Detection reagents and methods for detecting target substances

The detection kit uses aptamers to enhance peroxidase activity in porphyrins, enabling precise and accurate detection of target substances through enzymatic reactions.

JP2026086526APending Publication Date: 2026-05-26NAT UNIV CORP TOKYO UNIV OF AGRI & TECH

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NAT UNIV CORP TOKYO UNIV OF AGRI & TECH
Filing Date
2026-02-02
Publication Date
2026-05-26

AI Technical Summary

Technical Problem

There is a lack of practical assay systems using aptamers that increase peroxidase activity in porphyrins, particularly for detecting target substances in a homogeneous manner.

Method used

A detection kit comprising a nucleic acid molecule with a first aptamer that enhances peroxidase activity in porphyrins, a second aptamer linked to the first aptamer, a first enzyme, a first substrate, and a second substrate, which are used to detect target substances by measuring enzymatic reactions.

Benefits of technology

Enables precise and accurate detection of target substances by leveraging aptamers that enhance peroxidase activity, allowing for high-precision assays.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026086526000001_ABST
    Figure 2026086526000001_ABST
Patent Text Reader

Abstract

This invention provides a practical assay system using a predetermined aptamer, particularly a detection reagent and method for detecting homogeneous target substances. [Solution] The nucleic acid molecule used in this detection reagent and detection method has a first aptamer that acts on porphyrin exhibiting peroxidase activity to increase peroxidase activity, and a second aptamer that is linked to the first aptamer and has the ability to bind to a target substance.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a detection reagent for a target substance and a method for detecting a target substance, using an aptamer that specifically binds to the target substance. [Background technology]

[0002] In general, techniques for detecting target substances in a sample are known, such as immunoassay systems using antigen-antibody reactions. In particular, homogeneous assays (also called homogeneous immunoassays or homogeneous detection systems), which do not require the separation of enzyme-labeled substances into bound (B) and free (F) forms (B / F separation), are attracting attention as simple and rapid measurement systems in immunoassay systems using antigen-antibody reactions. To date, the following homogeneous detection systems using antibodies have been reported: Non-Patent Document 1: Enzyme-multiplied immunoassays technology (EMIT), Non-Patent Document 2: Fluorescence polarization immunoassay (FPIA), Non-Patent Document 3: Fluorescence resonance energy transfer (FRET), and Non-Patent Document 4: Chemiluminescence resonance energy transfer (CRET).

[0003] The methods described in these Non-Patent Documents 1 to 4 all require labeling the antibody with an enzyme, fluorescent substance, or chemiluminescent substance.

[0004] Furthermore, Non-Patent Documents 5-7 disclose homogeneous assay systems for detecting viruses using magnetic nanoparticles.

[0005] On the other hand, detection systems have also been reported that use a donor that emits a signal and an acceptor that specifically receives that signal and emits a detection signal (Non-Patent Documents 8 and 9). When light is shone on the donor, singlet oxygen is released and diffuses through the solution for a very short time. If the singlet oxygen reaches the acceptor during this time, energy is transferred from the singlet oxygen and light of a specific wavelength is emitted. In this detection system, the signal of that specific wavelength, which is generated when the donor and acceptor are in close proximity via the object to be detected, is detected.

[0006] Furthermore, Patent Document 1 discloses a method for measuring the concentration of a target substance in a sample by specifically binding a first enzyme and a second enzyme to the target substance, and detecting the reaction catalyzed by the second enzyme. Here, the reaction catalyzed by the second enzyme is a reaction that utilizes the product purified by the reaction catalyzed by the first enzyme. Therefore, when the target substance is present in a reaction solution containing the first enzyme, the second enzyme, and the substrates of each enzyme, the first enzyme and the second enzyme come into close proximity, and the reaction catalyzed by the second enzyme proceeds. Patent Document 1 discloses that the first and second enzymes are specifically glucose oxidase and peroxidase, respectively. In this case, the hydrogen peroxide produced by glucose oxidase is utilized by the second enzyme, peroxidase, to carry out an enzymatic reaction using a substrate such as orthophenyleneamine.

[0007] Incidentally, an aptamer refers to a nucleic acid molecule that specifically binds to a particular target substance. Examples of aptamers that specifically bind to growth factors, enzymes, receptors, membrane proteins, viral proteins, etc., have been found, and those that bind to metal ions, low molecular weight organic compounds, viruses, etc., are also known. For example, Patent Document 2 discloses an aptamer having a guanine quadruplex structure (hereinafter also referred to as the G4 structure) that specifically binds to heme proteins such as myoglobin and hemoglobin. The aptamer disclosed in Patent Document 2 has the function of significantly increasing the peroxidase activity of heme proteins.

[0008] In addition, Non-Patent Document 10 discloses an aptamer that specifically binds to porphyrins including hemoproteins and hemin having the peroxidase activity described above, and describes its function as a DNA enzyme (DNAzyme). Note that porphyrins showing peroxidase activity are also disclosed in Non-Patent Document 11. Further, Patent Document 3 and Non-Patent Document 12 disclose a technique for further increasing the peroxidase activity by introducing a mutation into an aptamer that increases the peroxidase activity by specifically binding to hemin.

Prior Art Documents

Patent Documents

[0009]

Patent Document 1

Patent Document 2

Patent Document 3

Non-Patent Documents

[0010]

Non-Patent Document 1

Non-Patent Document 2

Non-Patent Document 3

Non-licensed Document 4

Non-licensed Document 5

Non-licensed Document 6

Non-licensed Document 7

Non-licensed literature 9

Non-licensed literature 10

[0011] However, no practical assay systems using aptamers that increase peroxidase activity in porphyrins, such as peroxidases and hemins, were known, particularly no detection reagents or methods for homogeneous target substances. Therefore, in view of the above circumstances, the present invention aims to provide a detection reagent or method for target substances using an aptamer that increases peroxidase activity in porphyrins, or a detection reagent or method for target substances that does not use such an aptamer. [Means for solving the problem]

[0012] To achieve the above-mentioned objectives, the inventors diligently conducted research and succeeded in developing a practical target substance detection kit and detection method by controlling the three-dimensional structure of aptamers that increase peroxidase activity in porphyrins, thereby completing the present invention.

[0013] This invention encompasses the following: (1) A target substance detection kit comprising: a nucleic acid molecule having a first aptamer that acts on a porphyrin exhibiting peroxidase activity to increase its peroxidase activity, and a second aptamer directly or indirectly linked to the first aptamer; a first enzyme having oxidase activity that has the ability to bind to a target substance to which the second aptamer binds and catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate that is a substrate of the first enzyme; a porphyrin having peroxidase activity whose activity is increased by the first aptamer; and a second substrate that is a substrate for the peroxidase activity in the porphyrin. (2) The above porphyrin is a second enzyme having peroxidase activity, and the above first aptamer has a base sequence of formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 The detection kit according to (1), characterized by containing a polynucleotide represented by ggg [I], which increases the peroxidase activity in the second enzyme. (3) The detection kit according to (2), characterized in that the base sequence shown by formula [I] is one of the base sequences shown in sequence numbers 2 to 16. (4) The detection kit according to (1), characterized in that the nucleic acid molecule is a polynucleotide consisting of the base sequence shown in any of SEQ ID NOs. 21, 22, and 46. (5) The detection kit according to (1), wherein the porphyrin is hemin, and the first aptamer increases the peroxidase activity to hemin. (6) The first aptamer that increases peroxidase activity against hemin has the base sequence of formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 The detection kit according to (5), characterized by containing a polynucleotide represented by gg [IV]. (7) The detection kit according to (6), characterized in that the base sequence represented by formula [IV] above is the base sequence shown in any of sequence numbers 26, 27, 29, 30 and 32-42. (8) The detection kit according to (1), characterized in that the second aptamer binds to the surface of the virus. (9) The detection kit according to (1), characterized in that the second aptamer has a guanine quadruple chain structure. (10) The detection kit according to (1), further comprising catalase. (11) The detection kit according to (1), characterized in that the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the porphyrin and the second substrate are myoglobin and luminol, respectively. (12) The detection kit according to (1), characterized in that it comprises a first reagent containing at least the first substrate and a second reagent containing at least the first enzyme. (13) A method for detecting a target substance, comprising the steps of mixing a detection kit described in any of (1) to (12) with a sample that may contain a target substance, and measuring an enzymatic reaction based on the peroxidase activity of porphyrin contained in the detection kit, wherein the target substance in the sample is detected based on the enzymatic reaction. (14) A target substance detection kit comprising: a first enzyme having the ability to bind to a target substance supported on particles exhibiting peroxidase activity and having oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate which is a substrate for the first enzyme; and a second substrate which is a substrate for the peroxidase activity in the particles. (15) The detection kit according to (14), characterized in that the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol. (16) The detection kit according to (14), characterized by comprising a first reagent containing at least the first substrate and a second reagent containing at least the first enzyme. (17) The detection kit according to (14), characterized in that the particles are viruses and the target substance is a protein present on the surface of the virus. (18) The detection kit according to (14), characterized in that the above particles are magnetic particles. (19) The above-mentioned particles are magnetic particles having either one of a tag peptide and a tag capture peptide produced by magnetotactic bacteria on the surface thereof, the above-mentioned target substance is a protein fused with the other of the above-mentioned tag peptide and the above-mentioned tag capture peptide, and the above-mentioned detection kit according to (14) is characterized in that it is bound to the above-mentioned magnetic particles via the above-mentioned tag peptide and the above-mentioned tag capture peptide. (20) A method for detecting a target substance, comprising the steps of mixing the detection kit according to any one of (14) to (19) and a sample that may contain the target substance, and measuring an enzyme reaction based on the peroxidase activity in the above-mentioned particles, and detecting the target substance in the above-mentioned sample based on the above-mentioned enzyme reaction. (21) A nucleic acid molecule having a first aptamer that acts on a porphyrin showing peroxidase activity to increase the peroxidase activity, and a second aptamer that is directly or indirectly linked to the first aptamer and has a binding ability to a target substance. (22) The above-mentioned first aptamer has a base sequence represented by formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 ggg [I], and the nucleic acid molecule according to (20) is characterized in that it increases the peroxidase activity in a heme protein. (23) The nucleic acid molecule according to (21) is characterized in that the base sequence represented by the above-mentioned formula [I] is the base sequence shown in any one of SEQ ID NOs: 2 to 16. (24) The nucleic acid molecule according to (20) is characterized in that it is a polynucleotide consisting of the base sequence shown in any one of SEQ ID NOs: 21, 22 and 46. (25) The nucleic acid molecule according to (21) is characterized in that the above-mentioned first aptamer increases the peroxidase activity against hemin. (26) The above-mentioned first aptamer that increases the peroxidase activity against hemin has a base sequence represented by formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 gg [IV], and the nucleic acid molecule according to (25) is characterized in that it contains a polynucleotide. (27) The nucleic acid molecule according to (26), characterized in that the base sequence represented by formula [IV] is one of the base sequences shown in sequence numbers 26, 27, 29, 30 and 32-42. (28) The nucleic acid molecule according to (21), characterized in that the second aptamer binds to the surface of a virus. (29) The nucleic acid molecule according to (21), characterized in that the second aptamer is a polynucleotide having a guanine quadruplex structure. (30) The base sequence is formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 A method for detecting hemoglobin, comprising the steps of: mixing a polynucleotide represented by ggg [I] which is an aptamer molecule that increases the peroxidase activity of hemeproteins; a first enzyme that has specific binding ability to hemoglobin and has oxidase activity that catalyzes an oxidation reaction to produce hydrogen peroxide; a first substrate which is a substrate of the first enzyme; a second substrate which is a substrate of the peroxidase; and a sample which may contain hemoglobin; and measuring the peroxidase activity of the hemoglobin. (31) The method for detecting hemoglobin according to (30), characterized in that the base sequence shown by formula [I] is one of the base sequences shown in sequence numbers 2 to 16. (32) The method for detecting hemoglobin according to (30), characterized in that the base sequence shown by formula [I] above is the base sequence of sequence number 2. (33) The method for detecting hemoglobin according to (30), characterized in that the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol. [Effects of the Invention]

[0014] According to the present invention, target substances can be detected with high precision using an aptamer that increases the peroxidase activity of a porphyrin having a predetermined base sequence and exhibiting peroxidase activity.

[0015] Furthermore, according to the present invention, hemoglobin can be detected with high accuracy using an aptamer having a predetermined base sequence that increases the peroxidase activity of heme protein. [Brief explanation of the drawing]

[0016] [Figure 1] This figure schematically illustrates a target substance detection system using nucleic acid molecules according to the present invention. [Figure 2] This figure schematically illustrates another example of a target substance detection system utilizing nucleic acid molecules according to the present invention. [Figure 3] This figure schematically illustrates yet another example of a target substance detection system using nucleic acid molecules according to the present invention. [Figure 4] This figure schematically illustrates a hemoglobin detection system to which the present invention is applied. [Figure 5] This is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm the antibody-enzyme complex prepared in Example 1. [Figure 6] This is a characteristic diagram showing the results of measuring the oxidase activity of the antibody-enzyme complex prepared in Example 1. [Figure 7] This is a characteristic diagram showing the results of measuring the structure of the fusion aptamer using circular dichroism (CD) spectroscopy. [Figure 8] This characteristic diagram shows the results of examining the folding conditions of fusion aptamers using blotting. [Figure 9] This is a characteristic diagram showing the results of examining the concentration ratio of myoglobin and fusion aptamer. [Figure 10] This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 6. [Figure 11] This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 7. [Figure 12]This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 8. [Figure 13] This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 9. [Figure 14] This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 10. [Figure 15] This is a photograph showing the result of imaging the plate using the camera function of the iPhone (registered trademark) 12 in Example 10. [Figure 16] This is a photograph showing the result of imaging the membrane using the camera function of the iPhone (registered trademark) 12 in Example 11. [Figure 17] This is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm the antibody-enzyme complex prepared in Example 12. [Figure 18] This is a characteristic diagram showing the results of measuring inactivated influenza viruses using the system according to the present invention as shown in Example 13. [Figure 19] This is a characteristic diagram showing the results of measuring inactivated influenza virus using the system according to the present invention as shown in Example 14. [Figure 20] This is a characteristic diagram showing the results of measuring the virus (inactivated SARS-CoV-2) using the system according to the present invention shown in Example 15. [Figure 21] This photograph shows the results of confirming the expression of the Mms13-SC-Flag fusion protein in the Mms13-SC-Flag-BMP prepared in Example 16 using a dot plot. [Figure 22] This is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm Mms13-VHH in the VHH-presenting BMP (VHH-BMP) prepared in Example 17. [Figure 23]This characteristic diagram shows the results of measuring the chemiluminescence intensity to confirm the anti-CRPscFv antibody-presenting BMP (scFv-BMP) prepared in Example 18. [Figure 24] This is a photograph showing the results of SDS-polyacrylamide gel electrophoresis to confirm the GOx and scFv-ST complex prepared in Example 19. [Figure 25] This is a characteristic diagram showing the chemiluminescence intensity measured to evaluate the binding ability of the antibody-enzyme complex prepared in Example 19 to CRP. [Figure 26] This is a characteristic diagram showing the results of evaluating the CRP scavenging ability of the antibody-enzyme complex and the anti-CRPscFv antibody-presenting BMP in Example 20. [Figure 27] This is a characteristic diagram showing the results of measuring the peroxidase activity of Mms13-SC-Flag-BMP in Example 21. [Figure 28] This characteristic diagram shows the results of measuring the luminol emission intensity of the scFv-BMP, CRP, and GOx-scFv composite (after washing) prepared in Example 21, at varying CRP concentrations. [Figure 29] This characteristic diagram shows the results of measuring the luminol emission intensity of the scFv-BMP, CRP, and GOx-scFv composite (without washing) prepared in Example 21, at varying CRP concentrations. [Figure 30] This characteristic diagram shows the results of measuring luminol emission intensity by varying the CRP concentration in a reaction system that did not contain catalase in the reaction solution, as performed in Example 22. [Figure 31] This characteristic diagram shows the results of measuring the luminol emission intensity at different CRP concentrations in the reaction solution with and without catalase, as performed in Example 22. [Modes for carrying out the invention]

[0017] The present invention will now be described in detail with reference to the drawings.

[0018] [First aptamer] In the present invention, the first aptamer refers to a nucleic acid molecule consisting of a polynucleotide having a predetermined base sequence and the function of increasing the peroxidase activity of porphyrin exhibiting peroxidase activity. An example of such a nucleic acid molecule is the aptamer molecule disclosed in Japanese Patent Application Publication No. 2017-200472. As will be described in detail later, this nucleic acid molecule can be used in conjunction with other aptamers that bind to a target substance. Therefore, in this embodiment, in order to distinguish this nucleic acid molecule from the other aptamers, this nucleic acid molecule is referred to as the first aptamer. In this embodiment, the other aptamers are referred to as the second aptamer.

[0019] The base sequence of the first aptamer is, in one embodiment, formula [I]: ggg(n) 1-2 ggg(n) 1-8 ggg(n) 1-2 It is represented as ggg. Here, n is adenine (a), cytosine (c), guanine (g), thymine (t) (uracil (u) in the case of RNA), or inosine (i), or modified forms of these bases (methylated forms, etc.) or artificial nucleic acids. Furthermore, the base sequence of the first aptamer is one of the base sequences shown in formula [I], such as formula [II]: ggg(n) 1-2 ggg(n) 1-6 ggg(n) 1-2 The form represented by ggg is preferred, and furthermore, formula [III]: gggngggnnggg(n) 1-2 What is shown by ggg is more preferable.

[0020] A preferred specific example of the base sequence represented by formula [I] is the base sequence shown in any of sequence numbers 2 to 16, which were fabricated and whose effects were specifically confirmed in Japanese Patent Publication No. 2017-200472 (Table 1 below). In other words, the base sequence of the first aptamer may be any of sequence numbers 2 to 16 and is not particularly limited. Among these, it is most preferable that the first aptamer be a polynucleotide consisting of the base sequence of sequence number 2 used in this example.

[0021] Table 1

[0022] The first aptamer may consist of the base sequence shown in formula [I], but it may also have one or more nucleotides added to its 5' and / or 3' ends. Generally, the reason why aptamers specifically bind to target substances is thought to be because the aptamer exhibits a specific structure (three-dimensional or planar structure). Therefore, even if a base sequence that does not exhibit a specific structure is added to one or both ends of the base sequence shown in formula [I], the effect of increasing peroxidase activity is maintained. In particular, it is preferable to include one to three natural bases other than ACGT, such as inosine or methylated cytosine, or highly hydrophobic non-natural bases, at one or both ends of the base sequence shown in formula [I]. By configuring it in this way, the first aptamer can exhibit an even better effect of increasing peroxidase activity. Furthermore, by adding adenine to the 3' end of the base sequence shown in formula [I], it plays a similar role to histidine residues involved in peroxidase activity, and an even better effect of increasing peroxidase activity can be achieved. Whether or not DNA exhibits any particular structure can be determined by computer software analysis (for example, the Mapper from RAMAPO COLLEGE, available at http: / / bioinformatics.ramapo.edu / QGRS / analyze.php (Nucleic Acids Research 2006 July; 34 (Web Server issue): W676-W682)), so a base sequence that does not exhibit a specific structure can be easily defined by those skilled in the art. For example, poly-t sequences are widely known as DNA sequences that do not exhibit a specific structure, and aptamers represented by formula [I] with poly-t sequences attached to one or both ends also have the effect of increasing heme protein peroxidase and are included in the scope of the present invention.However, as specifically shown in Japanese Patent Publication No. 2017-200472, excellent effects can be achieved even if nucleotides are not attached to the 5' and 3' ends of the base sequence shown in formula [I]. Furthermore, as the length of the aptamer increases, the cost and effort of synthesis also increases. Therefore, an aptamer in which 0 to 10, preferably 0 to 6, and more preferably 0 to 3 nucleotides are attached to one or both ends of formula [I] is preferred (where "0 nucleotides attached" means that no nucleotides are attached).

[0023] Furthermore, as shown in Japanese Patent Publication No. 2017-200472, the first aptamer has a guanine quadruple chain structure (also referred to as a G4 structure). Generally, aptamers having a G4 structure (also referred to as G4 aptamers) are known to have parallel G4 and antiparallel G4 types, but as described in Japanese Patent Publication No. 2017-200472, the first aptamer has been confirmed to be a parallel G4 type based on circular dichroism (CD) spectral measurements. In G4 aptamers, the G-quartet, formed by four guanine units arranged in a plane, is arranged in parallel, and it is known that the target substance binds in a way that this G-quartet is embedded within it.

[0024] Incidentally, the first aptamer in the present invention is not limited to one that binds to peroxidase, as in the first embodiment described above, but may also have the function of specifically binding to porphyrins other than peroxidase and increasing the peroxidase activity of porphyrins other than peroxidase. That is, another embodiment of the first aptamer is an aptamer that specifically binds to porphyrins other than peroxidase and has the function of increasing the peroxidase activity of porphyrins other than peroxidase.

[0025] Here, porphyrin refers to a compound having a porphyrin ring with the following structure as its backbone, to which functional groups are bonded.

[0026] [ka]

[0027] Therefore, the term porphyrin is not limited to the peroxidases (proteins, enzymes) mentioned above, but also includes organic compounds such as hemin. The porphyrins used in the present invention are not particularly limited, and examples include hemin, chlorin, florin, porhodimethene, porhomethene, bacteriochlorin, isobacteriochlorin, porphyrinogen, holbin, porphyrazine, phthalocyanine, phytoporphyrin, cytoporphyrin, uroporphyrin I-IV, coproporphyrin I-IV, hematoporphyrin, mesoporphyrin, protoporphyrin, rhodoporphyrin, filoporphyrin, etioporphyrin I-IV, pyroporphyrin, deuteroporphyrin, phytochlorin, rhodochlorin, filochlorin, and pyrochlorin. Furthermore, examples of porphyrins used in the present invention include a group of compounds disclosed in Genevieve Pratviel, Coordination Chemistry Reviews 308 (2016) 460-477.

[0028] An example of a porphyrin used in the present invention is a hemin having the following structure.

[0029] [ka]

[0030] The first aptamer, which specifically binds to the various porphyrins described above and has the function of improving the peroxidase activity of said porphyrins, can have its nucleotide sequence designed by the method described, for example, Renzo A. Fenati, Zifei Chen, Yasuko Yamagishi, Kaori Tsukakoshi, Kazunori Ikebukuro, Anjay Manian, Salvy P. Russo, Tomohiko Yamazaki, and Amanda V. Ellis, J. Mater. Chem. B, 2022, 10, 8960-8969, and can be chemically synthesized based on the designed nucleotide sequence.

[0031] For example, the first aptamer that specifically binds to hemin and has the function of improving peroxidase activity in hemin is not particularly limited, but is given by formula [IV]: ggg(n) 1-3 ggg(n) 1-7 ggg(n) 1-3 Aptamers containing the base sequence represented by gg can be listed. Here, n is adenine (a), cytosine (c), guanine (g), thymine (t) (uracil (u) in the case of RNA), or inosine (i), or modified forms of these bases (such as methylated forms) or artificial nucleic acids. Furthermore, while not particularly limited, the first aptamer having the function of improving peroxidase activity in hemin can be listed as polynucleotides (which may also be called oligonucleotides) having the base sequences shown in Table 2, as disclosed in Cheng et al., Biochemistry, 2009, 48, 7817-7823.

[0032] [Table 2]

[0033] Among the polynucleotides shown in Table 2, the base sequences of SEQ ID NOs. 26, 27, 29, 30, and 32-42 in particular contain the base sequence shown in formula [IV] above. Therefore, as the first aptamer, it is preferable to use an aptamer containing a polynucleotide consisting of any of the base sequences of SEQ ID NOs. 26, 27, 29, 30, and 32-42 among the polynucleotides shown in Table 2. Note that the aptamers consisting of the base sequences of SEQ ID NOs. 29, 37, 40, and 41 are aptamers consisting of the polynucleotide shown in formula [IV], and the aptamers consisting of the base sequences of SEQ ID NOs. 26, 27, 30, 32-36, 38, 39, and 42 are aptamers in which one or more nucleotides are added to the 5' and / or 3' ends of the polynucleotide shown in formula [IV].

[0034] Furthermore, among aptamers containing polynucleotides represented by formula [IV], in particular, formula [V]: ggg(n) 1-2 ggg(n) 1-3 ggg(n) 1-2 It is preferable to use an aptamer containing a polynucleotide represented by gg. Of the polynucleotides shown in Table 2, the base sequences of SEQ ID NOs. 32, 33, 34, 37, and 38 contain the base sequence shown in formula [V] above. Therefore, as the first aptamer, it is more preferable to use an aptamer containing a polynucleotide consisting of one of the base sequences of SEQ ID NOs. 32, 33, 34, 37, and 38 from the polynucleotides shown in Table 2. These, EAD2 (SEQ ID NOs. 33), c-Myc (SEQ ID NOs. 38), EAD (SEQ ID NOs. 32), EAD3 (SEQ ID NOs. 34), and VEGF (SEQ ID NOs. 37), are extremely effective in improving kcat (turnover rate: catalytic constant for substrate-to-product conversion), as disclosed in Cheng et al., Biochemistry, 2009, 48, 7817-7823. Furthermore, the first aptamer is most preferably a polynucleotide (PS2.M) consisting of the base sequence of SEQ ID NO: 30 used in this embodiment, which is an aptamer containing a polynucleotide represented by formula [V].

[0035] Furthermore, the first aptamer may consist of a polynucleotide shown in Table 2 or formula [IV] or formula [V], but it may also have one or more nucleotides added to the 5' and / or 3' ends of the polynucleotide shown in Table 2 or formula [IV] or formula [V]. Generally, the reason why aptamers specifically bind to target substances is thought to be because the aptamer exhibits a specific structure (three-dimensional or planar structure). Therefore, even if a base sequence that does not exhibit a specific structure is added to one or both ends of the base sequence shown in Table 2 or formula [IV] or formula [V], the peroxidase activity-enhancing effect is maintained. In particular, it is preferable to include 1 to 3 natural bases other than ACGT, such as inosine or methylated cytosine, or highly hydrophobic non-natural bases, at one or both ends of the base sequence shown in Table 2 or formula [IV] or formula [V]. By configuring it in this way, the first aptamer can exhibit a superior peroxidase activity-enhancing effect. Furthermore, adding adenine to the 3' end of the base sequence shown in Table 2 or formula [IV] or formula [V] allows it to play a similar role to histidine residues involved in peroxidase activity, resulting in a superior increase in peroxidase activity. Whether or not DNA exhibits any structure can be determined by computer software analysis (for example, the Mapper from RAMAPO COLLEGE, available at http: / / bioinformatics.ramapo.edu / QGRS / analyze.php (Nucleic Acids Research 2006 July; 34 (Web Server issue): W676-W682)), so base sequences that do not exhibit a specific structure can be easily defined by those skilled in the art. For example, poly-t sequences are widely known as DNA sequences that do not exhibit a specific structure, and aptamers shown in Table 2 or formula [IV] or formula [V] with poly-t sequences added to one or both ends also have the effect of increasing heme protein peroxidase and are included within the scope of the present invention.Furthermore, since longer aptamers increase both the cost and effort of synthesis, aptamers are preferred in which 0 to 10 nucleotides, preferably 0 to 6, and more preferably 0 to 3 nucleotides, are attached to one or both ends of the base sequence shown in Table 2 or formula [IV] or formula [V] (wherein "0 nucleotides attached" means no nucleotides are attached).

[0036] Furthermore, the first aptamer that specifically binds to hemin and has the function of improving the peroxidase activity in said hemin is not particularly limited, but examples include the polynucleotide (which may also be called oligonucleotide) described in Japanese Patent Application Publication No. 2020-039300, which is particularly excellent in its ability to improve peroxidase activity. The polynucleotide described in Japanese Patent Application Publication No. 2020-039300 also has a sequence containing the polynucleotide shown in formula [IV].

[0037] On the other hand, as mentioned above, the porphyrin used in the present invention is not limited to peroxidase or hemin, but can also be so-called microperoxidase. Microperoxidase is a compound that has a structure in which some amino acid residues constituting peroxidase are bound to the heme portion and has peroxidase activity. Known microperoxidases include MP-6, which contains cysteine ​​from the 14th to the 19th threonine that constitute peroxidase; MP-8, which contains cysteine ​​from the 14th to the 21st glutamic acid; MP-9, which contains lysine from the 13th to the 21st glutamic acid; and MP-11, which contains valine from the 11th to the 21st glutamic acid.

[0038] A first aptamer that specifically binds to these microperoxidases and enhances their peroxidase activity can be designed by, for example, Renzo A. Fenati, Zifei Chen, Yasuko Yamagishi, Kaori Tsukakoshi, Kazunori Ikebukuro, Anjay Manian, Salvy P. Russo, Tomohiko Yamazaki, and Amanda V. Ellis, J. Mater. Chem. B, 2022, 10, 8960-8969, and can be chemically synthesized based on the designed sequence.

[0039] [Nucleic acid molecules according to the present invention] The nucleic acid molecule according to the present invention comprises a first aptamer described above and a second aptamer that is directly or indirectly linked to the first aptamer via an oligonucleotide and has the ability to bind to a predetermined target substance. The second aptamer is not particularly limited, but preferably has a guanine quadruplex structure. The target substance can be, but is not particularly limited, a biomolecule such as proteins, glycoproteins, lipids, glycolipids, polysaccharides, glycans, and nucleic acids. Examples of proteins can be, but are not particularly limited, growth factors, enzymes, receptors, membrane proteins, viral proteins, etc. Furthermore, cells, viruses, and microorganisms on which these biomolecules are displayed on the surface can also be targeted as target substances. Examples of cells can be cancer cells, iPS cells, ES cells, etc. Examples of viruses can be, but are not particularly limited. As for viruses, both DNA viruses and RNA viruses can be targeted, and both enveloped viruses such as coronaviruses and influenza viruses and non-enveloped viruses such as noroviruses and polioviruses can be targeted. Structures large enough for the second aptamer and antibody to bind, such as protein aggregates with a diameter of 10 nm or more, or liposomes that display such structures on their surface, can also be used as target substances.

[0040] As a second aptamer, one example that can be used is one that has the ability to bind to the receptor-binding domain (RBD) of the spike protein. The spike protein is a glycoprotein that is present in multiple, almost uniformly large numbers on the surface of the virus and is a protein that interacts with cell surface receptors of the host cell. The receptor-binding domain (RBD) refers to the region that interacts with the cell surface receptor of the host cell. Examples of viruses that have a spike protein include seasonal influenza viruses, novel influenza viruses, coronaviruses, novel coronaviruses, orthomyxoviruses, paramyxoviruses, rhabdoviruses, filoviruses, bunyaviruses, arenaviruses, and retroviruses.

[0041] In particular, the second aptamer is preferably one that binds to the receptor-binding domain (RBD) of viruses that cause disease in humans, such as the novel coronavirus and seasonal influenza viruses. Furthermore, the second aptamer is preferably one that binds to the receptor-binding domain (RBD) of the spike protein of the novel coronavirus (SARS-CoV-2). The nucleotide sequence of the aptamer that binds to the receptor-binding domain (RBD) of the spike protein of the novel coronavirus (SARS-CoV-2) is shown in Sequence ID No. 1. That is, as the second aptamer, a polynucleotide containing the nucleotide sequence of Sequence ID No. 1 (ggggctgctcgggattgcggatatgg) can be used.

[0042] Furthermore, the second aptamer is preferably one that binds to the spike protein in seasonal influenza virus. Seasonal influenza virus has two types of spike proteins: hemagglutinin (HA) and neuraminidase (NA). Therefore, as the second aptamer, it is possible to design an aptamer that binds to either hemagglutinin or neuraminidase in seasonal influenza virus. As an example, the nucleotide sequence of an aptamer that binds to hemagglutinin (HA) in seasonal influenza virus is shown in Sequence ID No. 45. That is, as the second aptamer, a polynucleotide containing the nucleotide sequence of Sequence ID No. 45 (ttggggttattttgggtgtggtgggtgggtt) can be used.

[0043] The nucleic acid molecule according to the present invention may be DNA or RNA, but chemically stable DNA is preferred. Furthermore, this nucleic acid molecule can be easily prepared by chemical synthesis using a commercially available DNA synthesizer or the like. Here, the order of the first aptamer and the second aptamer contained in the nucleic acid molecule is arbitrary. That is, the first aptamer and the second aptamer may be arranged in parallel in this order from the 5' end to the 3' end, or the second aptamer and the first aptamer may be arranged in parallel in this order.

[0044] Furthermore, the first aptamer and the second aptamer may be directly linked, or indirectly linked via an oligonucleotide consisting of one to several nucleotides. For example, the link between the first and second aptamers can consist of one nucleotide, two dinucleotides, three oligonucleotides, four oligonucleotides, or five oligonucleotides. These one to five nucleotides are not particularly limited, but can all be thymine. In addition, the link between the first and second aptamers may be via a synthetic linker such as PEG or PEO.

[0045] The nucleic acid molecule configured as described above exhibits the function of increasing peroxidase activity in porphyrins by the first aptamer when the second aptamer is bound to the target substance. In other words, in the nucleic acid molecule according to the present invention, when the second aptamer is not bound to the target substance, the guanine quadruplex structure of the first aptamer is unstable, and the effect of enhancing peroxidase activity is not fully exhibited. Furthermore, in the nucleic acid molecule configured as described above, it is preferable that the second aptamer has a guanine quadruplex structure. When the second aptamer has a guanine quadruplex structure, the effect of enhancing peroxidase activity by the first aptamer changes more significantly depending on whether the second aptamer is bound to the target substance or not. This is thought to be because the second aptamer has a guanine quadruplex structure, and when the second aptamer binds to the target substance, the structure and stability of the nucleic acid molecule change, stabilizing the guanine quadruplex structure in the first aptamer and further increasing the peroxidase activity enhancement effect. Thus, when the second aptamer in the nucleic acid molecule has a guanine quadruplex structure, the detection sensitivity of the target substance can be further improved.

[0046] Examples of porphyrins on which the first aptamer acts include heme proteins such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, and cytochrome P450. Of these, myoglobin and hemoglobin are preferred. Furthermore, as mentioned above, the porphyrin on which the first aptamer acts may also be compounds such as hemin or microperoxidase, with hemin being particularly preferred.

[0047] [Detection of target substance 1] By utilizing the nucleic acid molecule according to the present invention described above, a system for detecting target substances with high accuracy can be constructed. A schematic diagram of this system is shown in Figure 1. The example shown in Figure 1 is a scheme for detecting the novel coronavirus (SARS-CoV-2) as a target substance using the above-mentioned nucleic acid molecule. As described above, the second aptamer constituting the nucleic acid molecule is not limited to one that binds to the RBD of the novel coronavirus (SARS-CoV-2), but can also be an aptamer that binds to other viruses, growth factors, enzymes, receptors, or membrane proteins. Therefore, the target substance may be the virus in question, or cells expressing a predetermined growth factor, enzyme, receptor, or membrane protein may be used as the target substance.

[0048] In this system, as shown in Figure 1, a first enzyme 103 is prepared that specifically binds to a target substance 102 to which the second aptamer 101 of the nucleic acid molecule 100 binds. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding site 105 that specifically binds to the target substance 102. Here, the binding site 105 can be a molecule that specifically binds to the target substance 102, i.e., an antibody molecule against the RBD of the novel coronavirus (SARS-CoV-2) or a nucleic acid aptamer that has the ability to bind to the RBD of the novel coronavirus (SARS-CoV-2).

[0049] As the first enzyme 103, for example, glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, NADPH oxidase, lactate oxidase, galactose oxidase, alcohol oxidase, etc. can be used. Among these, glucose oxidase is preferred as the first enzyme 103. These enzymes may be enzymes mainly composed of proteins, or they may be DNAzymes (deoxyribozymes) which are enzymes mainly composed of DNA, or ribozymes which are enzymes mainly composed of RNA.

[0050] Furthermore, the first substrate 104 can be appropriately selected and used depending on the type of first enzyme 103. The pair of the first enzyme 103 and the first substrate 104 is preferably glucose oxidase and glucose. This is because glucose, the first substrate 104, is a stable and inexpensive compound.

[0051] Furthermore, while the binding site 105 is used as a means to bind the first enzyme 103 to the target substance 102, the binding site 105 is not limited to an antibody molecule whose antigen is the RBD of the novel coronavirus (SARS-CoV-2), but can also be an ACE2 fragment that interacts with the RBD. In addition, the binding site 105 may be an antibody molecule whose antigen is a region other than the RBD of the spike protein of the novel coronavirus (SARS-CoV-2), or it may be an antibody molecule whose antigen is a protein other than the spike protein, such as the N protein, M protein, or E protein. Moreover, the binding site 105 may be an aptamer mainly composed of nucleic acids.

[0052] Here, the first enzyme 103 and the binding site 105 may bind directly to form a complex, or they may bind indirectly to form a complex. The method of indirectly binding the first enzyme 103 and the binding site 105 is not particularly limited, but a method using a tag peptide and a tag capture peptide can be applied. Examples of tag peptides and tag capture peptides include the SpyTag / SpyCatcher system (Bijan Zakeri et al., PNAS, 109 (12) E690-E697, 2012) and the SnoopCatcher / SnoopTag system (Gianluca Veggiani et al., PNAS, 113 (5) 1202-1207, 2016). Furthermore, as tag peptides and tag-capturing peptides, the SpyTag2 / SpyCatcher2 system (Keeble et al., Angew. Chem. Int. Ed. 2017, 56, 16521-16525), an improvement on the above SpyTag / SpyCatcher system, and the SpyTag3 / SpyCatcher3 system (Keeble et al., PNAS, 116 (52) 26523-26533, 2019) can also be used.

[0053] In other words, either the first enzyme 103 or the binding site 105 has either a tag peptide or a tag-capturing peptide, and the other of the first enzyme 103 or the binding site 105 has either a tag peptide or a tag-capturing peptide. This allows the first enzyme 103 and the binding site 105 to be indirectly bound, thereby forming the complex described above.

[0054] When the binding site 105 is an antibody molecule, the antibody molecule may be any of the following: immunoglobulin (IgG, IgA, IgM, IgD, IgE) antibodies, heavy chain antibodies, or fragment antibodies. Immunoglobulin antibodies consist of a heavy chain (VH) and a light chain (LH), with the heavy chain and light chain each having three CDRs: CDR1, CDR2, and CDR3. Heavy chain antibodies consist only of a heavy chain and have three CDRs: CDR1, CDR2, and CDR3 in the heavy chain. Fragment antibodies are antibodies that have been fragmented using enzymes or genetic engineering techniques, and include Fab, F(ab'), F(ab')2, Fv, VHH antibodies, etc. Fragment antibodies also include scFab, scF(ab'), and scF(ab')2, which are single-chain antibodies formed by linking the light chain and heavy chain of Fab, F(ab'), and F(ab')2 via a linker sequence. Here, in scFab, scF(ab'), and scF(ab')2, a linker sequence may be attached to the C-terminus of the light chain, and a heavy chain may be attached to the C-terminus of the light chain. Furthermore, a linker sequence may be attached to the C-terminus of the heavy chain, and a light chain may be attached to the C-terminus of the heavy chain. Moreover, scFV, a single-chain antibody formed by linking the variable region of the light chain and the variable region of the heavy chain via a linker sequence, can also be used as the binding site 105.

[0055] If the binding portion 105 is an aptamer, the second aptamer described above can be used as the aptamer molecule.

[0056] Furthermore, as shown in Figure 1, this system includes porphyrin 107, which has peroxidase activity and to which the first aptamer 106 of nucleic acid molecule 100 can bind, and a second substrate 108, which is a substrate of porphyrin 107. As mentioned above, porphyrin 107 is an enzyme having peroxidase activity such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, cytochrome P450, or a compound having peroxidase activity such as hemin, or a compound such as microperoxidase. The second substrate 108 can be appropriately selected and used depending on the type of porphyrin 107, but it is particularly preferable to use a substance that can optically detect the progress of the enzymatic reaction of porphyrin 107. Specifically, orthophenylenediamine or luminol can be used as the second substrate 108.

[0057] Furthermore, when using enzymes with peroxidase activity, such as peroxidase, myoglobin, hemoglobin, metmyoglobin, catalase, or cytochrome P450, as porphyrin 107, these enzymes are referred to as the second enzyme to distinguish them from the first enzyme 103.

[0058] Furthermore, as shown in Figure 1, it is preferable that the system includes a third enzyme 109 that consumes hydrogen peroxide produced by the oxidase reaction of the first enzyme 103 as a substrate. The third enzyme 109 is not particularly limited as long as it is an enzyme that consumes hydrogen peroxide as a substrate and, unlike the second substrate 108, does not bind to the first aptamer 106. For example, catalase can be used as the third enzyme 109.

[0059] In the system configured as described above, the target substance 102 can be detected in a reaction system containing a nucleic acid molecule 100, a first enzyme 103 fused to a binding site 105, a first substrate 104, porphyrin 107, and a second substrate 108. Specifically, when the target substance 102 is present in the reaction system, porphyrin 107 indirectly binds to the target substance 102 via the nucleic acid molecule 100, and the first enzyme 103 indirectly binds to the target substance 102 via the binding site 105. In this state, an oxidase reaction using the first substrate 104 proceeds by the first enzyme 103, generating hydrogen peroxide. Since porphyrin 107 is located in close proximity to the first enzyme 103, it consumes the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103. As a result, a peroxidase reaction using the second substrate 108 by porphyrin 107 proceeds.

[0060] Therefore, according to this system, the target substance 102 can be detected by measuring the peroxidase reaction using the second substrate 108 by porphyrin 107. For example, if an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102 can be detected by measuring the chemiluminescence produced by the so-called luminol reaction. The means for measuring chemiluminescence are not particularly limited and may be measured visually or by an extremely weak chemiluminescence measurement method.

[0061] On the other hand, in a reaction system containing nucleic acid molecule 100, a first enzyme 103 fused to the binding site 105, a first substrate 104, porphyrin 107, and a second substrate 108, if the target substance 102 is not present, the oxidase reaction using the first substrate 104 by the first enzyme 103 proceeds, generating hydrogen peroxide, but porphyrin 107 is not present in close proximity. Therefore, the peroxidase reaction using the second substrate 108 by porphyrin 107 hardly proceeds. Consequently, it is only detected when the nucleic acid molecule 100 and the binding site 105 are bound in close proximity, making specific detection possible.

[0062] Furthermore, if a third enzyme 109 is present in the reaction system, the hydrogen peroxide produced by the enzymatic reaction of the first enzyme 103 can be consumed by the third enzyme 109. In this case, since the hydrogen peroxide necessary for the enzymatic reaction by porphyrin 107 has been consumed, the peroxidase reaction using the second substrate 108 can be stopped more reliably. Thus, in this system, the occurrence of false positives can be suppressed by adding a third enzyme 109 to the reaction system.

[0063] Furthermore, the method for detecting the target substance 102 using the system described above can be used with a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., nucleic acid molecule 100) may be included in either the first reagent or the second reagent, or in both. By separating the reagents into a first and second reagent, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during reagent storage. Then, when the first and second reagents are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can proceed, and the target substance 102 can be detected as described above.

[0064] The system described above is not particularly limited and can be applied to various situations in which target substance 102 is detected. In particular, this system can be applied to systems that detect viruses as target substance 102. To detect a virus using this system, an aptamer that binds to the surface of the virus should be used as the second aptamer. By applying this system to virus detection, viruses can be detected quickly and easily. As an example of a system for detecting a virus using this system, the reaction system described above is constructed by spraying the first reagent and the second reagent onto a location suspected of being contaminated with a virus. Based on the chemiluminescence resulting from the peroxidase reaction by porphyrin 107, it can be determined whether target substance 102 is attached to that location.

[0065] Furthermore, this system can be applied to devices that detect whether the target substance 102, the virus, is present in the air. Examples of such devices include air purifiers, air conditioners, handheld portable air capture devices, air capture devices installed at entrances to buildings and rooms, and devices for capturing exhaled breath and coughs installed in hospitals, etc. These devices all share the common feature of passing air through a filter, and by applying this system, viruses attached to the filter can be detected. In this case, the reaction system described above may be constructed by spraying the first and second reagents onto the filter, or by spraying the first and second reagents onto fine particles and dust that have been filtered. In addition, by making the filter disposable in these devices, sequential detection of the target substance 102, the virus, becomes possible.

[0066] Furthermore, this system can be applied to a device for detecting whether the target substance 102, a virus, is present in a liquid. Examples of such devices include those that collect saliva or other bodily fluids from patients complaining of fever symptoms, and those that collect liquids in which clothing or masks worn by healthcare workers have been immersed. Such devices recover liquids that may contain the target substance 102, the virus. The reaction system described above can be constructed by adding the first and second reagents to the recovered liquid. In this way, when detecting the target substance 102 contained in a liquid, a homogeneous detection system can be created that does not require bound / free separation, simply by adding reagents. In particular, chemiluminescence in liquids can be easily detected using solid-state image sensors such as CCD (charge-coupled device) image sensors or CMOS image sensors. Therefore, for example, by combining it with a microfluidic device, a simple and high-performance virus testing device can be created.

[0067] Furthermore, while the system described above detected a specific virus (novel coronavirus (SARS-CoV-2)) as the target substance 102, by simply using a second aptamer 101 and binding site 105 designed for a different target substance 102, it is possible to detect a different target substance 102. In other words, this system is a highly versatile system that can be easily redesigned for each target substance 102 to be detected. Moreover, this system can simultaneously detect multiple different target substances 102. For example, by using multiple types of nucleic acid molecules 100 with different second aptamers 101, it is possible to detect the presence of any of multiple different target substances 102.

[0068] In particular, when the first enzyme 103 and the binding site 105 are indirectly bound via a tag peptide and a tag-capturing peptide, although different binding sites 105 will be used depending on the target substance 102, the same tag peptide and tag-capturing peptide can be used between the first enzyme 103 and the binding site 105. In this case, even if the target substance 102 is different, by preparing the binding site 105 according to the target substance 102, the target substance 102 can be detected using the same first enzyme 103 and other components via the tag peptide and tag-capturing peptide.

[0069] [Detection of target substance 2] Furthermore, the system for detecting the target substance is not limited to the system utilizing nucleic acid molecules according to the present invention described above, but may also be a detection system as shown in Figure 2. Figure 2 shows a scheme for detecting the novel coronavirus (SARS-CoV-2) as the target substance, similar to the system shown in Figure 1. The system shown in Figure 2 detects the virus, particularly the novel coronavirus (SARS-CoV-2), by utilizing the phenomenon in which the target substance 102, a virus, particularly the novel coronavirus (SARS-CoV-2), and the first enzyme 103 coexist in the same reaction system, generating hydrogen peroxide due to the oxidase activity of the first enzyme 103, and promoting a series of reactions in which the generated hydrogen peroxide reacts with the second substrate 108. The mechanism by which the coexistence of the virus and the first enzyme 103 in the same reaction system promotes a series of reactions is not clear, but one hypothesis is that weak peroxidase activity exists on the surface of the virus, and that the reaction between the hydrogen peroxide generated by the first enzyme 103 and the second substrate is catalyzed.

[0070] In the system shown in Figure 2, a first enzyme 103 that specifically binds to the target substance 102 is prepared. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding site 105 that specifically binds to the target substance 102. Here, the binding site 105 can be a molecule that specifically binds to the target substance 102, i.e., an antibody molecule against the RBD of the novel coronavirus (SARS-CoV-2) or a nucleic acid aptamer that has the ability to bind to the RBD of the novel coronavirus (SARS-CoV-2).

[0071] As the first enzyme 103, for example, glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, NADPH oxidase, lactate oxidase, galactose oxidase, alcohol oxidase, etc. can be used.

[0072] Furthermore, the first substrate 104 can be appropriately selected and used depending on the type of first enzyme 103. The pair of the first enzyme 103 and the first substrate 104 is preferably glucose oxidase and glucose. This is because glucose, the first substrate 104, is a stable and inexpensive compound.

[0073] Furthermore, while the binding site 105 is used as a means to bind the first enzyme 103 to the target substance 102, the binding site 105 is not limited to an antibody molecule whose antigen is the RBD of the novel coronavirus (SARS-CoV-2), but can also be an ACE2 fragment that interacts with the RBD. In addition, the binding site 105 may be an antibody molecule whose antigen is a region other than the RBD of the spike protein of the novel coronavirus (SARS-CoV-2), or it may be an antibody molecule whose antigen is a protein other than the spike protein, such as the N protein, M protein, or E protein.

[0074] When the binding site 105 is an antibody molecule, the antibody molecule may be any of the following: immunoglobulin (IgG, IgA, IgM, IgD, IgE) antibodies, heavy chain antibodies, or fragment antibodies. Immunoglobulin antibodies consist of a heavy chain (VH) and a light chain (LH), with the heavy chain and light chain each having three CDRs: CDR1, CDR2, and CDR3. Heavy chain antibodies consist only of a heavy chain and have three CDRs: CDR1, CDR2, and CDR3 in the heavy chain. Fragment antibodies are antibodies that have been fragmented using enzymes or genetic engineering techniques, and include Fab, F(ab'), F(ab')2, Fv, VHH antibodies, etc. Fragment antibodies also include scFab, scF(ab'), and scF(ab')2, which are single-chain antibodies formed by linking the light chain and heavy chain of Fab, F(ab'), and F(ab')2 via a linker sequence. Here, in scFab, scF(ab'), and scF(ab')2, a linker sequence may be attached to the C-terminus of the light chain, and a heavy chain may be attached to the C-terminus of the light chain. Furthermore, a linker sequence may be attached to the C-terminus of the heavy chain, and a light chain may be attached to the C-terminus of the heavy chain. Moreover, scFV, a single-chain antibody formed by linking the variable region of the light chain and the variable region of the heavy chain via a linker sequence, can also be used as the binding site 105.

[0075] If the binding portion 105 is an aptamer, the second aptamer described above can be used as the aptamer molecule.

[0076] Furthermore, as shown in Figure 2, this system includes a second substrate 108 that serves as a substrate for the peroxidase activity on the surface of the target substance 102, which is a virus, particularly the novel coronavirus (SARS-CoV-2). Preferably, the second substrate 108 is a substance that serves as a substrate for peroxidase activity and allows for the optical detection of the progress of the peroxidase reaction. Specifically, orthophenylenediamine or luminol can be used as the second substrate 108.

[0077] In the system configured as described above, a virus, particularly the novel coronavirus (SARS-CoV-2), which is the target substance 102, can be detected in a reaction system containing a first enzyme 103 fused with a binding site 105, a first substrate 104, and a second substrate 108. Specifically, when the target substance 102 is present in the reaction system, a state is formed in which the first enzyme 103 indirectly binds to the target substance 102 via the binding site 105. In this state, an oxidase reaction using the first substrate 104 proceeds by the first enzyme 103, generating hydrogen peroxide. That is, hydrogen peroxide is generated near the surface of the virus, particularly the novel coronavirus (SARS-CoV-2). Therefore, one hypothesis is that the peroxidase activity on the surface of the virus, particularly the novel coronavirus (SARS-CoV-2), causes a peroxidase reaction to proceed using the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103 and the second substrate 108.

[0078] Therefore, according to this system, the target substance 102 can be detected by measuring the chemical reaction promoted by the presence of a virus, particularly the novel coronavirus (SARS-CoV-2), and the first enzyme 103 in the same reaction system. For example, if an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102, which is the virus, particularly the novel coronavirus (SARS-CoV-2), can be detected by measuring the chemiluminescence produced by the so-called luminol reaction. The means of measuring chemiluminescence are not particularly limited and may be measured visually or by an extremely weak chemiluminescence measurement method.

[0079] On the other hand, in a reaction system where the first enzyme 103 fused with the binding site 105, the first substrate 104, and the second substrate 108 are present, if the target substance 102 is not present, the oxidase reaction using the first substrate 104 by the first enzyme 103 proceeds and hydrogen peroxide is generated. However, since the target substance 102, a virus, especially the novel coronavirus (SARS-CoV-2), is not present in close proximity to the first enzyme 103, the second substrate 108 hardly reacts at all.

[0080] Furthermore, the method for detecting the target substance 102 using the system described above can be used with a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., a second substrate 108) may be included in either the first reagent or the second reagent, or in both. By separating the reagents into a first and second reagent, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during reagent storage. Then, when the first and second reagents are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can proceed, and the target substance 102 can be detected as described above.

[0081] The system described above is not particularly limited and can be applied to various situations for detecting target substances 102 having peroxidase activity. In particular, this system can be applied to systems for detecting viruses, especially the novel coronavirus (SARS-CoV-2). By applying this system to virus detection, viruses can be detected quickly and easily. As an example of a system for detecting viruses using this system, the reaction system described above is constructed by spraying the first reagent and the second reagent onto a location suspected of virus contamination. Based on the chemiluminescence caused by the presence of the first enzyme 103 contained in the second reagent and the virus in the same reaction system, it can be determined whether the target substance 102, which is the virus, is attached to that location.

[0082] Furthermore, this system can be applied to devices that detect whether the target substance 102, the virus, is present in the air. Examples of such devices include air purifiers, air conditioners, handheld portable air capture devices, air capture devices installed at entrances to buildings and rooms, and devices for capturing exhaled breath and coughs installed in hospitals, etc. These devices all share the common feature of passing air through a filter, and by applying this system, viruses attached to the filter can be detected. In this case, the reaction system described above may be constructed by spraying the first and second reagents onto the filter, or by spraying the first and second reagents onto fine particles and dust that have been filtered. In addition, by making the filter disposable in these devices, sequential detection of the target substance 102, the virus, becomes possible.

[0083] Furthermore, this system can be applied to a device for detecting whether the target substance 102, a virus, is present in a liquid. Examples of such devices include those that collect saliva or other bodily fluids from patients complaining of fever symptoms, and those that collect liquids in which clothing or masks worn by healthcare workers have been immersed. Such devices recover liquids that may contain the target substance 102, the virus. The reaction system described above can be constructed by adding the first and second reagents to the recovered liquid. In this way, when detecting the target substance 102 contained in a liquid, a homogeneous detection system can be created that does not require bound / free separation, simply by adding reagents. In particular, chemiluminescence in liquids can be easily detected using solid-state image sensors such as CCD (charge-coupled device) image sensors or CMOS image sensors. Therefore, for example, by combining it with a microfluidic device, a simple and high-performance virus testing device can be created.

[0084] Furthermore, while the system described above detected a specific virus (novel coronavirus (SARS-CoV-2)) as the target substance 102, by simply using a binding unit 105 designed for a different target substance 102, it is possible to detect a different target substance 102. In other words, this system is a highly versatile system that can be easily redesigned for each target substance 102 to be detected.

[0085] [Detection of target substance 3] Furthermore, as a system for detecting the target substance, a detection system that does not utilize the nucleic acid molecule according to the present invention described above may be used, such as the one shown in Figure 3. In the system shown in Figure 3, the target substance 102 is captured on the surface of the magnetic particle 110 and detected. The system shown in Figure 3 detects the target substance 102 by utilizing the phenomenon in which the coexistence of the target substance 102 and the first enzyme 103 in the same reaction system promotes a series of reactions in which hydrogen peroxide is generated by the oxidase activity of the first enzyme 103, and the generated hydrogen peroxide reacts with the second substrate 108. For information on the peroxidase activity of the magnetic particle 110, please refer to Nat. Nanotechnol., 2007, 2, 577-583. In other words, in this system, the reaction between the hydrogen peroxide generated by the first enzyme 103 and the second substrate is catalyzed by the peroxidase activity on the surface of the magnetic particle 110.

[0086] In the system shown in Figure 3, a first enzyme 103 that specifically binds to the target substance 102 is prepared. Here, the first enzyme 103 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 104) and generates hydrogen peroxide. The first enzyme 103 also forms a complex with a binding site 105 that specifically binds to the target substance 102. Here, the binding site 105 can be an antibody molecule against the target substance 102 or a molecule that specifically binds to the target substance 102, such as a nucleic acid aptamer.

[0087] As the first enzyme 103 and the first substrate 104, the enzyme and substrate described in [Detection of Target Substance 2] can be used. Furthermore, as described in [Detection of Target Substance 2], antibody molecules or aptamer molecules such as the second aptamer mentioned above can be used as appropriate for the binding site 105. As described in [Detection of Target Substance 2], orthophenylenediamine or luminol can be used for the second substrate 108.

[0088] In particular, in this system, the magnetic particles 110 are not limited, and commercially available magnetic particles or magnetic particles produced by magnetic bacteria can be used. Among these, it is preferable to use magnetic particles produced by magnetic bacteria (also called magnetic bacterial microparticles or Bacterial Magnetic Particles (BMP)). Magnetic bacteria are not limited, and examples include Magnetospirillum magnetotacticum MS-1, M. magneticum AMB-1, M. gryphiswaldense MSR-1, Magnetococcus marinus MC-1, Magnetovibrio blakemorei MV1, Desulfovibrio magneticus RS-1, etc. Magnetic particles produced by these magnetic bacteria can be used as appropriate.

[0089] The magnetic particles 110 have a target substance 102 supported on their surface. The method for supporting the target substance 102 on the surface of the magnetic particles 110 is not particularly limited and can include a method of chemically reacting functional groups introduced on the surface of the magnetic particles 110 with functional groups introduced on the target substance 102, or a method of providing a means for supporting the target substance 102 on the surface of the magnetic particles 110 produced by magnetic bacteria.

[0090] More specifically, one method involves introducing a so-called tag-capture peptide 111 onto the surface of a magnetic particle 110. In this case, the target substance 102 has a tag peptide 112, and the tag peptide 112 binds to the tag-capture peptide 111, thereby being supported on the surface of the magnetic particle 110. In the example shown in Figure 3, the tag-capture peptide 111 is introduced onto the surface of the magnetic particle 100 and the tag peptide 112 is introduced onto the target substance 102, but the reverse is also possible. That is, the tag peptide 112 may be introduced onto the surface of the magnetic particle 100 and the tag-capture peptide 111 may be introduced onto the target substance 102.

[0091] Examples of tag peptide 112 and tag capture peptide 111 include the SpyTag / SpyCatcher system (Bijan Zakeri et al., PNAS, 109 (12) E690-E697, 2012) and the SnoopCatcher / SnoopTag system (Gianluca Veggiani et al., PNAS, 113 (5) 1202-1207, 2016). Furthermore, as tag peptide 112 and tag capture peptide 111, the SpyTag2 / SpyCatcher2 system (Keeble et al., Angew. Chem. Int. Ed. 2017, 56, 16521-16525), which is an improved version of the SpyTag / SpyCatcher system described above, or the SpyTag3 / SpyCatcher3 system (Keeble et al., PNAS, 116 (52) 26523-26533, 2019) can also be used.

[0092] To introduce the tag-capture peptide 111 onto the surface of the magnetic particles 110, techniques such as the magnetosome display method using magnetite-binding proteins like Mms13 can be applied. Specifically, a polynucleotide encoding the tag-capture peptide 111 is linked downstream of the Mms13 gene, and a fusion protein having the tag-capture peptide 111 downstream of Mms13 is expressed within the magnetic bacteria. This allows magnetic particles 110 with the fusion protein displayed on their surface to be produced within the magnetic bacteria. The magnetic particles 110 can then be recovered from the magnetic bacteria according to standard methods.

[0093] Another method for supporting the target substance 102 on the surface of the magnetic particles 110 is to express a fusion protein having an antibody against the target substance 102 downstream of Mms 13 in magnetic bacteria. According to this method, it is not necessary to introduce the tag peptide 112 into the target substance 102, and the target substance 102 can be supported on the surface of the magnetic particles 110 based on the antibody-antigen reaction.

[0094] In the system configured as described above, the target substance 102 can be detected in a reaction system containing a first enzyme 103 fused with the binding site 105, a first substrate 104, and a second substrate 108. Specifically, when the target substance 102 is present in the reaction system, a state is formed in which the first enzyme 103 indirectly binds to the target substance 102 via the binding site 105. In this state, an oxidase reaction using the first substrate 104 proceeds with the first enzyme 103, generating hydrogen peroxide. That is, hydrogen peroxide is generated near the surface of the magnetic particle 110. Therefore, due to the peroxidase activity present on the surface of the magnetic particle 110, a peroxidase reaction using the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 103 and the second substrate 108 proceeds.

[0095] Therefore, according to this system, the target substance 102 can be detected by measuring the chemical reaction promoted by the presence of the target substance 102 and the first enzyme 103 in the same reaction system. For example, if an optically detectable substance such as luminol is used as the second substrate 108, the target substance 102 can be detected by measuring the chemiluminescence produced by the so-called luminol reaction. The means for measuring chemiluminescence are not particularly limited and may be measured visually or by an extremely weak chemiluminescence measurement method.

[0096] On the other hand, in a reaction system where the first enzyme 103 fused with the binding site 105, the first substrate 104, and the second substrate 108 are present, if the target substance 102 is not present, the oxidase reaction using the first substrate 104 by the first enzyme 103 proceeds and hydrogen peroxide is generated. However, since there are no magnetic particles 110 in close proximity to the first enzyme 103, the second substrate 108 hardly reacts at all.

[0097] Furthermore, the method for detecting the target substance 102 using the system described above can be used with a first reagent containing at least a first substrate 104 and a second reagent containing at least a first enzyme 103. Note that components other than the first substrate 104 and the first enzyme 103 (e.g., a second substrate 108) may be included in either the first reagent or the second reagent, or in both. By separating the reagents into a first and second reagent, the oxidase reaction using the first substrate 104 by the first enzyme 103 can be suppressed during reagent storage. Then, when the first and second reagents are mixed, the oxidase reaction using the first substrate 104 by the first enzyme 103 can proceed, and the target substance 102 can be detected as described above.

[0098] The system described above is not particularly limited and can be applied to various situations for detecting a target substance 102 by supporting the target substance 102 on the surface of magnetic particles 110 having peroxidase activity. By using a protein specifically possessed by a virus as the target substance 102, viruses can be detected quickly and easily. Furthermore, by using a specific allergen as the target substance 102, allergens can be detected quickly and easily.

[0099] Furthermore, this system can be applied to a device that detects whether the target substance 102 is present in the air, similar to the system described in [Target Substance Detection 2]. In other words, it can detect the target substance attached to a filter through which air passes.

[0100] Furthermore, this system can be applied to a device for detecting whether the target substance 102 is present in a liquid, similar to the system described in [Target Substance Detection 2]. In such a device, a liquid that may contain the target substance 102 is recovered. The reaction system described above can be constructed by adding the first and second reagents to the recovered liquid. In this way, when detecting the target substance 102 contained in a liquid, a homogeneous detection system can be created that does not require bound / free separation, only by adding reagents. In particular, chemiluminescence in liquids can be easily detected using solid-state image sensors such as CCD (charge-coupled device) image sensors or CMOS image sensors. Therefore, for example, by combining it with a microfluidic device, a simple and high-performance virus testing device can be created.

[0101] In particular, this system allows for the detection of a target substance 102 by supporting it on the surface of magnetic particles 110. The magnetic particles 110 supporting the target substance 102 can be accumulated by magnetic force, and the chemiluminescence produced by the luminol reaction, etc., can be made highly sensitive. Therefore, even a target substance 102 present only at extremely low concentrations can be detected with high accuracy using this system.

[0102] [Detection of hemoglobin] By utilizing the first aptamer described above, a system for detecting hemoglobin with high accuracy can be constructed. A schematic diagram of this system is shown in Figure 4. In this system, as shown in Figure 4, an aptamer molecule 200 consisting of the first aptamer described above and a first enzyme 202 that specifically binds to hemoglobin 201 are prepared. Here, the first enzyme 202 has oxidase activity that catalyzes an enzymatic reaction using a predetermined substance as a substrate (first substrate 203) and generates hydrogen peroxide. Furthermore, the first enzyme 202 forms a complex with an antibody 204 that specifically binds to hemoglobin 201. Here, the antibody 204 can be an antibody molecule against hemoglobin 201.

[0103] As the first enzyme 202, for example, glucose oxidase, aldehyde oxidase, cytochrome oxidase, catechol oxidase, diphenol oxidase, cholesterol oxidase, cytochrome C oxidase, hypoxanthine oxidase, xanthine oxidase, NADPH oxidase, etc. can be used. Among these, glucose oxidase is preferred as the first enzyme 202.

[0104] Furthermore, the first substrate 203 can be appropriately selected and used depending on the type of first enzyme 202. The pair of the first enzyme 202 and the first substrate 203 is preferably glucose oxidase and glucose. This is because glucose, the first substrate 203, is a stable and inexpensive compound.

[0105] Furthermore, the means of binding the first enzyme 202 to hemoglobin 201 is not limited to the antibody 204 that uses hemoglobin 201 as an antigen, but can also be used to utilize aptamer molecules (aptamers other than aptamer molecule 200) or proteins or partial fragments thereof that interact with hemoglobin 201. Also, antibody 204 may have any region of hemoglobin 201 as its epitope.

[0106] Furthermore, as shown in Figure 4, this system includes a second substrate 205 that serves as a substrate for hemoglobin 201 having peroxidase activity. The second substrate 205 is preferably a substance that allows for optical detection of the progress of the peroxidase reaction by hemoglobin 201. Specifically, orthophenylenediamine or luminol can be used as the second substrate 205.

[0107] Furthermore, although not shown in Figure 4, it is preferable that the system includes a third enzyme that consumes hydrogen peroxide produced by the oxidase reaction of the first enzyme 202 as a substrate. The third enzyme is an enzyme that consumes hydrogen peroxide as a substrate, and for example, catalase can be used.

[0108] In the system configured as described above, hemoglobin 201, the target substance, can be detected in a reaction system containing an aptamer molecule 200, a first enzyme 202 fused with an antibody 204, a first substrate 203, and a second substrate 205. Specifically, when hemoglobin 201 is present in the reaction system, the aptamer molecule 200 binds to hemoglobin 201, and simultaneously, the first enzyme 202 indirectly binds to hemoglobin 201 via the antibody 204. In this state, an oxidase reaction using the first substrate 203 proceeds by the first enzyme 202, generating hydrogen peroxide. Since hemoglobin 201 is located in close proximity to the first enzyme 202, it consumes the hydrogen peroxide generated by the enzymatic reaction of the first enzyme 202. As a result, a peroxidase reaction using the second substrate 205 by hemoglobin 201 proceeds.

[0109] Therefore, according to this system, hemoglobin 201 can be detected by measuring the peroxidase reaction of hemoglobin 201 using a second substrate 205. For example, if an optically detectable substance such as luminol is used as the second substrate 205, hemoglobin 201 can be detected by measuring the chemiluminescence produced by the so-called luminol reaction. The means for measuring chemiluminescence are not particularly limited and may be measured visually or by an extremely weak chemiluminescence measurement method.

[0110] On the other hand, in a reaction system containing aptamer molecule 200, a first enzyme 202 fused with antibody 204, a first substrate 203, and a second substrate 205, if hemoglobin 201 is absent, the oxidase reaction using the first substrate 203 by the first enzyme 202 proceeds, generating hydrogen peroxide, but the peroxidase reaction using the second substrate 205 by hemoglobin 201 does not proceed.

[0111] Furthermore, the hemoglobin 201 detection method using the system described above can be used with a first reagent containing at least a first substrate 203 and a second reagent containing at least a first enzyme 202. Note that components other than the first substrate 203 and the first enzyme 202 (e.g., aptamer molecule 200) may be included in either the first reagent or the second reagent, or in both. Separating the reagents into a first and second reagent suppresses the oxidase reaction using the first substrate 203 by the first enzyme 202 during reagent storage. When the first and second reagents are mixed, the oxidase reaction using the first substrate 203 by the first enzyme 202 can proceed, allowing for the detection of hemoglobin 201 as described above. [Examples]

[0112] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to the following examples.

[0113] [Example 1: Preparation of antibody-enzyme complex] In this example, SpyCatcher-fused glucose oxidase and SpyTag-fused anti-SARS-CoV-2 S protein antibody were prepared by recombinant production using Escherichia coli BL21(DE3) strain. Two types of SpyCatcher-fused glucose oxidase were prepared: a fusion protein with glucose oxidase (GOx) and SpyCatcher in that order from the N-terminus (referred to as GOx-SpyCatcher), and a fusion protein with SpyCatcher and GOx in that order from the N-terminus (referred to as SpyCatcher-GOx). Furthermore, two types of SpyTag-fused anti-SARS-CoV-2 S protein antibody were prepared: one with a Variable domain of heavy chain antibody (VHH) and another with a Single-chain variable fragment (scFv) in the antibody portion.

[0114] The amino acid sequence of GOx-SpyCatcher is shown in SEQ ID NO: 17, and the amino acid sequence of SpyCatcher-GOx is shown in SEQ ID NO: 18. In addition, the amino acid sequence of SpyTag-fused anti-SARS-CoV-2 S protein VHH is shown in SEQ ID NO: 19, and the amino acid sequence of SpyTag-fused anti-SARS-CoV-2 S protein scFv is shown in SEQ ID NO: 20.

[0115] Of these, complex formation experiments were conducted using either SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein VHH or SpyTag-fused anti-SARS-CoV-2 S protein scFv as follows. Specifically, the combinations of SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein VHH, and SpyCatcher-GOx and SpyTag-fused anti-SARS-CoV-2 S protein scFv were stoichiometrically mixed and allowed to stand. Here, the mixtures were diluted to 10 μM and 5 μM respectively with phosphate buffer (pH 7.0), mixed in equal volumes, and left to stand overnight at 4°C.

[0116] Subsequently, bands were confirmed by SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The results of SDS-PAGE are shown in Figure 5. As shown in Figure 5, for all combinations, a clear band was observed around the molecular weight at which complex formation between GOx and the antibody (VHH or scFv) was predicted to have occurred via covalent bond formation between SpyCatcher / SpyTag. From these results, it was determined that a complex was formed between glucose oxidase and the antibody against the SARS-CoV-2 S protein.

[0117] [Example 2: Measurement of oxidase activity of antibody-enzyme complex] In this example, the oxidase activity of GOx, SpyCatcher-fused GOx, and the antibody-enzyme complex prepared in Example 1 was measured. 20 μL of diluted sample was mixed with 160 μL of phosphate buffer (pH 7.0) containing 1.5 mM 4-aminoantipyrine (4AA), 1.5 mM N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methoxyaniline (TOOS), and 2 U / mL horseradish peroxidase. After adding 20 μL of glucose at final concentrations of 0, 10, 20, 50, 100, and 200 mM, the absorbance at 555 nm was immediately measured over 30 seconds using a Shimadzu spectrophotometer. The resulting absorbance change, cell length (1 cm), and molar extinction coefficient ε(39.2 mM) of the reaction product between 4AA and TOOS were recorded. -1 cm -1 From ) the Kinetic parameters (Km, V max ) was calculated.

[0118] The results are shown in Figure 6 and Table 3.

[0119] [Table 3]

[0120] As a result, no significant changes were observed in Km due to SpyCatcher fusion and complex formation. On the other hand, V maxRegarding this, a slight decrease was observed with SpyCatcher fusion, and further decreases were observed due to antibody-enzyme complex formation. Furthermore, when SpyCatcher was fused to the N-terminus of GOx, the V was slightly lower compared to when it was fused to the C-terminus. max It was confirmed that the value was high.

[0121] [Example 3: Structural evaluation of fusion aptamers and evaluation of structural changes due to target binding by circular dichroism (CD) spectral measurement] In this example, a fusion aptamer was synthesized between an aptamer (RBD-46) that binds to RBD in the SARS-CoV-2 S protein and an aptamer (PEA3-01) that increases peroxidase activity, as disclosed in Japanese Patent Application Publication No. 2017-200472. The fusion aptamers synthesized in this example were designed as RBD-46-PEA3-01 (SEQ ID NO: 21), in which RBD-46 and PEA3-01 are arranged in that order from the 5' end to the 3' end, and PEA3-01-RBD-46 (SEQ ID NO: 22), in which PEA3-01 and RBD-46 are arranged in that order from the 5' end to the 3' end, and were prepared by chemical synthesis. In addition, a ttt sequence was inserted between PEA3-01 and RBD-46 in these RBD-46-PEA3-01 and PEA3-01-RBD-46.

[0122] The synthesized fusion aptamers (RBD-46-PEA3-01, PEA3-01-RBD-46) were prepared in potassium acetate buffer (pH 5.0) to a final concentration of 10 μM, heat-treated at 95°C for 10 minutes, and folded by slow cooling to 25°C. The CD spectra of the folded fusion aptamers were measured at wavelengths of 220-320 nm using a J-720 circular dichroism spectrometer (JASCO) with a quartz cell (optical path length 1 cm). Measurements were performed after dilution with potassium phosphate buffer (pH 7.0) to a final concentration of 1 μM and standing at room temperature for 1 hour. Additionally, measurements were taken after mixing 50 dC inactivated SARS-CoV-2 virus (Sugiyama Gen) or 50 dC inactivated SARS-CoV-2 virus with 1 μM myoglobin (Life Diagnostics) and standing at room temperature for 1 hour. For data processing, the measurement results under the absence of fusion aptamers in each condition were subtracted.

[0123] The guanine quadruplex (G4) structure is formed when four guanine molecules are arranged in a plane and then aligned parallel to each other in the vertical direction. This G4 structure is broadly classified into parallel and antiparallel types depending on the order of the guanine molecules. In CD spectroscopy, a positive peak around 260 nm and a negative peak around 240 nm indicate a parallel type, while a positive peak around 290 nm and a negative peak around 260 nm indicate an antiparallel type. The fusion aptamer evaluated in this study showed a positive peak around 290 nm and a negative peak around 240 nm, suggesting it is a mixture of parallel and antiparallel types (Figure 7). This is thought to be due to the fusion aptamer being a combination of two aptamers. On the other hand, when inactivated SARS-CoV-2 virus, or when inactivated SARS-CoV-2 virus was mixed with myoglobin, a shoulder was observed in the spectrum around 260 nm. These results indicate that the fusion aptamer's parallel structure is stabilized when the RBD-46 portion binds to SARS-CoV-2, and this state is maintained even when mixed with myoglobin.

[0124] [Example 4: Investigation of folding conditions for fusion aptamers by blotting] In this example, biotinylated fusion aptamers (RBD-46-PEA3-01, PEA3-01-RBD-46) were diluted to 1 μM using a total of four buffers, combining conditions using sodium acetate buffer (pH 5.0) or sodium phosphate buffer (pH 7.0) and conditions with potassium chloride concentrations of 10 mM or 150 mM. Folding was performed in the same manner as in Example 3. 0.35 μg and 3.5 μg of myoglobin, or 5 dC and 20 dC inactivated SARS-CoV-2 virus, were spotted onto a nitrocellulose membrane and fixed by air drying. The membrane was blocked with 2% bovine serum albumin and washed with sodium phosphate buffer containing 0.05% Tween-20. The membrane was immersed in biotinylated fusion aptamers diluted to a final concentration of 100 nM in sodium phosphate buffer containing each potassium chloride concentration and reacted at room temperature for 1 hour. After washing, commercially available streptavidin-fused alkaline phosphatase was diluted 1000-fold and reacted at room temperature for 1 hour. The chemiluminescent substrate CDP-Star (Sigma-Aldrich) was added and reacted at room temperature for 5 minutes, after which chemiluminescence was observed using a chemiluminescence imager ImageQuant LAS4000 (GE Healthcare).

[0125] The results are shown in Figure 8. As shown in Figure 8, strong chemiluminescence was observed regardless of whether sodium acetate buffer or sodium phosphate buffer was used, and regardless of whether the potassium chloride concentration was 10 mM or 150 mM. In particular, strong chemiluminescence was observed for all targets for fusion aptamers folded using sodium phosphate buffer containing 10 mM potassium chloride (pH 7.0).

[0126] [Example 5: Investigation of the mixing ratio of myoglobin and fusion aptamer] The fusion aptamer (PEA3-01-RBD-46), diluted to 10 μM in sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride, was folded in the same manner as in Example 3. In a 96-well plate, 10 μL each of 100 nM myoglobin (Life Diagnostics) and fusion aptamer were mixed after dilution with sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride, resulting in molar ratios of 1:10, 1:5, 1:2, 1:1, 1:0.5, 1:0.1, and 1:0. The mixtures were left to stand at room temperature for 1 hour. 80 μL each of 50 mM Tris buffer (pH 8.0) containing 0.5 mM hydrogen peroxide (Kanto Chemical), 100 μM luminol (Tokyo Chemical Industry), and 10 mM potassium chloride was added, and the chemiluminescence intensity was immediately measured every minute using a plate reader (Thermo Fisher Scientific).

[0127] The results are shown in Figure 9. As shown in Figure 9, the chemiluminescence intensity increased in a ratio-dependent manner up to a mixing ratio of 1:5. Three minutes after the start of measurement, it was found that the chemiluminescence intensity increased by up to 374 times when five times the amount of fusion aptamer was added compared to the chemiluminescence intensity in the absence of the fusion aptamer, indicating that the fusion aptamer greatly enhanced the peroxidase activity of myoglobin.

[0128] [Example 6: Detection of inactivated SARS-CoV-2 virus 1] An antibody-enzyme complex was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. As shown in Example 4, the fusion aptamer (PEA3-01-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme complex, 2 μM myoglobin, 10 μM fusion aptamer, and 50 dC, 30 dC, or 10 dC inactivated SARS-CoV-2 virus were mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. For comparison, the same experiment was performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of inactivated SARS-CoV-2 virus. 80 μL of Tris buffer (pH 8.0) containing 100 mM glucose (Fujifilm Wako Pure Chemical Industries), 100 μM luminol (Tokyo Chemical Industries), 0.1 nM catalase (Fujifilm Wako Pure Chemical Industries), and 10 mM potassium chloride was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0129] Figure 10 shows the results of chemiluminescence intensity measurements 2 minutes after the start of measurement. An inactivated virus dose-dependent increase in chemiluminescence intensity was observed from 10 dC to 50 dC. In contrast, inactivated influenza virus and bovine serum albumin, used for comparison, showed chemiluminescence intensity similar to the background. Therefore, it was demonstrated that inactivated SARS-CoV-2 is detectable. The sensitivity, represented by the slope of the calibration curve, was 39 dC. -1 The detection limit, which is three times the standard deviation of the background, was calculated to be 9.8 dC.

[0130] [Example 7: Detection of inactivated SARS-CoV-2 virus 2] An antibody-enzyme complex was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. In this example, unlike the fusion aptamer (PEA3-01-RBD-46) used in Example 4, a fusion aptamer (PS2.M-RBD-46) consisting of the nucleotide sequence of Sequence ID No. 43 was used. This fusion aptamer (PS2.M-RBD-46) was designed with a nucleotide sequence in which PS2.M and RBD-46 are arranged in that order from the 5' end to the 3' end, and was prepared by chemical synthesis. PS.2 is known as an aptamer that binds to hemin and increases the peroxidase activity at hemin, as disclosed in Cheng et al., Biochemistry, 2009, 48, 7817-7823.

[0131] In this example, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme complex, 1 μM hemin, 1 μM fusion aptamer, and inactivated SARS-CoV-2 virus at concentrations of 50 dC, 25 dC, 12.5 dC, 5 dC, or 2.5 dC were mixed into a 96-well plate and allowed to stand at room temperature for 1 hour. 80 μL of a reaction solution consisting of 200 mM glucose (Fujifilm Wako Pure Chemical Industries) and BM chemiluminescence ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0132] Figure 11 shows the results of measuring chemiluminescence intensity in this example. As shown in Figure 11, a virus-load-dependent increase in chemiluminescence was observed within the range of inactivated SARS-CoV-2 virus loads tested. This example demonstrates that inactivated SARS-CoV-2 can be detected by using hemin as the porphyrin and a fusion aptamer that increases the peroxidase activity of hemin.

[0133] [Example 8: Detection of inactivated SARS-CoV-2 virus under modified conditions 3] An antibody-enzyme complex was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. In this example, as in Example 7, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme complex, 1 μM hemin, 1 μM fusion aptamer, and inactivated SARS-CoV-2 virus at concentrations of 50 dC, 25 dC, 12.5 dC, 5 dC, or 2.5 dC were mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. For comparison, the experiment was similarly performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of inactivated SARS-CoV-2 virus. 80 μL of a reaction solution consisting of 154 mM glucose (Fujifilm Wako Pure Chemical Industries), 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), and BM chemiluminescence ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0134] Figure 12 shows the results of measuring chemiluminescence intensity in this example. As shown in Figure 12, similar to Example 7, a virus-load-dependent increase in chemiluminescence was observed within the range of inactivated SARS-CoV-2 virus amounts tested. In particular, in this example, it was confirmed that the overall chemiluminescence intensity was even higher than under the conditions of Example 7. On the other hand, for inactivated influenza virus and bovine serum albumin used for comparison, chemiluminescence intensity at a level similar to the background was observed.

[0135] [Example 9: Investigation of visual detection of inactivated SARS-CoV-2 virus] In this example, the mixing ratio of the fusion aptamer (PS2.M-RBD-46) and hemin was changed to investigate a reaction system for visually detecting inactivated SARS-CoV-2 virus. In this example as well, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. In a 96-well low-adsorption protein plate, 5 μL each of 10 μM fusion aptamer and hemin of various concentrations (100 μM, 70 μM, 50 μM, 20 μM, 10 μM, or 5 μM) were mixed with 10 μL each of sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride, and the mixture was allowed to stand at room temperature for 1 hour. 80 μL of a reaction solution consisting of 200 mM glucose (Fujifilm Wako Pure Chemical Industries), 0.1 mM hydrogen peroxide (Fujifilm Wako Pure Chemical Industries), and BM chemiluminescence ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0136] Figure 13 shows the results of measuring the chemiluminescence intensity in this example. As shown in Figure 13, it was found that when the mixing ratio of the fusion aptamer (PS2.M-RBD-46) to hemin (fusion aptamer:hemin) is 1:5, that is, when the hemin concentration exceeds 5 times the aptamer concentration, extremely excellent chemiluminescence intensity can be achieved.

[0137] [Example 10: Visual detection of inactivated SARS-CoV-2 virus] In this example, a system for visually detecting inactivated SARS-CoV-2 virus was constructed. An antibody-enzyme complex was prepared using the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx prepared in Example 1. In this example, as in Example 7, the fusion aptamer (PS2.M-RBD-46) was folded in sodium phosphate (pH 7.0) containing 10 mM potassium chloride. 5 μL each of 1 μM antibody-enzyme complex, 50 μM hemin, 10 μM fusion aptamer, and 50 dC, 40 dC, 25 dC, or 15 dC inactivated SARS-CoV-2 virus were mixed in a 96-well plate and allowed to stand at room temperature for 1 hour. For comparison, the experiment was similarly performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of inactivated SARS-CoV-2 virus. 80 μL of a reaction solution consisting of 200 mM glucose (Fujifilm Wako Pure Chemical Industries), 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), and BM chemiluminescent ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader. Similarly, the post-reaction solution prepared on a plate was imaged using the camera function of an iPhone 12 to detect chemiluminescence.

[0138] Figure 14 shows the results of measuring chemiluminescence intensity in this embodiment, and Figure 15 shows the results of imaging with an iPhone® 12. As shown in Figure 14, remarkably high chemiluminescence intensity was observed under the conditions of this embodiment, and it was confirmed that the chemiluminescence intensity increased in a virus amount-dependent manner. Furthermore, as shown in Figure 15, it was demonstrated that chemiluminescence on the plate could be detected by the camera function of the iPhone® 12 under the conditions of this embodiment (ISO sensitivity: 8000, F-number: 1.6, shutter speed: 1.1 seconds (3-second exposure in night mode)). Note that under these conditions, 1.5 × 10 7 It was possible to detect signals up to the level of au (a Japanese mobile carrier).

[0139] [Example 11: Experiment to detect inactivated SARS-CoV-2 virus by spraying reaction solution] In this example, the aim was to construct a system capable of on-site detection of the presence of the virus, and to verify whether inactivated SARS-CoV-2 virus could be detected by spraying the reaction solution. In this example, inactivated SARS-CoV-2 at 50 dC, 25 dC, or 0 dC was spotted onto a nitrocellulose membrane and dried at room temperature for several minutes. Next, 15 μL of a reaction solution containing a 333 nM antibody-enzyme complex, a 3.3 μM fusion aptamer, and 16.7 μM hemin was spotted and incubated at room temperature for 20 minutes. An 800 μL dispenser was filled with a detection solution consisting of Solution A (Roche) of the BM chemiluminescent ELISA substrate (POD) containing a final concentration of 250 mM glucose (Fujifilm Wako Pure Chemical Industries) and a final concentration of 30 ng / mL catalase (Fujifilm Wako Pure Chemical Industries). Finally, the detection solution was sprayed onto the membrane, and chemiluminescence was detected by imaging the membrane with the camera function of an iPhone® 12.

[0140] Figure 16 shows the results of imaging the surface of the membrane with an iPhone® 12. As shown in Figure 16, it was demonstrated that inactivated SARS-CoV-2 viruses spotted on the nitrocellulose membrane could be detected by the camera function of the iPhone® 12 after spraying the detection solution (ISO sensitivity: 4000, F-number: 1.6, shutter speed: 3.3 seconds (29 seconds shooting in night mode)). Under these conditions, 9.0 × 10 5 It was possible to detect signals up to the level of au (a Japanese mobile carrier).

[0141] [Example 12: Preparation of antibody-enzyme complex for influenza virus detection] In this example, SpyTag-fused anti-influenza virus hemagglutinin antibody scFv was prepared by recombinant production using Escherichia coli BL21(DE3) strain (SEQ ID NO: 44). In this example as well, an antibody-enzyme complex was prepared by mixing SpyCatcher-GOx, prepared in the same manner as in Example 1, with the SpyTag-fused anti-influenza virus hemagglutinin antibody scFv.

[0142] Subsequently, the prepared antibody-enzyme complex was examined for band formation by SDS-PAGE. The SDS-PAGE results are shown in Figure 17. A clear band was observed near the molecular weight at which complex formation is predicted to have occurred due to covalent bond formation between SpyCatcher and SpyTag. From these results, it was determined that a complex was formed between glucose oxidase and the antibody against influenza virus hemagglutinin.

[0143] [Example 13: Detection of inactivated influenza virus] In this example, a fusion aptamer was synthesized by combining an aptamer that binds to hemagglutinin of the influenza virus (2R-01, SEQ ID NO: 45) with an aptamer that increases peroxidase activity (PEA3-01) disclosed in Japanese Patent Application Publication No. 2017-200472. The fusion aptamer synthesized in this example was designed as PEA3-01-2R-01 (SEQ ID NO: 46), in which PEA3-01 and 2R-01 are arranged in that order from the 5' end to the 3' end, and was prepared by chemical synthesis. In PEA3-01-2R-01, a ttt sequence is inserted between PEA3-01 and 2R-01.

[0144] In this example, as in Example 4, PEA3-01-2R-01 was folded using sodium phosphate buffer (pH 7.0) containing 10 mM potassium chloride. A 1 μM antibody-enzyme complex, 2 μM myoglobin, and 10 μM PEA3-01-2R-01 were placed in a 96-well plate, with a total volume of 55 × 10⁶. 4 , 40×10 4 , 20×10 4 , 55×10 3 , 22×10 3 or 55 × 10 2 5 μL each of inactivated influenza virus particles were mixed and allowed to stand at room temperature for 1 hour. In this example, as in Example 6, the reagents were mixed and the chemiluminescence intensity was measured.

[0145] Figure 18 shows the measurement results of the chemiluminescence intensity 2 minutes after the start of measurement. As shown in Figure 18, 55 × 104 From 55 x 10 2 An increase in chemiluminescence intensity dependent on the amount of inactivated influenza virus up to the particle was observed. This example demonstrates that influenza viruses can be detected in the same way as SARS-CoV-2 viruses.

[0146] [Example 14: Detection of inactivated SARS-CoV-2 by antibody-enzyme complex] In this example, instead of using a fusion aptamer, a system for detecting inactivated SARS-CoV-2 virus was constructed using an antibody-enzyme complex consisting of the anti-SARS-CoV-2 S protein antibody scFv and SpyCatcher-GOx, which was prepared in Example 1 (Figure 2).

[0147] In this example, first, 5 μL each of 1 μM antibody-enzyme complex, 50 dC, 25 dC, 12.5 dC, 5 dC, or 2.5 dC inactivated SARS-CoV-2 virus were mixed in a 96-well plate, along with 10 μL of sodium phosphate (pH 7.0) containing 10 mM potassium chloride, and the mixture was allowed to stand at room temperature for 1 hour. For comparison, the experiment was similarly performed using 50 particles of inactivated influenza virus (Sino Bio) or 500 ng of bovine serum albumin (Thermo Fisher Scientific) instead of inactivated SARS-CoV-2 virus. 80 μL of a reaction solution consisting of 154 mM glucose (Fujifilm Wako Pure Chemical Industries), 24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), and BM chemiluminescence ELISA substrate (POD) solution A (Roche) was added, and the chemiluminescence intensity was immediately measured using a plate reader.

[0148] Figure 19 shows the results of measuring the chemiluminescence intensity in this example. As shown in Figure 19, an increase in chemiluminescence intensity dependent on the amount of inactivated SARS-CoV-2 virus was observed from 2.5 to 25 dC. This example demonstrates that the virus (inactivated SARS-CoV-2 in this example) can be detected using the antibody-enzyme complex prepared in Example 1, luminol reagent, and glucose by utilizing the promotion of the luminol reaction due to the presence of the virus and antibody-enzyme complex in the same reaction system.

[0149] [Example 15: Detection of inactivated SARS-CoV-2 virus, and examination of reaction time] Chemiluminescence intensity was measured in the same manner as in Example 6, except that 5 μL each of 1 μM antibody-enzyme complex, 2 μM myoglobin, 10 μM fusion aptamer, and inactivated SARS-CoV-2 virus at 50 dC, 30 dC, or 10 dC were mixed in a 96-well plate and allowed to stand at room temperature for 15 minutes. The results of the chemiluminescence intensity measurement 2 minutes after the start of measurement are shown in Figure 20. As shown in Figure 20, an increase in chemiluminescence intensity dependent on the amount of inactivated virus was observed from 50 dC to 500 dC. From the results of this example, it became clear that inactivated SARS-CoV-2 virus can be detected in a shorter time.

[0150] [Example 16: Preparation of Mms13-SC-Flag-BMP] In this example, to construct the system shown in Figure 3, magnetic particles (referred to as Mms13-SC-Flag-BMP) were created, having a fusion protein of the Mms13 protein and a spycatcher (hereinafter referred to as SC) on their surface. The fusion protein of the Mms13 protein and SC has a Flag tag fused to the downstream (C-terminal) end of the SC so that it can be detected by a tagged antibody. First, we used the magnetic bacterium Magnetospirillum magneticum AMB-1 wild strain in OD. 660 Competent cells were prepared by aerobic culture to 0.3, centrifugation at 8,000 g and 4°C for 10 minutes, and washing the cell pellet with TES buffer (10 mM TES, 272 mM Glyserol, pH 7.4). An expression vector pUMtOR13-SC-Flag was constructed by fusing SpyCatcher (SC) and a Flag tag to Mms13, and the magnetic bacterium M. magneticum AMB-1 strain was transformed by electroporation, and 10 mM Mg 2+The cells were recovered in Magnetic Spirillum growth medium (MSGM) containing [ingredient name] for 6-12 hours. Then, the transformants were inoculated into 40 mL of MSGM medium (Amp, fc 0.5 μg / mL), microaerophilic conditions were created by argon displacement, and the cells were incubated statically at 28°C for approximately 5 days. Afterward, the cells were subcultured in 40 mL of MSGM medium (Amp, fc 5 μg / mL) and cultured under the same conditions until the stationary phase. Initial cell concentration of 1.0 × 10⁶ was obtained in 4000 mL of MSGM medium (Amp, fc 5 μg / mL) in a 5000 mL Erlenmeyer flask. 5 Inoculate with cells / mL and culture at 28°C, then reach the mid-logarithmic growth phase (3.0-5.0 × 10⁴). 7 To a culture medium (cells / mL), ATc (fc 100 ng / mL), succinic acid (fc 1.52 mM), sodium nitrate (fc 3.16 mM), and iron(II) sulfate heptahydrate (fc 0.194 mM) for expression induction were added after filter sterilization and cultured for 2 days under light-shielding conditions. The culture medium was centrifuged at 4°C and 8,000 g for 15 minutes. The resulting cells were suspended in 10 mM HEPES buffer (pH 7.4) and then crushed using a French press (Otake Seisakusho Co., Ltd.). Subsequently, magnetic separation was performed using a neodymium-iron-boron (Nd-Fe-B) magnet, the supernatant was removed, and the cells were resuspended in HEPES. This procedure was repeated 10 times to obtain purified Mms13-SC-Flag-BMP. The nucleotide sequence encoding the Mms13-SC-Flag fusion protein and the amino acid sequence of the fusion protein are shown in SEQ ID NOs. 47 and 48, respectively. In the amino acid sequence shown in Sequence ID No. 48, positions 1-127 from the N-terminus are Mms13, positions 128-243 are spycatchers, and positions 244-251 are Flag tags.

[0151] Next, the expression of the Mms13-SC-Flag fusion protein in purified Mms13-SC-Flag-BMP was confirmed. The membrane protein fraction was extracted from the BMP by adding 5 μL of 1% SDS to 100 μg of purified Mms13-SC-Flag-BMP and heating at 99°C for 15 minutes. 5 μL of the supernatant, separated by magnetic separation, was spotted onto a nitrocellulose membrane and fixed by air drying. Next, the membrane was blocked by shaking for 1 hour with PBS-T dissolved in 2% (w / v) bovine serum albumin (BSA). This membrane was washed three times with PBS-T (0.05% (v / v) Tween20 in PBS buffer), and then shaken for 1 hour with anti-Flag antibody diluted 5000-fold in PBS-T. After washing three times with PBS-T, the membrane was shaken for 1 hour with HRP-modified anti-mouse antibody diluted 5000-fold in PBS-T. After washing three times with PBS-T, Immobilon Western Chemiluminescent HRP Substrate (Roche) was added dropwise. After standing at room temperature for 5 minutes in the dark, the chemiluminescence intensity was measured using a chemiluminescence intensity imager ImageQuant LAS4000 (GE Healthcare). The same procedure was performed on Mms13-BMP without SC-Flag fusion as a negative control.

[0152] The results are shown in Figure 21. As shown in Figure 21, the membrane fraction of Mms13-SC-Flag-BMP showed a stronger chemiluminescence intensity than the membrane fraction of Mms13-BMP. This indicates that the Mms13-SC-Flag fusion protein is expressed in magnetobacteria, and that magnetic particles (Mms13-SC-Flag-BMP) having the Mms13-SC-Flag fusion protein on their surface can be produced.

[0153] [Example 17: Functional evaluation of Mms13-SC-Flag-BMP (composite formation evaluation)] 1.5 mg of Mms13-SC-Flag-BMP prepared in Example 16 was mixed with 50 μL of 7.5 μM Variable domain of heavy chain of heavy chain antibody-SpyTag (VHH-ST) prepared by recombinant production using E. coli BL21(DE3) strain, and incubated overnight at 4°C. This resulted in the production of VHH-presenting BMP (VHH-BMP) through a reaction between SC in Mms13-SC-Flag-BMP and ST in VHH-ST (SC / ST reaction). The nucleotide sequence encoding the VHH-ST fusion protein produced in this example and the amino acid sequence of the fusion protein are shown in SEQ ID NOs. 49 and 50, respectively. In the amino acid sequence shown in SEQ ID NO. 50, positions 23-149 from the N-terminus are VHH, and positions 156-168 are the spy tag.

[0154] Furthermore, unreacted VHH-ST was removed by magnetic separation. The protein was suspended in 100 μL of 0.2 M NaCl (pH 7.0) in 20 mM PPB, and the supernatant was removed by magnetic separation. This procedure was repeated three times for washing. 5 μL of 1% SDS was added to the BMP, and the membrane protein fraction was extracted from the BMP by heating at 99°C for 15 minutes. The extracted membrane proteins were subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). The proteins were transferred from the gel to a nitrocellulose membrane, washed with PBS-T, and then blocked by shaking for 1 hour in PBS-T (PBS-MT) containing 5% skim milk. After washing with PBS-T, the proteins were shaken for 30 minutes with HRP-modified anti-His antibody (QIAGEN) diluted 15,000-fold in PBS-MT. After washing with PBS-T, the chemiluminescence intensity was measured in the same manner as in Example 16. The same procedure was performed on Mms13-BMP without SC-Flag fusion as a negative control.

[0155] The results are shown in Figure 22. As shown in Figure 22, in the lane where only VHH-ST was electrophoresed, only the chemiluminescence intensity derived from VHH-ST (19 kDa) was observed, whereas in the lane where the VHH-BMP membrane protein was electrophoresed, the chemiluminescence intensity was observed around the theoretical molecular weight of Mms13-VHH (46 kDa). This suggests that Mms13-SC-Flag-BMP and VHH-ST bound via an SC / ST reaction, forming VHH-BMP. This result demonstrates that Mms13-SC-Flag-BMP capable of supporting a target substance containing ST on its surface could be prepared.

[0156] [Example 18: Evaluation of binding ability of scFv-BMP] In this example, an anti-CRP scFv antibody against C-reactive protein (CRP) was modified to produce scFv-ST by adding a SpyTag, and an anti-CRPscFv antibody-presenting BMP (scFv-BMP) was created. The nucleotide sequence encoding the scFv-ST fusion protein produced in this example and the amino acid sequence of the fusion protein are shown in SEQ ID NOs. 51 and 52, respectively. In the amino acid sequence shown in SEQ ID NO. 52, positions 27-269 from the N-terminus are the anti-CRP scFv antibody, and positions 284-296 are the SpyTag.

[0157] First, 40 μg of scFv-BMP suspended in carbonic acid-bicarbonate buffer was added to each of the 96 well plates (Thermo Fisher, white MaxiSorp) and allowed to stand for 1 hour to immobilize on the plate. After washing three times with PBS-T, 300 μL of 1×PBS containing 2% BSA was added to each well and allowed to stand for 2 hours to block. After washing three times with PBS-T, 100 μL of 100 nM C-reactive protein (CRP, Oriental Yeast Co., Ltd.) diluted in PBS containing 2% BSA (2% BSA / PBS) was added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of 100 nM Mouse anti-CRP IgG (Cat.# 4C28 Mab C2) (HyTest) diluted in 2% BSA / PBS was added to each well and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of HRP-modified anti-mouse IgG (Promega) diluted 10,000-fold in 2% BSA / PBS was added and allowed to stand for 1 hour. After washing three times with PBS-T, 100 μL of HRP substrate (Roche) was added, and the chemiluminescence intensity was measured using a plate reader (Thermofisher Scientific). The same procedure was also performed for Mms13-SC-Flag-BMP not incubated with scFv-ST and Mms13-BMP incubated with scFv-ST as negative controls, and for 14.7 ng / mL scFv-ST as a positive control.

[0158] The results are shown in Figure 23. As shown in Figure 23, strong chemiluminescence intensity was observed in the positive control, indicating that the presence or absence of binding ability can be correctly confirmed in this system. Furthermore, as shown in Figure 23, the addition of CRP resulted in significantly higher chemiluminescence intensity compared to the negative control without CRP, indicating that anti-CRP scFv-BMP has the ability to bind to CRP. On the other hand, as shown in Figure 23, chemiluminescence intensity was also observed in the negative control without CRP and the negative control without mouse anti-CRP IgG. This is thought to be because almost no chemiluminescence intensity was observed with Mms13-SC-Flag-BMP, suggesting that HRP-modified anti-mouse IgG is non-specifically adsorbed to scFv on BMP.

[0159] [Example 19: Preparation of antibody-enzyme complex and evaluation of binding ability] SpyCatcher-GOx, prepared in the same manner as in Example 1, and scFv-ST, which was obtained by adding a SpyTag to the anti-CRPscFv antibody prepared in Example 18, were stoichiometrically mixed and allowed to stand. In this example, each was diluted with phosphate buffer (pH 7.0) to make 5 μM solutions, which were then mixed in equal volumes and allowed to stand overnight at 4°C. Evaluation by SDS-polyacrylamide gel electrophoresis (SDS-PAGE) (Figure 24) showed a clear band near the molecular weight where complex formation between GOx and scFv-ST via covalent bonding between SpyCatcher / SpyTag is predicted. Therefore, it was determined that an antibody-enzyme complex with specific binding ability to CRP and glucose oxidase activity was formed.

[0160] In this example, the binding ability of the prepared antibody-enzyme complex to CRP was evaluated. First, 100 μL each of 100 nM CRP suspended in carbonic acid-bicarbonate buffer was added to a 96-well plate (Thermo Fisher, white MaxiSorp) and allowed to stand for 1 hour at 25°C. After washing three times with TBS buffer containing 0.05% Tween (TBS-T), 300 μL each of 1×TBS-T containing 1% BSA (1% BSA / TBS-T) was added and the plates were blocked for 1 hour at 25°C. After washing three times with TBS-T, 100 μL each of antibody-enzyme complexes of various concentrations (0, 1.25, 2.5, 5, 12.5, 25, 50, and 100 nM) diluted with 1% BSA / TBS-T was added and allowed to stand for 1 hour at 25°C. In this procedure, 1% BSA / TBS-T was added to the negative control and 100 nM scFv-ST was added to the positive control. After washing three times with TBS-T, 100 μL of HRP-modified anti-c-myc antibody diluted 5000-fold with 1% BSA / TBS-T was added to each sample, and the samples were allowed to stand at 25°C for 1 hour. After washing three times with TBS-T, 100 μL of HRP substrate (Roche) was added, and the chemiluminescence intensity was measured.

[0161] The results are shown in Figure 25. As shown in Figure 25, an increase in chemiluminescence intensity dependent on the antibody-enzyme complex concentration was observed. This indicates that the antibody-enzyme complex prepared in this example has the ability to bind to CRP (dissociation constant K). D (=37.3nM).

[0162] [Example 20: Evaluation of CRP capture by scFv-BMP and antibody-enzyme complex] In this example, a CRP capture evaluation test was performed using the antibody-enzyme complex prepared in Example 19 and the anti-CRPscFv antibody-presenting BMP (scFv-BMP) prepared in Example 18.

[0163] First, 120 μg of anti-CRP scFv antibody-presenting BMP (scFv-BMP) was added to a 0.5 mL protein LoBind tube. 200 μL of 2% BSA / TBS was then added, and the scFv-BMP was dispersed by sonication. The tube was then incubated at 25°C for 1 hour, with sonication performed every 15 minutes to further disperse the scFv-BMP. Next, 100 μL of TBS-T was added, and the scFv-BMP was dispersed by sonication. Magnetic separation was then performed, and the supernatant was removed. This washing procedure was repeated five times. Subsequently, 100 μL of CRP (concentrations: 0, 100, 250 nM) diluted in 20 mM PPB pH 7.0 was added, and the BMP was dispersed by sonication. The tube was incubated at 25°C for 1 hour. As negative controls, 100 μL each of BSA (Thermo Scientific) and EGFR 250 nM were added and incubated similarly. After five washes, 100 μL of 100 nM antibody-enzyme conjugate (GOx-scFv) diluted with 2% BSA / TBS-T was added. After dispersing the scFv-BMP by sonication, it was incubated at 25°C for 1 hour. After five washes, 30 μL of 20 mM PPB pH 7.0 was added, and after dispersing the scFv-BMP by sonication, 40 μg / 10 μL of scFv-BMP was added to 96-well plates (NUNK, clear). To this, 100 μL of the reaction solution (fc 2 U / mL horseradish peroxidase, fc 1.5 mM N-ethyl-N-(2-hydroxy-3-sulfopropyl)-3-methoxyaniline (TOOS), fc 1.5 mM 4-aminoantipyrine (4AA), fc 200 mM glucose (Fujifilm Wako Pure Chemical Industries), and 20 mM PPB (pH 7.0)) was added and the reaction was carried out. After magnetic separation, the absorbance of the separated reaction solution at 555 nm was measured.

[0164] The results are shown in Figure 26. As shown in Figure 26, there was almost no increase in absorbance when CRP was not added, or when the negative controls BSA or EGFR were added, whereas a concentration-dependent increase in absorbance was observed when CRP was added. This indicates that CRP can be captured by both scFv-BMP and the antibody-enzyme complex.

[0165] [Example 21: Peroxidase activity and CRP detection of Mms13-SC-Flag-BMP] In this example, the peroxidase activity of Mms13-SC-Flag-BMP was first measured. For information on peroxidase activity in magnetic particles, please refer to Nat. Nanotechnol., 2007, 2, 577-583. The Mms13-SC-Flag-BMP prepared in Example 16 was washed three times, and then 40 μg / 5 μL of Mms13-SC-Flag-BMP was added to a 96-well plate (NUNK, clear). 95 μL of reaction solution (fc0, 6, 30, 60, 150, 300 or 600 mM H2O2 (Fujifilm Wako Pure Chemical Industries), TMB (Nacalai Tesque)) was added, and after sufficient reaction, 100 μL of reaction stop solution from the same kit (ELISA POD substrate TMB kit (HYPER)) was added to stop the reaction. The absorbance of this solution at 450 nm was measured, and the kinetic parameters (K M、 V max ) was calculated.

[0166] As a result (Figure 27), K M It is 14.5 mM, V max is 0.61 × 10 -8 Ms -1 The calculated value confirmed that it possesses peroxidase activity nearly equivalent to that found in the literature.

[0167] Next, in this example, complexes of scFv-BMP, CRP, and GOx-scFv were formed in the same manner as in Example 20 (i.e., with washing), and 40 μg / 10 μL each were added to a 96-well plate (Thermo Fisher, polypropylene, white). 100 μL of the reaction solution (fc200 mM glucose, fc24 ng / mL catalase (Fujifilm Wako Pure Chemical Industries), luminol (Tokyo Chemical Industries)) was added, and the chemiluminescence intensity was measured using a plate reader.

[0168] The results are shown in Figure 28. As shown in Figure 28, when CRP was not added, and when the negative controls BSA and EGFR were added, only background-level signals were observed. In contrast, an increase in chemiluminescence intensity dependent on CRP concentration was confirmed in the concentration range of 10 to 250 nM. This indicates that a complex of scFv-BMP, CRP, and GOx-scFv is formed in a CRP concentration-dependent manner, and that the luminol reaction proceeds when the peroxidase activity of scFv-BMP utilizes H2O2 and luminol produced by the enzymatic reaction of GOx contained in the complex as substrates. Therefore, it was shown that the formation of this complex, i.e., the presence or absence of CRP, can be detected by detecting the luminescence associated with the luminol reaction.

[0169] On the other hand, unlike Example 20, this example investigated whether CRP could be detected similarly without a washing procedure. Specifically, 90 μL of CRP (fc 0, 10, 50, 100, 150 or 250 nM) and GOx-scFv (fc 100 nM), diluted with 2% BSA / TBS-T, were added to scFv-BMP blocked with 2% BSA / TBS. After dispersing the BMP by sonication, it was incubated at 25°C for 30 minutes. During this time, the BMP was dispersed by sonication every 10 minutes. Then, 40 μg / 30 μL of BMP was added to a 96-well plate (Thermo Fisher, polypropylene, white). 80 μL of the reaction solution (fc 200 mM glucose, fc 24 ng / mL catalase and luminol) was added, and the chemiluminescence intensity was measured using a plate reader.

[0170] The results are shown in Figure 29. As shown in Figure 29, a CRP concentration-dependent increase in chemiluminescence intensity was observed in the concentration range of 10–250 nM. This indicates that a simple system can be constructed that does not require washing when detecting target substances using scFv-BMP as an acceptor. Furthermore, the sensitivity in the range of 10–250 nM was 5.81 nM. -1 This was the calculated result.

[0171] [Example 22: Peroxidase activity and CRP detection of Mms13-SC-Flag-BMP] In this example, we investigated a system for detecting target substances without a washing step, as examined in Example 21, but without catalase in the reaction solution. Specifically, in this example, the scFv-BMP, CRP, and GOx-scFv complexes were added to a 96-well plate in the same manner as in Example 21 without a washing step, 80 μL of the reaction solution (fc200 mM glucose and luminol) was added, and the chemiluminescence intensity was measured using a plate reader.

[0172] The results are shown in Figure 30. As shown in Figure 30, even without the use of catalase, a CRP concentration-dependent increase in chemiluminescence intensity was observed in the range of 10–250 nM. Furthermore, the sensitivity in the range of 10–250 nM was 15.6 nM. -1 The result was calculated as follows. Figure 31 shows the results compared with those of Example 21, which used catalase. As shown in Figure 31, the sensitivity was improved when catalase was not included. It is thought that when catalase was added, not only the free hydrogen peroxide but also the hydrogen peroxide on the acceptor surface was decomposed, causing a decrease in signal and sensitivity. Therefore, it was found that in systems that utilize the peroxidase activity on the surface of magnetic particles, it is better not to include catalase in the reaction solution.

Claims

1. A first enzyme having oxidase activity that has the ability to bind to a target substance supported on a virus or magnetic particle exhibiting peroxidase activity, and catalyzes an oxidation reaction to produce hydrogen peroxide, The first substrate is a substrate of the first enzyme, A second substrate which is a substrate for peroxidase activity in the above-mentioned virus or magnetic particles, A detection kit for target substances that do not have aptamers that act on porphyrins exhibiting peroxidase activity to increase peroxidase activity.

2. The detection kit according to claim 1, characterized in that the first enzyme and the first substrate are glucose oxidase and glucose, respectively, and the second substrate is luminol.

3. The detection kit according to claim 1, characterized by comprising a first reagent containing at least the first substrate and a second reagent containing at least the first enzyme.

4. The detection kit according to claim 1, characterized in that the magnetic particles have either a tag peptide or a tag-capturing peptide produced by magnetic bacteria on their surface, the target substance is a protein fused with either the tag peptide or the tag-capturing peptide, and is bound to the magnetic particles via the tag peptide and the tag-capturing peptide.

5. A step of mixing a detection kit according to any one of claims 1 to 4 with a sample that may contain a target substance, A step of measuring the enzymatic reaction based on peroxidase activity in the above-mentioned virus or magnetic particles, and A method for detecting a target substance, comprising the above-mentioned enzymatic reaction, characterized by detecting the target substance in the above-mentioned sample based on the above-mentioned enzymatic reaction.