Method for detecting propionic acid-producing bacteria
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- NAT AGRI & FOOD RES ORG
- Filing Date
- 2024-12-13
- Publication Date
- 2026-06-25
AI Technical Summary
Conventional methods for measuring propionic acid ratios in ruminant livestock require specialized equipment and facilities, and existing microbial community detection methods lack specificity and quantification, leading to lengthy analysis times and inadequate identification of propionic acid-producing bacteria.
Development of specific primers targeting uncultured Syntrophococcus bacteria, allowing for rapid and accurate detection and quantification of propionic acid-producing bacteria using PCR, enabling the identification of ruminants with high propionic acid ratios.
Enables quick and easy measurement of propionic acid ratios without specialized equipment, providing quantitative data for propionic acid production and correlating with methane production, facilitating breeding selection and methane reduction strategies.
Smart Images

Figure 2026103998000002 
Figure 2026103998000003 
Figure 2026103998000004
Abstract
Description
Technical Field
[0001] The present invention relates to a novel primer, a method for detecting propionic acid-producing bacteria using this primer, and a method for identifying ruminant individuals with a high propionic acid ratio using this primer.
Background Art
[0002] Ruminant livestock decompose and ferment the ingested feed by the action of the microbiota inhabiting the rumen (first stomach), and absorb and utilize short-chain fatty acids (such as propionic acid, acetic acid, butyric acid, etc.), which are fermentation products. Hydrogen generated during the production of acetic acid and butyric acid is converted into methane by methanogenic archaea and released into the atmosphere. There are 1.5 billion cows raised worldwide, and methane derived from rumen fermentation in ruminant livestock is a major greenhouse gas emission source, accounting for 40% of the greenhouse gases emitted from the agricultural sector. Also, as the energy of methane gas, about 5 - 12% of the feed energy that should be used for livestock growth and milk production is lost. For the reduction of greenhouse gas emissions and the improvement of the productivity of ruminant livestock, research and development on methane reduction technologies from rumen fermentation in cows are being promoted in various countries.
[0003] In the development of methane reduction technologies, research focusing on the propionic acid ratio in the rumen has been underway. In the rumen, methane production and propionic acid production are in an antagonistic relationship regarding hydrogen consumption, and it is known that cows with a dominant propionic acid production have a lower methane production. It is known that Prevotella lacticifex and uncultured Succinivibrio bacteria are abundant in cows with a high propionic acid ratio in the rumen, and the present inventor has filed a patent application for a novel primer set for detecting and quantifying these bacteria (Japanese Patent Application No. 2023 - 088893, which has not been published at the time of filing this application).
[0004] The propionic acid ratio in the rumen of cattle is measured using a gas chromatograph or high-performance liquid chromatograph after gastric juice has been collected from the cattle and subjected to filtration and other treatments, but this requires specialized equipment and facilities.
[0005] In detecting microbial communities, complex analytical procedures are required to detect propionic acid-producing bacteria and determine their proportion within the overall bacterial community. These procedures include PCR amplification of DNA extracted from the rumen microbial community using universal primers (comprehensive primers targeting all bacteria) that target a partial sequence of the 16S rRNA gene (such as the V3-V4 region), sequencing of tens of thousands of DNA sequences using next-generation sequencers such as MiSeq, and analysis on dedicated platforms such as QIIME (Non-Patent Literature 1). [Prior art documents] [Non-patent literature]
[0006] [Non-Patent Document 1] Caporaso, J., Lauber, C., Walters, W. et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J 6, 1621-1624 (2012). [Overview of the Initiative] [Problems that the invention aims to solve]
[0007] Conventional methods for measuring propionic acid ratios require specialized equipment and facilities. On the other hand, conventional methods for detecting microbial communities are comprehensive occupancy surveys aimed at comparing samples, and do not provide quantitative data on specific bacteria. Furthermore, analysis by specialized testing laboratories using partial sequences of the 16S rRNA gene (such as the V3-V4 region) cannot identify which sequence corresponds to the target propionic acid-producing bacterium. Identification requires specialized analysis. Additionally, samples must be sent to specialized testing laboratories, and analysis takes approximately one month.
[0008] As described above, conventional methods for measuring propionic acid ratios and methods for estimating propionic acid production from microbial communities all have many problems. This invention was made against this backdrop and aims to provide a means for rapidly and easily measuring the propionic acid ratio in the rumen. [Means for solving the problem]
[0009] The inventors, after diligent research to solve the above problems, have found that the proportion of uncultured Syntrophococcus bacteria in the rumen of cattle is strongly correlated with the propionic acid ratio. Furthermore, the inventors have found that the above bacteria can be specifically detected and quantified by PCR using primers consisting of the nucleotide sequences described in SEQ ID NOs. 5 to 8. The present invention was completed based on these findings. That is, the present invention provides the following [1] to [7].
[0010] [1] A primer consisting of any of the following base sequences (a) to (d), (a) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 1, (b) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 2, (c) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 3, (d) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 4.
[0011] [2] The primer described in [1], wherein the base sequences of (a), (b), (c), and (d) are between 15 and 25 bases.
[0012] [3] The primer according to [1], wherein the base sequences of (a), (b), (c), and (d) are the base sequences described in Sequence ID Nos. 5, 6, 7, and 8, respectively.
[0013] [4] A primer as described in [1], used to detect propionic acid-producing bacteria in the rumen.
[0014] [5] A primer as described in [1], used to identify individuals of ruminants with a high propionic acid ratio in the rumen.
[0015] [6] A method for detecting propionic acid-producing bacteria in the rumen, comprising the following steps (1) to (4): (1) A process of collecting rumen fluid from ruminants, (2) A step of extracting DNA from the lumen contents collected in step (1), (3) A step of performing PCR using the DNA extracted in step (2) as a template and using primers described in any of [1] to [3], wherein the primers are a set of a primer consisting of the base sequence (a) and a primer consisting of the base sequence (b), or a set of a primer consisting of the base sequence (c) and a primer consisting of the base sequence (d). (4) A step to detect the DNA fragments amplified by PCR in step (3).
[0016] [7] A method for identifying individuals with a high propionic acid ratio in the rumen of ruminants, comprising the following steps (1) to (4): (1) A process of collecting rumen fluid from ruminants, (2) A step of extracting DNA from the lumen contents collected in step (1), (3) A step of performing quantitative PCR using the DNA extracted in step (2) as a template and the primer according to any one of [1] to [3], wherein the primer is a set of a primer consisting of the nucleotide sequence of (a) and a primer consisting of the nucleotide sequence of (b), or a set of a primer consisting of the nucleotide sequence of (c) and a primer consisting of the nucleotide sequence of (d). (4) A step of identifying an individual with a high propionate ratio in the rumen from the results of the quantitative PCR in step (3).
Advantages of the Invention
[0017] The present invention provides primers specific to uncultured Syntrophococcus bacteria. By using these primers, similar to the detection of conventional microorganisms, after collecting the rumen content fluid of cows, the presence, abundance, and ratio to total bacteria of anaerobic bacteria showing a strong correlation with the propionate ratio in the rumen of cows can be quickly and easily determined using a PCR device or the like. In addition, the obtained quantitative data can also be used for the development of a technique for estimating the propionate ratio from the rumen with individual differences.
[0018] Although analyzing the microbial community in the rumen of cows using specific primers exists as a research method, the primers of the present invention are new and have not been reported in the past. In addition, these primers are designed not only for the specificity of the nucleotide sequence but also for the utilization site and length of the sequence so as not to impair the function as a primer, and cannot be easily conceived from the prior art.
Brief Description of the Drawings
[0019]
Figure 1
Figure 2
Figure 3
Mode for Carrying Out the Invention
[0020] Hereinafter, the present invention will be described in detail. (A) Primer The primer of the present invention is a primer consisting of any of the following base sequences (a) to (d). (a) A continuous base sequence of 10 bases or more included in the base sequence described in SEQ ID NO: 1 below (b) A continuous base sequence of 10 bases or more included in the base sequence described in SEQ ID NO: 2 below (c) A continuous base sequence of 10 bases or more included in the base sequence described in SEQ ID NO: 3 below (d) A continuous base sequence of 10 bases or more included in the base sequence described in SEQ ID NO: 4 below SEQ ID NO: 1: 5’-CTTAACACAT GCAAGTCGAACGAGAYTTAA WYGATTTCTT-3’ SEQ ID NO: 2: 5’-TCCCATACCA CCGGAGTTTTCCACACAAAG AGATGCCTCTTC-3’ SEQ ID NO: 3: 5’-CTTGACATAC CGWTGACCGGCATAGAGATATG CCTTTCYTTC-3’ SEQ ID NO: 4: 5’-AAAAGATTCG CTCCAGGTCACCCTTTC GCTTCCCTCT-3’
[0021] The primer consisting of the nucleotide sequence (a) and the primer consisting of the nucleotide sequence (b) are used in combination, with the former used as a forward primer and the latter as a reverse primer. The primer consisting of the nucleotide sequence (c) and the primer consisting of the nucleotide sequence (d) are used in combination, with the former used as a forward primer and the latter as a reverse primer. All of these primers target uncultured Syntrophococcus bacteria.
[0022] In the base sequences (a) to (d), the number of consecutive bases may be 10 or more, but it is preferable that it be 12 or more, and more preferably 15 or more. Furthermore, the number of consecutive bases is preferably 35 or less, more preferably 30 or less, and even more preferably 25 or less.
[0023] The primers consisting of the nucleotide sequences (a), (b), (c), and (d) are preferably primers consisting of the nucleotide sequences described in SEQ ID NOs. 5, 6, 7, and 8 (the nucleotide sequences underlined in SEQ ID NOs. 1 to 4 above). The primers consisting of the nucleotide sequences described in SEQ ID NOs. 5, 6, 7, and 8 are designed not only for the specificity of the nucleotide sequences but also considering the site and length of the sequence used so as not to impair the function as a primer.
[0024] The primers of the present invention target uncultured Syntrophococcus bacteria. In the rumen, the proportion of these bacteria is strongly correlated with the propionic acid ratio. Therefore, by detecting these bacteria, it is possible to detect propionic acid-producing bacteria in the rumen. Furthermore, by quantifying the amount of these bacteria in the rumen, it is possible to identify individuals with a high propionic acid ratio in the rumen. Moreover, since propionic acid production in the rumen is antagonistic to methane production in relation to hydrogen consumption, the amount of uncultured Syntrophococcus bacteria in the rumen is thought to show a negative correlation with methane production in the rumen. Therefore, by quantifying the amount of these bacteria in the rumen, it is thought that it is possible to estimate the amount of methane produced in the rumen.
[0025] (B) Method for detecting propionic acid-producing bacteria The present invention provides a method for detecting propionic acid-producing bacteria in the rumen, comprising the following steps (1) to (4).
[0026] In step (1), rumen fluid is collected from ruminants. The collection of rumen (first stomach) fluid does not require any special methods and can be done according to known methods. Furthermore, specialized instruments for collecting rumen fluid are commercially available, so it can be done using such instruments.
[0027] The ruminant animals targeted are primarily cattle, but other ruminant animals such as goats, sheep, and deer may also be included. Furthermore, the cattle can be either dairy cows or beef cattle.
[0028] In step (2), DNA is extracted from the lumen fluid collected in step (1). DNA extraction from lumen fluid does not require any special methods and can be performed according to known methods. Furthermore, dedicated DNA extraction kits are commercially available and can be used for this purpose.
[0029] In step (3), PCR is performed using the primers of the present invention, with the DNA extracted in step (2) as a template.
[0030] PCR uses a set of primers consisting of the base sequence (a) and the base sequence (b), or a set of primers consisting of the base sequence (c) and the base sequence (d).
[0031] Standard PCR is acceptable, but quantitative PCR can also be used. Quantitative PCR allows for the quantification of propionic acid-producing bacteria within the rumen.
[0032] The denaturation conditions in PCR are not particularly limited, but the denaturation temperature is preferably 92 to 100°C, more preferably 94 to 98°C, and even more preferably about 98°C, and the denaturation time is preferably 5 to 180 seconds, more preferably 10 to 60 seconds, and even more preferably about 10 seconds.
[0033] The annealing conditions in PCR are not particularly limited, but the annealing temperature is preferably 45-68°C, more preferably 50-60°C, and even more preferably about 58°C, and the annealing time is preferably 10-60 seconds, more preferably 20-40 seconds, and even more preferably about 30 seconds.
[0034] The extension reaction conditions in PCR are not particularly limited, but the extension reaction temperature is preferably 60-75°C, more preferably 60-72°C, and even more preferably about 72°C, and the extension reaction time is preferably 10-60 seconds, more preferably 20-40 seconds, and even more preferably about 20 seconds.
[0035] The number of cycles in PCR is not particularly limited, but 20 to 60 cycles is preferred, 30 to 50 cycles is more preferred, and about 30 cycles is even more preferred.
[0036] In step (4), the DNA fragments amplified by PCR in step (3) are detected. The amplified DNA fragments can be detected by electrophoresis or other methods.
[0037] (C) Method for identifying individuals with a high propionic acid ratio The present invention provides a method for identifying ruminant individuals with a high propionic acid ratio in the rumen, comprising the following steps (1) to (4).
[0038] In step (1), rumen fluid is collected from ruminants. This step can be performed in the same manner as the method for detecting propionic acid-producing bacteria described above.
[0039] In step (2), DNA is extracted from the rumen fluid collected in step (1). This step can also be performed in the same manner as the method for detecting propionic acid-producing bacteria described above.
[0040] In step (3), quantitative PCR is performed using the primers of the present invention, with the DNA extracted in step (2) as a template.
[0041] PCR uses a set of primers consisting of the base sequence (a) and the base sequence (b), or a set of primers consisting of the base sequence (c) and the base sequence (d).
[0042] The type of quantitative PCR is not particularly limited, but real-time PCR is preferred. Real-time PCR is a known method, for example, SYBR TM Interaction methods using Green, etc., TaqMan TM This can be done using a probe method, such as a probe.
[0043] The denaturation conditions in PCR are not particularly limited, but the denaturation temperature is preferably 92 to 100°C, more preferably 94 to 98°C, and even more preferably about 98°C, and the denaturation time is preferably 5 to 180 seconds, more preferably 10 to 60 seconds, and even more preferably about 10 seconds.
[0044] The annealing conditions in PCR are not particularly limited, but the annealing temperature is preferably 45-68°C, more preferably 50-60°C, and even more preferably about 58°C, and the annealing time is preferably 10-60 seconds, more preferably 20-40 seconds, and even more preferably about 30 seconds.
[0045] The extension reaction conditions in PCR are not particularly limited, but the extension reaction temperature is preferably 60-75°C, more preferably 60-72°C, and even more preferably about 72°C, and the extension reaction time is preferably 10-60 seconds, more preferably 20-40 seconds, and even more preferably about 20 seconds.
[0046] The number of cycles in PCR is not particularly limited, but 20 to 60 cycles is preferred, 30 to 50 cycles is more preferred, and about 30 cycles is even more preferred.
[0047] In step (4), individuals with a high propionic acid ratio in the rumen are identified based on the results of quantitative PCR in step (3).
[0048] The results of quantitative PCR in step (3) reveal the amount of uncultured Syntrophococcus bacteria in the rumen of the target individual (the individual from which the rumen contents were collected). As mentioned above, the amount of these bacteria is strongly correlated with the propionic acid ratio. Therefore, the results of quantitative PCR in step (3) reveal the propionic acid ratio of the target individual, making it possible to identify whether the individual has a high propionic acid ratio. When identifying an individual, the propionic acid ratio of a control individual may be determined and compared with this. For example, steps (1) to (3) may be performed on an individual whose propionic acid ratio in the rumen is known (an individual whose propionic acid ratio has been measured by a known method such as gas chromatography) to determine the amount of uncultured Syntrophococcus bacteria, and individuals with a higher amount of uncultured Syntrophococcus bacteria than this control individual may be identified as "individuals with a high propionic acid ratio in the rumen." [Examples]
[0049] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.
[0050] [Materials and Methods] [Design of specific primers] The 16S rRNA gene sequence of uncultured Syntrophococcus bacteria was obtained from Holstein dairy cows with a high rumen propionic acid ratio using the following method: Rummary fluid was orally collected from high propionic acid ratio dairy cows kept in a free-stall barn equipped with a milking robot, using a rumen fluid collection probe (Luminar, Sanshin Kogyo). Microbial DNA was extracted from the obtained rumen fluid. A DNA library was prepared using a primer set specific to the V1-V9 region of the bacterial 16S rRNA gene (Forward, 5'-AGRGTTYGATYMTGGCTCAG-3'; Reverse, 5'-RGYTACCTTGTTACGACTT-3'). The base sequence was decoded using Sequel IIe (PacBio) to obtain the base sequence of the V1-V9 region of the 16S rRNA gene of uncultured Syntrophococcus bacteria. After aligning the nucleotide sequences of known and uncultured Lachnospiraceae bacteria using ClustalW, we detected sequence regions specific to uncultured Syntrophoccocus bacteria (Figure 1). Furthermore, we designed specific primers suitable for detection and quantification by ensuring that the nucleotide sequences within the primer sequence, and between the forward and reverse primers, do not form three-dimensional structures or undergo self-annealing. The specificity of the primer sequences was evaluated by searching the NCBI / EMBL / DDBJ databases. Finally, after preparing a DNA library using a two-step PCR method with the created primers, the specificity of the primers was confirmed by sequencing the PCR products using MiSeq (Illumina).
[0051] [Correlation analysis between uncultured Syntrophococcus bacteria and rumen fermentation product indicators] From November 2018 to November 2019, rumen fluid samples were orally collected from 66 Holstein dairy cows kept in free-stall barns equipped with milking robots, and microbial DNA was extracted and purified from each sample.
[0052] DNA libraries were prepared using a two-step PCR method with primer sets specific to the V3-V4 region of the bacterial 16S rRNA gene (341F, 5'-CCTACGGGNGGCWGCAG-3'; 805R, 5'-GACTACHVGGGTATCTAATCC-3'), and then sequenced using MiSeq. Sequence regions specific to uncultured Syntrophococcus bacteria were detected, and the proportion of uncultured Syntrophococcus bacteria in each sample was calculated. The primer sets used are shown in Table 1. The sequences of each primer listed in Table 1 are found in sequence numbers 5-16 of the sequence listing. [Table 1]
[0053] As an indicator of rumen fermentation, the concentration of short-chain fatty acids in the rumen was measured using the 6890 GC System (Agilent Technologies), a gas chromatography-based short-chain fatty acid analysis system. From the measurement data, the short-chain fatty acid balance (acetic acid + butyric acid) / propionic acid was calculated, and its relationship with the proportion of uncultured Syntrophococcus bacteria was analyzed.
[0054] 〔result〕 [Design of specific primers] Each of the designed primer sequences was confirmed to be specific to the 16S rRNA gene of uncultured Syntrophococcus bacteria through database searches of NCBI / EMBL / DDBJ / . Furthermore, PCR using primer sets 58F-238R and 999F-1280R specifically amplified microbial DNA contained in rumen contents, demonstrating the specific amplification of uncultured Syntrophococcus bacteria (Figure 2). On the other hand, despite being designed based on sequence sites specific to uncultured Syntrophococcus bacteria, PCR using primer sets 100F-226R and 835F-1021R failed to specifically amplify uncultured Syntrophococcus bacteria (Figure 2). It was also shown that quantitative PCR is possible with primer sets 58F-238R and 999F-1280R. From the above, it was confirmed that specific detection and quantification of uncultured Syntrophococcus bacteria are possible using these primers.
[0055] [Correlation analysis between bacterial quantification and rumen fermentation product index] Prevotella bacteria, the dominant bacteria in the rumen, Succiniclasticum bacteria, which produce propionic acid, and Blautia bacteria of the Lachnospiraceae family did not show a significant negative correlation with (acetic acid + butyrate) / propionic acid (Figure 3). On the other hand, the proportion of uncultured Syntrophococcus bacteria showed a negative correlation with (acetic acid + butyrate) / propionic acid. In rumens where the proportion of uncultured Syntrophococcus bacteria was 1% or less, the average (acetic acid + butyrate) / propionic acid was high at 3.4, while in rumens where uncultured Syntrophococcus bacteria were present at 1% or more, the average (acetic acid + butyrate) / propionic acid was low at 2.6. From these results, it was shown that uncultured Syntrophococcus bacteria have a positive relationship with propionic acid production in the rumen. [Industrial applicability]
[0056] The primers of the present invention can determine the presence, quantity, and percentage of bacteria relative to the total bacteria in the rumen of cattle, which show a strong correlation with the propionic acid ratio, without requiring special equipment investment. This can be used to develop primer sets or probe-based test kits for purposes such as: 1) estimating the propionic acid ratio in the rumen, which varies among individuals; 2) identifying individuals with high propionic acid ratios; 3) using this for breeding selection of cattle with high propionic acid ratios; and 4) estimating methane production from the propionic acid ratio.
Claims
1. A primer consisting of any of the following base sequences (a) to (d), (a) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 1, (b) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 2, (c) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No. 3, (d) A sequence of 10 or more consecutive bases contained in the base sequence described in Sequence ID No.
4.
2. The primer according to claim 1, wherein the base sequences of (a), (b), (c), and (d) are between 15 and 25 bases.
3. The primer according to claim 1, wherein the base sequences of (a), (b), (c), and (d) are the base sequences described in SEQ ID NOs. 5, 6, 7, and 8, respectively.
4. A primer according to claim 1, used for detecting propionic acid-producing bacteria in the rumen.
5. A primer according to claim 1, used to identify individuals of ruminants with a high propionic acid ratio in the rumen.
6. A method for detecting propionic acid-producing bacteria in the rumen, comprising the following steps (1) to (4): (1) A step of collecting rumen fluid from a ruminant, (2) A step of extracting DNA from the lumen contents collected in step (1), (3) A step of performing PCR using the DNA extracted in step (2) as a template and using primers according to any one of claims 1 to 3, wherein the primers are a set of a primer consisting of the base sequence (a) and a primer consisting of the base sequence (b), or a set of a primer consisting of the base sequence (c) and a primer consisting of the base sequence (d). (4) A step to detect the DNA fragment amplified by PCR in step (3).
7. A method for identifying individuals with a high propionic acid ratio in the rumen of ruminants, comprising the following steps (1) to (4): (1) A step of collecting rumen fluid from a ruminant, (2) A step of extracting DNA from the lumen contents collected in step (1), (3) A step of performing quantitative PCR using the DNA extracted in step (2) as a template and using a primer according to any one of claims 1 to 3, wherein the primer is a set of a primer consisting of the base sequence (a) and a primer consisting of the base sequence (b), or a set of a primer consisting of the base sequence (c) and a primer consisting of the base sequence (d). (4) A step to identify individuals with a high propionic acid ratio in the rumen based on the results of quantitative PCR in step (3).