Cell classification indicator circuit and method of using the same

A cell classification indicator gene circuit with multi-input sensing capabilities addresses the inefficiencies of current gene therapy vectors by enabling precise cell type-specific gene expression, enhancing treatment efficacy and reducing off-target effects.

JP2026136118APending Publication Date: 2026-08-25ETH ZURICH
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2026069961
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2020-04-14
Filing Date
2026-04-21
Publication Date
2026-08-25

AI Technical Summary

Technical Problem

Current gene therapy vectors suffer from low efficiency, high toxicity, and long development timelines due to insufficient control of therapeutic gene expression, leading to unintended gene expression in non-target cell types and dosage inconsistencies.

Method used

Development of a cell classification indicator gene circuit using inseparable polynucleic acid molecules with multi-input sensing capabilities, incorporating transactivator response elements and miRNA target sites for precise cell type-specific gene expression control.

Benefits of technology

Enables precise identification and targeted treatment of heterogeneous cell types, such as cancer cells, by ensuring therapeutic gene expression is limited to specific cell types, reducing off-target effects and improving treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026136118000001_ABST
    Figure 2026136118000001_ABST
Patent Text Reader

Abstract

This allows for precise control of gene expression, both in terms of the dosage of gene products (i.e., the number of protein molecules per cell) and expression that is limited by cell type. [Solution] Disclosed herein are a seamless DNA sequence encoding a highly compact multi-input gene logic gate for precise in vivo cell targeting, and a method for treating a disease using a combination of in vivo delivery and such seamless DNA sequence.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Field Disclosed herein are contiguous DNA sequences encoding highly compact multi-input genetic logic gates for precise in vivo cell targeting, and methods of treating diseases using in vivo delivery and combinations with such contiguous DNA sequences.

Background Art

[0002] Background Gene therapy is on the rise as a next-generation treatment option for genetic diseases and cancer. However, current gene therapy vectors are plagued by low efficiency, high toxicity, and long development timelines to produce therapeutic lead compounds. One reason for these weaknesses is the insufficiently stringent control of therapeutic gene expression in gene therapy vectors, which results in gene expression (i) in unintended cell types and tissues or (ii) at insufficient or excessive dosages. In other words, precise control of gene expression, both with respect to the dosage of the gene product (i.e., the number of protein molecules per cell) and expression limited by cell type, remains an unsolved problem in gene therapy.

Summary of the Invention

[0003] Summary Research in biomolecular computing and synthetic biology has long strived to enable novel types of therapeutic approaches based on: (i) multi-input sensing of molecular disease indicators; (ii) molecular-level calculations to determine the intensity of therapeutic responses; and (iii) in situ augmentation of treatment in a highly precise and coordinated manner. Described herein is a cell classification indicator gene circuit that enables the precise identification of heterogeneous cell types through the complex logical integration of inputs from multiple cells. Also described herein are methods for treating diseases using the classification indicator gene circuit. Cancer has been considered a class of diseases that would greatly benefit from cell classification indicator approaches due to the similarity of tumors to healthy cells, tumor heterogeneity, and its dissemination in both primary and secondary sites. The research described herein supports the concept that multi-input gene circuits for precise cell targeting are an ideal means for next-generation gene therapy.

[0004] Therefore, in some respects, this disclosure relates to an inseparable polynucleic acid molecule. In some embodiments, an inseparable polynucleic acid molecule is a) A first cassette encoding a first RNA whose expression is operably linked to a transactivator response element, wherein the first RNA includes (i) the nucleic acid sequence of the output; and (ii) a target site for a miRNA listed in Table 1 or a combination thereof; Furthermore b) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of the transactivator; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette.

[0005] In some embodiments, the first RNA includes a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0006] In some embodiments, the first RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0007] In some embodiments, the first RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0008] In some embodiments, the second RNA further comprises a target site for microRNAs or combinations thereof listed in Table 1. In some embodiments, the second RNA further comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0009] In some embodiments, the second RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0010] In some embodiments, the second RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0011] In some embodiments, at least one miRNA target site of the first cassette and at least one miRNA target site of the second cassette are either identical nucleic acid sequences or different sequences regulated by the same miRNA. In some embodiments, the first RNA and the second RNA each contain a let-7c target site.

[0012] In some embodiments, the transactivator response element includes nucleic acid sequences or combinations thereof listed in Table 3. In some embodiments, the expression of a second RNA is operably linked to a transcription factor response element. In some embodiments, the transcription factor response element comprises nucleic acid sequences or combinations thereof listed in Table 4.

[0013] In some embodiments, the transactivator independently couples to a transactivator response element and transactivates it. In some embodiments, the expression of the first RNA is operably linked to a transcription factor response element. In some embodiments, the transcription factor response element comprises nucleic acid sequences or combinations thereof listed in Table 4.

[0014] In some embodiments, the transactivator binds to and transactivates the transactivator response element only in the presence of a transcription factor bound to the transcription factor response element. In some embodiments, the first cassette and / or the second cassette include a promoter element. In some embodiments, the promoter element includes nucleic acid sequences or combinations thereof listed in Table 5. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment.

[0015] In some embodiments, the first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and the second cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element; (ii) a nucleic acid sequence encoding the transactivator; and (iii) a downstream component including a let-7c target site.

[0016] In some embodiments, the transcription factor response element of the first cassette and the transcription factor response element of the second cassette consist of the same nucleic acid sequence. In some embodiments, the transcription factor response elements of the first cassette and the transcription factor response elements of the second cassette consist of different nucleic acid sequences.

[0017] In some embodiments, the first cassette and / or the second cassette comprises two or more transcription factor response elements. In some embodiments, the first cassette and / or the second cassette comprises two different transcription factor response elements.

[0018] In some embodiments, the regulatory component upstream of the first cassette includes a promoter element. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment. In some embodiments, the regulatory component upstream of the second cassette includes a promoter element. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment.

[0019] In some embodiments, the first cassette and the second cassette are in a convergent orientation. In some embodiments, the first cassette and the second cassette are in a divergent orientation. In some embodiments, the first cassette and the second cassette are in a head-to-tail orientation. In some embodiments, the first cassette and / or the second cassette are adjacent to an insulator.

[0020] In some embodiments, the transactivator of the second cassette is tTA, rtTA, PIT-RelA, PIT-VP16, ET-VP16, ET-RelA, NarLc-VP16, or NarLc-RelA. In some embodiments, the transactivator of the second cassette comprises a nucleic acid sequence listed in Table 2.

[0021] In some embodiments, the output is a protein or an RNA molecule. In some embodiments, the output is a therapeutic agent. In some embodiments, the output is a fluorescent protein, a cytotoxin, an enzyme that catalyzes prodrug activity, an immunomodulatory protein and / or RNA, a factor that modifies DNA, a cell surface receptor, a factor that regulates gene expression, a kinase, an epigenetic modifier, and / or a factor required for vector replication, and / or a sequence encoding an antigen polypeptide of a pathogen. In some embodiments, the output is a thymidine kinase enzyme from human herpes simplex virus 1 (HSV-TK). In some embodiments, the immunomodulatory protein and / or RNA is a cytokine or a colony stimulating factor. In some embodiments, the factor that modifies DNA is a gene encoding a protein intended to correct a gene deficiency, an enzyme that modifies DNA, and / or a component of a system that modifies DNA. In some embodiments, the enzyme that modifies DNA is a site-specific recombinase, a homing endonuclease, or a protein component of a CRISPR / Cas DNA modification system. In some embodiments, the factor that regulates gene expression is a protein capable of regulating gene expression or a component of a multi-component system capable of regulating gene expression.

[0022] In some embodiments, the seamless polynucleotide molecule comprises the nucleic acid sequences listed in Table 6. In some embodiments, the seamless polynucleotide molecule comprises a cassette encoding an RNA whose expression is operably linked to a transactivator response element, where the RNA comprises (i) the nucleic acid sequence of the output; (ii) the nucleic acid sequence of the transactivator; and (iii) a target site for the miRNAs listed in Table 1 or combinations thereof; where the transactivator binds to and transactivates the transactivator response element when expressed as a protein.

[0023] In some embodiments, the first RNA includes a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0024] In some embodiments, the RNA further comprises the nucleic acid sequence of a polycistronic expression element that separates the nucleic acid sequences of the output and the transactivator. In some embodiments, the RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0025] In some embodiments, the RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

[0026] In some aspects, RNA contains a let-7c target site. In some embodiments, the transactivator response element includes nucleic acid sequences or combinations thereof listed in Table 3. In some embodiments, the transactivator independently couples to a transactivator response element and transactivates it.

[0027] In some embodiments, RNA expression is operably linked to transactivator response elements and transcription factor response elements. In some embodiments, the transcription factor response elements include nucleic acid sequences or combinations thereof listed in Table 4.

[0028] In some embodiments, the transactivator binds to and transactivates the transactivator response element only in the presence of a transcription factor bound to the transcription factor response element.

[0029] In some embodiments, the cassette includes a promoter element. In some embodiments, the promoter element includes nucleic acid sequences or combinations thereof listed in Table 5. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment.

[0030] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output and transactivator; and (iii) a downstream component including a let-7c target site.

[0031] In some embodiments, the upstream regulatory component in (i) includes a promoter element. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment. In some embodiments, the transactivator of at least one cassette is tTA, rtTA, PIT-RelA, PIT-VP16, ET-VP16, ET-RelA, NarLc-VP16, or NarLc-RelA.

[0032] In some embodiments, the output is a protein or RNA molecule. In some embodiments, the output is a therapeutic protein or RNA molecule. In some embodiments, the output is a fluorescent protein, a cytotoxin, an enzyme that catalyzes prodrug activity, an immunomodulatory protein and / or RNA, a DNA modifying factor, a cell surface receptor, a factor that regulates gene expression, a kinase, an epigenetic modifier, and / or a factor required for vector replication, and / or a sequence encoding a pathogen antigen polypeptide. In some embodiments, the output is a thymidine kinase enzyme from human herpes simplex virus 1 (HSV-TK). In some embodiments, the immunomodulatory protein and / or RNA is a cytokine or colony-stimulating factor. In some embodiments, the DNA modifying factor is a gene encoding a protein intended to correct a gene defect, a DNA modifying enzyme, and / or a component of a DNA modifying system. In some embodiments, the DNA modifying enzyme is a site-directed recombinase, a homing endonuclease, or a protein component of the CRISPR / Cas system. In some embodiments, the gene expression modulator is a protein capable of regulating gene expression or a component of a multi-component system capable of regulating gene expression.

[0033] In other respects, this disclosure relates to vectors, including the uninterrupted polynucleic acids described herein. In other aspects, this disclosure relates to engineered viral genomes, including the uninterrupted polynucleic acids described herein. In some embodiments, engineered viral genomes are derived from adeno-associated virus (AAV) genomes, lentivirus genomes, adenovirus genomes, herpes simplex virus (HSV) genomes, vaccinia virus genomes, poxvirus genomes, Newcastle disease virus (NDV) genomes, coxsackievirus genomes, reovirus genomes, measles virus genomes, varicella stomatitis virus (VSV) genomes, parvovirus genomes, Seneca Valley virus genomes, marabavirus genomes, or common cold virus genomes.

[0034] In other aspects, this disclosure relates to virions, including the engineered viral genomes disclosed herein. In some embodiments, the virions include AAV-DJ, AAV8, AAV6, or AAV-B1 capsids.

[0035] In other aspects, this disclosure relates to methods for stimulating cell-specific events in a population of cells. In some embodiments, a method for stimulating cell-specific events in a population of cells comprises contacting a population of cells with a seamless polynucleic acid molecule as described herein, a vector as described herein, an engineered viral genome as described herein, or a virion as described herein, wherein the population of cells comprises at least one target cell type and one or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level and / or activity of one or more endogenous miRNAs such that the level and / or activity of one or more endogenous miRNAs is at least twice as high in each of the two or more non-target cells compared to each of the target cells; and wherein the cell-specific event is regulated by the expression level of the output in the cells of the population of cells.

[0036] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, where the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

[0037] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in terms of promoter fragment level or activity, where an unbroken nucleic acid molecule further comprises this promoter fragment.

[0038] In other aspects, this disclosure relates to methods for diagnosing diseases or conditions. In some embodiments, a method for diagnosing a disease or condition comprises administering an uninterrupted polynucleic acid molecule, a vector, an engineered viral genome, or a virion described herein to a subject exhibiting one or more signs or symptoms associated with a disease or condition, wherein the level of output indicates the presence or absence of the disease and / or condition.

[0039] In some aspects, the disease is cancer. In some aspects, cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumors of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

[0040] In other aspects, this disclosure relates to methods for treating diseases or conditions. In some embodiments, methods for treating diseases or conditions include administering to a subject having a disease or condition an uninterrupted polynucleic acid molecule, a vector, an engineered viral genome, or a virion as described herein.

[0041] In some embodiments, the method further comprises administering a prodrug, optionally wherein the prodrug is ganciclovir, and optionally wherein the uninterrupted polynucleic acid molecule comprises the nucleic acid sequences listed in Table 6.

[0042] In some aspects, the disease is cancer. In some aspects, cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumors of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

[0043] In some respects, this disclosure relates to methods for use in methods for stimulating cell-specific events. In some embodiments, a composition for use in methods for stimulating cell-specific events in a population of cells comprises contacting a population of cells with an uninterrupted polynucleic acid molecule, a vector, an engineered viral genome, or a virion as described herein, wherein the population of cells comprises at least one target cell type and one or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level and / or activity of one or more endogenous miRNAs such that the level and / or activity of one or more endogenous miRNAs is at least twice as high in each of the two or more non-target cells compared to each of the target cells; and wherein the cell-specific event is regulated by the expression level of the output in the cells of the population of cells.

[0044] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, where the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

[0045] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in terms of promoter fragment level or activity, where an unbroken nucleic acid molecule further comprises this promoter fragment.

[0046] In other aspects, this disclosure relates to compositions for use in methods for diagnosing diseases or conditions. In some embodiments, compositions for use in methods for diagnosing diseases or conditions include administering an uninterrupted polynucleic acid molecule, a vector, an engineered viral genome, or a virion as described herein to a subject exhibiting one or more signs or symptoms associated with a disease or condition, wherein the level of output indicates the presence or absence of the disease and / or condition.

[0047] In some aspects, the disease is cancer. In some aspects, cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumors of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

[0048] In other aspects, this disclosure relates to compositions for use in methods of treating a disease or condition. In some embodiments, the compositions are for use in methods of treating a disease or condition, the methods comprising administering to a subject having a disease or condition an uninterrupted polynucleic acid molecule, a vector, an engineered viral genome, or a virion as described herein.

[0049] In some embodiments, the method further comprises administering a prodrug, optionally wherein the prodrug is ganciclovir, and optionally wherein the uninterrupted polynucleic acid molecule comprises the nucleic acid sequences listed in Table 6.

[0050] In some aspects, the disease is cancer. In some aspects, cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumors of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

[0051] In other aspects, the disclosure relates to methods for stimulating cell-specific events in a population of cells. In some embodiments, a method for stimulating cell-specific events in a population of cells comprises contacting the population of cells with an indistinct polynucleic acid molecule or a composition comprising the indistinct polynucleic acid molecule, wherein: a) the population of cells comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level of one or more endogenous miRNAs such that the level of one or more endogenous miRNAs is at least twice as high in each of at least a subset of non-target cells, e.g., at least two and optionally two or more non-target cells, compared to each of the target cells; and b) the indistinct polynucleic acid molecule comprises: i) a first cassette encoding RNA operably linked to a transactivator response element, wherein the first RNA comprises the nucleic acid sequence of the output; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and (ii) a second cassette encoding a second RNA, wherein the second RNA comprises the nucleic acid sequence of the transactivator; wherein the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette; and wherein a cell-specific event is regulated by the expression level of the output in cells of a population of cells. In some embodiments, the uninterrupted polynucleic acid molecule comprises the nucleic acid sequences listed in Table 6.

[0052] In some embodiments, a method for stimulating a cell-specific event in a population of cells comprises contacting the population of cells with an uninterrupted polynucleic acid molecule or a composition comprising the uninterrupted polynucleic acid molecule, wherein a) the population of cells comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types are such that the level of one or more endogenous miRNAs is at least twice as high in each of at least a subset of non-target cells, e.g., at least two and optionally two or more non-target cells, compared to each of the target cells. The differences are: a) an uninterrupted polynucleic acid molecule whose expression comprises a cassette encoding mRNA operably linked to a transactivator response element, wherein the RNA comprises the nucleic acid sequence of the output; the nucleic acid sequence of the transactivator; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and wherein the transactivator, when expressed as a protein, binds to and transactivates the transactivator response element of the cassette; and wherein a cell-specific event is regulated by the expression level of the output in cells of a population of cells.

[0053] In some embodiments, compositions comprising uninterrupted polynucleic acid molecules comprise a vector comprising uninterrupted polynucleic acid, an engineered viral genome comprising uninterrupted polynucleic acid, or a virion comprising polynucleic acid.

[0054] In some embodiments, the endogenous miRNA is selected from the miRNAs listed in Table 1 or combinations of the miRNAs listed in Table 1. In some embodiments, the endogenous miRNA is selected from the group consisting of let-7c, let-7a, let-7b, let-7d, let-7e, let-7f, let-7g, let-7i, miR-22, miR-26b, miR-122, miR-208a, miR-208b, miR-1, miR-217, miR-216a, or combinations thereof.

[0055] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, where the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

[0056] In some embodiments, at least a subset of target cells and at least a subset of non-target cells differ in terms of promoter fragment level or activity, where an unbroken nucleic acid molecule further comprises this promoter fragment.

[0057] In some embodiments, the target cells are tumor cells, and the cell-specific event is tumor cell death. In some embodiments, tumor cell death is mediated by immune targeting through the expression of activating receptor ligands, specific antigens, stimulating cytokines, or any combination thereof.

[0058] In some embodiments, the target cells are senescent cells, and the cell-specific event is the death of senescent cells. In some embodiments, the method further comprises contacting a population of cells with a prodrug or non-toxic precursor compound that is metabolized by the output to become a therapeutic or toxic compound.

[0059] In some embodiments, output expression ensures the survival of the target cell population, while non-target cells are eliminated due to the absence of output expression and in the presence of unrelated and nonspecific cell death inducers.

[0060] In some embodiments, the target cells contain the specific phenotype of interest, such that the output expression is limited to cells of this particular phenotype. In some embodiments, the target cells are a selected cell type, and the cell-specific event encodes a novel function through the expression of a gene that is naturally absent or inactive in the selected cell type.

[0061] In some embodiments, a population of cells includes multicellular organisms. In some embodiments, a multicellular organism is an animal. In some embodiments, an animal is a human being. In some embodiments, the cell populations are brought into contact ex vivo. In some embodiments, the cell populations are brought into contact in vivo.

[0062] In other aspects, this disclosure relates to indistinct polynucleic acid molecules. In some embodiments, indistinct polynucleic acid molecules are a) A first cassette encoding a first RNA whose expression is operably linked to a transactivator response element, wherein the first RNA comprises (i) an output nucleic acid sequence; and (ii) a target site for a miRNA, wherein the miRNA is highly expressed and / or active in at least two different healthy tissues of a mammal and is expressed at low levels in one or more types of target cells; b) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of ; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette.

[0063] The following drawings form part of this specification and are included to further illustrate certain aspects of the disclosure. This disclosure may be better understood by reference to one or more of these drawings in combination with the detailed descriptions of the particular aspects presented herein. It should be understood that the data shown in the drawings does not limit the scope of this disclosure in any way. [Brief explanation of the drawing]

[0064] [Figure 1A-1C]Figure 1A-1N. Conversion of multiplasmid circuit structures to viral vectors. Figure 1A. Schematic diagram of gene arrangement. Dispersive (top) and convergent (bottom) arrangements were performed; for each, two variants were created using different variants of the auxiliary transactivator PIT (dispersive: D-P2:PIT=PIT::RelA; D-PV:PIT=PIT::VPI6; convergent: C-P2:PIT=PIT::RelA; C-PV:PIT=PIT::VPI6). Figure 1B. Performance testing of skeletal DNA using transient transfection and ectopic input expression in HeLa cells. Bars in each group, from left to right: C-P2, D-P2, C-PV, D-PV. Figure 1C. Evaluation of construct response to endogenous input in HuH-7 and HeLa cells. The bars in each group, from left to right: C-P2, D-P2, C-PV, D-PV. [Figure 1D-1F] Figure 1A-1N. Conversion of the multiplasmid circuit structure to a viral vector. Figure 1D. Schematic diagram of a construct incorporating a miRNA target as a strong off-switch, shown using the miR-424 target sequence. Dispersed (top) and convergent (bottom) configurations were performed; for each, two variants were created using different variants of the auxiliary transactivator PIT (dispersed: D-P2:PIT=PIT::RelA-T424; D-PV:PIT=PIT::VPI6-T424; convergent: C-P2:PIT=PIT::RelA-T424; C-PV:PIT=PIT::VPI6-T424). Figure 1E. Verification of the AND-gate component of a logic program in HeLa cells via ectopic expression of TF input. Bars in each group, from left to right: C-P2-T424, D-P2-T424, C-PV-T424, D-PV-T424. Figure 1F. Evaluation of circuit responses to endogenous transcriptional inputs in HuH-7 and HeLa cells. The order of the bars is the same as in Figure 1E. [Figure 1G-1J]Figure 1A-1N. Conversion of multiplasmid circuit structures to viral vectors. Figure 1G. Complete evaluation of a three-input program encoded in dispersed orientation in HeLa cells using ectopic input delivery. Input combinations containing only miR-424 were not evaluated because it is obvious they are useless based on the absence of expression in the absence of all inputs and the fact that miR-424 is a negative regulator. Bars in each group, from left to right: D-P2-T424, D-PV-T424. Figure 1H. Functionality of miRNA switches in the presence of inducible TF inputs. Circuit outputs are tested in HuH-7 cells with or without ectopic transfection of miR-424 mimetic (shown below the X axis). The order of the bars is the same as in Figure 1G. Figure 1I. Evaluation of the repressibility of circuits possessing the miR-126 target in the presence of endogenously expressed inducible TF inputs. The order of the bars is the same as in Figure 1G. Figure 1J. Evaluation of the effect of miRNA targets on cell classification performance using two HCC cell lines and HeLa cells as a negative control. Bars in each group, from left to right: D-P2, D-PV, D-P2-T424, D-PV-T424, C-PV-T126, D-PV-T126. [Figure 1K-1L] Figure 1A-1N. Conversion of multiplasmid circuit structures to viral vectors. Figure 1K. Evaluation of circuit panels with and without miRNA sensors incorporated and packaged in DJ-pseudotype AAV vectors in HCC cell lines HepG2 and HuH-7. HeLa and HCT-116 cell lines were used as counter samples. Bars in each group, from left to right: CMV, D-P2, D-PV, D-P2-T424, D-PV-T424, C-PV-T126, D-PV-T126. Figure 1L. In vitro evaluation of a panel of miRNAs for their ability to distinguish healthy primary cultured hepatocytes from HCC cell lines. Bars in each group, from left to right: TFF5, T424, T126, T122. [Figure 1M]Figure 1A-1N. Conversion of multiplasmid circuit structures to viral vectors. Figure 1M-1N. Investigation of the placement of different miRNA targets and their effects on the strength of output suppression. Figure 1M. Schematic diagrams of different constructs and their abbreviated representations. [Figure 1N] Figure 1A-1N. Conversion of multiplasmid circuit structures to viral vectors. Figure 1M-1N. Investigation of the effects of different miRNA target placements and their impact on the strength of output suppression. Figure 1N. Outputs in HepG2 cells (no miR-122 expression) and HuH-7 cells (intermediate levels of miR-122 expression). Bars in each group, from left to right: HepG2, HuH-7. Abbreviations: ITR: internal terminal repeat of AAV2; pA: SV40 polyadenylation signal (convergent orientation), hGH after mCherry, and SV40pA after the PIT gene in dispersive orientation; Cherry: sequence encoding mCherry fluorescent protein; TATA: minimal TATA box (Angelici et al., 2016); HNF1 RE: response element that binds to HNF1A and HNF1B; PIT RE: response element that binds to PIT::RelA and PIT::VP16 transactivator; SOX RE: DNA sequences that bind to the SOX9 and SOX10 transcription factors, and possibly other transcription factors from the SOX family, SOX1-SOX15, SOX17, SOX18, SOX21, SOX30, and SRY; PIT: Pristinomycin-inducible transactivator (Fussenegger et al., 2000), which represents either PIT:RelA or PIT::VP16 fusion. Figure design: Normalized expression of output mCherry is shown on the Y axis.

[0065] [Figure 2A] Figures 2A-2F. Preliminary evaluation of specificity and efficacy of HCC in an orthotopic mouse model. Figure 2A. In vitro validation of the cell classification ability of selected circuits packaged in DJ-pseudotyped viral vectors. [Figure 2B] Figures 2A-2F. Preliminary evaluation of specificity and efficacy of HCC in an orthotopic mouse model. Figure 2B. In vitro cell removal by HSV-TK output circuit compared with a constitutive control vector. A schematic diagram of the circuit used is shown above the bar graph. For all cell lines or primary cultured hepatocytes, the dose-response (X axis) to ganciclovir was measured by GCV alone, in the presence of a constitutive HSV-TK vector and the circuit. Cell viability (MTS) readouts are shown on the Y axis. [Figure 2C] Figures 2A-2F. Preliminary evaluation of specificity and efficacy of HCC in an orthotopic mouse model. Figure 2C. Progression of tumor burden in tumor-bearing mice, as shown in the panel, for different experimental arm groups (n=2) of the pilot experiment. [Figure 2D-2F] Figures 2A-2F. Preliminary evaluation of specificity and efficacy of HCC in an orthotopic mouse model. Figure 2D. Quantitative analysis of tumor load in the liver at the end of treatment, measured by bioluminescence; the image on the left is a superposition of the liver (grayscale) and bioluminescence signals. Figure 2E. Quantitative analysis of tumor load in the liver after treatment. Figure 2F. Correlation between tumor load immediately after dissemination and tumor load at the end of treatment. Two mice from the treatment group are represented by two red dots.

[0066] [Figure 3A-3B] Figures 3A-3F. Identification of selective and broadly applicable miRNA inputs for tumor targeting programs. Figure 3A. Schematic diagram of cell profiling and ranking of miRNA candidates based on high expression of miRNA candidates in healthy liver and low expression in HCC samples. Figure 3B. Schematic diagram of functional validation of pre-selected miRNA inputs. Reporter viral vectors are constructed for all inputs, and all vectors are delivered (one by one) to all target samples to evaluate the biological activity of the inputs. [Figure 3C-3D]Figures 3A-3F. Identification of selective and broadly applicable miRNA inputs for tumor targeting programs. Figure 3C. Results of functional evaluation of a miRNA panel in two HCC cell lines and primary cultured healthy hepatocytes. Low reporter expression corresponds to high miRNA activity. FF5 is the control target. Figure 3D. Correlation between miRNA expression counts identified in NGS profiling experiments (Dastor et al., 2018) and the functional response of selected miRNA sensors. The trend line is fitted to the Hill function of the repressor. [Figure 3E] Figures 3A–3F. Identification of selective and broadly applicable miRNA inputs for tumor targeting programs. Figure 3E. Quantified expression of a panel of miRNA reporter vectors after systemic delivery in different mouse organs. Expression of different reporters in the same organ (shown above the figure) is grouped together. Bar intensity indicates which organs were predicted to respond to the reporter, based on literature analysis and profiling data. Values ​​are normalized against a control vector containing the TFF5 target; this reveals that this target responds to potential input in vivo, with many reporters yielding output values ​​greater than 1. [Figure 3F] Figures 3A–3F. Identification of selective and broadly applicable miRNA inputs for tumor targeting programs. Figure 3F. Representative images of reporter expression in various organs. Reporter names are shown on the left. The Cerulean panel shows the expression of constitutive mCerulean internal controls. The Cherry panel shows the remaining expression of mCherry reporters with the indicated miRNA targets.

[0067] [Figure 4A] Figures 4A-4C. Verification of circuit specificity in vitro. Figure 4A. Panel of control constructs used to evaluate the mechanism of action of the circuit. Abbreviations are the same as those in Figures 1A, 1D, and 1M. [Figure 4B-4C]Figures 4A-4C. Verification of circuit specificity in vitro. Figure 4B. Mapping of C.TF-AND partial circuit response to endogenous input in the cell lines of 10 and primary cultured hepatocytes. For all cell lines, the logarithmically transformed outputs of feedback-amplified sensors for SOX9 / 10 and HNF1A / B, normalized to the constitutive output in these cells, are shown on the X and Y axes, respectively. The output of the C.TF-AND circuit is shown on the Z axis. Figure 4C. Mapping of HCC.V2 circuit response in the cell lines of 10 and primary cultured hepatocytes. The logarithmically transformed outputs of the C.TF-AND circuit and the scale of the logarithmically transformed C.let-7c reporter circuit response are plotted on the X and Y axes, while the output of the complete circuit in all cell lines is shown on the Z axis. All values ​​for a given cell type are normalized to the constitutive expression in that cell type.

[0068] [Figure 5A] Figures 5A-5D. In vivo characterization of circuit targeting specificity. Figure 5A. Selected partial program, control vector, complete program, and background outputs obtained using the B1-pseudotype AAV vector in various organs. Values ​​are obtained by quantitative image analysis. [Figure 5B] Figures 5A-5D. In vivo characterization of the specificity of circuit targeting. Figure 5B. Images of tissue sections representing different organs show mCherry expression from different vectors as shown. Phase images and mCherry channels are shown. Pancreatic sections are represented using two different acquisitions to reflect the large dynamic range of mCherry changes. [Figure 5C-5D]Figures 5A-5D. In vivo characterization of the specificity of circuit targeting. Figure 5C. Expression of mCherry output from the HCC.V2 circuit in tumors and organs of HepG2 tumor-bearing mice. Tumors are stably transduced to mCitrine and appear in yellow fluorescent channels. Figure 5D. Quantitative analysis of mCherry expression in tumors and various organs of tumor-bearing mice obtained using image processing.

[0069] [Figure 6A] Figures 6A–6B. In vitro efficacy of circuits and controls in two HCC cell lines and primary cultured hepatocytes. Figure 6A. Dose response to GCV in the absence of any AAV vector (square), in the presence of a constitutive HSV-TK expression cassette (triangle), or in the presence of a complete circuit (circle). Cell viability, measured using the MTS assay, is shown on the Y axis. Schematic representatives of the circuits and their IDs are shown above. [Figure 6B] Figures 6A-6B. In vitro efficacy of the circuit and control in two HCC cell lines and primary cultured hepatocytes. Figure 6B. Sensitivity of HuH-7 cell lines to constitutive HSV-TK cassette and different vector doses of two different tumor targeting programs. Top figure, table: comparison between the two circuit variants; bottom figure, comparison between the constitutive vector and the second circuit variant.

[0070] [Figure 7A-7C] Figures 7A-7F. Efficacy of the HCC targeting circuit in an orthotopic mouse model. Figure 7A. Schematic diagram of tumor establishment and treatment regimen. Figure 7B. Tumor load over time in diverse experimental groups. Tumor load measured via whole-body bioluminescence in vivo is imaged over time. For each animal, the load is normalized to the load one day prior to the start of the GCV injection regimen. Figure 7C. Spider plot showing the development of tumor load for individual animals in the main experimental group, normalized to the tumor load one day prior to the start of the GCV injection regimen. [Figure 7D]Figures 7A-7F. Efficacy of the HCC targeting circuit in an orthotopic mouse model. Figure 7D. Representative images of whole-body luminescence in individual animals from multiple experimental groups. [Figures 7E-7F] Figures 7A-7F. Efficacy of the HCC targeting circuit in an orthotopic mouse model. Figure 7E. Tumor load in the liver measured by individual liver images and bioluminescence of the entire organ at the end of the study for multiple experimental groups. Figure 7F. Quantification of tumor load in Figure 7E.

[0071] [Figure 8A-8B] Figures 8A-8C. In vivo evaluation of AAV-B1 tumor transduction. Figure 8A. In liver and HepG2 tumors, the outputs of the control vector, the C.TF-AND subprogram and complete program packaged in the DJ-pseudotype AAV vector are compared with the output of the complete circuit packaged in the B1-pseudotype AAV vector. Tumors are stably transduced with mCitrine, which is reflected in the yellow fluorescent channel. Figure 8B. Quantification of HCC.V2-driven output levels (mCherry) in tumors by delivery of AAV-DJ and AAV-B1. Values ​​are obtained by quantitative image analysis. [Figure 8C] Figures 8A-8C. In vivo evaluation of AAV-B1 tumor transduction. Figure 8C. Output from the HCC.V2 circuit delivered by B1-pseudotype AAV in the core section of a large cancerous lesion.

[0072] [Figure 9A-9B]Figures 9A-9C. Rational design of an optimized circuit combining multiple hepatoprotective miRNAs. Figure 9A. Schematic diagram of a candidate circuit (HCC.V3) combining potent miR-let7c and weak miR-122 suppression. Potent miR-let7c suppression is obtained using the target configuration described in HCC.V2. The intensity of miR-122-induced suppression can be adjusted by changing the number, arrangement, or sequence of miRNA targets. Three distinct strategies have been identified to reduce the miR-122 suppression level compared to HCC.V1: (i) use of a complete miR-122 target (T-122*) only in the transactivator branch of the circuit; (ii) dual suppression of the transactivator and output using a miR-122 target (T-122*) with incomplete complementarity; or (iii) a mixed approach relying on a complete target to suppress the transactivator and an incomplete miRNA target to suppress the output. We select candidates that maximize suppression in liver cell lines while minimizing expression loss in a panel of HCC cell lines (particularly HUH-7). Each candidate is tested in variants positioned relative to both possible miRNA targets. Figure 9B. Examples of incomplete miR-122 targets (T-122*) driven from the conserved UTR region of the endogenous gene (P4HA1) regulated by miR-122 (SEQ ID NOs. 305 and 306, top and bottom, respectively). Targets with incomplete complementarity are obtained by using sequences present in the endogenous gene or by introducing random mutations in regions adjacent to the miRNA seed sequence. Either approach will be used to construct a selection of targets with various dose-response profiles. [Modes for carrying out the invention]

[0073] Detailed explanation One of the futures of molecular computing (Benenson, 2012) and synthetic biology (Weber and Fussenegger, 2012) is the rational design of "smart" therapies (Benenson et al., 2004) that sense and respond to disease-related cues in complex ways and in real time, leading to precise and "on-demand" therapeutic activation. To realize this future, three separate challenges must be addressed. First, a thorough understanding of disease mechanisms is required to design a blueprint for therapeutically relevant sense-compute-response cascades. In particular, relevant inputs must be identified and, preferably, programs that will yield the most effective and least toxic responses must be determined. Second, robust synthetic biology platforms capable of executing these therapeutic cascades must exist or be newly developed for this purpose. Third, these platforms must be adapted to clinically relevant therapeutic modalities. Among the latter, cell and gene therapy have been identified as the most suitable for the clinical translation of synthetic gene circuits, based on the fact that both of these modalities enable and often require the incorporation of manipulated gene payloads.

[0074] Addressing all these challenges narrows the area of ​​potential medical applications to developing approaches in a bridging setting. A series of studies focuses on cell-based implants in which genetically modified cells can sense disease-related cues in the bloodstream and, in response, secrete agents of molecules with therapeutic properties. In this series of studies, cell implants act as sentinels and "factories" that sense the disease state of an organism and, in response, generate therapies that affect the organism as a whole (Auslander et al., 2014; Tastanova et al., 2018; Ye et al., 2017). A second series of studies, based on CAR-T cell therapeutic approaches, aims to enhance these cells with multi-input combinatorial sensing properties to improve their specificity for cancer cells expressing surface antigen combinations and to mitigate on-target, off-tumor effects (Cho et al., 2018; Kloss et al., 2013; Royal et al., 2016; Zah et al., 2016).

[0075] The application of synthetic biology in the field of gene therapy has also shown initial success in animal disease models. A hybrid approach combining engineered T cells with a set of lentiviral vectors that target ovarian cancer cells and express immunomodulatory factors in these cells demonstrated efficacy in a mouse model of ovarian metastasis into the peritoneal cavity. Cell targeting was performed as an AND gate enabled by a miRNA sponge between two promoters whose combination has been shown to be tumor-specific (Nissim et al., 2017). In another recent study, an oncolytic adenovirus was engineered to replicate based on multi-input logical control of its life cycle and demonstrated efficacy when injected intratumorally into subcutaneous tumors (Huang et al., 2019).

[0076] The main added value of synthetic gene circuits for gene and cell therapy stems from sophisticated approaches that "program" therapeutic responses, i.e., modulate the specificity, timing, and dosage of therapeutic initiation in predetermined, potentially dynamic, and in combination with diverse feedback regulatory motifs (Angelici et al., 2016; Xie et al., 2011). However, supplying gene circuits that regulate the expression of known therapeutic transgenes is not necessarily superior to more established approaches that often utilize constitutively driven or tissue-specific promoter-driven therapeutic genes packaged in viral vectors with some degree of organ or cell-type specificity via their capsids (Al-Zaidy et al., 2019; Landegger et al., 2017; Scholl et al., 2016). Alternatively, viral vectors can be injected directly into the target tissue or organ (Juttner et al., 2019; Nelson et al., 2016), which reduces the diversity of cell types that need to be specifically targeted. Indeed, the vast majority of approved therapies, including clinically approved CAR-T cells (June et al., 2018) and many gene therapies (Keeler and Flotte, 2019) manipulated based on this approach, demonstrate satisfactory efficacy and safety profiles. Therefore, the responsibility to demonstrate this benefit lies with the synthetic biology community.

[0077] Cancer is a disease with immense potential to benefit from therapies powered by synthetic biology. Even cancer in the narrow sense is heterogeneous, both among groups of patients and even among individual tumors within the same patient (Dagogo-Jack and Shaw, 2018). Tumors within a patient are often dispersed between primary and metastatic sites, which makes intratumor injections only feasible for a subset of cases. Finally, antitumor therapies are highly toxic, meaning their activation in non-tumor cells will often result in dramatic adverse effects. In summary, the need to precisely target complex and heterogeneous cell populations, combined with the need to deliver agents systemically to target the dispersed population of tumors, suggests that the use of synthetic biology approaches may be beneficial.

[0078] Disclosed herein are seamless polynucleic acid molecules that encode classification indicator gene circuits, comparable to commonly used gene therapy viruses and non-viral vectors. Also disclosed herein are methods for performing complex multi-input control over the expression of an output (i.e., the gene of interest) in a population of cells. These methods include gene therapy for the diagnosis and treatment of diseases such as cancer (e.g., hepatocellular carcinoma (HCC)).

[0079] I. Composition of seamless polynucleic acid molecules In some aspects, this disclosure relates to uninterrupted polynucleic acid molecules containing gene circuits. As used herein, the term “uninterrupted polynucleic acid molecule” means either a single continuous nucleic acid molecule (i.e., a single-stranded polynucleic acid molecule) or two complementary continuous nucleic acid molecules (i.e., a double-stranded polynucleic acid molecule containing two complementary strands). In some embodiments, the uninterrupted polynucleic acid is RNA (e.g., single-stranded or double-stranded). In some embodiments, the uninterrupted polynucleic acid is DNA (e.g., single-stranded or double-stranded). In some embodiments, the uninterrupted polynucleic acid is a DNA:RNA hybrid.

[0080] As described herein, a continuous polynucleic acid comprises a gene circuit encoded in one or more expression cassettes. As used herein, the terms “expression cassette” and “cassette” are interchangeable and refer to a polynucleic acid comprising: (i) a nucleic acid sequence encoding RNA (e.g., including an output nucleic acid sequence and / or transactivator); and (ii) a nucleic acid sequence that modulates the RNA expression level (e.g., a transactivator response element, a transcription factor response element, a minimal promoter, and / or a promoter element).

[0081] In some embodiments, the uninterrupted polynucleic acid molecule comprises a gene circuit consisting of a single cassette. In other embodiments, the uninterrupted polynucleic acid molecule comprises a gene circuit comprising two or more cassettes.

[0082] In some embodiments, an indistinct polynucleic acid molecule comprises two or more cassettes, at least two of which are in a dispersed orientation. The term “dispersed orientation,” as used herein, refers to a configuration in which (i) the transcription of the first and second cassettes proceeds on different strands of the indistinct polynucleic acid molecule, and (ii) the transcription of the first cassette is directed away from the second cassette, and the transcription of the second cassette is directed away from the first cassette. Figure 1A (above schematic diagram) provides examples of various dispersed configurations.

[0083] In some embodiments, an indistinct polynucleic acid molecule comprises two or more cassettes, at least two of which are in a convergent orientation. As used herein, the term “convergent orientation” refers to a configuration in which (i) transcription of the first and second cassettes proceeds on different strands of the indistinct polynucleic acid molecule, and (ii) transcription of the first cassette is directed toward the second cassette, and transcription of the second cassette is directed toward the first cassette. In some embodiments, the two convergent cassettes share a polyadenylation sequence. Figure 1A (schematic diagram below) provides examples of various convergent configurations.

[0084] In some embodiments, an indistinct polynucleic acid molecule comprises two or more cassettes, at least two of which are in a head-to-tail orientation. As used herein, the term “head-to-tail” means a configuration in which (i) the transcription or translation of the first and second cassettes proceeds on the same strand of the indistinct polynucleic acid molecule, and (ii) the transcription or translation of the first cassette is directed toward the second cassette and the transcription or translation of the second cassette is directed away from the first cassette (5'...->...->...3').

[0085] In some embodiments, two cassettes are separated by one or more insulators. An insulator is a nucleic acid sequence that, when bound by an insulator-binding protein, shields a regulatory or responsive component from the effects of other neighboring regulatory elements. For example, by flanking a cassette of unbroken polynucleic acid molecules, each cassette can be shielded from the effects of the regulatory elements of the other cassette. Examples of insulators are known to those skilled in the art.

[0086] The gene circuits described herein utilize one or more mechanisms to regulate the expression level of an output molecule (i.e., the gene of interest). Thus, each of the continuous polynucleic acids described herein includes a cassette encoding RNA containing the output nucleic acid sequence. Exemplary output molecules are provided below. The RNA containing the output nucleic acid sequence is operably ligated to a transactivator response element (and optionally, one or more further nucleic acid sequences that regulate RNA expression, e.g., a transcription factor response element, a minimal promoter, and / or a promoter element).

[0087] To regulate the expression level of an output molecule (i.e., the gene of interest), each of the uninterrupted polynucleic acids described herein further comprises: (i) a cassette encoding RNA (e.g., mRNA) containing the nucleic acid sequence of a transactivator; and (ii) a cassette encoding RNA containing a miRNA target site. Exemplary transactivators and miRNA target sites are provided below.

[0088] A cassette encoding RNA (e.g., mRNA) containing the transactivator nucleic acid sequence may be operably ligated to nucleic acid sequences that regulate RNA expression (e.g., transactivator response elements, transcription factor response elements, minimal promoters, and / or promoter and / or enhancer elements). In some embodiments, the cassette encoding RNA containing the transactivator nucleic acid sequence is the same cassette encoding RNA containing the output nucleic acid sequence (i.e., a single RNA contains both the transactivator and output nucleic acid sequences).

[0089] The cassette encoding the RNA containing the miRNA target site may be the same cassette encoding the RNA containing the output nucleic acid sequence (i.e., the RNA containing the output nucleic acid sequence further contains the miRNA target site). Alternatively, or in addition, the cassette encoding the RNA containing the miRNA target site may be the same cassette encoding the RNA containing the transactivator nucleic acid sequence (i.e., the transactivator nucleic acid sequence further contains the miRNA target site).

[0090] In some embodiments, the nucleic acid sequence of the RNA encoded by the cassette further comprises a polyadenylation sequence. In some embodiments, the polyadenylation sequence is suitable for transcription termination and polyadenylation in mammalian cells.

[0091] (i) miRNA target site Each of the uninterrupted polynucleic acids described herein comprises one or more cassettes encoding RNA (for example, RNA containing a nucleic acid sequence encoding an output and / or RNA containing a nucleic acid sequence of a transactivator), which comprises a miRNA target site. miRNAs are a class of small non-coding RNAs, typically 21–25 nucleotides in length, that downregulate the level of RNA to which they bind in a variety of ways, including translational repression, mRNA cleavage, and deadenylation. The term “miRNA target site” as used herein means a sequence that is complementary to and regulated by a miRNA. A miRNA target site may have at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementarity with respect to a miRNA that binds to and modulates the miRNA target site.

[0092] In some embodiments, the RNA encoded by the cassette described herein contains at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 miRNA target sites. In some embodiments, the RNA encoded by the cassette described herein contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 miRNA target sites. In some embodiments, the RNA encoded by the cassette described herein contains 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 5-6, 5-7, 5-8, 5-9, 5-10, 6-7, 6-8, 6-9, 6-10, 7-8, 7-9, 7-10, 8-9, 8-10, or 9-10 miRNA target sites.

[0093] In some embodiments, the RNA encoded by the cassette described herein comprises multiple miRNA target sites, each of which has the same sequence or comprises different nucleic acid sequences regulated by the same miRNA. In other embodiments, the RNA encoded by the cassette described herein comprises two or more miRNA target sites regulated by distinguishable miRNAs (i.e., distinguishable miRNA target sites), which comprises, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 distinguishable miRNA target sites. In some embodiments, the RNA encoded by the cassette described herein comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 distinguishable miRNA target sites. In some embodiments, the RNA encoded by the cassette described herein contains 1-2, 1-3, 1-4, 1-5, 1-6, 1-7, 1-8, 1-9, 1-10, 2-3, 2-4, 2-5, 2-6, 2-7, 2-8, 2-9, 2-10, 3-4, 3-5, 3-6, 3-7, 3-8, 3-9, 3-10, 4-5, 4-6, 4-7, 4-8, 4-9, 4-10, 5-6, 5-7, 5-8, 5-9, 5-10, 6-7, 6-8, 6-9, 6-10, 7-8, 7-9, 7-10, 8-9, 8-10, or 9-10 distinguishable miRNA target sites.

[0094] The miRNA target site of the RNA encoded by the cassette described herein may be located anywhere in the RNA sequence. For example, in some embodiments, the RNA encoded by the cassette described herein includes a 3'UTR, where the 3'UTR includes the miRNA target site. In some embodiments, the RNA encoded by the cassette described herein includes an intron, where the intron includes the miRNA target site. In some embodiments, the RNA encoded by the cassette described herein includes a 5'UTR, where the 5'UTR includes the miRNA target site.

[0095] Exemplary miRNAs and miRNA target sites are listed in Table 1. In some embodiments, the RNA encoded by the cassettes described herein includes miRNA target sites for the miRNAs listed in Table 1. In some embodiments, the RNA encoded by the cassettes described herein includes multiple miRNA target sites corresponding to the miRNAs listed in Table 1 (for example, a combination including the let-7c target site and the miR-122 target site).

[0096] In some embodiments, the RNA encoded by the cassettes described herein includes miRNA target sites having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with respect to the miRNA target sites listed in Table 1. In some embodiments, the RNA encoded by the cassettes described herein includes multiple miRNA target sites having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with respect to the miRNA target sites listed in Table 1.

[0097] In some embodiments, the RNA encoded by the cassettes described herein includes the let-7a target site, let-7b target site, let-7c target site, let-7d target site, let-7e target site, let-7f target site, let-7g target site, let-7i target site, miR-22 target site, miR-26b target site, miR-122 target site, miR-208a target site, miR-208b target site, miR-1 target site, miR-217 target site, miR-216a target site, or a combination thereof (for example, a combination of the let7c target site and the miR-122 target site).

[0098] In some embodiments, the RNA encoded by the cassette described herein includes a let-7c target site (i.e., a nucleic acid sequence complementary to and regulated by hsa-let-7c). In some embodiments, the let-7c target site consists of the nucleic acid sequence AACCATACAACCTACTACCTCA (SEQ ID NO: 42).

[0099] In some embodiments, the RNA encoded by the cassette described herein includes a miR-22 target site (i.e., a nucleic acid sequence complementary to and regulated by miR-22). In some embodiments, the miR-22 target site consists of the nucleic acid sequence ACAGTTCTTCAACTGGCAGCTT (SEQ ID NO: 43).

[0100] In some embodiments, the RNA encoded by the cassette described herein includes a miR-26b target site (i.e., a nucleic acid sequence complementary to and regulated by miR-26b). In some embodiments, the miR-26b target site consists of the nucleic acid sequence ACCTATCTGAATTACTTGAA (SEQ ID NO: 44).

[0101] In some embodiments, the RNA encoded by the cassette described herein includes a miR-126-5p target site (i.e., a nucleic acid sequence complementary to and regulated by miR-126-5p). In some embodiments, the miR-126-5p target site consists of the nucleic acid sequence CGTGTTCACAGCGGACCTTGAT (SEQ ID NO: 45).

[0102] In some embodiments, the RNA encoded by the cassette described herein includes a miR-424 target site (i.e., a nucleic acid sequence complementary to and regulated by miR-424). In some embodiments, the miR-424 target site consists of the nucleic acid sequence GTCAAAACATGAATTGCTGCT (SEQ ID NO: 48).

[0103] In some embodiments, the RNA encoded by the cassette described herein includes a miR-122 target site (i.e., a nucleic acid sequence complementary to and regulated by miR-122). In some embodiments, the miR-122 target site consists of the nucleic acid sequence CAAACACCATTGTCACACTCCA (SEQ ID NO: 46).

[0104] Table 1. Exemplary miRNAs and exemplary miRNA target sites. [Table 1-1] [Table 1-2] [Table 1-3]

[0105] In some embodiments, the uninterrupted polynucleic acid described herein consists of a single cassette, where the single cassette encodes RNA containing a miRNA target site (in addition to including the output nucleic acid sequence and the transactivator nucleic acid sequence). In another embodiment, an uninterrupted polynucleic acid comprises two or more cassettes, at least one of which encodes RNA containing a miRNA target site.

[0106] In some embodiments, multiple cassettes of an indistinct polynucleic acid molecule each contain at least one miRNA target site. In some embodiments, each miRNA target site of the indistinct polynucleic acid is unique (i.e., the indistinct polynucleic acid contains only one copy of the miRNA target). In some embodiments, the indistinct polynucleic acid molecule comprises at least two cassettes, each containing at least one miRNA target site which is the same nucleic acid sequence. In some embodiments, the indistinct polynucleic acid molecule comprises at least two cassettes, each containing at least one miRNA target site, where at least one miRNA target site of each cassette contains different nucleic acid sequences regulated by the same miRNA. For example, the first cassette may contain miRNA target site X, and the second cassette may contain miRNA target site Y, where miRNA Z regulates target sites X and Y.

[0107] In some embodiments, a miRNA that modulates the miRNA target site of an uninterrupted polynucleic acid described herein (i.e., at least one miRNA) is highly expressed and / or active in at least one cell type (e.g., those of multicellular organisms such as mammals) in which output expression must be low. The miRNA is highly expressed and / or active, as described herein, if the output expression is reduced by at least 50% compared to the level of output expression of a reference uninterrupted polynucleic acid (i.e., one containing the same nucleic acid sequence but lacking the miRNA target site regulated by the miRNA) in the tissue cell type. In some embodiments, the output is reduced by at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.9% compared to a reference uninterrupted polynucleic acid.

[0108] In some embodiments, a miRNA (i.e., at least one miRNA) that modulates a miRNA target site of an indistinct polynucleic acid described herein is highly expressed and / or active in at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 500, and at least 1000 cell types (e.g., those of multicellular organisms such as mammals) where output expression must be low.

[0109] In some embodiments, a miRNA that modulates the miRNA target of a continuous polynucleic acid described herein (i.e., at least one miRNA) has low expression and / or inactivity in at least one target cell type (e.g., those of multicellular organisms such as mammals) where output expression must be high. The miRNA has low expression and / or inactivity, as described herein, when its output expression is less than 40% lower in the target cell type compared to the output expression level of a reference continuous polynucleic acid (i.e., one containing the same nucleic acid sequence but lacking the miRNA target site regulated by the miRNA). In some embodiments, the output is reduced by less than 35%, less than 30%, less than 25%, less than 20%, less than 15%, less than 10%, less than 5%, less than 4%, less than 3%, less than 2%, or less than 1% compared to the reference continuous polynucleic acid. In some embodiments, there is no statistically significant difference between the output expression levels of the continuous polynucleic acid containing the miRNA target and the reference continuous polynucleic acid molecule.

[0110] In some embodiments, a miRNA (i.e., at least one miRNA) that modulates a miRNA target site of an indistinct polynucleic acid described herein is expressed at a low level and / or inactive in at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 500, and at least 1000 target cell types (e.g., those of multicellular organisms such as mammals) where output expression must be high.

[0111] (ii) Exemplary transactivator Each of the uninterrupted polynucleic acids described herein comprises a cassette encoding RNA (e.g., mRNA) containing the nucleic acid sequence of a transactivator. In some embodiments, the uninterrupted polynucleic acid comprises the nucleic acid sequence of a single transactivator. In other embodiments, the uninterrupted polynucleic acid comprises the nucleic acid sequences of multiple transactivators (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 transactivators).

[0112] The terms “transactivator” or “transactivator protein,” as used herein, refer to a protein encoded on an inseparable polynucleic acid molecule that transactivates the expression of an output (i.e., the gene of interest) and binds to a transactivator response element operably linked to the nucleic acid encoding the output (i.e., the gene of interest). In some embodiments, the transactivator binds to and transactivates the transactivator response element independently (i.e., in the absence of any further factors). In other embodiments, the transactivator binds to and transactivates the transactivator response element only in the presence of a transcription factor bound to a transcription factor response element.

[0113] In some embodiments, the transactivator protein includes a DNA-binding domain. In some embodiments, the DNA-binding domain is engineered to bind to a DNA sequence that is distinct from (i.e., not naturally occurring) a sequence. Examples of DNA-binding domains are known to those skilled in the art, but include, DNA-binding domains derived using zinc finger technology or TALEN technology, or from mutant response modulators of two-component signaling pathways from bacteria.

[0114] In some embodiments, the DNA-binding domain is derived from mammalian proteins. In other embodiments, the DNA-binding domain is derived from non-mammalian proteins. For example, in some embodiments, the DNA-binding domain is derived from proteins derived from bacteria, yeast, or plants. In some embodiments, the DNA-binding domain requires additional components (e.g., proteins or RNA) to target the transactivator response element. For example, in some embodiments, the DNA-binding domain is that of a CRISPR / Cas protein (e.g., Cas1, Cas2, Cas3, Cas5, Cas4, Cas6, Cas7, Cas8a, Cas8b, Cas8c, Cas9, Cas10, Cas10d, Cse1, Cse2, Csy1, Csy2, Csy3, Csm2, Cmr5, Csx10, Csx11, Csf1, Cpf1, C2c1, C2c2, C2c3), which requires an additional guide RNA component to target the transactivator response element.

[0115] In some embodiments, the transactivator protein is derived from a naturally occurring transcription factor, where the DNA-binding domain of the naturally occurring transcription factor is mutated, resulting in modified DNA-binding specificity compared to the wild-type transcription factor. In some embodiments, the transactivator is a naturally occurring transcription factor.

[0116] In some embodiments, the transactivator protein further comprises a transactivation domain (i.e., a fusion protein containing a DNA-binding domain and a transactivation domain). As used herein, the term “transactivation domain” refers to a protein domain that functions to recruit a transcription mechanism to a minimal promoter. In some embodiments, the transactivation domain does not independently cause gene activation. In some embodiments, the transactivation domain is naturally occurring. In other embodiments, the transactivation domain is engineered. Examples of transactivation domains are known to those skilled in the art, and are not limited to these, but include the RelA transactivation domain, VP16, VP48, and VP64.

[0117] Exemplary transactivators are listed in Table 2. In some embodiments, the transactivator of at least one cassette is a transactivator listed in Table 2 or a transactivator having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity of its amino acid sequence with one or more transactivators listed in Table 2. In some embodiments, the seamless polynucleic acid molecules described herein encode a combination of transactivators listed in Table 2 or a combination of transactivators having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity of its amino acid sequence with one or more transactivators listed in Table 2.

[0118] In some embodiments, the transactivator of at least one cassette is tTA, rtTA, PIT-RelA, PIT-VP16, ET-VP16, ET-RelA, NarLc-VP16, or NarLc-RelA. See, for example, Angelici B. et al., Cell Rep. 2016 Aug 30; 16(9): 2525-2537.

[0119] Table 2. Exemplary transactivators. DNA sequences are merely examples of those that can encode the represented protein sequence; due to degenerate codons, a very large set of DNA sequences may encode the same protein sequence. Transactivator domains such as RelA and VP16 are merely examples of possible transactivator domains (TADs). "VP16 TAD" represents the transactivator domain derived from the VP16 gene of herpes simplex virus; multiple domains, combinations thereof, and their variants can function as transactivator domains when fused to a DNA-binding domain. Transactivator DNA-binding domains (DBDs) are merely examples of such domains when derived from full-length proteins; they may be further reduced or enlarged to contain more amino acids than their full-length protein precursors. DBDs derived from response regulators of prokaryotic two-component signaling pathways are shown based on their protein sequences in E. coli. However, orthologs of these genes from other eukaryotic strains and species can be used in exactly the same way. In addition, DNA-binding domains of response regulators from two-component signaling pathways that do not have an ortholog in E. coli can also be used for the same purpose. M (underlined) represents the start codon introduced before various DBDs to enable their translation. "::" represents the fusion point between DBD and TAD. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10] [Table 2-11] [Table 2-12]

[0120] (iii) Example output molecule Each of the uninterrupted polynucleic acids described herein comprises a cassette encoding RNA (e.g., mRNA) containing an output nucleic acid sequence (i.e., the gene of interest). In some embodiments, the uninterrupted polynucleic acid comprises a single output nucleic acid sequence. In other embodiments, the uninterrupted polynucleic acid comprises a plurality of output nucleic acid sequences (e.g., 2, 3, 4, 5, 6, 7, 8, 9, or 10 outputs).

[0121] In some aspects, the output is an RNA molecule. In some aspects, the RNA molecule is mRNA, which codes for a protein. In some aspects, the output is a non-coding RNA molecule. Examples of non-coding RNA molecules are known to those skilled in the art and include, but are not limited to, transfer RNA (tRNA), ribosomal RNA (rRNA), miRNA, siRNA, piRNA, snoRNA, snRNA, exRNA, scaRNA, and long ncRNA.

[0122] In some embodiments, the output is a therapeutic molecule (i.e., related to the treatment of a disease), such as a therapeutic protein or RNA molecule. Examples of therapeutic molecules, but not limited to, include antibodies (e.g., monoclonal or polyclonal; chimeric; humanized; antibody fragments and antibody derivatives (bispecificity, tripspecificity, scFv and Fab)), enzymes, hormones, inflammatory molecules, anti-inflammatory molecules, immunomodulatory molecules, anticancer molecules, short hairpin RNA, short interfering RNA and miRNA. Specific examples of the aforementioned classes of therapeutic molecules are publicly known in the art, and any of them may be used in accordance with this disclosure.

[0123] In some embodiments, the output encodes an antigenic protein, protein domain, or peptide that is derived from a pathogen and is known to trigger an immune response when produced in the body. In some embodiments, the output is a detectable protein, such as a fluorescent protein.

[0124] In some embodiments, the output is a cytotoxin. As used herein, the term “cytotoxin” refers to a substance that is toxic to cells. For example, in some embodiments, the output is a cytotoxic protein. Examples of cytotoxic proteins are known to those skilled in the art, but include, but are not limited to, granulysin, perforin / granzyme B, and Fas / Fas ligand.

[0125] In some embodiments, the output is an enzyme that catalyzes the activation of a prodrug. Examples of enzymes that catalyze the activation of prodrugs are known to those skilled in the art and include, but are not limited to, carboxylesterases, acetylcholinesterases, butyrylcholinesterases, paraoxonases, matrix metalloproteinases, alkaline phosphatases, β-glucuronidases, valacyclovirases, prostate-specific antigens, purine nucleoside phosphorylases, carboxypeptidases, amidases, β-lactamases, β-galactosidases, and cytosine deaminases. For example, see Yang Y. et al., Enzyme-mediated hydrolytic activation of prodrugs. Acta. Pharmaceutica. Sinica B. 2011 Oct; 1(3): 143-159. Similarly, a variety of prodrugs are known to those skilled in the art, and are not limited to these, including acyclovir, allopurinol, azidothymidine, bambuterol, bacampicillin, capecitabine, captopril, carbamazepine, carisoprodol, cyclophosphamide, diethylstilbestrol diphosphate, dipivefrin, enalapril, famciclovir, fludarabine triphosphate, fluorouracil, fosamprenavir, fosphenytoin, fursultiamine, gabapentin enacarbil, and cancer. This includes cyclovir, gemcitabine, hydrazide MAO inhibitors, leflunomide, levodopa, methanamine, mercaptopurine, mitomycin, morcidomin, nabumetone, orsalazine, omeprazole, paliperidone, phenacetin, pivampicillin, primidone, proguanil, psilocybin, ramipril, S-methyldopa, simvastatin, sulfasalazine, sulindac, tegafur, terfenadine, valacyclovir, valganciclovir, and zidovudine.

[0126] In some aspects, the output is thymidine kinase from HSV-TK, human alphaherpesvirus 1 (HHV-1), and UniProtKB-Q9QNF7 (KITH_HHV1). In some embodiments, the output is an immunomodulatory protein and / or RNA. As used herein, the term “immunomodulatory protein” (or “immunomodulatory RNA”) means a protein (or RNA) (i.e., immunosuppressive protein or RNA) that modulates (stimulates (i.e., immunostimulant protein or RNA) or inhibits the immune system by inducing the activation of and / or increasing the activity of components of the immune system. A variety of immunomodulatory proteins are known to those skilled in the art. For example, see Shahbazi S. and Bolhassani A. Immunostimulants: Types and Functions. J. Med. Microbiol. Infec. Dis. 2016; 4(3-4): 45-51. In some embodiments, immunomodulatory proteins are cytokines, chemokines (e.g., IL-2, IL-5, IL-6, IL-10, IL-12, IL-13, IL-15, IL-18, CCR3, CXCR3, CXCR4, and CCR10) or colony-stimulating factors.

[0127] In some embodiments, the output is a DNA-modifying factor. As used herein, the term “DNA-modifying factor” refers to a factor that alters the structure of DNA and / or alters the sequence of DNA (e.g., by inducing recombination or introducing mutations). In some embodiments, a DNA-modifying factor is a gene encoding a protein intended to correct a gene defect, a DNA-modifying enzyme, and / or a component of a DNA-modifying system. In some embodiments, a DNA-modifying enzyme is a site-directed recombinase, a homing endonuclease, or a protein component of a CRISPR / CasDNA modification system.

[0128] In some embodiments, the output is a cell surface receptor. In some embodiments, the output is a kinase. In some embodiments, the output is a factor that modulates gene expression. The term “factor that modulates gene expression,” as used herein, means any factor that, if present, increases or decreases the transcription of at least one gene. In some embodiments, the factor that modulates gene expression is a protein. In some embodiments, the factor that modulates gene expression is RNA. In some embodiments, the factor that modulates gene expression is a component of a multi-component system that can modulate gene expression.

[0129] In some embodiments, the output is an epigenetic modifier. The term “epigenetic modifier,” as used herein, means a factor (e.g., a protein or RNA) that increases, decreases, or alters epigenetic modifications. Examples of epigenetic modifications, though not limited to those skilled in the art, include, but are not limited to, DNA methylation and histone modifications. In some embodiments, the output is a factor necessary for vector replication. Examples of factors necessary for vector replication are known to those skilled in the art.

[0130] (iv) Adjustment component An RNA-encoding cassette (including, for example, an output nucleic acid sequence and / or transactivator) may further include a regulatory component. Where described herein, the regulatory component is a nucleic acid sequence that controls RNA expression (i.e., stimulates an increase or decrease in its expression). For example, in some embodiments, the cassette described herein may encode RNA operably ligated to a transactivator response element, a transcription factor response element, a minimal promoter, and / or a promoter element. The regulatory component is "operably ligated" to the RNA-encoding nucleic acid when it is in a precise functional position and orientation relative to the nucleic acid sequence to regulate (or drive) the transcription initiation and / or expression of that sequence.

[0131] In some embodiments, the regulatory component includes a transactivator response element. The “transactivator response element” may include a minimal DNA sequence that is bound to and recognized by the transactivator protein. In some embodiments, the transactivator response element includes one or more copies (i.e., repeats) of the minimal DNA sequence that is bound to and recognized by the transactivator protein. In some embodiments, the transactivator response element includes at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 repeats of the minimal DNA sequence that is bound to and recognized by the transactivator protein. In some embodiments, the repeats are tandem repeats. In some embodiments, the transactivator response element includes a combination of minimal DNA sequences. In some embodiments, the minimal DNA sequences are interspersed by spacer sequences. In some embodiments, the spacer sequence is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides long, or longer than 20 nucleotides long.

[0132] In some embodiments, the transactivator response element may include a minimal deviation from the DNA sequence or be adjacent to a further DNA sequence while still binding to the transactivator protein. In some embodiments, different transactivator response elements may be positioned adjacent to each other and all may bind to the same transactivator protein.

[0133] Exemplary transactivator response elements are listed in Table 3. In some embodiments, the transactivator response element comprises a nucleic acid sequence listed in Table 3, or a nucleic acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the nucleic acid sequences listed in Table 3.

[0134] Table 3. Exemplary transactivator response elements. "::" represents the fusion point between the transactivator domain (TAD) and the DNA-binding domain (DBD). Abbreviated symbols for the TAD and DBD sequences correspond to Table 2. DNA sequences use the following nomenclature: W=A or T; S=C or G; K=A or C; M=G or T; Y=A or G; R=C or T; V=C, G, or T; H=A, G, or T; D=A, C, or T; B=A, C, or G; N=A, C, G, or T. Uppercase letters indicate strong conservation; lowercase letters indicate weaker conservation. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

[0135] In some embodiments, the regulatory component includes a transcription factor response element. The term “transcription factor response element” refers to a DNA sequence to which a transcription factor binds and is recognized. As used herein, the term “transcription factor” refers to a protein that is not encoded on an unbroken polynucleic acid and regulates the transcription of a gene. In some embodiments, the transcription factor is a transcription activator (i.e., increases transcription). In other embodiments, the transcription factor is a transcription inhibitor (i.e., inhibits transcription). In some embodiments, the transcription factor is an endogenous transcription factor of a cell.

[0136] In some embodiments, the transcription factor response element is manipulated to directly bind to or be indirectly influenced by one or more of the following transcription factors: ABL1, CEBPA, ERCC3, HIST1H2BE, MDM4, PAX7, SMARCA4, TFPT, AFF1, CHD1, ERCC6, HIST1H2BG, MED12, PAX8, SMARCB1, THRAP3, AFF3, CHD2, ERF, HLF, MEF2B, PBX1, SMARCD1, TLX1, AFF4, CHD4, ERG, HMGA1, MEF2 C, PEG3, SMARCE1, TLX3, APC, CHD5, ESPL1, HMGA2, MEN1, PER1, SMURF2, TNFAIP3, AR, CHD7, ESR1, HOXA11, MITF, PHF3, SOX2, SOX4, TP53, ARID1A, CIC, ET S1, HOXA13, MKL1, PHF6, SOX5, TRIM24, ARID1B, CIITA, ETV1, HOXA7, MLLT1, PHOX2B, SOX9, TRIM33, ARID3B, CNOT3, ETV4, HOXA9, MLLT10, PLAG1, SRCAP, T RIP11, ARID5B, CREB1, ETV5, HOXC11, MLLT3, PML, SS18L1, TRPS1, ARNT, CREB3L1, ETV6, HOXC13, MLLT6, PMS1, SSB, TRRAP, ARNT2, CREBBP, EWSR1, HOXD1 1, MYB, PNN, SSX1, TSC22D1, ASB15, CRTC1, EYA4, HOXD13, MYBL1, MYBL2, POU2AF1, SSX2, TSHZ3, ASXL1, CSDE1, EZH2, ID3, MYC, POU2F2, SSX4, VHL, ATF1, C TCF, FEV, IRF2, MYCN, POU5F1, STAT3, WHSC1, ATF7IP, CTNNB1, FLI1, IRF4, MYOD1, PPARG, STAT4, WHSC1L1, ATM, DACH1, FOXA1, IRF6, NCOA1, PRDM1, STAT5 B, WT1, ATRX, DACH2, FOXE1, IRF8, NCOA2, PRDM16, STAT6, WWP1, BAZ2B, DAXX, FOXL2, IRX6, NCOA4, PRDM9, SUFU, WWTR1, BCL11A, DDB2, FOXP1, JUN, NCOR1,PRRX1, SUZ12, XBP1, BCL11B, DDIT3, FOXQ1, KHDRBS2, NCOR2, PSIP1, TAF1, AF15、ZBTB16、BCL6、DEK、FUS、KLF2、NFE2L2、RB1、TAL1、ZBTB20、BCLAF1、DIP2C、FXR1、KLF4、NFE2L3、RBM15、TAL2、ZFP36L1 、BCOR、DNMT1、GATA1、KLF5、NFIB、RBMX、TBX18、ZFX、BRCA1、DNMT3A、GATA2、KLF6、NFKB2、REL、TBX22、ZHX2、BRCA2、DOT1L、G ATA3、LDB1、NFKBIA、RUNX1、TBX3、ZIC3、BRD7、EED、GLI3、LMO1、NONO、RUNX1T1、TCEA1、ZIM2、BRD8、EGR2、GTF2I、LMO2、NOTCH 2、RXRA、TCEB1、ZNF208、BRIP1、ELAVL2、HDAC9、LMX1A、NOTCH3、SALL3、TCERG1、ZNF226、BRPF3、ELF3、HEY1、LYL1、NPM1、SAT B2、TCF12、ZNF331、BTG1、ELF4、HIST1H1B、LZTR1、NR3C2、SETBP1、TCF3、ZNF384、BTG2、ELK4、HIST1H1C、MAF、NR4A3、SFPQ、T CF7L2, ZNF469, CBFA2T3, ELL, HIST1H1D, MAFA, NSD1, SIN3A, TFAP2D, ZNF595, CBFB, EP300, HIST1H1E, MAFB, OLIG2, SMAD2, TFDP1, ZNF638, CDX2, EPC1, HIST1H2BC, MAML1, PAX3, SMAD4, TFE3, CDX4, ERCC2, HIST1H2BD, MAX, PAX5, SMARCA1, Oi-o-TFEB.

[0137] A “transcription factor response element” may include the smallest DNA sequence bound to and recognized by the transcription factor. In some embodiments, the transcription factor response element includes one or more copies (i.e., repeats) of the smallest DNA sequence bound to and recognized by the transcription factor. In some embodiments, the transcription factor response element includes at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 repeats of the smallest DNA sequence bound to and recognized by the transcription factor. In some embodiments, the repeats are tandem repeats. In some embodiments, the transcription factor response element includes a combination of the smallest DNA sequences. In some embodiments, the smallest DNA sequences are interspersed by spacer sequences. In some embodiments, the spacer sequences are 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 nucleotides long, or longer than 20 nucleotides long. In some embodiments, the transactivator response element may include a minimal deviation from the DNA sequence or be adjacent to a further DNA sequence while still binding to the transactivator protein. In some embodiments, different transactivator response elements may be positioned adjacent to each other and all may bind to the same transactivator protein.

[0138] In some embodiments, the transcription factor response element is unique (i.e., an unbroken polynucleic acid contains only one copy of the transcription factor response element). In other embodiments, the transcription factor response element is not unique. In some embodiments, the transcription factor that binds to the transcription factor response element activates the expression of the RNA to which it is operably ligated. In other embodiments, the transcription factor that binds to the transcription factor response element inhibits the expression of the RNA to which it is operably ligated.

[0139] In some embodiments, the regulatory component comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 different transcription factor response elements, each bound by a different transcription factor.

[0140] Exemplary transcription factor response elements are listed in Table 4. In some embodiments, the transcription factor response element comprises a nucleic acid sequence listed in Table 4, or a nucleic acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the nucleic acid sequences listed in Table 4.

[0141] Table 4. Exemplary transcription factor response elements. [Table 4-1] [Table 4-2] [Table 4-3]

[0142] In some embodiments, the regulatory component includes a promoter element (or promoter fragment). Exemplary promoter elements are listed in Table 5. In some embodiments, the promoter element consists of a nucleic acid sequence listed in Table 5, or a nucleic acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the nucleic acid sequences listed in Table 5.

[0143] Table 5. Exemplary promoter elements. [Table 5-1] [Table 5-2] [Table 5-3] [Table 5-4] [Table 5-5] [Table 5-6] [Table 5-7]

[0144] In some embodiments, the promoter element includes a transcription factor response element and a minimal promoter. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment. In some embodiments, the mammalian promoter or promoter fragment is unique (i.e., an unbroken polynucleic acid contains only one copy of the mammalian promoter or promoter fragment). In other embodiments, the mammalian promoter or promoter fragment is not unique.

[0145] In some embodiments, the regulatory component includes a minimal promoter. As used herein, the term “minimal promoter” refers to a nucleic acid sequence that is necessary but insufficient to initiate the expression of an output. In some embodiments, the minimal promoter is naturally occurring. In other embodiments, the minimal promoter is engineered, for example, by modifying and / or shortening a naturally occurring sequence, combining naturally occurring sequences, or combining a naturally occurring sequence with a non-naturally occurring sequence; in each case, the engineered minimal promoter is a non-naturally occurring sequence. In some embodiments, the minimal promoter is engineered from viral or non-viral sources. Examples of minimal promoters are known to those skilled in the art.

[0146] In some embodiments, the regulatory component includes a transactivator response element, a transcription factor response element, and a minimal promoter. Those skilled in the art will understand that these elements can be oriented in a variety of configurations. For example, the transactivator response element may be 5' or 3' relative to the promoter element and / or the transcription factor response element; the transcription factor response element may be 5' or 3' relative to the promoter element and / or the transactivator response element; and the promoter element may be 5' or 3' relative to the transcription factor response element and / or the transactivator response element.

[0147] In some embodiments, the regulatory component of the cassette includes a transactivator response element, a transcription factor response element, and a minimal promoter, from 5' to 3'.

[0148] In some embodiments, the regulatory component of the cassette includes a transactivator response element and a promoter element. In some embodiments, the regulatory component of the cassette includes a transactivator response element and a promoter element from 5' to 3'. In some embodiments, the regulatory component of the cassette includes a transactivator response element, a promoter element and a minimal promoter. In some embodiments, the regulatory component of the cassette includes a transactivator response element, a promoter element and a minimal promoter from 5' to 3'. In some embodiments, the regulatory component of the cassette includes a promoter element and a transactivator response element from 5' to 3'. In some embodiments, the regulatory component of the cassette includes a promoter element, a transactivator response element and a minimal promoter from 5' to 3'. In some embodiments, the promoter element is a mammalian promoter. In some embodiments, the promoter element is a promoter fragment.

[0149] (v) An example of a seamless polynucleic acid In some embodiments, an indistinct polynucleic acid molecule comprises a gene circuit having a single cassette. For example, in some embodiments, the indistinct polynucleic acid molecule comprises a cassette whose expression comprises an RNA encoding which is operably linked to a transactivator response element, wherein the RNA comprises (i) an output nucleic acid sequence; (ii) a transactivator nucleic acid sequence; and (iii) a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof); wherein the transactivator, when expressed as a protein, binds to and transactivates the transactivator response element.

[0150] In some embodiments, the mRNA further comprises a nucleic acid sequence of a polycistronic expression element. The term “polycistronic response element,” as used herein, refers to a nucleic acid sequence that facilitates the production of two or more proteins from a single mRNA. The polycistronic response element may include an internal recognition sequence (IRES) or a polynucleic acid encoding a 2A peptide. See, for example, Liu et al., Systematic comparison of 2A peptides for cloning multi-genes in a polycistronic vector. Sci. Rep. 2017 May 19; 7(1): 2193. In some embodiments, the polycistronic expression element separates the output nucleic acid sequence from the transactivator.

[0151] In some embodiments, the mRNA includes a 3'UTR, where the 3'UTR contains a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof). In some embodiments, the mRNA includes a 5'UTR, where the 5'UTR contains a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0152] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output and transactivator; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0153] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element and a transactivator response element; (ii) a nucleic acid sequence encoding the output and transactivator; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0154] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the transactivator and output; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0155] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element and a transactivator response element; (ii) a nucleic acid sequence encoding a transactivator and output; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0156] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a promoter element and a transactivator response element; (ii) a nucleic acid sequence encoding a transactivator and output; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0157] In some embodiments, an uninterrupted polynucleic acid molecule comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a promoter element; (ii) a nucleic acid sequence encoding the transactivator and output; and (iii) a downstream component including a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0158] In some embodiments, the promoter element includes a mammalian promoter or promoter fragment. In some embodiments, an uninterrupted polynucleotide molecule comprises a gene circuit having multiple cassettes. For example, in some embodiments, an uninterrupted polynucleotide molecule is as follows: a) A first cassette encoding a first RNA whose expression is operably linked to a transactivator response element, wherein the first RNA comprises (i) the nucleic acid sequence of the output; and (ii) a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof); Furthermore b) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of the transactivator; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette.

[0159] In some embodiments, the first RNA includes a 3'UTR, the 3'UTR containing a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof). In some embodiments, the first RNA includes a 5'UTR, the 5'UTR containing a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof).

[0160] In some embodiments, the second RNA includes a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof). In some embodiments, the second RNA includes a 3'UTR, which includes a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof). In some embodiments, the second RNA includes a 5'UTR, which includes a miRNA target site (e.g., a let-7c target site, a miR-22 target site, a miR-26b target site, or a combination thereof). In some embodiments, at least one miRNA target site of the first cassette and at least one miRNA target site of the second cassette are the same nucleic acid sequence or different sequences regulated by the same miRNA.

[0161] In some embodiments, a first RNA is operably ligated to a transcription factor response element. In some embodiments, a second RNA is operably ligated to a transcription factor response element. In some embodiments, the transcription factor response elements of the first cassette and the transcription factor response elements of the second cassette consist of the same nucleic acid sequence. In some embodiments, the transcription factor response elements of the first cassette and the transcription factor response elements of the second cassette consist of different nucleic acid sequences. In some embodiments, either or both of the first cassette or the second cassette contain at least two, at least three, ..., type transcription factor response elements.

[0162] In some embodiments, the first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and the second cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element; (ii) a nucleic acid sequence encoding the transactivator; and (iii) a downstream component including a let-7c target site.

[0163] In some embodiments, the first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element and a transactivator response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and the second cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element; (ii) a nucleic acid sequence encoding a transactivator; and (iii) a downstream component including a let-7c target site.

[0164] In some embodiments, the first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and the second cassette comprises, from 5' to 3', (i) an upstream regulatory component including a promoter element; (ii) a nucleic acid sequence encoding the transactivator; and (iii) a downstream component including a let-7c target site.

[0165] In some embodiments, the first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transcription factor response element and a transactivator response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and the second cassette comprises, from 5' to 3', (i) an upstream regulatory component including a promoter element; (ii) a nucleic acid sequence encoding a transactivator; and (iii) a downstream component including a let-7c target site.

[0166] In some embodiments, the upstream regulatory component of the first cassette includes a promoter element in addition to a transcription factor response element. In some embodiments, the promoter element replaces the transcription factor response element. In some embodiments, the promoter element includes a mammalian promoter or promoter fragment.

[0167] In some embodiments, the first cassette and the second cassette are in a convergent orientation. In some embodiments, the first cassette and the second cassette are in a dispersed orientation. In some embodiments, the first cassette and the second cassette are in a head-to-tail orientation.

[0168] The first and / or second cassette may be adjacent to one or more insulators (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 insulators). For example, in some embodiments, the first or second cassette is adjacent to an insulator. In some embodiments, both the first and second cassettes are adjacent to an insulator. In some embodiments, the first or second cassette is adjacent to an insulator on both sides.

[0169] Exemplary uninterrupted polynucleic acids are listed in Table 6. In some embodiments, an uninterrupted polynucleic acid comprises a nucleic acid sequence listed in Table 6, or a nucleic acid sequence having at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identity with the nucleic acid sequences listed in Table 6.

[0170] Table 6. Exemplary seamless polynucleic acids. [Table 6-1] [Table 6-2] [Table 6-3] [Table 6-4] [Table 6-5] [Table 6-6] [Table 6-7] [Table 6-8] [Table 6-9] [Table 6-10] [Table 6-11] [Table 6-12] [Table 6-13] Table 6-14 Table 6-15 Table 6-16 Table 6-17 Table 6-18 Table 6-19 Table 6-20 Table 6-21 Table 6-22 Table 6-23 Table 6-24 Table 6-25 Table 6-26 Table 6-27 Table 6-28 Table 6-29 Table 6-30

Table 6-31

Table 6-32

Table 6-33

Table 6-34

Table 6-35

Table 6-36

[0171] II. Other Compositions In another aspect, the disclosure relates to compositions of vectors. In some embodiments, the vector comprises the seamless polynucleotide molecule described above. In another aspect, the disclosure relates to compositions of engineered viral genomes. In some embodiments, the viral genome comprises the seamless polynucleotide molecule described above. In some embodiments, the viral genome is an adeno-associated virus (AAV) genome, a lentivirus genome, an adenovirus genome, a herpes simplex virus (HSV) genome, a vaccinia virus genome, a poxvirus genome, a Newcastle disease virus (NDV) genome, a coxsackievirus genome, a reovirus genome, a measles virus genome, a vesicular stomatitis virus (VSV) genome, a parvovirus genome, a Seneca Valley virus genome, a Maraba virus genome, or an influenza virus genome.

[0172] In other aspects, this disclosure relates to compositions of virions. As used herein, the term “virion” refers to an infectious form of a virus that is located outside a host cell (including, for example, a DNA / RNA genome and a capsid protein). In some embodiments, a virion comprises the above-described engineered viral genome. In some embodiments, a virion comprises the AAV-DJ capsid protein. In some embodiments, a virion comprises the AAV-B1 capsid protein, the AAV8 capsid protein, or the AAV6 capsid protein.

[0173] In other aspects, this disclosure relates to compositions comprising the above-mentioned uninterrupted polynucleic acid molecules, the above-mentioned vectors, the above-mentioned engineered viral genomes, or the above-mentioned virions. In some embodiments, the compositions are therapeutic compositions further comprising pharmaceutically acceptable excipients or buffers. Exemplary pharmaceutically acceptable excipients and buffers are known to those skilled in the art.

[0174] III. Methods for stimulating cell-specific events In other aspects, the disclosure relates to methods for stimulating cell-specific events in a population of cells. In some embodiments, the method for stimulating cell-specific events comprises contacting a population of cells with the aforementioned seamless polynucleic acid molecules, the aforementioned vectors, the aforementioned engineered viral genomes, or the aforementioned virions, where the cell-specific event is triggered via the level of output expressed in cells of the population of cells.

[0175] In some embodiments, the cell population includes at least one target cell and at least one non-target cell. The target cell and non-target cell types differ in the level of at least one endogenous transcription factor, and / or the expression intensity of at least one endogenous promoter or its fragment and / or at least one endogenous miRNA. In some embodiments, the expression levels of the output differ between the target cell and non-target cell by at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 500, at least 1,000-fold, or at least 10,000-fold.

[0176] In some embodiments, the method comprises contacting a population of cells with an uninterrupted polynucleic acid molecule or a composition comprising the uninterrupted polynucleic acid molecule, wherein: a) the population of cells comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types contain one or more endogenous miRNAs (for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 50, at least 100, at least 1000) such that the level of one or more endogenous miRNAs in each of the two or more non-target cells is at least twice as high as in each of the target cells (for example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 50, at least 100, at least 100, at least 1000) a) differing at the level of at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, and at least 20 endogenous miRNAs; and b) an unbroken polynucleic acid molecule comprising: (i) a first cassette encoding an RNA whose expression is operably linked to a transactivator response element, wherein the first RNA comprises an output nucleic acid sequence; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and (ii) a second cassette encoding a second RNA, wherein the second RNA comprises a transactivator nucleic acid sequence, wherein the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette.

[0177] In some embodiments, the method comprises contacting a population of cells with an uninterrupted polynucleic acid molecule or a composition comprising the uninterrupted polynucleic acid molecule, wherein: a) the population of cells comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types are such that the level of one or more endogenous miRNAs in each of the two or more non-target cells is at least twice as high as in each of the target cells (for example, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, at least ten times, at least fifteen times, at least twenty times, at least fifty times, at least 100 times, at least 1000 times higher), by one or more endogenous miRNAs (for example, at least 1) differ in the level of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, and at least 20 endogenous miRNAs; and b) an unbroken polynucleic acid molecule whose expression comprises a cassette encoding mRNA which is operably linked to a transactivator response element, wherein the RNA comprises an output nucleic acid sequence; a transactivator nucleic acid sequence; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and where the transactivator, if expressed as a protein, binds to and transactivates the transactivator response element of the cassette.

[0178] In some embodiments, target cell types (one or more) and non-target cell types differ at the level of one or more endogenous transcription factors (e.g., at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, and at least 20 endogenous transcription factors), where the uninterrupted nucleic acid molecule further comprises one or more transcription factor response elements that respond to endogenous transcription factors.

[0179] In some embodiments, contact between host cells and the aforementioned uninterrupted polynucleic acid molecules or vectors is carried out via nonviral delivery methods. Examples, but not limited to, include transfection (e.g., DEAE-dextran-mediated transfection, CaPO4-mediated transfection, lipid-mediated uptake, PEI-mediated uptake, and laser transfection), transformation (e.g., calcium chloride, electroporation, and heat shock), gene transfer, and microparticle guns.

[0180] In some embodiments, the cell populations are brought into contact ex vivo (i.e., the cell populations are isolated from the organism and brought into contact outside the organism). In some embodiments, the cell populations are brought into contact in vivo.

[0181] As used herein, the term “endogenous” refers, in the context of cells, to factors (e.g., proteins or RNA) found in cells in their native state. In some embodiments, endogenous transcription factors can bind to and activate promoter elements (e.g., transcription factor response elements) of regulatory components of at least one cassette. In some embodiments, endogenous miRNAs complement miRNA target sites of regulatory or response components of at least one cassette.

[0182] In some embodiments, the “transactivator” and the corresponding “transactivator response element” would be selected such that the transactivator specifically binds to the “transactivator response element,” but refrains from binding to the response element naturally present in the cell as much as possible. In some embodiments, the DNA-binding domain of the transactivator protein would not efficiently bind to native regulatory sequences present in the cell, and therefore would not cause excessive side effects.

[0183] In some embodiments, target cells and non-target cells are different cell types. In some embodiments, the target cells are cancerous cells, and the non-target cells are non-cancerous cells. In some embodiments, the target cells may be cancerous hepatocellular carcinoma cells or cholangiocarcinoma cells, and the non-target cells may be parenchymal and non-parenchymal liver cells, including hepatocytes, phagocytic Kupffer cells, astrocytes, and sinusoidal endothelial cells.

[0184] In some embodiments, the target cells are hepatocytes and the non-target cells are non-hepatocytes (e.g., muscle cells). In other embodiments, the target and non-target cells are of the same cell type (e.g., both are hepatocytes), but nevertheless differ at the level of at least one endogenous transcription factor and / or at least one endogenous miRNA. For example, the target cells may be senescent muscle cells and the non-target cells may be non-senescent muscle cells.

[0185] In some embodiments, the target cells are tumor cells, and the cell-specific event is cell death. In some embodiments, the target cells are senescent cells, and the cell-specific event is cell death. In some embodiments, cell death is mediated by immune targeting through the expression of an activating receptor ligand, a specific antigen, a stimulating cytokine, or any combination thereof. In some embodiments, the method further comprises contacting a population of cells with a prodrug or a non-toxic precursor compound that is metabolized by the output to become a therapeutic or toxic compound.

[0186] In some embodiments, target cells express certain factors differently compared to wild-type cells of the same type (e.g., healthy and / or non-disease cells), and cell-specific events regulate the expression levels of these factors. In some embodiments, output expression ensures the survival of the target cell population, while non-target cells are eliminated due to the absence of output expression in the presence of a cell death inducer. In other embodiments, the output ensures the survival of the non-target cell population, while target cells are eliminated due to output expression in the presence of a cell death inducer.

[0187] In some embodiments, the target cells contain the specific phenotype of interest, such that the output expression is limited to cells of this particular phenotype. In some embodiments, the target cells are a selected cell type, and the cell-specific event encodes a novel function through the expression of a gene that is naturally absent or inactive in the selected cell type.

[0188] In some embodiments, a population of cells includes multicellular organisms. In some embodiments, a multicellular organism is an animal. In some embodiments, an animal is a human being.

[0189] IV. Methods for diagnosing and / or treating a disease or condition In some aspects, the present disclosure relates to a method of diagnosing a disease or condition (e.g., cancer) in a subject exhibiting one or more signs or symptoms of the disease or condition. As used herein, the term "diagnosing" refers to the process of identifying or determining the nature and / or cause of a disease or condition. In some embodiments, the method comprises administering the seamless polynucleotide molecule, the vector, the engineered viral genome, or the virion described above to a subject exhibiting one or more signs or symptoms associated with the disease or condition, wherein the level of the output indicates the presence or absence of the disease or condition.

[0190] In some aspects, the present disclosure relates to a method of treating a disease or condition (e.g., cancer). As used herein, the term "treating" refers to the act of preventing the worsening of one or more symptoms associated with the disease or condition, and / or the act of alleviating one or more symptoms associated with the disease or condition. In some embodiments, the method comprises administering the seamless polynucleotide molecule, the vector, the engineered viral genome, or the virion described above to a subject having the disease or condition.

[0191] In some embodiments related to treating a disease or condition, the method of administration comprises intravenous delivery of the vector described above. In some embodiments, the method of administration comprises more than one act of intravenous delivery of the vector described above. In some embodiments, the method of administration comprises intratumoral delivery of the vector described above in one or more administrations. In some embodiments, the method of administration comprises transarterial delivery of the vector described above in one or more administrations. In some embodiments, the method of administration comprises intramuscular delivery, intranasal delivery, subretinal delivery, or oral delivery.

[0192] In some embodiments, the method of treating a disease further comprises administering a prodrug in one or more administrations. In some embodiments, the delivery of the prodrug is intravenous, transarterial, or intraperitoneal. In some embodiments, the prodrug is ganciclovir.

[0193] In some embodiments, a method for treating a disease further includes the administration of another treatment, such as a small molecule, a biologic, a monoclonal antibody, another gene therapy product, or a cell-based therapeutic product.

[0194] In some embodiments, the disease or condition is cancer. Exemplary cancers that can be treated by the methods described herein include, but are not limited to, hepatocellular carcinoma (HCC), metastatic colorectal cancer (mCRC), any other cancer that has metastasized to the liver, lung cancer, breast cancer, retinoblastoma, and glioblastoma.

[0195] Examples of cancers that can be treated by the methods described herein include, but are not limited to, hepatocellular carcinoma (HCC), metastatic colorectal cancer (mCRC), lung cancer, breast cancer, retinoblastoma, and glioblastoma. In some embodiments, the cancer is hepatocellular carcinoma (HCC). Indeed, treatment options for HCC are limited (Llovet and Lencioni, 2020), which has created an urgent need to explore novel modalities for a breakthrough. The methods described herein represent a significant advance in current methods of treating HCC.

[0196] example Example 1. Multiple diagnostic circuits are converted into gene therapy vectors. To evaluate whether logic gates assembled from multiple unlinked components (i.e., one gene per plasmid, and characterized in transient transfection of cell lines) can be remanufactured to fit into therapeutic-related vectors, we designed experiments and studied them as therapeutic candidates in animal disease models. Previously, it was shown that the incorporation of transcription factors (TFs) SOX9 / 10 and HNF1A / B by a multiplasmid system performing an AND logic between the sensor activities of these sensors elicited a potent response when transiently transfected into HuH-7 cells (Angelici et al., 2016). SOX9 is a prognostic marker associated with progressive HCC (Richtig et al., 2017). Interestingly, the SOX9 response element is likely to be bound by SOX4, another TF whose overexpression is associated with the malignant HCC phenotype (Liao et al., 2008; Uhlen et al., 2017). HNF1A and HNF1B are known liver housekeeping factors (Harries et al., 2009); however, they are also expressed in other organs of the GI duct.

[0197] We designed an experiment to measure whether previously described multiplasmid systems could be adapted to a seamless DNA cassette and ultimately packaged in a viral vector. For this purpose, we cloned circuit components (Angelici et al., 2016) that have been shown to execute the logic of multiplasmid setting "SOX9 / 10 AND HNF1A / B," including a SOX9 / 10-driven PIT-based activator (PIT::RelA or PIT::VP16) (Fussenegger et al., 2000), as well as a fluorescent output protein synergistically driven by PIT and HNF1A / B, into an adeno-associated virus (AAV) transfer vector during ITR, in either a dispersed or convergent orientation (Figure 1A). The resulting plasmid was transiently transfected into HEK293 cells, and the TF inputs SOX10 and HNF1A were ectopically expressed from the TRE-driven plasmid to generate all four logical input combinations for this gate. Interestingly, the trend was conserved in all four cases, but different variants differed significantly in their absolute ON levels when both inputs were present (Figure 1B). The same construct was also transfected into HuH-7 and HeLa cells, where it was predicted that endogenous expression of SOX9 / 10 and HNF1A / B would induce the circuit in the former and not activate it in the latter. In this case, the differences were less pronounced, but the dispersed orientation produced a somewhat higher output.

[0198] The AND gate strategy is a method for activating the output in the desired cell type, and the increased activation, designed by incorporating a deliberate "off" switch, is equivalent to the NOT gate, which would include an additional safety layer in therapeutic context. For this purpose, microRNA targets were incorporated into the 3'-UTR of the output gene, as well as into the 3'-UTR of the PIT-driven component. The selection of specific inputs, including miR-424, miR-126, and miR-122, was based on previously performed profiling (Dastor et al., 2018). The miR-424 target was introduced first, and the four resulting constructs (Figure 1D) were tested again for their response to ectopic TF combinations in HEK cells (Figure 1E), as well as in the presence of endogenous inputs in HuH-7 and HeLa cells (Figure 1F). Significant and consistent differences in performance were observed. The convergent construct failed to respond to ectopic input in HEK cells and responded in HuH-7 cells with significantly reduced intensity compared to the dispersed construct. This highlights the complexity of the transition from circuits supported on disparate plasmids to circuits integrated onto a seamless scaffold compatible with gene therapy delivery vectors. Next, the two dispersed cassettes were given broader logical characterizations, including inputs of both TF and miR-424 mimetic. Both constructs responded as predicted, executing the logic "SOX10 AND HNF1A AND NOT (miR-424)" (Figure 1G). To confirm that high miR-424 expression also neutralizes output activation by endogenous TF input, we transfected HuH-7 cells with miR-424 mimetic and found that this eliminated output expression to almost background levels (Figure 1H). Next, the miR-424 target was replaced with the miR-126 target. A new set of constructs was tested only in HuH-7 cells for its response to exogenous miR-126, and the results were similar to those for miR-424, consistent with predictions (Figure 1I).To summarize this design stage, we evaluated the ability of dispersed constructs—those without miRNA targets, those containing miR-424, and those containing miR-126 targets—to distinguish HCC cell lines HuH-7 and HepG2 from HeLa cells (Figure 1J).

[0199] The next steps involve incorporating the cassette into the viral vector and evaluating its logical performance prior to bridging to preclinical applications. The genome delivered by AAV is known to form a chain structure in human cells (Duan et al., 2003), which involves an additional layer of complexity compared to a DNA cassette that encodes the AAV genome but is not packaged and delivered with the assistance of the AAV capsid. For this purpose, we constructed a small amount of DJ-pseudotype (Grimm et al., 2008) AAV vector using a genome adjacent to the ITR. The vector was used to transduce two HCC cell lines, HepG2 and HuH-7, as well as two non-HCC cell lines, HeLa and HCT-116. The results showed high expression in target cells and very low expression in non-target cells (Figure 1K). Several further effects were revealed; for example, output expression obtained with vectors containing the T424 target in HuH-7 cells was reduced compared to vectors without the miRNA target, and this reduction was far more potent than that observed with naked DNA cassettes.

[0200] To obtain preliminary information on which of the two miRNA targets (T424 or T126) would function better in vivo, we designed experiments to evaluate which of them performs an important protective function (i.e., can distinguish between HCC cells and healthy hepatocytes). Primary cultured mouse hepatocytes were isolated for in vitro culture. Primary cultured hepatocytes and HCC cells were transduced with a gene reporter packaged in AAV-DJ for miR-424, miR-126, and miR-122, a known hepatic miRNA that has been shown to efficiently arrest gene expression in vivo in the liver (Dastor et al., 2018; Della Peruta et al., 2015) and is known to be downregulated in a subset of HCC tumors (Coulouarn et al., 2009) (Dastor et al., 2018). The results of this test (Figure 1L) surprisingly show that high expression counts of miR-424 and miR-126 in the liver did not translate into high biological knockdown activity in hepatocytes. Only miR-122 was consistently active. miR-122 was inactive in the HepG2 cell line, but it showed partial activity in the HuH-7 cell line. This suggests that the inclusion of miRNA targets may be beneficial for some subsets of HCC tumors, but not for all of them. Despite this fact, circuits including miR-122 were further studied due to their specificity in the pilot experimental setting and their antitumor potential. The effects of different miRNA target placements were also tested to assess how their number affects overall output suppression in the presence of miRNA inputs. Four different cassettes were tested, and it was found that increasing the number of targets and placing targets in both the output and PIT 3'-UTR increased suppression (Figures 1M-1N). This provides another knob that can be used in two ways: to increase the knockdown of output in non-target cells, and to decrease the knockdown in target cells that express partial levels of miRNA input.

[0201] Example 2. Initial evaluation of a circuit variant targeting the first HCC in a bridging context. Based on reporter studies, variants of the circuit with a miR-122 target were constructed. Due to its lower DNA payload, a PIT::VP16 activator variant was used to increase the available footprint for the output gene. The circuit with the mCherry output, referred to as HCC.V1-mCherry, was packaged in a DJ-pseudotyped AAV vector and retested for its ability to distinguish HCC cell lines from primary cultured mouse hepatocytes. The data highlight that the complete circuit produces highly specific expression in HepG2 and Hep3B cell lines compared to primary cultured hepatocytes, while the HuH-7 circuit produces reduced output due to the moderate activity of miR-122 in these cell lines (Figure 2A). Therefore, this tumor targeting program was evaluated in a pilot experiment on an orthotopic xenograft tumor model using HepG2 cells in NSG mice. To establish and track tumors, HepG2 cells were stably modified with lentiviral vectors encoding mCitrine fluorescent protein and the firefly luciferase gene, and selected for allogeneic mCitrine expression. Tumors were established by injection of 1M HepG2-LC cells into the spleen and subsequent spleen dissection.

[0202] Prior to in vivo experiments, in vitro efficacy studies were performed comparing primary cultured hepatocytes, HepG2 cells, and HeLa cells as another negative control cell line. The vector, named AAV-DJ-HCC.V1-HSV-TK, possessing the HSV-TK output gene, requires GCV as a prodrug to induce cytotoxicity due to a significant bystander effect (Freeman et al., 1993). The data (Figure 2B) showed that HepG2 cells were selectively removed by both the circuit and the constitutive control vector, while primary cultured hepatocytes and HeLa cells were removed by the constitutive vector but unaffected by the circuit-containing vector. Notably, the circuit removed HepG2 cells more effectively than the constitutive control, highlighting the importance of high output expression driven by a purpose-tailored TF logic compared to a purpose-tailored constitutive vector.

[0203] To measure antitumor efficacy in vivo, AAV-DJ-HCC.V1-HSV-TK was delivered to HepG2 tumor-bearing mice in two consecutive injections spaced 3 days apart. Four experimental groups (n=2 in this pilot study) included AAV-DJ-HCC.V1-HSV-TK in the GCV regimen (treatment group), the same vector alone without GCV, sham injection with added GCV regimen, and sham combined with PBS injection and without GCV. Live imaging of tumor progression in treated animals (Figure 2C) and autopsy analysis of total tumor load in the liver by bioluminescence (Figures 2D-2E) clearly demonstrated that the gene therapy vector with the complete circuit program in combination with the HSV-TK output and GCV regimen possessed potent antitumor activity, which was absent in any of the control groups. The low tumor burden in one animal in the PBS control group resulted from an inadequate initial tumor transplant (Figure 2F). Generally, all three control groups exhibited the same behavior, resulting in a final tumor burden proportional to the initial load, which means that tumor growth was governed by the same dynamics. The animals in the pilot treatment group were clear outliers, providing further evidence that the treatment was effective in reducing tumor burden.

[0204] Example 3. Designing a tumor targeting program with higher specificity and broader scope. Encouraged by the results of the pilot experiment, we modified the tumor targeting program and, in parallel, sought a more thorough evaluation of the circuit's mechanism of action in vitro and in vivo. We hypothesized that the combination of SOX9 / 10 and HNF1A / B inputs would be a good starting point for restricting expression to the liver and hepatic tumors, but previous data on miR-122 activity in vivo showed that its activity was limited to the liver (Dastor et al., 2018). Therefore, for all other organs, we had to rely on the TF-only component of the circuit, which could be problematic when using vector capsids with broad organ specificity. In addition, while miR-122 is a good classification marker for separating healthy hepatocytes from several HCC subtypes, it is not a universal HCC feature. Therefore, our search focused on miRNA inputs that could not only enable a broader classification capability of liver vs. hepatic tumors but also protect further organs. The starting point for this exploration was 1) a previously obtained miRNA profiling dataset (Dastor et al., 2018), and 2) a detailed literature review of microRNAs highly expressed in various organs. In earlier experiments, HuH-7 cells and healthy hepatocytes were profiled, and we initially attempted to identify miRNAs that are highly expressed in hepatocytes but downregulated in HuH-7 cells (Figure 3A). The set of miRNAs selected based on count ratios in the NGS profiling dataset included miR-122 (as reference), miR-424, miR-126-5p, miR-22, miR-26b, and let-7c. To ensure high delivery efficiency to primary cultured hepatocytes in vitro, a bidirectional miRNA reporter (Dastor et al., 2018) was constructed and packaged in an AAV-DJ vector (Figure 3B). The biological activity of candidate miRNAs was measured in isolated mouse hepatocytes from HuH-7, HepG2, and primary cultures.Of the miRNAs tested, let-7c showed the highest differential activity, and furthermore, it was downregulated in both HuH-7 and HepG2 cells (Figure 3C). Interestingly, a retrospective analysis comparing NGS counts to biological activity (Figure 3D) showed only very superficial correlations, which highlights the importance of functional testing of candidate inputs.

[0205] A literature search and profiling dataset experiments on potential organ-protective miRNAs yielded a set of miRNAs: miR-424 (kidney and other organs), miR-208a and miR-208 (heart), miR-216A, miR-217, and miR-375 (pancreas). Let-7c, a candidate for hepatoprotection found based on an in vitro screening campaign, was added to this list. For each of these miRNAs, a bidirectional reporter was designed and packaged in a B1-pseudotyped AAV vector selected due to its widespread distribution in vivo (Choudhury et al., 2016). A control vector with a miRNA target considered neutral was constructed ("TFF5") (however, as the data revealed, this target responded to miRNA input in at least some organs). The vectors were systemically injected into healthy mice, and reporter expression was evaluated in various organs three weeks after injection. Strong in vivo distributions were found in the liver, pancreas, heart, and kidneys, and the analysis focused on these organs. Let-7c was the only miRNA from the set that demonstrated potential as a healthy liver-specific input in vivo. In the pancreas, both miR-217 and miR-375 showed activity in vivo as predicted from literature data; however, let-7c had the strongest response. In the heart, miR-208a and miR-208b showed activity consistent with previous data, but again, let-7c had the strongest response. Finally, miR-424 was active in the kidney as predicted, but in this organ as well, let-7c showed the strongest effect (Figure 3EF).

[0206] In summary, the combination of in vitro and in vivo data showed that, for the purposes of this study, let-7c is strongly downregulated in both HCC cell lines used in tumor studies, suggesting it could serve as a “universal” input acting as a protective miRNA input for multiple organs immediately and simultaneously. Therefore, the next iteration of the circuit, referred to as HCC.V2, executes the program “SOX9 / 10 AND HNF1A / B AND NOT(let-7c)”.

[0207] Example 4. Mechanism of action in vitro and in vivo. We investigated the detailed mechanisms of AAV-packaged circuits by using the AAV-DJ capsid as an efficient vehicle for in vitro cell transduction and AAV-B1 as a capsid with broad in vivo distribution. Earlier in the study, we analyzed and validated the logical program by transfecting the plasmid DNA carrying the circuit into background cell lines that did not express any of the inputs, and then comparing the results with predictions by systemic ectopic expression of all possible input combinations. In the case of viral vectors, this strategy is now more effective for a longer period, because co-delivering individual ectopic inputs is virtually impossible when the circuit itself is delivered via AAV transduction. Indeed, a more interesting question is how the vector responds to endogenously expressed inputs, because therapeutic cell classification must depend on and respond appropriately to endogenous inputs. The proof of the mechanism therefore involves the question of whether the output of the complete circuit in a given cell type corresponds to the activation of the individual circuit inputs in those cells and the logical program of the circuit.

[0208] Therefore, for all circuit inputs, individual gene sensors were constructed and packaged in AAV-DJ (AAV-DJ.C.SOX-FB.mCherry and AAV-DJ.C.HNF1-FB.mCherry for SOX9 / 10 and HNF1A / B feedback amplification sensors, respectively); let-7c sensor (AAV-DJ.C.let-7c.mCherry); partial circuit that performs only AND gates (AAV-DJ.C.TF-AND.mCherry); complete circuit (AAV-DJ.HCC.V2.mCherry); and constructive reporter to serve as a reference (AAV-DJ.C.CMV.mCherry) (Figure 4A). The outputs of these constructs were measured in 10 cell lines and primary cultured hepatocytes. The results (Figures 4B-4C) show that the response of the multi-input circuit is consistent with the expression of the individual inputs, confirming that the mechanism of action is conserved between plasmid-based and viral vector-packaged systems. Strong responses from both the individual sensors for SOX9 / 10 and HNF1A / B are required to induce a high response from the TF-AND gate; the absence of a strong response from the TF-AND gate and a response from the let-7c sensor is required to achieve a high output from the complete program.

[0209] For in vivo characterization, we packaged the constitutive control AAV-B1.C.CMV.mCherry, the TF-only AND gate AAV-B1.C.TF-AND.mCherry, the let-7c reporter AAV-B1.C.let-7c.mCherry, and the complete circuit AAV-B1.HCC.V2.mCherry, respectively. B1-pseudotype vectors expressing mCherry as the output were systemically injected into the tail vein of mice, and mCherry expression was evaluated in various organs three weeks after injection. Expression was quantified in fresh organ sections by image processing. The results (Figures 5A-5B) highlight the complex synergistic effects of multiple inputs and their diverse roles in various organs. In the liver, the AND gate resulted in a decrease in the number of positive cells compared to the constitutive control, but expression was increased in cells that showed positive expression. The let-7c reporter showed decreased expression compared to the control, but the remaining expression was significantly higher than the background. The complete circuit produced expression virtually indistinguishable from the background. In the pancreas, expression controlled by the AND gate and expression controlled by let-7c resulted in a greater reduction in output expression, but in each case, the expression was higher than the background. As in the liver, the complete targeting program did not produce any detectable expression higher than the background. In the heart, either the AND gate or let-7c, both individually and in combination in the complete circuit, showed background-level expression. In the kidney, the situation was similar to the pancreas in that neither regulation of the AND gate nor let-7c reduced expression to the background, while the complete program did reduce expression to the background.In summary, the dataset strongly supports the hypothesis that multi-input logic circuits are necessary to achieve highly efficient de-targeting from healthy organs in vivo; the synergistic effect of multiple inputs, as summarized by the logic program "SOX9 / 10 AND HNF1A / B and NOT (let-7c)", is evident in three of the four cases. Next, we designed an experiment to determine whether the same program could efficiently target tumors in vivo, injecting tumor-bearing NSG mice with a B1-type AAV-B1.HCC.V2.mCherry circuit with an mCherry output. The data (Figure 5C) shows that tumors were indeed specifically and efficiently targeted in vivo, while other organs did not express the output, which is consistent with the data in Figures 5A-5B.

[0210] Example 5. Antitumor efficacy in vitro and in vivo. Because the circuit program demonstrated excellent tumor-specific expression and detargeting from major organs in vivo, its antitumor activity was evaluated in detail using the HSV-TK enzyme in combination with the prodrug ganciclovir as a benchmark antitumor actuator. The circuit was named HCC.V2-HSV-TK. The trials followed a similar line to the pilot experiment (Figure 2), but with a larger animal population and an expanded number of experimental groups. DJ-pseudotype vectors containing constitutive controls and the complete circuit were prepared, and their dose-response to ganciclovir was evaluated in HuH-7, HepG2, and HeLa cell lines, and in primary cultured hepatocytes cultured in vitro. As predicted, Huh-7 and HepG2 cells were equally targeted by the constitutive vector and the AAV-DJ.HCC.V2-HSV-TK circuit, while HeLa-negative control cells and primary cultured hepatocytes were both sensitive to the constitutive vector but not removed by the fully equipped circuit (Figure 6A). In addition, AAV-DJ.HCC.V2-HSV-TK was more potent in HuH-7 cells than AAV-DJ.HCC.V1-HSV-TK, due to its use in a let-7c sensor that is not downregulated in these cells. However, AAV-DJ.HCC.V1-HSV-TK was still active in HuH-7 cells, due to incomplete shutdown by miR-122 (Figure 6B).

[0211] Next, a circuit-encompassing DJ-pseudotyped AAV vector was systemically delivered to HepG2-LC tumor-bearing mice (Figure 7A). The non-ganciclovir group included: sham injection (saline); vector AAV-DJ.C.TF-AND-HSV-TK encoding the TF-AND program; and vector AAV-DJ.HCC.V2-HSV-TK encoding the complete circuit. The ganciclovir group mimicked the above group in terms of tail vein delivery of the vector or sham, followed by a ganciclovir injection regimen; i.e., included: sham injection + GCV; AND-gate circuit + GCV; and complete circuit + GCV. The animals (n=4 per group) were followed up using in vivo bioluminescence for their tumor burden and score sheet criteria for their health. The data (Figures 7B-7F) show that mice treated with a vector containing the complete HCC.V2-HSV-TK program, with an HSV-TK output and an added GCV regimen, showed potent and regenerative containment and subsequent regression of their tumor burden, while the control group without GCV, or the group injected with GCV alone, showed an exponential increase in tumor burden over time. The vector AAV-DJ-C.TF-AND-HSV-TK, encoding an AND gate along with the HSV-TK output, showed a similar antitumor effect to AAV-DJ.HCC.V2-HSV-TK, but also caused potent adverse effects, and therefore the animals in this group had to be euthanized prior to the planned completion. The group treated with the complete AAV-DJ.HCC.V2-HSV-TK circuit showed an expansion of tumor burden reduction without apparent adverse effects. These results undoubtedly demonstrate a tight relationship between the specificity of targeting in vivo (Figures 5A-5D) and the magnitude of adverse effects in vivo. Therefore, in the future, the presence of output expression outside the tumor, such as measured from fluorescent output expression, will constitute a pre-screening stage where their toxicity does not need to be evaluated alongside functional output.

[0212] Example 6. In vivo comparison of HCC targeting driven by AAV-B1 and AAV-DJ pseudotype circuits. Given the broad tropism and potent transduction observed in vivo for type B1 AAV capsids, and the large-scale multi-organ detargeting achieved by controlling gene expression under the HCC.V2 program, we hypothesized that the resulting type B1 AAV-B1.HCC.V2 circuit could produce high tumor transduction without compromising selectivity. To investigate this possibility, we compared the complete circuit output of AAV-B1.HCC.V2-mCherry with the circuit output (mCherry) when delivered using a B1 capsid instead of the DJ capsid used in previous efficacy studies. The data (Figure 8A) show that, when administered at the same dose, the B1-type circuit significantly outperforms the tumor expression levels of all DJ variants (AAV-DJ.HCC.V2.mCherry, TF-only AND gate AAV-DJ.C.TF-AND.mCherry, or AAV-DJ.C.CMV.mCherry), while maintaining its selectivity for adjacent liver tissue. Intratumoral output expression was approximately 40-fold higher (Figure 8B), resulting in potent fluorescence even in the core sections of large cancer lesions. This potent selective expression, combined with tumor penetration, suggests that targeting of the circuit coupled with the B1-type capsid is a promising candidate for HCC gene therapy.

[0213] Example 7. Combination of miR-let-7c and miR-122. In vitro efficacy data show that HCC.V1 completely protects hepatocytes even at high doses (Figure 2B), while the same program shows only a partial decrease in the killing efficiency of HUH-7 cells compared to HCC.V2 (Figure 5B), demonstrating nearly comparable performance at high viral doses. This difference is consistent with the more severe gene suppression observed in hepatocytes compared to HUH-7 cells (Figure 2A).

[0214] As established herein, alterations to the number and arrangement of miR-122 targets can be used to modulate the suppression intensity, resulting in different expression levels in cell lines with different miR-122 levels (Figure 1M). We hypothesized that a reduction in miR-122 suppression efficiency through alterations to the number and arrangement of targets, or through the use of imperfectly complementary targets, could be used to increase the efficacy of the circuit in HUH-7 (even at lower viral doses), where there is a risk of partial reduction in hepatic detargeting.

[0215] These data suggest that the HCC.V3 circuit (Figure 9A), which combines the miR-Let7c target from HCC.V2 with weaker miR-122 suppression, will outperform both the HCC.V3 and HCC.V2 circuits. The suppression intensity induced by miR-122 can be adjusted by altering the number and arrangement of T-122 targets, either by introducing an imperfectly complementary target or by a combination of the two approaches. Imperfectly complementary targets can be obtained by introducing random mutations in sequences adjacent to the miRNA seed sequence, or by using miR-122 targets driven from the conserved 3'UTR of miRNA-regulated genes (Figure 9B). Candidates can be selected that maximize the desired combination of hepatoprotection and efficacy against HCC cells (particularly HUH-7).

[0216] HCC.V3 is predicted to exhibit generalized miRNA detargeting from major organs (Let-7c), as well as the benefit of combined protection in the liver (Let7c and miR-122) without significant reduction in efficacy for either HepG2 or HUH-7. Achieving the most stringent possible liver detargeting is particularly desirable, given that the liver is the organ with the highest intracellular distribution for most viral vectors, and could lead to a further expansion of the therapeutic window.

[0217] Example 8. Discussion. This disclosure outlines a pathway for bridging the logical gene circuit approach to clinical applications. Three foundational pillars are necessary to support such bridging: (1) knowledge of the molecules constituting the disease; (2) the availability of a platform that can leverage this knowledge; and (3) the ability to translate this platform into clinically relevant therapeutic modalities. These pillars, combined, deliver viable therapeutic candidates with promising in vitro and in vivo efficacy and safety profiles. The detailed mechanism characterization described herein is constructed in a rational, bottom-up manner following a systematic procedure, highlighting the unique characteristics of the multi-input cell classification index compared to its individual components. Importantly, targeting specificity, such as that measured by reporter output, is shown herein to correlate tightly with both in vivo efficacy and adverse effects.

[0218] Other modalities of gene therapy, including specific expression and control of treatment such as timing and dosage, represent the next frontiers of gene therapy, not only for cancer but also for other indications. Significant effort has been invested in the development of novel capsids with preferred tissue targeting, as well as promoter elements for specific tissue expression. It is noteworthy that all lines of research rely on large-scale screening of large libraries, which do not guarantee success; furthermore, claims of specificity can only be made in the presence of a large panel of counter samples. For human therapy, these samples must be of human origin. Adding to the large library size for screening capsids and / or promoters, this effort will be constrainedly complex due to the great diversity of human tissues. The bottom-up approach described herein employs a rational design for creating combinatorial specificity from multiple individual inputs. Narrowing the candidate input space through profiling places the manipulation of complex programs capable of addressing heterogeneous cell populations (such as those for Huh-7 and HepG2 cells in our example) on a background of rational, prospective design. This approach does not exclude the use of targeted capsids or specific promoters: they can be applied as needed. However, for disseminated diseases such as cancer, broadly tropic capsids may be preferred; the loading of specific expression then shifts to classified programs encoded in the gene payload of the treatment in question. In other cases, capsid specificity and classified indicator programs can be used synergistically to achieve the best desired effect.

[0219] Efficient penetration of large multifocal tumors in the liver was achieved in vivo after a single systemic injection (Figures 5C-5D and 8A-8C), providing strong evidence that even a single injection can deliver the payload to disseminated and angiogenic tumors such as HCC. The output, with its bystander effect, can then effectively treat these tumors.

[0220] Example 9. Materials and methods for Examples 1-8. Cell line: HuH-7 cells were purchased from the Health Science Research Resources Bank of the Japan Health Sciences Foundation (Cat-# JCRB0403) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333), low glucose, and GlutaMAX (Life Technologies, Cat#21885-025). Hep G2 cells were purchased from ATCC (Cat# HB-8065) ​​and cultured at 37°C and 5% CO2 in RPMI (Gibco A10491-01) supplemented with 10% FBS (Sigma-Aldrich, Cat# F9665 or Life Technologies, Cat# 10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333). HeLa cells were purchased from ATCC (Cat# CCL-2) and cultured at 37°C and 5% CO2 in DMEM, high glucose (Life Technologies, Cat# 41966) supplemented with 10% FBS (Sigma-Aldrich, Cat# F9665 or Life Technologies, Cat# 10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333). Hep3B cells were purchased from ATCC (Cat# HB-8064) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat# F9665 or Life Technologies, Cat# 10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333), low glucose, and GlutaMAX (Life Technologies, Cat# 21885-025).HCT-116 cells were purchased from Deutsche Sammlung Von Microorganismen and Zellkulturen (DMZ) (DMZ number ACC-581) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333) in GlutaMAX (Life Technologies, Cat#31966-021). SW-620 cells were purchased from ATCC (Cat#CCL-227) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333) in GlutaMAX (Life Technologies, Cat#31966-021). LoVo cells were purchased from ATCC (Cat#CCL-229) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333) in GlutaMAX (Life Technologies, Cat#31966-021). A549 cells were purchased from ATCC (Cat#CCL-185) and cultured at 37°C and 5% CO2 in DMEM supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333) in GlutaMAX (Life Technologies, Cat#31966-021).SH4 cells were purchased from ATCC (Cat#CCL-185) and cultured at 37°C and 5% CO2 in DMEM, GlutaMAX (Life Technologies, Cat#31966-021) supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333). IGROV1 cells were part of the NCI-60 panel and obtained from the NCI (NIH). Cells were cultured at 37°C in 5% CO2 in RPMI (Gibco A10491-01) supplemented with 10% FBS (Sigma-Aldrich, Cat#F9665 or Life Technologies, Cat#10270106) and 1% penicillin / streptomycin solution (Sigma-Aldrich, P4333).

[0221] Creation of a stable luciferase and mCitrine cell line (HepG2 LC): A HepG2 cell line stably expressing mCitrine and luciferase (HepG2 LC) was created via TALEN editing of the AAVS gene locus. 4x10 5 HepG2 cells were seeded in 6-well plates and transfected with a total of 2 μg of DNA using Lipofectamine® 2000 after 24 hours. The transfection mix consisted of: 500 ng of hAAVS1 1L TALEN (pIK11), 500 ng of hAAVS1 1R TALEN (pIK12), and 1 μg of luciferase 2A citrine (Citrine) under the control of the EF1A promoter (pIK014). Transformed cells were cultured for 3 weeks to grow and dilute the expression resulting from transient transfection. After 3 weeks, mCitrine +The bulk population (<1%) was selected using BD FACS Aria III. The resulting 20,000 cells were seeded in 24-well plates in RPMI supplemented with 20% FBS for the first week to promote initial recovery. The cells were cultured and grown for two weeks to select cells with stable transgene expression and to avoid clones that were prone to silencing. Single mCitrine + Clones were selected in 96-well plates and cultured and grown in RPMI supplemented with 20% FBS. Three different high-expression clones were selected, and the best one was used for sequential experiments. The bioluminescence of the clones was measured for 5 minutes using PhotonIMAGER RT (Biospace Laboratories) to confirm luciferase expression.

[0222] Viral vector plasmid and virus generation: As previously described, single-stranded (ss) AAV vectors were generated and purified (Paterna, 2004; Conway, 1999). Briefly, human embryonic kidney cells (HEK293) expressing simian virus large T antigen (293T) were cotransfected in a 1:1:1 molar ratio with polyethyleneimine (PEI)-mediated AAV vector plasmid (providing the AAV vector genome to be packaged), AAV helper plasmid (providing the rep protein for AAV serotype 2 and the cap protein for the target AAV serotype), and adenovirus (AV) helper plasmid pBS-E2A-VA-E4 (Glatzel, 2000). HEK293T cells were harvested 96–120 hours after transfection and separated from their supernatant by slow centrifugation (1500 g / 4°C for 15 minutes). The AAV vector released into the supernatant was precipitated with PEG by adding PEG8000 solution (final: 8% v / v) and NaCl (final: 0.5M) overnight at 4°C. PEG precipitation was completed by slow centrifugation (3488g / 4°C for 60 minutes). The clarified supernatant was discarded, and the pelleted AAV vector was resuspended in AAV resuspension buffer (150mM NaCl, 50mM Tris-HCl, pH 8.5). HEK293T cells were resuspended in AAV resuspension buffer and lysed using a Bertin Minilys homogenizer combined with a 7mL soft tissue homogenizing CK14 tube (two 1-minute cycles at 5000rpm / RT, with a >4 minute cooling interval at -20°C). Crude cell lysates were treated with BitNuclease endonuclease (75 U / mL, 30-90 minutes at 37°C) and clarified by centrifugation (17000 g / 4°C for 10 minutes). The PEG-pelletized AAV vector was combined with the clarified lysates and subjected to ultracentrifugation under a discontinuous density iodixanol (OptiPrep, Axis-Shield) gradient (isodensity) (365929 g / 15°C for 2 hours and 15 minutes).Subsequently, iodixanol was removed from the fraction containing the AAV vector by three rounds of diafiltration (ultrafiltration) using a Vivaspin 20 ultrafiltration device (100000 MWCO, PES membrane, Sartorius) and 1× phosphate-buffered saline (PBS) supplemented with 1 mM MgCl2 and 2.5 mM KCl, according to the manufacturer's instructions. The AAV vector was stored in aliquots at -80°C. The capsid-formed viral vector genome (vg) was quantified using a Qubit 3.0 fluorometer in combination with the Qubit dsDNA HS assay kit (both Life Technologies). Briefly, two 5 μL undiluted (or 1:10 diluted) AAV vectors were prepared. One sample was heat-denatured (95°C for 5 minutes), and both the untreated and heat-denatured samples were quantified according to the manufacturer's instructions. The intraviral (capsid-formed) vg / mL was calculated by subtracting the non-viral (untreated sample; no capsid formation) from the total of intraviral and non-viral (capsid-formed and non-capsid-formed; heat-denatured sample).

[0223] Cell preparation for in vivo injection: HepG2 LC cells were cultured and passaged in T-75 or T-150 flasks to 70-80% confluence. For in vivo injection, the inventors used cells with a low passage number (12 passages or less) to minimize reporter gene silencing. After removing the growth medium, the cells were washed with PBS (10 ml for T-75 or 20 ml for T-150), and the cells were desorbed by dissociating them with trypsin (Gibco, 25200056) (2 ml for T-75 or 6 ml for T-150 flasks) at 37°C for 5 minutes. The cell suspension was diluted with 8 ml (T-75) or 24 ml (T-150) of PBS, gently resuspended by pipetting, and then filtered through a 100 μm filter in a 50 ml Falcon tube to obtain a single-cell suspension. For 10 ml (T-75) or T-150, the filter was washed with an additional 20 ml of PBS to further dilute the cells to a total volume of 20 ml (T-75) or 50 ml (T-150). The cell suspension was centrifuged at 498 rpm at 4°C for 9 minutes. The cell pellet was washed with 20 ml of PBS and centrifuged twice more at 498 rpm at 4°C for 6 minutes to remove any traces of trypsin. The procedure was performed in one or more flasks and tubes, depending on the number of cells required for the experiment. Each pellet was resuspended in a small amount of PBS (250-300 ul per pellet) and small aliquots were diluted (1:50 and 1:100) for manual counting of live cells using a Neubauer chamber and trypan blue. At least four independent counts were performed per cell suspension, and the average value was used to determine the number of cells to be injected. The cell suspension was visually inspected under a microscope to confirm the absence of large aggregates. Finally, the volume was measured in PBS to approximately 2 × 10⁻⁶. 7The cells were adjusted to the desired cell / mL concentration. The cell suspension was kept on ice for the duration of the surgical procedure. If high cell concentrations were observed, the cells required resuspension before each injection. To minimize handling and improve viability, the cells were divided into multiple stocks (2-3 tubes). The inventors note that the presence of cell aggregates and residual trypsin or other cell dissociation reagents are both toxic and potentially life-threatening to animals.

[0224] Xenograft mouse liver mouse model: All animal procedures were carried out in accordance with Swiss Federal Law and the guidelines of the Eidgenoessische Technische Hochschule (ETH) Zurich, and approved by the Animal Ethics Committee of the Canton of Basel-Stadt. Immunodeficient NSG mice (NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ, Charles River, Sulzfeld, Germany) aged 8-10 weeks were housed in a specific pathogen-free facility. NSG mice were anesthetized with inhaled isoflurane to create mouse liver tumors derived from human tumor cells. Using aseptic surgical techniques, a 1-1.5 cm left subcostal incision was made to expose the spleen. 10 5 HepG2 cells were injected into the lower lobe of the spleen using a 27-gauge needle. Immediately after needle removal, the lower pole of the spleen was ligated. The spleen was removed after allowing the majority of cells to reach the liver via a 10-minute drain before ligating the major vascular structures of the spleen. The abdominal incision was then closed by suturing. Tumor growth in mice was monitored by bioluminescence imaging 2-3 times per week (PhotonIMAGER RT, Biospace Lab).

[0225] In vivo delivery of reporter AAV and analysis of gene expression by fluorescence microscopy and flow cytometry: To visualize the expression of the circuit output in vivo, 2 × 10⁻¹⁵ units encoding the mCherry output were used. 12AAV or PBS containing the vg (viral genome) was administered as a single dose via the tail vein two weeks after tumor cell transplantation. Three weeks later, mice were euthanized and immediately perfused transcardially with 50-70 mL of HBSS containing 10 or 25 U / mL of heparin (Sigma-Aldrich) to remove autofluorescent erythrocytes. Organs and tissues (liver, lung, brain, pancreas, skeletal muscle, heart, and kidney) were collected, fresh tissue sections were prepared, and kept in PBS on ice. Immediately, mCherry expression was analyzed by fluorescence microscopy.

[0226] In vivo therapeutic AAV delivery and prodrug treatment: Two weeks after tumor cell dissemination, tumor-bearing mice were first stratified based on tumor burden, reflected by bioluminescence intensity (high vs. low), and then randomized to diverse treatment groups to ensure comparability of tumor burden between groups. 4 × 10 12 The AAV-circuit construct or PBS of vg (viral genome) was administered intravenously via two separate injections 1 week apart. Treatment with the prodrug GCV (50 mg / kg, InvivoGen) or saline was initiated 3 days after the first AAV injection and administered intraperitoneally to mice once daily for 2 weeks. Tumor growth was assessed by bioluminescence imaging 2-3 times per week. Mice were monitored using a score sheet and euthanized if the endpoint was achieved. All mice were discontinued 14 days after prodrug treatment. Liver tissue was harvested for bioluminescence imaging analysis of tumor burden ex vivo. Two weeks after tumor cell dissemination, tumor-bearing mice were first stratified based on tumor burden, as reflected by bioluminescence intensity (high vs low), and then randomized to diverse treatment groups to ensure comparability of tumor burden between groups. 4 × 10 12The AAV-circuit construct or PBS of vg (viral genome) was administered intravenously via two separate injections one week apart. Treatment with the prodrug GCV (50 mg / kg, InvivoGen) or saline was initiated 3 days after the first AAV injection and administered intraperitoneally to mice once daily for two weeks. Tumor growth was assessed by bioluminescence imaging 2-3 times per week. Mice were monitored using a score sheet and euthanized if the endpoint was achieved. All mice were discontinued 14 days after prodrug treatment. Liver tissue was harvested for bioluminescence imaging analysis of tumor burden in ex vivo.

[0227] References [Table 7-1] [Table 7-2] [Table 7-3] [Table 7-4]

[0228] Other embodiments All features disclosed herein may be combined in any combination. Each feature disclosed herein may be replaced by an alternative feature that is the same, equivalent, or serves a similar purpose. Thus, unless expressly stated otherwise, each feature disclosed is merely an example of a general series of equivalent or similar features.

[0229] From the above description, those skilled in the art will readily identify the essential features of this disclosure and can make various modifications and alterations to adapt it to diverse uses and conditions without departing from its spirit and scope. Therefore, other embodiments are also within the scope of the claims.

[0230] Equal portions While several embodiments are described and explained herein, those skilled in the art will readily recall a variety of other means and / or structures for performing the function and / or obtaining the result and / or for one or more of the advantages disclosed herein, and each of such modifications and / or alterations will be considered to fall within the scope of the embodiments of the invention described herein. More generally, those skilled in the art will readily understand that all parameters, dimensions, materials and configurations described herein are intended to be illustrative, and that actual parameters, dimensions, materials and / or configurations will depend on the specific application in which the teachings of the invention are used. Those skilled in the art will be able to recognize, or confirm by conventional experimentation alone, many equivalents to the specific embodiments of the invention described herein. It should be understood that the embodiments described herein are presented merely as examples, and that embodiments of the invention may be carried out in ways other than those specifically described and claimed, within the scope of the appended claims and their equivalents. The aspects of the present invention as disclosed herein are directed to each individual feature, system, article, material, kit, and / or method described herein. In addition, any combination of two or more such features, systems, articles, materials, kits, and / or methods is included within the scope of the present invention as disclosed herein, provided that such features, systems, articles, materials, kits, and / or methods are not inconsistent with each other.

[0231] It should be understood that all definitions defined and used herein take precedence over dictionary definitions, definitions in reference documents, and / or the ordinary meanings of the terms being defined. All references, patents, and patent applications disclosed herein are incorporated herein by reference with respect to the subject matter they refer to, and in some cases this may encompass the entire document.

[0232] The indefinite articles "a" and "an," as used herein and in the claims, should be understood to mean "at least one" unless it is clearly indicated otherwise. When the phrase “and / or” is used herein and in the claims, it should be understood to mean “either or both” of the elements thus connected, that is, elements that are sometimes connected and sometimes disjunctive. Any elements listed by “and / or” should be interpreted in the same way, that is, “one or more” of the elements thus connected. There may optionally be other elements other than those specifically identified by the “and / or” clause. Thus, as a non-restrictive example, a reference to “A and / or B” when used in combination with open-ended usage such as “comprising” may, in one embodiment, refer to A only (optionally including elements other than B); in another embodiment, refer to B only (optionally including elements other than A); in yet another embodiment, refer to both A and B (including any other elements), and so on.

[0233] Herein, as used herein and in the claims, “or” should be understood to have the same meaning as “and / or” as defined above. For example, when separating items in a list, “or” or “and / or” should be interpreted as inclusive, i.e., inclusion of (but also containing one or more of) a number of elements or a list of elements and optionally any further unlisted items. Only terms that clearly indicate the opposite, such as “one of” or “exactly one of” or, as used in the claims, “consisting of,” would refer to the inclusion of exactly one element from a number of elements or a list of elements. In general, the term “or” should be interpreted as indicating an exclusive choice (i.e., “one or the other, but not both”) only when preceded by terms of exclusivity such as “either,” “one of,” “one of” or “exactly one of.” When used in a claim, "essentially derived from" should have its usual meaning in the field of patent law.

[0234] Herein, as used herein and in the claims, the phrase “at least one” should be understood to mean, with respect to a list of one or more elements, at least one element selected from any one or more elements in the list of elements, but not necessarily including at least one of each and all of the elements specifically listed in the list of elements, nor excluding any combination of elements in the list of elements. This definition also allows for the presence of elements other than those specifically identified in the list of elements to which the phrase “at least one” refers, whether relating to or unrelated to those specifically identified elements. Therefore, in non-restrictive examples, “at least one of A and B” (or equivalently “at least one of A or B” or equivalently “at least one of A and / or B”) could mean, in one embodiment, at least one and any more than one A, where B is absent (and optionally includes elements other than B); in another embodiment, at least one and any more than one B, where A is absent (and optionally includes elements other than A); in yet another embodiment, at least one and any more than one A, and at least one and any more than one B (and optionally including other elements), and so on.

[0235] Furthermore, unless it is clearly shown to be the opposite, it should be understood that in any method claimed herein that includes one or more steps or actions, the order of the steps or actions of such method is not necessarily limited to the order in which the steps or actions of such method are described.

[0236] In the claims and in the above specification, all transitional clauses such as “comprising,” “including,” “carrying,” “having,” “containing,” “involving,” “holding,” “composed of,” and similar ones should be understood to be open-ended, meaning they include but are not limited to them. As described in Section 2111.03 of the United States Patent Office Manual of Patent Examining Procedures, only the transitional clauses “consisting of” and “consisting essentially of” should be closed or semi-closed transitional clauses, respectively. It should be understood that any aspect described in this document using an open-ended transitional clause (e.g., “comprising”) is also intended to be an alternative aspect of the features described by the open-ended transitional clause, such as “consisting of” and “composed essentially of.” For example, where this disclosure describes a “composition comprising A and B,” this disclosure also intends to describe alternative embodiments such as “a composition comprising A and B” and “a composition essentially consisting of A and B.”

Claims

1. It is a continuous polynucleotide molecule, a) A first cassette encoding a first RNA whose expression is operably linked to a transactivator response element, wherein the first RNA includes (i) the nucleic acid sequence of the output; and (ii) a target site for the miRNAs listed in Table 1 or a combination thereof; and b) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of the transactivator; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to the transactivator response element of the first cassette and transactivates it. The aforementioned seamless polynucleic acid molecule.

2. The seamless polynucleic acid molecule according to claim 1, wherein the first RNA comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

3. A seamless polynucleic acid molecule according to claim 1 or claim 2, wherein the first RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

4. A seamless polynucleic acid molecule according to any one of claims 1 to 3, wherein the first RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

5. An uninterrupted polynucleic acid molecule according to any one of claims 1 to 4, wherein the second RNA further comprises a target site for microRNAs or combinations thereof listed in Table 1.

6. A seamless polynucleic acid molecule according to any one of claims 1 to 5, wherein the second RNA further comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

7. The seamless polynucleic acid molecule according to claim 6, wherein the second RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

8. A seamless polynucleic acid molecule according to claim 6 or 7, wherein the second RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

9. A seamless polynucleic acid molecule according to any one of claims 6 to 8, wherein at least one miRNA target site of a first cassette and at least one miRNA target site of a second cassette are the same nucleic acid sequence or different sequences regulated by the same miRNA.

10. A seamless polynucleic acid molecule according to any one of claims 6 to 9, wherein the first RNA and the second RNA each contain a let-7c target site.

11. A seamless polynucleic acid molecule according to any one of claims 1 to 10, wherein the transactivator response element comprises nucleic acid sequences listed in Table 3 or combinations thereof.

12. A seamless polynucleic acid molecule according to any one of claims 1 to 10, wherein the expression of a second RNA is operably linked to a transcription factor response element.

13. The seamless polynucleic acid molecule according to claim 12, wherein the transcription factor response element comprises nucleic acid sequences listed in Table 4 or combinations thereof.

14. A seamless polynucleic acid molecule according to any one of claims 1 to 13, wherein the transactivator independently binds to and transactivates a transactivator response element.

15. A seamless polynucleic acid molecule according to any one of claims 1 to 13, wherein the expression of a first RNA is operably linked to a transcription factor response element.

16. The seamless polynucleic acid molecule according to claim 15, wherein the transcription factor response element comprises nucleic acid sequences listed in Table 4 or combinations thereof.

17. The unbroken polynucleic acid molecule according to any one of claims 12, 13, or 16, wherein the transactivator binds to and transactivates the transactivator response element only in the presence of a transcription factor bound to the transcription factor response element.

18. A seamless polynucleic acid molecule according to any one of claims 1 to 17, wherein the first cassette and / or the second cassette comprises a promoter element.

19. The seamless polynucleic acid molecule according to claim 18, wherein the promoter element comprises nucleic acid sequences listed in Table 5 or combinations thereof.

20. The seamless polynucleic acid molecule according to claim 18, wherein the promoter element comprises a mammalian promoter or promoter fragment.

21. The first cassette comprises, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding the output; and (iii) a downstream component including a let-7c target site; and The second cassette comprises, from 5' to 3', (i) an upstream regulatory component containing a transcription factor response element; (ii) a nucleic acid sequence encoding a transactivator; and (iii) a downstream component containing a let-7c target site. A seamless polynucleic acid molecule according to any one of claims 15 to 17.

22. The seamless polynucleic acid molecule according to claim 21, wherein the transcription factor response element of the first cassette and the transcription factor response element of the second cassette consist of the same nucleic acid sequence.

23. The seamless polynucleic acid molecule according to claim 21, wherein the transcription factor response element of the first cassette and the transcription factor response element of the second cassette consist of different nucleic acid sequences.

24. A seamless polynucleic acid molecule according to any one of claims 15 to 23, wherein the first cassette and / or the second cassette comprises two or more transcription factor response elements.

25. The seamless polynucleic acid molecule according to claim 24, wherein the first cassette and / or the second cassette comprises two different transcription factor response elements.

26. The seamless polynucleic acid molecule according to any one of claims 21 to 25, wherein the regulatory component upstream of the first cassette includes a promoter element.

27. The seamless polynucleic acid molecule according to claim 26, wherein the promoter element comprises a mammalian promoter or promoter fragment.

28. The seamless polynucleic acid molecule according to any one of claims 21 to 27, wherein the regulatory component upstream of the second cassette includes a promoter element.

29. The seamless polynucleic acid molecule according to claim 28, wherein the promoter element comprises a mammalian promoter or promoter fragment.

30. A seamless polynucleic acid molecule according to any one of claims 1 to 29, wherein the first cassette and the second cassette are in a convergent orientation.

31. A seamless polynucleic acid molecule according to any one of claims 1 to 29, wherein the first cassette and the second cassette are in a dispersed orientation.

32. A seamless polynucleic acid molecule according to any one of claims 1 to 29, wherein the first cassette and the second cassette are oriented head-to-tail.

33. A seamless polynucleic acid molecule according to any one of claims 1 to 32, wherein the first cassette and / or the second cassette are adjacent to the insulator.

34. A seamless polynucleic acid molecule according to any one of claims 1 to 33, wherein the transactivator of the second cassette is tTA, rtTA, PIT-RelA, PIT-VP16, ET-VP16, ET-RelA, NarLc-VP16, or NarLc-RelA.

35. The uninterrupted polynucleic acid molecule according to any one of claims 1 to 33, wherein the transactivator of the second cassette contains the nucleic acid sequence listed in Table 2.

36. A seamless polynucleic acid molecule according to any one of claims 1 to 35, wherein the output is a protein or an RNA molecule.

37. A seamless polynucleic acid molecule according to any one of claims 1 to 36, wherein the output is a therapeutic agent.

38. The seamless polynucleic acid molecule according to claim 36 or claim 37, wherein the output is a sequence encoding a fluorescent protein, a cytotoxin, an enzyme that catalyzes prodrug activity, an immunomodulatory protein and / or RNA, a DNA modifying factor, a cell surface receptor, a gene expression regulator, a kinase, an epigenetic modifier, and / or a factor required for vector replication, and / or a pathogen antigen polypeptide.

39. The seamless polynucleic acid molecule according to claim 36 or claim 37, wherein the output is a thymidine kinase enzyme from human herpes simplex virus 1 (HSV-TK).

40. The seamless polynucleic acid molecule according to claim 38, wherein the immunomodulatory protein and / or RNA is a cytokine or colony-stimulating factor.

41. The seamless polynucleic acid molecule according to claim 38, wherein the DNA-modifying factors are a gene encoding a protein intended to correct a gene defect, a DNA-modifying enzyme, and / or a component of a DNA-modifying system.

42. The seamless polynucleic acid molecule according to claim 41, wherein the enzyme that modifies the DNA is a site-directed recombinase, a homing endonuclease, or a protein component of the CRISPR / CasDNA modification system.

43. The seamless polynucleic acid molecule according to claim 38, wherein the factor that regulates gene expression is a protein capable of regulating gene expression or a component of a multi-component system capable of regulating gene expression.

44. A continuous polynucleotide molecule containing the nucleic acid sequences listed in Table 6.

45. A seamless polynucleic acid molecule comprising a cassette encoding RNA whose expression is operably linked to a transactivator response element, wherein the RNA comprises (i) an output nucleic acid sequence; (ii) a transactivator nucleic acid sequence; and (iii) a target site for miRNAs listed in Table 1 or a combination thereof, wherein the transactivator, when expressed as a protein, binds to and transactivates the transactivator response element, the seamless polynucleic acid molecule.

46. The seamless polynucleic acid molecule according to claim 45, wherein the first RNA comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

47. The seamless polynucleic acid molecule according to claim 45 or claim 46, further comprising the nucleic acid sequence of a polycistronic expression element that separates the nucleic acid sequences of the output and the transactivator.

48. An unbroken polynucleic acid molecule according to any one of claims 45 to 47, wherein the RNA comprises a 3'UTR, where the 3'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

49. An unbroken polynucleic acid molecule according to any one of claims 45 to 48, wherein the RNA comprises a 5'UTR, where the 5'UTR comprises a let-7c target site, a let-7a target site, a let-7b target site, a let-7d target site, a let-7e target site, a let-7f target site, a let-7g target site, a let-7i target site, a miR-22 target site, a miR-26b target site, a miR-122 target site, a miR-208a target site, a miR-208b target site, a miR-1 target site, a miR-217 target site, a miR-216a target site, or a combination thereof.

50. An unbroken polynucleic acid molecule according to any one of claims 45 to 49, wherein the RNA contains a let-7c target site.

51. A seamless polynucleic acid molecule according to any one of claims 45 to 50, wherein the transactivator response element comprises nucleic acid sequences listed in Table 3 or combinations thereof.

52. A seamless polynucleic acid molecule according to any one of claims 45 to 50, wherein the transactivator independently binds to and transactivates a transactivator response element.

53. A seamless polynucleic acid molecule according to any one of claims 45 to 52, wherein RNA expression is operably linked to a transactivator response element and a transcription factor response element.

54. The seamless polynucleic acid molecule according to claim 53, wherein the transcription factor response element comprises nucleic acid sequences listed in Table 4 or combinations thereof.

55. The seamless polynucleic acid molecule according to claim 53, wherein the transactivator binds to and transactivates the transactivator response element only in the presence of a transcription factor bound to the transcription factor response element.

56. The cassette comprises a promoter element, and the continuous polynucleic acid molecule is as described in any one of claims 45 to 55.

57. The seamless polynucleic acid molecule according to claim 56, wherein the promoter element comprises nucleic acid sequences listed in Table 5 or combinations thereof.

58. The seamless polynucleic acid molecule according to claim 56, wherein the promoter element comprises a mammalian promoter or promoter fragment.

59. An uninterrupted polynucleic acid molecule according to claim 53 or claim 55, comprising, from 5' to 3', (i) an upstream regulatory component including a transactivator response element and a transcription factor response element; (ii) a nucleic acid sequence encoding an output and a transactivator; and (iii) a downstream component including a let-7c target site.

60. The seamless polynucleic acid molecule according to claim 59, wherein the upstream regulatory component in (i) includes a promoter element.

61. The seamless polynucleic acid molecule according to claim 60, wherein the promoter element comprises a mammalian promoter or promoter fragment.

62. A seamless polynucleic acid molecule according to any one of claims 45 to 61, wherein the transactivator of at least one cassette is tTA, rtTA, PIT-RelA, PIT-VP16, ET-VP16, ET-RelA, NarLc-VP16, or NarLc-RelA.

63. The uninterrupted polynucleic acid molecule according to any one of claims 45 to 61, wherein the transactivator of the second cassette contains the nucleic acid sequence listed in Table 2.

64. A seamless polynucleic acid molecule according to any one of claims 45 to 62, wherein the output is a protein or RNA molecule.

65. A seamless polynucleic acid molecule according to any one of claims 45 to 64, wherein the output is a therapeutic protein or RNA molecule.

66. An uninterrupted polynucleic acid molecule according to claim 64 or claim 65, wherein the output is a sequence encoding a fluorescent protein, a cytotoxin, an enzyme that catalyzes prodrug activity, an immunomodulatory protein and / or RNA, a DNA modifying factor, a cell surface receptor, a gene expression modifier, a kinase, an epigenetic modifier, and / or a factor required for vector replication, and / or a pathogen antigen polypeptide.

67. The seamless polynucleic acid molecule according to claim 64 or claim 65, wherein the output is a thymidine kinase enzyme from human herpes simplex virus 1 (HSV-TK).

68. The seamless polynucleic acid molecule according to claim 66, wherein the immunomodulatory protein and / or RNA is a cytokine or colony-stimulating factor.

69. The seamless polynucleic acid molecule according to claim 66, wherein the DNA-modifying factors are a gene encoding a protein intended to correct a gene defect, a DNA-modifying enzyme, and / or a component of a DNA-modifying system.

70. The seamless polynucleic acid molecule according to claim 69, wherein the enzyme modifying the DNA is a site-directed recombinase, a homing endonuclease, or a CRISPR / Cas system protein component.

71. The seamless polynucleic acid molecule according to claim 66, wherein the factor that regulates gene expression is a protein capable of regulating gene expression or a component of a multi-component system capable of regulating gene expression.

72. A vector comprising an uninterrupted polynucleic acid molecule as described in any one of claims 1 to 44 or 45 to 71.

73. An engineered viral genome comprising an uninterrupted polynucleic acid molecule as described in any one of claims 1 to 44 or 45 to 71.

74. The manipulated viral genome according to claim 73, wherein the viral genome is an adeno-associated virus (AAV) genome, a lentivirus genome, an adenovirus genome, a herpes simplex virus (HSV) genome, a vaccinia virus genome, a poxvirus genome, a Newcastle disease virus (NDV) genome, a coxsackievirus genome, a reovirus genome, a measles virus genome, a varicella stomatitis virus (VSV) genome, a parvovirus genome, a Seneca Valley virus genome, a maraba virus genome, or a common cold virus genome.

75. A virion comprising the manipulated viral genome according to claim 73 or claim 74.

76. The billion according to claim 75, further comprising an AAV-DJ, AAV8, AAV6, or AAV-B1 capsid.

77. A method for stimulating a cell-specific event in a population of cells, comprising contacting the population of cells with a seamless polynucleic acid molecule according to any one of claims 1 to 44 or 45 to 71, a vector according to claim 72, an engineered viral genome according to claim 73 or 74, or a virion according to claim 75 or 76, wherein the population of cells comprises at least one target cell type and one or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level and / or activity of one or more endogenous miRNAs such that the level and / or activity of one or more endogenous miRNAs is at least twice as high in each of the two or more non-target cells compared to each of the target cells; and wherein the cell-specific event is regulated by the expression level of the output in the cells of the population of cells.

78. The method according to claim 77, wherein at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, wherein the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

79. The method according to claim 77, wherein at least a subset of target cells and at least a subset of non-target cells differ in terms of the level or activity of the promoter fragment, wherein an unbroken nucleic acid molecule further comprises the promoter fragment.

80. A method for diagnosing a disease or condition, comprising administering to a subject exhibiting one or more signs or symptoms associated with a disease or condition, the continuous polynucleic acid molecule described in any one of claims 1 to 44 or claims 45 to 71, the vector described in claim 72, the engineered viral genome described in claim 73 or claim 74, or the virion described in claim 75 or claim 76, wherein the level of output indicates the presence or absence of the disease and / or condition.

81. The method according to claim 80, wherein the disease is cancer.

82. The method according to claim 81, wherein the cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumor of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

83. A method for treating a disease or condition, comprising administering to a subject having the disease or condition an uninterrupted polynucleic acid molecule according to any one of claims 1 to 44 or claims 45 to 71, a vector according to claim 72, an engineered viral genome according to claim 73 or claim 74, or a virion according to claim 75 or claim 76.

84. The method of claim 83, further comprising administering a prodrug, wherein optionally the prodrug is ganciclovir, and optionally the unbroken polynucleic acid molecule comprises a nucleic acid sequence listed in Table 6.

85. The method according to claim 83, wherein the disease is cancer.

86. The method according to claim 85, wherein the cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumor of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

87. A composition for use in a method for stimulating a cell-specific event in a population of cells, the method comprising contacting a population of cells with a continuous polynucleic acid molecule according to any one of claims 1 to 44 or 45 to 71, a vector according to claim 72, an engineered viral genome according to claim 73 or 74, or a virion according to claim 75 or 76, wherein the population of cells comprises at least one target cell type and one or more non-target cell types, wherein the target cell type (one or more) and the non-target cell types differ in the level and / or activity of one or more endogenous miRNAs such that the level and / or activity of one or more endogenous miRNAs is at least twice as high in each of the two or more non-target cells compared to each of the target cells; and wherein the cell-specific event is regulated by the expression level of the output in the cells of the population of cells, the composition.

88. The method according to claim 87, wherein at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, wherein the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

89. The method according to claim 87, wherein at least a subset of target cells and at least a subset of non-target cells differ in terms of the level or activity of the promoter fragment, wherein the unbroken nucleic acid molecule further comprises the promoter fragment.

90. A composition for use in a method for diagnosing a disease or condition, the method comprising administering to a subject exhibiting one or more signs or symptoms associated with a disease or condition, the composition, the uninterrupted polynucleic acid molecule according to any one of claims 1 to 44 or claims 45 to 71, the vector according to claim 72, the engineered viral genome according to claim 73 or claim 74, or the virion according to claim 75 or claim 76, wherein the level of output indicates the presence or absence of the disease and / or condition.

91. The composition for use according to claim 90, wherein the disease is cancer.

92. The composition for use according to claim 91, wherein the cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumor of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

93. A composition for use in a method of treating a disease or condition, wherein the method comprises administering to a subject having a disease or condition an uninterrupted polynucleic acid molecule according to any one of claims 1 to 44 or claims 45 to 71, a vector according to claim 72, an engineered viral genome according to claim 73 or claim 74, or a virion according to claim 75 or claim 76.

94. The method of claim 93, further comprising administering a prodrug, wherein optionally the prodrug is ganciclovir, and optionally the uninterrupted polynucleic acid molecule comprises a nucleic acid sequence listed in Table 6.

95. The composition for use according to claim 93, wherein the disease is cancer.

96. The composition for use according to claim 95, wherein the cancer is hepatocellular carcinoma (HCC), metastatic colorectal cancer, metastatic tumor of the liver, breast cancer, lung cancer, retinoblastoma, and glioblastoma.

97. A method for stimulating a cell-specific event in a population of cells, the method comprising contacting the population of cells with an uninterrupted polynucleic acid molecule or a composition comprising the uninterrupted polynucleic acid molecule, wherein: a) The cell population comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level of one or more endogenous miRNAs such that the level of one or more endogenous miRNAs is at least twice as high in each of each of the target cells in at least a subset of non-target cells, e.g., at least two and optionally two or more non-target cells; and b) A continuous polynucleotide molecule is (i) a first cassette encoding RNA whose expression is operably linked to a transactivator response element, wherein the first RNA comprises an output nucleic acid sequence; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and (ii) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of the transactivator; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to and transactivates the transactivator response element of the first cassette; and Here, cell-specific events are regulated by the expression levels of the output in cells of a population of cells. The aforementioned method.

98. The method according to claim 97, wherein the continuous polynucleic acid molecule comprises the nucleic acid sequences listed in Table 6.

99. A method for stimulating a cell-specific event in a population of cells, comprising contacting the population of cells with an uninterrupted polynucleic acid molecule or a composition comprising the uninterrupted polynucleic acid molecule, wherein a) The cell population comprises at least one target cell type and two or more non-target cell types, wherein the target cell type(s) and non-target cell types differ in the level of one or more endogenous miRNAs such that the level of one or more endogenous miRNAs is at least twice as high in each of each of the non-target cells, for example, at least two and optionally two or more non-target cells, compared to each of the target cells; and b) A continuous polynucleic acid molecule comprises a cassette encoding mRNA whose expression is operably linked to a transactivator response element, wherein the RNA comprises an output nucleic acid sequence; a transactivator nucleic acid sequence; and one or more miRNA target sites corresponding to one or more endogenous miRNAs; and Here, the transactivator, when expressed as a protein, binds to and transactivates the transactivator response element of the cassette; and Here, cell-specific events are regulated by the expression levels of the output in cells of a population of cells. The aforementioned method.

100. The method according to claim 97 or 99, wherein the composition comprising an uninterrupted polynucleic acid molecule comprises a vector comprising an uninterrupted polynucleic acid, an engineered viral genome comprising an uninterrupted polynucleic acid, or a virion comprising a polynucleic acid.

101. The method according to any one of claims 97 to 100, wherein the endogenous miRNA is selected from the miRNAs listed in Table 1 or combinations of the miRNAs listed in Table 1.

102. The method according to any one of claims 97 to 101, wherein the endogenous miRNA is selected from the group consisting of let-7c, let-7a, let-7b, let-7d, let-7e, let-7f, let-7g, let-7i, miR-22, miR-26b, miR-122, miR-208a, miR-208b, miR-1, miR-217, miR-216a, or combinations thereof.

103. The method according to any one of claims 97 to 101, wherein at least a subset of target cells and at least a subset of non-target cells differ in the level or activity of endogenous transcription factors, wherein the uninterrupted nucleic acid molecule further comprises a transcription factor response element that responds to endogenous transcription factors.

104. The method according to any one of claims 97 to 101, wherein at least a subset of target cells and at least a subset of non-target cells differ in terms of the level or activity of the promoter fragment, wherein the unbroken nucleic acid molecule further comprises the promoter fragment.

105. The method according to any one of claims 97 to 103, wherein the target cell is a tumor cell, and the cell-specific event is the death of the tumor cell.

106. The method according to claim 105, wherein tumor cell death is mediated by immune targeting through the expression of an activating receptor ligand, a specific antigen, a stimulating cytokine, or any combination thereof.

107. The method according to any one of claims 97 to 103, wherein the target cell is a senescent cell and the cell-specific event is the death of a senescent cell.

108. The method according to any one of claims 97 to 107, further comprising contacting a population of cells with a prodrug or non-toxic precursor compound that is metabolized by the output to become a therapeutic or toxic compound.

109. The method according to any one of claims 97 to 103, wherein output expression ensures the survival of the target cell population, while non-target cells are eliminated due to the absence of output expression and in the presence of an unrelated and nonspecific cell death inducer.

110. Claims 97-103, wherein the target cells include the specific phenotype of the target, so that the output expression is limited to cells of this particular phenotype.

111. The method according to any one of claims 97 to 102, wherein the target cell is a selected cell type, and the cell-specific event encodes a novel function through the expression of a gene that is naturally absent or inactive in the selected cell type.

112. The method according to any one of claims 97 to 111, wherein the population of cells includes a multicellular organism.

113. The method according to claim 112, wherein the multicellular organism is an animal.

114. The method according to claim 113, wherein the animal is a human.

115. The method according to any one of claims 97 to 114, wherein a population of cells is brought into ex vivo contact.

116. The method according to any one of claims 97 to 114, wherein a population of cells is brought into contact in vivo.

117. It is a continuous polynucleotide molecule, a) a first cassette encoding a first RNA whose expression is operably linked to a transactivator response element, wherein the first RNA comprises (i) an output nucleic acid sequence; and (ii) a target site for a miRNA, wherein the miRNA is highly expressed and / or active in at least two different healthy tissues of a mammal and is expressed at low levels in one or more types of target cells; b) A second cassette encoding a second RNA, where the second RNA contains the nucleic acid sequence of ; Includes, Here, the transactivator of the second cassette, when expressed as a protein, binds to the transactivator response element of the first cassette and transactivates it. The aforementioned seamless polynucleic acid molecule.