Use of Staphylococcus epidermidis strains that produce indole metabolites and their use for improving the skin barrier - Patents.com

By using indole compounds produced by the Staphylococcus epidermidis strain to activate the skin's self-repair mechanism, the problem of existing skincare products being unable to provide long-term hydration and enhance the skin barrier is solved, achieving lasting skin hydration and barrier function enhancement effects.

JP2026501198APending Publication Date: 2026-01-14LOREAL SA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025535395
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2022-12-21
Filing Date
2023-12-20
Publication Date
2026-01-14

AI Technical Summary

Technical Problem

Common moisturizing ingredients in existing skincare products cannot maintain skin hydration in the long term and cannot effectively activate the skin's self-repair mechanism, leading to a decline in skin barrier function and problems such as dryness, tightness, and itching, which are more pronounced under the influence of external environmental and internal factors.

Method used

Using a specific Staphylococcus epidermidis strain, it activates the mammalian receptor (AhR) pathway and promotes keratinocyte differentiation by producing specific metabolites such as indole compounds (e.g., indole-3-lactic acid, indole-3-formaldehyde, indole-3-acetic acid and their salts), thereby enhancing skin barrier function and moisturizing effect.

Benefits of technology

It significantly enhances the skin barrier function, improves skin hydration and elasticity, reduces dryness and tightness, relieves itching, and improves skin texture in the long term, especially for dry skin and skin with eczema and other skin conditions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026501198000001
    Figure 2026501198000001
  • Figure 2026501198000002
    Figure 2026501198000002
  • Figure 2026501198000003
    Figure 2026501198000003
Patent Text Reader

Abstract

The present invention relates to isolated live bacterial strains of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, as well as compositions comprising them. The present invention also relates to the use of such strains for preventing a decline in and / or strengthening the skin barrier function in an individual, for improving skin moisturization, for improving skin quality, in particular the quality of dry skin, for preventing and / or treating cosmetic signs associated with dry skin, in particular selected from tightness, itching, discomfort, a dull complexion, rough skin and pronounced microrelief of the skin, and / or for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis, and / or for the prevention and / or treatment of atopic dermatitis, as well as to a non-therapeutic cosmetic method for caring for keratinous materials, said non-therapeutic cosmetic method comprising at least one step of topically applying such strains or compositions to said keratinous materials.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] The present invention relates to a Staphylococcus epidermidis bacterial strain and to its use for improving the barrier function and moisturizing the skin.

[0002] More particularly, the present invention provides a live bacterial strain of the species Staphylococcus epidermidis in isolated form or contained in a composition, in particular a cosmetic composition, which composition further comprises a physiologically acceptable medium, and in particular for caring for keratinous materials.

[0003] Furthermore, the present invention relates to a composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, which comprises, in a physiologically acceptable medium, Staphylococcus epidermidis, capable of producing a mixture of indoles comprising indole-3-lactic acid and / or salts thereof, indole-3-carboxaldehyde and / or salts thereof and indole-3-acetic acid and / or salts thereof. epidermidis); and at least one adjuvant selected from the group consisting of a fatty substance; an organic solvent selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, and tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol), and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; an ionic or nonionic, hydrophilic or lipophilic thickener; an emollient; an opacifier; a stabilizer; a silicone; an antifoaming agent; a fragrance; a preservative; an anionic, cationic, nonionic, zwitterionic, or amphoteric surfactant; a filler; a polymer; a propellant; and combinations thereof.

[0004] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a live bacterial strain or of a composition according to the invention for preventing a decline in the skin barrier function in an individual and / or for strengthening said skin barrier function.

[0005] The present invention additionally relates to the cosmetic use, especially the topical cosmetic use, of a live bacterial strain according to the invention or of such a composition to improve skin moisturization.

[0006] The present invention also provides to improve skin quality, in particular the quality of dry skin, and / or For preventing and / or treating cosmetic signs associated with dry skin, in particular cosmetic signs associated with dry skin selected from tautness, itching, feelings of discomfort, dull complexion, skin roughness and marked microrelief of the skin, The present invention relates to the cosmetic use, especially the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention.

[0007] The present invention additionally relates to the cosmetic use, especially the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.

[0008] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of such compositions for the prevention and / or treatment of atopic dermatitis.

[0009] Finally, the present invention relates to a non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, especially dry skin, which comprises topically applying to these keratinous materials a live bacterial strain according to the invention or a composition according to the invention. [Background technology]

[0010] Skin is a tissue in which cells are interconnected and integrally attached to one another. Skin tissue forms the outer covering, which contains sebaceous or sweat glands and hair follicles. Skin is an epithelium that constantly renews. This renewal, or desquamation, is a regulated and finely controlled process that results in the imperceptible removal of superficial cells.

[0011] Human skin consists of two parts: the upper epidermis and the deep compartment dermis.

[0012] The epidermis is conventionally divided into a basal layer of keratinocytes that constitutes the germinal layer of the epidermis; a spinous layer consisting of several layers of polyhedral cells located above the germinal layer; one to three "granular" layers composed of flat cells containing distinct cytoplasmic inclusions called keratohyalin granules; and finally, a set of upper layers called the cornified layers (or stratum corneum) composed of keratinocytes, which are in the final stage of differentiation. The organization and, above all, cohesion between these various cell layers is made possible by a series of intercellular junctions, including adherens junctions, which contribute to maintaining homeostasis in epithelial tissues. These adherens junctions are specifically referred to as desmosomes. Desmosomes are composed of transmembrane proteins from the cadherin family, such as desmoglein. These junctions play an essential role in the structure, maintenance, and architectural cohesion of the epidermis and allow the transmission and attenuation of mechanical forces acting on keratinocytes. These adherens junctions are primarily present in the middle to uppermost layers of the epidermis, i.e., the cornified layer composed of keratinocytes.

[0013] Keratinocytes are anucleate cells composed primarily of cytokeratin-containing fibrous material, surrounded by a cornified envelope (CE), and comprise, among other things, the protein filaggrin. Filaggrin aggregates keratin filaments into macrofibrils in the lower stratum corneum. Closer to the skin surface, filaggrin is primarily degraded to free amino acids, which form the main components of the highly hygroscopic complex natural moisturizing factor (NMF). NMF is important for maintaining stratum corneum moisture and skin suppleness.

[0014] New keratinocytes are constantly being produced to compensate for the continuous loss of epidermal cells in the cornified layers, by a mechanism referred to as desquamation.

[0015] Nevertheless, an imbalance between cell production and desquamation rate in the stratum basale can lead to the formation of scales on the skin surface, among other things. Similarly, for various reasons, a lack of terminal differentiation of cells in the stratum corneum can result in the formation of large, thick cell clusters, referred to as "squamae," visible to the naked eye, and in other situations, a thinning of the stratum corneum.

[0016] In addition, the overall junction system responsible for cell-cell cohesion is reduced, which directly results in a reduction in the effectiveness of the skin's barrier function.

[0017] Thus, one or more of these internal factors can result in a weakening in the barrier function of the epidermis, chronic dehydration of the stratum corneum, loss of mechanical elasticity, tautness of the skin, and also loss of skin radiance and clarity.

[0018] In parallel, a weakening of the skin barrier can also occur in the presence of external aggressors, in particular chosen from irritants (detergents, acids, bases, oxidizing agents, reducing agents, concentrated solvents, gases or harmful fumes), temperature or climatic imbalances (cold, drought, radiation), xenobiotics (undesirable microorganisms, allergens, pollutants), or in the presence of internal aggressors, for example psychological stress.

[0019] One of the key steps in the terminal differentiation process of the stratum corneum is the cross-linking of precursor proteins of the cornified envelope (CE). This phenomenon plays an essential role in the development and maintenance of skin cohesion, the physical properties of skin, such as its barrier function, and is a step in the terminal differentiation process mentioned above. The cornified envelope is an essential component of the keratinocyte.

[0020] Commonly used moisturizing active ingredients, such as moisturizers, moisturizing polymers, or occlusive fatty substances, such as liquid petroleum jelly, temporarily change the surface properties of the skin. These active ingredients can cause mechanical softening of the stratum corneum, increasing its moisturizing state and / or improving the micro-relaxation of the skin by forming a film on the skin surface. However, these effects do not necessarily last particularly long over time and disappear after cleansing the skin.

[0021] Moreover, these active ingredients can be removed by cleansing action.

[0022] To overcome these drawbacks, it may be advantageous to select active ingredients that have beneficial effects on biological pathways and biomarkers involved in skin barrier function.

[0023] In addition to the aforementioned key factors involved in skin barrier function, especially filaggrin and adherens junctions (desmogleins), the tryptophan metabolic pathway, i.e., the aryl hydrocarbon receptor (AhR) pathway, has attracted particular attention because it is known to be involved in various skin disorders, such as accelerated aging and inflammation (Parrado, C. et al. Front. Pharmacol. 10, (2019); Krutmann, J. Dermatol. Sci. 85, 152-161 (2017); Vogeley, C., Int. J. Mol. Sci. 20, (2019); Hidaka, T., Front. Med. 6, (2019); Stockinger, B. Annu. Rev. Immunol. 32, 403-432 (2014)).

[0024] It is also known to be essential for the integrity of the skin barrier (Haas, K. et al. J. Invest. Dermatol. 136, 2260-2269 (2016)), and its activation, particularly by the OVOL1 gene, can improve the skin barrier in the context of atopic dermatitis (Furue, M., Hashimoto-Hachiya, A. & Tsuji, G. Int. J. Mol. Sci. 20, (2019)). Summary of the Invention [Problem to be solved by the invention]

[0025] Therefore, there is a need to identify new active ingredients, such as desmoglein, that are able to stimulate the tryptophan metabolic pathway, i.e., the aryl hydrocarbon receptor (AhR) pathway, but also, optionally, the expression of filaggrin and / or adherens junctions.

[0026] There is a need for active ingredients that enable skin, especially dry skin, to maintain its barrier function.

[0027] There is a need for active ingredients to prevent a decline in and / or strengthen skin barrier function in individuals.

[0028] There is also a need for active ingredients that improve skin moisturization.

[0029] Moreover, there is a further need for active ingredients for improving skin quality, in particular the quality of dry skin; and / or for preventing and / or treating cosmetic signs associated with dry skin, in particular cosmetic signs selected from tightness, itching, discomfort, dull complexion, rough skin and pronounced microrelief of the skin.

[0030] There is also a need for active ingredients for preventing and / or treating pruritus, especially pruritus of skin affected by skin disorders such as atopic dermatitis.

[0031] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of such compositions for preventing and / or treating atopic dermatitis.

[0032] The object of the present invention is to solve the above-mentioned technical problems.

[0033] Indeed, the inventors have now discovered that certain bacterial strains of the species Staphylococcus epidermidis according to the invention overexpress genes for activating the AhR pathway (in particular the OVOL1 gene described by Furue et al. Int. J. Mol. Sci. 20, (2019) and, optionally, genes for stimulating differentiation (FLG-filagrin and / or DSG1-(Desmoglein 1)), and thereby prevent a decline in and / or strengthen the skin barrier function in individuals. They are therefore advantageous in improving the skin barrier function and moisturizing. [Means for solving the problem]

[0034] Thus, according to a first aspect, the present invention relates to an isolated live bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695.

[0035] The present invention also relates to a composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5904, I-5692, I-5693, I-5694 and I-5695.

[0036] The present invention additionally relates to a composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, comprising in a physiologically acceptable medium: at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and / or salts thereof, indole-3-carboxaldehyde and / or salts thereof, and indole-3-acetic acid and / or salts thereof; and at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof. The present invention relates to the above composition, which comprises:

[0037] Suitable polyols for use in the present invention are intended to be linear, branched, or cyclic, saturated or unsaturated alkyl-type compounds having at least two -OH functional groups on the alkyl chain, particularly at least three -OH functional groups, more particularly at least four -OH functional groups.

[0038] Polyols suitable for formulating the compositions according to the invention are in particular polyols containing from 2 to 32 carbon atoms, preferably from 3 to 16 carbon atoms.

[0039] "Fillers" are to be understood as colorless or white solid particles of any shape, which are in an insoluble form and are dispersed in the medium of the composition, and which may be of mineral or organic nature, and which give the composition body or rigidity and / or softness.

[0040] The fillers used in the compositions according to the invention can be lamellar, globular, spherical, fibrous, or any other intermediate shape between these defined shapes.

[0041] Fillers in the context of the present invention may be superficially coated or uncoated, and may in particular be surface-treated with silicones, amino acids, fluorinated derivatives or any other substance that promotes the dispersion and compatibility of the filler in the composition.

[0042] The fillers can be inorganic or organic.

[0043] The inorganic filler may be selected from synthetic or natural mica; silica powder; talc; kaolin; boron nitride; or combinations thereof.

[0044] The organic filler can be selected from: Silicone resin-coated organopolysiloxane powders, such as those sold by Shin-Etsu Chemical Co., Ltd. under the trade names "KSP-100", "KSP-101", "KSP-102", "KSP-103", "KSP-104", and "KSP-105"; Polymethylsilsesquioxane powders, such as those sold under the trade name TOSPEARL by Momentive Performance Materials; Polyamide powders (also known as Nylon), such as Nylon-1 (Polyamide 1), Nylon-12 (Polyamide 12), for example Nylon-66 (Polyamide 66) sold under the trade name ORGASOL by Arkema; ​​Nylon-6 (Polyamide 6); polyethylene powder; microspheres based on acrylic copolymers, such as those made from ethylene glycol dimethacrylate / lauryl methacrylate copolymer sold under the trade name POLYTRAP by Dow Corning; Expanded powders, such as hollow microspheres, in particular those sold under the trade name EXPANCEL by Nouryon; methyl polymethacrylarte microspheres, such as those sold under the trade name MICROSPHERE M-100 by Matsumoto Yushi Pharmaceutical Co., Ltd. and those sold under the trade name COVABEAD LH85 by Sensient; Ethylene-acrylate copolymer powders, such as those sold under the trade name FLOBEADS by Sumitomo Seika Chemicals Co., Ltd.; natural organic material powders, such as starch powders, in particular corn, wheat or rice starch, optionally crosslinked, for example starch powders crosslinked with octenylsuccinic anhydride, such as those sold under the trade name DRY-FLO by Nouryon; Poly-p-phenylene terephthamide powder; and combinations thereof.

[0045] The propellant may be selected from compressed or liquefied gases.

[0046] Examples of compressed gases include air, nitrogen, carbon dioxide (or carbon dioxide), and mixtures thereof.

[0047] Examples of liquefied gases include dimethyl ether, chlorinated and / or fluorinated hydrocarbons such as trichlorofluoromethane, dichlorodifluoromethane, chlorodifluoromethane, 1,1,1,2-tetrafluoroethane, chloropentafluoroethane, 1-chloro-1,1-difluoroethane, and 1,1-difluoroethane; and volatile hydrocarbons, in particular C3-C5 alkanes, such as propane, isopropane, n-butane, isobutane, and pentane, either alone or in mixture. Preferably, the hydrocarbons include propane, isopropane, n-butane, and isobutane, either alone or in mixture.

[0048] In the composition according to the invention, the live bacterial strain of the species Staphylococcus epidermidis may in particular be capable of producing a mixture of indoles comprising (i) indole-3-lactic acid (ILA) and / or salts thereof, (ii) indole-3-carboxaldehyde (IAld) and / or salts thereof, (iii) indole-3-acetic acid (IAA) and / or salts thereof, and (iv) tryptamine and / or salts thereof.

[0049] For the purposes of the present invention, the term "Staphylococcus epidermidis" refers to a strain of Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid (ILA) and / or a salt thereof, indole-3-carboxaldehyde (IAld) and / or a salt thereof, and indole-3-acetic acid (IAA) and / or a salt thereof, and optionally tryptamine and / or a salt thereof. "Live bacterial strain of the species IgE. epidermidis" means a live bacterial strain which, when contacted with human keratinocytes in a culture medium suitable for culturing human keratinocytes, in particular in KSFM medium, at a bacteria / keratinocyte ratio of 10:1, after at least 10 hours of culture, preferably after 10 to 24 hours of culture, and even better after 14 hours of culture, gives a total indoles (indole-3-lactic acid (ILA) and / or salts thereof, indole-3-carboxaldehyde (IAI) and / or salts thereof, and indole-3-acetic acid (IAA) and / or salts thereof, and optionally tryptamine and / or salts thereof) of at least 890 pmol / ml, in particular at least 1000 pmol / ml, more in particular indole-3-lactic acid (ILA) and / or salts thereof at least 770 pmol / ml, in particular at least 860 pmol / ml, and indole-3-carboxaldehyde (IAld) and / or salts thereof at least 40 pmol / ml, in particular at least 50 pmol / ml, and Indole-3-acetic acid (IAA) and / or salts thereof at least 80 pmol / ml, in particular at least 90 pmol / ml, and optionally Tryptamine and / or its salts at least 0.5 pmol / ml, particularly at least 1 pmol / ml This allows production at a concentration of

[0050] The bacterial strain of the species Staphylococcus epidermidis of the composition according to the invention is particularly capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and / or salts thereof, (ii) indole-3-carboxaldehyde and / or salts thereof, (iii) indole-3-acetic acid and / or salts thereof, and (iv) tryptamine and / or salts thereof.

[0051] The bacterial strain of the species Staphylococcus epidermidis of the composition according to the invention may more particularly be selected from the group consisting of the bacteria with reference ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and in particular from the group consisting of the bacteria with reference ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.

[0052] As shown in the examples below, the applicant has surprisingly discovered that the bacterial strain according to the invention overexpresses genes for activating the AhR pathway (in particular the OVOL1 gene) and, optionally, genes for stimulating differentiation (FLG-filaggrin and / or DSG1-desmoglein 1), thus making it possible to prevent a decline in and / or strengthen the skin barrier function. This discovery forms the basis of the present invention (see, for example, Hoober JK, Eggink LL. Int. J. Mol. Sci., 2022 Jan 27;23(3):1455).

[0053] In fact, filaggrin (FLG) is a major structural protein involved in the skin's surface barrier. Mutations in the gene encoding filaggrin are the most important risk factor for skin diseases. Approximately 50% of patients with atopic dermatitis have loss-of-function mutations in filaggrin. Esparza-Gordillo et al. (Curr Opin Allergy Clin Immunol. 2010 Oct;10(5):418-26) showed that 10%-20% of people in industrialized countries suffer from atopic dermatitis, and that mothers with FLG gene mutations have a strong predisposition to the condition in children. Mutations in the FLG gene have also been associated with ichthyosis vulgaris, a common skin disease characterized by dry, squamous epithelium with a prevalence of at least 1 in 250 people.

[0054] Furthermore, DSG1 encodes desmoglein 1, a major component of desmosomes. Desmosomes connect the cell surface to the keratin cytoskeleton and play an important role in maintaining epidermal integrity and barrier function. Mutations causing psoriasiform dermatitis, SAM syndrome (severe dermatitis, multiple allergies, and metabolic wasting syndrome), are reflected in the lack of membrane expression of DSG1, resulting in a loss of cell-cell adhesion (Oh, J. et al. Nature 514, 59-64 (2014)). Lack of desmoglein 1 leads to severe dermatitis, multiple allergies, and metabolic disorders (Samuelov L et al. Nat Genet. 2013 Oct;45(10):1244-1248; Lisa M Godsel et al. J Clin Invest. 2022 Feb 1;132(3):e144363).

[0055] These two proteins are therefore key to the barrier role played by the skin.

[0056] The compositions according to the invention may be particularly suitable for topical administration.

[0057] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for preventing a decline in the skin barrier function in the body and / or for strengthening said skin barrier function. For the purposes of the present invention, the individual is preferably a human being.

[0058] The present invention additionally relates to the cosmetic use, especially the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for improving skin moisturization.

[0059] The present invention relates to the cosmetic use, especially the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for improving skin quality, especially the quality of dry skin.

[0060] The present invention additionally relates to the cosmetic use, especially the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for preventing and / or treating cosmetic signs associated with dry skin, in particular cosmetic signs associated with dry skin selected from tightness, itching, discomfort, dull complexion, rough skin and pronounced microrelief of the skin.

[0061] Dry skin, also known as "xerosis," can appear at any age and may not be associated with a medical condition.

[0062] The present invention further relates to the cosmetic use, especially the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for preventing and / or treating pruritus, especially pruritus of skin affected by skin disorders, such as atopic dermatitis.

[0063] The present invention also relates to the cosmetic use, in particular the topical cosmetic use, of a composition according to the invention or of at least one bacterial strain according to the invention for the prevention and / or treatment of atopic dermatitis.

[0064] The compositions used according to the invention or the bacterial strains used according to the invention can in particular be administered topically to an individual.

[0065] Finally, the present invention also relates to a non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, especially dry skin, which comprises topically applying to these keratinous materials at least one live bacterial strain according to the invention or a composition according to the invention.

[0066] Other features, aspects and advantages of the present invention will become apparent from reading the following detailed description. DETAILED DESCRIPTION OF THE INVENTION

[0067] Bacterial strains according to the invention

[0068] Staphylococcus epidermidis, the white staphylococcus, is a normal human bacterium and is part of the mucocutaneous flora of virtually all humans.

[0069] The present inventors have identified a novel strain of Staphylococcus epidermidis that possesses the specific capabilities described above.

[0070] Consequently, the present invention relates to an isolated bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.

[0071] In particular, the isolated bacterial strain of the species Staphylococcus epidermidis according to the present invention is selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695.

[0072] A strain according to the invention is preferably the bacterial strain deposited at the CNCM under deposit number I-5691.

[0073] The above-mentioned specific capabilities of the bacterial strains according to the invention are mainly due to their ability to produce a particular mixture of indoles, as demonstrated in the examples.

[0074] Therefore, the bacterial strains according to the invention should preferably be administered live.

[0075] The term "live" is understood according to the present invention to mean metabolically active or reactivatable bacteria, e.g., bacteria in fresh or freeze-dried form, also referred to as dry form. Thus, within the meaning of the present invention, the term "live" is also understood to cover bacteria that have been inactivated but may be reactivatable. Consequently, dead bacteria, i.e., bacteria that have been metabolically inactivated but can no longer be reactivated, e.g., bacteria in lysed form, are not covered by the present invention.

[0076] The live bacterial strains according to the present invention may be in encapsulated or microencapsulated form. Processes for encapsulating bacteria and various types of capsules are well known to those skilled in the art. For example, Antunes et al., 2013 (Food Science and Technology 54:125-131) describe a microencapsulation process in which a bacterial suspension is immobilized in cellulose acetate with glycerol, maltodextrin, and Tween. During spray drying, the bacterial suspension is nebulized using a single nozzle in a heated zone (100°C-200°C). Thus, the water contained in the suspension evaporates, and a dry bacterial powder is obtained. The resulting powder resembles a matrix containing the microorganisms, instead of microcapsules containing a water-insoluble and water-impermeable shell, with the microcapsule core containing the microorganisms contained in a non-aqueous composition.

[0077] The term "microencapsulation" or "microcapsule" refers to a product obtained by a microencapsulation process, in which particles or droplets of minute size (on the order of micrometers) are surrounded by a coating to obtain small capsules with many useful properties. In the context of the present invention, it is used to entrap bacteria according to the invention. In its relatively simplest form, a microcapsule is a small sphere surrounded by a uniform wall. The material inside the microcapsule is referred to as the core, internal phase or filler, while the wall is referred to as the shell, coating or membrane.

[0078] Those skilled in the art will recognize that there are numerous methods for producing microcapsules, and that the present invention is not limited to any of these methods. Microencapsulation methods suitable in the context of the present invention include, but are not limited to, pan coating, air suspension coating, centrifugal extrusion, vibrating nozzle, spray drying, ionotropic gelation, coacervation and phase separation, interfacial polycondensation, interfacial crosslinking, in situ polymerization, and matrix polymerization.

[0079] The strains according to the invention are preferably administered by topical application to the keratinous material in question, in particular to the skin, especially to the dry skin in question.

[0080] Compositions according to the invention

[0081] The present invention also relates to a composition comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis, selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695. In particular, the live bacterial strain is selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695, in particular the bacterium deposited at the CNCM under deposit number I-5691.

[0082] Of course, the composition according to the invention may contain one type of bacterial strain as indicated above, or a mixture of at least two or more bacterial strains as indicated above.

[0083] The composition according to the invention preferably does not contain any strains different from those indicated above.

[0084] The present invention also provides a composition comprising, in a physiologically acceptable medium: at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and / or salts thereof, indole-3-carboxaldehyde and / or salts thereof, and indole-3-acetic acid and / or salts thereof; and at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof. The present invention relates to a composition comprising:

[0085] The composition according to the invention is preferably a cosmetic composition, in particular a cosmetic composition for caring for keratinous materials.

[0086] In particular, the composition according to the present invention comprises at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing indoles including (i) indole-3-lactic acid and / or salts thereof, (ii) indole-3-carboxaldehyde and / or salts thereof, (iii) indole-3-acetic acid and / or salts thereof, and (iv) tryptamine and / or salts thereof.

[0087] Such strains may in particular be selected from the group consisting of the reference bacteria ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, and more in particular from the group consisting of the reference bacteria ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.

[0088] The compositions according to the invention are preferably suitable for topical application onto keratinous materials, in particular onto the skin, and therefore comprise a physiologically acceptable medium, i.e. a medium that is compatible with application to keratinous materials, in particular the skin, and have, inter alia, a pleasant color, a pleasant odor and a pleasant feel, so as not to cause unacceptable discomfort, i.e. stinging or tightness, which would deter the user from applying the composition.

[0089] The term "cosmetics" means compositions that are compatible with keratinous materials, in particular the skin, mucous membranes and integuments. The compositions according to the invention are non-therapeutic.

[0090] The term "keratinous materials" is intended to refer in particular to skin, mucous membranes, fibers, eyelashes and skin appendages.

[0091] The term "skin" means all skin of the body, preferably the skin of the face, the skin of the scalp, the skin of the nape of the neck, the skin of the arms and the skin of the forearms, more preferably also the skin of the face (in particular the skin of the forehead, nose, cheeks and chin), the skin of the nape of the neck and the skin of the neck.

[0092] As used herein, the terms "treat" and "treatment" refer to the alleviation and / or elimination of symptoms associated with a particular disorder or condition, and also the complete disappearance of the disorder or condition in question.

[0093] In the context of the present invention, the words "prevent" and "prevention" refer to reducing the risk or probability of occurrence of a given phenomenon to a lower degree.

[0094] The invention therefore makes it possible to provide the skin with beneficial properties, in particular an effective barrier function; a moisturizing effect; elasticity and smooth texture of the skin; a surface morphology with less roughness; good tissue cohesion; a good thickness of the stratum corneum; and an improvement in the visual appearance of the skin, especially over the long term.

[0095] In physiological terms, dry skin is often associated with, among other things, a decrease in skin moisture and a negative impact on the barrier function, as measured by transepidermal water loss. Sensory-wise, it is characterized in particular by a feeling of tightness, itchiness, discomfort, and / or tension in the skin. For obvious reasons, these symptoms are unpleasant.

[0096] The composition according to the invention contains 10% of the bacteria according to the invention. 7 ~10 12 topical application expressed in colony-forming units (cfu), preferably 10 9 or 10 10 topical application with a dose equivalent to cfu.

[0097] The live bacterial strain of the species Staphylococcus epidermidis according to the invention or the composition according to the invention therefore proves to be very particularly effective for treating dry skin conditions, for treating dry skin, for treating itching and / or tightness associated with dry skin, for physiological restoration of an adequate moisturizing state of the stratum corneum, for treating hyposeborrheic dry skin, for improving the comfort of dry skin or for combating the dull and / or lifeless appearance of the skin as a result of dryness.

[0098] As indicated above and illustrated in the Examples, the strains according to the invention are capable of producing, inter alia, (i) indole-3-lactic acid (ILA) and / or salts thereof; (ii) indole-3-carboxaldehyde (IAld) and / or salts thereof; and (iii) indole-3-acetic acid (IAA) and / or salts thereof.

[0099] "Salts" of indoles according to the invention are understood to mean salts formed with inorganic or organic acids or with inorganic or organic bases.

[0100] As examples of acid salts, mention may be made of sulfate, citrate, acetate, oxalate, chloride, bromide, iodide, nitrate, bisulfate, phosphate, isonicotinate, lactate, salicylate, tartrate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharinate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and aspartate.

[0101] Examples of base salts that may be mentioned include hydroxides of alkali metals, such as sodium, potassium, and lithium; hydroxides of alkaline earth metals, such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; aqueous ammonia and organic amines, such as unsubstituted or hydroxy-substituted mono-, di-, or trialkylamines; dicyclohexylamine; tributylamine; pyridine; N-methyl-N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris(2-hydroxyalkylamines), such as mono-, bis-, or tris(2-hydroxyethyl)amine; 2-hydroxy-tert-butylamine, or tris(hydroxymethyl)methylamine, N,N-dialkyl-N-(hydroxyalkyl)amines, such as N,N-dimethyl-N-(2-hydroxyethyl)amine; N-methyl-D-glucamine; and amino acids, such as arginine and lysine.

[0102] The indole salts according to the invention are preferably basic salts, in particular sodium or potassium salts.

[0103] Indole-3-lactic acid (ILA) is of the following formula (I): [ka]

[0104] Indole-3-carboxaldehyde (IAld) is of the following formula (II): [ka]

[0105] Indole-3-acetic acid (IAA) is of formula (III) below: [ka]

[0106] Indole-3-acetic acid (IAA) may in particular be in the form of its sodium salt in the composition according to the invention, completely or partly.

[0107] The bacterial strain according to the invention may also be capable of producing tryptamine.

[0108] The tryptamine is of formula (IV): [ka]

[0109] As indicated above, the compositions according to the present invention may comprise at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof.

[0110] Such adjuvants may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% by weight and better still from 0.1% to 5% by weight relative to the total weight of the composition.

[0111] Of course, the skilled person will take care to select this adjuvant or adjuvants and / or the amount thereof so that the advantageous properties of the strain according to the invention are not or substantially not adversely affected by the envisaged addition.

[0112] According to one embodiment, the composition according to the invention may comprise water.

[0113] In particular, the composition according to the invention may contain 20% to 90% by weight, preferably 30% to 60% by weight, of water relative to the total weight of the composition.

[0114] The composition according to the invention may also comprise at least one additional cosmetic active agent.

[0115] This may in particular be at least one active agent for caring for dry skin, such as glycerol or urea.

[0116] In the context of the present invention, the term "additional active agent" means a compound that acts on its own, i.e., a compound that does not require the intervention of an external agent to be active.

[0117] Additional active agents that can be used in the compositions of the present invention can be selected from desquamating agents, soothing agents, anti-inflammatory agents, anti-aging agents, wound healing agents, vitamins, and mixtures thereof in any proportion.

[0118] The additional active agents used in the composition according to the invention may represent from 0.0001% to 20% by weight, preferably from 0.01% to 10% by weight, and better still from 0.1% to 5% by weight, relative to the total weight of said composition.

[0119] Of course, the skilled person will take care to select this compound or any one or more of these additional compounds, and / or the amount thereof, such that the advantageous properties of the bacterial strain according to the invention or of the composition according to the invention are not adversely affected or are not substantially affected by the envisaged addition.

[0120] The compositions according to the invention may be in any presentation form normally used in the cosmetics field.

[0121] The compositions according to the invention may be in the form of, inter alia, aqueous or aqueous-alcoholic solutions, which may be gelled, lotion-type dispersions, two-phase dispersions, oil-in-water or water-in-oil emulsions, multiple emulsions, aqueous gels, or dispersions of oil in an aqueous phase, and in particular spheres may be used, which may be polymer particles or, better still, lipid vesicles of ionic and / or nonionic type, and which have a more or less fluid liquid consistency.

[0122] Preferably, the compositions according to the invention are different from compositions which essentially have a detergent purpose with respect to the skin, hair and / or mucous membranes, such as soaps, shampoos and shower gels for washing and / or cleansing.

[0123] The compositions according to the invention are preferably suitable for topical administration.

[0124] Thus, the compositions according to the invention may contain all the ingredients normally used in the topical application and administration envisaged.

[0125] The compositions according to the invention may advantageously be in the form of an emulsion, in particular of liquid or semi-liquid consistency of the milk type, or of soft consistency, obtained by dispersion of an aqueous phase in a fatty phase (W / O) or of a fatty phase in an aqueous phase (O / W), or even in the form of a multiple emulsion (W / O / W or O / W / O). These compositions are prepared according to the usual known methods.

[0126] More particularly, the compositions according to the invention may be intended for topical application and may preferably be in the form of an emulsion, preferably an oil-in-water emulsion, preferably such an emulsion is not intended to be washed off after application.

[0127] The compositions according to the invention are preferably intended to be applied to the skin.

[0128] Preferably, the skin is the skin of the face, scalp, nape, neck, arms or forearms, or more preferably the skin of the face (especially the forehead, nose, cheeks, chin), nape and neck.

[0129] The pH of said composition is advantageously less than or equal to 8, preferably in the range 4 to 7, more preferably in the range 4.5 to 6.5.

[0130] Alternatively, the composition may be in the form of a face and / or body care or make-up product, packaged, for example, as a cream in a jar or a fluid in a tube or in a pump or dropper bottle.

[0131] The compositions according to the invention can be prepared by any known method generally known in the cosmetic field.

[0132] The ingredients are mixed before molding in an order and under conditions that are readily determined by one skilled in the art.

[0133] According to a particular embodiment of the invention, other agents intended to decorate the appearance and / or texture of the skin may also be added to the composition according to the invention.

[0134] Use and Method

[0135] According to one of its aspects, the invention relates to the cosmetic use, in particular the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing a decline in the skin barrier function in an individual and / or for strengthening said skin barrier function.

[0136] According to yet another of its aspects, the invention relates to the cosmetic use, in particular the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for improving skin moisturization.

[0137] The present invention additionally comprises: to improve skin quality, in particular the quality of dry skin, and / or For preventing and / or treating cosmetic signs associated with dry skin, in particular cosmetic signs associated with dry skin selected from tightness, itching, discomfort, dull complexion, rough skin and pronounced microrelief of the skin, The present invention relates to the cosmetic use, especially the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention.

[0138] A subject of the present invention additionally relates to the cosmetic use, especially the topical cosmetic use, of a live bacterial strain according to the invention or of a composition according to the invention for preventing and / or treating itching, in particular itching of skin affected by skin disorders, such as atopic dermatitis.

[0139] The present invention also relates to the cosmetic use, especially the topical cosmetic use, of such compositions for the prevention and / or treatment of atopic dermatitis.

[0140] According to yet another of its aspects, the present invention relates to a non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, especially dry skin, which comprises topically applying to these keratinous materials a live bacterial strain according to the invention or a composition according to the invention.

[0141] The cosmetic uses and methods contemplated according to the present invention are non-therapeutic.

[0142] The cosmetic uses and methods of the invention are preferably carried out by topically administering a live bacterial strain according to the invention or a composition according to the invention.

[0143] By way of example, a cosmetic use or method according to the invention may be carried out by topically, for example daily, applying at least one composition according to the invention, which may be formulated, for example, in the form of a cream, gel, serum, lotion, emulsion or makeup-removing milk, preferably in the form of an emulsion.

[0144] The administration may be repeated, for example, once or twice daily for one or more days, generally for an extended period of at least 4 weeks, and even 4 to 15 weeks, with one or more rest periods, if appropriate.

[0145] According to one embodiment, the administration is daily (once a day) and is generally carried out over an extended period of at least 4 weeks, and even 4 to 15 weeks, with one or more rest periods, if appropriate.

[0146] According to one embodiment, the cosmetic treatment method according to the invention may comprise a single application.

[0147] Throughout this specification, including the claims, the words "to" and "ranging from" should be understood to mean inclusive limits unless otherwise indicated.

[0148] The examples presented below illustrate the invention without limiting its scope.

[0149] In the examples, unless otherwise specified, temperatures are room temperature (20° C.) and are expressed in degrees Celsius, and pressures are atmospheric.

[0150] Example

[0151] Materials and Methods

[0152] Strain origin, CNCM name, and cultivation method

[0153] Eight selected strains of Staphylococcus epidermidis were collected from subjects with normal, healthy skin. The samples were obtained using the swabbing method, as previously described in, for example, Leung, MHY et al., "Changes of the human skin microbiota upon chronic exposure to polycyclic aromatic hydrocarbon pollutants," Microbiome 8, 100 (2020). The collected bacteria were isolated on tryptone soy agar (TSA) and stored in the form of frozen stocks.

[0154] These eight strains are: Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021, under the accession number CNCM I-5688 (I-5688); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021, under the accession number CNCM I-5689 (I-5689); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021, under the accession number CNCM I-5689 (I-5689); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on September 21, 2022 under the accession number CNCMI-5904 (I-5904); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under the accession number CNCM I-5691 (I-5691); Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under the accession number CNCM I-5691 (I-5691). A Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under accession number I-5692 (I-5692); a Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 3, 2021 under accession number I-5693 (I-5693); a Staphylococcus epidermidis (S. epidermidis) strain, deposited by L'Oreal at the CNCM on June 7, 2021 under accession number I-5694 (I-5694); and a Staphylococcus epidermidis (S.The strain (I-5695) was deposited by L'Oreal at the CNCM on June 7, 2021, under the accession number CNCM I-5695.

[0155] The ATCC 12228 strain is sold by LGC STANDARD under the name ATCC12228.

[0156] The bacterial strains were cultured using conventional microbiological techniques in either tryptic soy broth (TSB) or keratinocyte serum-free medium (KSFM).

[0157] Culture and treatment of keratinocytes

[0158] Normal neonatal human primary epidermal keratinocytes (NHEKs) (CellnTec) were cultured at 37°C and 5% CO2 in medium supplemented with CnT-57 (CellnTec) containing bovine pituitary extract (BPE). NHEKs were cultured to approximately 90% confluence in keratinocyte-SFM medium (Gibco, LifeTech, Corp., Grand Island, USA) supplemented with 0.035 μg / μl EGF and 12.4 mg / ml BPE (Gibco) for 24 hours before treatment. For treatment with live bacterial strains, NHEKs were treated with S. epidermidis in KSFM medium at an MOI (mode of infection) of 10:1 (10 bacteria per keratinocyte) for 14 hours. After treatment, the medium was collected, indole metabolite quantification and cytotoxicity assay (CyQuant™ LDH cytotoxicity assay, Thermo Fisher) were performed, and the cells were harvested for real-time quantitative PCR assay.

[0159] Quantitative RT-PCR

[0160] Total RNA was extracted from keratinocytes using the Rneasy Micro kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol, with additional treatment with DNase (Rnase-Free Dnase Set, Qiagen). The RNA concentration was measured using Nanodrop 商標 The mRNA levels were determined using a Nanodrop 1000 (Thermo Scientific). iScript cDNA Synthesis (Biorad) was used for cDNA synthesis. 商標 Real-Time PCR system (Applied Biosystems 商標 ) and SYBR Green Master Mix (Biorad). Data from quantitative PCR (qPCR) were analyzed using the 2-ΔΔCt quantification method, with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) for eukaryotic cells and GyrB (DNA gyrase subunit B) for staphylococcus used as endogenous controls. Primers for FLG, IVL, KLK7, DSG1, CDSN, Ki67, DEFB4, STAT6, OVOL1, and OVOL2 were provided by Biorad; other primer sequences are listed below.

[0161] Target gene GyrB Se: Sense primer (5'-3') sequence of SEQ ID NO: 1: GTTGTAATTGAGAAAGACAATTG (SEQ ID NO: 1), and antisense primer (3'-5') sequence of SEQ ID NO: 1: TACAGTTAAGATAACTTCGACAG (SEQ ID NO: 2).

[0162] Quantification of AhR metabolites / ligands

[0163] Preparation: 5-hydroxyindoleacetic acid-d5, serotonin-d4, indole-3-acetic acid-d4, kynurenic acid-d5, melatonin-d4, piconylic acid-d3, tryptamine-d4, and xanthurenic acid-d4 were purchased from Santa Cruz Biotechnology. 3-hydroxyanthranilic acid-d4, 3-hydroxykynurenine-13C2-15N, 5-hydroxytryptophan-d4, indole-3-acetamide-d5, kynurenine-d4, and tryptophan-d5 were purchased from Toronto Research Chemicals.

[0164] Stock solutions of labeled analytes were prepared in water containing 0.1% formic acid, and final concentrations were chosen to correspond to the estimated concentrations of endogenous metabolites.

[0165] Metabolite extraction: Metabolites were extracted from 50 μl of co-culture medium and obtained as described above. After adding 100 μl of the preparation shown above and 300 μl of methanol, the sample was mixed for 15 seconds and homogenized at −20°C for 30 minutes. After centrifugation at 5000 rpm for 10 minutes at −4°C, 350 μl of supernatant was collected and concentrated under a stream of nitrogen. The residue was redissolved in 100 μl of methanol / water (1:9) and transferred to a 96-well plate for LC-HRMS analysis.

[0166] Instrumentation: The analysis was performed as previously described in Lefevre, A. et al., Talanta 195, 593-598 (2019). Briefly, 2 μl was analyzed by LC-MS (XEVO-TQ-XS, Waters 登録商標 ) was injected into a Kinetex C18 xb column (1.7 μm × 150 mm × 2.1 mm, temperature 55°C) with a gradient of two-phase mobile phase (phase A: water + 0.5% formic acid; phase B: methanol + 0.5% formic acid) at a flow rate of 0.4 ml / min.

[0167] For each metabolite, a calibration curve was used to determine the concentration of each metabolite in the samples.

[0168] statistical analysis

[0169] All experiments were performed in at least three biological replicates. Data are presented as mean ± SEM. GraphPad Prism (version 7.0; GraphPad Software, La Jolla, California) was used. Data were analyzed using the Kruskal-Wallis test followed by Dunnett's multicomparison test. Results were considered statistically significant when p < 0.05.

[0170] Example 1: Selection of eight live strains of Staphylococcus epidermidis isolated from human skin and the reference strain ATCC12228

[0171] For this selection, single strains were cocultured with NHEKs for 14 h, then supernatants were collected to quantify indole metabolites, and keratinocytes were used for RT-qPCR as described above.

[0172] Quantification of specific AhR ligands revealed the presence of indole-3-carboxaldehyde (IAld) and indole-3-lactic acid (ILA), indole-3-acetic acid (IAA), and tryptamine. The total amount of indole produced was also quantified.

[0173] result

[0174] Quantification of indole concentrations in culture supernatants showed that for nine of the strains tested, namely those previously designated with reference numbers I-5689, I-5688, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, as well as the reference strain ATCC12228, the total indole concentration (i.e. the sum of the concentrations of ILA (indole-3-lactic acid), IAld (indole-3-carboxaldehyde), IAA (indole-3-acetic acid) and tryptamine) was greater than 890 pmol / ml.

[0175] [Table 1]

[0176] Example 2: Determining the ability of bacteria to maintain skin barrier function

[0177] Next, the ability of each strain to activate the AhR pathway was measured by monitoring the expression of the OVOL1 gene and the barrier function markers FLG and DSG1. OVOL1 is known to be involved in keratinocyte differentiation (Tsuji, G. et al. Cell Death Dis. 8, e2931-e2931 (2017)), and filaggrin (FLG) is involved in skin differentiation and skin barrier function, as previously described. DSG1 is a tight junction protein involved in skin cell cohesion.

[0178] The ATCC12228, I-5692, I-5688, I-5694, I-5695, I-5693, I-5691, and I-5904 strains induced strong expression of OVOL1 compared to the untreated control strain. The ATCC12228, I-5692, I-5688, I-5694, I-5695, I-5693, I-5691, and I-5904 strains also secreted the most indoles as defined above, confirming that these indoles act to activate the AhR pathway.

[0179] [Table 2]

[0180] Strains I-5688 and I-5689 induced higher FLG expression than the untreated control.

[0181] [Table 3]

[0182] Strains I-5688 and I-5693 induced higher DSG1 expression than untreated controls.

[0183] [Table 4]

[0184] Overall, strains ATCC12228, I-5688, I-5689, I-5691, I-5692, I-5693, I-5694, and I-5695 enhance markers of barrier function through AhR activation and indole secretion.

[0185] [Table 5]

[0186] [Table 6]

[0187] [Table 7]

[0188] [Table 8]

Claims

1. 1. An isolated live bacterial strain of the species Staphylococcus epidermidis, selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695.

2. 1. A composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, comprising, in a physiologically acceptable medium, at least one live bacterial strain of the species Staphylococcus epidermidis selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular selected from the group consisting of the bacteria deposited at the CNCM under deposit numbers I-5688, I-5691, I-5904, I-5692, I-5693, I-5694 and I-5695.

3. A composition, in particular a cosmetic composition, in particular a composition for caring for keratinous materials, in particular a cosmetic composition, comprising in a physiologically acceptable medium: at least one live bacterial strain of the species Staphylococcus epidermidis capable of producing a mixture of indoles comprising indole-3-lactic acid and / or salts thereof, indole-3-carboxaldehyde and / or salts thereof, and indole-3-acetic acid and / or salts thereof; and at least one adjuvant selected from the group consisting of fatty substances; organic solvents selected from lower monoalcohols having 1 to 5 carbon atoms, such as ethanol, isopropanol, tert-butanol; polyols, such as propylene glycol, pentylene glycol, caprylyl glycol, hexylene glycol (i.e., 2-methyl-2,4-pentanediol) and polyethylene glycol; polyol ethers, such as dipropylene glycol monomethyl ether; ionic or nonionic, hydrophilic or lipophilic thickeners; emollients; opacifiers; stabilizers; silicones; antifoaming agents; fragrances; preservatives; anionic, cationic, nonionic, zwitterionic or amphoteric surfactants; fillers; polymers; propellants; and combinations thereof. The composition comprising:

4. 4. The composition of claim 3, wherein the bacterial strain of the species Staphylococcus epidermidis is capable of producing a mixture of indoles comprising (i) indole-3-lactic acid and / or salts thereof, (ii) indole-3-carboxaldehyde and / or salts thereof, (iii) indole-3-acetic acid and / or salts thereof, and further (iv) tryptamine and / or salts thereof.

5. 5. The composition according to claim 3, wherein the bacterial strain of the species Staphylococcus epidermidis is selected from the group consisting of the reference bacteria ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5689, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695, in particular selected from the group consisting of the reference bacteria ATCC 12228 and the bacteria deposited at the CNCM under the deposit numbers I-5688, I-5904, I-5691, I-5692, I-5693, I-5694 and I-5695.

6. The composition of any one of claims 2 to 5, wherein the composition is suitable for topical administration.

7. 10. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 2 to 6 or of at least one bacterial strain according to claim 1 for preventing a decline in skin barrier function and / or strengthening said skin barrier function in an individual.

8. 10. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 2 to 6 or of at least one bacterial strain according to claim 1 for improving skin moisturization.

9. 10. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 2 to 6 or of at least one bacterial strain according to claim 1 for improving skin quality, in particular the quality of dry skin.

10. 10. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 2 to 6 or of at least one bacterial strain according to claim 1 for preventing and / or treating cosmetic signs associated with dry skin, in particular cosmetic signs associated with dry skin selected from tightness, itching, discomfort, dull complexion, roughness of the skin and pronounced microrelief of the skin.

11. 10. Non-therapeutic cosmetic use, in particular non-therapeutic topical cosmetic use, of a composition according to any one of claims 2 to 6 or of at least one bacterial strain according to claim 1 for preventing and / or treating pruritus, in particular pruritus of skin affected by skin disorders, such as atopic dermatitis.

12. A composition according to any one of claims 2 to 6 or at least one bacterial strain according to claim 1 for use in the prevention and / or treatment of atopic dermatitis.

13. The cosmetic use according to any one of claims 7 to 11, or the composition for use or the bacterial strain for use according to claim 12, wherein the composition or the at least one bacterial strain is suitable for topical administration.

14. 10. A non-therapeutic cosmetic method for caring for keratinous materials, in particular skin, especially dry skin, comprising topically applying to these keratinous materials at least one bacterial strain according to claim 1 or a composition according to any one of claims 2 to 6.