A method for simultaneously identifying multiple species of root-knot nematodes using multiplex PCR.

Multiplex PCR with specific primers allows simultaneous and efficient discrimination of major root-knot nematode species in Japan, improving diagnostic accuracy and crop selection by analyzing band patterns in PCR products.

JP2026109208APending Publication Date: 2026-07-01NAT AGRI & FOOD RES ORG

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NAT AGRI & FOOD RES ORG
Filing Date
2024-12-19
Publication Date
2026-07-01

AI Technical Summary

Technical Problem

Existing methods for discriminating major species of root-knot nematodes in Japan are inefficient, requiring multiple processes and cannot be performed simultaneously, complicating accurate diagnosis and crop selection.

Method used

A method utilizing multiplex PCR with specific primer sets (e.g., primers with nucleotide sequences in Sequence IDs 1-4) for simultaneous and specific detection of root-knot nematodes, including Honshu type and Javan nematodes, and other species, eliminating the need for additional steps like restriction enzyme treatment.

Benefits of technology

Enables rapid and accurate identification of major root-knot nematode species by analyzing band patterns in PCR products, simplifying the diagnostic process and enhancing crop management strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026109208000002
    Figure 2026109208000002
  • Figure 2026109208000003
    Figure 2026109208000003
  • Figure 2026109208000004
    Figure 2026109208000004
Patent Text Reader

Abstract

The objective is to provide a method for simultaneously and specifically detecting the major root-knot nematode species in Japan. [Solution] A method for identifying root-knot nematodes, comprising the step of performing a multiplex PCR amplification reaction of a target nucleic acid region of one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode using a primer set consisting of four specific primers.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0006] , , ,

[0001] The present invention relates to a method for simultaneously discriminating major species of root-knot nematodes in, for example, Japan.

Background Art

[0002] Root-knot nematodes are important pests in agriculture and cause damage such as parasitizing plant roots and forming root knots. Since the parasitism varies depending on the species, it is necessary to accurately and quickly diagnose the occurring species in order to select appropriate crops and varieties.

[0003] As a conventional technique, primers developed in Non-Patent Document 1 (Harris et al. (1990)) and Non-Patent Document 2 (Powers & Harris (1993)) have been applied to discriminate major species of root-knot nematodes in Japan (sweet potato root-knot nematode, Meloidogyne arenaria main island type, Meloidogyne arenaria Okinawa type, Meloidogyne javanica, Meloidogyne kitaiana) (Non-Patent Document 3 (Iwabori et al., 2000); Non-Patent Document 4 (Orui, 1998); Non-Patent Document 5 (Orui et al., 1996)). However, these cannot simultaneously discriminate major species of root-knot nematodes in Japan, and in addition to PCR, another process (restriction enzyme treatment) is required, which is complicated.

[0004] In addition, in Non-Patent Document 6 (National Agriculture and Food Research Organization (2016) "Manual for Multispecies Simultaneous Diagnosis Technology of Root-lesion Nematodes and Root-knot Nematodes"), although it is for the multispecies simultaneous diagnosis of root-knot nematodes, in fact, it is a technique that focuses on species discrimination of root-lesion nematodes, and species discrimination of root-knot nematodes has become a substantially difficult technique.

[0005] Thus, the development of a method for simultaneously diagnosing major species of root-knot nematodes in Japan is required.

Prior Art Documents

Non-Patent Documents

[0006] [Non-Patent Document 1] Harris et al. (1990) Identification of single Meloidogyne juveniles by polymerase chain reaction amplification of mitochondrial DNA. Journal of Nematology 22(4), 518-524. [Non-Patent Document 2] Powers and Harris. (1993) A polymerase chain reaction method for identification of five major Meloidogynespecies. Journal of Nematology 25(1), 1-6. [Non-Patent Document 3] Iwahori, Hideaki, Sano, Yoshikazu, and Ogawa, Tetsuji (2000). Major harmful nematodes in sweet potato and taro fields in the Kyushu and Okinawa regions. 1. Development of an efficient nematode species identification method by survey and DNA analysis in central and southern Kyushu (Kumamoto, Miyazaki, and Kagoshima prefectures). Kyushu Plant Protection Society Bulletin 46, 112-117. [Non-Patent Document 4] Orui Y (1998) Identification of Japanese species of the genus Meloidogyne (Nematoda: Meloidogynidae) by PCR-RFLP analysis. Appl Entomol Zool 33, 43-51. [Non-Patent Document 5] Orui Y, Nishi T, Matsuzawa H (1996) Geographical distribution of Meloidogyne species (Nematoda: Tylenchida) in tobacco fields of Japan. Appl Entomol Zool 31, 225-231. [Non-Patent Document 6] National Agriculture and Food Research Organization (2016) Manual for Simultaneous Diagnosis of Multiple Nematodes, including Root-Knot Nematodes. [Overview of the project] [Problems that the invention aims to solve]

[0007] In view of the above circumstances, the present invention aims to provide a method for discriminating between major root-knot nematode species in Japan, which can be detected simultaneously and specifically. [Means for solving the problem]

[0008] In order to solve the above problems, we conducted intensive research and found that by PCR such as multiplex PCR using a specific primer set, major species of root-knot nematodes in Japan can be detected simultaneously and specifically, thus completing the present invention.

[0009] In other words, the present invention encompasses the following:

[0010] [1] A primer set comprising the primers (1) and (2) below for amplifying nucleotide sequences specific to the Honshu type and / or Javan root-knot nematode by PCR, and for distinguishing between the Honshu type and / or Javan root-knot nematode. (1) Primers (1a) or (1b) below: (1a) A primer containing the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) The following primers (2a) or (2b): (2a) Primer containing the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 2.

[0011] A kit for amplifying nucleotide sequences specific to the Honshu type and / or Javan root-knot nematode of Arenaria nematode by PCR, including the primer set described in [2][1], and for distinguishing between the Honshu type and / or Javan root-knot nematode of Arenaria nematode.

[0012] A method for identifying Arenaria nematode Honshu type and / or Javan nematode, comprising the step of performing an amplification reaction of the target nucleic acid region of Arenaria nematode Honshu type and / or Javan nematode by PCR using the primer set described in [1] or the kit described in [2].

[0013] [4] A primer set for distinguishing between the following one or more root-knot nematodes, comprising the primers (1) to (4) below, which amplify the specific base sequence of one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode by multiplex PCR. (1) Primers (1a) or (1b) below: (1a) A primer containing the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) The following primers (2a) or (2b): (2a) Primer containing the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 2, (3) Primers of (3a) or (3b) below: (3a) A primer containing the nucleotide sequence described in Sequence ID No. 3; (3b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 3, (4) The following primers (4a) or (4b): (4a) A primer containing the nucleotide sequence set forth in SEQ ID NO: 4; (4b) A primer containing a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted, and / or added in the nucleotide sequence set forth in SEQ ID NO: 4.

[0014] A kit for discriminating one or more root-knot nematodes selected from the group consisting of Meloidogyne incognita, Meloidogyne arenaria (race 1), Meloidogyne arenaria (race O), Meloidogyne javanica, and Meloidogyne kitaiana, which amplifies a nucleotide sequence specific to the one or more root-knot nematodes by multiplex PCR, comprising the primer set described in [5][4].

[0015] A method for discriminating one or more root-knot nematodes selected from the group consisting of Meloidogyne incognita, Meloidogyne arenaria (race 1), Meloidogyne arenaria (race O), Meloidogyne javanica, and Meloidogyne kitaiana, comprising the step of performing an amplification reaction of a target nucleic acid region of the one or more root-knot nematodes by multiplex PCR using the primer set described in [6][4] or the kit described in [5].

Advantages of the Invention

[0016] According to the present invention, the main species of root-knot nematodes, which are important pests occurring throughout Japan, can be simultaneously and specifically detected and discriminated.

Brief Description of the Drawings

[0017] [Figure 1]The base sequences of the DNA regions targeted by the primers developed by Dong et al. (2001): 5'-CCTTAATGTCAACACTAGAGCC-3' (SEQ ID NO: 5) and 5'-GGCCTTAACCGACAATTAGA-3' (SEQ ID NO: 6) are shown (SEQ ID NO: 7: This sequence is the result of analysis of one population of Javan root-knot nematode). The sequences underlined with solid lines indicate the position of the primer consisting of the base sequence described in SEQ ID NO: 1. The sequences underlined with dashed lines indicate the position of the primer consisting of the base sequence described in SEQ ID NO: 2 (however, the sequences shown in the figure are complementary sequences). Sequences enclosed in squares are base sequences that are deleted in the Honshu type of Arenaria root-knot nematode. [Figure 2] This is an electrophoresis image showing the amplification products obtained by PCR using primer set 1 (SEQ ID NOs: 1 and 2). The abbreviations are: S: sweet potato root-knot nematode, AHON: Arenaria root-knot nematode Honshu type, AOKI: Arenaria root-knot nematode Okinawa type, JI: Java root-knot nematode, KI: Northern root-knot nematode. The asterisk (*) in the figure indicates a specific band obtained by PCR using the SEQ ID NOs: 1 / 2 primer set according to the present invention (approximately 370 bp for Arenaria root-knot nematode Honshu type, and approximately 680 bp for Java root-knot nematode). [Figure 3] This is an electrophoresis image showing the amplification product obtained by PCR using primer set 2 (SEQ ID NOs: 3 and 4). The abbreviations are: S: sweet potato root-knot nematode, AHON: Arenaria root-knot nematode (Honshu type), AOKI: Arenaria root-knot nematode (Okinawa type), JI: Java root-knot nematode, KI: Northern root-knot nematode. [Figure 4]This is an electrophoresis image showing the amplification products obtained by multiplex PCR using primer sets 1 and 2 (SEQ ID NOs: 1 and 2, SEQ ID NOs: 3 and 4). The abbreviations are: S: sweet potato root-knot nematode, AHON: Arenaria root-knot nematode Honshu type, AOKI: Arenaria root-knot nematode Okinawa type, JI: Java root-knot nematode, KI: Northern root-knot nematode. The asterisk (*) in the figure indicates a specific band obtained by PCR using the SEQ ID NOs: 1 / 2 primer set according to the present invention (approximately 370 bp for Arenaria root-knot nematode Honshu type, and approximately 680 bp for Java root-knot nematode). [Modes for carrying out the invention]

[0018] The present invention will be described in detail below. <First aspect of the present invention> A primer set according to a first aspect of the present invention is a primer set comprising two primers for amplifying nucleotide sequences specific to Meloidogyne arenaria honshu-type (Meloidogyne arenaria A2-J) and / or Meloidogyne javanica by PCR, and for distinguishing between Meloidogyne arenaria honshu-type and / or Meloidogyne javanica. By performing PCR using this primer set, Meloidogyne arenaria honshu-type and / or Meloidogyne javanica can be distinguished from the differences in the band patterns of the PCR products after electrophoresis.

[0019] Specifically, the primer set of the first embodiment includes the following primers: (1) and (2): (1) Primers (1a) or (1b) below: (1a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) The following primers (2a) or (2b): (2a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 2.

[0020] The primers (1b) and (2b) may contain or consist of a nucleotide sequence in which one or more (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) nucleotides are substituted, deleted, inserted, and / or added in the nucleotide sequence indicated by the sequence number of each primer, and each primer may have its respective primer function. Alternatively, the primers (1b) and (2b) may contain or consist of a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, preferably at least 90%, and at least 95% sequence identity with the nucleotide sequence indicated by the sequence number of each primer, and each primer may have its respective primer function.

[0021] Furthermore, a first aspect of the present invention relates to a kit for amplifying a nucleotide sequence specific to the Honshu type and / or Javan root-knot nematode by PCR, and for distinguishing between the Honshu type and / or Javan root-knot nematode, which includes the primer set described above. The kit may further include, for example, DNA polymerase, nucleic acid synthesis substrate (dNTP), buffer, salts, agarose gel, nucleic acid staining reagent, container, instructions for use, etc.

[0022] Furthermore, a first aspect of the present invention relates to a method for identifying (or detecting) Arenaria nematode Honshu type and / or Javan nematode, comprising the step of performing an amplification reaction of the target nucleic acid region of Arenaria nematode Honshu type and / or Javan nematode by PCR using the primer set or kit described above. According to the PCR in this method, Arenaria nematode Honshu type and / or Javan nematode can be identified from differences in the band patterns of the PCR products after electrophoresis.

[0023] In this method, DNA is first extracted and purified from root-knot nematode individuals (including larvae) or root-knot nematode communities isolated from field soil samples containing or suspected to contain, for example, the Honshu type of Arenaria root-knot nematode and / or Javan root-knot nematode. A commercially available DNA extraction reagent can be used as the DNA extraction method.

[0024] Next, the purified DNA is used as a template for PCR using the primer set according to the first embodiment of the present invention. The PCR reaction mixture is prepared, for example, by containing, each primer included in the primer set according to the first embodiment of the present invention at a final concentration of 80-400 nM (preferably 400 nM each), 2-10 μL (preferably 8 μL) of template DNA, and the respective volumes of DNA polymerase and dNTPs according to the manufacturer's manual, per 50 μL of reaction mixture. Furthermore, examples of thermal cycling conditions for PCR include: Initial denaturation: 94-98°C (preferably 94°C) for 1-2 minutes (preferably 2 minutes) → [Denaturation: 94-98°C (preferably 98°C) for 10-30 seconds (preferably 10 seconds) → Annealing: 54-56°C (preferably 56°C) for 30-60 seconds (preferably 45 seconds) → Extension: 68-72°C (preferably 68°C) for 2-3 minutes (preferably 2 minutes) for 25-40 cycles (preferably 35 cycles)] → Maintenance: 68-72°C (preferably 68°C) for 5-10 minutes (preferably 5 minutes).

[0025] After PCR is completed, the PCR product is subjected to electrophoresis on an agarose gel to which nucleic acid staining reagent has been added, for example, at 50-150V (preferably 100V) for 30-60 minutes (preferably 40 minutes). Then, the gel after electrophoresis is photographed to obtain an electrophoretic image. As a result, if a specific band of approximately 370 bp is observed for the Honshu type of Arenaria root-knot nematode and a specific band of approximately 680 bp is observed for Javan root-knot nematode, the root-knot nematode individual or community subjected to discrimination can be identified as the respective root-knot nematode.

[0026] <Second aspect of the present invention> A primer set according to a second aspect of the present invention is a primer set comprising four primers for amplifying the nucleotide sequence specific to one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode (Meloidogyne incognita), arenaria root-knot nematode Honshu type, arenaria root-knot nematode Okinawa-type (Meloidogyne arenaria A2-O), Javan root-knot nematode, and northern root-knot nematode (Meloidogyne hapla) by multiplex PCR, and for distinguishing between the said one or more root-knot nematodes. Multiplex PCR using this primer set allows for the identification of specific root-knot nematodes among sweet potato root-knot nematodes, Arenaria root-knot nematode (Honshu type), Arenaria root-knot nematode (Okinawa type), Java root-knot nematode, and northern root-knot nematode based on differences in the band patterns of the PCR products after electrophoresis.

[0027] Specifically, the primer set of the second embodiment includes the following primers (1) to (4): (1) Primers (1a) or (1b) below: (1a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) The following primers (2a) or (2b): (2a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising or consisting of a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 2, (3) Primers of (3a) or (3b) below: (3a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 3; (3b) A primer comprising or consisting of a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 3, (4) The following primers (4a) or (4b): (4a) A primer containing or consisting of the nucleotide sequence described in Sequence ID No. 4; (4b) A primer comprising or consisting of a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 4.

[0028] The primers in (1) and (2) are the same as those in the first embodiment. On the other hand, the primers (3b) and (4b) may contain or consist of a nucleotide sequence in which one or more (e.g., 1 to 10, 1 to 5, 1 to 3, preferably 1 or 2) nucleotides are substituted, deleted, inserted, and / or added in the nucleotide sequence indicated by the sequence number of each primer, and may have their respective primer functions. Alternatively, the primers (3b) and (4b) may contain or consist of a nucleotide sequence having at least 70%, at least 75%, at least 80%, at least 85%, preferably at least 90%, and at least 95% sequence identity with the nucleotide sequence indicated by the sequence number of each primer, and may have their respective primer functions.

[0029] Furthermore, a second aspect of the present invention relates to a kit for amplifying a nucleotide sequence specific to one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode by multiplex PCR, and for identifying said one or more root-knot nematodes, including the primer set described above. Similar to the first aspect, the kit may further include, for example, DNA polymerase, nucleic acid synthesis substrate (dNTP), buffer, salts, agarose gel, nucleic acid staining reagent, container, instructions for use, etc.

[0030] Furthermore, a second aspect of the present invention relates to a method for identifying (or detecting) one or more root-knot nematodes, comprising the step of performing an amplification reaction of the target nucleic acid region of one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode by multiplex PCR using the primer set or kit described above. According to the multiplex PCR in this method, it is possible to determine which of the sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode is the actual root-knot nematode based on the differences in the band patterns of the PCR products after electrophoresis.

[0031] In this method, DNA is first extracted and purified from root-knot nematode individuals (including larvae) or root-knot nematode communities isolated from field soil samples containing or suspected to contain at least one of the following species: sweet potato root-knot nematode, Arenaria root-knot nematode (Honshu type), Arenaria root-knot nematode (Okinawa type), Java root-knot nematode, and northern root-knot nematode.

[0032] Aside from performing multiplex PCR and ensuring that the final concentrations of primers (3) and (4) in the PCR reaction solution are, for example, 80-400 nM (preferably 80 nM each), DNA extraction, PCR (e.g., composition of the PCR reaction solution, thermal cycling conditions for PCR), electrophoresis of the PCR product after the completion of PCR, and electrophoresis photography can be carried out in accordance with the method of the first embodiment.

[0033] As a result, when one specific band of approximately 1.7 kbp is observed in the sweet potato root-knot nematode, two specific bands of approximately 1.7 kbp and 370 bp are observed in the Honshu type of the Arenaria root-knot nematode, one specific band of approximately 1.1 kbp is observed in the Okinawa type of the Arenaria root-knot nematode, two specific bands of approximately 1.7 kbp and 680 bp are observed in the Javan root-knot nematode, and one specific band of approximately 500 bp is observed in the northern root-knot nematode, the individual or community of root-knot nematodes used for identification can be identified as the respective root-knot nematode. [Examples]

[0034] The present invention will be described in more detail below using examples, but the technical scope of the present invention is not limited to these examples.

[0035] [Distinguishing between the five main root-knot nematode species in Japan (sweet potato root-knot nematode, Arenaria root-knot nematode (Honshu type), Arenaria root-knot nematode (Okinawa type), Javan root-knot nematode, and northern root-knot nematode)] In this example, species identification was performed based on differences in DNA sequences using multiplex PCR with two types of primer sets.

[0036] We identified the DNA sequence of the DNA region targeted by the primers developed by Dong et al. (2001), and designed a novel primer set based on that sequence information (Primer Set 1 (SEQ ID NO: AAATGATTGATGAAGACAATATGTG, SEQ ID NO: CAATAGATCACGTTGAGGATTAC)).

[0037] PCR using primer set 1 yielded specific amplification products of approximately 370 bp for the Honshu type of Arenaria nematode and approximately 680 bp for Javan nematode.

[0038] By performing multiplex PCR combining this primer set 1 with a known primer set developed by Powers & Harris (1993) (primer set 2 (sequence number 3: GGTCAATGTTCAGAAATTTGTGG, sequence number 4: TACCTTTGACCAATCACGCT)), it was possible to simultaneously distinguish the five major types mentioned above based on the differences in the band patterns of the PCR products (Figure 4).

[0039] Unlike conventional techniques, multiplex PCR using the above primer set can be completed in a single PCR procedure, and no additional steps after PCR (such as restriction enzyme treatment) are required, making it simple and rapid to perform the determination.

[0040] 1. Method / Procedure (1) Primer design For the Honshu type of Arenaria root-knot nematode and Javan root-knot nematode, the nucleotide sequences (SEQ ID NO: 7) of the DNA regions targeted by the primers 5'-CCTTAATGTCAACACTAGAGCC-3' (SEQ ID NO: 5) and 5'-GGCCTTAACCGACAATTAGA-3' (SEQ ID NO: 6), developed by Dong et al. (2001), were determined by Sanger sequencing (Figure 1). The nucleotide sequence analysis was performed using Macrogen Japan's contract sequencing service (general sequencing). A search for similar sequences of this nucleotide sequence on the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ) yielded no results; therefore, the specific location of this nucleotide sequence on the genome and information regarding related genes remain unknown. In the relevant DNA region of Arenaria root-knot nematode Honshu type and Javan root-knot nematode, a gap of approximately 300 base pairs exists. A novel primer set was designed to encompass this gap and not overlap with the size of the amplification product produced by primer set 2 (SEQ ID NOs: 3 and 4) (Primer set 1 (SEQ ID NOs: 1: AAATGATTGATGAAGACAATATGTG, SEQ ID NOs: 2: CAATAGATCACGTTGAGGATTAC)). A list of primers is shown in Table 1 below.

[0041] [Table 1]

[0042] (2) DNA extraction DNA extraction from root-knot nematodes was performed following the method described by Iwahori (2014). The reagents included with the hair DNA extraction kit ISOHAIR (Nippon Gene) were mixed in the ratio of enzyme solution: lysis solution: TE buffer (pH 8.0) = 5:4:100 to prepare the DNA extraction solution.

[0043] 2.5 μL of DNA extraction solution was pre-dispensed into a 0.2 mL microcentrifuge tube, and one second-instar larva of root-knot nematode was suspended under a stereomicroscope. After incubation at 55°C for 30 minutes, inactivation treatment was performed at 95°C for 5 minutes, and finally 17.5 μL of distilled water was added. The DNA extraction sample was stored at -20°C until use.

[0044] (3) Procedures for PCR and electrophoresis For the PCR reagent, we used TaKaRa Ex Taq Hot Start Version (Takara Bio), and set the reaction solution composition and reaction conditions according to the instructions.

[0045] The reaction mixture consisted of 6.9 μL of water, 1.3 μL of buffer, 1 μL of dNTPs, 0.1 μL of polymerase, 0.5 μL each of primer set 1, 0.1 μL each of primer set 2, and 2 μL of DNA extraction sample.

[0046] The reaction conditions consisted of one cycle of 94°C for 2 minutes, 35 cycles of 98°C for 10 seconds - 56°C for 45 seconds - 68°C for 2 minutes, and one cycle of 68°C for 5 minutes.

[0047] After PCR was completed, the PCR product was dispensed onto a 1.0% Agarose S gel (Nippon Gene) to which 10000× GelRed (Biotium), a nucleic acid staining reagent dissolved in 1×TAE, was added, and electrophoresis was performed at 100V for 40 minutes. During electrophoresis, 1 kb DNA Ladder N3232 and 100 bp DNA Ladder N3231 (New England BioLabs) were also dispensed onto the gel to check the approximate fragment length of the amplified product, and the gel after electrophoresis was imaged using an E-Graph AE-9000 (ATTO).

[0048] 2.Results / Discussion Figure 2 shows the results of PCR using the primer set (primer set 1) newly developed in this invention. Amplification products were confirmed at approximately 370 bp for the Honshu type of Arenaria nematode and approximately 680 bp for Javan nematode, demonstrating that these primers can specifically detect the Honshu type of Arenaria nematode and Javan nematode.

[0049] Next, Figure 3 shows the results of PCR using the previously reported primer set (Primer Set 2) (Powers & Harris, 1993). Amplification products of approximately 1.7 kbp were confirmed for sweet potato root-knot nematode, Arenaria root-knot nematode (Honshu type), and Java root-knot nematode, approximately 1.1 kbp for Arenaria root-knot nematode (Okinawa type), and approximately 500 bp for Northern root-knot nematode, which are consistent with the results of previous studies (Iwahori et al., 2000; Orui, 1998; Orui et al., 1996).

[0050] Figure 4 shows the results of multiplex PCR using primer sets 1 and 2. For sweet potato root-knot nematode, only an amplification product of approximately 1.7 kbp was obtained; for Arenaria root-knot nematode (Honshu type), amplification products of approximately 1.7 kbp and approximately 370 bp were obtained; for Arenaria root-knot nematode (Okinawa type), only an amplification product of approximately 1.1 kbp was obtained; for Java root-knot nematode, amplification products of approximately 1.7 kbp and approximately 680 bp were obtained; and for Northern root-knot nematode, only an amplification product of approximately 500 bp was obtained. Thus, we successfully detected different amplification products for each species.

[0051] Based on the above, we have determined that this method is practical as a diagnostic method capable of distinguishing between the five major species of root-knot nematodes found in Japan.

[0052] [References] Dong et al. (2001) Development of PCR primers to identify species of root-knot nematodes: Meloidogyne arenaria, M. hapla, M. incognita and M. javanica. Nematoropica 31(2), 271-280. Harris et al. (1990) Identification of single Meloidogyne juveniles by polymerase chain reaction amplification of mitochondrial DNA. Journal of Nematology 22(4), 518-524. Iwahori, Hideaki (2014) 2.2.1 DNA extraction by ISOHAIR. In: Mizukubo, Takayuki & Nii, Kazuyoshi (eds.). Nematobiology Experiments. Kyoto University Press. pp. 53-54. Iwahori, Hideaki, Sano, Yoshikazu, and Ogawa, Tetsuji (2000). Major harmful nematodes in sweet potato and taro fields in the Kyushu and Okinawa regions. 1. Development of an efficient nematode species identification method by survey and DNA analysis in central and southern Kyushu (Kumamoto, Miyazaki, and Kagoshima prefectures). Kyushu Plant Protection Society Bulletin 46, 112-117. National Agriculture and Food Research Organization (2016) Manual for Simultaneous Diagnosis of Multiple Nematodes, including Root-Knot Nematodes. Orui Y (1998) Identification of Japanese species of the genus Meloidogyne(Nematoda: Meloidogynidae) by PCR-RFLP analysis. Appl Entomol Zool 33, 43-51. Orui Y, Nishi T, Matsuzawa H (1996) Geographical distribution of Meloidogynespecies (Nematoda: Tylenchida) in tobacco fields of Japan. Appl Entomol Zool 31, 225-231. Powers and Harris. (1993) A polymerase chain reaction method for identification of five major Meloidogyne species. Journal of Nematology 25(1), 1-6.

Claims

1. A primer set comprising the primers (1) and (2) below, for amplifying nucleotide sequences specific to the Honshu type and / or Javan root-knot nematode by PCR, and for distinguishing between the Honshu type and / or Javan root-knot nematode. (1) Primers (1a) or (1b) below: (1a) A primer containing the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) Primers of (2a) or (2b) below: (2a) Primer containing the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No.

2.

2. A kit comprising the primer set described in claim 1 for amplifying a nucleotide sequence specific to the Honshu type and / or Javan root-knot nematode by PCR, and for distinguishing between the Honshu type and / or Javan root-knot nematode.

3. A method for identifying Arenaria nematode Honshu type and / or Javan nematode, comprising the step of performing an amplification reaction of the target nucleic acid region of Arenaria nematode Honshu type and / or Javan nematode by PCR using the primer set described in claim 1 or the kit described in claim 2.

4. A primer set for distinguishing between one or more root-knot nematodes, selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode (Honshu type), Arenaria root-knot nematode (Okinawa type), Java root-knot nematode, and northern root-knot nematode, by multiplex PCR, comprising the following primers (1) to (4). (1) Primers (1a) or (1b) below: (1a) A primer containing the nucleotide sequence described in Sequence ID No. 1; (1b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 1, (2) Primers of (2a) or (2b) below: (2a) Primer containing the nucleotide sequence described in Sequence ID No. 2; (2b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 2, (3) Primers (3a) or (3b) below: (3a) A primer containing the nucleotide sequence described in Sequence ID No. 3; (3b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No. 3, (4) Primers (4a) or (4b) below: (4a) Primers containing the nucleotide sequence described in Sequence ID No. 4; (4b) A primer comprising a nucleotide sequence in which one or more nucleotides are substituted, deleted, inserted and / or added in the nucleotide sequence described in Sequence ID No.

4.

5. A kit for identifying one or more root-knot nematodes, selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode (Honshu type), Arenaria root-knot nematode (Okinawa type), Java root-knot nematode, and northern root-knot nematode, comprising the primer set described in claim 4, by multiplex PCR.

6. A method for identifying one or more root-knot nematodes, comprising the step of performing an amplification reaction of a target nucleic acid region of one or more root-knot nematodes selected from the group consisting of sweet potato root-knot nematode, Arenaria root-knot nematode Honshu type, Arenaria root-knot nematode Okinawa type, Java root-knot nematode, and northern root-knot nematode by multiplex PCR using the primer set according to claim 4 or the kit according to claim 5.