Modified viral particles for gene therapy

Abstract

Provision of modified viral particles for gene therapy. [Solution] The present invention relates to novel surface-modified viral capsids and recombinant virions containing them. Furthermore, the present invention relates to intermediates for the preparation of surface-modified viral capsids. Surface-modified viral capsids are designed to deliver gene therapy selectively and / or more efficiently. When incorporated into recombinant virions, surface-modified viral capsids can be used to treat diseases characterized by genetic abnormalities.

Description

[Technical Field]

[0001] 1. Cross-reference of related applications This application primarily takes priority over U.S. Provisional Application No. 63 / 112,457, filed on November 11, 2020. This is a provision, and the provisional application is incorporated in its entirety by reference.

[0002] 2. Sequence Listing This application includes a sequence listing submitted via EFS-Web, which is in its entirety. The above ASCII copy created in ~ is incorporated herein by reference. The file is named sting.txt and has a size of ~ bytes.

[0003] 3. Field of Invention This invention relates to improved surface-modified viral capsids for gene delivery and gene therapy. Regarding this matter, adeno-associated virus (AAV) particles containing modified capsid proteins are provided. The present invention further relates, in certain embodiments, to the natural adeno-associated virus (AAV) capsid. The binding site was removed and the ligand was introduced into the capsid to enhance the transduction efficiency. / or by providing an AAV that selectively transduces targeted cells This invention relates to a method for producing improved surface-modified viral capsids. An additional aspect is the use of surface-modified viral capsids in the treatment of diseases, and Treating a disease involves administering a surface-modified viral capsid to a subject who requires it. The present invention relates to a method for that purpose. Further aspects of the present invention include, for example, gene delivery in basic research. The present invention's surface-modified viral caps for cell transfection as a tool Regarding Do. [Background technology]

[0004] 4. Background of the Invention Introducing molecules carrying genetic information into cells is a useful tool in modern medicine and basic research. Preferred methods include the use of gene delivery vehicles derived from viruses, including adenoviruses, retroviruses, lentiviruses, vaccinia viruses, and adeno-associated viruses. Among these, recombinant adeno-associated virus (AAV) has become a preferred virus for in vivo gene therapy due to its lack of pathogenicity, non-replicability, and stable expression. More than 100 clinical trials are underway using AAV-based vectors, and recently, two AAV gene therapy products, namely voretigene neparvovec-rzyl (LUXTURNA) for the treatment of hereditary retinal diseases and onasemnogene abeparvovec-xioi (ZOLGENSMA) for the treatment of spinal muscular atrophy, have been approved by the FDA.

[0005]

[0006] Adeno-associated virus is a member of the Dependovirus genus of the Parvoviridae family. These viruses do not have an envelope; their viral genome is contained within an icosahedral protein capsid. Interactions between the protein capsid and mammalian cell surface polysaccharides, proteins, and glycoproteins cause the internalization of virions by mammalian target cells. Differences in the amino acid sequences of the protein capsids among natural AAV isolates drive different binding patterns to mammalian cell surface proteins, and thus different cell infectivity or tropism patterns.

[0007] Kern et al. (J. Virology 77 (20):11072-11081, 2003) (Non-patent document 1) showed that adenocarcinoma to cells Infection with AAV-associated virus type 2 (AAV-2) leads to the binding of heparan sulfate proteoglycans. It is mediated by and discloses that this may compete with heparin. AAV-2 capsidol Protein mutation analysis involves a group of basic amino acids (arginine 484, 487, 585, and 588). This showed that lysine 532 contributes to the binding of heparin to HeLa cells. These amino acids are arranged in three clusters of the spike region, which consists of three parts of the AAV-2 capsid. The tissue distribution of recombinant AAV-2 with mutations in R484 and R585 in mice is similar to that of wild-type mice. Although liver infection was significantly reduced compared to recombinant AAV infection, persistent cardiac infection was observed. These findings suggest that heparin binding affects the infectivity of AAV-2, but is not necessary. It was suggested that this is not possible. Afione et al. (J. Virology 89(3):1660-1672, 2014) (Non-patent document) Reference 2) performed a similar analysis and found that the caps that contribute to AAV5 binding to mammalian cells The residue was identified.

[0007] The capsids used in current AAV gene therapy have limited efficacy. The low transduction efficiency into tissues encourages the administration of high-titer recombinant viruses, leading to off-target effects. Transduction leads to toxicity, particularly hepatotoxicity. Another limitation of the current approach is that many Current AAV capsids require the gene cargo to be delivered for effective therapy. This means it is not effective for transduction of specific cell types.

[0008] Modified capsids that alter the cell binding specificity of recombinant AAV for use in gene therapy. A wide variety of approaches are employed to perform this operation.

[0009] One approach is to investigate new natural isolation in humans, non-human primates, and other mammals. The purpose is to search for stocks. For example, WO 2018 / 160582 (Patent Document 1); WO 2015 / 121501 (Patent Document 1) See Document 2); WO2020 / 223232 (Patent Document 3). In these approaches, It is not guaranteed that a capsid with the desired directional properties will be found.

[0010] Another approach involves replacing the primary amino acid of the capsid protein via substitution without peptide insertion. This involves mutating the acid sequence. Typically, random amix is ​​created in a desired region of the capsid surface. A library is constructed in which no-acid mutations are clustered. This library is then used to construct a library. Screened in vivo, and retrieved from specific organizations, And a capsid that can be transduced into cells is identified. Related approaches include in silico By applying the method and inferring from the capsid sequences of known AAV isolates, altered tissue and cell types were identified. The objective is to predict novel functional capsids that may possess directionality. The sids were then synthesized and screened in vivo for patterns of tissue transduction. For example, US9,695,220 (Patent Document 4); US 10,738,087 (Patent Document 5), and WO See 2019 / 217911 (Patent Document 6). These experience-based approaches are highly complex. The degree of library manufacturing and evaluation based on experience are dependent on the desired directionality. Identification depends on chance.

[0011] A more direct approach involves using peptides known to bind to specific cell types. In-frame insertion of a cell-targeting peptide coding region into the capsid (CAP) gene. By inserting via this, the amino acid sequence of the capsid protein is altered. Yes, there are. For example, WO2019 / 207132 (Patent Document 7); WO 2021 / 077000 (Patent Document 8); WO 2017 / See Patent Document 100671 (Patent Document 9) and WO2020 / 068990 (Patent Document 10). However, However, this approach has limitations: insertions can lead to billions of acetone during the production of recombinant products. It must be positioned so as not to significantly interfere with the mammalian cells. Viral capsids drive productive interaction with surface targets and subsequent internalization. It must be positioned at the top.

[0012] In addition, all of these approaches to capsid manipulation are large-scale preclinical and clinical This generates a completely new protein capsid that cannot be developed as gene therapy without thorough investigation.

[0013] It does not rely on accidental discovery, does not reduce production efficiency, or induces transduction upon administration. The need for new methods to alter the tissue specificity of AAV capsids without reducing their efficiency. It has a sex.

[0014] WO 2020 / 225363 (Patent Document 11) describes ligands having known cell targeting specificity. Post-assembly modification of intact virion AAV capsids using chemical consumption. Methods for this purpose are disclosed, and surface-modified capsids prepared by these methods The need to expand and optimize such post-assembly modification approaches is disclosed. There is. [Prior art documents] [Patent Documents]

[0015] [Patent Document 1] WO2018 / 160582 [Patent Document 2] WO2015 / 121501 [Patent Document 3] WO2020 / 223232 [Patent Document 4] US9,695,220 [Patent Document 5] US10,738,087 [Patent Document 6] WO2019 / 217911 [Patent Document 7] WO2019 / 207132 [Patent Document 8] WO2021 / 077000 [Patent Document 9] WO2017 / 100671 [Patent Document 10] WO 2020 / 068990 [Patent Document 11] WO 2020 / 225363 [Non-patent literature]

[0016] [Non-Patent Document 1] Kern et al., J. Virology 77 (20):11072-11081, 2003. [Non-Patent Document 2] Afione et al., J. Virology 89(3):1660-1672, 2014. [Overview of the Initiative]

[0017] 5. Outline of the Invention In light of the above limitations, improving and / or lowering the transduction of specific cells of interest Potentially more effective when delivered at high potency, resulting in higher transduction efficiency to the relevant target tissue. And the need remains to develop new virus platforms with specific characteristics.

[0018] One aspect of the present invention is the chemical modification of a viral capsid to allow ligand attachment, and related The objective is to attach the target ligand to the capsid. In some embodiments, the ligand Before viral modification that allows for attachment, the natural binding site in the AAV capsid is removed.

[0019] In certain aspects of this disclosure, the viral capsid protein is covalently bonded via a linker. A surface-modified viral capsid containing one or more conjugated ligands is provided. The linker includes: a crosslinking portion comprising a first and second crosslinking agent reactive pair A bridging portion formed by the reaction between members; and one or more arbitrary Spacer.

[0020] In some embodiments, the first and second members of the crosslinking agent reactive pair are Cu(I) catalyst A Zide-alkyne cycloaddition (CuAAC) reaction, strain-promoted alkyne-azide cycloaddition (SPAAC) reaction In response to strain-promoted alkyne-nitrone cycloaddition (SPANC) reactions, the reverse electron-demanded Diels-A reaction is also possible. The Ruder (IEEDD) reaction, as well as Staudinger ligation and [4+1] addition. It is involved in reactions selected from cyclization reactions.

[0021] In some embodiments, the crosslinked portion includes at least one of an 8-membered ring and a triazole ring. In a particular embodiment, the bridging portion consists of an 8-membered ring condensed to form a biring portion and It contains both riazole rings.

[0022] In some embodiments, the reaction is a strain-enhanced alkyne-azide cycloaddition (SPAAC) reaction. In certain cases of these embodiments, the crosslinking agent reactive pair is cyclooctin and A Contains zide. In certain embodiments, cyclooctin is dibenzylcyclooctin (DIBO ), dibenzoazacyclooctinone (DBCO), and biarylazacyclooctinone (BA Selected from RAC), or their derivatives. In certain embodiments, cyclooctyne is , DBCO.

[0023] In some configurations, the bridged portion has the following structure: TIFF2026136377000001.tif28128 Includes, In the formula, R1 and R2 indicate the points of attachment to the linker.

[0024] In some embodiments, the reaction is an inverse electron-demanded Diels-Alder (IEEDD) reaction. In certain cases of these embodiments, the crosslinking agent reactive pair is trans-cyclooctane Contains tetrazine and tetrazine.

[0025] In some configurations, the bridged portion has the following structure: TIFF2026136377000002.tif24128 Includes, In the formula, R1 and R2 indicate the points of attachment to the linker.

[0026] In some embodiments, the linker includes one or more spacers. In this case, one or more spacers are ethylene glycol monomers, and viruses The total number of ethylene monomers in the linker between the ligand and the ligand is less than 50 monomers in total. In a particular embodiment, the ethylene monomer in the linker between the virus and the ligand The total number of monomers is less than 25. In the alternative embodiment, one or more spaces The compound contains 1 to 20 ethylene glycol monomers. In certain embodiments, one or Each of the multiple spacers contains 2 to 8 ethylene glycol monomers. In this embodiment, each of one or more spacers is made of four ethylene glycol monomers Includes. In a particular embodiment, the linker is each of four polyethylene glycol mono Includes at least two spacers, including a marker.

[0027] In some embodiments, the ligand is a cell-type specific ligand. In certain embodiments, Ligands include cytokines, growth factors, lectins, toxins, single-chain antibodies, peptides, and A selection is made from those combinations.

[0028] In some embodiments, the linker is coupled to the primary amino group of the capsid protein primary sequence. It attaches bondably. In certain embodiments, the primary amino group is the N-terminal amino group, lysine. Selected from amino acid residues and arginine amino acid residues. In a particular embodiment, first The alpha amino group is a side chain of a lysine amino acid residue.

[0029] In some embodiments, the linker is connected to the ligand via the primary amino group of the ligand. It adheres in a bonded manner.

[0030] In some embodiments, the linker is transmitted via non-native amino acid residues of the ligand's primary sequence. It covalently attaches to the ligand. In a particular embodiment, the non-natural amino acid residue is Cu( I) Catalytic azide-alkyne cycloaddition (CuAAC) reaction, strain-promoted alkyne-azide cycloaddition ( SPAAC reaction, strain-promoted alkyne-nitrone cycloaddition (SPANC) reaction, reverse electron-demanded reaction Ruhls-Alder (IEEDD) reaction, Staudinger ligation and [4+1] reaction Includes members of a crosslinking agent reactivity pair involved in a reaction selected from cyclization reactions. In this embodiment, the crosslinking agent reactive pair is azide, cyclooctin, cyclooctene or 1,2, Contains the 4,5-tetrazine moiety.

[0031] In an alternative embodiment, the linker is part of the ligand-linker fusion protein.

[0032] In some embodiments, the surface-modified viral capsid comprises one or more natural polysaccharide binding sites. This includes the position. In some embodiments, the viral capsid removes the natural polysaccharide binding site. It has not been modified. In certain embodiments, the surface-modified viral capsid is of the same serotype. It is characterized by increased infectivity compared to the unmodified viral capsid.

[0033] In some embodiments, the viral capsid removes one or more innate polysaccharide binding sites. It has been modified to do so. In certain embodiments, the removal mediates the binding of heparin sulfate. This is mediated by mutations in amino acids, which are known to cause this. In certain embodiments, surface modification Modified viral capsids are characterized by altered directivity compared to unmodified viral capsids. In certain embodiments, surface-modified viral capsids are compared to unmodified viral capsids. It features improved transduction efficiency.

[0034] In some aspects, the viral capsid is an adenovirus capsid, an adeno-associated virus Ruscapsid, retroviral capsid, lentiviral capsid, herpes simplex virus The choice is made between scapsids and baculovirus capsids.

[0035] In some aspects, the viral capsid is an adeno-associated virus (AAV) capsid. In certain embodiments, 585 and 588 of VP1, or similar positions in VP2 or VP3 At least one of the arginine residues is mutated. In a particular embodiment, VP1 has 585 The arginine residue at cell 588 has been mutated to an alanine residue.

[0036] In some embodiments, the surface-modified viral capsid is dispersed on the surface of the capsid. Further comprising PEG oligomers or PEG polymers. In some embodiments, surface-modified viruses Capsids exhibit evasion of existing neutralizing antibodies, lower immunogenicity, and immune stealth.

[0037] In certain aspects of this disclosure, Formula I: TIFF2026136377000003.tif17128 Surface-modified viral capsid proteins containing ligand-linked viral capsid proteins Sid provided, During the ceremony, JPEG2026136377000004.jpg7170 It is a viral capsid; Y and Y' are, independently, attachment points; n and n' are independently integers between 0 and 50, Sp and Sp' are, independently, arbitrary spacers; L is a ligand; x is the ratio of ligand to viral capsid, and is in the range of 50 to 250; and Q is, TIFF2026136377000005.tif24128 Selected from, where Z is a 7- or 8-membered ring or heterocyclic structure. In this case, x is in the range of 80 to 120.

[0038] In certain aspects of this disclosure, Formula I-1: TIFF2026136377000006.tif41128 Surface-modified viral capsid proteins containing ligand-linked viral capsid proteins Sid provided, During the ceremony, JPEG2026136377000007.jpg7170 It is a viral capsid; n and n' are independent integers between 0 and 30; L is a ligand; and x is an integer between 1 and 300.

[0039] In certain aspects of this disclosure, the average ratio of ligand to viral capsid is 50-250 A composition is provided which includes a surface-modified viral capsid, such as the one provided herein. It can be done.

[0040] In certain aspects of this disclosure, the disclosure includes surface-modified viral capsids such as those provided herein. A pharmaceutical composition is provided which contains a virion and further comprises a pharmaceutically acceptable carrier.

[0041] In certain aspects of this disclosure, a method for treating a patient with a genetic abnormality, as described herein. The virions contain surface-modified viral capsids, as provided, and are pharmaceutically acceptable. A method comprising the step of administering a pharmaceutical composition further comprising a carrier.

[0042] In certain aspects of this disclosure, one member of the crosslinking agent reactive pair and optionally one other This is a surface-functionalized virus capsid comprising multiple spacers, and the surface-functionalized virus The scapsid is suitable for reaction with functionalized ligands, and the ligand is the crosslinking agent reactive It includes one of the members of A, and both members of the crosslinking agent reactive pair are Cu(I) catalyst A do-alkyne cycloaddition (CuAAC) reaction, strain-promoted alkyne-azide cycloaddition (SPAAC) reaction , strain-promoted alkyne-nitrone cycloaddition (SPANC) reaction, reverse electron-demanded Diels-Al Dah (IEEDD) reaction, as well as Staudinger ligation and [4+1] ring addition. A surface-functionalized viral capsid is provided that is involved in a reaction selected from chemical reactions.

[0043] A certain aspect of this disclosure is the surface modification of a viral capsule as described herein, which includes the following steps This provides a method for creating a SID: (i) the viral capsid protein and the first member of the crosslinking agent reactive pair and The process involves reacting a capsid-reactive linker, optionally containing one or more spacers. Therefore, the process of obtaining a surface-functionalized viral capsid; (ii) the surface-functionalized virus capsid and the second member of the crosslinking agent reactive pair The process involves conjugating a functionalized ligand that optionally includes one or more spacers. To that extent, the first and second members of the crosslinking agent reactive pair react to form a crosslinked portion Q. The process of doing; and (iii) A step to obtain a surface-modified viral capsid.

[0044] The preferred features of each aspect of the present invention may be further modified for each of the other aspects as necessary. Applies to the extent permitted by law. References cited herein are to the maximum extent permitted by law. It is incorporated within the enclosure. The present invention and its advantages are described in detail, but in this specification Without departing from the spirit and scope of the invention as defined in the attached claims Furthermore, it should be understood that various changes, substitutions, and modifications are acceptable. [Invention 1001] The linker is covalently conjugated to the viral capsid protein. Including one or more Gunds, the linker is Crosslinking is formed by the reaction between the first and second members of the crosslinking agent reactive pair. Part; and Optionally, one or more spacers A surface-modified viral capsid containing this substance. [Invention 1002] The first and second members of the crosslinking agent reactive pair perform Cu(I)-catalyzed azide-alkyne cycloaddition. (CuAAC) reaction, strain-promoted alkyne-azide cycloaddition (SPAAC) reaction, strain-promoted alkyne N-nitron cycloaddition (SPANC) reaction, reverse electron-demanded Diels-Alder (IEEDD) reaction , as well as selected from Staudinger ligation and [4+1] cycloaddition reactions A surface-modified viral capsid of the present invention 1001 that is involved in the reaction. [Invention 1003] The crosslinking portion includes at least one of an 8-membered ring and a triazole ring, any of the prior inventions Akira's surface-modified virus capsid. [Invention 1004] The reaction is a strain-promoted alkyne-azide cycloaddition (SPAAC) reaction on the surface of Invention 1002. Modified virus capsid. [Invention 1005] The crosslinking agent reactive pair comprises cyclooctin and azide, according to any prior invention table. A surface-modifying virus capsid. [Invention 1006] Cyclooctin is also known as dibenzylcyclooctin (DIBO) and dibenzoazacyclooctin. (DBCO), and biarylazacyclooctinone (BARAC), or their derivatives A surface-modified viral capsid of the present invention 1005 is selected from among the following. [Invention 1007] The surface-modified viral capsid of the present invention 1006, wherein cyclooctin is DBCO. [Invention 1008] The bridged section has the following structure: TIFF2026136377000008.tif27128 Includes, In the formula, R1 and R2 indicate the points of attachment to the linker. A surface-modified viral capsid of any of the prior art inventions. [Invention 1009] The reaction is an inverse electron-demanded Diels-Alder (IEEDD) reaction on the surface of Invention 1002. Modified virus capsid. [Invention 1010] The crosslinking agent reactive pair comprises transcyclooctene and tetrazine, according to the present invention 1001~ A surface-modified viral capsid of either 1002 or 1009-1003. [Invention 1011] The bridged section has the following structure: TIFF2026136377000009.tif23128 Includes, In the formula, R1 and R2 indicate the points of attachment to the linker. A surface-modified viral capsid according to any of the present invention 1001-1002 and 1009-1010. [Invention 1012] The linker includes one or more spacers, any of the prior art surface modifications Illuscapsid. [Invention 1013] One or more spacers contain 1 to 20 monomers of polyethylene glycol. Surface-modified viral capsid of the present invention 1012. [Invention 1014] One or more spacers contain 2 to 8 monomers of polyethylene glycol. Surface-modified viral capsid of the present invention 1013. [Invention 1015] One of the one or more spacers contains four monomers of polyethylene glycol. A surface-modified viral capsid of the present invention 1014, comprising the above. [Invention 1016] Invention 1015 comprises two spacers, each containing four monomers of polyethylene glycol. Surface-modified viral capsid. [Invention 1017] Any of the prior surface-modified viruses of the present invention whose ligand is a cell-type specific ligand. Capsid. [Invention 1018] The ligand is a cytokine, growth factor, lectin, toxin, single-chain antibody, multi-chain antibody or A choice of antigen-binding antibody fragments, peptides, and combinations thereof. The present invention relates to a surface-modified viral capsid. [Invention 1019] The linker covalently attaches to the primary amino group of the capsid protein's primary sequence. A surface-modified viral capsid of any of the prior art inventions. [Invention 1020] Primary amino groups include the N-terminal amino group, the lysine epsilon amino group, and the arginine amino group. A surface-modified viral capsid of the present invention 1019, selected from the acid groups. [Invention 1021] The primary amino group is the epsilon amino group of a lysine amino acid residue, as shown in Table 1020 of the present invention. A surface-modifying virus capsid. [Invention 1022] The linker covalently attaches to the ligand via the primary amino group of the ligand. A surface-modified viral capsid of any of the prior art inventions. [Invention 1023] The linker targets the targeting ligand via non-natural amino acid residues in the primary sequence of the targeting ligand. Any of the prior surface-modified viruses of the present invention that covalently attach to the getting ligand Capsid. [Invention 1024] Non-natural amino acid residues promote the Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) reaction, strain reduction. Advanced alkyne-azide cycloaddition (SPAAC) reaction, strain-promoted alkyne-nitrone cycloaddition (S PANC reaction, reverse electron-demanded Diels-Alder (IEEDD) reaction, Staudingara The crosslinking agent is reactive in a reaction selected from ligation and [4+1] cycloaddition reactions. A surface-modified viral capsid of the present invention 1023, including member A. [Invention 1025] The crosslinking agent reactive pair is azide, cyclooctin, cyclooctene, or 1,2,4,5-tetra A surface-modified viral capsid of the present invention 1024, including a din portion. [Invention 1026] The protein sequence of the viral capsid is transferred to polysaccharides or proteoglycans in mammalian cells. The invention 1001~ is mutated to weaken or disable the binding of the capsid. One of 1025 surface-modified viral capsids. [Invention 1027] The protein sequence of the viral capsid is transferred to polysaccharides or proteoglycans in mammalian cells. It has not mutated to weaken or disable the binding of the capsid protein. A surface-modified viral capsid according to any of the invention items 1001 to 1025. [Invention 1028] Increased infection compared to unmodified viral capsids with the same capsid protein sequence. A surface-modified viral capsid of the present invention 1026 or 1027, characterized by its strength. [Invention 1029] Viral capsids include adenovirus capsids, adeno-associated virus capsids, and retroviral capsids. Viral capsids, lentiviral capsids, herpes simplex virus capsids, and A surface-modified viral capsid selected from any of the prior art culovirus capsids Sid. [Invention 1030] The surface of Invention 1029, wherein the viral capsid is an adeno-associated virus (AAV) capsid. Modified virus capsid. [Invention 1031] A decrease in arginine residues at positions 585 and 588 in VP1, or similar positions in VP2 or VP3. At least one of the 30 surface-modified viral capsids has mutated. [Invention 1032] Table 31 shows that the arginine residues at VP1 585 and 588 have been mutated to alanine residues. A surface-modifying virus capsid. [Invention 1033] The present invention 1031 or 10 is characterized by altered directivity compared to the unmodified viral capsid. 32 surface-modified viral capsids. [Invention 1034] A surface-modified viral capsid of any prior invention that exhibits evasion of existing neutralizing antibodies. [Invention 1035] Formula I: TIFF2026136377000010.tif16128 A surface-modified viral capsid that conforms to the following During the ceremony, TIFF2026136377000011.tif6128 It is a viral capsid; Y and Y' are, independently, attachment points; n and n' are independently integers between 0 and 50; Sp and Sp' are, independently, arbitrary spacers; L is a ligand; X is the ligand ratio per capsid, and is in the range of 1 to 500; and Q is, TIFF2026136377000012.tif23128 Selected from, where Z is a 7- or 8-membered ring or heterocyclic structure, Surface-modified viral capsid. [Invention 1036] A surface-modified viral capsid of the present invention 1035, wherein x is in the range of 100 to 200. [Invention 1037] A surface-modified viral capsid of the present invention 1035, wherein x is in the range of 130 to 170. [Invention 1038] Formula I-1: TIFF2026136377000013.tif43128 A surface-modified viral capsid that conforms to the following During the ceremony, JPEG2026136377000014.jpg7170 It is a viral capsid; n and n' are integers independently selected from 0 to 30; T is a ligand; and x is an integer between 1 and 500, representing a surface-modified viral capsid. [Invention 1039] A surface-modified viral capsid of the present invention 1038, wherein x is in the range of 100 to 200. [Invention 1040] The ligand ratio (x) per capsid is in the range of 130 to 170 for each of the inventions 1001 to 1038. Any surface-modified viral capsid. [Invention 1041] A surface-modified viral capsid and recombinant polynucleotide capsid of any of invention 1001-1039 A pharmaceutically acceptable carrier, diluent comprising at least one recombinant virion including -go Pharmaceutical combinations further include solubilizers, fillers, preservatives, excipients, or combinations thereof. A finished product. [Invention 1042] Intracellular delivery of recombinant polynucleotide cargoes can treat patients with treatable diseases. A method of treatment, The present invention includes the step of administering a therapeutically effective amount of the pharmaceutical composition of the present invention 1041, The recombinant polynucleotide cargo can treat the disease. The aforementioned method. [Invention 1043] Used in treating treatable diseases by intracellular delivery of recombinant polynucleotide cargoes. A composition for use, The composition contains a therapeutically effective amount of the pharmaceutical composition of the present invention 1041, The recombinant polynucleotide cargo can treat the disease. composition. [Invention 1044] For treating treatable diseases by intracellular delivery of recombinant polynucleotide cargo Use of any surface-modified viral capsid from invention 1001 to 1039 for the manufacture of pharmaceuticals. [Invention 1045] The crosslinking agent reactive pair comprises the first member and optionally one or more spacers. a surface-functionalized viral capsid, wherein the surface-functionalized viral capsid is the crosslinking agent Functionalization including the second member of a reactive pair and optionally one or more spacers. Suitable for reaction with ligands, both members of the crosslinking agent reactive pair are Cu(I) catalyst azi do-alkyne cycloaddition (CuAAC) reaction, strain-promoted alkyne-azide cycloaddition (SPAAC) reaction , strain-promoted alkyne-nitrone cycloaddition (SPANC) reaction, reverse electron-demanded Diels-Al Dah (IEEDD) reaction, as well as Staudinger ligation and [4+1] ring addition. A surface-functionalized viral capsid involved in a reaction selected from chemical reactions. [Invention 1046] A method for producing surface-modified viral capsids, including the following steps: (i) By reacting the viral capsid protein with a capsid-reactive linker A step to obtain a surface-functionalized virus capsid, wherein the linker is a crosslinking agent reactive pair A process including our first member and optionally one or more spacers; (ii) the surface-functionalized viral capsid and the second member of the crosslinking agent reactive pair and conjugate with a functionalized ligand that optionally includes one or more spacers. A process in which the first and second members of the crosslinking agent reactive pair react to form a crosslinked portion Q. The process of accomplishing something. [Invention 1047] A surface-modified viral capsid conforms to any of the inventions 1001 to 1039, as described in invention 1046. method. [Invention 1048] Recombinant virions comprising any surface-modified capsid from invention 1001 to 1039. [Invention 1049] A recombinant virion of the present invention 1048, which is rAAV. [Brief explanation of the drawing]

[0045] 6. Brief explanation of some of the figures in the drawing A deeper understanding of the features, aspects, and advantages of this disclosure is provided for illustrative purposes of the use of the principles of the present invention. Further understanding can be gained by considering the following detailed description of the embodiments and the accompanying drawings. Let's become one.

[0046] [Figure 1] Figure 1 illustrates the surface modification of a viral capsid surface-functionalized with a BG group that reacts with a SNAP-tagged fusion ligand for producing a surface-modified virus with improved directivity and / or gene cargo transduction efficiency. [Figure 2] Figure 2 shows that the HSPG virus capsid relating to this disclosure does not have residual infectious activity (dark image); a construct with the heparin binding site removed was tested in sensory neurons of a fluorescent reporter mouse model. The inset shows phase-contrast microscope images of the cells. [Figure 3] Figure 3 shows that capsids surface-modified with wheat germ agglutinin (WGA) fusion ligand completely restored viral transduction efficiency to 100% (fluorescent cells) when tested in sensory neurons of a fluorescent reporter mouse model similar to that used in Figure 2. [Figure 4] Figures 4a–4c show that the neurotrophic factors NGF (Figure 4a), NT3 (Figure 4b), and BDNF (Figure 4c) deliver the virus to different neuronal populations when conjugated on the capsid surface. The inset shows phase-contrast microscopy images of cells. The construct was tested in sensory neurons of a fluorescent reporter mouse model in the same manner as in Figure 2. [Figure 5] Figure 5 shows that a capsid surface-modified with cholera toxin B subunit transported the virus retrogradely to the nerve cell body when injected into the skin. The inset shows a microscopic image of the cells. The construct was tested in sensory neurons of a fluorescent reporter mouse model in the same manner as in Figure 2. [Figure 6]Figures 6a-6c show sensory neuron tissue in the trigeminal ganglion three weeks after IV injection of a virus containing the NGF ligand according to the present invention (Figure 6a), and staining with an antibody against TrkA (receptor for NGF, Figure 6b). At least 80% overlap can be confirmed (Figure 6c). [Figure 7] Figure 7 shows sections from Figure 6a stained with antibodies against NF200 and IB4, primarily representing other neurons (mechanoreceptors (green / gray) and non-peptidogenic nociceptors (blue / dark gray), respectively). Infected cells, shown in red (light gray), are generally distinct from the green and blue cells. [Figure 8] Figures 8a–8b demonstrate that gene delivery is more efficient with ligand-type viruses. Figure 8a shows the normal AAV9 variant PHP.S; Figure 8b shows the PHP.S variant of Figure 8a further modified with WGA. The WGA modified construct resulted in increased strong delivery. [Figure 9-1] Figures 9a-9f show the NGFR121W-SNAP::AAV2-●HSPG transduction of DRG neurons at different modification ratios. The inset figures show phase-contrast images. [Figure 9-2] Please refer to the explanation in Figure 9-1. [Figure 10] Figures 10a–10c show neurotrophin-AAV2-●HSPG transduction of DRG neurons. Figures 10a–10c demonstrate that NGFR121W, BDNF, and NT3 (each)-bound AAV2-●HSPG target morphologically distinct cell subtypes. [Figure 11-1] Figures 11a–11f show the effect of linker length on the transduction efficiency of NGFR121W-SNAP::AAV2-●HSPG across different sensory ganglia. 3E+10 viral genomes (VG) were injected into the posterior orbit. Figures 11a–11c show the results for shorter BG-GLA linkers, and Figures 11d–11f show the results for longer BG-PEG13 linkers. [Figure 11-2] Please refer to the explanation in Figure 11-1. [Figure 12]Figures 12a–12d show the effect of injection route on transduction efficiency in DRGs. Histological analysis of transduction efficiency in DRGs for different injection routes: local injection in the skin (Figure 12a) or nerve (Figure 12b); and systemic injection via IP (Figure 12c) or IV (Figure 12d). [Figure 13-1] Figures 13a–13d support the selectivity of NGFR121W-SNAP::AAV2-●HSPG for TrkA+ cells in DRG. Histological analysis of transduction selectivity in DRG after posterior orbital injection of 3E+10 VG particles: Figure 13a shows the fluorescent tdTomato signal (red) from NGFR121W-SNAP::AAV2-●HSPG; Figure 13b shows green TrkA+ cells (green) identified using an antibody against TrkA; Figure 13c is a merged image (orange). Figure 13d quantifies the number of infected cells that are TrkA-positive cells and the number of infected TrkA-positive cells. [Figure 13-2] Please refer to the explanation in Figure 13-1. [Figure 14] Figures 14a–14c show in vivo infection of wild-type mouse keratinocytes with IL31K134A-AAV2-●HSPG. Histological analysis of transduction selectivity in the skin of wild-type mice after subcutaneous injection of 3E+10 VG particles: Figure 14a shows the fluorescent tdTomato signal (red) from IL31K134ASNAP::AAV2-●HSPG. Figure 14b shows keratinocytes identified using an antibody against K14 (green). Figure 14c shows a merged image (orange). [Figure 15] Figures 15a-15c show that IL31K134A-AAV2-●HSPG does not infect keratinocytes in the absence of the IL31RA receptor. Histological analysis of transduction selectivity in the skin of IL31RA- / - mice after subcutaneous injection of 3E+10 VG particles: Figure 15a shows the absence of a fluorescence signal from IL31K134A::AAV2-●HSPG. Figure 15b shows keratinocytes identified using an antibody against K14 (green). Figure 15c shows a merged image (orange). [Figure 16]Figures 16a-16c show the CTB-HSPG-AAV transduction in vitro and in vivo. [Figure 17] Figures 17a-17b show the in vitro transduction of WGA-●HSPG-AAV. [Figure 18] Figures 18a–18c show neonatal IV injection of WGA::AAV2-●HSPG. 1E+9 VG cells of WGA::AAV2-●HSPG were injected IV into neonatal mice. Robust tdTomato fluorescence was observed in neurons in the skin (Figure 18a), DRG (Figure 18b), and spinal cord (Figure 18c). [Figure 19] Figures 19a–19c show retrograde transport of WGA::AAV2-●HSPG in the mouse brain. 6E+8 VG cells of WGA::AAV2-●HSPG were injected into the prefrontal cortex of adult mice. Robust tdTomato fluorescence was observed at the injection site (Figure 19a) and in the thalamus (Figures 19b–19c), indicating retrograde transport from the terminal to the cell body. [Figure 20-1] Figures 20a-20f show the increased transduction efficiency of PHP.S in DRG using WGA-●HSPG-AAV with different virus:ligand ratios. [Figure 20-2] Please refer to the explanation in Figure 20-1. [Figure 21] Figure 21 shows the application of IB4::AAV2-●HSPG to cultured DRG neurons. 1E+9 VG cells of IB4::AAV2-●HSPG were applied to cultured DRG neurons. Robust tdTomato fluorescence was observed in most of the small neurons. [Figure 22]Figures 22a-22d show in vivo injection of IB4::AAV2-●HSPG in adult mice. Injection of IB4::AAV2-●HSPG via subcutaneous, intraneural, and intraspinal injection routes. (Figure 22a) Vascular labeling of IB4::AAV2-●HSPG after subcutaneous injection. (Figure 22b) Whole-mount DRG from a mouse injected with IB4::AAV2-●HSPG into the sciatic nerve. (Figure 22c) Spinal cord section stained with IB4-488 from a mouse injected with IB4::AAV2-●HSPG into the left sciatic nerve. Ipsilateral signal overlap. (Figure 22d) Labeled microglia from a mouse injected with IB4::AAV2-●HSPG into the spinal cord. [Figure 23] Figure 23 shows plots of transduction efficiency when increased concentrations of wild-type AAV2 (corresponding to images in Figures 24a-24f) and IB4-AAV2 (corresponding to images in Figures 24g-24l) were applied to PC12 cells. [Figure 24-1] Figures 24a–24l show the GFP fluorescence of PC12 cells treated with wild-type AAV2 (Figures 24a–24f) and IB4-AAV2 (Figures 24g–24l) at various concentrations. [Figure 24-2] Please refer to the explanation in Figure 24-1. [Figure 24-3] Please refer to the explanation in Figure 24-1. [Figure 24-4] Please refer to the explanation in Figure 24-1. [Figure 25] Figure 25 shows plots of transduction efficiency when increased concentrations of wild-type AAV9 (corresponding to images in Figures 26a-26f) and IB4-AAV9 (corresponding to images in Figures 26g-26l) were applied to PC12 cells. [Figure 26-1] Figures 26a–26l show the GFP fluorescence of PC12 cells treated with wild-type AAV9 (Figures 26a–26f) or IB4-AAV9 (Figures 26g–26l) at various concentrations. [Figure 26-2] Please refer to the explanation in Figure 26-1. [Figure 26-3] Please refer to the explanation in Figure 26-1. [Figure 26-4] Please refer to the explanation in Figure 26-1. [Figure 27]Figures 27a-27d show representative GFP fluorescence images obtained by applying IB4 conjugated to increased molar ratio ●HSPG-AAV2 without a spacer to PC12 cells. [Figure 28] Figures 28a-28d show representative images of IB4:●HSPG-AAV2 constructs prepared with increased amounts of reactive linker and short-chain n=3PEG spacers applied to PC12 cells. [Figure 29] Figures 29a-29d show representative images of IB4:●HSPG-AAV2 constructs prepared with increased amounts of capsid-reactive linker and an intermediate chain n=8PEG spacer applied to PC12 cells. [Figure 30] Figures 30a-30d show representative images of IB4:●HSPG-AAV2 constructs prepared with increased amounts of capsid-reactive linker and long-chain PEG=16 spacers applied to PC12 cells. [Figure 31] Figure 31 shows the quantification of the average GFP fluorescence intensity in each cell at different linker lengths (n=3, mean + / - SEM) with increasing ligand molar ratio to virus. [Figure 32-1] Figures 32a–32s show GFP fluorescence images corresponding to the transduction efficiency in PC12 cells of WGA:AAV2ΔHSPG virus constructs containing linkers with different spacer lengths, i.e., (n) PEGn (ethylene glycol units) on the virus side (V) and the WGA ligand side (L), where the virus is functionalized with various molar amounts of linker. [Figure 32-2] Please refer to the explanation in Figure 32-1. [Figure 33] Figure 33 shows a chart of the mean GFP fluorescence intensity of PC12 cells transduced with WGA-modified AAV2ΔHSPG virus having different linker spacers. The plotted data correspond to the mean transduction efficiency. [Figure 34] Figure 34 shows a chart of individual cell transduction efficiencies of PC12 cells treated with surface-modified AAV2ΔHSPG virus constructs with different linker spacers, compared to the unmodified virus (red dotted line). [Figure 35] Figure 35 shows the average transduction efficiency of PC12 cells treated with AAV2ΔHSPG virus constructs surface-modified with WGA having different linker spacers, compared to the unmodified virus. [Figure 36] Figure 36 shows the quantification of expression, displaying only the less performing discrete and distributed PEG combinations. [Figure 37] Figures 37a–37d show tdTomato fluorescence images in PC12 cells treated with AAV2●HSPG-WGA constructs prepared using TCO / tetrazine ligation, where the virus was functionalized with varying molar amounts of linker. Figure 37e shows the unmodified virus; Figure 37f shows tdTomato fluorescence images in PC12 cells treated with AAV2●HSPG-WGA prepared using DBCO / azide crosslinker reactive pairs with a virus:linker ratio of 3E+9 VG:1.73 nmol. [Figure 38] Figures 38 and 39 show quantification of tdTomato fluorescence images, providing the mean transduction efficiency and individual cell transduction efficiency in PC12 cells treated with AAV2●HSPG-WGA constructs prepared with different virus-to-linker ratios using TCO / tetrazine ligation, respectively, compared to those obtained with AAV2●HSPG-WGA prepared with a virus-to-linker ratio of 3E+9 VG:1.73 nmol using DBCO / azide. [Figure 39] Please refer to the explanation in Figure 38. [Figure 40] Figures 40a–40d show tdTomato fluorescence images in PC12 cells treated with AAV2●HSPG-WGA constructs prepared with different virus-to-linker ratios using phosphine-NHS / azid drigation. Figure 40e shows the unmodified virus; Figure 40f shows tdTomato fluorescence images in PC12 cells treated with AAV2●HSPG-WGA prepared with a virus-to-linker ratio of 3E+9 VG:1.73 nmol using DBCO / azid crosslinker reactive pairs. [Figure 41]Figures 41 and 42 show tdTomato fluorescence imaging quantifications, respectively, providing the mean transduction efficiency and individual cell transduction efficiency in PC12 cells treated with AAV2●HSPG-WGA constructs prepared with different virus-to-linker ratios using phosphine-NHS / azid drigation, compared to those obtained with AAV2●HSPG-WGA prepared with 3E+9 VG:1.73 nmol virus:linker ratios using DBCO / azid crosslinker reactive pairs. [Figure 42] Please refer to the explanation in Figure 41. [Figure 43] Figure 43 illustrates the number of PEG4-DBCO molecules and WGA-PEG4-azide molecules per AAV9 at optimal transduction efficiency. [Figure 44] Figure 44 illustrates the number of ligands per AAV particle for the AAV9-PEG4-DBCO::WGA-SNAP-TMR-PEG4-azide construct and for control AAV9 incubated only with WGA-SNAP-TMR-PEG4-azide that was not pre-functionalized with the DBCO-PEG4-NHS linker. [Figure 45] Figures 45a–45e illustrate GFP or RFP fluorescence in PC12 cells treated with unmodified wild-type AAV3 (Figure 45a) and WGA-AAV3 prepared with various virus:linker ratios (Figures 45b–45e). [Figure 46] Figures 46 and 47 show fluorescence image quantifications providing the average transduction efficiency and individual cell transduction efficiency in PC12 cells treated with the prepared AAV3●HSPG-WGA construct, respectively. [Figure 47] Please refer to the explanation in Figure 46. [Figure 48] Figures 48a–48e illustrate GFP or RFP fluorescence in PC12 cells treated with unmodified wild-type AAV5 (Figure 48a) and WGA-AAV3 prepared with various virus:linker ratios (Figures 48b–48e). [Figure 49]Figures 49 and 50 show fluorescence image quantifications providing the average transduction efficiency and individual cell transduction efficiency in PC12 cells treated with the AAV6●HSPG-WGA construct prepared as shown in Figure 48, respectively. [Figure 50] Please refer to the explanation in Figure 49. [Figure 51] Figures 51a-51e illustrate GFP or RFP fluorescence in PC12 cells treated with unmodified wild-type AAV6 (Figure 51a) and WGA-AAV6 prepared with various virus:linker ratios (Figures 51b-51e). [Figure 52] Figures 52 and 53 show quantification of tdTomato fluorescence images, providing the average transduction efficiency and individual cell transduction efficiency in PC12 cells treated with the WGA-AAV6 construct prepared as shown in Figure 51, respectively. [Figure 53] Please refer to the explanation in Figure 52. [Figure 54] Figures 54a–54e illustrate GFP or RFP fluorescence in PC12 cells treated with unmodified wild-type AAV8 (Figure 54a) and WGA-AAV8 prepared with various virus:linker ratios (Figures 54b–54e). [Figure 55] Figures 55 and 56 show fluorescence image quantifications providing the average transduction efficiency and individual cell transduction efficiency in PC12 cells treated with the WGA-AAV8 construct prepared as shown in Figure 54, respectively. [Figure 56] Please refer to the explanation in Figure 55. [Figure 57] Figure 57 illustrates the transduction of HEK293 cells by AAV2 as analyzed by FACS (non-transduced cells are gray, transduced cells are black). [Figure 58] Figure 58a illustrates transduction into HEK293 cells by AAV2 as analyzed by microscopy. Figure 58b illustrates transduction into HEK293 cells by AAV2 in the case of AAVR gene deletion. [Figure 59]Figures 59a and 59b show representative images of transduction into AAVR-KOHEK293 cells using the WTAAV2 vector (Figure 59a) and (Figure 59b) WGA-AAV2. [Figure 60] Figures 60a and 60b show the mean fluorescence intensity (MFI) and the percentage of tdtomato-positive cells, respectively, and the data characterize the transduction of AAVR KO HEK293 cells by WT AAV2 vector and WGA-AAV2. [Figure 61] Figure 61 shows the synthetic amino acid sequence of nemolizumab SNAP, which contains the upstream GP64 signal sequence and the downstream Sortag, SNAP tag, and 6xHis tag. The GP64 signal sequence is italicized, nemolizumab is in bold, the Sortag is underlined, the Snap tag is gray, and 6xHIS is in gray bold (SEQID NO. 3). The asterisk indicates a stop codon. [Figure 62] Figures 62a–62c illustrate histological analysis of transduction selectivity in the skin of wild-type mice after subcutaneous injection of 3E+10 VG particles of the nemoluzimab-AAV2●HSPG construct. Figure 62a shows the fluorescent tdTomato signal (red) from nemoluzimab-SNAPAAV2●HSPG virus-infected cells. Figure 62b shows keratinocytes identified using an antibody against K14 (green). Figure 62c shows a merged image of virus-infected keratinocytes (orange). [Figure 63] Figures 63a–63b illustrate the human antibody-mediated recognition and neutralization of surface-modified AAV2 functionalized with different amounts of DBCO-PEGn linker. Figure 63a shows the binding of IgG contained in human pooled serum to AAV2 functionalized with different amounts of DBCO-PEGn linker, measured by ELISA and expressed in optical density (OD) units measured at 450 nm light. Figure 63b illustrates neutralization assays performed in HEK293T cells with various dilutions of human pooled serum and pre-incubated unmodified and modified viruses, with the percentage of transduction inhibition shown for each serum dilution. [Figure 64]Figures 64a–64c illustrate antibody recognition and neutralization when AAV2 is chemically modified using linkers with varying PEG lengths for both the virus and ligand. Figure 64a illustrates human IgG binding to AAV2 modified with different linker PEG lengths for the virus and ligand, as measured as in Figure 63a. Figures 64b–64c illustrate the neutralizing activity of human antibodies against unmodified and modified viruses pre-incubated with various dilutions of human pooled serum, as in Figure 63b (where 4 virus = DBCO PEG4; 2K virus = DBCO-PEG2000; 5K ligand = WGA-PEG5000-azide; 4 ligand = WGA-PEG4-azide). [Figure 65] Figures 65a–65n illustrate neutralization assays using unmodified and AAV2-WGA in PC12 cells. Unmodified (Figures 65a–65g) and AAV2-WGA modified with PEG4-azide (Figures 65h–n) were incubated with 2-fold serial dilutions of AAV2-immunized mouse serum before being added to PC12 cells. [Figure 66] Figures 66a–66f illustrate neutralization assays in primary DRG neurons using unmodified (Figures 66a–66c) and AAV2-WGA modified with PEG4-azide (Figures 66d–66f). Both the unmodified and AAV2-WGA were pre-incubated with diluted mouse serum containing antibodies against AAV2 before being added to DRG cultures. [Modes for carrying out the invention]

[0047] 7. Detailed Description of the Invention a. Definition When used herein, the term "rAAV" refers to the package contained within the AAV capsid. This refers to recombinant virions containing sizing recombinant nucleic acid constructs.

[0048] Recombinant nucleic acid constructs (synonymously "recombinant viral genomes") are located between AAV inverted terminal repeat sequences. It contains a polynucleotide payload (synonymously referred to as "cargo") positioned at [location]. The payload is , expressible polynucleotides or DNA constructs that provide templates for homologous recombination repair It can be. In various embodiments, expressible polynucleotides can make proteins To modify (for example, a transgene encoding a therapeutic protein), or to edit the gene miRNA, siRNA, or guide RNA for aggregation, or RNA such as CRISPR, ADAR, and ADAT for aggregation. Codes the collection mechanism.

[0049] "AAV", "Adeno-associated virus", "AAV virus", "AAV virion", "AAV virus" "AAV particles," "adeno-associated virus vectors," and "AAV vectors" The term is used synonymously with rAAV in this specification.

[0050] When used herein, mammalian cell surface proteins, polysaccharides or proteins The "binding of a capsid" or "binding of a surface-modified capsid" to the oglycan is the same as the capsid. Alternatively, recombinant virions containing surface-modified capsids, typically intended for rAAV binding.

[0051] As used herein, “treat” or “treatment” The term is used in its most widely accepted clinical sense. The word, in a non-restrictive sense, diminishes the signs or symptoms of a disease, whether detectable or undetectable. To improve the signs or symptoms of a disease; to alleviate symptoms; to reduce the extent of the disease; the state of the disease Stabilization of the condition (i.e., preventing deterioration); delay or slowing of disease progression; improvement of the disease state. or relief; remission (whether partial or total); cure; what would be expected if left untreated This includes an extension of survival compared to the survival rate.

[0052] "Effective dose" refers to the amount of AAV particles of the present invention that is effective in treating a disease.

[0053] As used herein, “prevention” or “prevention” The term "eventing)" is used in relation to the subject, typically to the prevention of disease, For example, disease prevention in individuals at risk of developing disease due to the presence of genomic mutations. This refers to...

[0054] As used herein, the term "directional" means by viral capsid This refers to preferential infection and / or transduction of certain cells or tissues. In a specific configuration, in order to modify the directivity of the AAV capsid, the capsid has the inherent properties of Certain characteristics that are not present, for example, a certain affinity for receptors on the surface of target cells. ru.

[0055] In relation to the present invention, the term "subject" is preferred when used in a particular manner. Mammals, such as mice, rats, guinea pigs, rabbits, cats, dogs, monkeys, etc. The term "patient" preferably refers to a human being. The term "patient" preferably refers to a diagnosis or prognosis. Alternatively, therapies are desired for mammals such as mice, rats, guinea pigs, rabbits, and horses. , cattle, cow, cat, dog, monkey, or preferably human, for example, hi This refers to patients with bacterial infections, viral infections, fungal infections, or parasitic infections. There is a risk of contracting diseases such as material infections. Further details on the medical indications in relation to this invention are available. Further explanations are provided elsewhere in this specification.

[0056] The term "may be substituted" means that a given chemical part (e.g., an alkyl group) may be substituted for another part. It can bond with substituents (e.g., heteroatoms) (but does not need to). This means that, for example, an alkyl group that may be substituted is a fully saturated alkyl group. It can be a chain (for example, a pure hydrocarbon). Or it can be the same even if it is substituted. Alkyl alkyl groups can have substituents other than hydrogen. For example, alkyl groups can have substituents other than hydrogen. At any point on the chain, a halogen atom, a hydroxyl group, or any of the elements described herein. It can be bonded to other substituents. Therefore, the term "may be substituted" is used. This means that a given chemical moiety may contain other functional groups, but not necessarily any further. This means that it is not necessary to have a functional group. Suitable substituents include, but are not limited to, halogens, oxo, -OH, -CN, -COOH, -CH2CN, -O-(C (C1-C6) alkyl, (C1-C6) alkyl, (C1-C6) alkoxy, (C1-C6) haloalkyl, (C1-C6) Haloalkoxy, -O-(C2-C6)alkenyl, -O-(C2-C6)alkynyl, (C2-C6)alkenyl, ( C2-C6)alkynyl, -OP(O)(OH)2, -OC(O)(C1-C6)alkyl, -C(O)(C1-C6)alkyl, -OC( O)O(C1-C6)alkyl, -NH2, -NH((C1-C6)alkyl), -N((C1-C6)alkyl)2, -NHC(O)(C1 -C6)alkyl, -C(O)NH(C1-C6)alkyl, -S(O)2(C1-C6)alkyl, -S(O)NH(C1-C6)alkyl Contains Kill and S(O)N((C1-C6)alkyl)2. Substituents may themselves be substituted. i. When used herein, "may be replaced" means "may be replaced". "T" also refers to the case where no substitution has been made, and its meaning is explained below. (Includes additional substitutions) In this specification, the portion is referred to as a “derivative” of the substituted portion. For example, alkyl Substituted nitrones are examples of derivatives of the nitrone moiety.

[0057] The term "replaced" means that the base or part of the provision is replaced by one or more suitable places This means possessing substituents, where substituents are one or more substituents on the given group or part. It may be connected at the position. For example, an aryl substituted with a cycloalkyl is A chloroalkyl group is bonded to one atom of an aryl group, either by a bond with the aryl group or by condensation with the aryl group. This can refer to a connection made by sharing two or more common atoms.

[0058] Unless otherwise specifically defined, "aryl" refers to phenyl, biphenyl, or naphthyl. A cyclic aromatic hydrocarbon group having 1 to 3 aromatic rings, including monocyclic or bicyclic groups. This means that. When it contains two aromatic rings (such as a bicyclic compound), the aromatic ring of the aryl group is , optionally, connected at a single point (e.g., biphenyl) or condensed (e.g., (Naphthyl). The aryl group is substituted with one or more substituents, for example, 1 to 5 substituents. And may be substituted at any attachment point. Exemplary substituents are -halogens, oxo, -OH , -CN, -COOH, -CH2CN, -O-(C1-C6) alkyl, (C1-C6) alkyl, (C1-C6) alkoxy, (C 1-C6) haloalkyl, (C1-C6) haloalkoxy, -O-(C2-C6) alkenyl, -O-(C2-C6) alk ynyl, (C2-C6) alkenyl, (C2-C6) alkynyl, -OP(O)(OH)2, -OC(O)(C1-C6) alkyl, -C(O)(C1-C6) alkyl, -OC(O)O(C1-C6) alkyl, -NH2, -NH((C1-C6) alkyl), -N((C1 -C6) alkyl)2, -NHC(O)(C1-C6) alkyl, -C(O)NH(C1-C6) alkyl, -S(O)2(C1-C6) a ryl, -S(O)NH(C1-C6) alkyl, and S(O)N((C1-C6) alkyl)2, including, but not limited to, them.

[0059] The substituents themselves may be substituted. Further, when containing two condensed rings, the aryl group optionally has an unsaturated or partially saturated ring condensed with a fully saturated ring. Exemplary ring systems for these aryl groups include, but are not limited to, phenyl, biphenyl, naph hthyl, anthracenyl, phenalenyl, phenanthrenyl, indanyl, indenyl, tetrahydronaphthalenyl, tetrahydrobenzoannulenyl, etc.

[0060] Halogen or "halo" means fluorine, chlorine, bromine, or iodine.

[0061] "Alkyl" means a straight-chain or branched-chain saturated hydrocarbon containing 1 to 12 carbon atoms. Examples of (C1-C6) alkyl groups are , hexyl, isopropyl, isobutyl, sec-butyl, tert-butyl, isopentyl, ne opentyl, and isohexyl, including but not limited to them.

[0062] "Alkoxy" means a straight-chain or branched-chain saturated hydrocarbon containing 1 to 12 carbon atoms and containing a terminal "O" in the chain, for example, -O(alkyl). Examples of alkoxy groups include, without limitation, methoxy, ethoxy, propoxy, butoxy, t-butoxy, or pent oxy groups.

[0063] "Alkenyl" means a straight-chain or branched-chain unsaturated hydrocarbon containing 2 to 12 carbon atoms. The "alkenyl" group contains at least one double bond in the chain. The double bond of the alkenyl group may or may not be conjugated to another unsaturated group. Examples of alkenyl groups include ethenyl, propenyl, n-butenyl, isobutenyl, pentenyl, or hexenyl. The alkenyl group may or may not be substituted and may be straight-chain or branched.

[0064] "Alkynyl" means a straight-chain or branched-chain unsaturated hydrocarbon containing 2 to 12 carbon atoms. The "alkynyl" group contains at least one triple bond in the chain. Examples of alkynyl groups include ethynyl, propargyl, n-butynyl, isobutynyl, pentynyl, or hexynyl. The alkynyl group may or may not be substituted.

[0065] "Cycloalkyl" or "carbocyclic" means a monocyclic ring containing 3 to 18 carbon atoms This refers to a polycyclic saturated carbon ring. Examples of cycloalkyl groups are, non-limitingly, cycloalkyl groups. Clopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptanyl, cyclo Chlooctanil, norboranyl, norborenyl, bicyclo [2.2.2]octanyl or bicyclo[2.2.2]octenyl, and their derivatives. (C3-C8) Cycloalkyl is a cycloalkyl group containing 3 to 8 carbon atoms. The R-alkyl group may be condensed (e.g., decalin) or cross-linked. (For example, Norbomane).

[0066] "Haloalkyl" refers to an alkyl group that is substituted with one or more halogens. This means that examples of haloalkyl groups are trifluoromethyl, difluoromethyl, and pentamethyl. This includes, but is not limited to, oroethyl and trichloromethyl.

[0067] "Haloalkoxy" refers to an alkoxy group that is substituted with one or more halogens. This means that. Examples of haloalkyl groups are trifluoromethoxy, difluoromethoxy, and pe. This includes, but is not limited to, fluoroethoxy and trichloromethoxy.

[0068] The term "pharmaceutically acceptable," as used herein, refers to a drug that can be administered to humans. When administered, it is physiologically tolerable and typically toxic or allergenic. Molecular entities and This refers to a composition. Preferably, when used herein, it means "pharmaceutically acceptable". The term "approved" means approved by a regulatory agency of the Federal or State government with respect to use in animals, and more particularly in humans, or listed in the United States Pharmacopeia or other generally recognized pharmacopeia.

[0069] As used herein, "therapeutic index" is a parameter that represents the therapeutic efficacy of an active drug. The therapeutic index is low, for example, if it implies that a high concentration of the active substance is required to achieve a therapeutic effect, or if the dose required to obtain the effect induces toxicity. Conversely, a high therapeutic index implies that the dose of the active substance required to produce a therapeutic effect is low and / or that the toxicity of the active drug is low.

[0070] b. Other interpretive conventions Methods and materials similar or equivalent to those described herein can be used in the practice or testing of the subject methods and compositions, but the preferred methods and materials are described below. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety.

[0071] As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an antibody or antigen-binding fragment" includes a plurality of such antibodies and antigen-binding fragments. The reference to "that recombinant adeno-associated virus" refers to one or more recombinant adeno-associated viruses. This includes references to Russ and its equivalents known to those skilled in the art. It should also be noted that the scope of the claims may be drafted to exclude any arbitrary element. Therefore, this description is related to the listing of claim elements, such as "simply," "only," etc. The use of such exclusive terms, or the use of "negative" limitation, serves as an antecedent. This is intended.

[0072] Certain features of the present invention, described in relation to other embodiments for clarity, are single It is understood that, in some embodiments, they may be provided in combination. Conversely, in order to be concise, The various features of the present invention described in relation to a single aspect are also separately or optionally preferred It may be provided in any of the following subcombinations. All combinations of embodiments relating to the present invention are provided in this invention. The invention specifically encompasses and every conceivable combination is disclosed individually and clearly. As disclosed herein, in addition to various embodiments and all of their elements Subcombinations are also specifically included by the present invention, and all such subcombinations The combinations are disclosed herein as if they were individually and explicitly disclosed herein.

[0073] The publications discussed herein are provided solely for disclosure prior to the filing date of this application. The publication dates provided may differ from the actual publication dates and are verified separately. It may be necessary to do so.

[0074] If a range of values ​​is provided, it is understood that the listed endpoints of that range are included. In addition, unless otherwise specified in the context, the upper and lower limits of that range are up to one-tenth of the lower limit. Each intervening value between them, and any other specified or intervening value within that specified range, within the present invention These are included in the upper and lower limits of these smaller ranges, independently of their smaller limits. These may be included within the scope, and these too may be any specifically excluded within the scope of the provisions. The specified range is encompassed within the present invention according to the boundary value. If both are included, then one or both of the included upper and lower limits are excluded. The scope is also included in the present invention.

[0075] In this specification, the ranges listed include all values ​​within that range, including the listed endpoints. It is understood that this is an alternative abbreviation. For example, the range 1 to 50 is 1, 2, 3, 4, 5, 6, 7 , 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, Any number or combination of numbers derived from the group consisting of 48, 49, and 50, or 11 to 48 This is understood to include sub-ranges such as 39-41.

[0076] The term "approximately" as used herein means a certain degree of a value or range. A variation of a degree, for example, within 10% of a specified value or a specified range limit, may be permitted.

[0077] c. Surface-modified viral capsids In accordance with this disclosure, the linker containing the cross-linking portion Q is linked to the viral capsid protein. A surface-modified viral capsid containing a bound, conjugated ligand is provided. Recombinant virions containing surface-modified viral capsids are also provided.

[0078] In some embodiments, the surface-modified viral capsid provided is a recombinant of which it is part. In contrast to virions, unmodified recombinant virions, for example, those possessing the same primary amino acid sequence A viral capsid that has not been modified to crosslink to a ligand as described herein Compared to recombinant virions, it exhibits improved transduction efficiency, improved cell type selectivity, and This provides both improved transduction efficiency and improved cell type selectivity.

[0079] In accordance with this disclosure, a surface-functionalized virus comprising the first member of a crosslinking agent-reactive pair. A capsid is provided. Also, a functionalization containing the second member of the crosslinking agent reactive pair is provided. In a Gand, the first and second members of the crosslinking agent reactive pair react to form a crosslinked portion Q. Functionalized ligands are also provided. Surface-functionalized viral capsids are crosslinking agent-reactive It is crosslinked, or conjugated, to a ligand having a complementary member of A. This is possible.

[0080] In some embodiments, the surface-modified viral capsid in the composition contains x conjugates The composition contains ligands, where x is the average number of conjugated ligands per capsid in the composition. This is the number, which is also referred to herein as the ligand ratio per capsid or LCR. In some embodiments, x is between 1 and 500. In a particular embodiment, x is between 1 and 300. In a certain mode, x is between 100 and 200. In a certain mode, x is between 110 and 190. Yes, in certain embodiments, x is between 130 and 170. In some embodiments, x is 1, 5, 10. , 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, 265, 270, 275, 280, 285, 290, 295, or 300, or any two of the aforementioned numbers. It is within the range. In a particular embodiment, x is approximately 1350, approximately 140, approximately 145, approximately 150, approximately 155, approximately 1 It is 60, approximately 165, approximately 170, approximately 175, or approximately 180. In certain embodiments, x is approximately 55 to approximately 85. Yes. In certain embodiments, x is approximately 140 to approximately 160. In certain embodiments, x is approximately 13 It is 5 to approximately 165. In a particular mode, x is approximately 130 to approximately 170. In a particular mode, , x is approximately 150. In a particular embodiment, x is a range between any two of the numbers provided above. It is enclosed.

[0081] Furthermore, (i) a capsid-reactive portion that can covalently attach to the viral capsid protein. (ii) Capsid-reactive linkers, including members of the crosslinking agent-reactive pair, are also included in this disclosure. Therefore, it is provided.

[0082] In various aspects of this disclosure, the surface-modified viral capsid relating to this disclosure is obtained by the following process To be produced: (i) the viral capsid protein and the first member of the crosslinking agent reactive pair and The process involves reacting a capsid-reactive linker, optionally containing one or more spacers. Therefore, the process of obtaining a surface-functionalized viral capsid; and (ii) the surface-functionalized viral capsid and the second member of the crosslinking agent reactive pair A step of conjugating with a functionalized ligand, wherein the first crosslinking agent reactive pair and a second member react to form a crosslinked portion Q; and (iii) A step to obtain a surface-modified viral capsid.

[0083] a. Crosslinking agent reactivity pairs Covalent binding of ligands to viral capsids for the creation of surface-modified viral capsids To achieve optimal consumption, recombinant virions are surface-functionalized, and surface-functionalized A viral capsid protein is prepared, and then it is reacted with a functionalized ligand. The surface-functionalized capsid and functionalized ligand each contain a member of the crosslinking agent-reactive pair. The crosslinking agent-reactive pair members react to form a partial Q, which then crosslinks the viral capsid. It forms a covalent bridge with Gand.

[0084] In a typical embodiment, the crosslinking agent-reactive pair member is bioorthogonal. When used in this context, the term bioorthogonal chemistry refers to interfering with natural biochemical processes. It may not occur within the biological system, or it may interfere with the biochemical / biological activity of the reaction products. This refers to any chemical process that can occur in vitro. Azide and cyclooc 1,3-dipole cycloaddition between tin (also known as copper-free click chemistry), nitrate 1,3-dipolar cycloaddition between ron and cyclooctin, oxy from aldehydes and ketones Sym / hydrazone formation, tetrazine ligation, e.g., s-tetrazine and trans- Cycloaddition or click reaction based on isocyanides of cyclooctene derivatives, and Numerous advancements that meet the requirements of bioorthogonality, including the most recent quadriclan ligation. Academic consumption strategies are being developed.

[0085] a. CuAAC In certain embodiments, the crosslinking agent reactive pair is Cu(I)-catalyzed azide-alkyne cycloaddition (Cu Selected from the chemical moieties involved in AAC). In a particular embodiment, the crosslinking agent reactivity pair is This includes azides and alkynes. Derivatives of these parts that retain the desired chemical reactivity are also included. As assumed in the specification, in certain embodiments, the bridging portion Q includes a five-membered heteroatom ring. In a particular embodiment, the crosslinked portion Q contains 1,4-triazole.

[0086] b. SPAAC and SPANC Unlike CuAAC, Cu-free click chemistry removes cytotoxic copper catalysts. It has been modified to be bioorthogonal, thereby enabling rapid and non-biogenic development. The reaction becomes possible. Instead of copper, the reaction is strain-promoting alkyne-azide cycloaddition (SPA AC) is the case. Copper-free click chemistry is nitro, not azide, as the 1,3-dipole. It has been adapted for use and is used in peptide modification.

[0087] In certain embodiments, the crosslinking agent reactive pair performs strain-promoting alkyne-nitrone addition cycloaddition (S Selected from the chemical moieties involved in PANC). In a particular embodiment, the crosslinking agent reactivity pair is It contains azides and nitrones. Derivatives of these parts that retain the desired chemical reactivity are also available. As assumed in the specification, in certain embodiments, the crosslinked portion Q comprises isoxazoline. .

[0088] In some embodiments, the crosslinking agent reactive pair is an azide and a nitrone, as illustrated below. In this formula, the R group represents an attachment site to a capsid-reactive linker or functionalized ligand. Derivatives of these moieties that retain the desired chemical reactivity are also assumed herein. For example, both carbon and nitrogen atoms in a nitron dipole, as well as acyclic and intracyclic nitros. All substitutions on the line are acceptable. TIFF2026136377000015.tif19128

[0089] In some embodiments, the crosslinking agent reactive pair comprises a cyclooctin analog. In some embodiments, the crosslinking agent reactive pair includes a cyclooctin analog, for example, one of those exemplified below. In the formula, the R group represents an attachment site to a capsid-reactive linker or functionalized ligand. Derivatives of these parts that retain the desired chemical reactivity are also assumed herein. TIFF2026136377000016.tif77139

[0090] In certain embodiments, the crosslinking agent reactive pair is dibenzylcyclooctin (DIBO), dibenzylcyclooctin. Nzoazacyclooctinone (DIBAC or DBCO), and biarylazacyclooctinone Includes a dibenzylcyclooctin analog selected from the group (BARAC). Desired chemical reaction Derivatives of these parts that retain their properties are also assumed herein.

[0091] In a particular embodiment, the crosslinking agent reactive pair comprises a nitrone following the structure below, where R1 The base represents the attachment site to the capsid-reactive linker or functionalized ligand. R2 and R3 are It is not particularly limited. In some embodiments, R2 and R3 are independently hydrogen and C-C4 aluminum. A butyl group is selected, for example, from methyl, ethyl, propyl, and butyl groups. Derivatives of these receptive parts are also envisioned herein. TIFF2026136377000017.tif20128

[0092] In certain embodiments, the crosslinking agent reactivity pair is dibenzylcyclooc as identified above. It comprises a tin analog and either 1,3-nitrone or azide. In certain embodiments, The bridge agent-reactive pair is dibenzylcyclooctin (or its analogues) as shown below. The formula comprises either 1,3-nitrone or azide, wherein the R1 group is a viral capsid or Represents the attachment site to the capsid-reactive linker, and the R2 group on either the azide or nitrone is This represents the attachment site to the functionalized ligand. In an alternative embodiment, the crosslinking agent reactive pair is as shown below. Dibenzylcyclooctin (or its analogues) and 1,3-nitrone or azide The formula includes either an azide or a nitrone, where the R1 group represents the attachment site to the ligand. The R2 group on either side is an attachment site to the surface-functionalized viral capsid or capsid-reactive linker. It represents. TIFF2026136377000018.tif77128

[0093] In a particular embodiment, the bridging portion Q comprises a ring portion that follows one of the examples shown below. In the formula, R1 and R2 represent attachment sites to the viral capsid. R3 and R4 are H or may be any substituent described herein, and the substituted derivative may react to the desired chemical reaction These are also assumed in this specification, provided that they retain their sexual properties. TIFF2026136377000019.tif66128

[0094] c. IEDDA In certain embodiments, the crosslinking agent reactivity pair is an inverse electron-demanded Diels-Alder (IEDD) ​​pair. A) Contains a chemical moiety involved in the reaction. In certain embodiments, the crosslinking agent reactive pair is electron-independent. It contains a diene and electron-rich dienophiles. Examples of such groups are in the art. This is publicly known and can be found elsewhere, for example, F. Thalhammer, et al., Tetrahedron Lett., 1990. , 31, 6851-6854; and BL Oliveira, Chem. Soc. Rev., 2017, 46, 4895-4950. It is listed. In some embodiments, electron-deficient dienes are on dienes as illustrated below. It has an electron-withdrawing group which is substituted. In some embodiments, the electron-rich dienophile is It has an electron-donating group substituted on a dienophile, as illustrated below. TIFF2026136377000020.tif29128

[0095] In certain embodiments, the crosslinking agent reactive pair contributes to Diels-Alder[4+2] cycloaddition. Including the chemical moieties involved, this cycloaddition involves 4●-electrons from the diene and 2●-electrons from the dienophile. Diene and di This is a reaction between an electron-rich diene and an electron-deficient dienophile. In contrast to the normal electron-demanded Diels-Alder reaction, the reverse electron-demanded Diels-Alder reaction... In the Dah reaction (IEDDA), an electron-rich dienophile reacts with an electron-deficient diene. Then, the alkinedienophiles directly produce their respective pyridazines.

[0096] In a particular embodiment, the crosslinking agent reactive pair is a triazine (e.g., 1,2,4-triazine) , tetrazine (Tz) (for example, 1,2,4,5-tetrazine, also called s-tetrazine), Or distorted dienophiles, such as noroborene and transcyclooctene. (TCO), cyclopropene or N-acylazetine are included. In certain embodiments, crosslinking The drug-reactive pair includes the portion shown below, wherein the formula, the R group is the capsid-reactive phosphorus of the present disclosure. This represents the attachment site to the surface-functionalized viral capsid or functionalized ligand. Derivatives of these parts that retain chemical reactivity are also assumed herein. In one embodiment, the crosslinking agent reactive pair comprises TCO and tetrazine. TIFF2026136377000021.tif31128

[0097] 7.1.1.1 Staudinger Liegation In certain embodiments, the crosslinking agent reactive pair can react to produce an iminophosphorane. Zide, phosphine (PPh2), or phosphite, etc., are involved in the Staudinger reaction. It is selected from the chemical components.

[0098] In certain embodiments, the crosslinking agent reactive moiety is triphenylphosphine, for example, shown below. A triphenylphosphine is formed, wherein the R group is the capsid-reactive linker of the present disclosure. This indicates the attachment point to [the substance]. Derivatives of this portion that retain the desired chemical reactivity are also specified herein. It is expected. TIFF2026136377000022.tif33128

[0099] d. [4+1] Cycloaddition In certain embodiments, the crosslinking agent reactive pair involves [4+1] cycloaddition followed by retrograde N2. Chemical moieties involved in Diels-Alder elimination, e.g., isocyanides or 1,2,4,5-type Selected from Trazin.

[0100] In some embodiments, the crosslinking agent reactive moiety is an isocyanide as shown below, in the formula The R group, for example, represents an attachment site to a capsid-reactive linker. In some embodiments, The crosslinking agent reactive moiety is 1,2,4,5-tetrazine as shown below, where R1 or R2 is, For example, it represents the attachment site to the ligand. Derivatives of these parts that retain the desired chemical reactivity. This is also assumed in this specification. TIFF2026136377000023.tif26128

[0101] 7.1.1.1 Tag Response In a particular embodiment, the crosslinking agent reactive portion is a bio-orthogonal tag known in the art. For example, SNAP tags, CLIP tags, Halo tags, or LUMIO tags, or tags that are opposite to these tags. Corresponding chemical groups, for example, benzylguanine group, benzylcytosine group, or chloroalkali group. It is a n group. In a particular embodiment, one member of the crosslinking agent reactive moiety includes a SNAP tag. Furthermore, the other member of the crosslinking agent reactive moiety contains a benzylguanine group.

[0102] b. Crosslinked part-Q In certain aspects of this disclosure, surface-modified viral capsids are as described herein. It includes a portion Q, which is a part formed by the reaction between the crosslinking agent reactive pairs.

[0103] In certain embodiments, Q includes the product of the CuAAC reaction. In certain embodiments, Q is SPA It contains the product of the AC reaction. In certain embodiments, Q is the product of the SPANC reaction. In one embodiment, Q comprises the product of the IEEDD reaction. In a particular embodiment, Q is Staudy The product includes a ligation reaction. In certain embodiments, Q is a [4+1] cycloaddition reaction. The reaction includes the product of the reaction. In some embodiments, Q is a strain-promoting reaction, e.g., SPAAC, SPANC , and the products of IEEDD.

[0104] In certain embodiments, Q includes a ring portion. In certain embodiments, Q includes a biring portion. Includes. In certain embodiments, Q includes a triring part. In certain embodiments, Q includes O, S or a 5-8 membered carbon ring containing 0-3 heteroatoms selected from N. In this case, Q contains an 8-membered ring containing 0 to 1 heteroatoms selected from O and N. In one embodiment, Q comprises a five-membered ring containing 0 to 3 heteroatoms selected from O and N. In certain embodiments, Q is a triazole ring. In certain embodiments, Q is derived from O and N. It contains a 6-membered ring containing 0 to 3 selected heteroatoms. In a particular embodiment, Q contains 2 N hematophores. It contains a six-membered ring that includes a terror atom.

[0105] In some embodiments of Q, which includes a ring portion, Q follows the structure shown below, where Z is O or N It is a 7 or 8-membered carbon ring containing 0 to 3 heteroatoms selected from the following. TIFF2026136377000024.tif22128

[0106] In some embodiments, Q includes the following structure. TIFF2026136377000025.tif27128

[0107] c. Surface-functionalized viral capsids In certain aspects of this disclosure, the surface of the viral capsid contains members of a crosslinking agent-reactive pair. A surface-functionalized viral capsid is provided, which is functionalized in such a way. The viral capsid protein is functionalized by a reaction with a capsid-reactive linker. In some embodiments, the surface of the viral capsid contains a non-natural crosslinking agent-reactive portion. It contains amino acids. In some embodiments, the viral capsid contains at least one capsid. The fusion protein includes a bioorthogonal tag within the primary sequence of the protein.

[0108] In some aspects of this disclosure, the surface of the viral capsid reacts with a capsid-reactive linker A surface-functionalized viral capsid is provided, which is functionalized in the following ways. The surface-functionalized viral capsid contains y capsid-reactive linker groups, where y is This is the number of capsid-reactive linkers attached to each viral capsid.

[0109] In some aspects of this disclosure, a composition comprising a surface-functionalized viral capsid, Y A composition is provided in which is the average number of capsid-reactive linkers attached to each capsid.

[0110] a. Capsid-reactive linker The capsid-reactive linker, in accordance with this disclosure, (i) covalently adheres to the capsid surface (ii) a capsid surface-reactive moiety available for formation, and on the ligand of the present disclosure A crosslinking agent selected to be reactive with another member of the functionalized crosslinking agent reactive pair. Includes members of the bridge agent-reactive pair.

[0111] a. Spacer The capsid-reactive linker optionally further includes one or more spacer portions. The spacer portion is not particularly limited and is any spacer known in the art. Obtain. In some embodiments, the spacer is made of one or more monoethylene glycols. MAR, that is, polyethylene glycol, ●(O●CH2●CH2)n● or [PEG]n("discrete") Polyethylene glycol (also known as dPEG n) is included in the formula, "n" is the number of ethylene oxide (or "ethylene glycol") units. In a certain mode, n is 0. In a particular mode, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 75, 100 ru.

[0112] b. Capsid surface reactive portion In accordance with this disclosure, the capsid surface reactive portion is not particularly limited and can be on a desired capsid surface. It includes any part that can be attached covalently.

[0113] In some embodiments, the capsid surface-reactive portion is used in residue-specific protein labeling. Using known techniques, the surface-exposed amino acid residues in the primary sequence of the capsid protein are shared They adhere bondably.

[0114] In some embodiments, amino acid residues are present in the wild-type capsid protein. In this embodiment, amino acid residues are manipulated within the primary amino acid sequence of the capsid.

[0115] a. Primary amines on capsid surfaces In some embodiments, the capsid surface reactive moiety reacts with a primary amine (-NH2). Contains a chemical base. Primary amines are present at the N-terminus of each capsid protein, and the capsid protein It is present in the side chain of the lysine (Lys, K) amino acid residue in the nucleotide sequence. It reacts with primary amines. Examples of chemical groups include isothiocyanates, isocyanates, acyl azides, and NHS esters. L, sulfonyl chloride, aldehyde, glyoxal, epoxide, oxirane, carbon Fluoropropyl alcohols, aryl halides, imide esters, carbodiimides, anhydrides, and fluorocarbons. Contains phenyl esters. Most of these are either acylated or alkylated. Therefore, it is conjugated with an amine. In some embodiments, the capsid surface reactive portion is NHS esters or imide esters, for example, those shown below, where the R group is This indicates the attachment point to the capsid-reactive linker. TIFF2026136377000026.tif72134

[0116] In some embodiments, the capsid surface reactive portion is located on the surface of the primary sequence of the capsid protein. It covalently attaches to exposed lysine residues. In certain cases of these embodiments, the capsid The surface-reactive parts are NHS esters, isocyanates, and isothiocyanates, as shown below. , or benzyl fluoride, wherein the R group represents the attachment site to the capsid-reactive linker. death, JPEG2026136377000027.jpg7170 The symbols indicate the attachment sites of lysine residues in the capsid protein sequence. TIFF2026136377000028.tif86128

[0117] In some embodiments, the capsid-reactive linker is N-hydroxysuccinimide. Contains (NHS ester). NHS esters are the carbodiimide activity of carboxylate molecules. It is a reactive group formed by chemical reaction. NHS ester-activated capsid reactive linkers are Physiologically, it reacts with primary amines under slightly alkaline conditions (pH 7.2-9) to become stable. This generates an amide bond. The reaction liberates N-hydroxysuccinimide (NHS).

[0118] In some embodiments, the capsid-reactive linker is tetrafluorophenyl (TFP) Contains esters. TFP esters are formed by carbodiimide activation of carboxylate molecules. It is a reactive group that is formed. The TFP ester of carboxylic acid is formed with primary amines and NHS esters. NHS esters that form covalent amide bonds identical to those formed by the reaction between them It reacts with primary amines at the same rate.

[0119] b. Sulfhydryl groups on the capsid surface In some embodiments, the capsid surface reactive portion is covalently bonded to the surface-exposed sulfhydryl groups. They adhere together. In some embodiments, the capsid surface reactive portion is the capsid protein. It covalently attaches to surface-exposed cysteine ​​residues in the primary sequence.

[0120] In certain cases of these embodiments, the capsid surface reactive portion is as illustrated below. Maleimide, iodoacetamide, 2-thiopyridne, or 3-aryl It contains propioronitrile, where the R group represents the attachment site to the capsid-reactive linker. JPEG2026136377000029.jpg7170 The symbols indicate the attachment sites of lysine residues in the capsid protein sequence. TIFF2026136377000030.tif108128

[0121] In some embodiments, the capsid-reactive linker contains maleimide. The derivatives are prepared from maleic anhydride by treatment with an amine and subsequent dehydration. The maleimide group reacts specifically with the sulfhydryl group when the pH of the reaction mixture is 6.5 to 7.5. It reacts with; resulting in the formation of irreversible, stable thioether linkages.

[0122] c. Unnatural amino acids In some embodiments, the surface of the viral capsid is a non-natural amine containing a crosslinking agent-reactive portion. It contains a mono-teria protein with a no acid.

[0123] In certain aspects, non-natural amino acids are, as illustrated below, 1:3-(6-acetylnaphthol). Talene-2-ylamino)-2-aminopropanoic acid (Anap), 2:(S)-1-carboxy-3-(7-Hydrogen Xy-2-oxo-2H-chromen-4-yl)propane-1-aminium (CouAA), 3:3-(5-(dimethicone (Amino)naphthalene-1-sulfonamide)propanoic acid (dansylalanine), 4:N ● -p-a 5: Didobenzyloxycarbonyllysine (PABK), 6: Propargyl-L-lysine (PrK), N ● -(1-methylcyclopropa-2-encarboxamide)lysine (CpK), 7:N ● - Acrylic Jin (AcrK), 8:N ● -(cycloocta-2-in-1-yloxy)carbonyl)L-lysine(CoK ), 9: Bicyclo[6.1.0]non-4-in-9-ylethanolidine (BCNK), 10: Trans- Cycloocta-2-enlyne (2●-TCOK), 11:trans-cycloocta-4-enlyne (4 ●-TCOK), 12: Dioxo-TCO-lysine (DOTCOK), 13: 3-(2-cyclobuten-1-yl)propane acid (CbK), 14:N ● -5-norbornene-2-yloxycarbonyl-L-lysine (NBOK), 15 :Cyclooctinlysine (SCOK), 16:5-norbornene-2-alltyrosine (NOR), 17: Cycloocta-2-inoltyrosine (COY), 18:(E)-2-(cycloocta-4-en-1-yl Oxyl) Ethanol Tyrosine (DS1 / 2), 19: Azido Homoalanine (AHA), 20: Homop Ropargylglycine (HPG), 21:azidnorleucine (ANL), and 22:N ● -2-Azid Selected from ethyloxycarbonyl-L-lysine (NEAK). TIFF2026136377000031.tif139164

[0124] d. Functionalized ligands In certain aspects of this disclosure, the ligand is functionalized to include a member of the crosslinking agent reactive pair. A functionalized ligand is provided. In some embodiments, the ligand is the ligand antagonist. It is functionalized by reaction with a responsive linker. In some embodiments, the ligand is a polyp It is a peptide, and the polypeptide is modified to include non-natural amino acids containing a crosslinking agent reactive moiety. They differ. In some embodiments, the ligand has a bioorthogonal tag in the ligand's primary sequence. It is a fusion protein that contains this protein.

[0125] a. Ligand-reactive linker The ligand-reactive linker, in accordance with this disclosure, (i) covalently attaches to the ligand surface (ii) ligand-reactive moieties available for formation, and (ii) surface-functionalized viruses of the present disclosure Members of crosslinking agent reactivity pairs available for bioorthogonal consumption with scapsids Includes.

[0126] a. Spacer The ligand-reactive linker optionally further includes at least one spacer portion. The spacer portion is not particularly limited and is any spacer known in the art. Obtain. In some embodiments, the spacer is an ethylene glycol monomer, i.e., Polyethylene glycol, ●(O●CH2●CH2)n● or [PEG]n("dispersed polyethylene glycol") The term "call" is also known as "dPEG n"), and in the formula, "n" is ethyl This is the number of ethylene glycol (or "ethylene glycol") units. In certain embodiments, n n is 0. In a particular mode, n is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 , 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 75, 100. A certain In this embodiment, n is 4.

[0127] b. Ligand-reactive portion In accordance with this disclosure, the ligand-reactive moiety is not particularly limited and is covalently bound to a desired ligand. Includes any part that can adhere to the target.

[0128] In some embodiments where the ligand is a peptide, oligopeptide, or polypeptide, The ligand-reactive portion was identified using known techniques in residue-specific protein labeling. It attaches to amino acid residues in the primary sequence of the Gand protein.

[0129] In some embodiments, amino acid residues are present in the wild-type ligand protein. In this embodiment, amino acid residues are manipulated within the primary amino acid sequence of the ligand.

[0130] a. Ligands: Primary amines In some embodiments, the ligand-reactive moiety is a chemical group that reacts with a primary amine (-NH2). Includes. In embodiments where the ligand is a polypeptide, the primary amine is each ligand protein The protein has a side chain at its N-terminus, and a lysine (Lys, K) amino acid residue in the ligand protein sequence. It is present within. Exemplary chemical groups that react with primary amines are isothiocyanates, isothiocyanates. Anate, acyl azide, NHS ester, sulfonyl chloride, aldehyde, glyoxal Epoxides, oxiranes, carbonates, aryl halides, imide esters, carboxymethyl phosphates It contains bodiimides, anhydrides, and fluorophenyl esters. Most of these chemical groups These are conjugated to amines by either acylation or alkylation. In some embodiments, the ligand surface-reactive portion is an NHS ester or an imide ester, for example. For example, including those shown below, in the formula, the R group has an attachment site to the ligand-reactive linker. represent. TIFF2026136377000032.tif72134

[0131] In some embodiments where the ligand is a polypeptide, the ligand-reactive portion is the ligand It covalently attaches to surface-exposed lysine residues in the protein primary sequence. In certain cases, the ligand surface-reactive moiety is an NHS ester, isocyanate, as shown below. The compound comprises a phosphate, isothiocyanate, or benzyl fluoride, where the R group is involved in ligand reactions. This indicates the point of attachment to the linker. JPEG2026136377000033.jpg7170 The symbols indicate the attachment sites of lysine residues in the ligand protein sequence. TIFF2026136377000034.tif85128

[0132] In some embodiments, the ligand-reactive linker is N-hydroxysuccinimide. Contains (NHS ester). NHS esters are the carbodiimide activity of carboxylate molecules. It is a reactive group formed by chemical reaction. The NHS ester-activated ligand reactive linker is Physiologically, it reacts with primary amines under slightly alkaline conditions (pH 7.2-9) to become stable. This generates an amide bond. The reaction liberates N-hydroxysuccinimide (NHS).

[0133] b. Ligand sulfhydryl group In some embodiments, the ligand-reactive moiety is covalently bonded to the surface-exposed sulfhydryl group. It attaches to. In some embodiments where the ligand is a polypeptide, the ligand-reactive portion It covalently attaches to cysteine ​​residues in the primary sequence of the ligand protein.

[0134] In certain cases of these embodiments, the ligand-reactive moiety is a male as illustrated below. Imide, iodoacetamide, 2-thiopyridine, or 3-arylpropionitrile In the formula, the R group represents the attachment site to the ligand-reactive linker. JPEG2026136377000035.jpg7170 The symbols indicate the attachment sites of lysine residues in the ligand protein sequence. TIFF2026136377000036.tif108128

[0135] In some embodiments, the ligand-reactive linker comprises maleimide. Maleimide and its derivatives are prepared from maleic anhydride by treatment with an amine followed by dehydration. The maleimide group reacts specifically with sulfhydryl groups when the pH of the reaction mixture is between 6.5 and 7.5; as a result, it leads to the formation of a stable, irreversible thioether linkage.

[0136] c. Unnatural Amino Acids In some embodiments, the ligand is a polypeptide that has been mutated to include an unnatural amino acid that contains a crosslinker-reactive moiety.

[0137] In certain embodiments, the ligand polypeptide is 1: 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), 2: (S)-1-carboxy-3-(7-hydroxy-2-oxo-2H-chromen-4-yl) propan-1-aminium (CouAA), 3: 3-(5-(dimethylamino) naphthalene-1-sulfonamido) propanoic acid (dansylalanine), 4: N- ● -p-azidobenzyl oxycarbonyllysine (PABK), 5: propargyl-L-lysine (PrK), 6: N- ● ● -(1-methylcycloprop-2-enecarboxamido) lysine (CpK), 7: N- ● -(cycloocta-2-in-1-yloxy) carbonyl) L-lysine (CoK), 9: bicyclo [6.1.0] non-4-in-9-ylmethanol lysine (BCNK), 10: trans-cycloocta-2-ene lysine (2●-TCOK), 11: trans-cycloocta-4-ene lysine (4●-TCOK), 12 : Dioxo-TCO-lysine (DOTCOK), 13:3-(2-cyclobuten-1-yl)propanoic acid (CbK), 14:N ● -5-norbornene-2-yloxycarbonyl-L-lysine (NBOK), 15:cyclooctane Nlysine (SCOK), 16:5-norbornene-2-alltyrosine (NOR), 17:cycloocta-2 - Inoltyrosine (COY), 18:(E)-2-(cycloocta-4-en-1-yloxyl) ethano 19: N (HPG), 21: Azidonorleucine (ANL), 22: N ● -2-Azidoethyloxycarbonyl - Mutated to contain one or more non-natural amino acids selected from L-lysine (NEAK) ru. TIFF2026136377000037.tif139164

[0138] d. Fusion protein with tag-reactive molecule In various aspects of this disclosure, ligands have high affinity for their corresponding counterparts. Tags that can be combined, for example, SNAP tags, CLIP tags, Halo tags, Lumio tags and publicly available to those skilled in the art. It is a fusion protein that includes other elements of knowledge.

[0139] Benzylguanine, benzylcytosine, and chloroalkanes are "suicide" enzymes such as SNAP. It is recognized by the element. In connection with the present invention, benzylguanine or benzylcytosine is Even if substituted to form a derivative of benzylguanine or benzylcytosine Good. Benzyl guanine derivatives or benzyl cytosine derivatives are modified, but However, it still refers to the benzylguanine or benzylcytosine group that is recognized by suicide enzymes. It is understood to be something that happens.

[0140] A tag molecule can be any molecule or biomolecule that can specifically bind to another molecule. Examples may include SNAP tags, CLIP tags, Lumio-Tag, or Halo-Tag. For example, affinity The tag is a SNAP tag, which is a variant of alkylguanine-DNA alkyltransferase. It is possible. Importantly, one of the substrates for the SNAP tag is benzylguanine. Commercially available products for this purpose include, for example, HaloTag from Promega, Lumio Tag from Life Technologies, and Includes SNAP / CLIP tags from NEB.

[0141] Self-labeled protein tags are commercially available in a variety of expression vectors. SNAP tags can be fused to any protein of interest, and suitable materials such as fluorescent dyes are available. A 182-residue polypeptide (19. It is 4kDa). The SNAP tag protein is O-6-methylguanine-DNA methyltrans in humans. Engineering operations of the ubiquitous mammalian enzyme AGT encoded by the ferase (MGMT) gene It is a technique. SNAP tags use a directed evolutionary strategy to improve damaged DNA. hAG accepts O6-benzylguanine derivatives instead of repairing rukylated guanine derivatives. This can be obtained by leading to the T variant.

[0142] CLIP tags use O2-benzylcytosine derivatives as substrates instead of O6-benzylguanine. Further engineering operations were performed on the SNAP tags to enable acceptance. Protein complementation assays and A split SNAP tag version, suitable for protein-protein interaction studies, will later be available. Developed.

[0143] HaloTag is a self-labeling protein tag. It covalently binds to a synthetic ligand. HaloTag is a 297-residue peptide (33kDa) derived from a bacterial enzyme designed to be reactive. It has a genetically modified active site that specifically binds to chloroalkane linkers, and rig It is a hydrolytic enzyme with increased bond binding rate. Protein tags and chloroalkane linkages. The reaction that forms a bond between the two is due to the terminal chlorine of the linker portion, under physiological conditions. Furthermore, it is fast and basically irreversible. In the aforementioned reaction, the chloroalkane-reactive linker A nuclear attack causes a substitution between halogens and amino acid residues, resulting in the covalent bonding of halogens. Kill leads to the formation of an enzyme intermediate. This intermediate then leads to the formation of an enzyme intermediate within the wild-type hydrolase. It will be hydrolyzed by the amino acid residue. This will lead to the regeneration of the enzyme after the reaction. However, in the modified haloalkane dehalogenase (HaloTag), the reaction intermediate is Because the enzyme is unable to hydrolyze the product due to a mutation, the subsequent reaction cannot proceed. As a result, the intermediate remains as a stable covalent adduct without any accompanying reverse reaction.

[0144] There are two steps that use this system: fusion of the SNAP tag (registered trademark) of the protein of interest. Cloning and expression of the fusion as a compound, and labeling of the fusion with an optimal SNAP tag substrate. AP tags are human O6-alkylguanine-DNA-alkyltrans, a DNA repair protein. It is a small protein based on ferase (hAGT). In this case, the SNAP tag substrate is ben It is a guanine leaving group attached to the zill linker. In the labeling reaction, the substrate is substituted The nucleotide group is covalently attached to the SNAP tag.

[0145] The SNAP-tagged protein labeling system can label virtually any molecule onto a protein of interest. It enables heterogeneous covalent adhesion.

[0146] e. Examples of reactive linkers The following reactive linkers are capsid-reactive linkers or according to various aspects of this disclosure. It is suitable for use as one of the ligand-reactive linkers.

[0147] a. TCO-PEG4-NHS TIFF2026136377000038.tif18128

[0148] Synonym: trans-cyclooctene-PEG4-NHS; empirical formula (Hill notation): C24H38N2O10; molecule Amount:514.57

[0149] b. Tetrazine-PEG5-NHS TIFF2026136377000039.tif27128 Tetrazin-PEG5-NHS ester is used in proteins, peptides, and other products that utilize the tetrazin moiety. It is an amine-reactive linker often used for modifying amine-modified oligonucleotides. ru.

[0150] c. Azido-PEG4-NHS(Azido-PEG4-NHS) TIFF2026136377000040.tif20128 Furthermore, in this specification, it is also referred to as "Azide-PEG4-NHS".

[0151] d. Phosphine-NHS TIFF2026136377000041.tif20128 Molecular weight: 461.40

[0152] e. DBCO-PEG12-TFP ester TIFF2026136377000042.tif21128

[0153] f. Maleimide-PEG8-succinimidyl ester TIFF2026136377000043.tif26128

[0154] Maleimide PEG8 succinimidyl ester, 31-(2,5-dihydro-2,5-dioxo-1H-pyro 1-yl)-29-oxo-4,7,10,13,16,19,22,25-octaoxa-28-azahentricone 2,5-Dioxo-1-pyrrolidinyl tanic acid ester, maleimide-PEG8-NHS ester, 31-(2,5- Dihydro-2,5-dioxo-1H-pyrrole-1-yl)-29-oxo-4,7,10,13,16,19,22,25-octa Oxa-28-azahentricontanoic acid 2,5-dioxo-1-pyrrolidinyl ester, Maleimi DO-PEG8-NHS ester.

[0155] 7.1.1. Surface-modified viral capsid of formula I In certain embodiments, the surface-modified viral capsid is of formula I: TIFF2026136377000044.tif17128 in accordance with During the ceremony, JPEG2026136377000045.jpg7170 It is a viral capsid; Y is the attachment point; Y' is the attachment point; Q is the bridge portion; PEG is a monomer of ethylene glycol; n and n' are independent integers between 0 and 100. Sp and Sp' are, independently, arbitrary spacers; L is a ligand; and x is an integer between 1 and 300, 100 and 200, 120 and 180, or around 150.

[0156] In a particular embodiment, the attachment portion Y is between the capsid-reactive portion and the capsid protein. It is formed by the reaction of the NHS ester and the capsid. In a particular embodiment, the attached portion Y is formed by the reaction of the NHS ester and the capsid. It is formed by the reaction between the primary amino group of an amino acid in a protein. In this context, the amino group is a lysine side chain present in the primary sequence of the capsid protein. In some embodiments, the amino group is present in the wild-type primary sequence of the AAV capsid protein. It is lysine.

[0157] In a particular embodiment, the attached portion Y' is formed by a reaction between the ligand-reactive portion and the ligand. It is formed in a certain manner. In a particular embodiment, the attachment portion Y' is formed by the NHS ester and the ligand amino It is formed by a reaction with a group.

[0158] In a particular embodiment, Q is formed by a reaction between members of a crosslinking agent reactive pair. It is a product. In a particular embodiment, Q is formed by the reaction of DBCO with an azide group. This is the bridge section.

[0159] In certain aspects, Q is: TIFF2026136377000046.tif24128 Selected from, In the formula, Z is a 7- or 8-membered ring or heterocyclic structure.

[0160] In a particular embodiment, the surface-modified viral capsid is of formula I-1: TIFF2026136377000047.tif56132 in accordance with During the ceremony, JPEG2026136377000048.jpg7170 It is a viral capsid; n and n' are integers independently selected from 0 to 30; L is a ligand; and x is an integer between 50 and 250.

[0161] In a particular mode, n is an integer selected from 0 to 100. These are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 The values ​​are selected from 20, 25, 30, 35, 40, 45, 50, 75, and 100.

[0162] In a particular mode, n' is an integer selected from 0 to 100. n' is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, The options are 25, 30, 35, 40, 45, 50, 75, and 100.

[0163] f. Ligand Ligands for use with this disclosure include viral capsulci as described herein. It is not particularly limited as long as it is suitable for consumption on a surface. In some embodiments, Ligands have cognates located on the surface of mammalian cells, such as receptors. Selected from protein ligands. In some of these embodiments, its homologous protein. However, it is involved in the transduction of surface-modified viral capsids.

[0164] In some embodiments, the ligand is a cell-type specific ligand. In certain embodiments, Ligands are polypeptides, proteins, monosaccharides, or polysaccharides, and are derived from steroid hormones. From RGD motif peptides, from vitamins, from low molecular weights, or targeting Selected from peptides; also antibodies (e.g., single-chain) and nanobodies; proteases , enzymes such as glycosidase, lipase, and peptidase; CD47 (don't eat me signal) Immunoglobulins such as IdeZ and IdeS; IgG proteases such as IdeZ and IdeS; vaccines Protein-based and low-molecular-weight adjuvants are also being considered.

[0165] According to one embodiment, the cell type-specific ligand is transferrin, epidermal growth factor (EGF), salt It is derived from proteins such as basal fibroblast growth factor (bFGF).

[0166] According to one embodiment, the cell type-specific ligand is galactose, N-acetylgalactosamine It is also derived from monosaccharides or polysaccharides such as mannose.

[0167] According to one embodiment, the cell type-specific ligand is derived from vitamins such as folic acid.

[0168] According to one embodiment, the cell type-specific ligand is naproxen, ibuprofen or other It originates from small molecules, including known protein-binding molecules.

[0169] In certain embodiments, ligands are protein ligatures such as growth factors or cytokines. Root; cholera toxin B subunit and other toxin subunits; isolectin B4 or wheat embryo Lectins such as bud agglutinins; adhesion factors such as lactoadherins; antibodies or their single-chain variable sections. Fragments, for example, anti-CD-34 antibodies; more specifically, E. coli recombinant scFv CD-34 antibody fragments, Deltor Peptides such as finopioid receptor ligands; and gene-editing nuclei such as Cas9. -Selected from the list.

[0170] g. Viral capsid In some aspects of this disclosure, the viral capsid is not particularly limited. In some aspects, Viral capsids are enveloped adenoviruses or adeno-associated viruses. Selected from viruses that do not exist. In some embodiments, the viral capsid is retrovirus Envelops such as rus, lentivirus, herpes simplex virus and baculovirus Selected from viruses that possess a capsid. Various forms include capsids that do not exist in nature, and primary In addition to or in addition to changes in the amino acid sequence, naturally occurring capsid proteins in organisms This includes scientific or chemical changes or mutations.

[0171] a. AAV All recombinant adeno-associated viruses (rAAV), or those used interchangeably as described herein Such AAVs can be practiced within the framework of this disclosure. Such AAV particles are widely used in mammals. Exemplary cells that have terminated division, such as muscle cells, hepatocytes, and neurons (including, but not limited to, these). In vivo transduction is possible into (undefined) individuals.

[0172] In some embodiments, AAV capsids are naturally occurring AAV serotypes VP1, VP2, and / Or it contains VP3 capsid protein. In some embodiments, AAV is a naturally occurring VP 1. comprising one or more of the VP2 and / or VP3 capsid proteins. In certain cases, naturally occurring VP1, VP2, or VP3 capsid proteins may be present in nature. The primary amino acid sequence differs from that of naturally occurring capsids. In certain aspects, it does not exist naturally. Capsids are not affected by changes in the primary amino acid sequence, or by changes in naturally occurring AAs. This includes biological or chemical changes or mutations in the V capsid protein.

[0173] In various forms, capsid proteins include AAV1, AAV2, AAV3B, AAV5, AAV6, AAV8, and Or it is a naturally occurring AAV serotype of AAV9. In various forms, the capsid protein The codes are PCT / US2014 / 060163, USP9695220, PCT / US2016 / 044819, PCT / US2018 / 032166, PCT / U Selected from capsid proteins disclosed in S2019 / 031851 and PCT / US2019 / 047546. These are incorporated herein by reference in their entirety.

[0174] Adeno-associated virus capsids are found in all identified native serotypes, particularly AAV2 and AAV3. b, AAV5, AAV8, AAV9 and AAV10 may be selected, and more specifically, AAV2. That's fine.

[0175] Furthermore, adeno-associated viruses undergo unnatural processes, such as capsid mutations, but are not limited to natural mutations. Induction, insertion or deletion of peptides into the capsid sequence, capsids from various serotypes They may be selected from synthetic serotypes produced by ffling or ancestral reconstruction.

[0176] AAV capsids for use in conjunction with this disclosure are, but not limited to, known in the art. It is produced by any method. For example, AAV capsids are produced in HEK293 cells, Ad, or HSV. Infected stable cell lines, mammalian cells infected with Ad or HSV (rep-cap and introduced cells) Insect cells (rep-cap and) that express the gene, or are infected with a baculovirus vector. By several methods, including transient transfection (expressing the introduced gene) It can be produced. Use AAV capsid produced by any of these methods. This method produces surface-functionalized and surface-modified viral capsids as described herein. It is possible. In certain embodiments, the vector may be as illustrated in the provided examples. , two plasmids: AAVRep2-Cap2 and adenovirus helper gene (E2A, VA RNA pHelper, PDP2-KANA, which encodes E4, and pVectors-CAG-eGFP, Produced by transient transfection of HEK293 cells using the calcium phosphate-HeBS method. It can be done.

[0177] In some embodiments, the AAV capsid of this disclosure may, if desired, be derived from a non-viral source. Includes one or more sequences.

[0178] In some embodiments, the AAV capsid consists of a unique VP1 N-terminus, a VP1 / VP2 common part, and VP1. Three overlapping capsid proteins (VP1, VP2) containing a common portion of VP2 and VP3. It consists of VP3).

[0179] In certain embodiments, one or more capsid proteins are naturally occurring, i.e. In an alternative embodiment, the primary sequence contains an amino group corresponding to the wild-type capsid protein. The primary sequences of one or more capsid proteins are found in the wild-type capsid protein sequence. Contains manipulated amino acids. In certain cases of these embodiments, the manipulated amino acids are They are present on the surface of the capsid and are involved in the surface functionalization of one or more capsid proteins. It contains one or more amino groups. In certain embodiments, the surface functionalization of the capsid The naturally occurring or manipulated amino groups involved are lysine, arginine, and cysteine. It is selected from the amino acids. In certain embodiments, the amino acid is lysine.

[0180] In certain embodiments, AAV capsids are derived from one or more naturally occurring serotypes. Contains live capsid protein.

[0181] According to another specific embodiment, AAV capsids contain genetically modified capsid proteins. In certain embodiments, a genetically modified capsid protein may be one or more genetically modified. These are naturally occurring serotypes that have been manipulated to include genetic modifications (mutations, insertions, or deletions). In an alternative embodiment, the rAAV capsid is composed of one or more synthetic capsid proteins. In certain embodiments, AAV capsids are modified to alter their natural directivity, for example, by using heparin. The process is designed to reduce the nucleotide bond.

[0182] Within the framework of this disclosure, synthetic capsids represent novel AAs not known to exist in nature. Natural serotypes and genetically modified serotypes capable of assembling and producing V virus capsids. and artificially created serotypes (random mutation, sequence shuffling, in silico design) Contains any combination of capsid proteins derived from ( ).

[0183] Currently, there are over 100 AAVs with different capsid protein binding capsid abilities to specific cell surface receptors. Serotypes have been identified, and it can transduce different cell types. AAV2 is a bacterial plasmid. It was the first serotype to be identified, and since then, it has been used as a comparison to identify other serotypes. It has been used for 12 serotypes (AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12) thoroughly investigate the ability of these proteins to transduce specific cell types. It has been specifically tested, and the capsid protein that binds to specific cell surface receptors for cell adhesion. They are distinguished by their chemical motifs. In relation to the present invention, AAV capsids are AAV1, AAV2, AAV3 It is preferable to choose from AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. However, it is reasonable to assume that any other AAV capsid can be used in connection with the present invention. It should be explained.

[0184] In one embodiment, the adeno-associated virus (AAV) particles of the present invention are AAV1, AAV2, AAV3, AAV4, A Select from AV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and AAV12. The most commonly used gene transfer system is a virus, such as adeno-associated virus type 2 (AAV2). ), AAV9, and AAV8 derivatives. In certain embodiments, rAAV capsids AAV-2 and AAV-9 This means that the capsid protein may optionally reduce or modify its natural directivity, for example, It has been further manipulated to reduce heparin binding.

[0185] b. Removal of natural bonding sites In certain embodiments of the adeno-associated virus (rAAV) capsids of this disclosure, rAAV is heparan sulf Naturally occurring serum from which the native cell-binding sites capable of binding to acid proteoglycans have been removed. Selected from the available types.

[0186] In certain embodiments, the removal of heparin binding is performed by arginine 585 or arginine 588 of VP1. and / or at least one of the similar arginines in VP2 or VP3 such as alanine It is manipulated by substituting different amino acids. In some embodiments, VP2 is Arginine 448 and arginine 451, or at least one of 383 and 386 in VP3 is modified. It will be done.

[0187] In certain embodiments, the adeno-associated virus (AAV) capsid of this disclosure mutates from the wild type. It consists of at least one protein, for example, the manipulated / mutated protein is wild-type Selected from proteins VP1, VP2, and / or VP3, or in the capsid. Two proteins, VP1, VP2, and / or VP3, are mutated, or the tan in the capsid is mutated. All three proteins VP1, VP2, and VP3 are modified. In certain embodiments, the capsid contains At least one part of the protein to be modified, for example, one A The amino acids are mutated (substituted, inserted, or deleted). However, the ta in the capsid Multiple parts of protein VP1, VP2, and VP3, for example, multiple amino acids, for example, 2, 3, 4, It is also possible to mutate 5, 6, 7, 8, 9, 10, or any other number of parts or amino acids. In certain embodiments, arginine 484, 487, 585 and 588 and lysine 532 of VP1, and In / or at least one of the similar arginines in VP2 or VP3, such as alanine. These are removed by substituting them with amino acids.

[0188] 7.1.1. PEG Immunocloaking According to another specific embodiment, the viral capsid surface is prepared in a manner known in the art. Therefore, it may be modified to include a steric shielding agent to avoid interaction with neutralizing antibodies. In some embodiments, the steric shielding agent is polyethylene glycol (PEG) or pHPMA, etc. It is derived from synthetic polymers. The PEG polymer is prepared by a polymerization process and polydisperse Also known as the PDI, variance index, or simply degree of variance (indicated by the symbol "●"). The size and molecular weight can be characterized by the Poisson distribution of the chain length and molecular weight. Contains a heterogeneous mixture of varying amounts. The reported molecular weight is the average molecular weight, and ● (or PDI) This serves as an indicator of the molecular weight range in the sample.

[0189] h. Capsid Cargo The nucleic acid cargo packaged within the surface-modified rAAV capsid of the present invention is provided by rAAV It can be any type of nucleic acid molecule that can be effectively transduced into cells.

[0190] In some embodiments, the payload or cargo of the rAAV capsid is an expressible polynucleus. It is a rheotide. In certain embodiments, expressible polynucleotides can make proteins co To encode (for example, a therapeutic protein). In a particular embodiment, expressible Polynucleotides encode transgenes. In certain aspects, expressible polynucleotides Creotide is transcribed into guide RNA, trans-activated CRISPR RNA (tracrRNA), and MESSA. We can provide senger RNA (mRNA), microRNA (miRNA), or shRNA.

[0191] In some embodiments, the payload provides a DNA homologous construct for homologous recombination repair. ru.

[0192] In some embodiments, the nucleic acid molecule is an intracellular antibody (for example, a specific intracellular antibody). Nucleic acid molecules encode peptide toxins (for neutralizing proteins), and these molecules are responsible for the action of peptide toxins (e.g., pain). It codes for blocking ion channels in the pathway, and nucleic acid molecules are optogenetic. Actuators (for example, using light to turn neuronal activity on or off) Nucleic acid molecules encode and are genetic pharmacological tools (e.g., do not interfere with pharmacological effects). (To turn neuronal signaling on or off using chemical ligands) Nucleic acid molecules are used to code CRISPR-based editors for precise gene editing. Nucleic acid molecules are used as CRISPR-epigenetic tools to regulate gene expression. It codes for and / or the nucleic acid molecule codes for suicide genes to induce cell death. It's running.

[0193] Preferably, if the cargo contains a gene editing nuclease such as Cas9, the cargo is a dwelling. This further includes nucleic acid molecules such as gRNA and / or specific DNA that are to be inserted into the main genome. In certain cases of these embodiments, cargo is known to be associated with genetic disorders. It includes introduced genes.

[0194] Those skilled in the art can also use other substances besides Cas9, such as Cpfl, TALEN, ZFN, or homing endonucleases. We are aware of other gene editing nucleases. Furthermore, we are aware of the DNA-guided Argonaut interference system (D In some cases, it may be advantageous to operate using AIS. Basically, the Argonaut The (Ago) protein is derived from polynucleotides introduced into the cells. At least one exogenous oligo that provides cleavage specificity to a pre-selected gene locus Heterologous expression occurs in the presence of nucleotides (DNA guides). TALENs and Cas9 systems, respectively, Zinc finger nuclear is described in WO2013 / 176915 and WO 2014 / 191128. ZFN is a hybrid restriction enzyme, derived from Kim, YG; Cha, J.; and Chandrasegaran, S. zinc finger fusions to Fok I cleavage domain" (1996). Proc Natl Acad Sci USA 93 (3): 1156-60) was first described. Cpfl is described by Zhang et al. (Cpflis a single RNA-guided According to "ed Endonuclease of a Class 2 CRIPR-Cas System. (2015). Cell;163:759-771") It is a Class 2 CRISPR-Cas system as described. It belongs to the Argonaut (AGO) gene family. Guo S,Kemphues KJ.(Par-1, a gene required for establishing polarity in C. elegansembryos, encodes a putative Ser / Thr kinase that is asymmetrically distri It was first described in buted. (1995). Cell;81(4):611-20).

[0195] d. Method for preparing surface-modified viral capsids Another aspect of this disclosure relates to a method for producing surface-modified recombinant viral capsids. In certain embodiments, the provided capsid contains nucleic acids from eukaryotes, typically mammals, particularly hyphens. It is intended for use in transduction into cells. In some embodiments, surface modification The viral capsid is a recombinant adenovirus virion. In some embodiments, the surface The modified virus capsid is recombinant AAV virion.

[0196] This method involves transferring a ligand to a viral capsid protein via a linker containing a cross-linking portion Q. The process includes a step of crosslinking, that is, a step of covalently conjugating. Preferably The ligand introduces a surface target binding site of at least one mammalian cell into the capsid. And optionally, the natural cell surface target binding sites in the capsid are removed, for example, It will be removed.

[0197] In one embodiment, the method for producing the surface-modified viral capsid described herein is as follows: This includes the following steps: (i) the viral capsid protein and the first member of the crosslinking agent reactive pair and The process involves reacting a capsid-reactive linker, optionally containing one or more spacers. Therefore, the process of obtaining a surface-functionalized viral capsid; (ii) the surface-functionalized viral capsid and the second member of the crosslinking agent reactive pair and conjugate with a functionalized ligand that optionally includes one or more spacers. A process in which the first and second members of the crosslinking agent reactive pair react to form a crosslinked portion Q. To accomplish, process; and (iii) A step to obtain a surface-modified viral capsid.

[0198] As described above, the aforementioned natural mammalian cell surface target binding site in the capsid exists The capsid is present, not removed, and contains at least one ligand relating to this disclosure. If surface-modified in the manner described herein, the surface-modified viral capsid provided is as described herein. Compared to capsids that have not been surface-modified, a higher infectivity rate (i.e., modified Improved trait introduction (having similar efficiency with greater efficiency or lower potency). Alternative form In this case, the aforementioned natural mammalian cell target binding site in the capsid contains the ligand. If removed before surface modification of the capsid (for example, genetic modification of a known heparin-binding site) (Modified), the surface-modified capsids provided are not surface-modified as described herein. Compared to the capsid, (i) modified directivity and (ii) improved trait introduction. It has multiple instances.

[0199] The adeno-associated virus (AAV) particles produced by the above method are preferably AAV1, A AV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, hu68, rh.10 , and mixtures thereof are selected.

[0200] The proteins of adeno-associated virus (AAV) particles to be produced by the above method The difference can be modified. Preferably, the proteins VP1, VP2 in the capsid or At least one of VP3 is modified in the above method. Alternatively, the capsid contains Two of the proteins VP1, VP2, and / or VP3 are modified, or the protein in the capsid is modified. All three proteins VP1, VP2, and VP3 are modified. Preferably, the modification in the capsid is At least one part of the protein that is to be altered, for example, at One amino acid is modified. However, the proteins VP1 and VP2 in the capsid and multiple parts of VP3, for example, multiple amino acids, for example, 2, 3, 4, 5, 6, 7, 8, 9, 10 Alternatively, any number of other parts or amino acids may be modified. Preferably, VP Arginine 484, 487, 585 and 588 and Lysine 532 and / or similar compounds in VP2 or VP3 By substituting at least one of the similar arginine molecules with a different amino acid such as alanine, These are then removed.

[0201] Capsid protein derived from natural AAV serotypes (which can be further genetically modified if desired) For example, VP1, VP2, or VP3 are chemically modified with specific amino acids. Such modifications Examples of this are well known in the art and are incorporated herein by reference, for example. R. Lundblad,Chemical Reagents for Protein Modification, 3rd ed. CRC Press, 2005 It is summarized here. Chemical modification of amino acids can be limited to acylation, amidine (am Lysine modification by idination, pyridoxylation, and reductive alkylation. The amino group of trinitrobenzyl compound is formed by 2,4,6-trinitrobenzenesulfonic acid (TNBS). Chemical modification, amide modification of carboxyl groups, and performic oxidation of cysteine ​​to cysteic acid Modification of sulfhydryl, formation of mercury derivatives, and mixing with other thiol compounds. Formation of synthetic disulfides, reaction with maleimide, and with iodoacetic acid or iodoacetamide This includes carboxymethylation and carbamoylation by cyanate at an alkaline pH. However, it is not limited to these. In this regard, those skilled in the art will know how to chemically modify proteins. For a broader range of methodologies, see Current Protocols in Protein Science, Eds. Coligan et al. (John Wiley & Sons NY 1995–2000, the entire content of which is expressly incorporated herein) Please refer to Chapter 15 of (reru).

[0202] In some aspects of the above method for producing improved adeno-associated virus (AAV) Capsid modification involves removing the natural binding site and modifying the ligand binding site, for example, by changing the capsid to a different location. Both methods involve introducing the capsid surface through functionalization with the capsid surface reactive moiety. Includes. In certain other embodiments, the native binding site of the AAV capsid remains unchanged, i.e., removed. Not performed, and at least one ligand-binding site or ligand is introduced in accordance with this disclosure. .

[0203] In some embodiments, the natural binding site is an improved adeno-associated virus (AAV) particle. The natural binding site here is removed by the above method for production, and heparan sulfate pro Enables binding to theoglycans. In certain cases of these embodiments, the natural binding site This refers to arginine 585 and 588 in VP1 and / or similar arginine in VP2 or VP3. It is removed by substituting at least one of the amino acids with a different amino acid such as alanine. .

[0204] In some embodiments, the ligand-binding site introduced in accordance with this disclosure is a ligand This enables covalent adhesion. In certain cases of these embodiments, The bond site is more preferably the capsid is benzylguanine N-hydroxysuccinate Mido (BG-NHS) and / or benzylcytosine N-hydroxysuccinimide (BC-NHS) By reacting with it, select from the benzylguanine groups attached to the available lysine residues. It will be selected.

[0205] The present invention preferably provides a tag that can bind to their specific ligands with high affinity, for example For example, SNAP tags, CLIP tags, Halo-Tag, Lumio-Tag, etc., are used. These are implemented using the method described above. Such tag molecules are any molecule or biomolecule that can specifically bind to further molecules. Obtain. Examples may include SNAP tags, CLIP tags, Lumio-Tag, or Halo-Tag. For example, parent The Japanese tag is the SNAP tag, a variant of alkylguanine-DNA alkyltransferase. This is possible. Importantly, one of the substrates for the SNAP tag is benzylguanine. Useful commercially available products include, for example, the HaloTag from Promega and the Lumio Tag from Life Technologies. , and includes SNAP / CLIP tags from NEB. The ligand-binding sites introduced are preferred Alternatively, it may be attached to the epsilon-amino group or primary amine of the available lysine residues mentioned above. do.

[0206] Therefore, the above method for producing improved adeno-associated virus (AAV) particles The ligand is the benzylguanine and / or the benzylcytosine group, in particular The process of attaching to HaloTag (trademark), SNAP tag (trademark), or CLIP tag (trademark) is further... A method that includes this is even more preferable.

[0207] The ligand to be attached can be any type of ligand, but preferably These include protein ligands such as growth factors or cytokines; and the cholera toxin B subunit. Toxin subunits such as; lectins such as isolectin B4 or wheat germ agglutinin; lact Adhesion factors such as adherins; antibodies such as anti-CD-34 antibodies; deltorphin opioid receptors Selected from peptides such as ligands, and gene editing nucleases such as Cas9.

[0208] e. Formulation Yet another aspect of the present invention is the above-mentioned surface modification for use in the treatment of diseases With respect to ruscapsid, the AAV is available in liquid, dry, or semi-solid form, for example, tablets. Coated tablets, effervescent tablets, capsules, powders, granules, sugar-coated tablets, lozenges, pills, and Samples, intravenous drugs, suppositories, emulsions, ointments, gels, tinctures, pastes, creams, moisturizing agents Moisture compresses, mouthwash, plant juices, nasal sprays, and compounded inhalers. Available in the form of aerosols, mouthwashes, oral sprays, nasal sprays, or room sprays. It is administered in a state such as [unspecified].

[0209] In a particular embodiment, a pharmaceutical composition comprising recombinant virion is provided, and recombinant virion This refers to a surface-modified viral cargo, such as the one provided herein, which contains recombinant nucleic acid cargo. The pusid is included in the pharmaceutical composition, which is a pharmaceutically acceptable carrier, diluent, solubilizer, filler, Further comprising preservatives and / or excipients; such pharmaceutically acceptable carriers, diluents. Solubilizers, fillers, preservatives and / or excipients are used, for example, in Remington: The Science ce and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & This can be confirmed in Wilkins, 2000.

[0210] A further aspect of the present invention is to then modify the surface-modified viral capsid according to the present invention to at least It can also be used with another pharmaceutically acceptable carrier and / or diluent, i.e., pharmaceutically acceptable Additives, carriers, diluents, solvents, filters, lubricants, excipients, binders or stabilizers This relates to a pharmaceutical composition containing a combination of agents. Preferably, the composition contains the target This includes sprays, coatings, foams, lotions, gels, mouthwashes, and oral preparations. It is administered in the form of a compound or injection. The composition is administered to the subject systemically, orally, It may be administered by any other clinically / medically recognized method.

[0211] Further aspects of the present invention are, a) as disclosed and / or in accordance with this disclosure. Surface-modified viral capsids for use, or surfaces such as those disclosed pursuant to this disclosure. a) a pharmaceutical composition comprising a modified viral capsid, b) the surface-modified viral capsid or the A written instruction for applying the pharmaceutical composition to the target site (target said); and Optionally, a container and writing to hold the surface-modified viral capsid or composition for use. Regarding the kit, including the instruction manual.

[0212] Another aspect of the present invention is the prevention, treatment, and prevention of viral infections in subjects requiring treatment. / or regarding the use of the aforementioned kits for suppression.

[0213] f. Methods of treating diseases This disclosure also relates to the development and / or development of diseases, including single-gene or polygenetic genetic disorders. or a method for treating a subject at risk of progression, provided by this disclosure This also includes methods for administering a therapeutically effective amount of such AAV particles to a patient. In connection with this, treatment "Effective" means that the AAV particles are sufficient to treat diseases such as genetic disorders by resolving their symptoms. This refers to the amount of [something]. "Therapeutically effective" means preventing the onset of symptoms of diseases such as genetic disorders. It may be a sufficient amount. The risk of disease is, for example, genetic predisposition to the disease and / or This can result from phenotypic symptoms. In some cases, patients at risk of genetic disorders may have residual symptoms. They have been determined to possess or be deficient in genes associated with infectious diseases.

[0214] A further aspect of this disclosure is the treatment of diseases that can be treated by gene therapy. A method for administering the surface-modified viral capsid relating to this disclosure to a subject requiring such administration. The present invention relates to a method that includes the process of [doing something].

[0215] The cells and / or subjects to be treated with the surface-modified viral capsid of the present invention are preferred More specifically, it is of mammalian origin, for example, of human origin. Nevertheless, the present invention is about cells Depending on the similarity of the entry mechanism, veterinary medicine, cell culture procedures, or even plant cell diseases may be involved. It can also be used advantageously in some cases. Cells are mammalian cells, prokaryotic cells, or plant cells. In certain aspects, treatment is The aforementioned cells are human cells.

[0216] Another aspect of the present invention involves applying the surface-modified virus according to the disclosure to a target that requires it. A method for treating the above-mentioned disease, comprising the step of administering a psid, wherein the surface modification The mutated virus capsid is applied to the target in liquid, dry, or semi-solid form, for example, tablets, coated Tablets, effervescent tablets, capsules, powders, granules, sugar-coated tablets, lozenges, pills, ampoules, Intravenous drugs, suppositories, emulsions, ointments, gels, tinctures, pastes, creams, moist compresses, Mouthwash, plant juice, nasal drops, compound inhalants, aerosols, mouthwash, oral sprays, nose This relates to a method of administration, such as in the form of a spray or room spray.

[0217] The above method for treating a disease, comprising the step of administering a surface-modified viral capsid to a subject. A disease that is to be treated by... Diseases, such as hereditary retinal diseases, hereditary skin diseases, such as Olmsted syndrome, or family Primary cutaneous amyloidosis, infections, adrenoleukodystrophy, alpha-1 Intitrypsin deficiency, aromatic L-amino acid deficiency, Batten disease, Becker muscular dystrophy Fee, beta-thalassemia, Canavan disease, chronic granulomatous disease, Crigler-Nadjar syndrome, Cystic fibrosis, Duchenne muscular dystrophy, Fabry disease, familial adenomatous polyposis, home Familial hypercholesterolemia, familial lecithin cholesterol acyltransferase Hemophilia, Fanconi anemia, galactosialidosis, Gaucher disease, cerebral gynecomastia, hemophilia Disease A, Hemophilia B, Harler syndrome (Mucopolysaccharidosis type I), Hunter syndrome (Mucopolysaccharidosis type II) Huntington's disease, junctional epidermolysis bullosa, late-onset childhood neuronal ceroid lipofuscinosis Leukocyte adhesion deficiency, limb-girdle muscular dystrophy, lipoprotein lipase deficiency, metachromatic Leukodystrophy, Sly syndrome (mucopolysaccharidosis type VII), Netherton syndrome, ornithomycosis Transcarbamylase deficiency, Pompe disease, purine nucleoside phosphorylase deficiency Recessive dystrophic epidermolysis bullosa, Sanfilipo A (mucopolysaccharidosis type IIIA), Sanfilipo B (mu Polysaccharidosis type IIIB, sickle cell disease, severe combined immunodeficiency, spinal muscular atrophy, Taysax Diseases, Wiscott-Aldrich syndrome, Von Gierke disease (glycogen storage disorder type Ia) ), X●-linked myotubular myopathy, anemia in end-stage renal failure, angina pectoris (stable, unstable, Refractory coronary artery stenosis, severe lower limb ischemia, heart failure, intermittent claudication, myocardial ischemia, peripheral vascular disease Patients, pulmonary hypertension, venous ulcers, adenovirus infection, cytomegalovirus infection, EPS Tyne-Barr virus infection, Hepatitis B infection, Hepatitis C infection, HIV / AIDS, influenza, Japanese encephalitis, malaria, pediatric respiratory diseases, respiratory syncytial virus, tetanus, tuberculosis, gynecology Breast cancer, ovarian cancer, cervical cancer, vulvar cancer, nervous system cancer, glioblastoma, meningeal carcinomatosis, Glioma, astrocytoma, neuroblastoma, retinoblastoma, gastrointestinal cancer, colon, colorectal cancer, hepatic metastasis Transplantation, post-hepatitis ● Liver cancer, pancreas, gallbladder, hepatocellular carcinoma, urinary tract cancer, prostate, kidney, bladder Anal and genital neoplasms, skin cancer, melanoma (malignant / metastatic), head and neck cancer, nasopharyngeal cancer, tonsils Squamous cell carcinoma, esophageal cancer, lung cancer, adenocarcinoma, small cell / non-small cell cancer, mesothelioma, hematological cancer, leukemia Diseases, lymphoma, multiple myeloma, sarcoma, germ cell carcinoma, Lie-Fraumeni syndrome, thyroid cancer Alzheimer's disease, amyotrophic lateral sclerosis, carpal tunnel syndrome, chronic traumatic brain injury, cubital tunnel syndrome Symptoms, diabetic neuropathy, epilepsy, giant axonal neuropathy, late-onset childhood neuropathy Transceroid lipofuscinosis, multiple sclerosis, myasthenia gravis, pain, Parkinson's disease, peripheral Sexual neuropathy, spinal muscular atrophy type 2, color blindness, age-related macular degeneration, total choroidal atrophy, glucose Uropathic macular edema, glaucoma, Leber congenital amanniopsia, macular telangiectasia type 2, retinal pigment Degenerative diseases, superficial corneal opacity, X-linked retinal schizophrenia, arthritis (rheumatic, inflammatory, degenerative) Osteoarthritis, severe inflammatory bowel disease, ulcerative colitis, chronic kidney disease, diabetic ulcers, foot disease Sexual ulcers, detrusor overactivity, erectile dysfunction, fractures, hearing loss, hereditary inclusion body myopathy, graft pairs Host disease / transplant patients, oral mucositis, parotid gland dysfunction, systemic sclerosis, type 1 diabetes, and wound Wound healing, or a combination thereof, will be selected.

[0218] Furthermore, a process of administering the surface-modified viral capsid according to this disclosure to a subject that requires it. A method for treating a disease, comprising the surface-modified viral capsid, wherein the surface-modified viral capsid is the same as the In the form of a pharmaceutical composition, for example, a pharmaceutically acceptable additive, carrier, or dilute, to an elephant or cell. Administered in combination with a solvent, filter, lubricant, excipient, binder, or stabilizer. A method is also provided. In a particular embodiment, the composition is sprayed onto the subject. Coating agents, foams, lotions, gels, mouthwashes, oral preparations or injections The composition is administered to the subject systemically, orally, or in any other manner. It can be administered by methods that are clinically / medically recognized.

[0219] Another aspect of the present invention is in cell transfection, for example in research. For use as a gene delivery tool, the surface-modified viral capsid relating to this disclosure The above use may also be for cosmetic purposes, and the present invention is described herein. This disclosure includes methods for medical treatments and similar cosmetic treatments as disclosed. Administering surface-modified viral capsids related to this to a target or cells is also a cosmetic composition. In the form of, for example, cosmetically safe and acceptable additives, carriers, diluents, solvents, and filters. This can be achieved in combination with lubricants, excipients, binders, or stabilizers. In a particular embodiment, the composition is provided to the target as a spray agent, a coating agent, a foam agent, The composition is administered in the form of a lotion, gel, mouthwash, oral preparation, or injection. This applies to the aforementioned subjects systemically, orally, or to any other clinically / cosmetically recognized substance. It can be administered by a specific method.

[0220] A person skilled in the art can use the methods described in WO93 / 09239, US4797368, US 5139941 and EP 488 528. Which methods are used to transfer AAV-derived vectors into genes in vitro and in vivo? I understand.

[0221] An additional aspect of the present invention is a) surface-modified viral carcinoma for cell transfection. a) Surface-modified viral capsids for use in cell transfection Written instructions; and optionally, a container and document for holding the surface-modified viral capsid. Regarding the kit, including the instruction manual.

[0222] a. Indications Another aspect of the present invention is the surface modification virus according to the present invention for use in the treatment of diseases. Recombinant virions containing scapsids, and surface-modified capsids as described herein This relates to a method of treating a disease by administering an effective dose of recombinant virion containing a certain In certain embodiments, the compositions provided herein are used in treatments including gene therapy. This invention is for the purpose of [doing something]. Furthermore, the present invention relates to surface modification for the preparation of pharmaceuticals for gene therapy. The invention provides the use of a mutated virus capsid composition. Furthermore, the invention provides therapies including gene therapy. The present invention also provides a method that includes the administration of a surface-modified viral capsid composition.

[0223] Treatment or prevention can be achieved by a surface-modified viral capsid for use in accordance with the present invention. The types of diseases are not particularly limited. The diseases that are to be treated or prevented by the psid are diseases that can be treated by gene therapy. For example, cancer, hereditary single-gene disorders, for example, hereditary retinal diseases, hereditary skin diseases, for example Olmsted syndrome or familial primary focal cutaneous amyloidosis, infections, loss of motor function Adrenoleukodystrophy, alpha-1 antitrypsin deficiency, aromatic L-amino acids Deficiency, Batten disease, Becker muscular dystrophy, beta-thalassemia, Canavan disease, chronic Granulomatous muscular dystrophy, Crigler-Nadjar syndrome, cystic fibrosis, Duchenne muscular dystrophy Fabry disease, familial adenomatous polyposis, familial hypercholesterolemia, familial lecithin ● Cholesterol acyltransferase deficiency, Fanconi anemia, galactosialides -sis, Gaucher disease, cerebral gynecomastia, hemophilia A and B, Harler syndrome (mucopolysaccharidosis I (Type), Hunter syndrome (mucopolysaccharidosis type II), Huntington's chorea, junctional epidermolysis bullosa, Late-onset childhood neuronal ceroid lipofuscinosis, leukocyte adhesion disorder, limb-girdle muscular dystrophy Lipoprotein lipase deficiency, metachromatic leukodystrophy, Sly syndrome (mucopolysaccharide Netherton syndrome (type VII), ornithine transcarbamylase deficiency, Pompe disease, Purine nucleoside phosphorylase deficiency, recessive dystrophic epidermolysis bullosa, Sanfilipo A (Mucopolysaccharidosis type IIIA), Sanfilipo B (Mucopolysaccharidosis type IIIB), Sickle cell disease, Severe composite Immunodeficiency, spinal muscular atrophy, Taysachs disease, Wiscott-Aldrich syndrome, Ongyrke's disease (glycogen storage disorder type Ia), X●-linked myotubular myopathy, terminal Anemia in advanced renal failure, angina pectoris (stable, unstable, refractory), coronary artery stenosis, severe lower limb ischemia, heart Failure, intermittent claudication, myocardial ischemia, peripheral vascular disease, pulmonary hypertension, venous ulcers, adenovirus Infection, cytomegalovirus infection, Epstein-Barr virus infection, hepatitis B infection, C Hepatitis type infection, HIV / AIDS, influenza, Japanese encephalitis, malaria, pediatric respiratory diseases, respiratory system Syncytial virus, tetanus, tuberculosis, gynecological cancer, breast, ovary, cervix, vulva, nervous system Cancer, glioblastoma, meningeal carcinomatosis, glioma, astrocytoma, neuroblastoma, retinoblastoma, digestion Urinary tract cancer, colon, colorectal cancer, liver metastasis, post-hepatitis, liver cancer, pancreatic cancer, gallbladder cancer, hepatocellular carcinoma, urinary tract cancer Systemic cancers, prostate, kidney, bladder, anal, genital neoplasms, skin cancer, melanoma (malignant / metastatic) Head and neck cancer, nasopharyngeal cancer, squamous cell carcinoma, esophageal cancer, lung cancer, adenocarcinoma, small cell / non-small cell carcinoma Cellular cancer, mesothelioma, hematological cancer, leukemia, lymphoma, multiple myeloma, sarcoma, germ cell carcinoma, Lee's disease. Fraumeni syndrome, thyroid cancer, Alzheimer's disease, amyotrophic lateral sclerosis, carpal tunnel syndrome Chronic traumatic brain injury, cubital tunnel syndrome, diabetic neuropathy, epilepsy, giant axonal neuropathy Neuropathy, late-onset childhood neuronal ceroid lipofuscinosis, multiple sclerosis, myasthenia gravis Pain, Parkinson's disease, peripheral neuropathy, spinal muscular atrophy type 2, color blindness, aging ● Macular degeneration, total choroidal atrophy, diabetic macular edema, glaucoma, Leber congenital amaurosis, macula Telangiectasia type 2, retinitis pigmentosa, superficial corneal opacity, X-linked retinal schizophrenia, arthritis ( (Eumatic, inflammatory, degenerative), osteoarthritis, severe inflammatory bowel disease, ulcerative colitis, chronic Kidney disease, diabetic ulcers / podiatric ulcers, detrusor overactivity, erectile dysfunction, fractures, hearing loss, hereditary Inclusion body myopathy, graft-versus-host disease / transplant patients, oral mucositis, parotid gland dysfunction, systemic stagnation This includes skin conditions, type 1 diabetes, and / or wound healing.

[0224] In certain aspects, the ataxia to be treated in accordance with this disclosure is related to the cerebellum or spine. Ataxia associated with hereditary disorders resulting in degeneration, including cerebellar and sensory ataxia, and further... In some cases, they may overlap. A genetic disorder that causes ataxia is spinocerebellar ataxia. Autosomal dominant conditions such as paroxysmal ataxia, dentateburubral-pallidoluysian atrophy, and other autosomal dominant conditions. Furthermore, Friedreich's ataxia (sensory and cerebellar, formerly predominant) and Niemann-Pick disease, telangiectatic ataxia (sensory and cerebellar, later predominant) , and autosomal recessive disorders such as abetalipoproteinemia. X-linked ataxia One example of this condition is the rare fragility X-related tremor / ataxia syndrome or FXTAS.

[0225] In certain aspects, the indications for treatment include lipoprotein lipase deficiency, B-cell lymphoma, beta-thalassemia, mantle cell lymphoma, vascular endothelial growth factor Peripheral artery disease, head and neck squamous cell carcinoma, spinal muscular atrophy, adenosine deaminase deficiency (AD) A-SCID), melanoma, B-cell lymphoblastic leukemia, or leukemia in patients with recurrent skin lesions. He has congenital amaurosis.

[0226] In certain aspects, the indication for treatment is Charcot-Marie-Tooth disease. All types), galactosidosis (all types), diathesis (i.e., Dravet's epilepsy), Tuberous sclerosis, spinal cord injury, all demyelinating hereditary motor-sensory neuropathy (HMSN), Krabbe disease, fibrodysplasia ossificans progressive, neurofibromatosis 1 and 2, essential tremor, fragility X Syndrome, Lesch-Nyhan syndrome, myotonic dystrophy, multiple system atrophy (MSA), Elweger syndrome, neuromyelitis optica, or Devic's disease, central pontine myelin disintegration, tabes dorsalis (sprouts) Myelopathy (such as toxic myelopathy), progressive multifocal leukoencephalopathy, leukodystrophy, etc. Any leukoencephalopathy, as well as Guillain-Barré syndrome and its chronic counterpart, chronic inflammation This includes symptomatic demyelinating polyneuropathy.

[0227] In certain aspects, the indications for treatment are anti-MAG peripheral neuropathy, and Copper deficiency-related conditions (peripheral neuropathy, myelopathy, and rarely optic neuropathy), It is a progressive inflammatory neuropathy.

[0228] b. Mode of administration Another aspect of the present invention is the surface modification virus according to the present invention for use in the treatment of diseases. Regarding the mode of administration of scapsid.

[0229] In some embodiments, the surface-modified viral capsid according to the present invention is used in the art. It can be administered directly or indirectly by known and suitable means. Method and use of the present invention The surface-modified viral capsid composition according to the present invention is applied systemically, regionally, or locally. By means of injection, infusion, or oral administration (e.g., ingestion or inhalation), or by any route, for example, by injection, infusion, or oral administration. This includes delivery and administration by means of a device or topically (e.g., transdermally). The typical routes of administration and delivery are intravenous (IV), intra-articular, intraperitoneal (IP), intra-arterial, and intramuscular. Internally, parenterally, subcutaneously, intrathoracically, locally, skin, intradermally, percutaneously, parenterally, for example, permucosa, head Intracavitary, intraspinal, oral (digestive), mucous membrane, respiratory, nasal cavity, intubation, intrapulmonary, intrapulmonary infusion, oral cavity, sublingual Intravascular, intrathecal, intrabody cavity, iontophoresis, intraocular, eye drop, optical, intraglandular, intraorgan, lymphatic vessel Including the internal, intramedullary, and intracisional magna. The individual or the cells of the said individual. Improvement of means for providing the surface-modified viral capsid composition according to the present invention to tissues and organs. This is expected considering the progress already made. Such future improvements Naturally, this can be incorporated to achieve the effects mentioned in the present invention. In the process of administering the surface-modified viral capsid according to the present invention, the capsid composition The substance is dissolved in a solution compatible with the delivery method. In certain embodiments, intravenously, subcutaneously. For formulations intended for intramuscular, intrathecal, intra-articular, and / or intraventricular administration, the capsid composition It is formulated as physiological saline. [Examples]

[0230] g. Examples Summary of experimental observations Recombinant adeno-associated virus (rAAV) is optimal for both basic research and clinical applications. It emerged as a vivo gene delivery vector. Recombinant AAV vectors deliver to specific locations on the host genome. These vectors do not undergo heterologous integration, and therefore, combined with moderate immunogenicity, It has become one of the safest strategies for gene therapy (Naso MF, Tomkowicz B, Perry WL, 3rd,Strohl WR. Adeno-Associated Virus (AAV) as a Vector for Gene Therapy. BioDrugs 2017;31:317-34). Clearly superior to other viral vectors for in vivo use. Despite its advantages, AAV still has some limitations. For example, These are not effective for transduction into some cell types; as a result, efficient inheritance Sub-transfer often requires high titer. This, in turn, leads to the transduction of inappropriate cell types. This leads to off-target effects, significantly increases production costs, and contributes to toxicity.

[0231] Efforts to improve AAV-mediated gene delivery initially involved separate fingers for different cell types. The focus was on utilizing the wild-type serotype that exhibited tropism. By generating pseudotype AAV containing the entered gene and capsids derived from other wild-type serotypes, This allows for the modification of the trait specificity of recombinant vectors. Furthermore, recently, directing Synthetic AAV capsids containing capsid proteins derived from sex evolution or rational design. The vehicle is being manipulated ((Colella P, Ronzitti G, Mingozzi F. Emerging Issues in AAV-M Edited In vivoGene Therapy. Mol Ther Methods Clin Dev 2018;8:87-104). This The approach involves modified AAV-PHP.eB and AAV-PHP to transduce the central and peripheral nervous systems. As exemplified by the development of S-capsids ((ChanKY, Jang MJ, Yoo BB, Greenbaum A, Ravi N, Wu WL, etal. Engineered AAVs for efficient noninvasive gene delivery to the central andperipheral nervous systems. Nat Neurosci 2017;20:1172-9). These The variant is administered systemically to mice to target the entire brain or peripheral ganglia. It can be injected. However, despite the success of such an approach, AAVs in which the primary amino acid sequences of psidoproteins VP1, VP2, and / or VP3 are manipulated. Vectors still have several drawbacks, such as the high titer required for systemic transduction. Furthermore, there are questions regarding its translational potential beyond the rodent model.

[0232] One aspect of our solution to these problems is the use of a viral capsid (recombinant AAV). (As part of the virion), along with its capsid-encapsulated cargo, to the optimal cell. This provides a protein chemistry-based method that facilitates the delivery of pre-packaged protein. This was the case. In this disclosure, the inventors describe how to improve directivity and / or trait introduction effect. To enhance the rate, provide ligand crosslinking to the AAV capsid via bioorthogonal chemistry. In certain embodiments, the ligand for a surface-modified viral capsid is on the surface of mammalian cells. It binds to its homologous receptor and selectively facilitates gene delivery to cell types that exhibit the appropriate homologous receptor. This enables targeted delivery of viral genes.

[0233] In certain cases of the experiments described later, the inventors found that heparan sulfate proteate in the capsid Through mutations in the oglycan-binding motif, non-infectious AAV serotype 2 viruses are generated (Kern A, Schmidt K, Leder C, Muller OJ, Wobus CE, Bettinger K, et al. Identification o f aHeparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids. Journal of V Irology 2003;77:11072-81) (R585 / 588A, also known as AAV2-●HSPG), then, assemble The surface-exposed lysine residues on the HSPG-AAV2 capsid are crosslinked by members of the crosslinking agent-reactive pair. For example, a reactive linker containing benzylguanine (BG) and cyclooctin (DBCO) Chemically modified. Subsequently, the inventors developed a SNAP tag fusion or an azido functionalized official By cross-linking activating ligands to the virus, viral infectivity can be restored in a receptor-dependent manner. Done.

[0234] The inventors first identified proteins such as neurotrophins and cytokines (IL31). The system was tested using a crystalline ligand, but it was found that the receptors for these molecules in the skin... This is because it is expressed in a subset of cells in the peripheral nervous system. The inventors used protein ligands such as single-chain antibodies (scFv) against the same receptor. We compared them to understand whether they improve ligand targeting. Furthermore, it possesses the same function as the ligand (for example, retrograde transport in the case of CTB, or In the case of lectins, the purpose is to encode improved binding to cell surface glycans in AAV. We also explored ligands from other classes, such as Lera toxin B (CTB) and various lectins.

[0235] In parallel, the inventors also developed BG-SNAP tag consumption and longer space In addition to the effect of incorporating Sir into the linker, other bioorthogonal chemistry was also evaluated. The inventors of this invention, Strain-promoting azide-alkyn crystal between dibenzocyclooctin (DBCO) and azide groups We found that the chemistry (SPAAC) reaction surprisingly improves efficiency even further. This means that commercially available peptides and proteins can be used without the need to generate SNAP fusion proteins. This enables easy consumption of AAV to crystalline ligands.

[0236] In summary, the inventors' data shows that their chemical modification approach is effective in sequence modification. It has been shown to have numerous advantages over AAV capsids. Despite thorough research efforts... However, several human tissue-specific variants of modified capsids have not yet been defined. Unlike the previous approach, our approach involves a vast number of known human drivers to drive the directivity. It utilizes cell receptor-ligand interactions. Tissue targeting must be determined empirically. Unlike non-modified capsids, the inventors have removed the native cell-binding site of the AAV capsid. When removed, our approach is driven by the receptor specificity of the attached ligand. This provides high specificity for cell targeting, and for natural capsid cells. Ligands that enhance transduction were attached without removing or altering the binding site. Sometimes, greater transduction efficiency can be achieved without significantly altering known directivity. .

[0237] In addition, our approach does not affect the virus yield, It is compatible with AAV production platforms. The method provided herein is also inexpensive. It can be implemented and scalable from small-scale research use to clinical-scale production. Finally, AAV caps The platform provided for modifying the surface of the SID is modular, and Therefore, basically any virus / ligand combination is possible, and this means This should facilitate the transition from dental models to human patients.

[0238] Table 1 below shows some ligand-type AAV experiments, which are further detailed in Examples 1-8 below. Stop.

[0239] (Table 1) TIFF2026136377000049.tif247108

[0240] In subsequent experiments, the inventors found that adding SNAP tag fusion was necessary to functionalize the ligand. Other crosslinking agent reactive pairs that were not required were used.

[0241] Example 1. Removal of the natural binding site in AAV2 One of the aims of the inventors' early experiments was to study adeno-associated viruses (AAVs) in detail. By manipulating adeno-associated virus (AAV) capsids to selectively induce transduction into cells Yes, it was. This is due to mutations such as those described herein, which can cause natural AAVs. This was achieved by removing the innate binding site to cells in psidoproteins. Next, the capsid is chemically functionalized to conjugate with the functionalizing ligand. Next, a bioorthogonal functionalized ligand was covalently bound to the virus, and then to the cell. In contrast, the tests were conducted in vitro and in vivo in mice using AAV2, AAV9, and PHP. While we explored S, these examples can be easily applied to other viral capsids as well.

[0242] AAV2 binds to heparan sulfate proteoglycans via arginine 585 and 588. By mutating these positions with alanine, a deletion with mutations in the CAP gene R585A+R588A is created: ●HSPG They created it.

[0243] Plasmid pTAV2-0 contains bilaterally inverted sequences and clonin at the BamHI site of pBluescriptII. It contains the entire AAV-2 genome derived from pAV-2. Sub-containers containing appropriate fragments of AAV-2. Plasmids were created and used as templates for site-directed mutagenesis. Stratagene (Amsterdam, Netherlands) manufactures the QuikChange site-directed mutagenesis kit. Mutagenesis was performed by following the manufacturer's protocol. There are two complementary PCR primers, adjacent to 15-20 homologous base pairs on each side of the mutation. The mutant plasmid was designed to contain the substitution sequence. Next, the fragment containing the appropriate mutation was placed in the plasma containing the remaining protein. Subcloning is performed on the skeleton (e.g., pTAV2-0), and then the complete fragment is sequenced and added. We checked for PCR mutations.

[0244] The CAP gene has mutations within R585A+R588A (KernA, Schmidt K, et al. Identification o f aHeparin-Binding Motif on Adeno-Associated Virus Type 2 Capsids. Journal of v (irology2003;77:11072-81) and transport tdTomato as cargo under the CAG promoter. Recombinant AAV2-●HSPG is used in HEK293 cells or SF21 insect cells as previously described. Produced in either location (Grieger JC, et al. Production and characterization of ad eno-associated viral vectors. Nat Protoc 2006;1:1412-28; Wu Y, et al. A Recombin ant BaculovirusEfficiently Generates Recombinant Adeno-Associated Virus Vectors inCultured Insect Cells and Larvae. Mol Ther Methods Clin Dev 2018;10:38-47) Cells were collected 5 days after infection, lysed with 0.5% TritonX-100, treated with nuclease, and then... Concentrated by kinetic flow filtration and purified using isodensity ultracentrifugation. (DiasFlorencio G, et al.. Simple downstream process based on detergent treat ment improves yield and in vivo transduction efficacy of adeno-associated virus vectors. MolTher Methods Clin Dev 2015;2:15024). Vector genome titer measurement, We used Q-PCR with primers that target the promoter region of Iluscargo. This was implemented (Grieger 2006).

[0245] Example 2. BG-NHS functionalization of HSPG for receiving SNAP-tagged ligands Selective attachment of ligands to proteins, such as protein labeling, is often directly performed by living organisms. This is achieved by the incorporation of the intermodulation group into the protein, followed by chemoselective modification. Roach is also called "tag and modify." Various bioorthogonal reactions have been developed. This is done by (1) a carbonyl-mediated condensation reaction and (2) an azide-mediated "click" reaction. "Reactions, (3) Reverse electron-requiring Diels-Alder cycloaddition (DAINV) and other cycloadditions (4) Transition metal catalyzed coupling and decaching reactions, and (5) as discussed above These can be classified into labeling reactions involving cysteine ​​residues.

[0246] In the inventors' first experimental set, the virus was treated with benzylguanine NHS ester (S By reacting it with a NAP-tagged substrate (also called BG-●NHS or BG-GLA-NHS), Lysine (BG) was attached to exposed lysine. For this purpose, a needle was used to remove it in a non-aqueous solution. Add DMSO to the vial containing the dried SNAP-tagged ligand BG-NHS at room temperature to the desired final concentration ( For example, the concentration was 20 mM. The protein to be amine-functionalized was then diluted with the solvent (PBS) to the desired final concentration. Diluted to 1 degree. Mix the two preparations and incubate at room temperature for 180 minutes, then Unreacted components were removed using a centrifugal 100 kDa MWCO filter unit. BG-GLA-NHS: TIFF2026136377000050.tif21128

[0247] Example 3. Recombinant ligand having a C-terminal SNAP tag To use this system, there are two steps: register the protein of interest with a SNAP tag. (Trademark) Process of cloning and expressing as a fusion, and optimal SNAP-tag of the fusion There is a step of labeling with a substrate. SNAP-tag is a DNA repair protein, human O6 alkyl This is a small protein based on anine-DNA alkyltransferase (hAGT). The SNAP-tag substrate is a guanine leaving group linked to a benzyl linker. Labeling reaction In this configuration, the substituted benzyl group of the substrate is covalently bonded to the SNAP-tag.

[0248] The SNAP-tag protein labeling system can label virtually any molecule as the protein of interest. This enables specific covalent bonding (see Example 4 below for details of this experiment). thing).

[0249] Recombinant ligands with a C-terminal SNAP tag are introduced into Escherichia coli (E. coli) or mammalian cells. It was produced. Next, for covalent bonding, a saturated concentration of SNAP-tagged ligand was added, and then the chamber By incubating overnight at warm temperature, SNAP-tagged ligands can be converted into BG-modified viruses. The reaction mixture was then passed through a centrifugal 100 kDaMWCO filter unit (see Figure 1). This removed excess unreacted ligand.

[0250] For the purposes of this invention, the experiment involves cloning a restriction site adjacent to the gene of interest. It contains a mammalian expression plasmid (pSNAPf) encoding the SNAP-tag (registered trademark). Follow the instructions in the SNAP-Cell® Starter Kit (NEB) to make the necessary modifications for this purpose. And so, it was implemented.

[0251] Example 4. Targeting and boosting of transduction - Recombination with C-terminal SNAP tag Ligand-based BG-GLA-NHS modification ● In vitro and in vivo testing of HSPGAAV capsid The aforementioned capsid surface modification strategies will determine whether ligands can also change their directivity. Therefore, multiple classes of ligands, namely proteins such as growth factors and cytokines Ligands; toxin subunits such as cholera toxin B subunit; isolectin B4 or Lectins such as wheat germ agglutinins; adhesion factors such as lactoadherins; anti-CD-34 (stem cells) Antibodies such as markers; and deltorphin opioid receptor ligands. The study was conducted using eel peptides.

[0252] Example 4a. ●HSPG capsid is not infectious, and surface-modified viral capsid improves transduction efficiency. Bring it back First, we tested it on sensory neurons in a fluorescent reporter mouse model. The HSPG virus particles produced according to the present invention have been shown to have no residual infectious activity (Figure 2). ). Wheat germ agglutinin (WGA, lectin; i.e., WGA-SNAP) fusion (BG / SNAP linkerized) Viral capsid surfaces modified with WGA via the same fluorescent reporter mouse model When tested on sensory neurons in the area, the viral transduction efficiency was increased to over 100%. It improved (Figure 3).

[0253] Next, we tested several ligands for the neurotrophic factors NGF, NT3, and BDNF (proteins). The ligand delivered the virus to different specific populations of neurons, that is, they This is a factor used in the capsid construct tested in a fluorescent reporter mouse model. Depending on the type, it gave different orientations (Figures 4a-4c). Cholera toxin B subunit (toxin) is particularly In contrast, the virus was directed retrogradely towards the neuron cell body (i.e., the cell compartment) (ment / partially specific) (Figure 5). In a similar test, lactoadherin (adhesion factor) Specifically, the virus exposes macrophages and neurons that are exposed to phosphatidylserine. It directs the virus towards the mutant and then Deltorphin (peptide) specifically targets the mutant and the mutant. The probes were directed to neurons expressing the lutadelta opioid receptor.

[0254] In the experiment shown in Figures 6a-6b, capsids surface-modified with NGF ligand IV were introduced into the trigeminal nerve. The drug was injected into the junction, then sensory neuronal tissue was collected and analyzed three weeks later. Sections were then formed. The tissue was stained with an antibody against TrkA (NGF receptor), and very good duplication was observed. I found it. TrkA antibody staining is not perfect, and therefore the 80% overlap is extremely significant.

[0255] In the experiment shown in Figure 7, sections from Figures 6a-6c were compared to other neurons (each being a machine). Antibodies against NF200 and IB4 that label receptors and non-peptidergic nociceptors. The cells were stained with these markers. Again, these markers are not perfect, but the green and blue cells were visible. It can be seen that these are different from the red infected cells.

[0256] As a negative control, IL31 ligand-knockout mice were used to knock out the IL31 receptor via the virus. Introducing it internally does not cause infection.

[0257] In summary, all ligand-labeled viruses were introduced into cultured cells in vitro. Both when applied topically and when injected in vivo into mice, the respective rates We successfully and specifically transduced the receptor only into cells expressing the receptor, i.e., systemically or It can be injected locally to selectively target different cell populations.

[0258] Example 4b. Targeting of TrkA+ nociceptors In this embodiment, TrkA+ nociceptors in the peripheral nervous system are surface-modified with a capsid. Targeted by the structure. NGF that binds to TrkA but does not activate it. R121W The ligand, ●HSPG-AAV2 (capsid prepared as described above) containing tdTomato Cargo is crosslinked This construct was injected subcutaneously, intraneuronally, retroorbitally, and intraperitoneally into mice. Three weeks later, TrkA Fluorescence was detected and quantified using antibodies.

[0259] Regarding retroorbital application, it was found that 80% of TrkA+ cells were infected with NGF-AA. 83% of V-infected cells were TrkA+. Furthermore, different routes of administration were highly effective. The results did not differ significantly from those of the other findings.

[0260] Example 4c. Targeting of IL31RA+ itch receptors In this embodiment, IL31RA is bound to IL31RA but does not activate it. K134A Ta We targeted with AAVs that were surface-modified to contain targeting ligands. L31RA was crosslinked to HSPG-AAV2 (a capsid as described above) which has tdTomato cargo. The construct was injected into wild-type mice and IL31RA knockout mice. Three weeks later, the report... By detecting fluorescence from the gene and using a keratin 14 antibody, duplication can be detected. Quantification was performed. Targeted cells were basically completely positive for K14. It was discovered that in IL31RA knockout mice, tomato expression is not detected. That was a good thing.

[0261] Example 4d. Targeting with Isolectin B4 In this embodiment, isolectin B4 (IB4) is used as described above, having a tomato cargo. ●HSPG-AAV2 was conjugated. IB4 is a vascular structure, non-peptide-gated nociceptor This construct can be used as a marker for microglia. It was injected subcutaneously, intraneuronally, or intraspinally. Fluorescence was detected after 3 weeks. Targeting The cells tested were found to be virtually completely positive, regardless of the route of administration.

[0262] Example 4e. Targeting with wheat germ agglutinin In this embodiment, wheat germ agglutinin (WGA) is used as described above in the Tomato Cargo. ●HSPG-AAV2 was conjugated. WGA is present on the N-A of most neurons' cell membranes. It binds to cetylglucosamine and is used as a (transsynaptic) tracer. The construct was injected into mice intravenously in P1 neonates, or intracortically in adult mice. 3 A week later, fluorescence was detected from the reporter gene.

[0263] Gene delivery has been found to be more efficient when ligand-bound viruses are used. (See Figures 8a-8b). Cultured DRG neurons were given the AAV9 mutant PHP.S(1E+9). Infecting the genotype (VG) and the above WGA-modified constructs result in a strong increase in delivery. The resulting effects were found (see Figure 8b).

[0264] Example 5. Targeting with neurotrophin ligands The inventors have developed a neurotrophinrigan for conjugation to AAV2-●HSPG. I selected NGF, BDNF, and NT3 because their receptors are involved in peripheral sensory neurons. This is because it marks functionally different groups of ¹¹. The inventors also linked TrkA. Mutant NGFs that combine but do not transmit signals. R121W This generated the ligand of AAV. To evaluate the evaluation, NGF R121W I selected this.

[0265] As a conjugation strategy, the inventors first used a dual-function linker to connect SNAPta To allow the ligand to attach to the tag, the N-terminus of the AAV2 VP2 protein is encoded with a CLIP tag. We attempted to do so. The AAV virus capsid could help with the embedding of CLIP tags. Instead, they were produced in a state where only VP1 and VP3 proteins were contained within those capsids. Therefore, this approach was unsuccessful. Furthermore, the inventors developed a ligand-Spycatcher fusion... For the final conjugation into mergers, insert a smaller tag like Spytag. We investigated this. The insertion of Spytag at position 588 in the viral capsid contains Spytag. These experiments yielded virus particles, but the yield decreased by more than 10 times. This relates to genetically modifying the AAV capsid for targeting ligand binding. Examples of the difficulties encountered are given below.

[0266] To solve this problem, the inventors have found that the AAV capsid has numerous exposed surfaces. Since it has lysine residues (more than 1000), N-hydroxysuccinimide (NHS) I thought it would be suitable for modification with amine-reactive chemical groups such as esters. Therefore Theoretically, the inventors believe that the AAV capsule can be labeled via a labeling reaction with an NHS-BG probe. The dot could be decorated with a SNAP tag reactive benzylguanine (BG) group. However, The inventors set up the reaction with various molar ratios of BG-GLA-NHS to AAV2-●HSPG, and The purified product was applied to isolated dorsal root ganglion (DRG) neurons. Furthermore, the inventors of the present invention have found that NGF R121W Modified AAV2-HSPG is actually used against the 3E+9VG virus 1.73n Transduction of DRG neuron populations using the optimal molar ratio of the mol-linker BG-GLA-NHS to AAV2-●HSPG On the other hand, it was determined that AAV2-●HSPG alone was not effective (Figures 9a-9f). They then optimized the reaction (see the method below), and once each AAV preparation was completed... Once the optimal ratio for this is empirically determined, the modification can be applied to a wide range of reactive linkers, such as NH4. S ester derivatives, virus concentration and purity, and ligand class They discovered that they work together.

[0267] method Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0268] Example 5a. NGF R121W -SNAP::AAV2-●Targeting with HSPG As mentioned above, NGF in mammalian cells R121W -Produced SNAP (Nocchi L, et al. Ne rve growthfactor-mediated photoablation of nociceptors reduces pain behavior in mice.Pain 2019). To conjugate to AAV, purified AAV2-●HSPG was used in BG -GLA-NHS(NEB) or BG-PEG13-NHS (custom synthesis) and 3E+9VG virus vs 1.73 nmol The linker was reacted in PBS at pH 7.2 for 3 hours at room temperature, with the apparent VG to NHS linker molar ratio. The reaction product was purified using a 100kDaMWCO centrifuge filter, and then further purified with 5 μM NGF. R121W -S Incubated overnight at room temperature with NAP. Excess unreacted NGF R121W -SNAP, 100KdaMWCO The crosslinking product was removed by passing it through a centrifuge twice, and then resuspended in PBS. TIFF2026136377000051.tif100128

[0269] In vivo injection and tissue processing For the in vivo injection experiment, mice were anesthetized with 2-2.5% isoflurane, and then subcutaneously... It was injected via the intraneural, intraperitoneal, or retroorbital (IV) route. For subcutaneous injection, in 10 ul, 3E+10VG NGF R121W -SNAP::AAV2-●HSPG was injected into the plantar surface of the foot. Regarding intraneural injection... And, out of 2ul, 3E+9VG NGF R121W -SNAP::●HSPG-AAV2 was injected into the sciatic nerve. Intraperitoneal injection For retroorbital injections, use 8E+10VG or 3E+10VG NGF. R121W -SNAP::●Inject HSPG-AAV2 Three weeks later, the dorsal root ganglia and trigeminal ganglia were harvested and solidified in 4% paraformaldehyde. The tissue was stabilized, cleared with ScaleS, and prepared as a whole tissue sample. In several experiments, Additionally, DRG was sectioned to 10 μm and blotted in PBS containing 5% serum and 0.3% Triton-X. Incubate with King's solution for 30 minutes, then in the blocking solution with anti-TrkA The antibody (R&Dsystems, 1:200) was incubated overnight at 4●°C. The secondary antibody was blocked. The sample was added to King's solution for 1-2 hours, and then prolonggold was placed on a slide. The image was taken using a Leica camera. Images were taken using an SP5 confocal microscope and then analyzed with ImageJ.

[0270] result To test viral transduction in vitro, 1E+9VG in 100µl of PBS was used in 96 wells. It was applied to dorsal root ganglion neurons in a plate. Fluorescence was monitored daily, and the fluorescence was normal. The effect became apparent after 24 hours and peaked after 4 days. As shown in Figures 10a-10c, NGF R1 21W BDNF and NT3-coupled AAV2-HSPG target morphologically distinct cell subtypes. To ping.

[0271] To test viral transduction in vivo, use 10 µl of NGF in PBS. R121W ::AAV2-●HSPG The drug was injected into mice either intraorbitally, intraperitoneally, intraneuronally, or subcutaneously. Three weeks later, the mice The animals were slaughtered, and tissue samples were taken to monitor the fluorescence of reporter genes across different organs. did.

[0272] Example 5b. Transmutation NGF in DRG R121W ::AAV2-●Effect of linker length on HSPG In the initial experiment, the inventors used two different reactive linkers, commercially available from NEB. A short molecule called BG-GLA-NHS, and BG-PEG13-NHS synthesized in-house by the inventors. They tested a "long" version called BG-GLA-NHS or BG-PEG13-NHS. Equivalent amounts (3E + 10VG) of NGF R121W ::AAV2-●HSPG was injected intraorbitally into mice, and then DRG We collected samples and evaluated the transduction efficiency. See Figures 11a-11f. From these experiments, we found that It is clear that longer linkers perform far better than shorter linkers. While not bound by theory, this likely represents greater stability in vivo. And / or it may be for potential immune evasion.

[0273] The inventors further developed NGF R121W::Comparing injection routes for AAV2-HSPG and systemic Injections result in higher levels of virus in DRG compared to local subcutaneous or intraneural injections. We found that this induces the introduction of the Russ trait. Please refer to Figures 12a-12d. This was discovered by the inventors. When other unmodified AAV serotypes were administered systemically, the inventors reported that they function via intraorbital injection. Even in PHP.S, which has been used, we observed very little transduction, which was unexpected (C han KY, et al.Engineered AAVs for efficient noninvasive gene delivery to the ce Internal and peripheral nervous systems. Nat Neurosci 2017;20:1172-9). This data This exemplifies the efficiency of the inventors' approach.

[0274] Finally, the inventors collected DRG from infected animals, sectioned it, and then... - Staining with an antibody against TrkA allows NGF R121W ::AAV2-●HSPG-mediated gene transfer The specificity of these cells was evaluated. The inventors evaluated the relationship between virus-infected cells and the presence of TrkA receptors. A strong correlation was observed: 80% of TrkA-positive cells were NGF R121W ::By AAV2-●HSPG Infected, and NGF R121W 83% of AAV2-HSPG-infected cells were TrkA-positive. Figure 13a~ See 13d.

[0275] Example 5c. IL31 K134A ::AAV2-●Targeting with HSPG Interleukin 31 (Il31) was selected as the targeting ligand. The reason is... Furthermore, their receptors IL31RA and OSMR are highly expressed on keratinocytes, and they This is because it plays an important role in inflammatory itching (Furue M, et al. Emerging role of interleukin-31and interleukin-31 receptor in pruritus in atopic dermatitis. Al (lergy2018;73:29-36). The inventors have identified a mutation that binds to IL31RA but does not transmit signals. Body IL31 K134A (NocchiL, et al. Interleukin-31-mediated photoablation of p ruritogenicepidermal neurons reduceitch-associated behaviors in mice. Nat Bi (omed Eng2019;3:114-25), and as previously mentioned, this is conjugated to AAV2-HSPG. Gated. IL31 K134A ::AAV2-●HSPG was subcutaneously injected into mice with 3E+10VG and then administered for 3 weeks. Next, skin samples are taken, sectioned, and stained with anti-K14 antibody, a marker for keratinocytes. As shown in Figures 14a-14c, the inventors found that virus-infected cells and K14-positive keratin Nearly 100 percent overlap was observed with nocytes. Importantly, fluorescence was observed in mice. It lasted longer than the 8-10 day epidermal turnover cycle (PottenCS, Saffhill). R, Maibach HI. Measurement of the transit time for cells through the epidermis and stratumcorneum of the mouse and guinea-pig. Cell Tissue Kinet 1987;20:461-7 2) The inventors' data also shows that epidermal stem cells were targeted in this experiment. This demonstrates that IL31RA is present in interfollicular and follicular epithelium. It is shown that it is expressed in basal keratinocytes in epidermal stem cells (Jo ost S, ZeiselA, Jacob T, Sun X, La Manno G, Lonnerberg P, et al. Single-Cell Tr anscriptomics reveals that Differentiation and Spatial Signatures Shape Epiderma Cell Syst 2016;3:221-37 e9).

[0276] IL31 K134A To further investigate the selectivity of AAV2-HSPG gene delivery, the inventors of this invention, IL31RA knockout mouse strain (IL31RA - / - (Nocchi2018) utilizes ). The inventors IL31 K134A ::IL31RA administered by subcutaneous injection of AAV2-HSPG - / - In mice, the reporter tdtomat No signal of o was detected. This suggests that transduction did not actually affect the receptor. This indicates that they are different. See Figures 15a-15c.

[0277] material and method AAV vector production Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0278] IL31 K134A - Chemical modification of SNAP and coupling to AAV2-●HSPG IL31 K134A -SNAP was produced as described above (Nocchi2019). To surface modify AAV Purified AAV2-●HSPG is combined with BG-PEG13-NHS (custom synthesis) and 3E+9VG virus protection with a rating of 1.73 nmo The linker was reacted in PBS at pH 7.2 for 3 hours at room temperature, using the apparent VG to NHS linker molar ratio. The reaction mixture was purified using a 100kDaMWCO centrifuge filter, and then further purified with 5μM IL31. K134A- SNAP The excess unreacted functionalized ligand was incubated overnight at room temperature. The O is removed by passing it through a centrifuge unit twice, and the conjugated product is then mixed in PBS. It was resuspended.

[0279] In vivo injection and tissue processing Regarding in vivo injection experiments, wild-type or IL31RA - / - Mice were treated with 2-2.5% isoflurane. Anesthetize, then 3E+10VG of IL31 in 10ul of PBS. K134A -SNAP::AAV2-●HSPG subcutaneously into the ear Injected. Three weeks later, skin was taken, fixed overnight in 4% paraformaldehyde, and then 40● Sections were prepared using m-grade filtration. The sections were then subjected to a filtration process in PBS containing 5% goat serum + 0.3% Triton-X, which was then used to sample rabbit anti-K14 antibodies. The bodies were stained overnight at 4°C with Covance (1:200 dilution). A secondary anti-rabbit Alexa488 antibody was added at a 1:1000 dilution. Diluted and incubated at room temperature in the dark for 2 hours. Prolonggold was placed on the slide. Then, images were taken using a Leica SP5 confocal microscope and analyzed with ImageJ.

[0280] result Il31 was selected as the targeting ligand. The reason is that its receptor IL31RA OSMR is highly expressed on keratinocytes and is important in inflammatory itching. This is because it plays a role (Furue 2018). Furthermore, the inventors found that IL31RA binds to the signal IL31 mutant that does not transmit IL K134A This was previously generated (Nocchi 2019), and this is the itching pathway. It was proven that it can be used for targeting.

[0281] IL31 K134A AAV2-HSPG was subcutaneously injected into mice, and skin sections were then subjected to keratinization. We investigated for duplication using the site marker K14. As shown in Figures 14a-14c. The inventors found that there is nearly 100% overlap between virus-infected cells and K14-positive keratinocytes. We observed that the fluorescence was more rapid than the 8-10 day epidermal turnover in mice. Because the effect lasted for a long time (Potten 1987), the inventors' data also showed that epidermal stem cells were included in this experiment. This indicates that it is being targeted. In fact, transcriptomics research shows that IL 31RA is present in the interfollicular and follicular epithelium (most of which are epidermal stem cells) basal keratinocytes This shows that it is expressed in (Joost 2016).

[0282] IL31 K134A To further investigate the selectivity of AAV2-HSPG gene delivery, the inventors of this invention, The inventors have previously produced an IL31RA knockout mouse strain (IL31RA - / - ) (Nocchi2019). The inventors of the present invention have identified IL31K134A ::IL31RA administered by subcutaneous injection of AAV2-HSPG - / - Ma In the Uss, no signal was detected from the tdtomato reporter gene (Figure). 15a-15c). This indicates that transduction is indeed receptor-specific.

[0283] Example 6. Targeting of cholera toxin B subunit background I chose cholera toxin B subunit (CTB). The reason is that it is a classic retrograde treatment. As a user, and the inventors of this invention, by coupling it to AAV, New This was because we believed it would be possible to achieve the transport of AAV from the ron terminal back to the cell body. Because the natural tendency for retrograde transport of live AAV serotypes is low, both gene therapy and basic science are being investigated. In contrast, a platform that enables AAV trafficking along projection neurons. There is an unaddressed need to create a m. Previous attempts to address this problem have been directed The goal was to use evolution to incorporate retrograde function within the AAV2 capsid (rAAV2-retro). (TervoDG, et al. A Designer AAV Variant Permits Efficient Retrograde Access to ProjectionNeurons. Neuron 2016;92:372-82). However, the inventors of the present invention have found that CTB ( If (and potentially any other retrograde tracer) promotes retrograde transport of AAV, I thought this would allow for a simple post-hoc conversion of any AAV to a retrograde AAV.

[0284] method The inventors initially produced a CTB-SNAP fusion protein in E. coli, but the SNAP-tag We found that the presence of reduced retrograde transport. Therefore, the inventors Unmodified CTB was purchased and then labeled with azide-PEG4-NHS ester. In short, CTB was reacted with 10 times the molar equivalent of azide-PEG4-NHS ester in PBS at pH 7.2 for 3 hours at room temperature. The unreacted azide groups were removed by dialysis using a 2kDa MWCO membrane. To achieve this, the purified AAV2-●HSPG prepared earlier is mixed with DBCO-PEG4-NHS and 3E+9VG The virus was reacted with VG at a molar ratio of 1.73 nmol linker in PBS at pH 7.2 for 3 hours at room temperature. The reaction product was purified using a 100kDaMWCO centrifuge filter, and then further purified with 5μM CTB-PEG4. - Incubated overnight with azide at room temperature. Excess unreacted ligand was centrifuged at 100kDaMWCO. The CTB-●HSPG-AAV was removed by passing it through the unit twice, and then resuspended in PBS.

[0285] result To test viral transduction in vitro, 1E+9VG of CTB-●HSPG is used in 100µl of PBS. -AAV was applied to dorsal root ganglion neurons in a 96-well plate. Fluorescence was monitored daily, and The effect usually becomes apparent after 24 hours and peaks after 4 days. CTB is a large DRG neuron. It is known that (presumably mechanoreceptors) can be labeled, and in practice, CTB-●HSPG-A AV induces transduction in large neurons, as shown in Figure 16a.

[0286] To test viral transduction in vivo, we introduced 3E+9VG CTB-●HSPG-AAV into mice. The drug was administered subcutaneously. Three weeks later, the mice were sacrificed, and tissue samples were taken to monitor the fluorescence of the cells. The inventors have found that fluorescence signals can be used in sciatic nerve fibers and large neurons in the DRG. We observed the following. See Figures 16b and 16c for details.

[0287] In ongoing experiments, the inventors also conjugate CTB to wild-type AAV2, and They then injected it into the brains of mice. The inventors' aim here was to differentiate between CTB-AAV2 and wild-type AAV2. This involves directly comparing the retrograde transport of these systems.

[0288] Example 7. Targeting with lectins Lectins are specific to the same cell surface carbohydrates that are utilized by AAV for cell adhesion. Lectins were selected because they bind effectively. Therefore, the inventors selected lectins for AAV2-●H By conjugating with SPG, it is possible to mimic and improve natural AAV serotypes. We thought that this could be achieved. In the first experiment, the inventors observed that the traits in organoid culture of the spinal cord Regarding delivery capability, we screened several lectin-AAV2-●HSPG conjugates. Next, the inventors of the present invention will develop lentil (Lens culinaris) lectin (Lens) and To further characterize the wisteria lectin (WFL), we also investigated Wisteria floribunda lectin (WFL). Wheat germ agglutinin (WGA) and isolectin B4 (IB4) were selected.

[0289] General method Lectin was incubated with 20 molar equivalents of azide-PEG4-NHS ester in PBS at pH 7.2 for 3 hours at room temperature. The reaction was initiated. Unreacted azide groups were removed using a 10 kDa molecular MWCO centrifugal filter. AAV To perform surface functionalization, the purified AAV2-●HSPG prepared earlier is mixed with DBCO-PEG4-NHS and 3E+9 VG virus to 1.73 nmol linker molar ratio in PBS, pH 7.2, 3 hours at room temperature. The reaction was carried out. The reaction product was purified using a 100 kDa MWCO centrifuge filter, and then further purified to 5 μM. The lectin-PEG4-azide was incubated overnight at room temperature. The excess unreacted ligand was then... The lectin-H was removed by passing it twice through a 100kDa MWCO centrifuge unit, and the resulting lectin-H The SPG-AAV construct was resuspended in PBS.

[0290] Example 7a. WGA::AAV2-● Targeting with HSPG Chemical modification of WGA and coupling to AAV2-●HSPG WGA was dissolved in 20 molar equivalents of azide-PEG4-NHS ester in PBS at pH 7.2 for 3 hours at room temperature. The process was streamlined. Unreacted reactive linker was removed using a 10 kDa molecule MWCO centrifugal filter. To perform surface functionalization on AAV, the purified AAV2-●HSPG prepared earlier was applied to DBCO-P In the apparent VG to DBCO-PEG4-NHS molar ratio of EG4-NHS virus versus 3E+9VG linker at 1.73 nmol, The reaction was carried out in PBS at pH 7.2 for 3 hours at room temperature. The reaction mixture was then filtered using a 100kDaMWCO centrifuge. The solution was purified and then incubated overnight at room temperature with 5 μM WGA-PEG4-azide. Excess unreacted functionalized ligands are removed by passing them twice through a 100 kDa MWCO centrifuge unit. The produced WGA-●HSPG-AAV construct was then resuspended in PBS.

[0291] To test viral transduction in vitro, 1E+9VG WGA::AAV2- in 100µl of PBS ●HSPG was applied to dorsal root ganglion neurons in a 96-well plate. Fluorescence was monitored daily. Fluorescence became apparent after 24 hours and peaked after 4 days. See Figure 17a. WGA::AAV2-●HSPG was transduced into virtually all cells in the dish. Considering the high efficiency, the inventors also believe that transduction is difficult in other cases, such as in early mouse embryos. We also tried WGA::AAV2-●HSPG in the cell type. Blastocysts were extracted from mice, and then 1.6E The cells were grown in vitro in 100 μl of KSOM medium containing +9VG WGA::AAV2-●HSPG. Fluorescence was observed. We monitored it daily, and the fluorescence became apparent after 24 hours, peaking after 4 days, and at that point... By then, 100% of the cells had emitted fluorescence. See Figure 17b.

[0292] All images were acquired using a Leica SP5 confocal microscope and then analyzed using ImageJ.

[0293] WGA::AAV2-●HSPG targets peripheral neurons in vivo in mice. To determine whether or not this was the case, the inventors administered a systemic injection to neonatal mice. Regarding the experiment with neonatal mice, as mentioned above, 1 µl of PBS was administered into the superficial temporal vein of P1 offspring. The following was injected with 1E+9VG WGA::AAV2-●HSPG (StoicaL, Ahmed SS, Gao G, Sena-Esteves) M. Genetransfer to the CNS using recombinant adeno-associated virus. Curr Proto c Microbiol 2013; Chapter 14: Unit 14D 5). After 5 weeks, the mice were sacrificed, and the skin was examined. The root ganglia (DRG) and spinal cord were harvested and fixed in 4% paraformaldehyde. The skin was cleared with ScaleS and prepared as a whole tissue sample, with the DRG and spinal cord being 10mm thick. The tissue was then sectioned and placed on a glass slide.

[0294] In neonatal mice that received intravenous injection of 1E+9VG WGA::AAV2-●HSPG, the inventors found that the skin Robust transduction was detected throughout the peripheral nervous system in the skin, DRG, and spinal cord, but No nerves were detected in the central nervous system. See Figures 18a-18c. The inventors have identified nerves in the skin. These are clearly shown as fibers (Figure 18a), cell bodies within the DRG (Figure 18b), and central terminals within the spinal cord (Figure 18c). Yes, robust tdTomato fluorescence was detected throughout the entire peripheral nervous system. The inventors of this invention found that the central nervous system... No fluorescence was observed in the nervous system. This suggests that WGA::AAV2-●HSPG crosses the blood-brain barrier. To indicate that you will not make a decision.

[0295] The inventors also injected a modified virus into the prefrontal cortex and observed fluorescence in the thalamus. By examining the cell bodies of projection neurons, WGA::AAV2-●HSPG is retrograde in the brain. We investigated whether or not to initiate transportation.

[0296] For injection into the brains of adult mice, the mice were anesthetized with 2-2.5% isoflurane. Craniotomy was performed. The following coordinates were used to obtain WGA::AAV2-●HSPG of 6E+8VG in PBS500nl: M / L=0.500 The injection was administered into the prefrontal cortex using standard stereotactic neurosurgery with A / P=-1.700 and D / V=-1.8 (St (oica 2013). After 5 weeks, the mice were perfused with 4% paraformaldehyde, their brains were collected, and then... Coronal sections were prepared at 100 mm. Before imaging, the sections were stained with DAPI.

[0297] As can be seen in Figures 19a-19c, the inventors have found that at the injection site (Figure 19a) and within the thalamus In the cell bodies of projection neurons (Figures 19b and 19c), robust signals were detected in brain slices. I took it out.

[0298] Example 7b. Boosting in WGA::PHP.S Surface functionalization with WGA ligands also increases the transduction efficiency of synthetic AAV vectors. In order to explore whether it can be used, the inventors have effectively given traits to DRG neurons We surface-functionalized PHP.S, which has been previously proven to be effective. The purified PHP.S was then used as described above. Prepared as follows, and with DBCO-PEG4-NHS and 1E+9VG in concentrations of 0.43 nmol, 0.87 nmol, 1.73 nmol, and 2.6 nmol. Alternatively, react a VG:linker molar ratio of 3.47 nmol DBCO-PEG4-NHS in PBS at pH 7.2 for 3 hours at room temperature. The reaction was then purified using a 100kDaMWCO centrifuge filter, and further purified to 0.1 nmol W. The GA-PEG4-azide was incubated overnight at room temperature. Excess unreacted functionalized WGA was incubated at 100KD. The WGA-PHP.S construct is removed by passing it twice through an MWCO centrifugal unit, and the resulting WGA-PHP.S construct is then processed. The unmodified and modified PHP.S were then resuspended in PBS. Next, the unmodified and modified PHP.S were fermented in 1E+9VG in 100µl of PBS, and then fermented again. It was applied to Ron. As can be seen in Figures 20a-20f, WGA-PHP.S has the same titer as unmodified PHP.S. When applied to (1E+9VG)DRG neurons, it substantially increased transduction efficiency. This was evident in the range of DBCO-PEG4-NHS molar amounts from 0.43 nmol to 3.47 nmol.

[0299] Example 7c.IB4::AAV2-●Targeting with HSPG Non-peptidergic sensory neurons within the DRG, and the ends of microglia within the central nervous system IB4 is used as a marker for vascular structure in the periphery. Therefore, the inventors of the present invention use In S, IB4::AAV2-●HSPG was tested via subcutaneous, intraneural, and intraspinal injection.

[0300] Chemical modification of IB4 and coupling to AAV2-●HSPG IB4 was reacted with 20 times the molar equivalent of azide-PEG4-NHS ester in PBS at pH 7.2 for 3 hours at room temperature. The unreacted azide linker was removed using a 10 kDa molecular MWCO centrifugation filter. AAV To conjugate it, purified AAV2-●HSPG is mixed with DBCO-PEG4-NHS and 3E+9VG. Russ with 1.73 nmol linker in apparent VG to DBCO-PEG4-NHS molar ratio in PBS, pH 7.2, 3 hours at room temperature. The reaction was carried out. The reaction product was purified using a 100 kDa MWCO centrifuge filter, and then further purified to 5 μm. M IB4-PEG4-azide was incubated overnight at room temperature. Excess unreacted IB4 was incubated in 100 kDaMWC. Remove by passing through a centrifuge unit twice, and then resuspend IB4-●HSPG-AAV in PBS. Ta.

[0301] In vitro application, in vivo injection, and tissue processing Regarding experiments with cultured sensory neurons, DRG was collected from mice, and then 1● mg / m² was used. Each was incubated in collagenase IV and 0.05% trypsin for 25 minutes at 37°C. The cells were filtered, and then DMEM, 10% heat-inactivated fetal bovine serum, 0.8% glucose, and 100● Suspend in a medium containing penicillin / streptomycin U, and then poly-L-lysine. It was plated onto a glass cover glass treated with [method]. The next day, the culture medium was removed, and then IB4::AAV2-●HSPG in 100 µl of PBS was added to the cells. After 2 hours, the PBS was mixed with the culture medium. The cells were then kept at 37°C for 5 days before imaging using a Zeiss AxioObserver A1 microscope. I held on.

[0302] For the in vivo injection experiment, mice were anesthetized with 2-2.5% isoflurane, and then subcutaneously... It was injected via intraneural or intraspinal pathways. For subcutaneous injection, 3E+10VG of IB4 in 10µl. AAV2-HSPG was injected into the plantar surface of the foot. For intraneural injection, 3E+9VGIB4 was administered in 2µl. ::●HSPG-AAV2 was injected into the sciatic nerve. For intraspinal injection, 6E+8VG of IB4::●H per 1 ul SPG-AAV2 was injected into the lumbar spinal cord. Three weeks later, tissue was collected and treated in 4% paraformaldehyde. The tissue was fixed, cleared with ScaleS, and prepared as a whole tissue sample. The spinal cord was also sectioned into 10 μm sections as mentioned above, and then stained with IB4-488 (Dhandapani R, Arokiaraj CM, Taberner FJ, Pacifico P, Raja S, Nocchi L, et al. Control of m mechanical pain hypersensitivity in mice through ligand-targeted photoablation of TrkB-positive sensory neurons. Nature communications 2018;9:1640). Image taken with Leica. Images were taken using an SP5 confocal microscope and then analyzed with ImageJ.

[0303] result In the peripheral nervous system, IB4 is used as a marker for non-peptidergic sensory neurons. Therefore, the inventors first introduced IB4::AAV2-●HSPG into this neuronal population. We tested whether transduction was possible in vitro. As shown in Figure 21, the inventors used cultured DR Robust tdTomato fluorescence was observed in G neurons. It was mainly limited to small-diameter cells. This referred to non-peptidergic sensory neurons. IB4 also refers to peripheral blood vessels. It is used as a structural and microglia marker in the central nervous system. The inventors of this invention have determined whether IB4::AAV2-●HSPG can target these structures in vivo. To determine the appropriate treatment, different injection routes were tested in mice. (IB4::AAV2-●HSPG) Following subcutaneous injection, the inventors administered tdTo to the endothelial and smooth muscle cells surrounding blood vessels. mato expression was detected (Figure 22a). When 3E+9VGIB4::●HSPG-AAV2 was injected into the left sciatic nerve, The inventors have identified non-peptide-gated neurons in the DRG (Figure 22b) and their terminals in the spinal cord. Fluorescence was observed at the edge (Figure 22c). We then examined whether this expression was consistent with that of IB4-positive neurons. To confirm this, the inventors stained spinal cord sections with fluorescently labeled IB4-488. Figure 22c As shown, the inventors have found that in the ipsilateral spinal cord, the IB4::●HSPG-AAV2 trait-introduced new A clear overlap was observed between Ron and IB4-488 staining, which was not present in the contralateral spinal cord. Finally, following the injection of IB4::●HSPG-AAV2 into the spinal cord, the inventors administered to the microglia Robust expression of tdTomato was detected (Figure 22d).

[0304] Example 7d. Substantial boosting using IB4::AAV2-HSPG and IB4::AAV9-HSPG method AAV production Recombinant AAV2 and AAV9 containing GFP, as previously described, SF21 and It was produced in either HEK293 (Grieger 2006 and Wu 2018) 5 days after infection. Cells were collected, lysed with 0.5% TritonX-100, treated with nuclease, and tangent spheroidized. The product was concentrated by low-pressure filtration and then purified using isodensity ultracentrifugation (Dias Florenc io G, PrecigoutG, Beley C, Buclez PO, Garcia L, Benchaouir R. Simple downstream processbased on detergent treatment improves yield and in vivo transduction ef ficacy ofadeno-associated virus vectors. Mol Ther Methods Clin Dev 2015; 2:1502 4) Vector genome titer measurement targeting the promoter region of the viral cargo. This was performed using Q-PCR with primers (Grieger 2006).

[0305] Chemical modification of IB4 and coupling to AAV2 or AAV9 IB4 was reacted with 20 times the molar equivalent of azide-PEG4-NHS ester in PBS at pH 7.2 for 3 hours at room temperature. The unreacted azide linker was removed using a 10 kDa molecular MWCO centrifugation filter. AAV To conjugate, purified AAV2 or AAV9 is combined with DBCO-PEG4-NHS and 3E+9VG Virus vs. 1.73 nmol linker in PBS at an apparent VG vs. DBCO-PEG4-NHS molar ratio, pH 7.2, 3 hours. The reaction was carried out at room temperature. The reaction product was purified using a 100 kDa MWCO centrifuge filter, and then... The excess unreacted IB4 was incubated overnight at room temperature with 5 μM IB4-PEG4-azide. Removed by passing it twice through the 00KDa MWCO centrifuge unit, and then through IB4-AAV2 or IB4-AAV9. The solution was resuspended in PBS.

[0306] In vitro application to PC12 cells PC12 cells were treated with 5% horse serum, 5% fetal bovine serum, and 100 U of penicillin / streptonite. Wild-type AAV2 and wild-type A were maintained at 37°C in DMEM / F12 medium containing mycin. AV9, IB4-AAV2, or IB4-AAV9 were incubated with PC12 cells in PBS for 2 hours. The culture medium was changed, and the cells were maintained at 37°C for 5 days, then fixed in 4% PFA and marked with DAPI. Identification was performed and then imaged using a ZeissAxioObserver A1 microscope. GFP was detected in each DAPI-positive cell. By measuring fluorescence and plotting it as the average + / - SEM for each titer, the image can be visualized. The image was analyzed.

[0307] result PC12 cells can be transduced using wild-type AAV serotypes such as AAV2 or AAV9. It is difficult. Therefore, the inventors believe that the conjugation of AAV2 or AAV9 to IB4 is difficult. We investigated whether this would increase the AAV transduction efficiency in this cell type. Figure 23 shows the plot. As shown in the images in Figures 24a-f and 24f, the inventors have found that any concentration of 2E+7 to 5E+9VG is possible. GFP fluorescence could not be detected in cells treated with AAV2 at a certain degree. However, However, dispersed GFP-positive cells were identified with 5E+8VG, and this was over 80% effective with 5E+9VG. The conjugation of IB4 to AAV substantially increases transduction efficiency, as evidenced by the increase in the rate. The cells were added (Figure 24g~24l). These values ​​were quantified (GFP fluorescence intensity across all cells). (Measured) was 5E+8VG, and the conjugation of IB4 to AAV2 increased efficiency by 15 times, 1 It was revealed that at E+9VG, the increase was 38 times, and at 5E+9VG, the increase in efficiency was 104 times. I did.

[0308] Similarly, GFP fluorescence in treated PC12 cells is undetectable at any concentration in wild-type AAV9 cells. This did not happen. See plot in Figure 25 and Figures 26a-26f. In contrast, IB4-AAV9 processing The treated cells showed an increase in the number of GFP-positive cells from a concentration of 5E+8VG, and demonstrated high efficiency at 5E+9VG. See plots in Figure 25 and Figures 26g-26l. Notably, processed with 1E+9VG. In PC12 cells, conjugation of IB4 to AAV9 increased efficiency by 9 times, and in 5E+9VG cells. The increase was 84 times greater compared to the wild type.

[0309] Example 8. Effect of linker length on transduction efficiency method AAV production Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0310] Chemical modification of IB4 and coupling to AAV2-●HSPG IB4 (8.8 nmol) was mixed with 20 times the molar equivalent of azide-PEGn-NHS ester (176 nmol) in PBS at pH 7.2. The reaction was carried out at room temperature for 3 hours. Unreacted azide groups were removed using a 10 kDa molecular MWCO centrifugation filter. Removed. To conjugate to AAV, 0.17 nmol of purified AAV2-●HSPG at 6E+12 was added. 0.52 nmol, 1.73 nmol, or 5.2 nmol DBCO were reacted in PBS at pH 7.2 for 3 hours at room temperature. (Reaction product) The solution was purified using a 100kDaMWCO centrifuge filter, and then further purified to 0.1 nmol IB4-PEG4-azide The mixture was incubated overnight at room temperature. The excess unreacted IB4 was placed in a 100 kDa MWCO centrifuge unit. The modified AAV was removed by passing it through twice, and then resuspended in PBS.

[0311] The following linker combinations in Table 2 were investigated (and their commercial sources).

[0312] (Table 2) TIFF2026136377000052.tif52170

[0313] In vitro application to PC12 cells PC12 cells were treated with 5% horse serum, 5% fetal bovine serum, and 100 U of penicillin / streptonite. The samples were maintained at 37°C in DMEM / F12 medium containing mycin. Different molar ratios and various linkers were used. - Long-conjugated IB4::AAV2-●HSPG particles were incubated with PC12 cells in PBS for 2 hours. The cells were then incubated. Next, the culture medium was changed, and the cells were maintained at 37°C for 5 days, followed by 4% PFA. The samples were fixed inside, labeled with DAPI, and then imaged using a Zeiss AxioObserver A1 microscope. GFP fluorescence was measured in each DAPI-positive cell, and the mean + / - SEM was used for each titer. The images were analyzed by lotting. See Figure 30.

[0314] Results and Explanation In these experiments, the inventors found that linker length (i.e., ethino) has a relationship to transduction efficiency. The effect of the number of ylene glycol monomer spacers was investigated. The inventors investigated the standard AA Transduction using V vectors is difficult (therefore reducing background noise) (Therefore, PC12 cells were selected as the target cell line, and a strong binding was performed on these cells.) Therefore, IB4 was selected as the targeting ligand. The inventors selected four different ligands. Experiments were conducted on linker length, and the efficiency of each linker was determined using various molar ratios. The measurement was taken. The inference here is that each linker reacts differently to the virus or ligand. By obtaining and using various modification ratios, the inventors have improved the reaction efficiency. And ultimately, any fluctuations in the trait introduction efficiency of the final structure can be captured. That's unbelievable.

[0315] From the data plotted in Figure 31, it can be seen that there is a spacer between AAV and ligand. It is clear that not doing so has a strong negative impact on the efficiency of transduction. 0.17 Surface-modified capsids produced with nmol, 0.52 nmol, and 1.73 nmol NHS-DBCO were transduced. There were hardly any cells present, and it was only at 5.2 nmol that the inventors observed a recognizable infection. Even without a spacer between the ligand and the virus, the cell still retains its characteristics. It is interesting because it shows that it is possible to implement it. However, this is the structure For preparation, a high concentration of NHS-DBCO is required for AAV. This is not constrained by theory. However, one possibility is that there is a bridge between the targeting ligand-azide and AAV-DBCO. The bridging reaction is limited by steric hindrance, and the optimal deposition of DBCO groups on the virus is This is necessary for the reaction to proceed. The short total PEGn = 3 PEG spacers are It performed better than a design without any spacers, but again, a low molar ratio (0. At 17 nmol, the efficiency decreased. Interestingly, at higher modification ratios, this spacer... - The long-duration model performed moderately better than all the others. Medium (n=8) and long-duration (n=16) ) Structures with spacers perform similarly, and AAV: ligand 3E+9VG When produced with a molar ratio of 1 / 20 IV to 0.17 nmol linker, it showed higher transduction efficiency. These data indicate that increasing the spacer length within this range results in a modification ratio below the optimal level. This suggests that it increases the efficiency of transduction.

[0316] Example 9. Size limitations of PEG linkers Includes discrete PEG (dPEG) and dispersed PEG (pPEG) spacers that provide various linker lengths. We investigated the effect of AAV constructs on the AAV transduction efficiency in PC12 cells. The present inventors have proposed (i) DBCO-PEGn-NHS (where n is 4, 12, about 45 (dPEG 2K), about 114 ( dPEG 5K), approximately 228 (dPEG 10K), approximately 682 (dPEG 30K) or DBCO-PEGn-TFP (here (where n is 24) Capsid-reactive linkers functionalized with a capsid-reactive linker selected from any of the above. (ii) Ligand-reactive linker: Azide-PEGn-NHS (where n is 4, 12, 24) Alternatively, by combining it with a WGA ligand functionalized with approximately 114 (dPEG5K), AAV2●HSPG capsids were surface-modified with WGA ligands. Various linkers / PEGs were investigated. The corresponding structures for the spacers are further illustrated in Table 3, where capsid reactivity is demonstrated. The linker is DBCO-PEGn-NHS unless otherwise specified as "TFP".

[0317] (Table 3) Ligand-reactive linker (L) and capsid-reactive linker (V) Surface-modified viral constructs prepared using various PEGn spacers TIFF2026136377000053.tif138160 *Polydisperse PEG sizes are provided as average molecular weights. (Values ​​in parentheses are for ethylene glycol.) This is the average number of corresponding monomers.

[0318] method Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0319] Chemical modification of WGA using different linkers and coupling to AAV2●HSPG WGA (1.7 nmol) is mixed with 20 times the molar equivalent of ligand-reactive linker azide-PEGn-NHS (54 nmol). (where n is 4, 12, or 24) react in 100 µl of PBS at pH 7.2 for 3 hours at room temperature. Therefore, it was functionalized. Unreacted linker was removed using a 10 kDa molecule MWCO centrifugation filter. To conjugate the functionalized ligand to the AAV, first, the surface-functionalized AAV capsule was used. The linker for each capsid is DBCO-PEGn-NHS (where n is 4, 12, or 24). and prepared for DBCO-PEGn-TFP (where n is 4, 12, or 24). Each capsid / Transduction efficiency of ligand constructs was determined by preparing each construct with various capsid-to-ligand ratios. Optimization was achieved by doing the following. Specifically, each surface-functionalized AAV capsid was optimized using 3E+9VG. AAV2●HSPG is manufactured in selected reactive linkers of 0.17 nmol, 0.52 nmol, 1.73 nmol, and 5.2 nmol. - was prepared by reacting with PBS at pH 7.2 at room temperature for 3 hours. Next, each of the obtained Surface-functionalized capsid with 0.1 nmol of WGA-PEGn-azide (functionalized targeting ligand) ) along with various WGA-AAV2●HSPG surfaces and incubated at room temperature for 1 hour, then overnight at 4C. A modified structure was obtained.

[0320] In vitro application to PC12 cells PC12 cells were treated with 5% horse serum, 5% fetal bovine serum, and 100 U of penicillin / streptonite. PC12 cells were maintained at 37C in DMEM / F12 medium containing mycin. Various WGA-A cells were added to 3E+9VG. The AV2ΔHSPG construct was incubated in PBS for 2 hours. Then the medium was changed, and the culture medium was changed. The cells were maintained at 37°C for 5 days, labeled with Hoechst, and then examined using a Zeiss AxioObserver A1 microscope. The images were then created. The images were analyzed by measuring GFP fluorescence in each Hoechst-positive cell. Then, each titer was plotted as the average + / - SEM.

[0321] result In combination, the data illustrated in Figures 32-36 are PE used to modify viruses. The size of the G-linker is controlled to achieve the desired boost in transduction efficiency. It is important that this is optimal for the system being tested around PEG12. This proves that, on the ligand side, a longer linker containing dispersed PEG5000 is expected to be more tolerable. It is possible, but it is not ideal.

[0322] Figures 32a-s show the results of each of the prepared WGA-AAV2●HSPG surface-modified constructs treated with Hoechst. These are images of labeled PC12 cells. As shown in Figures 32a-s and 33-36, the most efficient The linker selects the brightest image showing the most effective trait introduction, and sets the range to 4-24 (or 4-12). It contains various PEG lengths having "n" (i.e., ethylene glycol monomers), In experiments where the entire linker contains a total of "n" PEG units, ranging from 8 to 24 (or 8 to 16), Obtained. The optimal combination is DBCO-PEG4 on the virus and azide-PEG4 on the ligand. (Total n=8) (Figure 32a), followed by DBCO-PEG12 on the virus and azide-PE on the ligand. G4 (total n=16) (Figure 32d), DBCO-PEG4 on the virus and azide-PEG12 on the ligand ( (Total n=8) (Figure 32b), as well as DBCO-PEG12 on the virus and azide-PEG1 on the ligand The result was 2 (total n=24) (Figure 32e). The only distributed PEG that showed some signal was... The condition was WGA-azide-PEG5000 reacting with DBCO-PEG4 within the virus (Figure 32n). The combinations of dispersed PEG 4L+4V and 12L+12V clearly perform better than longer dispersed pPEG. He demonstrated it.

[0323] Figures 33 and 34 further show discrete PEG linker spacers (i.e., ethylene glyco PC12 cells treated with an AAV2ΔHSPG virus construct surface-modified with WGA containing a monomer. This provides confidence in the boost to the individual and average (each) cell transduction efficiency. And here, the total n (in the linker formed between the viral capsid and the ligand) The total number of PEG monomers is between 8 and 24.

[0324] Figures 35 and 36 show the selected discrete and dispersed PEG combinations compared to the unmodified virus. We compare the average trait transfer efficiency for each pair. Figure 35 shows discrete PEG 4L+4V and 12L+12V pairs. Seeing that the combination performs significantly better than longer dispersed PEG spacers It can be taken. Figure 36 shows only the discrete and distributed PEG combinations that perform the worst. We will focus on this. Interestingly, only the 5KL+4V performed better than the control, and this is The limited spacer length on the virus side of the linker allows for the desired boosted traits to be transmitted. While it may be useful in obtaining input, the spacer length on the ligand side of the linker is more This suggests that using longer spacers may be more suitable.

[0325] Example 10. DBCO-azido crosslinker reactive pair is best for WGA-AAV2●HSPG constructs. It performs well in that context. Next, the inventors investigated a different method in addition to DBCO-azide chemistry, which they had already investigated. This study explored whether linker chemistry improves AAV transduction efficiency in PC12 cells. For the purpose of this, the inventors have provided TCO / tetrazine ligation, and separately, Schutau Phosphine-NHS / azidocroslinker reaction via dinger ligation AAV2●HSPG-WGA constructs were prepared using sex pairs.

[0326] TCO / tetrazine ligation chemistry involves the reaction of trans-cyclooctene with tetrazine. Based on the reverse-required Diels-Alder cycloaddition reaction between A and B, dihydropyridazine compound It forms a combination and exhibits ultrafast movement unmatched by any other bio-orthogonal ligation pair. It is known that it has a state (>800M-1s-1).

[0327] NHS-azide and NHS-phosphine bifunctional linkers are amine-reactive and tan It contains NHS esters suitable for derivatizing primary amines of proteins. Once the (capsid or ligand) is functionalized with an azide or phosphine, the two components Mix for effective and stable conjugation. The phosphine group is Staude It reacts with the azide via the Winger reaction to produce an aza-ylide intermediate, which is then captured and stabilized. It forms a stable covalent amide bond.

[0328] method Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0329] To prepare the functionalized targeting ligands used in these experiments, Trazine-PEG5-NHS and azide-PEG4-NHS stock solutions were prepared in DMSO at 150 mM. WGA(27 μM (1 mg / ml) is added to 20 times the molar equivalent of tetrazine-PEG5-NHS (540 μM) or azide-PEG4-NHS (540 μM). The reaction was carried out in PBS at pH 7.2 at room temperature for 3 hours. The unreacted linker was centrifuged using a 10 kDa MWCO. It was removed using a filter.

[0330] To prepare surface-functionalized viral capsids for use in these experiments: 20 mM TC O-PEG4-NHS or phosphine-NHS stock solution was prepared in DMSO. The AAV capsid was then surface-modified. Therefore, purified AAV2●HSPG of 3E+9VG is used in concentrations of 0.17 nmol, 0.52 nmol, 1.73 nmol, and 5.2 nmol TCO-PE. G4-NHS or phosphine-NHS was reacted with 20 µl of PBS at pH 7.2 for 3 hours at room temperature. Then, TCO Alternatively, Phos surface-modified AAV with 0.1 nmol of WGA-PEG5-tetrazine or WGA-PEG4-azide Then, it was incubated at room temperature for 1 hour, and then overnight at 4C.

[0331] In vitro application to PC12 cells PC12 cells in 5% horse serum, 5% fetal bovine serum, and 100 U of penicillin / streptomycin. PC12 cells were maintained at 37C in DMEM / F12 medium containing isin. AV: Incubate the WGA-AAV2●HSPG construct, prepared at the linker ratio, in PBS for 2 hours. Next, the culture medium was changed, and the cells were maintained at 37°C for 5 days, labeled with Hoechst, and then Z Images were obtained using the eissAxioObserver A1 microscope. GFP fluorescence was measured in each Hoechst-positive cell. The images were then analyzed by plotting each titer as the mean + / - SEM.

[0332] result As shown in Figures 37a-37f and 38-39, TCO / tetrazine ligation is used In cells treated with AAV2●HSPG conjugated with WGA, very low levels of t dTomato fluorescence was detected. This indicates inefficient transduction. Phosphine-NHS / azide was used. In cells treated with AAV2●HSPG conjugated with WGA, a slight difference was observed. Many trait introductions were evident (Figures 40a-40d and 41-42); however, observed The introduced traits provided only minimal improvement compared to the unmodified AAV2●HSPG (Figure 37). e and 40e). The chemical modification showing the highest transduction efficiency was DBCO-azidocroslinker reaction. The AAV structure remains as prepared using the responsive pair (Figures 37f and 40f).

[0333] Example 11. Quantification of AAV particles and chemical modification of the virus surface background To quantify the degree of surface modification of AAV capsids, the inventors used capsids of known concentrations. I used a standard AAV9 with a SID (purchased from Innovavector). Next, the inventors quantified the degree of modification using two strategies: (1) The inventors This involves reacting NHS-PEG4-DBCO with the virus, and then measuring the absorbance of the DBCO chromophore to determine the amount per capsid. The number of DBCO molecules per unit was calculated. Next, the inventors modified WGA-PEG4-azide into AAV9. The ligands are denuded, and the number of ligands per capsid is measured from the decrease in DBCO absorbance. (2) The inventors have found a fluorescently labeled azide ligand (WGA-SNAP-TMR-PEG4-azide The virus is conjugated with (D), and here again absorbance measurement is used for 1 virus The number of ligands per molecule was evaluated.

[0334] method Modification of AAV9 in DBCO and bridging in the following WGA azid 3.6E+10VG AAV9 with 52 nmol DBCO-PEG4-NHS at a final volume of 97 µl for 3 hours on a shaker. It was incubated at room temperature. This amount of linker was conjugated to AAV9 and then to PC This amount of linker was selected because it provides optimal transduction efficiency when applied to 12 cells.

[0335] To modify the virus with WGA-azide ligand, 2.8 nmol of WGA is added to 20 times the molar equivalent of azide ligand. PEG4-NHS ester (56 nmol) in 100 μl of PBS at pH 7.2 for 3 hours at room temperature (RT). The reaction was initiated. Subsequently, unreacted azide groups were removed using a 10 kDa molecular MWCO centrifugal filter. Then, 242.5 nmol of WGA-azide was added and incubated at room temperature for 1 hour. After modification, rinse the sample three times with 0.001% Pluronic F68 in PBS and 200 mM NaCl. Excess unbound reagent was removed using a 100 kDa molecular MWCO. 20 μl recovered from the column was then speeched. Concentrated by vacuum, and then mixed in PBS with 0.001% Pluronic F68 and 10 ul of 200 mM NaCl. Resuspended. In addition to the reaction with WGA-azide, the inventors also reacted with two other groups, 1) AAV9 AAV9 was incubated alone and with DBCO alone. The reaction and cleanup were performed. To compensate for virus loss during the interval, ddPCR analysis was performed using a 5µl sample. did.

[0336] Evaluation of the degree of PEG4-DBCO and WGA-PEG4-azide chemical modification on the virus The absorbance was measured at a wavelength of 307 nm, which is the peak absorbance of the chromophore embedded in DBCO. The reaction between AV9-PEG4-DBCO and WGA-PEG4-azide results in the loss of chromophores present in DBCO. Therefore, the PEG4- in the sample PEG4-DBCO and PEG4-DBCO+ WGA-PEG4-azide The difference from the total number of DBCO molecules should provide the number of ligand molecules bound to the virus. That is the case.

[0337] The raw data was processed as follows: • Using a standard curve of absorbance versus PEG4-DBCO concentration, sample absorbance (absorbance of AAV9 alone) (and corrected for the residual absorbance of unreacted NHS-PEG4-DBCO after reaction cleanup) Calculation of the total number of PEG4-DBCO molecules; • The number of PEG4-DBCO molecules on each capsid is calculated by dividing the total number of DBCO molecules by the total number of capsids. Numerical calculations; • PEG4-DBCO present in sample PEG4-DBCO + WGA-PEG4-azide from sample PEG4-DBCO alone Calculation of the number of ligand molecules bound to the virus by subtracting the number of BCO molecules.

[0338] Modification of viruses using fluorescently labeled ligands To modify the virus using a fluorescently labeled ligand, 2.8 nMol of WGA-SNAP was added. In 0 molar equivalents of azide-PEG4-NHS ester (56 nMol) in 100 μl of PBS at pH 7.2, 3 The reaction was carried out at room temperature (RT) for 2 hours. Unreacted azide groups were removed using a 10 kDa molecular MWCO centrifuge filter. It was then removed. Next, fluorescent BG-tetramethylrhodamine (BG-TMR, from NEB) was added in an equimolar concentration. Incubate with WGA-SNAP azide at 1°C at room temperature for 1 hour, then add WGA-SNAP-TMR-PEG4-azide. I obtained it.

[0339] To modify the virus using WGA-SNAP-TMR-PEG4-azide, 3.6E+10VG AAV9 was modified to 52n Incubate with mol of DBCO-PEG4-NHS in a final volume of 97 µl on a shaker at room temperature for 3 hours. Then, 242.5 nmol of WGA-SNAP-TMR-PEG4-azide was added, and the mixture was incubated at room temperature for 1 hour. In contrast, the inventors compared 1) AAV9 alone; 2) any DBCO-PEG4-NHS phosphorus. AAV9 incubated with TMR-WGA-azide alone, without the use of CAR; and 3) WGA-azide AAV9 incubated with 2. After modification, 0.001% Pluronic F68 in PBS was used. Rinse the sample three times with 00 mM NaCl and remove excess unbound reagent using 100 kDa molecular MWCO. The substance was removed. 20 µl was recovered from the column for absorbance measurement and ddPCR analysis. .

[0340] Evaluation of the number of fluorescent ligands per AAV9 capsid. • Absorbance was measured at a wavelength of 544 nm, which is the peak absorbance of TMR. The raw data is as follows: Processed: • Absorbance value of AAV9 alone compared to the total absorbance value of AAV9-PEG4-DBCO::WGA-SNAP-TMR-PEG4-azide Calculation of the total number of TMR molecules based on the absorbance and extinction coefficient of TMR by subtracting [a certain value]; • The number of TMR molecules on the capsid is calculated by dividing the total number of TMR molecules by the total number of capsids. Calculation of the number of ligand molecules;

[0341] result Based on the absorbance of DBCO, the inventors calculated the number of PEG4-DBCO molecules per virus. This is approximately 210, while the number of WGA-PEG4-azide ligands is approximately 150 per capsid. It was a molecule (Figure 43). From measurements using fluorescent WGA-SNAP-TMR-PEG4-azide, the inventors found that The number of ligands was estimated to be 170 molecules per capsid (Figure 44). The most abundant AAV capsid protein, VP3 (50 copies of VP3 per virion), is exposed. It has 10 lysines, which is for the linker DBCO-PEG4-NHS, and therefore lygan This is consistent with the fact that it means approximately 500 binding sites.

[0342] Example 12. Increased infectivity of clinically relevant capsids. method AAV production Recombinant AAV3 and AAV8 with GFP cargo were purchased from Innovavector, while tdTomat I purchased an AAV5 with cargo from Addgene (plasmid #59462). It also has a tomato cargo. AAV6 was produced using HEK293T as previously described (Grieger2006, Wu 2018). ). Cells were collected 5 days after infection, lysed with 0.5% TritonX-100, and treated with nuclease. The solution is concentrated by tangential flow filtration and then purified using isodense ultracentrifugation. (Dias2015). Vector genome titer measurement was performed on the promoter region of the viral cargo. The procedure was performed using Q-PCR with targeting primers (Grieger 2006).

[0343] Chemical modification of WGA and coupling to AAV3, AAV5, AAV6, and AAV8. WGA (1.7 nmol) with 20 times the molar equivalent of azide-PEG4-NHS reactive linker (54 nmol) and PBS100 The reaction was carried out in UL at pH 7.2 at room temperature for 3 hours to produce a functionalized targeting WGA ligand. The unreacted reactive linker was removed using a 10 kDa molecular MWCO centrifugation filter. To conjugate to AAV, 3E each of purified AAV3, AAV5, AAV6, and AAV8 is used. +9VG was mixed with 0.17 nmol, 0.52 nmol, 1.73 nmol, and 5.2 nmol DBCO-PEGn-NHS in 20 μl of PBS at pH 7 The reaction was allowed to proceed at room temperature for 2-3 hours to identify the optimized capsid-to-linker ratio and then the surface coating was prepared. A functionalized viral capsid was formed. Next, each of the obtained surface-functionalized viral capsid products was processed. These were incubated with 0.1 nmol of WGA-PEG4-azide for 1 hour at room temperature, and then overnight at 4C. Then, the corresponding WGA surface-modified viral capsid was produced.

[0344] In vitro application to PC12 cells PC12 cells were treated with 5% horse serum, 5% fetal bovine serum, and 100 U of penicillin / streptonite. PC12 cells were maintained at 37C in DMEM / F12 medium containing mycin. Each of the prepared WGA surface-modified viral capsid products was incubated with 3E+9VG in PBS for 2 hours. The cells were incubated. Next, the culture medium was changed, and the cells were maintained at 37°C for 5 days, then in 4% PFA. The samples were fixed, labeled with DAPI, and then imaged using a Zeiss AxioObserver A1 microscope. Each DAPI GFP fluorescence was measured in positive cells and plotted as the mean + / - SEM for each titer. The images were analyzed by doing the following.

[0345] result PC12 cells are transduced using wild-type AAV serotypes such as AAV3, AAV6, and AAV8. This is difficult. Therefore, compared to unmodified wild-type viruses, the inventors have developed these Conjugation of AAV serotypes into WGA increases the efficiency of AAV transduction in this cell type. We investigated whether adding it would boost viral infection. (See Figures 45a, 51a, and 54a) To that end, the inventors treated with unmodified wild-type AAV serotypes AAV3, AAV6, and AAV8. In cells, GFP or RFP / tdTomato fluorescence could not be detected. In contrast, Transduced positive cells were revealed for all serotypes at different reactive linker molar levels. As shown above, surface modifications of serotypes AAV3, AAV6, and AAV8 in WGA improve transduction efficiency. This effectively increased (Figures 45b-45e, 46-47, 51b-51e, 52-53, 54b-54e, and (Figures 55-56).

[0346] PC12 cells treated with wild-type AAV5 showed higher transduction than those treated with AAV3, AAV6, and AAV8. The level was observed (Figure 48a). Surface modification of AAV5 in WGA according to this disclosure improves the trait introduction efficiency. The amount was substantially increased (Figures 48b-48e). The cells were adjusted using different molar amounts of reactive linker. For all surface-modified viral capsid products produced, an increase in the number of tdTomato-positive cells was observed. This was shown (Figures 49-50).

[0347] Example 13. The need for AAVR for the internalization of modified vectors method Generation of AAVR KOHEK293 cells The AAV receptor (AAVR) gene (KIAA0319L) was modified using CRISPR-Cas9 technology to identify HEK293 In short, HEK293 cells were knocked out with puromycin and hygromycin. spCas9 and gRNA (ATAGGTGTAACTACGTCACT) (SEQ) containing a glomycin selective cassette ID NO: 1) Plasmid was transfected. Cells were treated with puromycin and hygro The cells were grown in HEK293 medium containing mycin. After expansion and growth, AAVR2 knockout (KO) HEK29 cells were produced. When 3 cells are infected with AAV2 eGFP, they are selected by fluorescence-activated cell sorting (FACS). Cells that were negative for eGFP fluorescence were enriched, and then further treated with puromycin and The cells were grown in hygromycin medium. HEK293 cells were infected with AAV2 eGFP and subjected to FACS sperm extraction. It was produced and then expanded and propagated a total of four times.

[0348] Surface modification of WGA and crosslinking to AAV2 Targeting ligand WGA (1.7 nmol) is mixed with 20 times the molar equivalent of the reactive linker azide-PEG4- The functionalized target was reacted in NHS (54 nmol) and 100 µl of PBS at pH 7.2 for 3 hours at room temperature. A linking ligand was formed. The unreacted reactive linker was filtered through a 10 kDa molecule MWCO centrifugation filter. It was removed using the following method: Functionalized targeting ligands were conjugated to AAV2. To do this, purified AAV2 of 1E+9VG was mixed with 0.17 nmol of DBCO-PEG4-NHS in 20 μl of PBS at pH 7.2 for 3 hours. The reaction was carried out at room temperature. The resulting surface-functionalized virus capsid was mixed with 0.1 nmol of WGA-PEG4-azide. Both were incubated at room temperature for 1 hour and then overnight at 4C to obtain the "WGA-AAV2" surface-modified wood chips. It produced ruscapsid.

[0349] In vitro application to AAVR KOHEK293 cells WGA-AAV2 or unmodified AAV2 was added to AAVRKO HEK293 at a titer of 1E+9VG. Transduction 5 After a few days, the cells were imaged and quantified using ImageJ open-source software. .

[0350] result In these experiments, the inventors demonstrated that AAVs with surfaces modified according to this disclosure Can the receptor evade the requirements for intracellular entry and transduction of the AAVR receptor? They wanted to investigate whether this was the case. To achieve this, the inventors deleted the AAVR gene. HEK293 cell lines were generated by performing the following: In normal HEK293 cells, the inventors performed FACS analysis (Figure) As shown in 57) and microscopic examination (Figure 58a), robust transduction by AAV2 Observations showed that transduction by AAV2 tdTomato in AAVRKO HEK293 cells was dramatically reduced. (Figure 58b)

[0351] The inventors further demonstrated that ligand WGA is sufficient to regain AAV2 entry into AAVR KO cells. The inventors investigated whether WGA-AAV2 infection was the case compared to the control (AAV2 unmodified). Furthermore, both the percentage of tdTomato-positive cells and the mean fluorescence intensity (MFI) were significantly improved. We found that this resulted in higher numbers (Figures 59a-b and 60a-b). This is because of the WGA of AAV2. This modification demonstrates that the vector can enter cells even in the absence of AAVR. This suggests that it bypasses AAVR-mediated internalization. do.

[0352] Example 14. ScFv targeting using nemolizumab-SNAP-AAV2●HSPG method AAV production Recombinant AAV2-●HSPG was prepared according to the procedure described in Example 1.

[0353] Nemolizumab-SNAP production The amino acid sequence of nemolizumab was obtained from the IMGT / 3D structural database (http: / / imgt.or g / 3Dstructure-DB / cgi / details.cgi?pdbcode=10064)(SEQID NO: 2). (See Figure 61 for an example.) As described, the CDR is used in the upstream GP64 signal array and the downstream Sortag, SNAP-tag It was cloned into an scFv skeleton containing 6xHistag (SEQ ID NO. 3). For production using a culovirus expression system, it was cloned into pFastBac. Standard Using this method, the protein was produced in SF9 insect cells, and affinity chromosomes were developed. The sample was purified from cell culture medium using tography.

[0354] Surface modification and crosslinking of AAV2-HSPG and nemolizumab-SNAP Purified AAV2-●HSPG of 3E+10VG in 17.3 nmol of BG-PEG13-NHS (custom synthesis) in 200●l of PBS. The reaction was carried out at pH 7.2 at room temperature for 3 hours to produce BG-functionalized viral capsids. The reaction mixture was then heated to 100K. Purified using a Da MWCO centrifugal filter, and further processed with nemolizumab-SNAP functionalized ligane. Incubate overnight at room temperature with 1 nmol of nemolizumab-SNAP::AAV2-●HSPG. Surface-modified viral capsids were produced. Excess unreacted ligand was centrifuged at 100 kDa in a MWCO. The virus capsid is removed by passing it through the knit twice, and then the surface-modified virus capsid is placed in PBS. It was resuspended.

[0355] In vivo injection and tissue processing Regarding the in vivo injection experiment, wild-type mice were anesthetized with 2-2.5% isoflurane, and then... 30 µl of nemolizumab-SNAP::AAV2-●HSPG in PBS was subcutaneously injected into the ear. 3 weeks later... Afterward, skin samples were taken, fixed overnight in 4% paraformaldehyde, and then sectioned at 40°F. The sections were then subjected to a PBS solution containing 5% goat serum + 0.3% Triton-X, and rabbit anti-K14 (Covance 1: The samples were stained overnight at 4°C using a 200-fold dilution. A secondary anti-rabbit Alexa488 antibody was diluted 1:1000, and then... Then, incubate at room temperature in the dark for 2 hours. Place prolonggold on the slide, and Images were acquired using a Leica SP5 confocal microscope and then analyzed with ImageJ software.

[0356] result Nemolizumab is specific to the IL31RA receptor and is effective for moderate to severe atromeda. Nemolizuma has shown some promise in clinical trials for atopic dermatitis. The b was selected as scFv (1). Nemolizumab-SNAP::AAV2-●HSPG was administered to mice in skin The injection is administered, and then skin sections are examined for duplication using K14, a keratinocyte marker. The inventors investigated and found that virus-infected cells and We observed substantial overlap between K14-positive keratinocytes around the hair follicles. Importantly, Since the light lasted longer than the 8-10 day epidermal turnover in mice (2), this The inventors' data indicates that epidermal stem cells were also targeted in this experiment. In fact, transcriptomics studies have shown that IL31RA is involved in interfollicular and follicular epithelium (many of them). This shows that it is expressed in basal keratinocytes in epidermal stem cells (3).

[0357] reference TIFF2026136377000054.tif86157

[0358] Example 15. Investigation of immune stealth - evasion of neutralizing antibodies Neutralizing antibodies that recognize the AAV capsid protein are a major obstacle in AAV-mediated gene therapy. Currently, patients who have tested positive even for low-titer anti-AAV neutralizing antibodies are... They are excluded from clinical trials using AAV as a gene therapy vector. Approximately 50% of the population Since they have neutralizing antibodies against AAV from a young age, they have ways to avoid / evade humoral immunity. Finding this would be of significant benefit by expanding the pool of eligible patients. Currently, much of the research in this field focuses on the aspect of immune evasion (Wang M , et al.Prediction of adeno-associated virus neutralizing antibody activity for clinical application. Gene Ther. 2015 Dec; 22(12):984-92.). The present inventors have found that Using the reactive linker described in the details, or using the linker and ligand together We hypothesize that the surface modification of AAV used in this study can also lead to reduced recognition by neutralizing antibodies. did.

[0359] (i) functionalizing the virus with different amounts of reactive linker, and (ii) virus The linker length on either the ligand side only, or on both the ligand and virus sides. The effects of AAV on humoral immunity were investigated in vitro. To the wild-type AAV2 functionalized with different molar amounts of linker having a fixed-length spacer, IgG binding and its neutralization were tested in the absence of the ligand. For the second test, fixed Functionalized with discrete PEG (dPEG) and dispersed PEG (pPEG) spacers, and conjugate Either it remains unprocessed, or it also involves fixed amounts of discrete PEG (dPEG) and distributed PEG (pPEG). Human IgG to either AAV2 conjugated with a pacer-functionalized WGA The combination and neutralization were tested. Neutralization was tested to determine the tolerable differences in response to wild-type AAV2 infection. The tests were performed on cell lines or primary cells.

[0360] material AAV Vector Recombinant AAV2 containing tdtomato cargo was produced in HEK293T cells. Samples were collected 3 days after sfection and dissolved in TritonX-100 in the presence of ribonuclease. Recombinant AAV2 was concentrated by tangential flow filtration and then subjected to isodense ultracentrifugation. Purified using (Grieger 2006). AAV titer measurement was performed by terminating the ITR region of the virus cargo. The procedure was performed using qPCR with GETTING primers (Dias 2015).

[0361] Human pooled serum and mouse serum I purchased human pooled serum from Sigma (Cat. Nr.: H4522-20ML). I used human serum for complement... It is inactivated by heating in order to inactivate other non-antibody virus inhibitors, and furthermore The serum was frozen for use. Mouse serum was collected from mice 4 weeks after systemic injection of AAV2. The blood was collected from the tail vein and left at room temperature for 30 minutes to allow it to clot. The blood clot was prepared in advance. It was removed by a 10-minute centrifugation process at 2000g in a cooled centrifuge. The supernatant was collected and then inactivated by heating at 56°C for 30 minutes. The serum was stored at -20°C until use. Saved.

[0362] method DBCO-PEG(12)-NHS of virus (AAV2) using different virus-to-reactive linker ratios Surface modification in linker As in the previous experiment, DBCO-PEG(12)-NHS linker 0.52 nmol, 1.73 nmol, 5.2 nmol, 17.3 nmol, 52 nmol, or 173.3 nmol were incubated in 20 μl of PBS in 3E+9VG AAV2 at pH 7.2 for 3 hours at room temperature. I conjugated it.

[0363] By crosslinking WGA functionalized with PEG(n)-azide-NHS and AAV2 functionalized with DBCO-PEG(n), PEG Exploring length Similar to Example 9, the wild AAV2 capsid was subjected to a capsid reaction where n was either 4 or 2k. Functionalized with the DBCO-PEGn-NHS linker, each forming either a "4 virus" or a "5k virus". It produced a structure. The WGA ligand was ligand-reactive azide-PEGn-NHS ligand where n is 4 or 5K. They were functionalized with ligands to produce either "4 ligand" or "5k ligand," respectively. This involves mixing WGA (1.7 nmol) with 20 times the molar equivalent of azide-PEGn-NHS (54 nmol) in 100 μl of PBS at pH 7. In step 2, the reaction was allowed to proceed at room temperature for 3 hours. Unreacted linker was removed using a 10 kDa molecule MWCO centrifuge filter. It was removed by combining 0.1 nmol of WGA-PEG(n)-azide with the surface-modified virus at 1 hour. The crosslinking reaction was carried out at room temperature, and then overnight at 4°C.

[0364] ELISA AAV2-specific IgG antibodies were detected using enzyme-linked immunosorbent assay (ELISA). 96U Prepare the ELISA plate in a coating buffer (37 mM Na2CO3, 63 mM NaHCO3, H2O; pH 9.6) Using AAV2 particles diluted in ) at a concentration of 1 x 10^9 vg / well, ferment at room temperature for 2 hours or overnight at 4°C. The plates were coated with [a specific coating agent]. The plates were washed three times with washing buffer (PBS containing 0.05% Tween20). Then, a blocking solution (PBS containing 0.05% Tween20 and 5% skim milk powder) was added, and The plates were incubated at 37°C for 2 hours. After blocking, the plates were washed with buffer. Washed once. Added serum diluent to the well, and then left at room temperature for 2 hours or overnight at 4°C. The plate was washed three times with washing buffer, and then diluted with buffer (0.05% Tween2). HRP conjugated to IgG diluted in PBS (containing 0% and 1% skim milk powder) The plates were incubated with the secondary antibody at 37°C for 1 hour. The plates were washed three times with washing buffer and HR was performed. TMB, a substrate of P, was added. To stop the reaction, a stop solution containing an acidic acid was added. The absorbance (expressed in optical density units, OD) was then measured at 450 nm using a spectrophotometer. The D value is reported after subtracting background and the antibody is bound to the immobilized antigen (AAV). It correlates with the degree of compatibility.

[0365] Neutralization assay using HEK293T cells (tolerant cell line) HEK293T cells were supplemented with 5% FBS and 100U of penicillin / streptomycin in DMEM. Cells were maintained in +Glutamax at 37°C and 5% CO2. For the assay, cells were stored in 96 wells. Seed 3x10^4 cells and incubated with 2x serial dilutions of human or mouse serum at 37°C for 1 hour. AAV virus, pre-incubated, was added at an MOI of 1000. Transduction was performed after 72 hours. Cell fluorescence was determined by flow cytometry using an S3e cell sorter from BioRad. That's what I analyzed.

[0366] Neutralization assay using PC12 cells (a cell line with low tolerance) PC12 cells were treated with 10% horse serum, 5% FBS, and 100 U of penicillin / streptomycin. Cells were maintained in supplemented DMEM / F12 medium at 37°C and 5% CO2. For the assay, 9 Seed 3 x 10^4 cells per 6 wells and incubated with a 2-fold serial dilution of mouse serum at 37°C for 1 hour. AAV virus, pre-incubated, was added at an MOI of 1000. After 5 days, the transduced cells... The fluorescence was obtained using a ZeissAxioObserver A1 microscope.

[0367] Neutralization assay using primary dorsal root ganglion (DRG) neurons A glass-bottomed dish was treated with poly-L-lysine solution (original concentration: 1 mg / ml, diluted 1:10 with H2O). The coating was applied with 15L droplets at 37°C for 1 hour. After 1 hour, the droplets were removed, and the ditch was... The dish was washed twice with PBS. Next, 15 liters of Matrigel diluted 1:50 in PBS was added to the dish. And then incubated at 37°C. Before seeding the cells, remove the Matrigel droplets. The dish was then air-dried. Next, DRG was isolated from adult mice. Primary cells (Mainly neurons and satellite cells) are treated with DRG collagenase at 37°C for 25 minutes, followed by Further isolation was achieved through washing and incubation with trypsin. The reaction was then carried out. Stop the cell culture using 500 liters of complete culture medium, then filter the cell suspension, centrifuge, and finely chop the cells. The cells were resuspended in cell culture medium. 10 liters of the cell suspension were added to each dish. After 1 hour, the culture medium was added. Pour 100 liters gently. Remove the culture medium the next day, and then add 200 liters of fresh culture medium to the dish. The next day, the culture medium was replaced with 100 liters of DMEM + Pen / Strep (FBS-free). After 15 minutes, serum-free culture was performed. Unmodified virus and PEG4-DBC were removed and pre-incubated with serum. O: Add the azide-PEG4-WGA modified virus to the cells, and after 15 minutes, add 50 liters of culture medium. The following day, 2 ml of DMEM / F12 medium was added to each dish. Imaging of the transduced cells was performed. The procedure was performed using a confocal microscope five days later.

[0368] result In Figures 63a and 63b, the inventors converted AAV2 using different amounts of linker DBCO-PEG4. ELISA was performed using chemically modified human pooled serum containing antibodies against AAV2. The process was carried out (Figure 63a). Consistent with the inventors' hypothesis, the maximum amount of linker (173.3 nmol) was reduced to the minimum. This is indicated by an almost 80% decrease in the OD signal compared to the amount (0.52 nmol). Therefore, increasing the amount of linker per virus results in the IgG antibody This results in a decrease in virus recognition. However, with these increased linker levels, the virus The transduction efficiency was drastically reduced. These data are based on the established practices described herein. It has been shown that constructs can be produced that provide enhanced transduction efficiency, as in Examples 8 and 9. The linker-to-virus ratio used for this purpose was determined by the spacer length. This shows that it is influenced by the inverse correlation between the bond and the other.

[0369] The inventors also performed a neutralization assay in HEK293T cells to determine the increased linkage A decrease in IgG binding to AAV2 with a DBCO-PEG12 linker, observed at low levels, indicates a loss of neutralizing activity. We further investigated whether it correlated with loss (Figure 63b). As shown in Figure 63b, antibody neutralization The capacity is 0.52 nmol, 1.73 nmol, 5.2 nmol, 17.3 nmol, and 52 nmol per 3E+9VG virus. This is a linker amount of 173.3 nmol (notably, still compatible with enhanced transduction). It was not affected by constructs prepared in the amount available. Therefore, in antibody binding Regardless of the decrease, a virus using a linker amount that is compatible with enhancing transduction. Sensory enhancement is unlikely to result in an escape from neutralization.

[0370] Furthermore, the inventors have found that only the linker portion that binds to the virus, or the virus and Increasing the PEG spacer length in either of the ligands improves recognition by the antibody. We investigated whether it would have an effect. The inventors of DBCO-PEG4-NHS ("4-virus"), D The virus was modified with BCO-PEG2000-NHS ("2K-virus"). In addition, DBCO-PEG4- Modifications that are surface-functionalized using an NHS linker and then cross-linked with WGA-PEG5000-azide. Using the virus ("4-virus 5K ligand") and initially the DBCO-PEG2000-NHS linker Modified viruses ("2K-virus") are surface-functionalized and then cross-linked with WGA-PEG4-azide. (Figure 64a) By increasing the PEG spacer length, the inventors Furthermore, ELISA was used to observe no difference in AAV recognition by antibodies (Figure 64a). Therefore, Even if you increase the PEG length of the DBCO-PEGn-NHS linker, or change the PEG length of the WGA-PEG-azid, There was no difference in neutralization ability (Figures 64b-64c).

[0371] The inventors have developed a neutralization assay using a highly tolerant HEK293T cell line. Since no changes were observed, the inventors have determined that the finer points of less tolerant neurons The cells were changed to the PC12 cell line (Figure 65) and to primary DRG (Figure 66). In these experiments, The inventors surface-modified the virus using DBCO-PEG4-NHS, and then WGA-PEG4-Az. The virus, which was cross-linked and surface-modified, was then placed in mouse serum containing antibodies against AAV2. They were incubated with serial dilutions. As shown in Figure 65, in PC12 cells, Transduction by modified AAV was blocked at all serum dilutions tested, while WGA modified The modified virus, starting from a 1:16 dilution, escapes recognition by neutralizing antibodies. This is not bound by theory, but WGA surface-modified viruses use different pathways This suggests that the cells may be able to invade PC12 cells, thereby evading inhibition by antibodies. To encourage. The inventors also applied this neutralization assay to DRG culture. Here again, The inventors have found that in serum dilutions that completely neutralize unmodified AAV2, WGA surface-modified viruses can be used. The landscape is shown (Figure 66).

[0372] 8. Sequence Listing SEQ ID NO: 1 JPEG2026136377000055.jpg3170 SEQ ID NO: Amino acid sequence of 2-nemolizumab TIFF2026136377000056.tif104158 SEQ ID NO: Synthetic amino acid sequence of 3-nemolizumab SNAP TIFF2026136377000057.tif68128

[0373] 9. Incorporation by Equivalents and References The present invention is specifically illustrated and described with reference to preferred embodiments and various alternative embodiments. However, without departing from the essence and scope of the present invention, various changes in form and detail are permitted. Those skilled in the art in the relevant field will understand that this can be done.

[0374] All references, published patents, and patent applications cited in the text of this specification are the exclusive rights of the holders of the right to use any and all other references. For any purpose, the entirety of these is incorporated herein by reference.

[0375] PCT / EP2020 / 062713 is incorporated herein by reference in its entirety for all purposes. It can be done.

Claims

[Claim 1] It comprises one or more ligands covalently conjugated to a viral capsid protein via a linker, and the linker is A crosslinked portion formed by the reaction between the first and second members of a crosslinking agent reactive pair; and Optionally, one or more spacers A surface-modified viral capsid containing this substance.

Images