., hepatocytes) as a component of the asialoglycoprotein receptor (ASGR), in certain embodiments, it is desirable to specifically deliver RNAi constructs to these liver cells. Therefore, in certain embodiments, ligands target the specific delivery of RNAi constructs to liver cells (e.g., hepatocytes) using various means, as described in more detail below. In certain embodiments, RNAi constructs are targeted to liver cells by ligands that bind to surface-expressed ASGR, ASGR1, and / or ASGR2. In these embodiments, ASGR1 expression is reduced due to the effect of previously delivered RNAi constructs, so it is assumed that this targeting means can result in an autoregulatory system that reduces the amount of RNAi constructs delivered to liver cells.

[0075] In some embodiments, the RNAi construct can be specifically targeted to the liver by employing ligands that bind to or interact with proteins expressed on the surface of hepatocytes. For example, in certain embodiments, the ligand may include an antigen-binding protein (e.g., an antibody or its binding fragment (e.g., Fab, scFv)) that specifically binds to receptors expressed on hepatocytes, such as the asialoglycoprotein receptor and the LDL receptor. In a particular embodiment, the ligand includes an antibody or its binding fragment that specifically binds to ASGR1 and / or ASGR2. In another embodiment, the ligand includes a Fab fragment of an antibody that specifically binds to ASGR1 and / or ASGR2. The "Fab fragment" consists of one immunoglobulin light chain (i.e., the light chain variable region (VL) and constant region (CL)) and the CH1 region and variable region (VH) of one immunoglobulin heavy chain. In another embodiment, the ligand includes a single-chain variable antibody fragment (scFv fragment) of an antibody that specifically binds to ASGR1 and / or ASGR2. The “scFv fragment” comprises a VH region and a VL region of an antibody, which are present in a single polypeptide chain and include a peptide linker between the VH and VL regions, which optionally allows Fv to form a desired structure for antigen binding. Exemplary antibodies and their conjugated fragments that specifically bind to ASGR1 and can be used as ligands for targeting the RNAi construct of the present invention to the liver are described in U.S. Patent Application No. 62 / 234,546 and International Publication No. 2017 / 058944, both of which are incorporated herein by reference in their entirety. Other antibodies or their conjugated fragments that specifically bind to ASGR1, the LDL receptor, or other proteins expressed on the surface of the liver and are suitable for use as ligands in the RNAi construct of the present invention are commercially available.

[0076] In some embodiments, the ligand comprises a cys monoclonal antibody (mAb) or its antigen-binding fragment. A "cys mAb" is a monoclonal antibody or its antigen-binding fragment in which at least one amino acid of the light or heavy chain is substituted with a cysteine ​​amino acid, or at least one cysteine ​​amino acid is inserted into the primary sequence of the light or heavy chain. The free thiol group in the side chain of the cysteine ​​amino acid provides a conjugation site to which the sense chain of the RNAi construct of the present invention can be covalently bound. The cysteine ​​substitution / addition may be located at the amino-terminus or carboxy-terminus of the light or heavy chain of the antibody or antigen-binding fragment. Alternatively or in addition, the cysteine ​​substitution / addition may be located at an internal site of the light or heavy chain, provided that the cysteine ​​substitution / addition does not affect the binding affinity of the antibody or antigen-binding fragment to its target (e.g., ASGR1). Exemplary amino acids in the heavy and light chains of antibodies that can be substituted with cysteine ​​residues are described in International Publication No. 2006 / 034488 and International Publication No. 2007 / 022070, both of which are incorporated herein by reference in their entirety. In certain embodiments, the ligand comprises a cys mAb or its antigen-binding fragment that specifically binds to human ASGR1. An exemplary anti-ASGR1 cys mAb is described in Example 10. In one embodiment, the ligand comprises an anti-ASGR1 antibody having a heavy chain and a light chain, the heavy chain comprising the sequence of SEQ ID NO: 4696, and the light chain comprising the sequence of SEQ ID NO: 4697. The anti-ASGR1 cys mAb or its antigen-binding fragment may be covalently bound to the 5' or 3' end of the sense strand of the RNAi construct of the present invention via one of the linkers described herein, as necessary. In some embodiments, the anti-ASGR1 antibody-RNA molecule conjugate contains one copy of the interfering RNA molecule (e.g., siRNA or shRNA) (i.e., the RNAi ratio to antibody is 1). In other embodiments, the anti-ASGR1 antibody-RNA molecule conjugate contains two copies of the interfering RNA molecule (e.g., siRNA or shRNA) (i.e., the RNAi ratio to antibody is 2).

[0077] In certain embodiments, the ligand includes carbohydrates. “Carbohydrate” refers to a compound composed of one or more monosaccharide units having at least six carbon atoms (which may be linear, branched, or cyclic) with oxygen, nitrogen, or sulfur atoms bonded to each carbon atom. Carbohydrates include, but are not limited to, sugars (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, and oligosaccharides containing about 4, 5, 6, 7, 8, or 9 monosaccharide units) as well as polysaccharides such as starch, glycogen, cellulose, and polysaccharide gums. In some embodiments, the carbohydrates incorporated into the ligand are monosaccharides selected from pentoses, hexoses, or heptoses, as well as disaccharides and trisaccharides containing such monosaccharide units. In other embodiments, the carbohydrates incorporated into the ligand are amino sugars such as galactosamine, glucosamine, N-acetylgalactosamine, and N-acetylglucosamine.

[0078] In some embodiments, the ligand comprises a hexose or hexosamine. The hexose may be selected from glucose, galactose, mannose, fucose, or fructose. The hexosamine may be selected from fructosamine, galactosamine, glucosamine, or mannosamine. In certain embodiments, the ligand comprises glucose, galactose, galactosamine, or glucosamine. In one embodiment, the ligand comprises glucose, glucosamine, or N-acetylglucosamine. In another embodiment, the ligand comprises galactose, galactosamine, or N-acetyl-galactosamine. In a particular embodiment, the ligand comprises N-acetyl-galactosamine. Ligands comprising glucose, galactose, and N-acetyl-galactosamine (GalNAc) are particularly effective in targeting the compound to hepatocytes because such ligands bind to ASGR expressed on the surface of hepatocytes. For example, see D'Souza and Devarajan, J. Control Release, Vol. 203: 126-139, 2015. Examples of GalNAc or galactose-containing ligands that can be incorporated into the RNAi construct of the present invention are described in U.S. Patent No. 7,491,805; No. 8,106,022; and No. 8,877,917; U.S. Patent Publication No. 20030130186; and International Publication No. 2013166155, all of which are incorporated herein by reference in their entirety.

[0079] In certain embodiments, the ligand comprises a polyhydric carbohydrate moiety. As used herein, “polyhydric carbohydrate moiety” refers to a moiety comprising two or more carbohydrate units that can independently bind to or interact with other molecules. For example, a polyhydric carbohydrate moiety comprises two or more binding domains composed of carbohydrates that can bind to two or more different molecules or two or more different sites on the same molecule. The valency of a carbohydrate moiety refers to the number of individual binding domains within the carbohydrate moiety. For example, the terms “monovalent,” “divalent,” “trivalent,” and “tetravalent” with respect to carbohydrate moieties refer to carbohydrate moieties having one, two, three, and four binding domains, respectively. A polyhydric carbohydrate moiety may include a polyhydric lactose moiety, a polyhydric galactose moiety, a polyhydric glucose moiety, a polyhydric N-acetyl-galactosamine moiety, a polyhydric N-acetyl-glucosamine moiety, a polyhydric mannose moiety, or a polyhydric fucose moiety. In some embodiments, the ligand comprises a polyhydric galactose moiety. In other embodiments, the ligand comprises a polyhydric N-acetyl-galactosamine moiety. In these and other embodiments, the polyhydric carbohydrate moiety is divalent, trivalent, or tetravalent. In such embodiments, the polyvalent carbohydrate moiety may be bivalent or trivalent. In one particular embodiment, the polyvalent N-acetyl-galactosamine moiety is trivalent or tetravalent. In another particular embodiment, the polyvalent galactose moiety is trivalent or tetravalent. Exemplary trivalent or tetravalent GalNAc-containing ligands for incorporation into the RNAi construct of the present invention are detailed below.

[0080] Ligands can be directly or indirectly bound or conjugated to the RNA molecule of the RNAi construct. For example, in some embodiments, the ligand is directly covalently bound to the sense or antisense strand of the RNAi construct. In other embodiments, the ligand is covalently bound to the sense or antisense strand of the RNAi construct via a linker. Ligands can be bound to nucleic acid bases, sugar moieties, or internucleotide bonds of the polynucleotide (e.g., sense or antisense strand) of the RNAi construct of the present invention. Conjugation or binding to purine nucleic acid bases or their derivatives can occur at any position, including atoms inside and outside the ring. In certain embodiments, the ligand is bound to positions 2, 6, 7, or 8 of the purine nucleic acid base. Conjugation or binding to pyrimidine nucleic acid bases or their derivatives can also occur at any position. In some embodiments, the ligand can be bound to positions 2, 5, and 6 of the pyrimidine nucleic acid base. Conjugation or binding to the sugar moiety of a nucleotide can occur at any carbon atom. Exemplary carbon atoms in the sugar moiety that can bind to a ligand include the 2', 3', and 5' carbon atoms. The 1' position can also be bound to the ligand, for example, at debasal residues. Nucleotide-nucleotide bonds also facilitate ligand binding. For phosphorus-containing bonds (e.g., phosphodiesters, phosphorothioates, phosphorodithioates, phosphoramidates, etc.), the ligand can be directly bound to the phosphorus atom or to an O, N, or S atom bonded to the phosphorus atom. For amine or amide-containing nucleoside bonds (e.g., PNA), the ligand can be bound to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0081] In certain embodiments, the ligand may be bound to the 3' or 5' end of either the sense strand or the antisense strand. In certain embodiments, the ligand is covalently bound to the 5' end of the sense strand. In other embodiments, the ligand is covalently bound to the 3' end of the sense strand. For example, in some embodiments, the ligand is bound to the 3' terminal nucleotide of the sense strand. In such certain embodiments, the ligand is bound at the 3' position of the 3' terminal nucleotide of the sense strand. In alternative embodiments, the ligand is bound near the 3' end of the sense strand, but before one or more terminal nucleotides (i.e., before 1, 2, 3, or 4 terminal nucleotides). In some embodiments, the ligand is bound at the 2' position of the sugar of the 3' terminal nucleotide of the sense strand.

[0082] In certain embodiments, the ligand is bound to the sense or antisense strand via a linker. The "linker" is an atom or atomic group that covalently binds the ligand to the polynucleotide component of the RNAi construct. Linkers can have atomic lengths of about 1 to about 30, about 2 to about 28, about 3 to about 26, about 4 to about 24, about 6 to about 20, about 7 to about 20, about 8 to about 20, about 8 to about 18, about 10 to about 18, and about 12 to about 18. In some embodiments, the linker may include a bifunctional binding moiety typically comprising an alkyl moiety having two functional groups. One of the functional groups is selected to bind to the compound of interest (e.g., the sense or antisense strand of the RNAi construct), and the other is further selected to bind essentially to any selected group, such as the ligand described herein. In certain embodiments, the linker comprises a chain structure or oligomer of repeating units such as ethylene glycol or amino acid units. Examples of functional groups typically employed in the difunctional bond moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In some embodiments, the difunctional bond moiety includes amino, hydroxyl, carboxylic acid, thiol, and unsaturated (e.g., double or triple bonds).

[0083] Linkers that can be used to bind ligands to the sense or antisense strand in the RNAi construct of the present invention include pyrrolidine, 8-amino-3,6-dioxaoctanoic acid, succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate, 6-aminohexanoic acid, substituted C1-C 10 Alkyl, substituted, or unsubstituted C2-C 10 Alkenyl or substituted or unsubstituted C2-C 10 Preferred substituents for such linkers include, but are not limited to, alkynyls. Preferred substituents for such linkers include, but are not limited to, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0084] In certain embodiments, the linker is cleavable. The cleavable linker is sufficiently stable outside the cell but is cleaved after entering the target cell, releasing the two parts that the linker holds together. In some embodiments, the cleavable linker is cleaved at least 10, 20, 30, 40, 50, 60, 70, 80, or 90 times or more, or at least 100 times faster, in the target cell or under a first reference condition (e.g., one that mimics or is selected to be equivalent to intracellular conditions) than under the target blood or a second reference condition (e.g., one that mimics or is selected to be equivalent to conditions found in blood or serum).

[0085] Cleavable linkers are sensitive to the presence of cleavage agents, such as pH, redox potential, or degradable molecules. Generally, cleavage agents are more prevalent or found at higher levels or activity inside cells than in serum or blood. Examples of such degradable agents include, for example, oxidases or reductases or reducing agents such as mercaptans that are present inside cells and can degrade redox-cleavable linkers by reduction; redox-selective or non-substrate-specific redox agents; esterases; agents that can create an endosome or acidic environment, e.g., those that result in a pH of 5 or less; and enzymes that can hydrolyze or degrade acid-cleavable linkers by acting as common acids, peptidases (which may be substrate-specific), and phosphatases.

[0086] Cleavable linkers may contain pH-sensitive regions. While human serum has a pH of 7.4, the average intracellular pH is slightly lower, ranging from approximately 7.1 to 7.3. Endosomes have a more acidic pH in the range of 5.5 to 6.0, and lysosomes have an even more acidic pH of approximately 5.0. Some linkers have cleavable groups that are cleaved at a favorable pH, thereby releasing RNA molecules from ligands into the cell or into a desired compartment of the cell.

[0087] Linkers can contain cleavable groups that can be cleaved by specific enzymes. The type of cleavable group incorporated into a linker may depend on the target cell. For example, liver-targeting ligands may bind to RNA molecules via linkers containing ester groups. Liver cells are rich in esterases, and therefore the linker will be cleaved more efficiently in liver cells than in esterase-deficient cell types. Other types of cells rich in esterases include the lungs, renal cortex, and testes. Linkers containing peptide bonds may be used to target peptidase-rich cells such as liver cells and synovial cells.

[0088] Generally, the suitability of a cleavable linker candidate can be evaluated by testing the ability of a degrading agent (or condition) to cleave the linker candidate. It is also desirable to test the cleavable linker candidate for its ability to resist cleavage when in contact with blood or other non-target tissues. Therefore, the relative sensitivity to cleavage can be determined between a first condition selected to demonstrate cleavage in target cells and a second condition selected to demonstrate cleavage in other tissues or biological fluids, such as blood or serum. Evaluations can be performed in cell-free systems, cells, cell cultures, organ or tissue cultures, or whole animals. It may be useful to perform an initial evaluation in cell-free or culture conditions and confirm it with further evaluation in whole animals. In some embodiments, a useful linker candidate cleaves at least 2, 4, 10, 20, 50, 70, or 100 times faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions).

[0089] In other embodiments, redox-cleavable linkers are utilized. Redox-cleavable linkers are cleaved upon reduction or oxidation. An example of a reductively cleavable group is a disulfide linking group (-SS-). One or more of the methods described herein can be used to determine whether a cleavable linker candidate is a suitable “reductively cleavable linker” or suitable for use with, for example, a particular RNAi construct and a particular ligand. For example, a linker candidate can be evaluated by incubation with dithiothreitol (DTT) or other reducing agents known in the art that mimic the cleavage rate that would be observed in cells, such as target cells. Linker candidates can also be evaluated under conditions selected to mimic blood or serum conditions. In certain embodiments, a linker candidate is cleaved by up to 10% in blood. In other embodiments, useful linker candidates are degraded at least 2-fold, 4-fold, 10-fold, 20-fold, 50-fold, 70-fold, or 100-fold faster in cells (or under in vitro conditions selected to mimic intracellular conditions) compared to blood (or under in vitro conditions selected to mimic extracellular conditions).

[0090] In yet another embodiment, a phosphate-based linker candidate is cleaved by a drug that degrades or hydrolyzes the phosphate group. An example of a drug that hydrolyzes the phosphate group in a cell is an enzyme such as an intracellular phosphatase. Examples of cleavable groups in phosphate systems are -OP(O)(ORk)-O-, -OP(S)(ORk)-O-, -OP(S)(SRk)-O-, -SP(O)(ORk)-O-, -OP(O)(ORk)-S-, -SP(O)(ORk)-S-, -OP(S)(ORk)-S-, -SP(S)(ORk)-O-, -OP(O)(Rk)-O-, -OP(S)(Rk)-O-, -SP(O)(Rk)-O-, -SP(S)(Rk)-O-, -SP(O)(Rk)-S- and -OP(S)(Rk)-S-, where Rk can be hydrogen or alkyl. Specific embodiments include -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-. Another specific embodiment is -OP(O)(OH)-O-. These linker candidates can be evaluated using methods similar to those described above.

[0091] In other embodiments, the linker may include an acid-cleavable group, which is a group that is cleaved under acidic conditions. In some embodiments, the acid-cleavable group is cleaved in an acidic environment with a pH of about 6.5 or less (e.g., about 6.0, 5.5, 5.0 or less), or by an active agent such as an enzyme that can act as a general acid. Within cells, certain low-pH organelles, such as endosomes and lysosomes, can provide a cleavage environment for acid-cleavable groups. Examples of acid-cleavable linking groups include, but are not limited to, hydrazones, esters, and amino acid esters. The acid-cleavable group may have the general formula -C=NN-, C(O)O, or -OC(O). In particular embodiments, the carbon bonded to the oxygen (alkoxy group) of the ester is an aryl group, a substituted alkyl group, or a tertiary alkyl group such as dimethyl, pentyl, or t-butyl. These candidates can be evaluated using methods similar to those described above.

[0092] In other embodiments, the linker may include ester-based cleavable groups that are cleaved by enzymes such as esterases and amidases in cells. Examples of ester-based cleavable groups include, but are not limited to, esters of alkylene, alkenylene, and alkynylene groups. The ester-cleavable groups have the general formula -C(O)O- or -OC(O)-. These linker candidates can be evaluated using methods similar to those described above.

[0093] In a further embodiment, the linker may comprise a peptide-based cleavable group that is cleaved by enzymes such as peptidases and proteases in the cell. The peptide-based cleavable group may be a peptide bond formed between amino acids to give rise to oligopeptides (e.g., dipeptides, tripeptides, etc.) and polypeptides. The peptide-based cleavable group does not contain an amide group. The amide group may be formed between any alkylene, alkenylene or alkynylene. The peptide bond is a special type of amide bond formed between amino acids to give rise to peptides and proteins. The peptide-based cleavage group is generally limited to the peptide bond (i.e., amide bond) formed between amino acids to give rise to peptides and proteins and does not include the entire amide functional group. The peptide-based cleavable linking group generally has the general formula -NHCHR A C(O)NHCHR B C(O)-, wherein R A and R B are the side chains of two adjacent amino acids. These candidates can be evaluated using a method similar to that described above.

[0094] Exemplary linkers that can be employed to bind a ligand, particularly a ligand containing a GalNAc moiety, to the sense strand in the RNAi construct of the present invention are shown in Formulas A - K below.

[0095] In one embodiment, the linker for binding a ligand to the 3'-end of the sense strand in the RNAi construct of the present invention has the structure of Formula A below, wherein n is 1 or 2, R is a ligand (e.g., a moiety containing 3 - 4 GalNAc units), and R' is the 3'-end of the sense strand of the double-stranded RNA molecule. [Chemical formula]

[0096] In another embodiment, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula B, where n is 1, 2, or 3, R is the ligand (e.g., a portion containing 3 to 4 GalNAc units), and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0097] In yet another embodiment, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula C, where n is 1 or 2, R is the ligand (e.g., a portion containing 3-4 GalNAc units), R' is the 3' end of the sense strand of a double-stranded RNA molecule, and R'' is H, alkyl, or functional alkyl. [ka]

[0098] In certain embodiments, the linker for binding a ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula D, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0099] In certain other embodiments, the linker for binding a ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula E, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0100] In some embodiments, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula F, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0101] In other embodiments, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of formula G below, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0102] In certain other embodiments, the linker for binding a ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of formula H below, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0103] In some embodiments, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula J, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0104] In other embodiments, the linker for binding the ligand to the 3' end of the sense strand in the RNAi construct of the present invention has the structure of the following formula K, where R is the ligand (e.g., a portion containing 3-4 GalNAc units) and R' is the 3' end of the sense strand of a double-stranded RNA molecule. [ka]

[0105] Other types of linkers suitable for binding ligands to the sense or antisense strand in the RNAi construct of the present invention are known in the art and may include the linkers described in U.S. Patent Nos. 7,723,509; 8,017,762; 8,828,956; 8,877,917; and 9,181,551, all of which are incorporated herein by reference in their entirety.

[0106] In certain embodiments, the ligand covalently bound to the sense or antisense strand of the RNAi construct of the present invention comprises a GalNAc moiety, for example, a polyvalent GalNAc moiety. In some embodiments, the polyvalent GalNAc moiety is a trivalent GalNAc moiety and is bound to the 3' end of the sense strand. In other embodiments, the polyvalent GalNAc moiety is a trivalent GalNAc moiety and is bound to the 5' end of the sense strand. In yet another embodiment, the polyvalent GalNAc moiety is a tetravalent GalNAc moiety and is bound to the 3' end of the sense strand. In yet another embodiment, the polyvalent GalNAc moiety is a tetravalent GalNAc moiety and is bound to the 5' end of the sense strand. Examples of trivalent and tetravalent GalNAc moieties and linkers that can bind to a double-stranded RNA molecule in the RNAi construct of the present invention are provided in the following structural formulas I to XXIX.

[0107] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula I, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0108] In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula II below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0109] In yet another embodiment, the RNAi construct comprises a ligand and a linker having the following structural formula III, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0110] In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula IV below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0111] In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula V, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0112] In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula VI below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, j is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0113] In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula VII, wherein the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0114] In another specific embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula VIII below, where the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0115] In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula IX, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0116] In other embodiments, the RNAi construct comprises a ligand and a linker having the structure of the following formula X, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0117] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XI, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0118] In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XII below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0119] In yet another embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XIII below, where each n is independently 1 to 3, k is 1 to 3, m is 1 or 2, and the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0120] In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XIV, where each n is independently 1 to 3, k is 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0121] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XV, where n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0122] In other embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XVI, where each n is independently 1 to 3, k is 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0123] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XVII, where each n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0124] In certain other embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XVIII, where each n is independently 1 to 3, k is 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0125] In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XIX, where n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0126] In some embodiments, the RNAi construct comprises a ligand and a linker having the structure of the following formula XX, where each n is independently 1 to 3, k is 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0127] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XXI, where n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0128] In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XXII, where each n is independently 1 to 3, k is 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0129] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XXIII, where n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0130] In certain other embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XXIV, where n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0131] In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XXV, where each n is independently 1 to 3, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0132] In certain embodiments, the RNAi construct comprises a ligand and a linker having the structure of formula XXVI, where the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0133] In one embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XXVII, where each n is independently 1 to 3, k is 1 to 9, m is 1 or 2, and the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0134] In another embodiment, the RNAi construct comprises a ligand and a linker having the structure of the following formula XXVIII, where the ligand is bound to the 5' end of the sense strand of a double-stranded RNA molecule (represented by a solid wavy line). [ka]

[0135] In one particular embodiment, the RNAi construct comprises a ligand and a linker having the structure of formula XXIX, wherein the ligand is bound to the 3' end of the sense strand of a double-stranded RNA molecule (represented by a solid dashed line). [ka]

[0136] In some embodiments, the RNAi constructs of the present invention may be delivered to target cells or tissues by administering a vector that encodes and controls the intracellular expression of the RNAi construct. A “vector” (also referred to herein as an “expression vector”) is a composition of substances that can be used to deliver a nucleic acid of interest into the interior of a cell. Numerous vectors are known in the art and include, but are not limited to, linear polynucleotides, polynucleotides conjugated with ionic or amphiphilic compounds, plasmids, and viruses. Thus, the term “vector” includes plasmids or viruses that autonomously replicate. Examples of viral vectors include, but are not limited to, adenovirus vectors, adeno-associated virus vectors, and retrovirus vectors. Vectors may be replicated in living cells or may be synthesized.

[0137] Generally, a vector for expressing the RNAi construct of the present invention will include one or more promoters operably ligated to the sequence encoding the RNAi construct. As used herein, the terms “operably ligated” or “transcriptionally regulated” mean that the promoter is in the appropriate position and orientation relative to the polynucleotide sequence and controls the initiation of transcription by RNA polymerase and the expression of the polynucleotide sequence. “Promoter” refers to a sequence that is recognized by or introduced into the cellular synthesis machinery and is required to initiate transcription of a particular gene sequence. Preferred promoters include, but are not limited to, RNA polI, polII, H1 or U6 RNA polIII and viral promoters (e.g., human cytomegalovirus (CMV) early gene promoter, SV40 early promoter, and the long repeat sequence of the Roussarcoma virus terminal). In some embodiments, the H1 or U6 RNA polIII promoter is preferred. The promoter may be tissue-specific or inducible. Of particular interest are liver-specific promoters, such as promoter sequences derived from the human α1-antitrypsin gene, albumin gene, hemopexin gene, and hepatic lipase gene. Inducible promoters include promoters regulated by ecdysone, estrogen, progesterone, tetracycline, and isopropyl-P-D1-thiogalactopyranoside (IPTG).

[0138] In some embodiments where the RNAi construct includes siRNA, the two separate strands (sense strand and antisense strand) may be expressed from a single vector or two separate vectors. For example, in one embodiment, the sequence encoding the sense strand is operably ligated to the promoter of a first vector, and the sequence encoding the antisense strand is operably ligated to the promoter of a second vector. In such embodiments, the first and second vectors are introduced simultaneously into target cells, for example, by infection or transfection, and as a result, the sense and antisense strands are transcribed and hybridize within the cell to form an siRNA molecule. In another embodiment, the sense and antisense strands are transcribed from two separate promoters located in a single vector. In some such embodiments, the sequence encoding the sense strand is operably ligated to the first promoter, and the sequence encoding the antisense strand is operably ligated to the second promoter, and the first and second promoters are located in a single vector. In one embodiment, the vector comprises a first promoter operably ligated to a sequence encoding an siRNA molecule and a second promoter operably ligated to the same sequence in the reverse direction, such that transcription of the sequence from the first promoter results in the synthesis of the sense strand of the siRNA molecule, and transcription of the sequence from the second promoter results in the synthesis of the antisense strand of the siRNA molecule.

[0139] In other embodiments in which the RNAi construct includes shRNA, a sequence encoding a single, at least partially, self-complementary RNA molecule is operably linked to a promoter that produces a single transcript. In some embodiments, the sequence encoding shRNA includes reverse repeats linked by a linker polynucleotide sequence, which generate stem and loop structures of the shRNA after transcription.

[0140] In some embodiments, the vector encoding the RNAi construct of the present invention is a viral vector. Suitable viral vector systems for expressing the RNAi construct described herein include, but are not limited to, adenovirus vectors, retrovirus vectors (e.g., lentivirus vectors, Moloney's mouse leukemia virus), adeno-associated virus vectors; herpes simplex virus vectors; SV40 vectors; polyomavirus vectors; papillomavirus vectors; picornavirus vectors; and poxvirus vectors (e.g., vaccinia virus). In certain embodiments, the viral vector is a retrovirus vector (e.g., a lentivirus vector).

[0141] Various vectors suitable for use in the present invention, methods for inserting nucleic acid sequences encoding siRNA or shRNA molecules into vectors, and methods for delivering vectors to target cells are within the scope of the art for which the present invention is practiced. For example, Dornburg, Gene Therap.,Vol.2:301-310,1995;Eglitis,Biotechniques,Vol.6:608-614,1988;Miller,Hum Gene Therap.,Vol.1:5-14,1990;Anderson,Nature,Vol.392:25-30,1998;Rubinson DA et al.,Nat.Genet.,Vol.33:401-406,2003;Brummelkamp et al.,Science,Vol.296:550-553,2002;Brummelkamp et al.,Cancer Cell,Vol.2:243-247,2002;Lee et al.,Nat Biotechnol,Vol.20:500-505,2002;Miyagishi et al. al.,Nat Biotechnol,Vol.20:497-500,2002;Paddison et al.,Genes Dev,Vol.16:948-958,2002;Paul et al.,Nat Biotechnol,Vol.20:505-508,2002;Sui et al., Proc Natl Acad Sci USA, Vol.99:5515-5520, 2002; and Yu et al., Proc Natl Acad Please refer to Sci USA, Vol.99:6047–6052, 2002, all of which are incorporated herein by reference in their entirety.

[0142] The present invention also includes pharmaceutical compositions and formulations comprising the RNAi construct described herein and a pharmaceutically acceptable carrier, excipient, or diluent. Such compositions and formulations are useful for reducing ASGR1 expression in subjects where it is needed. When considering clinical applications, pharmaceutical compositions and formulations will be prepared in a form appropriate for the intended use. Generally, this will inevitably involve preparing compositions that are essentially free of pyrogens and other impurities that may be harmful to humans or animals.

[0143] The terms “pharmaceutically acceptable” or “pharmacologically acceptable” refer to molecular entities and compositions that do not produce adverse allergic or other undesirable reactions when administered to animals or humans. As used herein, “pharmaceutically acceptable carriers, excipients or diluents” include solvents, buffers, solutions, dispersion media, coatings, antimicrobial and antifungal agents, isotonic agents and absorption retarders, etc., that are acceptable for use in the formulation of pharmaceuticals, such as drugs suitable for administration to humans. The use of such media and drugs for pharmaceutically active substances is known in the art. Unless any conventional media or drug is incompatible with the RNAi construct of the present invention, its use in therapeutic compositions is envisioned. Auxiliary active ingredients may also be incorporated into the composition, provided they do not inactivate the vector or RNAi construct of the composition.

[0144] The composition and method of formulation of a pharmaceutical composition depend on several conditions, including but not limited to the route of administration, the type and degree of the disease or disorder being treated, or the dose administered. In some embodiments, the pharmaceutical composition is formulated based on the intended route of delivery. For example, in certain embodiments, the pharmaceutical composition is formulated for parenteral delivery. Parenteral delivery forms include intravenous, intra-arterial, subcutaneous, intrathecal, intraperitoneal, or intramuscular injection or infusion. In one embodiment, the pharmaceutical composition is formulated for intravenous delivery. In such embodiments, the pharmaceutical composition may comprise a lipid-based delivery vehicle. In another embodiment, the pharmaceutical composition is formulated for subcutaneous delivery. In such embodiments, the pharmaceutical composition may comprise a targeted ligand (e.g., a GalNAc-containing or antibody-containing ligand as described herein).

[0145] In some embodiments, the pharmaceutical composition comprises an effective amount of the RNAi construct described herein. “Effective amount” is an amount sufficient to produce a favorable or desired clinical outcome. In some embodiments, the effective amount is sufficient to reduce ASGR1 expression in the hepatocytes of interest. In some embodiments, the effective amount may be sufficient to partially reduce ASGR1 expression to a level equivalent to, for example, the expression of the wild-type ASGR1 allele in a human heterozygous individual. Heterozygous human carriers of the functionally deficient ASGR1 variant allele have been reported to have lower serum levels of non-HDL cholesterol and a lower risk of coronary artery disease and myocardial infarction compared to non-carriers (Nioi et al., New England Journal of Medicine, Vol.374(22):2131-2141, 2016). Therefore, without being constrained by theory, it is considered that a partial reduction in ASGR1 expression may be sufficient to achieve a favorable reduction in serum non-HDL cholesterol and a reduction in the risk of coronary artery disease and myocardial infarction.

[0146] The effective dose of the RNAi construct of the present invention may be about 0.01 mg / kg body weight to about 100 mg / kg body weight, about 0.05 mg / kg body weight to about 75 mg / kg body weight, about 0.1 mg / kg body weight to about 50 mg / kg body weight, about 1 mg / kg to about 30 mg / kg body weight, about 2.5 mg / kg body weight to about 20 mg / kg body weight, or about 5 mg / kg body weight to about 15 mg / kg body weight. In certain embodiments, the effective single dose of the RNAi construct of the present invention may be about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, about 6 mg / kg, about 7 mg / kg, about 8 mg / kg, about 9 mg / kg, or about 10 mg / kg. A pharmaceutical composition containing an effective dose of the RNAi construct may be administered weekly, bi-weekly, monthly, every three months, or every six months. The precise determination of what is likely to be an effective dose and administration frequency may be based on several factors, including the patient's size, age and general condition, the type of disorder being treated (e.g., myocardial infarction, heart failure, coronary artery disease, hypercholesterolemia), the specific RNAi construct employed, and the route of administration. Estimates of the effective dose and in vivo half-life for any specific RNAi construct of the present invention can be confirmed using conventional methods and / or studies in appropriate animal models.

[0147] The pharmaceutical composition of the present invention may be administered via any common route, as long as the target tissue is available through that route. Such routes include, but are not limited to, parenteral (e.g., subcutaneous, intramuscular, intraperitoneal, or intravenous), oral, nasal, buccal, intradermal, transdermal, and sublingual routes, or direct injection into liver tissue or delivery via the hepatic portal vein. In some embodiments, the pharmaceutical composition is administered parenterally. For example, in certain embodiments, the pharmaceutical composition is administered intravenously. In other embodiments, the pharmaceutical composition is administered subcutaneously.

[0148] Colloidal dispersion systems such as oil-in-water emulsions, micelles, mixed micelles and liposomes, polymer complexes, nanocapsules, microspheres, beads and lipid-based systems can be used as delivery vehicles for the RNAi constructs of the present invention or vectors encoding such constructs. Suitable commercially available lipid emulsions for delivering the nucleic acids of the present invention include Intralipid® (Baxter International Inc.), Liposyn® (Abbott Pharmaceuticals), Liposyn® II (Hospira), Liposyn® III (Hospira), and Nutrilipid (B. Braun). This includes Medical Inc. and other similar lipid emulsions. A preferred colloidal system for use as an in vivo delivery vehicle is liposomes (i.e., artificial membrane vesicles). The RNAi constructs of the present invention can be encapsulated within liposomes or can form complexes with liposomes, particularly cationic liposomes. Alternatively, the RNAi constructs of the present invention can form complexes with lipids, particularly cationic lipids. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidylethanolamine (DOPE), dimyristoylphosphatidylcholine (DMPC), and dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine), negative (e.g., dimyristoylphosphatidylglycerol (DMPG)), and cationic (e.g., dioleoyltetramethylaminopropyl (DOTAP) and dioleoylphosphatidylethanolamine (DOTMA)). The preparation and use of such colloidal dispersions are well known in the art. Exemplary formulations are described in U.S. Patent Nos. 5,981,505; 6,217,900; 6,383,512; 5,783,565; 7,202,227; 6,379,965; 6,127,170; 5,837,533; 6,747,014; and in International Publication No. 03 / 093449.

[0149] In some embodiments, the RNAi constructs of the present invention are fully encapsulated in lipid formulations to form, for example, SPLPs, pSPLPs, SNALPs, or other nucleic acid-lipid particles. As used herein, the term "SNALP" refers to a stable nucleic acid-lipid particle containing SPLPs. As used herein, the term "SPLP" refers to a nucleic acid-lipid particle containing plasmid DNA encapsulated in a lipid vesicle. SNALPs and SPLPs typically contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). SNALPs and SPLPs are extremely useful for systemic administration because they exhibit a long circulating lifetime after intravenous injection and accumulate at distal sites (e.g., sites physically distant from the administration site). SPLPs include "pSPLPs" containing encapsulated condensant-nucleic acid complexes as described in International Publication No. 00 / 03683. Nucleic acid-lipid particles typically have average diameters of approximately 50 nm to 150 nm, 60 nm to 130 nm, 70 nm to 110 nm, or 70 nm to 90 nm, and are substantially non-toxic. In addition, nucleic acids present in nucleic acid-lipid particles are resistant to degradation by nucleases in aqueous solutions. Nucleic acid-lipid particles and methods for preparing them are disclosed, for example, in U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; and International Publication No. 96 / 40964.

[0150] Pharmaceutical compositions suitable for injection include, for example, sterile aqueous solutions or dispersions and sterile powders for the immediate preparation of sterile solutions or dispersions for injection. Generally, these preparations are sterile and fluid enough to be easily injected. The preparations should be stable under manufacturing and storage conditions and should be protected against microbial contamination such as bacteria and fungi. Suitable solvents or dispersion media may include, for example, water, ethanol, polyols (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils. Adequate fluidity can be maintained, for example, by the use of coating materials such as lecithin, maintaining the particle size required in the case of dispersions, and the use of surfactants. Prevention of microbial activity can be provided by various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, and thimerosal. In many cases, it is preferable to include isotonic agents, such as sugars or sodium chloride. Sustained absorption of the injection composition can be provided by the use of absorption-delaying agents, such as aluminum monostearate and gelatin, in the composition.

[0151] Sterile solutions for injection can be prepared by incorporating an active compound in an appropriate amount with any other desired components (e.g., those listed above) into a solvent, followed by sterilization by filtration. Generally, dispersions are prepared by incorporating various sterilized active ingredients into a sterile vehicle containing a basic dispersion medium and other desired components, e.g., those listed above. For sterile powders for the preparation of sterile solutions for injection, preferred preparation methods include vacuum drying and freeze-drying techniques, from which powders of the active ingredient and any additional desired components are obtained from a pre-sterilized filtered solution.

[0152] The compositions of the present invention can generally be formulated in neutral or salt form. Pharmaceutically acceptable salts include, for example, acid addition salts (formed by free amino groups) derived from inorganic acids (e.g., hydrochloric acid or phosphoric acid) or organic acids (e.g., acetic acid, oxalic acid, tartaric acid, mandelic acid, etc.). Salts formed by free carboxyl groups can also be derived from inorganic bases (e.g., sodium, potassium, ammonium, calcium, or ferric hydroxide) or organic bases (e.g., isopropylamine, trimethylamine, histidine, procaine, etc.).

[0153] For parenteral administration in aqueous solutions, for example, the solution is usually appropriately buffered, and the liquid diluent is first isotonic with, for example, sufficient saline or glucose. Such aqueous solutions may be used for, for example, intravenous, intramuscular, subcutaneous, and intraperitoneal administration. Preferably, a sterile aqueous medium known to those skilled in the art is employed, especially in consideration of this disclosure. As an example, a single dose may be dissolved in 1 ml of isotonic NaCl solution and added to 1000 ml of subcutaneous injection solution, or injected into the proposed injection site (see, for example, “Remington's Pharmaceutical Sciences” 15th Edition, pages 1035-1038 and 1570-1580). With regard to administration to humans, the preparation should meet the sterility, pyrogenicity, overall safety, and purity standards required by FDA standards. In certain embodiments, the pharmaceutical composition of the present invention comprises or consists of sterile saline and the RNAi construct described herein. In other embodiments, the pharmaceutical composition of the present invention comprises or consists of the RNAi construct described herein and sterile water (e.g., water for injection, WFI). In yet another embodiment, the pharmaceutical composition of the present invention comprises or consists of the RNAi construct described herein and phosphate-buffered saline (PBS).

[0154] In some embodiments, the pharmaceutical compositions of the present invention are packaged in or stored within an administration device. Devices for injectable formulations include, but are not limited to, injection ports, pre-filled syringes, autoinjectors, injection pumps, attachable syringes, and injection pens. Devices for aerosolized or powder formulations include, but are not limited to, inhalers, inhalers, and aspirators. Accordingly, the present invention includes an administration device containing a pharmaceutical composition of the present invention for treating or preventing one or more of the disorders described herein.

[0155] The present invention provides methods for reducing or inhibiting ASGR1 expression in subjects where this is necessary, and methods for treating or preventing conditions, diseases, or disorders associated with ASGR1 expression or activity. “Conditions, diseases, or disorders associated with ASGR1 expression” refers to conditions, diseases, or disorders in which altered or elevated ASGR1 expression levels are associated with an increased risk of developing the condition. Conditions, diseases, or disorders associated with ASGR1 expression may also include conditions, diseases, or disorders resulting from abnormal changes in lipoprotein metabolism, such as abnormal levels of cholesterol, lipids, triglycerides, or impaired clearance of these molecules. In recent years, human carriers of a functionally deficient variant allele of the ASGR1 subunit of the asial glycoprotein receptor have been reported to have lower serum levels of non-HDL cholesterol and a lower risk of coronary artery disease and myocardial infarction compared to non-carriers (Nioi et al., New England Journal of Medicine, Vol.374(22):2131-2141, 2016, the entire paper is incorporated herein by reference). Therefore, in certain embodiments, the RNAi construct of the present invention is particularly useful for the treatment or prevention of cardiovascular diseases (e.g., coronary artery disease and myocardial infarction) and cholesterol-related disorders (e.g., hypercholesterolemia).

[0156] Conditions, diseases, or disorders associated with ASGR1 expression that can be treated or prevented according to the methods of the present invention include, but are not limited to, cardiovascular diseases such as myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral artery disease), fragility plaque, hypercholesterolemia, and dyslipidemia (e.g., manifestation of elevated total cholesterol, elevated low-density lipoprotein (LDL), elevated very low-density lipoprotein (VLDL), elevated triglycerides, and / or low levels of high-density lipoprotein (HDL)).

[0157] In certain embodiments, the present invention provides a method for reducing ASGR1 expression in a patient in need, comprising administering one of the RNAi constructs described herein to the patient. As used herein, the term “patient” refers to a mammal, including humans, and can be used interchangeably with the term “subject.” Preferably, the expression level of ASGR1 in the patient’s hepatocytes is reduced after administration of the RNAi construct compared to the expression level of ASGR1 in a patient who has not received the RNAi construct.

[0158] In some embodiments, the patients who need to reduce ASGR1 expression are patients at risk of having a myocardial infarction. Patients at risk of having a myocardial infarction can be patients with a history of myocardial infarction (e.g., who have previously suffered from myocardial infarction). Patients at risk of having a myocardial infarction can also be patients with a familial history of myocardial infarction or patients having one or more risk factors for myocardial infarction. Such risk factors include, but are not limited to, hypertension, elevated levels of non-HDL cholesterol, elevated levels of triglycerides, diabetes, obesity or a history of autoimmune diseases (e.g., rheumatoid arthritis, lupus). In one embodiment, the patients at risk of having a myocardial infarction are patients having or diagnosed with coronary artery disease. The risk of myocardial infarction in these and other patients can be reduced by administering to the patient any of the RNAi constructs described herein. Thus, the present invention provides a method for reducing the risk of myocardial infarction in a patient who needs it, which comprises administering to the patient an RNAi construct described herein. In some embodiments, the present invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for reducing the risk of myocardial infarction in a patient who needs it. In other embodiments, the present invention provides an RNAi construct targeting ASGR1 for use in a method for reducing the risk of myocardial infarction in a patient who needs it.

[0159] In certain embodiments, patients requiring reduction of ASGR1 expression are those diagnosed with or at risk of cardiovascular disease. Therefore, the present invention includes methods for treating or preventing cardiovascular disease in patients in need by administering any of the RNAi constructs of the present invention. In some embodiments, the present invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for treating or preventing cardiovascular disease in patients in need. In other embodiments, the present invention provides an RNAi construct that targets ASGR1 for use in methods for treating or preventing cardiovascular disease in patients in need. Cardiovascular disease includes myocardial infarction, heart failure, stroke (ischemic and hemorrhagic), atherosclerosis, coronary artery disease, peripheral vascular disease (e.g., peripheral artery disease), and fragility plaque. In some embodiments, the cardiovascular disease treated or prevented according to the methods of the present invention is coronary artery disease. In other embodiments, the cardiovascular disease treated or prevented according to the methods of the present invention is myocardial infarction. In certain embodiments, administration of the RNAi construct described herein reduces the risk of cardiovascular events in patients with non-fatal myocardial infarction, fatal and non-fatal stroke, certain types of cardiac surgery (e.g., angioplasty, bypass), hospitalization for heart failure, chest pain in patients with heart disease, and / or certain heart conditions (e.g., history of myocardial infarction, history of cardiac surgery, and / or chest pain with signs of arterial occlusion). In some embodiments, administration of the RNAi construct described herein according to the method of the present invention can be used to reduce the risk of recurrent cardiovascular events.

[0160] In certain other embodiments, the patients who require reduction of ASGR1 expression are patients having elevated levels of non-HDL cholesterol. Thus, in some embodiments, the invention provides a method for effecting reduction of non-HDL cholesterol in a patient who needs it, by administering to the patient any of the RNAi constructs described herein. In some embodiments, the invention includes the use of any of the RNAi constructs described herein in the preparation of a medicament for effecting reduction of non-HDL cholesterol in a patient who needs it. In other embodiments, the invention provides an RNAi construct that targets ASGR1 for use in a method for effecting reduction of non-HDL cholesterol in a patient who needs it. Non-HDL cholesterol is a measure of all cholesterol-containing atherogenic lipoproteins, including LDL cholesterol, very low density lipoproteins, intermediate density lipoproteins, lipoprotein (a), chylomicrons, and chylomicron remnants. Non-HDL cholesterol has been reported to be an excellent predictor of cardiovascular risk (Rana et al., Curr. Atheroscler. Rep., Vol. 14:130-134, 2012). Non-HDL cholesterol levels can be calculated by subtracting HDL cholesterol levels from total cholesterol levels. In one embodiment, the patient's LDL cholesterol level is reduced after administration of the RNAi construct. In another embodiment, the patient's lipoprotein (a) level is reduced after administration of the RNAi construct.

[0161] In some embodiments, the patient treated according to the method of the present invention is a patient having elevated levels of non-HDL cholesterol (e.g., elevated serum levels of non-HDL cholesterol). Ideally, the level of non-HDL cholesterol should be about 30 mg / dL above the target value of LDL cholesterol for any given patient. In certain embodiments, a patient is administered the RNAi construct of the present invention if the patient has a non-HDL cholesterol level of about 130 mg / dL or higher. In one embodiment, a patient is administered the RNAi construct of the present invention if the patient has a non-HDL cholesterol level of about 160 mg / dL or higher. In another embodiment, a patient is administered the RNAi construct of the present invention if the patient has a non-HDL cholesterol level of about 190 mg / dL or higher. In yet another embodiment, a patient is administered the RNAi construct of the present invention if the patient has a non-HDL cholesterol level of about 220 mg / dL or higher. In certain embodiments, a patient is administered the RNAi construct of the present invention if the patient has a high or very high risk of cardiovascular disease according to the 2013 ACC / AHA guideline on the assessment of cardiovascular risk (Goff et al., ACC / AHA guideline on the assessment of cardiovascular risk: a report of the American College of Cardiology / American Heart Association Task Force on Practice Guidelines. Circulation. 2013;00:000-000) and has a non-HDL cholesterol level of approximately 100 mg / dL or higher.

[0162] In some embodiments of the method of the present invention, a patient is administered the RNAi construct described herein if the patient has a moderate to high risk of cardiovascular disease according to the 2013 ACC / AHA guidelines for assessing cardiovascular risk (hereinafter referred to as the "2013 Guidelines"). In certain embodiments, the RNAi construct of the present invention is administered to a patient if the patient's LDL cholesterol level is higher than about 160 mg / dL. In other embodiments, the RNAi construct of the present invention is administered to a patient if the patient's LDL cholesterol level is higher than about 130 mg / dL and the patient has a moderate risk of cardiovascular disease according to the 2013 Guidelines. In yet another embodiment, the RNAi construct of the present invention is administered to a patient if the patient's LDL cholesterol level is higher than 100 mg / dL and the patient has a very high risk of cardiovascular disease according to the 2013 Guidelines.

[0163] In certain embodiments, the patients treated according to the methods of the present invention are those with fragile plaques (also known as unstable plaques). Fragile plaques are accumulations of macrophages and lipids, primarily cholesterol, beneath the endothelial layer of the arterial wall. These fragile plaques can rupture, potentially leading to the formation of blood clots that can block blood flow through the artery, causing myocardial infarction or stroke. Fragile plaques can be identified by methods known in the art, including but not limited to intravascular ultrasound and computed tomography (Sahara et al., European Heart Journal, Vol.25:2026-2033, 2004; Budhoff, J.Am.Coll.Cardiol., Vol.48:319-321, 2006; Hausleiter et al., J.Am.Coll.Cardiol., Vol.48:312-318, 2006).

[0164] In some embodiments of the method of the present invention, the RNAi construct is administered in combination with another therapeutic agent, such as a therapeutic agent for treating or preventing cardiovascular disease. In one embodiment, the RNAi construct of the present invention is administered alone or in combination with other agents useful for treating a condition the patient is suffering from. Examples of such agents include both proteinogenic and non-proteinogenic drugs. When multiple therapeutic agents are administered concurrently, the doses may be adjusted as appropriate, as is recognized in the relevant art. "Concurrent administration" and combination therapy include, but are not limited to, a treatment regime in which the RNAi construct of the present invention is administered at least once in a course of treatment that includes the administration of at least one other therapeutic agent to the patient. In certain embodiments, the RNAi construct of the present invention is administered before the administration of at least one other therapeutic agent. In other embodiments, the RNAi construct of the present invention is administered concurrently with the administration of at least one other therapeutic agent. In some embodiments, the RNAi construct of the present invention is administered after the administration of at least one other therapeutic agent.

[0165] In certain embodiments of the method of the present invention, the RNAi construct is administered to the patient in combination with a PCSK9 antagonist such as an anti-hPCSK9 antibody (e.g., Repatha® (evolocumab)). In another embodiment, the RNAi construct of the present invention is administered to the patient in combination with at least one other cholesterol-reducing (serum and / or systemic cholesterol) agent. In some embodiments, agents that increase LDLR expression have been observed to increase serum HDL levels, decrease LDL levels, or decrease triglyceride levels. Exemplary drugs include, but are not limited to, statins (e.g., atorvastatin, cerivastatin, fluvastatin, lovastatin, mevastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin), nicotinic acid (niacin) (NIACOR, NIASPAN (sustained-release niacin), SLO-NIACIN (sustained-release niacin)); fibrinic acid (LOPID (gemfibrozil), TRICOR (fenofibrate)); bile acid scavengers (QUESTRAN (cholestyramine), coleseveram (WELCHOL), COLESTID (cholestipol)); cholesterol absorption inhibitors (ZETIA (ezetimibe)); combinations of nicotinic acid and statins (ADVICOR (LOVASTATIN and NIASPAN)); combinations of statins and absorption inhibitors (VYTORIN (ZOCOR and ZETIA)); and / or lipid modifiers.

[0166] In some embodiments, the RNAi constructs of the present invention are combined with PPAR gamma agonists, PPAR alpha / gamma agonists, squalene synthase inhibitors, CETP inhibitors, antihypertensive drugs, antidiabetic agents (such as sulfonylurea, insulin, GLP-1 analogs, and DDPIV inhibitors), ApoB modulators, MTP inhibitors, and / or treatments for obstructive arteriosclerosis. In certain embodiments, the RNAi constructs of the present invention are combined with agents that increase the level of LDL receptor (LDLR) protein in patients, such as statins, certain cytokines like oncostatin M, estrogens, and / or certain herbal ingredients like berberine.

[0167] In some embodiments, the RNAi construct of the present invention is used to increase serum cholesterol levels in patients with certain antipsychotic agents. The RNAi construct is combined with certain HIV protease inhibitors, dietary factors such as high fructose, sucrose, cholesterol, or certain fatty acids, and certain nuclear receptor agonists and antagonists for RXR, RAR, LXR, and FXR. In certain embodiments, the RNAi construct of the present invention is combined with agents that increase the level of PCSK9 protein in a subject, such as statins and / or insulin. Administration of the RNAi construct in such embodiments may allow the RNAi construct to mitigate undesirable side effects of these other agents, such as increased serum non-HDL cholesterol.

[0168] It is understood that all ribonucleic acid sequences disclosed herein can be converted to deoxyribonucleic acid sequences by substituting uracil bases with thymine bases in the sequence. Similarly, all deoxyribonucleic acid sequences disclosed herein can be converted to ribonucleic acid sequences by substituting thymine bases with uracil bases in the sequence. Sequences containing deoxyribonucleic acid sequences, ribonucleic acid sequences, and mixtures of deoxyribonucleotides and ribonucleotides of all sequences disclosed herein are included in the present invention.

[0169] In addition, any nucleic acid sequences disclosed herein may be modified by any combination of chemical modifications. Those skilled in the art will readily understand that, in certain cases, such designations of “RNA” or “DNA” for describing modified polynucleotides are optional. For example, a polynucleotide comprising a nucleotide having a 2'-OH substituent on a ribose sugar and a thymine base may be described as a DNA molecule having a modified sugar (2'-OH for the natural 2'-H of DNA) or an RNA molecule having a modified base (thymine (methylated uracil) for the natural uracil of RNA).

[0170] Therefore, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and / or DNA, including but not limited to those containing modified nucleic acid bases. As a further example, but not limited to, polynucleotides having the sequence "ATCGATCG" include, but not limited to, any polynucleotides having such sequences, including, but not limited to, polynucleotides having RNA bases, whether modified or unmodified, e.g., the sequence "AUCGAUCG", as well as several DNA bases and RNA bases such as "AUCGATCG", as well as polynucleotides having other modified bases such as "ATmeCGAUCG", where meC represents a cytosine base with a methyl group at position 5.

[0171] The following examples, including the experiments conducted and the results achieved, are provided for illustrative purposes only and should not be construed as limiting the scope of the appended claims. [Examples]

[0172] Example 1. Selection and design of ASGR1 siRNA sequence The identification and selection of optimal sequences for therapeutic siRNA molecules targeting human asialoglycoprotein receptor 1 (ASGR1) proceeded in two stages. Candidate sequences to be included in the first stage screening set were identified using bioinformatics analysis of two alternatively spliced ​​transcripts of human ASGR1: transcript variant 1 encoding the longer isoform A (NCBI reference sequence number NM_001671.4; see Figure 1A) and transcript variant 2 encoding the shorter isoform B (NCBI reference sequence number NM_001197216.2; see Figure 1B). The two human ASGR1 transcript sequences were analyzed using an in-house developed siRNA design algorithm to identify 19-nucleotide sequences with specific base content at specific sites or regions within the 19-nucleotide sequence. The sequences were also evaluated for identity with the ASGR1 sequence in mouse (NCBI reference number NM_009714.2; see Figure 2), rat (Figure 3), and cynomolgus monkey (NCBI reference number XM_005582698.1; see Figure 4). The 19-nucleotide sequences were also evaluated for sequence identity with other human gene sequences and overlap with known single-nucleotide polymorphisms to predict off-target effects. Based on the results of bioinformatics analysis, 211 sequences were included in the first-stage screening set. UU dinucleotides were appended to the 3' ends of selected 19-nucleotide sense and antisense sequences to generate siRNA molecules with a 19-base pair double-stranded region and 2-nucleotide overhangs at the 3' ends of both strands.

[0173] The second stage of siRNA sequence selection aimed to identify additional active siRNAs that target human ASGR1 mRNA that might have been excluded as a result of bioinformatics analysis. All overlapping 19-base sequences from human ASGR1 transcript variants 1 and 2 (NCBI reference sequence numbers NM_001671.4 and NM_001197216.2; see Figures 1A and 1B) were extracted, and reverse complementary antisense sequences were designed. 1284 sequences that were not included in the first stage were included as part of the second stage sequences. Similar to the first stage sequences, the second stage sequences were converted to 21 bases in length by adding UU dinucleotides to the 3' ends of the sense and antisense strands to generate siRNA molecules with a 19-base pair double-stranded region and 2-nucleotide overhangs at each 3' end. The second stage also included 55 sequences identified in the first stage for resynthesis and testing. The combined screening set of the first and second stages included 1495 19-base sequences spanning the entire mRNA transcript of human ASGR1. The sense and antisense sequences of the siRNA molecules included both the first and second stage screening sets as well as 8 additional siRNA molecules targeting the terminal regions of the transcript, which are shown in Table 1 below. Each site of the human ASGR1 transcript targeted by each of the siRNA molecules is also listed in Table 1.

[0174]

Table 1

[0175]

Table 2

[0176]

Table 3

[0177]

Table 4

[0178] Table 5

[0179] Table 6

[0180] Table 7

[0181] Table 8

[0182] Table 9

[0183] Table 10

[0184] Table 11

[0185] Table 12

[0186] Table 13

[0187] Table 14

[0188] Table 15

[0189] Table 16

[0190] Table 17

[0191] Table 18

[0192] Table 19

[0193] Table 20

[0194] Table 21

[0195] Table 22

[0196] Table 23

[0197] Table 24

[0198] Table 25

[0199] Table 26

[0200] Table 27

[0201] Table 28

[0202] Table 29

[0203] Table 30

[0204] Table 31

[0205] Table 32

[0206] Table 33

[0207] Table 34

[0208] Table 35

[0209] Table 36

[0210] Table 37

[0211] Table 38

[0212] Table 39

[0213] Table 40

[0214] Table 41

[0215] Table 42

[0216] Table 43

[0217] Table 44

[0218] Table 45

[0219] [Table 46]

[0220] [Table 47]

[0221] [Table 48]

[0222] [Table 49]

[0223] Example 2. In vitro efficacy of the ASGR1 siRNA molecule siRNA molecules in the first and second stage screening sets were synthesized without chemical modification. Each siRNA molecule consisted of a 21-nucleotide sense strand and a 21-nucleotide antisense strand that hybridized to form a 19-base-pair double-stranded region with a 2-nucleotide overhang at the 3' end of each strand. The efficacy of each siRNA molecule in reducing ASGR1 expression was evaluated using a 384-well in vitroimunoassay to quantify the level of ASGR1 protein on the cell surface of Hep3B or HepG2 cells.

[0224] Transfection conjugates of siRNA molecules in EMEM medium (ATCC 30-2003) and RNAiMax transfection reagent (Life Technologies) were prepared in 384-well plates according to the manufacturer's recommendations. Human hepatocellular carcinoma Hep3B (ATCC HB-8064) or HepG2 (ATCC HB-8065) ​​cells were added to each well in EMEM medium supplemented with 10% fetal bovine serum and 1% antibiotic / antifungal agent. Cells were incubated at 37°C and 5% CO2 for 4 days. Four days after siRNA transfection, cells were fixed with formaldehyde to block bovine serum albumin, followed by staining with anti-ASGR1 primary antibody (Amgen clone 7E11, light and heavy chain sequences provided below (SEQ ID NOs. 3 and 4)) at room temperature for 1 hour or overnight at 4°C. Plates were washed three times with phosphate-buffered saline (PBS). Next, the cells were incubated in a dark room at room temperature for 45 minutes with Alexa488 conjugate anti-human IgG secondary antibody and the nuclear staining reagent DRAQ5 (ThermoFisher #62251), which was included to evaluate cell count. After three washes with PBS, the plates were imaged using 488 and 640 channels with an Opera Phenix high-content screening system (PerkinElmer) to measure anti-ASGR1 antibody staining and nuclear staining, respectively. The data were analyzed using Columbus image analysis software and GeneData Screener software to quantify ASGR1 protein levels, cell count, and several cell morphological measurements on a per-cell and per-well basis. Light chain amino acid sequence of the anti-ASGR1 primary antibody: [ka] Anti-ASGR1 primary antibody heavy chain amino acid sequence: [ka]

[0225] The activity of each siRNA molecule was measured using "normalized Alexa 488 mean intensity" readings, which quantify ASGR1 protein expression based on an analysis of the cell population relative to ASGR1 expression in a control cell population. Cells transfected with untargeted siRNA double helix (i.e., siRNA that does not have 100% sequence matching to any human gene sequence) were used as controls in each plate, and a "central reference value" was calculated from these control cells. Specifically, the "central reference value" was the median of Alexa 488 intensities across multiple wells containing cells transfected with untargeted siRNA. The "normalized Alexa 488 mean intensity" was calculated for each well as follows: The nucleus and cytoplasm were separated using DRAQ5 counterstaining. The mean Alexa 488 fluorescence intensity was measured for each cell (i.e., the entire cell region including cytoplasm and nucleus). The average Alexa 488 intensity value for each well was generated by averaging the values ​​of individual cells. Next, this average intensity value was normalized relative to a central reference value to obtain a "normalized Alexa 488 average intensity," which represents the measured ASGR1 expression as a percentage of the control. Therefore, a negative "normalized Alexa 488 average intensity" value represents reduced ASGR1 expression compared to control cells. The cell number evaluated by DRAQ5 staining was also normalized relative to the number of control cells, and therefore represents the measured cell viability as a percentage of the control.

[0226] The first-stage siRNA molecules were dual-tested at three different concentrations (0.3 nM, 1.25 nM, and 5 nM) in in vitro siRNA no assays in both Hep3B and HepG2 cells. For each siRNA molecule, the reduction in ASGR1 cell surface expression compared to cells transfected with untargeted siRNA in Hep3B cells is shown in Table 2 below. Cell number measurements are also provided. For clarity, data for the lowest concentration (0.3 nM) and data for HepG2 cells are not shown. The data shown in Table 2 are results from two independent transfections of each siRNA (e.g., Act 1 and Act 2).

[0227] [Table 50]

[0228] [Table 51]

[0229] [Table 52]

[0230] [Table 53]

[0231] [Table 54]

[0232] [Table 55]

[0233] [Table 56]

[0234] Of the 211 unmodified siRNA molecules selected in the first stage, at a concentration of 5 nM, approximately 168 siRNA molecules reduced ASGR1 cell surface expression by at least 30% compared to control cells, approximately 119 siRNA molecules reduced ASGR1 cell surface expression by at least 50% compared to control cells, and approximately 30 siRNA molecules reduced ASGR1 cell surface expression by at least 60% compared to control cells. Some siRNA molecules showed no reduction in ASGR1 cell surface expression compared to control cells, or only a slight reduction.

[0235] A subset of siRNA molecules derived from the initial selection of molecules in the first stage were selected for further testing in a 10-point dose-response configuration (0.004 nM to 83 nM) in an in vitro anti-ASGR1 immunoassay in Hep3B cells. The IC50 values ​​for each of these 55 siRNA molecules were calculated from the dose-response curves and are shown in Table 3 below. Data from two independent transfections (implementation 1 and implementation 2) for each siRNA molecule are shown. At least 18 of these siRNA molecules had an IC50 value of approximately 0.30 nM or less. Compounds D-1983, D-1098, D-1438, D-1246, and D-1494 were among the most potent, with an average IC50 value of less than 0.15 nM.

[0236] [Table 57]

[0237] All second-step siRNA molecules, with the exception of eight siRNA molecules that target the 5' and 3' ends of the human ASGR1 transcript, were tested in an in vitro anti-ASGR1 immunoassay in Hep3B cells at two different concentrations (1.25 nM and 5 nM). For each siRNA molecule, the reduction in ASGR1 cell surface expression compared to that in Hep3B cells transfected with untargeted siRNAs is shown in Table 4 below. Cell number measurements are also provided.

[0238] [Table 58]

[0239] [Table 59]

[0240] [Table 60]

[0241] Table 61

[0242] Table 62

[0243] Table 63

[0244] Table 64

[0245] Table 65

[0246] Table 66

[0247] Table 67

[0248] Table 68

[0249] Table 69

[0250] Table 70

[0251] Table 71

[0252] [Table 72]

[0253] [Table 73]

[0254] [Table 74]

[0255] [Table 75]

[0256] [Table 76]

[0257] Results from the second-stage molecular screening assay revealed 663 additional potent siRNA molecules that, when tested at 5 nM, reduced ASGR1 cell surface expression by at least 50% compared to control cells. These siRNA molecules were not included in the first stage and were not identified by bioinformatics analysis of transcript sequences. When tested at 5 nM, at least 263 of these novel siRNA molecules reduced ASGR1 cell surface expression by at least 70% compared to control cells, and at least 14 siRNA molecules reduced ASGR1 cell surface expression by at least 80% compared to control cells.

[0258] Example 3. Efficacy of selected ASGR1 siRNA molecule in RNA FISH assay. To evaluate the efficacy of subgroups of ASGR1 siRNA molecules that reduce ASGR1 expression at the mRNA level, the IC50 values ​​were determined for each siRNA in a fluorescence in-situ hybridization (FISH) assay of ASGR1 RNA. Hep3B cells (ATCC HB-8064) were transfected with siRNA using lipofectamine RNAiMax transfection reagent (ThermoFisher Scientific 13378-150) at a rate of 0.035 μL / reaction. Human ASGR1 siRNA was tested in 10 dose-response configurations ranging from 0 to 83.3 nM at 3-fold dilutions. Control siRNAs were tested at a final concentration of 5 nM and included: neutral control (used for normalization): untargeted RcsC2 (UUACAUCGUUAAUGCGUUA (SEQ ID NO: 4316)), inhibitor-positive control: human ASGR1 (ACUUCACAGCGAGCACGGA (SEQ ID NO: 4317)), and transfection control: human EIF4A3 (GCAUCUUGGUGAAACGUGA (SEQ ID NO: 4318)). Cells were seeded onto the transfection complex at a rate of 2000 cells per reaction in Perkin Elmer Cell Carrier PDL-coated 384-well assay plates (Perkin Elmer #6007580). The transfection time was 96 hours, after which cells were fixed with methanol-free formaldehyde at a final concentration of 4%. Immediately after fixation, Affymetrix QuantiGene View RNA was used. Cells were dehydrated in ethanol according to the cell dehydration protocol for storage or delivery in the manufacturer's protocol for the HC screening assay. The plates were sealed and stored at -20°C.

[0259] Cells were restored to their original water content according to the manufacturer's protocol and processed in the Affymetrix QuantiGene View RNA HC screening assay, an in-situ hybridization method that quantifies messenger RNA levels. In this example, a multiplex assay was used to detect human ASGR1 (NM_001671.4; SEQ ID NO: 1), human ASGR2 (NM_0080912.3 or NM_001181.4), and human PPIB (NM_000942.4). The assay was performed using the QG ViewRNA HC screening assay kit and the QG ViewRNA HC screening signal amplification kit (3plex) (Affymetrix QVP0011 and QVP0213, respectively) as well as probe sets for detecting human ASGR1, ASGR2, and PPIB (Affymetrix, VA6-19401-01, custom type 4 probe, VA1-10148-01, respectively). Each probe set was labeled with a different fluorophore. A protease for the digestion step was added at a final concentration of 1:8000. After the assay, the nucleus and cytoplasm were counterstained using Hoechst 33342 nuclear staining reagent and Cell Mask Blue reagent (ThermoFisher Scientific H3570 and H32720 at final concentrations of 10 ng / μL and 4 ng / μL, respectively). The plates were imaged on Perkin Elmer's Phenix, which read Hoechst and Cell Mask Blue on UV channels (PPIB / Type 1 for channel 488, ASGR2 / Type 4 for channel 550, and ASGR1 / Type 6 for channel 650). Image acquisition and data analysis were performed using Perkin Elmer's Columbus software package, and well normalization / IC50 value generation was performed using Geneda Screener.

[0260] The assay results are shown in Table 5. The IC50 values ​​determined by the RNA FISH assay correlate with those determined by the immunoassay for ASGR1 protein levels described in Example 2. However, at the time of testing, the IC50 values ​​determined by the RNA FISH assay were higher than those determined by the immunoassay.

[0261] [Table 77]

[0262] Example 4. Design and synthesis of modified ASGR1 siRNA molecules To improve the potency and in vivo stability of ASGR1 siRNA molecules, chemical modifications were incorporated into a subset of the most potent ASGR1 siRNA molecules from the first and second stages of sorting, including five of the most potent ASGR1 siRNA molecules from the first stage sorting that also had sequence homology to mouse Asgr1 mRNA and cynomolgus monkey ASGR1 mRNA. Specifically, 2'-O-methyl and 2'-fluoro modifications of ribose sugar were incorporated at specific positions within the ASGR1 siRNA. Phosphothioate nucleotide-nucleotide bonds were also incorporated at the ends of the antisense and / or sense sequences. Table 6 below shows the modifications in the sense and antisense sequences of each modified ASGR1 siRNA. The nucleotide sequences in Table 6 are listed according to the following notation. A, U, G, and C = corresponding ribonucleotides; dT = deoxythymidine; a, u, g, and c = corresponding 2'-O-methylribonucleotides; Af, Uf, Gf, and Cf = corresponding 2'-deoxy-2'-fluoro("2'-fluoro")ribonucleotides. The insertion of "s" in the sequence indicates that two adjacent nucleotides are joined by a phosphorothiodiester group (e.g., a phosphorothioate nucleotide interbonding). Unless otherwise specified, all other nucleotides are joined by a 3'-5' phosphodiester group. Each of the siRNA compounds in Table 6 contains a 19-base pair double-stranded region with a 2-nucleotide overhang at the 3' end of both strands.

[0263] Table 78

[0264] Table 79

[0265] Table 80

[0266] Table 81

[0267] Table 82

[0268] Table 83

[0269] Table 84

[0270] Table 85

[0271] Table 86

[0272] Table 87

[0273] [Table 88]

[0274] [Table 89]

[0275] [Table 90]

[0276] [Table 91]

[0277] [Table 92]

[0278] [Table 93]

[0279] [Table 94]

[0280] Chemically modified siRNA sequences were synthesized on a GE AKTA OligoPilot 100.

[0281] material: Acetonitrile (DNA synthesis grade, AXO152-2505, EMD) Capping reagent A (20% N-methylimidazole in acetonitrile, BI0224-0505, EMD, lot number 56090) Capping reagent B1 (20% acetic anhydride in acetonitrile, BI0347-0505, EMD, lot number 55015) Capping reagent B2 (30% 2,6-lutidine in acetonitrile, BI0349-0505, EMD, lot number 55176) Capping reagents B1 and B2 were mixed together in a 1:1 (v / v) ratio. Activator (0.3M benzylthiotetrazole (BTT) in acetonitrile, BI0166-1005, EMD lot number 55106, on molecular sieves) Detritylation reagent (3% dichloroacetic acid in toluene, BIO832-2505, EMD, lot number 55316) Oxidizing reagent (0.05 M iodine in 90:10 pyridine / water, BIO424-1005, EMD, lot number 54323) Diethylamine solution (20% DEA in acetonitrile, NC0017-0505, EMD, lot number 55202) Ammonium hydroxide (high concentration, JTBaker) thiolation reagent, 0.2M phenylacetyl disulfide (phenylacetic disulfide) (PADS, Aldrich) in 50:50 2-methylpyridine (picoline, Aldrich) / N-methylpyrrolidinone (NMP, Aldrich) Thymidine (Thermo Fisher Scientific), along with 2'-O-methyl and 2'-fluorophosphoramidites of adenosine, guanosine, cytosine, and uridine (Thermo Fisher Scientific), were prepared at 0.15 M in acetonitrile on approximately 10 mL of molecular sieve (JTBaker). Primer support 5G UnyLinker 350, lot number 10236161, 343 μmol / g, 0.60 g (206 μmol) or Primer support 5G amino with GalNAc clusters

[0282] Synthesis: The reagent solution, phosphoramidite solution, and solvent were connected to the instrument. The solid support was added to the column (6.3 mL), and the column was mounted to the instrument. The column was flushed with acetonitrile. Synthesis was initiated using Unicorn software. The phosphoramidite and reagent solution lines were purged. Synthesis was carried out by repeating the deprotection / coupling / oxidation / capping synthetic cycle. The 5'-dimethoxytrityl (DMT) protecting group was removed by adding the detritylation reagent to the solid support. The solid support was washed with acetonitrile. The phosphoramidite and activator solution were added to the support, and then recycled to bond the incoming nucleotides to the free 5'-hydroxyl groups. The support was washed with acetonitrile. The oxidizing or thiolation reagent was added to the support to convert the phosphite triester to phosphate triester or phosphorothioate. Any unreacted oligonucleotide chains were terminated by adding capping reagents A and B to the support. The support was washed with acetonitrile. After the final reaction cycle, the resin was washed with diethylamine solution to remove the 2-cyanoethyl protecting group. The support was then washed with acetonitrile.

[0283] Cutting: The synthesis column was removed from the synthesis apparatus and dried under vacuum for 20 minutes. The column was opened and the solid support was transferred to a 100 mL bottle. 40 mL of high-concentration ammonium hydroxide was added to the solid support. The cap was tightly attached to the bottle and the mixture was heated at 65°C overnight. The bottle was moved to the freezer and cooled in a hood for 20 minutes before opening. The mixture was filtered through a 60 mL frit glass funnel. The bottle and solid support were rinsed with 20 mL of 50:50 ethanol / water, then 40 mL of water.

[0284] Analysis and purification: A portion of the combined filtrate was analyzed and purified by anion exchange chromatography. The pooled fraction was desalted by size exclusion chromatography and analyzed by ion-pair reverse-phase HPLC. The pooled fraction was freeze-dried to obtain a white amorphous powder.

[0285] Analytical anion exchange chromatography (AEX): Column: Thermo DNAPac PA200RS (4.6 × 50 mm, 4 μm) Equipment: Agilent 1100 HPLC Buffer A: 20 mM sodium phosphate, 10% acetonitrile, pH 8.5 Buffer B: 20 ​​mM sodium phosphate, 10% acetonitrile, pH 8.5, 1 M sodium bromide Flow rate: 1 mL / min at 40°C Gradient: 20-65% B over 6.2 minutes

[0286] Preparative anion exchange chromatography (AEX): Column: Tosoh TSK Gel SuperQ-5PW, 21 x 150 mm, 13 μm Equipment: Agilent 1200 HPLC Buffer A: 20 mM sodium phosphate, 10% acetonitrile, pH 8.5 Buffer B: 20 ​​mM sodium phosphate, 10% acetonitrile, pH 8.5, 1 M sodium bromide Flow rate: 8mL / min Injection volume: 5mL Gradient: 35-55% over 20 minutes

[0287] Preparative size exclusion chromatography (SEC): Column: GE Hi-Prep 26 / 10 Equipment: GE AKTA Pure Buffer solution: 20% ethanol aqueous solution Flow rate: 10mL / min Injection volume: 15 mL using a sample load pump

[0288] Ion-pair reversed-phase (IP-RP) HPLC: Column: Water Xbridge BEH OST C18, 2.5 μm, 2.1 × 50 mm Equipment: Agilent 1100 HPLC Buffer A: 15.7 mM DIEA and 50 mM HFIP in water Buffer B: 15.7 mM DIEA and 50 mM HFIP in 50:50 water / acetonitrile Flow rate: 0.5mL / min Gradient: 10-30% over 6 minutes

[0289] annealing: Small amounts of sense and antisense strands were weighed into individual vials. siRNA reconstitution buffer (Qiagen) was added to the vials to a concentration of approximately 2 mM based on dry weight. The actual sample concentration was measured on a NanoDrop One (ssDNA, extinction coefficient = 33 μg / OD260). The two strands were then mixed in equimolar ratios, and the sample was heated in a 90°C water bath for 3 minutes and slowly cooled to room temperature. The sample was analyzed by AEX. RNA double helixes were observed to have longer retention times by analytical AEX than single helixes. The double helixes were registered and subjected to in vitro (see the method described in Examples 2 and 3) and in vivo (see the method described in Example 6) studies.

[0290] Example 5. Synthesis of GalNAc-containing ligand This embodiment describes the synthesis of a tetravalent GalNAc moiety that can be conjugated to a double-stranded RNA molecule in the RNAi construct of the present invention to promote the delivery and uptake of the RNAi construct by the liver (e.g., hepatocytes). The synthesis scheme is shown in Figure 5.

[0291] Resin-bonded quaternary GalNAc Step 1: (S)-4-(2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(trityloxy)propoxy)-4-oxobutanoic acid (1) [ka] (R)-(9H-fluoren-9-yl)methyl(1-hydroxy-3-(trityloxy)propan-2-yl)carbamate (20 g, 36.0 mmol), succinic anhydride (7.20 g, 72 mmol), polystyrene-supported DMAP (3 mmol / g, 24 g, 72 mmol), and triethylamine (10 mL, 72 mmol) were dissolved in DCM (720 mL). The suspension was stirred at room temperature for 16 hours. The reaction was filtered through Celite (to remove PS-dmap), and the filtrate was rinsed with DCM (200 mL). The combined filtrate was extracted with saturated NaCl aqueous solution (3 × 100 mL). The organic layer was dried over sodium sulfate and concentrated to obtain the crude title compound (23.6 g, 36.0 mmol, 100% yield) for use in the next step without further purification. MS m / z 678.2 (M+Na).

[0292] Step 2: [ka] Active hemysuccinic acid was prepared in a 50 mL conical tube as follows: (S)-4-(2-((((9H-fluoren-9-yl)methoxy)carbonyl)amino)-3-(trityloxy)propoxy)-4-oxobutanoic acid (0.5 g, 0.763 mmol) and TATU (344 mg, 1.07 mmol) were dissolved in 5 mL of DMF, and the tube was swirled for 3 minutes. Huenig base (0.400 mL, 2.29 mmol) was added. Meanwhile, resin (GE Lifesciences Primer Support 5G Amino, 0.46 mmol / g, 1.66 g, 0.763 mmol) was swollen in a 50 mL Falcon tube containing 10 mL of DMF. The active hemysuccinic acid solution was added. The tube was gently shaken at 400 rpm at room temperature. The reaction mixture was filtered, then rinsed with DCM (50 mL), 10% MeOH-DCM (50 mL), and DCM (50 mL), and dried under vacuum. The resin was capped by adding a solution of acetic anhydride (5.625 mL, 59 mmol), pyridine (16.65 mL), and triethylamine (0.225 mL), and shaken at 400 rpm for 2 hours at room temperature. The resin was filtered, rinsed with DCM (50 mL), 10% MeOH-DCM (50 mL), and DCM (50 mL), and dried under vacuum to obtain intermediate 2 (2.55 g, 0.255 mmol / g, 0.65 mmol), which was used directly in the next step.

[0293] Step 3: [ka] Intermediate 2 (2.55 g, 0.65 mmol) was suspended in a 20% 4-methylpiperidine solution in DMF (15 mL) and stirred for 5 minutes. The solution was drained, and this process was repeated two more times to obtain a deprotected intermediate. An active solution of Fmoc-protected 6-aminohexanoic acid was prepared by dissolving Fmoc-protected 6-aminohexanoic acid (1.41 g, 4.0 mmol) and TATU (1.288 g, 4.0 mmol) in DMF (10 mL). After 5 minutes, Hünig base (1.05 mL, 6.05 mmol) was added. This solution was added to the deprotected resin. The mixture was shaken overnight at 400 rpm at room temperature. The reaction was filtered, and the resin was washed with DMF (3 × 30 mL). The same procedure (deprotection, preparation of active acid, and coupling) was repeated to obtain crude intermediate 3 (2.40 g, 0.184 mmol / g, 0.442 mmol), which was used in the next step.

[0294] Step 4: [ka] Intermediate 3 was suspended in a 20% 4-methylpiperidine solution in DMF (15 mL) and stirred for 5 minutes. The solution was drained, and this process was repeated two more times to obtain a deprotected intermediate. An active solution of bis-Fmoc protected lysine was prepared by dissolving bis-Fmoc protected lysine (2.07 g, 3.5 mmol) and TATU (1.13 g, 3.5 mmol) in DMF (10 mL) and stirring for 5 minutes. Hünig base (0.96 mL, 5.5 mmol) was added. This solution was added to the deprotected resin. The suspension was shaken overnight at 400 rpm at room temperature. The reaction mixture was filtered, and the resin was subsequently washed with DMF (3 × 30 mL). The resin was deprotected using the procedure described above. An active solution of bis-Fmoc-protected lysine was prepared as described above, except that the amount of bis-Fmoc-protected lysine was 2.96 g (5.0 mmol), the amount of TATU was 1.61 g (5.0 mmol), and the amount of Hünig base was 1.31 mL (7.5 mmol). The deprotected resin was bound to the active acid by shaking overnight at 400 rpm at room temperature. The resin was washed with DMF (3 × 30 mL), followed by DCM (3 × 30 mL), and dried to obtain crude intermediate 4 (2.28 g, 0.165 mmol / g, 0.376 mmol).

[0295] Step 5: [ka] Intermediate 4 (0.4 mmol) was suspended in a 20% 4-methylpiperidine solution in DMF (25 mL) and stirred for 5 minutes. The solution was drained, and this process was repeated once more to obtain a deprotected intermediate. TATU (1.92 g, 6.0 mmol) was added to a solution of 5-(((2R,3R,4R,5R,6R)-3-acetamido-4,5-diacetoxy-6-(acetoxymethyl)tetrahydro-2H-pyran-2-yl)oxy)pentanoic acid (5, 2.68 g, 6 mmol) in DMF (20 mL), and the solution was stirred for 5 minutes. Hünig base (1.57 mL, 9.0 mmol) was added to this solution, and the mixture was then added to the deprotected intermediate. The suspension was left at room temperature overnight, and the solvent was drained. The resin was washed with DMF (3 × 30 mL) and DCM (3 × 30 mL). The resin was treated with 3% dichloroacetic acid in Tol along with 5% TIPS (25 mL), and the solvent was drained after 5 minutes. This treatment was repeated two more times to obtain intermediate 6, which was used directly in the next step (e.g., the conjugation reaction to the 5' or 3' end of the sense strand of the RNAi construct of the present invention).

[0296] The effectiveness of single chemically modified ASGR1 siRNA or chemically modified ASGR1 siRNA conjugated to the GalNAc moiety in reducing ASGR1 expression was evaluated using the in vitro chromoassay described in Example 2, the RNA FISH assay described in Example 3, or the in vivo mouse model described in Example 6.

[0297] Example 6. In vivo efficacy of the ASGR1 siRNA molecule To evaluate the efficacy of chemically modified ASGR1 siRNA molecules for reducing ASGR1 hepatic expression in vivo, modified ASGR1 siRNA molecules (conjugated with Invivofectamine® reagent) or GalNAc-siRNA conjugates are administered intravenously or subcutaneously to C57BL / 6J mice. Specifically, mice are injected with 1–5 mg / kg body weight in 0.25 ml of buffer, the indicated siRNA, and the corresponding control siRNA on day 0. Animals are harvested on days 2, 4, and 7 for further analysis. Total RNA from the livers of the harvested animals is processed for qPCR analysis. The efficacy of ASGR1 siRNA is evaluated by comparing the amounts of Asgr1 mRNA and ASGR1 protein in the liver tissue of siRNA-treated animals with the amounts of Asgr1 mRNA and ASGR1 protein in the liver tissue of animals injected with the buffer or control siRNA.

[0298] Serum levels of alkaline phosphatase and LDL cholesterol can also be measured in mice at various time points after injection of the ASGR1 siRNA molecule or the corresponding control to evaluate the in vivo efficacy of the ASGR1 siRNA molecule. Elevated serum alkaline phosphatase levels correlate with decreased serum levels of non-HDL cholesterol and a reduced risk of coronary artery disease (Nioi et al., New England). Journal of Medicine, Vol.374(22):2131-2141, 2016 (the entire article is incorporated herein by reference). Therefore, serum alkaline phosphatase levels can be used as an alternative biomarker for the effectiveness of specific ASGR1 siRNAs in reducing serum non-HDL cholesterol levels or the risk of coronary artery disease. Effective ASGR1 siRNA molecules result in decreased serum non-HDL cholesterol (e.g., LDL cholesterol) levels or elevated serum alkaline phosphatase levels in treated animals compared to levels in animals injected with buffer or control siRNA.

[0299] Example 7. In vitro efficacy of chemically modified ASGR1 siRNA molecules The selected chemically modified siRNA molecules listed in Table 6 were conjugated to the three-branched GalNAc moiety shown in formula VII of the structure reproduced below. The GalNAc moiety was conjugated to the 3' end of the sense strand of each double helix via a phosphodiester bond. [ka]

[0300] GalNAc-siRNA conjugates were evaluated for their ability to inhibit ASGR1 expression in a transfection assay of Hep3B cells and a free uptake assay of human ASGR1 CHO cells. The Hep3B cell transfection immunoassay is described in Example 2 above. A free uptake assay using Chinese hamster ovary (CHO) cells that stably express human ASGR1 was performed as follows: GalNAc conjugate siRNA molecules were prepared in F-12K medium (Corning Cellgro #10-025-CV) in a 384-well plate. Human ASGR1-stable expressing CHO cells in F-12K medium supplemented with 10% fetal bovine serum and 1% antibiotic / antifungal agent were added to each well. The cells were incubated at 37°C and 5% CO2 for 4 days. Four days after siRNA delivery, cells were fixed in formaldehyde to block bovine serum albumin, followed by staining with anti-ASGR1 primary antibody (Amgen clone 7E11, light and heavy chains provided in SEQ ID NOs. 3 and 4, respectively) at room temperature for 1 hour or overnight at 4°C. The plates were washed three times with phosphate-buffered saline (PBS). Subsequently, the cells were incubated in a dark room at room temperature for 45 minutes with Alexa488 conjugate anti-human IgG secondary antibody and nuclear staining reagent Hoechst33342 (Invitrogen #H3570) to assess cell count. After three washes with PBS, the plates were imaged on an Opera Phenix high-content screening system (PerkinElmer) using excitation / emission filter settings of 488 / 500-550 and 375 / 435-480 to measure anti-ASGR1 antibody staining and nuclear staining, respectively. The data was analyzed using Columbus image analysis software and GeneData Screener software to quantify several measurements of ASGR1 protein levels, cell number, and cell morphology at the cell-by-cell and well-by-well level.

[0301] GalNAc-siRNA conjugates were tested in each assay at 22 different doses ranging from 0.000012 to 25 μM, and dose-response curves were constructed. IC50 values ​​and maximum antagonist activity (relative to control cells; a maximum antagonist activity of -1.0 represents complete inhibition) were calculated from the dose-response curves. The assay results are shown in Table 7 below.

[0302] [Table 95]

[0303] [Table 96]

[0304] [Table 97]

[0305] When transfected into Hep3B cells, several GalNAc-siRNA conjugates knocked down ASGR1 expression by over 80%. In particular, GalNAc-siRNA conjugates targeting nucleotides 692–710 of human ASGR1 transcript variant 1 (NM_001671.4; SEQ ID NO. 1) with various chemical modification patterns (e.g., double-strand Nos. 3026, 3037, 3051, 3053, and 3057) showed low nanomolar IC50 values ​​when transfected into Hep3B cells and demonstrated a maximum knockdown activity of approximately 50% in a free uptake assay of CHO cells. By modifying the GalNAc moiety in conjugates to other tribranched GalNAc structures described herein (e.g., formula XVI), the performance of GalNAc-siRNA conjugates in free uptake assays was improved (data not shown).

[0306] Example 8. Further design and efficacy of GalNAc-ASGR1 siRNA molecules Further GalNAc-ASGR1 siRNA conjugates were constructed with various patterns of chemical modification, different sequences, and different GalNAc moieties. Table 8 below lists the modifications in the sense and antisense sequences, as well as the structure and conjugation site of the GalNAc moiety for each GalNAc-ASGR1 siRNA conjugate. The nucleotide sequences in Table 8 are listed according to the following notation: A, U, G, and C = corresponding ribonucleotide; dT, dA, dG, and dC = corresponding deoxyribonucleotide; a, u, g, and c = corresponding 2'-O-methylribonucleotide; Af, Uf, Gf, and Cf = corresponding 2'-deoxy-2'-fluoro("2'-fluoro") ribonucleotide; Phos = terminal nucleotide has a monophosphate group at its 5' end; invAb = reverse debasalized nucleotide (i.e., a debasalized nucleotide (3'-3' bond) attached to an adjacent nucleotide via its 3' substituent). The insertion of "s" in the sequence indicates that two adjacent nucleotides are joined by a phosphorothiodiester group (e.g., a phosphorothioate nucleotide bond). Unless otherwise specified, all other nucleotides are joined by a 3'-5' phosphodiester group. The GalNAc structure is shown in the referenced formula, which is shown above.

[0307] [Table 98]

[0308] [Table 99]

[0309] [Table 100]

[0310] [Table 101]

[0311] Table 102

[0312] Table 103

[0313] Table 104

[0314] Table 105

[0315] Table 106

[0316] Table 107

[0317] Table 108

[0318] Table 109

[0319] Table 110

[0320] Table 111

[0321] [Table 112]

[0322] [Table 113]

[0323] [Table 114]

[0324] The efficacy of the GalNAc-siRNA conjugate in inhibiting ASGR1 expression was tested in a Hep3B cell transfection immunoassay (described in Example 2) and / or a human ASGR1 CHO cell free uptake immunoassay (described in Example 7). The assay results are shown in Table 9 below.

[0325] [Table 115]

[0326] [Table 116]

[0327] [Table 117]

[0328] [Table 118]

[0329] [Table 119]

[0330] [Table 120]

[0331] Several GalNAc-ASGR1 siRNA conjugates were further evaluated for their efficacy in knocking down ASGR1 mRNA levels in hepatocytes. Human primary hepatocytes (Xenotech / Sekisui donor lot number HC3-38) were thawed in OptiThaw medium (Xenotech catalog number K8000) according to the manufacturer's protocol. After centrifuging and aspirating the medium, the cells were resuspended in OptiPlate hepatocyte medium (Xenotech catalog number K8200) and seeded on 96-well collagen-coated plates (Greiner catalog number 655950). After 2–4 hours of incubation, the medium was removed and replaced with OptiCulture hepatocyte medium (Xenotech catalog number K8300). After 2–4 hours of OptiCulture medium addition, GalNAc-conjugated siRNA was delivered to the cells by free uptake (without transfection reagent). Cells were incubated at 37°C and 5% CO2 for 24–72 hours. Next, cells were lysed with Qiagen's RLT buffer (79216) with 1% 2-mercaptoethanol (Sigma, M-3148), and the lysates were stored at -20°C. RNA was purified using Qiagen's QIACube HT instrument (9001793) and Qiagen's RNeasy 96 QIACube HT kit (74171) according to the manufacturer's instructions. Samples were analyzed using the QIAxpert system (9002340).

[0332] cDNA was synthesized from RNA samples using Applied Biosystems' High Capacity cDNA Reverse Transcription Kit (4368813). The reaction was assembled according to the manufacturer's instructions, and the RNA concentration used varied depending on the sample. Reverse transcription was performed on a BioRad quad thermal cycler (model number PTC-0240G) under the following conditions: 10 minutes at 25°C, 120 minutes at 37°C, 5 minutes at 85°C, followed by (optional) retention at 4°C. Droplet digital PCR (ddPCR) was performed using a BioRad QX200 AutoDG droplet digital PCR system according to the manufacturer's instructions. Reactions were assembled on Eppendorf Clear 96-well PCR plates (951020303) using BioRad's probe ddPCR supermix (1863010), ordered with ASGR1 (IDT Hs.PT.56a.24725395, primer-to-probe ratio 3.6:1, 9 nanomoles each of forward and reverse primers (sequences listed below), and 2.5 nanomoles of 6-FAM / ZEN / IBFQ-labeled probe (probe listed below)) and GUSB (IDT Hs.PT.58v.27737538, primer-to-probe ratio 3.6:1, 9 nanomoles each of forward and reverse primers (sequences listed below), and 2.5 nanomoles of HEX / ZEN / IBFQ-labeled probe (probe listed below)) and RNase-free water (Ambion, AM9937). The final primer / probe concentrations were 900 nM / 250 nM, respectively, and the cDNA concentration varied between wells.

[0333] Droplets were formed using a BioRad Auto DG droplet generator (1864101) installed with consumables recommended by the manufacturer (BioRad DG32 cartridge 1864108, BioRad tip 864121, Eppendorf blue 96-well PCR plate 951020362, BioRad droplet generation oil for probes 1864110, and BioRad droplet plate assembly). Droplets were amplified on a BioRad C1000 touch thermal cycler (1851197) under the following conditions: enzyme activation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, followed by annealing / extension at 60°C for 1 minute, 40 cycles using a ramp rate of 2°C / second, enzyme deactivation at 98°C for 10 minutes, followed by (optional) holding at 4°C. Next, samples were read on a BioRad QX200 droplet reader to measure FAM / HEX signals correlated to either ASGR1 or GUSB concentration, respectively. The data were analyzed using BioRad's QuantaSoft software package. Samples were gated using channels (fluorescently labeled) to determine the concentration per sample. Each sample was then expressed as the ratio of the concentration of the target gene (ASGR1) to the concentration of the housekeeping gene (GUSB) relative to the control, for different sample loadings. The data were then imported into Geneda Screener, where each test siRNA was normalized to the median of the neutral control well (buffer only) and expressed as POC (percentage of control). IC50 and maximal activity are reported in Table 10 below. ddPCR assay sequence ASGR1: Primer 1: CAGGCTGGAGTGATCTTCA (SEQ ID NO: 4688) Primer 2: TTCAGCAACTTCACAGCGA (SEQ ID NO: 4689) Probe: 56-FAM / TCTTTCTTC (Sequence ID 4690) / ZEN / CCACATTGCCTCCCTG (Sequence ID 4691) / 3IABkFQ / GUSB: Primer 1: GTTTTGATCCAGACCCAGATG (SEQ ID NO: 4692) Primer 2: GCCCATTATTCAGAGCGAGTA (SEQ ID NO: 4693) Probe: 5HEX / TGCAGGGTT (SEQ ID NO: 4694) / ZEN / TCACCAGGATCCAC (SEQ ID NO: 4695) / 3IABkFQ /

[0334] [Table 121]

[0335] Most of the GalNAc-siRNA conjugates tested reduced ASGR1 mRNA levels in human primary hepatocytes, indicating efficient delivery of the conjugates to cells and activation of the siRNAs. Compounds D-3780, D-3782, D-3791, D-3795, and D-3800 were the most potent, exhibiting the highest maximal inhibitory activity of the conjugates evaluated in this assay. These compounds also showed potent inhibition of ASGR1 protein expression when transfected into Hep3B cells. See Table 9 for Hep3B transfection assay data.

[0336] Example 9. In vivo efficacy of GalNAc-ASGR1 siRNA conjugate To evaluate whether GalNAc-ASGR1 siRNA conjugates could efficiently inhibit ASGR1 expression in vivo, the conjugate that showed the highest inhibition in vitro as measured by ddPCR (Table 10) was administered to ASGR1 knockout mice expressing the human ASGR1 gene. ASGR1 knockout mice aged 10-12 weeks (The Jackson Laboratory) were administered 1 × 10⁶ doses of adeno-associated virus (AAV) encoding the human ASGR1 gene (AAV-hASGR1) per animal. 12The drugs were administered intravenously at genome copy (GC) doses. Two weeks after AAV-hASGR1 injection, mice received subcutaneous injections of either buffer or the indicated GalNAc-siRNA conjugates (compounds D-3752, D-3779, D-3780, D-3782, D-3784, D-3785, D-3788, D-3791, D-3795, D-3797, D-3799, D-3800, and D-3801) at a dose of 5 mg / kg body weight in 0.25 ml buffer (n=6 in each group). Eight days after compound administration, three animals from each treatment group were euthanized and collected for further analysis. The remaining three animals from each treatment group were collected fifteen days after compound administration. Serum and liver were collected from all animals. Human ASGR1 mRNA levels were assessed by processing total RNA isolated from animal livers for qPCR analysis. Serum levels of alkaline phosphatase (ALP) were measured using a clinical analyzer (AU400 chemical analyzer, Olympus). Elevated serum ALP levels have been reported to correlate with decreased serum levels of non-HDL cholesterol and a reduced risk of coronary artery disease (Nioi et al., New England Journal of Medicine, Vol.374(22):2131-2141, 2016), and therefore function as a useful biomarker.

[0337] As shown in Figure 6A, several GalNAc-siRNA conjugates reduced human ASGR1 mRNA levels on day 8 post-administration. Compounds D-3752, D-3779, D-3782, D-3788, D-3799, and D-3800 were particularly effective. Suppression of hASGR1 mRNA levels was observed with some of the compounds on day 15 post-administration. At this point, compounds D-3752 and D-3788 were particularly effective. Figure 6B shows serum ALP levels at the same time point. Generally, the increase in serum ALP levels correlated with the knockdown of hASGR1 mRNA. Some of the compounds (e.g., D-3752, D-3782) resulted in elevated serum ALP levels similar to those observed in ASGR1 knockout animals, indicating maximum inhibition of ASGR1 expression. In vivo studies have demonstrated that subcutaneous administration of the GalNAc-ASGR1 siRNA conjugate efficiently suppresses ASGR1 gene expression in the liver and modulates serum ALP, a biomarker of efficacy in treating coronary artery disease.

[0338] Example 10. ASGR1 antibody as an alternative delivery mechanism for siRNA molecules The objective of the experiment described in this example was to determine whether the ASGR1 siRNA molecule could be delivered to the liver using a monoclonal antibody against ASGR1. An anti-ASGR1 monoclonal antibody (anti-ASGR1 cyc mAb, 200 mg) with the E272C mutation in the heavy chain according to the EU numbering scheme was incubated at room temperature for 15–20 hours with 50 mL of 2.5 mM cystamine and 2.5 mM cysteamine solution in 40 mM HEPES buffer at pH 7.5–8.5. The amino acid sequences of the heavy and light chains of the anti-ASGR1 antibody are provided below as SEQ ID NOs. 4696 and 4697, respectively. The reaction mixture was filtered using a 0.22 μm filter and diluted to 250 mL in 100 mM sodium acetate buffer at pH 5. Bis-cysteamine-capped anti-ASGR1 cys mAb was purified from the reaction mixture by cation exchange chromatography. First, 250 mL of the reaction mixture, diluted in 100 mM sodium acetate buffer at pH 5, was loaded at 5 mL / min onto a 25 mL SP HP column (GE Healthcare Life Sciences). The column was washed with 2 column volumes (CV) of 100 mM sodium acetate at pH 5, and then a 0–20% gradient of 100 mM sodium acetate was applied over 10 CVs using 1.2 M sodium chloride (NaCl) at pH 5. The main peak containing the bis-cysteamine-capped anti-ASGR1 cys mAb was collected, and the buffer was replaced by dialysis with 10 mM sodium acetate at pH 5.2 containing 9% sucrose. [ka] [ka]

[0339] mAb-siRNA conjugates were generated using siRNA duplexes containing a sense strand with the sequence (5'-3') of GfsusGfgGfaAfgAfAfgAfuGfaAfgUfuUf (SEQ ID NO: 4698) and an antisense strand with the sequence (5'-3') of asCfsuUfcAfuCfuuuCfuUfcCfcAfcsUfsu (SEQ ID NO: 4699). The notation for the sense and antisense sequences is the same as that used for the nucleotide sequences in Tables 6 and 8 described above. The siRNA duplex had a 19-base-pair duplex region with a 2-nucleotide overhang at the 3' end of both the sense and antisense strands. The sense strand of the siRNA duplex had a homoserine-aminohexanoic acid (hSer-Ahx) modification at its 3' end. siRNA double helices were formed by heating at 90°C for 5 minutes in 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4, followed immediately by cooling to room temperature over 30 minutes. 3'hSer-Ahx siRNA double helices were further functionalized with bromoacetyl groups using succinimimidyl bromoacetate (SBA) (Figure 7A). 3'hSer-Ahx siRNA double helices in 100 mM potassium acetate, 30 mM HEPES-KOH, pH 7.4 were incubated with 10–20 equivalents of SBA at room temperature for 1 hour. Subsequently, another 10–20 equivalents of SBA were added, and the reaction mixture was incubated at room temperature for another 1 hour. The reaction was monitored using LC-TOF. Excess SBA was removed from the 3'-bromoacetyl-siRNA by buffer exchange using an Amicon-15 3k spin concentrator with 50 mM sodium phosphate, 2 mM ethylenediaminetetraacetic acid (EDTA), pH 7.5.

[0340] Bis-cysteamine-capped anti-ASGR1 cys mAbs (approximately 5 mg / mL in 10 mM sodium acetate containing 9% sucrose) were partially reduced at room temperature for 60–90 minutes using 3–4 equivalents of tris(2-carboxyethyl)phosphine (TCEP) or triphenylphosphine-3,3',3''-trisulfonic acid trisodium salt (TPPTS) (Figure 7B). The reaction was monitored using analytical cation exchange chromatography. After removing TCEP or TPPTS, the partially reduced cys mAbs were buffer-exchanged with 50 mM sodium phosphate at pH 7.5 containing 2 mM EDTA. 6–10 equivalents of dehydroascorbic acid (DHAA) were added to the partially reduced cys mAbs, and oxidation was performed at room temperature until only trace amounts of reduced mAb species were observed (30–180 minutes). Six equivalents of bromoacetyl-siRNA double helix were added to the reaction mixture without removing DHAA, and alkylation was carried out at room temperature for 15–48 hours (Figure 7B). Excess siRNA double helix and low molecular weight reagents were removed by size exclusion chromatography (SEC) using a homogeneous concentration stream of 0.17 M potassium phosphate, 0.21 M potassium chloride, 10% (v / v) isopropanol, pH 7. Anti-ASGR1 mAb-siRNA conjugates with RNA-antibody ratios (RARs) of 1 and 2 were separated using anion exchange chromatography. The SEC pool was diluted in 20 mM Tris-HCl, 100 mM NaCl at pH 7 and loaded onto a Q HP column (GE Healthcare Life Sciences). The column was washed with 5 CV of 20 mM Tris-HCl, 100 mM NaCl at pH 7, and then gradient eluted with 20 mM Tris-HCl at pH 7 containing 0.4–1 M NaCl over 20 CV. The purified RAR1 (compound 3549) and RAR2 (compound 3550) products were buffered in Dulbecco's phosphate-buffered saline (DPBS) using spin concentration.

[0341] The activity of mAb-siRNA conjugates was evaluated in a free uptake assay to determine whether the antibody efficiently delivered siRNA to human primary hepatocytes and inhibited ASGR1 expression. Anti-ASGR1 mAbs at various concentrations (0.18 nM to 400 nM) conjugated to one or two ASGR1 siRNA molecules (compounds 3549 and 3550, respectively) were incubated with human primary hepatocytes for 4 days. RNA was isolated from the cells and processed for droplet digital PCR analysis to assess ASGR1 mRNA levels as described in Example 8. The results of the in vitro assay are shown in Figure 8. Anti-ASGR1 mAbs conjugated to one or two ASGR1 siRNA molecules demonstrated a 40–60% knockdown of ASGR1 mRNA. An unconjugated anti-ASGR1 cys mAb (PL-53515) was used as a control.

[0342] Next, the efficacy of the anti-ASGR1 mAb-siRNA conjugate was tested in vivo. Nine-week-old C57Bl / 6 wild-type mice were administered either compound 3550 (30 mg / kg or 60 mg / kg) or a GalNAc-conjugated siRNA control subcutaneously or intravenously. The GalNAc-conjugated siRNA control had a sense strand with the sequence of SEQ ID NO: 4698 and an antisense strand with the sequence of SEQ ID NO: 4699, with the sense strand conjugated at the 3' end to a tribranched GalNAc portion. Serum and liver samples were collected from the animals on days 2, 4, 8, and 15 after compound administration. Total RNA isolated from the animal livers was processed for qPCR analysis to assess ASGR1 mRNA levels. ASGR1 protein expression in the liver was measured by ELISA. Serum alkaline phosphatase (ALP) levels were measured using a clinical analyzer (AU400 chemical analyzer, Olympus).

[0343] The mAb-siRNA conjugate 3550 efficiently delivered siRNA to its in vivo mRNA target. The highest knockdown level (approximately 80%) was obtained from intravenous administration of 30 mpk of 3550 in wild-type mice, measured on day 8 (Figure 9A). ASGR1 protein expression in the liver was also measured, and a reduction of over 80% of ASGR1 protein was achieved in the 30 mpk intravenous administration group, consistent with the level of mRNA knockdown (Figure 9B). The lowest point of protein knockdown was day 8 for anti-ASGR1 mAb-siRNA conjugate administered intravenously or subcutaneously, and day 4 for GalNAc-siRNA conjugate. The mAb-siRNA conjugate 3550 resulted in a 2-4-fold increase in ALP at day 8, corresponding to the reduction in ASGR1 mRNA levels and protein expression (Figure 10). Anti-ASGR1 antibody alone did not induce any increase in ALP, even at 100 mg / kg (data not shown).

[0344] In summary, these experimental results demonstrate that siRNA duplexes can be efficiently delivered to the liver using an anti-ASGR1 antibody instead of the GalNAc portion. The mAb-siRNA conjugate showed comparable efficacy to the GalNAc-siRNA conjugate in terms of inhibition of ASGR1 expression in the liver and elevation of serum ALP levels, a biomarker of targeted inhibition.

[0345] All publications, patents, and patent applications discussed and cited herein are incorporated herein by reference in their entirety. The disclosed invention is not limited to the specific methodologies, protocols, and materials described herein, and these are subject to change. It is also understood that the terms used herein are for the purpose of describing specific embodiments and are not intended to limit the scope of the appended claims.

[0346] Those skilled in the art will be able to recognize or confirm many equivalents to the specific embodiments of the present invention described herein through simple routine experiments. Such equivalents shall be included in the appended claims.

Claims

[Claim 1] The method or RNAi construct described in the specification.

Images