Lung cancer detection method using lung cancer-specific methylation marker genes

Abstract

The present invention relates to a novel use of the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes as lung cancer-specific methylation markers, and more specifically to a composition for diagnosing lung cancer by detecting the presence or absence of methylation using the PRRX1 or ABCC9 gene as a biomarker, a kit containing the same, and a method for providing information for lung cancer diagnosis.

Description

[Technical Field]

[0001] The present invention relates to a novel use of the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes as lung cancer-specific methylation markers, and more specifically to a composition for diagnosing lung cancer by detecting the presence or absence of methylation using the PRRX1 or ABCC9 gene as a biomarker, a kit containing the same, and a method for providing information for lung cancer diagnosis.

[0002] [Background technology]

[0003] In addition to A, C, G, and T, mammalian genomic DNA contains a fifth base: 5-methylcytosine (5-mC), in which a methyl group is attached to the fifth carbon of the cytosine ring. 5-mC always occurs at the C position of a CG dinucleotide (5'-mCG-3'), and this type of CG is commonly referred to as CpG. Most Cs in CpGs are methylated. Methylation of these CpGs suppresses the expression of repetitive sequences in the genome, such as alu or transposons, and they are the most common sites of extragenic variation in mammalian cells. The 5-mC in these CpGs is naturally deaminates to T, resulting in a frequency of only 1% in mammalian genomes, far lower than the normal frequency (1 / 4 × 1 / 4 = 6.25%).

[0004] Among CpGs, there are exceptions where they occur in close proximity, called CpG sites (CpG islands). CpG sites are 0.2 to 3 kb in length, with a high concentration of C and G bases (over 50%) and a high CpG distribution (over 3.75%). Approximately 45,000 CpG sites occur in the human genome, and are particularly concentrated in promoter regions that regulate gene expression. In fact, CpG sites occur in the promoters of important housekeeping genes, which account for approximately half of the human genes (Cross, S. et al., Curr. Opin. Gene Develop., 5:309, 1995). Abnormal DNA methylation is known to occur primarily in the 5' regulatory region of a gene, reducing its expression.

[0005] On the other hand, in somatic cells of normal individuals, the CpG islands in the promoter regions of these important genes are unmethylated, but imprinted genes that are not expressed during development and genes on the inactivated X chromosome are methylated.

[0006] During the carcinogenesis process, methylation occurs in promoter CpG islands, impairing the expression of the corresponding genes. In particular, when methylation occurs in CpG islands, which are regulatory sites for tumor suppressor genes that regulate cell cycles and apoptosis, repair DNA, participate in cell adhesion and cell-cell interaction, and suppress invasion and metastasis, this blocks the expression and function of these genes, just like mutations in the coding sequence, thereby promoting the development and progression of cancer. In addition, partial methylation of CpG islands can also occur due to aging.

[0007] Methylation of expression regulatory sites of tumor-related genes is an important indicator of cancer, and therefore, it can be used in a wide range of applications, including cancer diagnosis and early diagnosis, cancer risk prediction, cancer prognosis prediction, post-treatment follow-up, and response prediction to anti-cancer therapy. In fact, in recent years, active efforts have been made to examine promoter methylation of tumor-related genes in blood, sputum, saliva, feces, urine, etc., and use it in various cancer treatments (Ahlquist, DA et al., Gastroenterol., 119:1219, 2000).

[0008] Against this technical background, the inventors of the present application have made intensive efforts to develop an effective lung cancer-specific methylation marker that can be used for early diagnosis, cancer risk prediction, or cancer prognosis prediction, and as a result, have confirmed that the PRRX1 or ABCC9 gene is lung cancer-specific, thereby completing the present invention.

[0009]

[0010] Summary of the Invention

[0011] An object of the present invention is to provide a lung cancer-specific methylation biomarker and a composition for diagnosing lung cancer using the same.

[0012] An object of the present invention is to provide a method for diagnosing lung cancer using lung cancer-specific methylation biomarkers.

[0013] An object of the present invention is to provide a use for diagnosing lung cancer using lung cancer-specific methylation biomarkers.

[0014] An object of the present invention is to provide a kit for diagnosing lung cancer, which comprises the composition.

[0015] An object of the present invention is to provide a method for providing information for lung cancer diagnosis using methylated lung cancer marker genes as lung cancer-specific methylation biomarkers.

[0016] To achieve the above-mentioned objectives, the present invention provides a lung cancer diagnostic composition containing a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0017] The present invention also provides a method for diagnosing lung cancer, comprising the steps of administering to a patient a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes, or treating a patient sample with a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0018] The present invention also provides use of a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes in the production of a composition for diagnosing lung cancer.

[0019] The present invention also provides a kit for diagnosing lung cancer, which comprises the composition.

[0020] The present invention also provides a method for providing information for diagnosing lung cancer, which comprises treating a sample with a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0021] [Brief explanation of the drawings]

[0022] [Figure 1] FIG. 1 illustrates the CpG microarray analysis design for the discovery of novel methylation biomarker candidates in lung cancer tissues.

[0023] [Figure 2] FIG. 1 shows the process of discovering novel methylation biomarker candidates using statistical analysis in lung cancer tissues.

[0024] [Figure 3] The methylation status of two candidate biomarker genes in lung cancer cell lines (A) and tissues (B) was measured by pyrosequencing.

[0025] [Figure 4] The methylation status of two biomarker genes was measured using methylation-specific real-time PCR in bronchial lavage fluid from patients with lung cancer and benign lung disease, and the sensitivity and specificity for diagnosing lung cancer were measured using receiver operating characteristic (ROC) analysis.

[0026] [Figure 5] The methylation status of the PRRX1 gene was measured by methylation-specific real-time PCR in the blood of healthy subjects and lung cancer patients.

[0027]

[0028] DETAILED DESCRIPTION OF THE INVENTION

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one skilled in the art to which this invention belongs. Generally, the nomenclature used herein is well known and commonly used in the art.

[0030] In one aspect, the present invention relates to a novel use of lung cancer-specific methylation genes PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes, namely, use for diagnosing lung cancer. More specifically, the present invention relates to a lung cancer diagnostic composition containing a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0031] The present invention also provides a method for diagnosing lung cancer, comprising the steps of administering to a patient a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes, or treating a patient sample with a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0032] The present invention also provides use of a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes in the production of a composition for diagnosing lung cancer.

[0033] In another aspect, the present invention relates to a method for providing information for diagnosing lung cancer, comprising treating a sample with a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes.

[0034] By measuring the methylation of PRRX1 and / or ABCC9 genes, which are specifically methylated in lung cancer cells, information regarding the diagnosis of lung cancer is provided. Furthermore, by detecting the presence or absence of CpG island methylation in these novel markers, lung cancer can be diagnosed with excellent sensitivity and specificity, and it has been confirmed that this method is highly useful for lung cancer diagnosis.

[0035] In the present invention, "methylation" refers to the addition of a methyl group to the fifth carbon in the cytosine base ring, resulting in the modification to 5-methylcytosine (5-mC). 5-methylcytosine always occurs at the C position of a CG dinucleotide (5'-mCG-3'), and such CG is generally referred to as CpG. Methylation of such CpGs suppresses the expression of repeated base sequences in the genome, such as alu or transposons, and is the most frequent site of extragenic alterations in mammalian cells. The 5-mC in such CpGs is naturally deaminated to T, resulting in the CpGs occurring at only 1% frequency in mammalian genomes, far lower than their normal frequency (1 / 4 x 1 / 4 = 6.25%).

[0036] Among CpGs, there are exceptions where they appear in close proximity, and these are called CpG islands. CpG islands are 0.2 to 3 kb in length, and are regions where the distribution percentage of C and G bases exceeds 50%, with a high CpG distribution percentage of 3.75% or more. There are approximately 45,000 CpG islands in the human genome, and they are particularly concentrated in promoter regions that regulate gene expression. In fact, CpG islands appear in the promoters of important genes (housekeeping genes), which account for approximately half of the human genes.

[0037] The CpG island may be located at any site in the PRRX1 or ABCC9 gene. Specifically, the CpG island may be located in the promoter site of the PRRX1 or ABCC9 gene, or may be located in the upstream or downstream region of the PRRX1 or ABCC9 gene. Specifically, the CpG island may be located in an intron, exon, enhancer, or the like of the PRRX1 or ABCC9 gene, but is not limited thereto.

[0038] According to a specific example of the present invention, it was confirmed that lung cancer-specific hypermethylation occurs in CpG islands in the promoter region of the PRRX1 or ABCC9 gene. Based on this, the CpG island may be located in the promoter of the PRRX1 or ABCC9 gene.

[0039] The PRRX1 gene may comprise, for example, the sequence of SEQ ID NO: 1. The CpG islands of the PRRX1 gene may be characterized, for example, by being located at positions −1,505 to −1,299 from the transcription initiation site (+1) in the sequence of SEQ ID NO: 1. Specifically, the CpG islands may be characterized by being located at positions −1,505, −1,411, and −1,343 from the transcription initiation site (+1) in the sequence of SEQ ID NO: 1.

[0040] [SEQ ID NO: 1]

[0041] JPEG2026500727000002.jpg201134

[0042] The ABCC9 gene may comprise, for example, the sequence of SEQ ID NO: 2. The CpG islands of the ABCC9 gene may be characterized, for example, by being located at positions −373 to −220 from the transcription start site (+1) in the sequence of SEQ ID NO: 2. Specifically, the CpG islands of the ABCC9 gene may be characterized, for example, by being located at positions −373 and −264 from the transcription start site (+1) in the sequence of SEQ ID NO: 2.

[0043] [SEQ ID NO: 2]

[0044] JPEG2026500727000003.jpg62131

[0045] The genes for the methylation biomarkers for diagnosing lung cancer according to the present invention are as follows:

[0046] TIFF2026500727000004.tif23170

[0047] Specifically, the PRRX1 gene may comprise, for example, the sequence of SEQ ID NO: 1. The CpG island of the PRRX1 gene may be, for example, a CpG island located between the transcription initiation site (+1 in SEQ ID NO: 1) and the transcription initiation site (+1 in SEQ ID NO: 1) in the sequence of SEQ ID NO: 1. Underlined A The PRRX1 target position may be located at positions -1,505 to -1,299 from the transcription start site (SEQ ID NO: 1). Underlined A Standard) -1,505 to -1,460 CTGCTCTATTTCTAGGGAGGTTTTGGGGAGACTGATCAGCTCCAAG , -1,411 to -1,366

[0048] GATGGAAACCTCTCTGCGCTATTAGACTGCGTCCAGTACAGCAGAT , -1,343 to -1,299 AGCTTAGGCTCTCGGAGGCAGCTGAGTTGGAAATCCCGACGGAAA It may be.

[0049] Specifically, the ABCC9 gene may comprise, for example, the sequence of SEQ ID NO: 2. The CpG island of the ABCC9 gene may be, for example, a CpG island located between the transcription initiation site (+1 in SEQ ID NO: 1) and the transcription initiation site (+1 in SEQ ID NO: 2). A Underlined A The ABCC9 target position may be located at positions -373 to -220 from the transcription start site (SEQ ID NO: 2). G Underlined G Standard) -373 to -326 AGAAACCAAGTTTTCTAGGTCGCCGGGGAAAAGCGGAAAATTAGACTT , -264 to -220 CTAGAATGAGCCCTTCATTTCCCGGATCCGTTCAGGGGGAAACAG It may be.

[0050] The presence or absence of CpG island methylation can be determined by real-time quantitative amplification, such as real-time polymerase chain reaction (RTC), in which the amount of PCR amplification product can be detected by fluorescent signal. As the RTC proceeds, the intensity of the fluorescent signal increases with the amount of polynucleotide, and an amplification profile curve showing the intensity of the fluorescent signal as a function of the number of amplification cycles is obtained.

[0051] The amplification profile curve is generally divided into a baseline region where background fluorescent signals appear that do not reflect the actual amount of polynucleotide, an exponential region where fluorescent signals increase with increasing amounts of polynucleotide products, and a plateau region where the PCR reaction reaches saturation and no increase in fluorescent signal intensity appears.

[0052] Typically, the point at which the fluorescence signal intensity crosses from the baseline region to the exponential region, i.e., when the amount of PCR amplification product reaches an amount that can be detected by fluorescence, is called the threshold, and the number of amplification cycles corresponding to the threshold in the amplification profile curve is called the threshold cycle (Ct) value.

[0053] The Ct value is measured, and a standard curve in which the concentration is determined based on the Ct (threshold cycle) value for the standard substance is analyzed to confirm the concentration of the amplified gene, thereby determining the methylation-specific sensitivity and / or specificity.

[0054] In one embodiment, the methylation detection may be performed by a method selected from the group consisting of PCR, methylation-specific PCR, real-time methylation-specific PCR, PCR using a methylated DNA-specific binding protein, PCR using a methylated DNA-specific binding antibody, quantitative PCR, gene chip, sequencing, sequencing by synthesis, and sequencing by ligation.

[0055] (1) Methylation-specific PCR: When detecting using methylation-specific PCR, bisulfite treatment leaves the cytosine at the 5'-CpG'-3 site methylated, while unmethylated cytosine is converted to uracil. Therefore, primers corresponding to the site containing the 5'-CpG-3' sequence can be prepared for the base sequence converted after bisulfite treatment. PCR is performed using the primers, and if methylation occurs, PCR products are generated using the primers corresponding to the methylated base sequence. The presence or absence of methylation can be confirmed by agarose gel electrophoresis. Here, the methylation detection probe may be, but is not limited to, TaqMan, molecular beacon, a probe with self-reporting function, or a probe with energy transfer function.

[0056] (2) Real-time methylation-specific PCR: This method converts the methylation-specific PCR method into a real-time measurement method. Genomic DNA is treated with bisulfite, and PCR primers corresponding to the methylated DNA are designed. Real-time PCR is performed using these primers. Detection can be performed using TaqMan probes complementary to the amplified base sequence or Sybergreen. Therefore, real-time methylation-specific PCR can selectively quantify only methylated DNA. A standard curve can be created using in vitro methylated DNA samples, and a gene lacking the 5'-CpG-3' sequence in its base sequence can be amplified as a negative control for standardization, allowing quantitative analysis of the level of methylation.

[0057] (3) PCR or quantitative PCR and DNA chip using a methylated DNA-specific binding protein: In the PCR or DNA chip method using the methylated DNA-specific binding protein, when a protein that specifically binds only to methylated DNA is mixed with DNA, the protein specifically binds only to methylated DNA, making it possible to selectively separate only methylated DNA.

[0058] The presence or absence of methylation can also be measured using quantitative PCR. Methylated DNA separated using a methylated DNA-specific binding protein can be labeled with a fluorescent dye and hybridized to a DNA chip containing complementary probes to determine the presence or absence of methylation.

[0059] (4) Differential Methylation Detection - Bisulfite Sequencing Method: Another method for detecting methylated CpG-containing nucleic acids involves contacting a nucleic acid-containing sample with an agent that modifies unmethylated cytosines and amplifying the CpG-containing nucleic acids in the sample using CpG-specific oligonucleotide primers. The oligonucleotide primers may be characterized as being capable of detecting methylated nucleic acids by distinguishing between modified methylated and unmethylated nucleic acids. The amplification step is optional and preferred, but not essential. The method relies on a PCR reaction that distinguishes between modified (e.g., chemically modified) methylated and unmethylated DNA.

[0060] (5) Bisulfite Sequencing Method: Another method for detecting methylated CpG-containing nucleic acids involves contacting a sample containing the nucleic acid with a preparation that modifies unmethylated cytosines and amplifying the CpG-containing nucleic acid in the sample using methylation-independent oligonucleotide primers. The oligonucleotide primers may amplify the nucleic acid without distinguishing between modified methylated and unmethylated nucleic acids. The amplified product is sequenced using a sequencing primer by the Sanger method, or as a next-generation sequencing method, bisulfite sequencing for detecting methylated nucleic acids has been described.

[0061] (6) Here, the next-generation sequencing method may be characterized by a sequencing by synthesis and sequencing by ligation method. This method is characterized in that, instead of creating bacterial clones, single DNA fragments are spatially separated, amplified in situ (clonal amplification), and sequenced. Because hundreds of thousands of fragments are read simultaneously, this method is sometimes called a massively parallel sequencing method.

[0062] Basically, it is a sequencing by synthesis method, which uses a method of obtaining a signal by sequentially adding mono- or dinucleotides, and examples of this include pyrosequencing, ion torrent, and Solexa methods.

[0063] NGS systems based on sequencing by synthesis include Roche's 454 platform, Illumina's HiSeq platform, Life Technologies' Ion PGM platform, and Pacific BioSciences' PacBio platform. 454 and Ion PGM use emergence PCR as a clonal amplification method, while HiSeq uses bridge amplification. Sequencing by synthesis involves detecting phosphate, hydrogen ions, or pre-attached fluorescent material to read the sequence as DNA is synthesized, adding each nucleotide sequentially. 454 uses pyrosequencing, which uses phosphate, while Ion PGM uses hydrogen ion detection. HiSeq and PacBio read the sequence by detecting fluorescent material.

[0064] Sequencing by ligation is a sequencing technology that uses DNA ligase to identify nucleotides at specific positions in a DNA base sequence. Unlike most sequencing technologies that use polymerases, this technology does not use polymerases and takes advantage of the fact that DNA ligases do not ligate mismatched sequences. The SOLiD system is an example of this technology. This method reads two bases at a time with intervals, but uses primer reset to repeat this process independently five times, ultimately reading each base twice in duplicate, increasing accuracy.

[0065] In the case of sequencing by ligation, dinucleotide primers corresponding to the relevant base sequence from a dinucleotide primer set consisting of 16 combinations are ligated sequentially, and the ligation combinations are finally analyzed to complete the base sequence of the DNA.

[0066] Here, the next-generation sequencing method may be characterized as a sequencing by synthesis or sequencing by ligation method, in which the methylated DNA-specific binding protein is, but is not limited to, MBD2bt, and the antibody is, but is not limited to, a 5'-methyl-cytosine antibody.

[0067] Therefore, the substance capable of detecting the presence or absence of CpG island methylation is not limited as long as it can detect a high level and frequency of methylation positivity specifically in lung cancer, and may be, for example, a primer or primer pair capable of amplifying a fragment containing a methylated CpG island, a probe capable of hybridizing to the methylated CpG island, a sequencing primer, a sequencing bi-synthesis primer, or a sequencing bi-ligation primer.

[0068] As used herein, "primer" refers to a single-stranded oligonucleotide that can act as an initiation point for template-directed DNA synthesis under appropriate conditions (i.e., four different nucleoside triphosphates and a polymerization enzyme) at a suitable temperature and buffer.

[0069] The primers may be made to be "approximately" complementary to each strand of the gene locus to be amplified, meaning that the primers have sufficient complementarity to hybridize with corresponding nucleic acid strands under the conditions of the polymerization reaction.

[0070] The primer can mean, for example, a site having a length of 5 bp to 50 bp, specifically 10 bp to 30 bp, for a target gene or any site therein.

[0071] As used herein, "complementary binding" refers to hybridization of a primer with a corresponding nucleic acid strand under polymerization conditions, forming a duplex structure. Complementary binding can occur when the complementarity between the paired nucleotide sequences forms a Watson-Crick pair, or even when some non-Watson-Crick base pairs exist.

[0072] As used herein, a "probe" is a single-stranded nucleic acid molecule that contains a sequence substantially complementary to a target nucleic acid sequence and is capable of hybridizing thereto.

[0073] In a hybridization reaction, the conditions used to achieve a specific level of stringency vary depending on the nature of the nucleic acid to be hybridized. For example, the length of the nucleic acid to be hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio), and the nucleic acid type (e.g., RNA, DNA) are taken into consideration when selecting hybridization conditions. Another consideration is whether the nucleic acid is immobilized, for example, on a filter.

[0074] Examples of highly stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42°C (moderate stringency conditions); and 0.1X SSC at 68°C (high stringency conditions). The wash step can be performed using one of these conditions, e.g., high stringency conditions, or each of the above conditions, in the order listed above, for 10-15 minutes each, with all or part of the above conditions repeated. However, as noted above, optimal conditions vary depending on the particular hybridization reaction involved and can be determined empirically. Generally, high stringency conditions are used for hybridization of the probe of interest.

[0075] In some cases, the primer or probe may be detectably labeled, for example, with a radioisotope, a fluorescent compound, a bioluminescent compound, a chemiluminescent compound, a metal chelate, or an enzyme. Appropriate labeling of such primers or probes is a technique widely known in the art and can be carried out by conventional methods.

[0076] The amount of the amplified product can be detected by a fluorescent signal, using methods such as the intercalating method, which uses an intercalator that binds to the double-stranded DNA of the amplified product to which the primer or probe is bound and emits fluorescence, or the method using an oligonucleotide labeled with a fluorescent substance at the 5' end or a quencher at the 3' end.

[0077] In one embodiment, the substance capable of detecting the presence or absence of CpG island methylation may be a primer or primer pair and / or a sequencing primer capable of amplifying a fragment containing a methylated CpG island.

[0078] In a specific example of the present invention, PCR and sequencing primers were designed for pyrosequencing the PRRX1 or ABCC9 gene, amplifying the CpG islands located at positions −1,361, −1,355, −1,351, and −1,348 from the transcription start site (+1) in the sequence of SEQ ID NO: 1 of the PRRX1 gene.

[0079] Specifically, PCR primers for measuring the methylation of the PRRX1 gene may include a primer comprising the sequence of SEQ ID NO:3 and the sequence of SEQ ID NO:4, and a sequencing primer comprising the sequence of SEQ ID NO:7.

[0080] In the sequence of SEQ ID NO: 2 of the ABCC9 gene, CpG islands located at -242 and -236 from the transcription initiation site (+1) can be amplified.

[0081] Specifically, PCR primers for measuring methylation of the ABCC9 gene may include a primer comprising the sequence of SEQ ID NO:5 and the sequence of SEQ ID NO:6, and a sequencing primer comprising the sequence of SEQ ID NO:8.

[0082] TIFF2026500727000005.tif49170

[0083]

[0084] The reverse primer of the primers may further contain a label.

[0085] The label contained in the reverse primer may be, but is not limited to, biotin, FAM, Cy5, Cy3, FITC, EDANS (5-(2'-aminoethyl)amino-1-naphthalene sulfate), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, or an antibody or nanoparticles bound thereto.

[0086] The amplification of the target nucleic acid can be detected by reacting the label with a binding agent that induces color development and confirming whether color development or fluorescence occurs, where the binding agent may be, but is not limited to, streptavidin.

[0087] In one embodiment, the presence or absence of CpG island methylation may be detected by quantitative methylation-specific real-time PCR (qMSP). Primers and probes can be used for methylation analysis using qMSP.

[0088] The primers may be, for example, a pair of forward and reverse primers that can be used simultaneously. The forward primer that specifically amplifies the methylated PRRX1 gene may comprise, for example, the sequence of SEQ ID NO: 9. The reverse primer may comprise, for example, the sequence of SEQ ID NO: 10. The primers that specifically amplify the methylated PRRX1 gene may comprise the primer pair of SEQ ID NOs: 9 and 10.

[0089] The forward primer that specifically amplifies the methylated ABCC9 gene may comprise, for example, the sequence of SEQ ID NO: 11. The reverse primer may comprise, for example, the sequence of SEQ ID NO: 12. The primers that specifically amplify the methylated ABCC9 gene may comprise the primer pair of SEQ ID NOs: 11 and 12.

[0090] The reverse primer of the primers may further include a label.

[0091] The label contained in the reverse primer may be, but is not limited to, biotin, FAM, Cy5, Cy3, FITC, EDANS (5-(2'-aminoethyl)amino-1-naphthalene sulfate), tetramethylrhodamine (TMR), tetramethylrhodamine isocyanate (TMRITC), x-rhodamine, DIG, or an antibody or nanoparticles bound thereto.

[0092] The amplification of the target nucleic acid can be detected by reacting the label with a binding agent that induces color development and confirming whether color development or fluorescence occurs, where the binding agent may be, but is not limited to, streptavidin.

[0093] The method may further comprise the step of treating with a probe capable of hybridizing complementary to the methylated PRRX1 or ABCC9 gene specifically amplified by the primers.

[0094] In a hybridization reaction, the conditions used to achieve a specific level of stringency vary depending on the nature of the nucleic acid to be hybridized. For example, the length of the nucleic acid to be hybridized, the degree of homology, the nucleotide sequence composition (e.g., GC / AT composition ratio), and the nucleic acid type (e.g., RNA, DNA) are taken into consideration when selecting hybridization conditions. Another consideration is whether the nucleic acid is immobilized, for example, on a filter.

[0095] Examples of highly stringent conditions are as follows: 2X SSC / 0.1% SDS at room temperature (hybridization conditions); 0.2X SSC / 0.1% SDS at room temperature (low stringency conditions); 0.2X SSC / 0.1% SDS at 42°C (moderate stringency conditions); and 0.1X SSC at 68°C (high stringency conditions). The wash process can be performed using one of these conditions, e.g., high stringency conditions, or each of the above conditions, in the order listed above, for 10-15 minutes each, with some or all of the above conditions repeated. However, as noted above, optimal conditions vary depending on the particular hybridization reaction involved and can be determined empirically. Generally, high stringency conditions are used for hybridization of the probe of interest.

[0096] The probe capable of complementary hybridization to the amplified methylated PRRX1 or ABCC9 gene may comprise, for example, the sequence of SEQ ID NO: 13 or 14. The probe capable of complementary hybridization to the amplified methylated PRRX1 gene may comprise the sequence of SEQ ID NO: 13. The probe capable of complementary hybridization to the amplified methylated ABCC9 gene may comprise the sequence of SEQ ID NO: 14.

[0097] Specifically, the primers and probes for detecting methylation of the PRRX1 gene and / or ABCC9 gene according to the present invention are as follows:

[0098] TIFF2026500727000006.tif43170

[0099] Optionally, it may further comprise one or more reagents that differentially modify the methylated PRRX1 gene and / or ABCC9 gene and the unmethylated PRRX1 gene and / or ABCC9 gene.

[0100] The one or more reagents that convert methylated DNA and unmethylated DNA differently can be used without limitation as long as they can distinguish between unmethylated and methylated cytosine bases, and may include, but are not limited to, bisulfite, hydrogen sulfite, disulfite, and combinations thereof. Specifically, the reagents may leave methylated cytosine bases unchanged, and convert unmethylated cytosine bases to uracil or a base other than cytosine.

[0101] When genomic DNA is treated with bisulfite, if the cytosine in the 5'-CpG'-3 site is methylated, it remains as cytosine, and if it is unmethylated, it is converted to uracil or a base other than cytosine. Therefore, by targeting the base sequence modified after bisulfite treatment, a primer corresponding to the site where the 5'-CpG-3' base sequence exists can be prepared.

[0102] The nucleic acid isolated from a specimen is obtained by a sample, which is a biological specimen of the specimen. To diagnose lung cancer or the stage of lung cancer, nucleic acid must be isolated from lung tissue by scraping or biopsy. Such a sample may be obtained by several medical procedures known in the art.

[0103] The degree of methylation of the nucleic acid in the sample obtained from the specimen is measured by comparing it with the same nucleic acid in a specimen without a lung tissue cell growth abnormality. Hypermethylation or hypermethylation refers to the presence of methylated alleles in one or more nucleic acids. When the same nucleic acid is examined in a specimen without a lung tissue cell growth abnormality, no methylated alleles are present.

[0104] The present invention is based on the discovery of an association between hypermethylation or hypermethylation of the PRRX1 (Paired Related Homeobox 1) and / or ABCC9 (ATP Binding Cassette Subfamily C Member 9) genes and lung cancer.

[0105] "Normal" cells refer to cells that do not exhibit abnormal cell morphology or altered cytological properties. "Tumor" cells refer to cancer cells, and "non-tumor" cells refer to cells that are part of diseased tissue but are not considered to be part of a tumor site.

[0106] According to the present invention, the methylation status of one or more nucleic acids isolated from a sample can be determined to enable early diagnosis of a cell growth disorder in lung tissue of the sample. The methylation status of the one or more nucleic acids may be compared with the methylation status of one or more nucleic acids isolated from a sample that does not have a cell growth disorder in lung tissue. The nucleic acid is preferably a CpG-containing nucleic acid, such as a CpG island.

[0107] According to the present invention, a predisposition to a cell growth disorder in lung tissue of a sample can be diagnosed by determining the methylation of one or more nucleic acids isolated from the sample, which may be characterized by comparing the methylation status of one or more nucleic acids isolated from a sample that does not have a predisposition to a cell growth disorder in lung tissue.

[0108] "Predisposition" refers to a tendency to develop the cell proliferation abnormality. A predisposed subject is one who does not yet have a cell proliferation abnormality, but who has the presence or increased propensity to have a cell proliferation abnormality.

[0109] The presence of CpG methylation in the target DNA may be indicative of lung cancer, for example, CpG methylation in promoter regions of the target DNA may be measured.

[0110] Typically, CpG-containing genes are DNA. However, the method of the present invention can be applied to samples containing, for example, DNA or RNA, including DNA and mRNA, where the DNA or RNA may be single-stranded or double-stranded, or may be characterized as a sample containing a DNA-RNA hybrid.

[0111] A mixture of nucleic acids can also be used. The term "multiple" as used herein refers to both cases where there are multiple specific nucleic acid sequence sites to be detected within a single gene and cases where multiple target DNAs are contained within a single tube (single reaction vessel). The specific nucleic acid sequence to be detected may be a fraction of a larger molecule, or may exist in the form of an isolated molecule in which the specific sequence constitutes the entire nucleic acid sequence. The nucleic acid sequence does not need to be a nucleic acid present in a pure form; the nucleic acid may be a minor fraction within a complex mixture, such as the entire human DNA.

[0112] Specifically, the present invention is directed to detecting the methylation of multiple target DNAs in a sample in a single reactor, and the sample may contain multiple target DNAs. The target DNAs may be any gene, including control genes, that affects the onset or progression of lung cancer when their expression is suppressed due to abnormal methylation.

[0113] As used herein, the terms "sample," "clinical sample," or "specimen" refer to a wide range of biological fluids, including any biological fluid obtained from an individual, body fluids, cell lines, tissue cultures, etc., depending on the type of analysis being performed. Methods for obtaining body fluids and tissue biopsies from mammals are generally well known.

[0114] In the present invention, the sample may be characterized by being derived from a human body, and for example, the sample may be lung cancer tissue, cells, stool, urine, blood, serum, respiratory lavage fluid, such as bronchial lavage fluid, or plasma.

[0115] In the primers used in the present invention, when a reagent, e.g., bisulfite, is used in step (a), the cytosine at the 5'-CpG'-3 site remains as cytosine if it is methylated, and is converted to uracil if it is unmethylated. Therefore, a primer corresponding to the site where the 5'-CpG-3' base sequence exists can be prepared by targeting the base sequence converted after treatment with a reagent, e.g., bisulfite.

[0116] The primers may be made to be "approximately" complementary to each strand of the gene locus to be amplified, meaning that the primers have sufficient complementarity to hybridize with corresponding nucleic acid strands under the conditions of the polymerization reaction.

[0117] In yet another aspect, the present invention relates to a kit for detecting methylation of target DNA, which comprises the composition.

[0118] In one embodiment, the kit may include a compartmented carrier means for containing a sample, a container containing a reagent, and a container containing a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 gene and / or a container containing a substance capable of detecting the presence or absence of CpG island methylation in the ABCC9 gene. Optionally, the kit may further include containers containing probes for detecting the methylated PRRX1 gene and / or methylated ABCC9 gene amplification products, respectively.

[0119] The carrier means is suitable for containing one or more containers, such as bottles, tubes, etc., each containing an individual component used in the method of the present invention. With the present invention in mind, one skilled in the art can easily dispense the required formulations into the containers.

[0120] According to the present invention, lung cancer can be diagnosed by examining the methylation of the marker gene PRRX1 or ABCC9 gene.

[0121] By examining the methylation of the marker gene PRRX1 or ABCC9 gene using a sample exhibiting a normal phenotype, the possibility of progression to lung cancer can be diagnosed.

[0122] "Cell transformation" refers to a change in cellular characteristics from one morphology to another, such as from normal to abnormal, from non-neoplastic to neoplastic, from undifferentiated to differentiated, or from stem cell to non-stem cell. Furthermore, the transformation may be recognized by the morphology, phenotype, biochemical properties, etc. of the cell.

[0123] As used herein, "early detection" of cancer refers to the detection of possible cancer before metastasis, preferably before morphological changes are observed in the specimen tissue or cells. Furthermore, "early detection" of cell transformation refers to the high probability of transformation occurring at an early stage, before the cells reach a transformed morphology.

[0124] The present invention allows the use of PRRX1 or ABCC9 genes individually or in combination as diagnostic or predictive markers for lung cancer. When PRRX1 and ABCC9 genes are used in combination, they can be used in the form of a panel display. In this case, the number of methylated genes and their importance can be ranked and weighted, allowing the level of likelihood of progression to cancer to be determined.

[0125]

[0126] The present invention will be described in more detail below using examples. It will be apparent to those skilled in the art that these examples are merely for the purpose of illustrating the present invention and are not to be construed as limiting the scope of the present invention.

[0127]

[0128] Example 1: Discovery of lung cancer-specific methylated genes

[0129] To select biomarkers specifically methylated in lung cancer, 500 ng of genomic DNA from cancer tissues and adjacent normal tissues obtained from surgical tissues of 13 lung cancer patients (listed as I-III, provided by Chungnam National University Hospital) was ultrasonically pulverized (Vibra Cell, SONICS) to prepare genomic DNA fragments of approximately 200-300 bp.

[0130] To isolate methylated DNA from genomic DNA, we used a methyl-binding domain (MBD), known to bind to methylated DNA, as described by Oh et al. (J. Mol. Diag. 2013;15(4):498-507). The resulting methylated DNA was amplified by MBD2bt as described by Oh et al. (J. Mol. Diag. 2013;15(4):498-507) and hybridized to a human 244K human CpG microarray (Agilent, USA) (Figure 1). After hybridization, the array was washed and scanned using a laser scanner (Agilent, USA). Signal values ​​from microarray images were calculated using the Feature Extraction program v.9.5.3.1 (Agilent, USA) to calculate the relative intensity difference of signals between lung cancer tissues from lung cancer patients and adjacent normal tissue samples.

[0131] To select probes with reliable hybridization signals, we used the GeneSpring 7.3.1 program (Agilent, USA). From these, we performed an analysis of variance (ANOVA) comparing lung cancer-specific hypermethylated normal tissues with lung cancer tissues, and selected 6,854 probes with a P value of 0.05 or less. From these, we further selected 621 probes that were, on average, four times more hypermethylated in lung cancer tissues than in normal tissues. From these, we identified two novel biomarker gene candidates (PRRX1 and ABCC9) that have not been reported to be hypermethylated in lung cancer, among genes that simultaneously showed hypermethylation in two or more promoter-linked probes (Figure 2).

[0132] The two biomarker candidate genes analyzed by this method are listed in Table 1. In addition, the presence of CpG islands was confirmed using MethPrimer (http: / / itsa.ucsf.edu / ~urolab / methprimer / index1.html) for the base sequences corresponding to the probes of these two genes that showed hypermethylation in the CpG microarray analysis.

[0133] [Table 1]

[0134]

[0135] Example 2: Confirmation of methylation of two biomarker candidate genes in lung cancer cell lines

[0136] To further confirm the methylation status of the biomarker candidate genes selected in Example 1, pyrosequencing was performed on each promoter site.

[0137] To convert unmethylated cytosines to uracils using bisulfite, total genomic DNA was isolated from the lung cancer cell line H358 (Korean Cell Line Bank, KCLB No. 25807). 200 ng of the genomic DNA was treated with bisulfite using the EZ DNA methylation-Gold kit (Zymo Research, USA). Bisulfite treatment of DNA converts unmethylated cytosines to uracils, while methylated cytosines remain unchanged. The bisulfite-treated DNA was eluted in 20 μL of sterile distilled water and subjected to pyrosequencing.

[0138] The PCR and sequencing primers for pyrosequencing the two genes were designed using PyroMark Assay Design 2.0 (QIAGEN, Germany). The PCR and sequencing primers for measuring the methylation of each gene are listed in Table 2 below.

[0139] [Table 2]

[0140]

[0141] 20 ng of bisulfite-converted genomic DNA was amplified by PCR. PCR reaction solution (20 ng of bisulfite-converted genomic DNA, TOPsimple TM DryMIX-HOT (Enzynomics, P581H, Korea) and 2 μL (10 pmole) of PCR primer were treated at 95°C for 5 minutes, followed by 45 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, followed by 5 minutes of reaction at 72°C. Amplification of the PCR product was confirmed by electrophoresis using a 2.0% agarose gel.

[0142] The amplified PCR products were treated with PyroMark Q48 Advanced CpG Reagents (QIAGEN, Germany) and then pyrosequencing was performed using a PyroMark Q48 Autoprep System (QIAGEN, Germany). After pyrosequencing, the degree of methylation was measured by calculating the methylation index. The methylation index was calculated by calculating the average rate of cytosine binding at each CpG site.

[0143] The methylation levels of the candidate biomarker genes in lung cancer cell lines were quantitatively measured using pyrosequencing. As shown in Figure 3A, both of the two biomarker genes were confirmed to be methylated at very high levels (over 80%) in the H358 cell line. The high methylation levels of the two genes in lung cancer cell lines indicated their potential utility as biomarkers for diagnosing lung cancer. To verify this, further methylation validation experiments using tissue samples were performed as follows.

[0144]

[0145] Example 3: Measurement of methylation of biomarker genes in cancer tissues and adjacent normal tissues of lung cancer patients

[0146] For the two novel biomarker candidate genes in Example 1 to be useful as diagnostic markers for lung cancer, they must show low methylation levels in normal lung tissues and high methylation levels in lung cancer tissues.

[0147] Therefore, the usefulness of these two genes as biomarkers was examined using lung cancer patient tissues. To this end, DNA from surgical tissues (lung cancer tissues and adjacent normal tissues) of 13 lung cancer patients used in the microarray experiment in Example 1 was treated with bisulfite, eluted with 20 μL of sterile distilled water, and used for pyrosequencing.

[0148] 20 ng of the bisulfite-converted genomic DNA was amplified by PCR. PCR reaction solution (20 ng of bisulfite-converted genomic DNA, TOP simple TM DryMIX-HOT (Enzynomics, P581H, Korea) and 2 μL (10 pmole) of PCR primer were treated at 95°C for 5 minutes, followed by 45 cycles of 95°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds, followed by 5 minutes of reaction at 72°C. Amplification of the PCR product was confirmed by electrophoresis using a 2.0% agarose gel.

[0149] Pyrosequencing was performed in the same manner as in Example 2.

[0150] As a result, as shown in Figure 3B, both genes were confirmed to show higher levels of methylation in lung cancer tissues than in normal tissues. PRRX1 showed higher methylation levels in lung cancer tissues from 13 of 13 patients (100%), and ABCC9 showed higher methylation levels in lung cancer tissues from 12 of 13 patients (92.3%) than in the adjacent normal tissues.

[0151] Table 3 shows the average methylation levels of the PRRX1 and ABCC9 genes in lung cancer tissues and adjacent normal tissues. A chi-square test was performed to confirm whether the methylation levels of lung cancer tissues and normal tissues were statistically significantly different. The results showed a high level of significance, with a p-value of less than 0.0001 (Table 3).

[0152] [Table 3]

[0153]

[0154] Example 4: Evaluation of the lung cancer diagnostic ability of novel biomarker genes PRRX1 and ABCC9 in bronchial lavage fluid

[0155] To further evaluate the diagnostic ability of the two candidate genes for lung cancer, methylation was analyzed in bronchial lavage fluids from patients with lung cancer and patients with benign lung diseases.

[0156] A quantitative methylation-specific real-time PCR (qMSP) method was established for methylation analysis. The primer and probe sequences used for methylation analysis are listed in Table 4.

[0157] [Table 4]

[0158] After confirming methylation in lung cancer cell lines, the same method was used to measure methylation in bronchial lavage DNA. Genomic DNA was isolated from bronchial lavage fluid (provided by Gongyang University Hospital) of 20 patients without lung cancer and 20 patients with lung cancer. 40 ng of the isolated genomic DNA was treated with bisulfite using the EZ DNA methylation-Gold kit (Zymo Research, USA), eluted with 10 μL of sterile distilled water, and subjected to qMSP. The PCR conditions and reaction solution composition were identical to those for bronchial lavage fluid in Table 5. PCR results were normalized at 35-ΔC. T (Biomarker gene C T -Control gene C T ) values ​​and then analyzed.

[0159] [Table 5]

[0160] Methylation of these two biomarker candidates was measured in bronchial lavage fluid, and it was confirmed that methylation was higher in lung cancer patients than in non-lung cancer patients (Figure 4). To evaluate the lung cancer diagnostic ability of these two genes, receiver operating characteristics (ROC) curve analysis was performed to determine the optimal cutoff for lung cancer diagnosis and evaluate the sensitivity and specificity (Figure 4). As a result, the PRRX1 gene had a sensitivity of 80% (16 / 20) and a specificity of 100% (20 / 20) for lung cancer diagnosis (Table 6). The ABCC9 gene had a sensitivity of 75% (15 / 20) and a specificity of 80% (16 / 20) for lung cancer diagnosis (Table 6).

[0161] [Table 6]

[0162] In conclusion, of these two genes, PRRX1 was confirmed to have excellent sensitivity and specificity for diagnosing lung cancer and to be useful for lung cancer diagnosis, and was therefore secured as the final biomarker.

[0163]

[0164] Example 5: Evaluation of the diagnostic ability of the PRRX1 novel biomarker gene in blood for lung cancer

[0165] The diagnostic ability of the novel PRRX1 biomarker in lung cancer was evaluated in plasma using the same method as in Example 4. To do so, DNA was isolated from 1.0 mL of plasma from five normal subjects (provided by Ulji University Hospital) and five lung cancer patients (provided by Chungnam National University Hospital), and then bisulfite-treated using the EZ DNA methylation-Gold kit (Zymo Research, USA). The DNA was then eluted with 5 μL of sterile distilled water and methylation was measured using qMSP in the same manner as in Example 4.

[0166] As a result, we confirmed that methylation was increased in lung cancer patients compared to normal individuals (Figure 5). These results confirmed that the PRRX1 novel biomarker gene is also useful for diagnosing lung cancer using blood.

[0167] [Industrial Applicability]

[0168] The present invention presents the PRRX1 or ABCC9 gene as a lung cancer-specific methylation marker, and by using the PRRX1 or ABCC9 gene as a biomarker to detect the presence or absence of methylation, methylation can be detected with high detection sensitivity, and lung cancer can be usefully diagnosed through accurate and rapid lung cancer detection.

[0169]

[0170] Although certain parts of the present invention have been described in detail above, it will be apparent to those skilled in the art that such specific descriptions are merely preferred embodiments and do not limit the scope of the present invention. Therefore, the true scope of the present invention is defined by the appended claims and their equivalents.

[0171] Sequence Catalog Free Text

[0172] Attached as an electronic file.

Claims

1. A lung cancer diagnostic composition comprising a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) gene and / or the ABCC9 (ATP Binding Cassette Subfamily C Member 9) gene.

2. The composition of claim 1, wherein the CpG island is located in the promoter of the PRRX1 gene or the ABCC9 gene.

3. The composition according to claim 1, wherein the CpG island of the PRRX1 gene is located at positions −1,505 to −1,299 from the transcription start site in the sequence of SEQ ID NO:

1.

4. The composition according to claim 1, wherein the CpG island of the ABCC9 gene is located at positions −373 to −220 from the transcription start site in the sequence of SEQ ID NO:

2.

5. The composition of claim 1, wherein the substance capable of detecting the presence or absence of CpG island methylation is a primer or primer pair capable of amplifying a fragment containing a methylated CpG island, a probe capable of hybridizing to the methylated CpG island, a sequencing primer, a sequencing bi-synthesis primer, or a sequencing bi-ligation primer.

6. The composition of claim 1, wherein the substance capable of detecting the presence or absence of CpG island methylation is one or more primers selected from the group consisting of sequences of SEQ ID NOs: 3 to 12, or a probe comprising the sequence of SEQ ID NO: 13 or 14.

7. The composition of claim 1, further comprising one or more reagents that differentially modify methylated PRRX1 and / or ABCC9 genes and unmethylated PRRX1 and / or ABCC9 genes.

8. 8. The composition of claim 7, wherein the reagent is bisulfite, hydrogen sulfite, disulfite, or a combination thereof.

9. A lung cancer diagnostic kit comprising the composition according to any one of claims 1 to 8.

10. A method for providing information for diagnosing lung cancer, comprising the step of treating a sample with a substance capable of detecting the presence or absence of CpG island methylation in the PRRX1 (Paired Related Homeobox 1) gene and / or the ABCC9 (ATP Binding Cassette Subfamily C Member 9) gene.

11. The method of claim 10, wherein the CpG island is located in the promoter of the PRRX1 gene or the ABCC9 gene.

12. The method according to claim 10, wherein the CpG island of the PRRX1 gene is located at positions -1,505 to -1,229 from the transcription start site in the sequence of SEQ ID NO:

1.

13. The method according to claim 10, wherein the CpG island of the ABCC9 gene is located at positions −373 to −220 from the transcription start site in the sequence of SEQ ID NO:

2.

14. The method of claim 10, characterized in that the substance capable of detecting the presence or absence of CpG island methylation is a primer or primer pair capable of amplifying a fragment containing a methylated CpG island, a probe capable of hybridizing to the methylated CpG island, a sequencing primer, a sequencing bi-synthesis primer, or a sequencing bi-ligation primer.

15. The method of claim 10, wherein the substance capable of detecting the presence or absence of CpG island methylation is one or more primers selected from the group consisting of sequences of SEQ ID NOs: 3 to 12, or a probe comprising the sequence of SEQ ID NO: 13 or 14.

16. The method of claim 10, further comprising a step of treating with one or more reagents that differentially modify the methylated PRRX1 and / or ABCC9 genes and the unmethylated PRRX1 and / or ABCC9 genes.

17. 11. The method of claim 10, wherein the substance is bisulfite, hydrogen sulfite, disulfite, or a combination thereof.

Images