Anti-TGF-beta receptor 1 antibodies and uses thereof

Abstract

The present invention provides an antibody or antigen-binding fragment thereof that specifically binds to a region comprising amino acid residues 126 to 133 of transforming growth factor beta receptor I (TGFβR1), as well as pharmaceutical compositions, kits, methods, uses, and medical uses comprising the same.

Description

[Technical Field]

[0001] The present invention relates to an antibody or antigen-binding fragment thereof that specifically binds to a region comprising amino acid residues 126 to 133 of transforming growth factor beta receptor I (TGFβR1), as well as pharmaceutical compositions, kits, methods, uses, and medical uses comprising the same. [Background technology]

[0002] Transforming growth factor β (TGFβ) is a multifunctional cytokine with potent regulatory effects on cell fate during embryogenesis, in normal adult organisms, and in cancer cells. In adult healthy cells, TGFβ normally exerts growth-inhibitory functions through binding to the transmembrane serine kinase receptors TβRI and TβRII (serine / threonine kinase receptors). This activates an intracellular cascade of events that activates genes required for normal cellular homeostasis [1].

[0003] However, dysregulated TGFβ signaling is involved in many pathological processes, such as tumor progression and fibrosis. We previously found that in several common forms of cancer, this pathway is instead regulated by polyubiquitination of TβRI by the E3 ubiquitin ligase TRAF6 [4]. Activation of TRAF6 promotes proteolytic cleavage of the transmembrane TGFβ type I receptor (TβRI), liberating its intracellular domain (TβRI-intracellular domain, TβRI-ICD). Nuclear TβRI-ICD promotes cancer cell invasion and is recognized as acting distinctly from the canonical TGFβ-Smad signaling pathway occurring in normal cells. It is thought that proteolytic enzymes present in cancer cells cleave TβRI, thereby initiating the above mechanism. It has been reported that TNFα-converting enzyme (TACE) induces TβRI cleavage. TACE is also known as ADAM metallopeptidase domain 17 (ADAM17).

[0004] TGFβ has recently become recognized as a potent regulator of cellular plasticity, a central event during embryogenesis and tumor progression, and therefore represents an attractive new target for drug development.

[0005] Inhibitors targeting TGF-β are being investigated by pharmaceutical companies for cancer therapy, and some of them are currently undergoing clinical trials. For example, antibodies that prevent TGF-β ligands from binding to their receptors are currently being tested. GC1008 (fresolimumab) is one such antibody that neutralizes all three isoforms of TGF-β. However, this lack of specificity means that isoform-specific antagonists must be developed because TGF-β isoforms are expressed differently in different cancers.

[0006] Due to the pleiotropic effects of TGFβ on both normal physiological function and tumorigenesis, long-term blockade of TGFβ and related signaling pathways can have deleterious effects. In animal studies, several TGFβRI inhibitors resulted in increased incidence of hemorrhagic, degenerative, and inflammatory lesions in heart valves (Herbertz et al., Drug Des Devel Ther. 2015;9:4479-4499). Furthermore, blocking TGFβ signaling can cause chronic inflammation in the skin and intestine, which may then lead to precancerous conditions. In the skin, TGFβ inhibits normal keratinocyte proliferation and enhances differentiation. Accordingly, the development of keratoacanthoma (KA) and squamous cell carcinoma (SCC) has been reported after treatment with several different TGFβ inhibitors, including TβRI kinase inhibitors and fresolimumab, a TGFβ-neutralizing antibody.

[0007] Therefore, the present invention aims to provide a novel agent for use in inhibiting dysregulated TGFβ signaling. Interestingly, cleavage of TβRI occurs only in malignant prostate cancer cells (PC-3U), but not in normal primary human prostate epithelial cells [4]. Nuclear accumulation of TβRI-ICD is observed in many types of cancer, including prostate cancer, breast cancer, lung cancer, and bladder cancer. Against this background, the present inventors developed an antibody that prevents the nuclear translocation of TβRI-ICD.

[0008] TGFβR1 contains four regions: an N-terminal leader sequence (1-33) that is cleaved during secretion, a mature extracellular domain (amino acids 34-126), a transmembrane region (amino acids 127-147), and an intracellular C-terminal region (amino acids 148-503). Therefore, it is surprising that we were able to develop a functional antibody that binds to the region containing amino acids 126-133 of TGFβR1, where amino acids 126 precede the transmembrane region and amino acids 127-133 are in the transmembrane region. Transmembrane regions of proteins are often avoided in antigen selection due to the low accessibility of antibodies that bind to this region of the target protein. These regions are hydrophobic and highly conserved, making the generation of antibodies through tolerance-mediated immunization more difficult. DETAILED DESCRIPTION OF THE INVENTION

[0009] In a first aspect, the present invention provides an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGFβR1), wherein the antibody or fragment binds to a region of TGFβR1 that includes amino acid residues 126 to 133.

[0010] The term "antibody" as used herein is used in the broadest sense and encompasses a variety of antibody structures, including, but not limited to, monoclonal antibodies, synthetic antibodies, polyclonal antibodies, monospecific and multispecific antibodies (e.g., bispecific antibodies), human antibodies, humanized antibodies, chimeric antibodies, and antibody fragments, so long as they exhibit the desired antigen-binding activity. The term "antibody," as used herein, also includes antigen-binding fragments of the above-described antibody molecules. The terms "antigen-binding portion" of an antibody, "antigen-binding fragment" of an antibody, and the like, as used herein, include any naturally occurring, enzymatically obtainable, synthetic, or genetically engineered polypeptide or glycoprotein that specifically binds to an antigen to form a complex. Antigen-binding fragments of antibodies can be derived from intact antibody molecules using any suitable standard technique, such as, for example, proteolytic digestion or recombinant genetic engineering techniques involving the manipulation and expression of DNA encoding antibody variable and, optionally, constant domains. Such DNA is known and / or readily available, for example, from commercial sources, DNA libraries (including, for example, phage antibody libraries), or can be synthesized. The DNA can be sequenced and manipulated chemically or using molecular biology techniques, for example, to arrange one or more variable and / or constant domains in a suitable configuration, or to introduce codons, create cysteine ​​residues, or modify, add, or delete amino acids.

[0011] Non-limiting examples of antigen-binding fragments include Fab fragments, Fab' (antibody fragments containing a single anti-binding domain comprising an Fab and an additional portion of a heavy chain via the hinge region), F(ab')2 (two Fab' molecules linked by an interchain disulfide bond at the hinge region of the heavy chain; the Fab' molecules can be directed against the same or different epitopes), bispecific Fab (a Fab molecule having two antigen-binding domains, each of which can be directed against a different epitope), a single Fab chain comprising a variable region, also known as sFv, disulfide-linked Fv or dsFv (disulfide-linked Fv), camelized VH (variable antigen-binding determining region of a single heavy chain of an antibody, in which some amino acids at the VH interface are those found in the heavy chain of naturally occurring camelid antibodies), minimal recognition units consisting of amino acid residues mimicking the hypervariable region of an antibody (e.g., isolated complementarity determining regions such as CDR3 peptides), and the like. Examples of such antigen-binding domains include: tetrabodies, minibodies, and tribodies. These include: tetrabodies, minibodies, and trimeric sFvs (sFv or dsFv molecules with two antigen-binding domains, each of which can be directed against a different epitope); diabodies (dimerized sFvs formed when the VH domain of one sFv associates with the VL domain of a second sFv and the VL domain of the first sFv associates with the VH domain of a second sFv; the two antigen-binding regions of the diabody can be directed against the same or different epitopes); triabodies (trimerized sFvs formed in a manner similar to diabodies, but in which three antigen-binding domains are created in a single complex; the three antigen-binding domains can be directed against the same or different epitopes); tetrabodies; and minibodies. An scFv is an antibody fragment comprising the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain. Generally, the scFv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen binding.For a review of scFvs, see Pluckthun in The Pharmacology of Monoclonal Antibodies, vol. 113, Rosenburg and Moore eds. Springer-Verlag, New York, pp. 269-315 (1994).

[0012] A typical immunoglobulin molecule comprises four polypeptide chains, two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and multimers thereof (e.g., IgM). Each heavy chain comprises a heavy chain variable region (HCVR or VH) and a heavy chain constant region. The heavy chain constant region comprises four domains: CH1, hinge, CH2, and CH3. Each light chain comprises a light chain variable region (LCVR or VL) and a light chain constant region. The light chain constant region comprises one domain (CL1). The VH and VL regions can be further subdivided into regions of hypervariability called complementarity-determining regions (CDRs), interspersed with more conserved regions called framework regions (FRs). Each VH and VL is composed of three CDRs and four FRs, arranged from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0013] The present invention also provides antibodies, including variants of the antibodies disclosed in the Examples, which specifically bind to TGFβR1. "Variant" includes antibodies or fragments that contain one or more additions, deletions, or substitutions of amino acids when compared to the parent CDR, framework, VH, and / or VL sequences, but that exhibit essentially the same biological activity as the described antibody or fragment.

[0014] Mutations can be introduced into nucleotide sequences encoding antibodies or fragments of the invention using standard techniques known to those of skill in the art, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis resulting in amino acid substitutions. Preferably, variants contain fewer than 25 amino acid substitutions, fewer than 20 amino acid substitutions, fewer than 15 amino acid substitutions, fewer than 10 amino acid substitutions, fewer than 5 amino acid substitutions, fewer than 4 amino acid substitutions, fewer than 3 amino acid substitutions, or fewer than 2 amino acid substitutions relative to the original molecule. In another embodiment, variants have conservative amino acid substitutions. Variants may have conservative amino acid substitutions made at one or more predicted non-essential amino acid residues. Alternatively, mutations can be introduced randomly along all or part of the coding sequence, such as by saturation mutagenesis, and the resulting mutants can be screened for biological activity to identify mutants that retain activity. After mutagenesis, the encoded protein can be expressed and the activity of the protein can be determined. Variants of antibodies or fragments of the invention can be constructed, for example, by making one or more substitutions of residues or sequences or by deleting terminal or internal residues or sequences not required for biological activity. For example, cysteine ​​residues that are not essential for biological activity can be deleted or substituted with other amino acids to prevent the formation of unnecessary or incorrect intramolecular disulfide bridges during renaturation.

[0015] Antibody variants and derivatives include antibody fragments that retain the ability to specifically bind to a target.

[0016] The antibodies provided herein can be of any type (e.g., IgG, IgE, IgM, IgD, IgA, and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2), or subclass of immunoglobulin molecule.

[0017] Antibodies of the invention can be from any animal origin, including birds and mammals (e.g., human, murine, donkey, sheep, rabbit, goat, guinea pig, camel, horse, or chicken). In certain embodiments, antibodies of the invention are human or humanized monoclonal antibodies. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin, including antibodies isolated from a human immunoglobulin library or from a mouse expressing an antibody derived from human genes.

[0018] The antibodies and fragments of the present invention include antibodies and fragments that have been chemically modified, i.e., modified by the covalent attachment of any type of molecule to the antibody. For example, but not limited to, antibody derivatives include antibodies that have been chemically modified by one or more of the following: glycosylation, acetylation, PEGylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, linkage to cellular ligands or other proteins, etc. Any of a number of chemical modifications can be performed by known techniques, including, but not limited to, specific chemical cleavage, acetylation, formulation, metabolic synthesis of tunicamycin, etc. Additionally, the antibody may contain one or more non-classical amino acids, such as β-amino acids and non-proteinogenic amino acids.

[0019] "Transforming growth factor beta receptor I" includes receptor I for transforming growth factor beta (TGFβ). The terms "transforming growth factor beta receptor I" and "TGFβ receptor 1" can be abbreviated as "TGFbRI," "TGFβR1," "TβRI," and "TβR1." TGFbRI is also known as activin A receptor type II-like kinase (ALK5). Three types of cell surface proteins mediate TGF-β signaling: TGF-β receptor I (TβRI), II (TGF-β receptor II, TβRII), and III (TGF-β receptor III, TβRIII). TβRI and TβRII mediate signal transduction. Both receptors are transmembrane serine / threonine kinases that associate into homomeric or heteromeric complexes and act as tetramers. They are sequentially organized into an N-terminal extracellular ligand-binding domain, a transmembrane region, and a C-terminal serine / threonine kinase domain. Type II receptors range from 85 to 110 kDa, while type I receptors are smaller, ranging in size from approximately 55 to 56 kDa. The TGFβR1 described herein can be human TGFβR1, e.g., one comprising the amino acid sequence of human TGFβR1 disclosed herein (SEQ ID NO: 1), or a naturally occurring variant thereof, and / or a TGFβR1 ortholog found in other species, such as horse, dog, pig, cow, sheep, rat, mouse, guinea pig, or primate.

[0020] TGFβR1 contains four regions: an N-terminal leader sequence (1-33) that is cleaved during secretion, a mature extracellular domain (amino acids 34-126), a transmembrane region (amino acids 127-147), and an intracellular C-terminal region (amino acids 148-503). Therefore, it was surprising that the inventors were able to develop functional antibodies that bind to the region encompassing amino acids 126-133 of TβRI (SEQ ID NO: 1). Residue L126 precedes the transmembrane region, and residues 127-133 are within the transmembrane region (see Figure 7, where the transmembrane region is shown in a box). Transmembrane regions of proteins are often avoided in antigen selection due to the low accessibility of antibodies that bind to this region of the target protein. These regions are hydrophobic and highly conserved, making the generation of antibodies via tolerance immunization more difficult.

[0021] "Specifically binds to TGFβR1" includes the selective recognition of an antibody or fragment for TGFβR1, which can be used to determine the presence of TGFβR1 in a heterogeneous population of molecules, such as biological molecules. For example, an antibody that specifically binds to a target (which may be an epitope) is an antibody that binds to that target with higher affinity, avidity, more readily, and / or for a longer duration than it binds to other unrelated targets or molecules. Included is that the antibody or fragment does not substantially cross-react with another unrelated polypeptide. "Does not substantially cross-react" includes that the antibody or fragment has a binding affinity for a heterologous protein that is less than 10%, more preferably less than 5%, and even more preferably less than 1% of its binding affinity for TGFβR1.

[0022] The specificity of an antibody can be determined based on affinity measurements. Affinity (KD), represented by the equilibrium constant of association and dissociation between an antigen and an antigen-binding protein, is a measure of the strength of binding between an epitope and an antigen-binding site on the antigen-binding protein; a smaller KD value indicates a stronger binding strength between antigen-binding molecules (alternatively, affinity can be expressed as an affinity constant (KA), which is 1 / KD). As will be apparent to those skilled in the art, affinity can be determined by any method known in the art and described herein. 1×10 -6 Any KD value greater than M is generally considered to indicate non-specific binding.

[0023] Preferably, the antibody or fragment binds to TGFβR1 with an affinity that is at least 5, or at least 10, or at least 50 times higher than to another unrelated receptor, such as epidermal growth factor receptor (EGFR). More preferably, the antibody binds to TGFβR1 with an affinity that is at least 100, or at least 500, or at least 1,000, or at least 5,000, or at least 10,000 times higher than to another unrelated receptor, such as EGFR. The term "higher affinity" refers to binding affinity to TGFβR1 in the low nanomolar range, i.e., 1×10 or greater, as measured by techniques known in the art and described herein, such as Bio-layer interferometry (BLI), spectral shift technology (Nanotemper), surface plasmon resonance (SPR), or ELISA. -8 M, 1 x 10 -9 M, or 1 x 10 -10 M etc. at least 1 × 10 -7 K of M D"Surface plasmon resonance" includes the optical phenomenon that allows for the analysis of real-time interactions by detecting changes in protein concentration within a biosensor matrix, using, for example, a BIAcore™ system (BIAcore Life Sciences division of GE Healthcare, Piscataway, NJ) or kinetic exclusion assays. "Biolayer Interferometry (BLI)" includes the optical technique that measures macromolecular interactions by analyzing the interference patterns of white light reflected from the surface of a biosensor chip. BLI can be performed, for example, using a BLItz instrument (ForteBio).

[0024] In one embodiment, the antibody or fragment specifically binds to human TGFβR1 (including naturally occurring variants thereof) and / or TGFβR1 orthologs found in other species, such as horses, dogs, pigs, cattle, sheep, rats, mice, guinea pigs, or primates.

[0025] "Binds to a region comprising" includes that the antibody or antigen-binding fragment binds to a region of the antigen that contains the defined amino acid. The antibody or antigen-binding fragment thereof may or may not bind to all of the amino acid residues in that portion of the sequence. However, the antibody or antigen-binding fragment may also bind to other amino acids in the antigen. For example, the antibody or antigen-binding fragment thereof may bind to amino acids upstream of the defined sequence.

[0026] As shown in Figure 1, the antibody or fragment binds to a region including amino acid residues 126-133 of TGFβR1, such as the region corresponding to amino acid residues 126-133 of human TGFβR1 (SEQ ID NO: 1). In one embodiment, the antibody or fragment binds to a region including amino acid residues 126-133 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1). Amino acid residues 126-133 of TGFβR1 of human TGFβR1 are LAAVIAGP (SEQ ID NO: 230). As shown in Figure 8D, the following residues of human TGFβR1 (SEQ ID NO: 1) are involved in mAb #19 binding: L126, V129, I130, G132, and P133.

[0027] In some embodiments, the antibody or fragment binds to a region consisting of amino acid residues 126 to 133 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1).

[0028] In some preferred embodiments, the antibody or fragment binds to a region comprising amino acid residues 118-133 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1).

[0029] As shown in Example 17, the antibody or fragment binds to a region including amino acid residues 118-133 of TGFβR1, such as the region corresponding to amino acid residues 118-133 of human TGFβR1 (SEQ ID NO: 1). Amino acid residues 118-133 of human TGFβR1 are SPGLGPVELAAVIAGP (SEQ ID NO: 229). As shown in Example 17, the following residues of human TGFβR1 (SEQ ID NO: 1) are involved in mAb#19 binding: P119, L121, G122, V129, I130, and G132.

[0030] In some embodiments, the antibody or fragment binds to a region comprising amino acid residues 71-82 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1).

[0031] As shown in Example 17, the antibody or fragment binds to a region including amino acid residues 71-82 of TGFβR1, such as the region corresponding to amino acid residues 71-82 of human TGFβR1 (SEQ ID NO: 1). Amino acid residues 71-82 of human TGFβR1 are CIAEIDLIPRDR (SEQ ID NO: 228). As shown in Example 17, the following residues of human TGFβR1 (SEQ ID NO: 1) L77 and I78 are involved in mAb#19 binding.

[0032] In some embodiments, the antibody or fragment binds to a region comprising amino acid residues 71-82 and 126-133 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1).

[0033] In some embodiments, the antibody or fragment binds to a region comprising amino acid residues 71-82 and 118-133 of TGFβR1 of human TGFβR1 (SEQ ID NO: 1).

[0034] In one embodiment, the antibody or fragment binds to one or more of L77, 178, P119, L121, G122, V129, 1130, and G132 of TGFβR1 (SEQ ID NO: 1).

[0035] In one embodiment, the antibody or fragment binds to one or more of L126, V129, I130, G132, and P133 of TGFβR1 (SEQ ID NO: 1).

[0036] In one embodiment, the epitope to which the antibody or fragment binds comprises one or more of L77, 178, P119, L121, G122, V129, 1130, and G132 of TGFβR1 (SEQ ID NO: 1).

[0037] In one embodiment, the epitope to which the antibody or fragment binds comprises one or more of L126, V129, I130, G132, and P133 of TGFβR1 (SEQ ID NO: 1).

[0038] In one embodiment, the antibody or fragment binds to one or more of L77, 178, P119, L121, G122, L126, V129, 1130, G132, and P133 of TGFβR1 (SEQ ID NO: 1).

[0039] In one embodiment, the epitope to which the antibody or fragment binds comprises one or more of L77, 178, P119, L121, G122, L126, V129, 1130, G132, and P133 of TGFβR1 (SEQ ID NO: 1).

[0040] In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits proteolytic cleavage of TGFβR1.

[0041] "Reducing and / or inhibiting proteolytic cleavage of TGFβR1" includes the meaning that the antibody or fragment reduces the level of proteolytic cleavage of TGFβR1 compared to the level of proteolytic cleavage of TGFβR1 in the absence of the antibody or fragment. In one embodiment, the antibody or fragment reduces the level of proteolytic cleavage of TGFβR1 by at least 10%, 20%, 30%, 40%, or 50% compared to the level of proteolytic cleavage of TGFβR1 in the absence of the antibody or fragment, or reduces the level of proteolytic cleavage of TGFβR1 by at least 70%, 80%, 90%, 95%, or 99% compared to the level of proteolytic cleavage of TGFβR1 in the absence of the antibody or fragment. In one embodiment, the antibody or fragment reduces the level of proteolytic cleavage of TGFβR1 to undetectable levels or eliminates proteolytic cleavage of TGFβR1 compared to the level of proteolytic cleavage of TGFβR1 in the absence of the antibody or fragment.

[0042] Suitable methods for detecting and / or measuring (quantitating) proteolytic cleavage of TGFβR1 are well known to those skilled in the art. Examples of suitable methods are disclosed herein and include observing a reduction in the formation of cleaved TGFβR1, e.g., observing a reduction in the formation of nuclear TβRI-ICD as determined by immunohistochemistry or immunoblotting. The reduction can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%.

[0043] "Proteolytic cleavage" includes the enzymatic hydrolysis of peptide bonds in peptide or protein substrates by a specialized family of enzymes called proteases. Proteolytic cleavage of TGFβR1 can be mediated by one or more proteases selected from the group including TACE, presenilin-1 (PS1), ADAM10, MMP2, and / or MMP9. In one embodiment, proteolytic cleavage of TGFβR1 is mediated by TACE and / or presenilin-1 (PS1). PS1 functions either as gamma-secretase itself or as a necessary cofactor within the gamma-secretase protein complex.

[0044] In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits TACE-mediated proteolytic cleavage of TGFβR1.

[0045] In one embodiment, the antibody or fragment blocks cleavage of TβRI by TACE between A127 / A128 and / or A128 / V129 (numbering in SEQ ID NO: 1). As shown in the accompanying Examples, the inventors surprisingly found that TACE cleaves TβRI in a region of amino acids found in the transmembrane region of TβRI (see Figure 7, the transmembrane domain is shown in a box).

[0046] In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of a cell.

[0047] "Reducing and / or inhibiting intracellular domain (ICD) translocation" includes the meaning that the antibody or fragment reduces the level of TGFβR1-ICD in the nucleus compared to the level of TGFβR1-ICD in the nucleus in the absence of the antibody or fragment. In one embodiment, the antibody or fragment reduces the level of TGFβR1-ICD in the nucleus by at least 10%, 20%, 30%, 40%, or 50% compared to the level of TGFβR1-ICD in the nucleus in the absence of the antibody or fragment, or reduces the level of TGFβR1-ICD in the nucleus by at least 70%, 80%, 90%, 95%, or 99% compared to the level of TGFβR1-ICD in the nucleus in the absence of the antibody or fragment. In one embodiment, the antibody or fragment reduces the level of TGFβR1-ICD in the nucleus to undetectable levels or excludes TGFβR1-ICD from the nucleus.

[0048] In the nucleus, TβRI-ICD interacts with p300 and promotes tumor invasion indirectly or directly by inducing the transcription of target genes such as SNAI1, MMP2, and TβRI. Therefore, immunofluorescence and / or co-immunoprecipitation can be used to determine whether TβRI-ICD interacts with p300 and, therefore, whether TβRI-ICD translocates to the nucleus. As shown in the accompanying examples, in situ PLA was performed to determine whether TβRI-ICD interacts with p300 using anti-HA and anti-p300 antibodies (R&D. Cat. AF3789). A negative control in situ PLA assay was performed using a human PC3U cell line (A9) in which TGFβRI / ALK5 expression was silenced by CRISPR-Cas9. In addition, it was shown that colocalization of p300 and TβRI-ICD reoccurred when expression was reconstituted by transfection with a plasmid encoding TGFβRI (C-terminally HA-tagged).

[0049] In one embodiment, the antibody or fragment has an IC 50 and reduces and / or inhibits the translocation of the intracellular domain (ICD) of TGFβR1 into the nucleus of the cell.

[0050] In one embodiment, the antibody or fragment has an IC of 100 nM or less, such as 90 nM, 80 nM, 70 nM, 60 nM, or less. 50 In one embodiment, the antibody or fragment has an IC50 of 50 nM or less, such as 40 nM, 30 nM, 20 nM, 10 nM, or less. 50 As shown in Example 6 and Figure 6, antibody 19 (mAb #19) prevented TGFβ-induced translocation of TβRI-ICD to the nucleus, with an IC of 39 nM. 50 As shown in Example 15 and Figure 22A, the lead affinity matured antibody, F11, had an IC of 26 nM. 50and reduces and / or inhibits the translocation of the intracellular domain (ICD) of TGFβR1 into the nucleus of a cell. As shown in the accompanying examples, the extent of translocation of the intracellular domain (ICD) of TGFβR1 into the nucleus of a cell was determined by measuring the interaction between TβRI-ICD and p300 in a proximity ligation assay (PLA).

[0051] In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits cell migration. In one embodiment, the antibody or antigen-binding fragment thereof designated F11 reduces and / or inhibits cell migration. As can be seen from the accompanying examples, mAb F11 inhibited cell migration of human colorectal cancer cells. "Reducing and / or inhibiting cell migration" includes reducing the ability of cells to migrate within a tissue and / or organ and / or organism. Cell migration can be assessed by any known method in the art, such as those described in Front. Cell Dev. Biol., 14 June 2019 Sec. Cell Adhesion and Migration Volume 7, including the wound healing assay described in the accompanying examples. This wound healing method is based on the observation that when a new artificial cleft, or "scratch," is created on a confluent cell monolayer, cells on the edge of the newly created cleft migrate toward the opening and close the "scratch" until new cell-cell contact is reestablished. The basic steps involve creating a "scratch" on a cell monolayer, capturing images initially and at regular intervals during cell migration to close the scratch, and comparing the images to determine the rate of cell migration.

[0052] In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits cell migration by at least 50%, such as at least 60%, 70%, 80%, or 90%, compared to an isotype control antibody. In one embodiment, the antibody or antigen-binding fragment thereof reduces and / or inhibits cell migration by at least 80%, such as at least 90%, compared to an isotype control antibody.

[0053] In one embodiment, the equilibrium dissociation constant (Kd) between the antibody or antigen-binding fragment thereof and TGFβR1 is 1×10 -8 (M) or less.

[0054] In some embodiments, the antibody or fragment is administered at a concentration of 1×10 -7 mol / liter (M), preferably less than 1 x 10 -8 less than 1×10 -9 Dissociation constant (K D In some embodiments, the antibody or fragment has a -8 etc., 8 x 10 -8 , 7×10 -8 , 6×10 -8 , 5×10 -8 , 4×10 -8 , 3×10 -8 , 2 × 10 -8 . etc., 9×10 -8 Dissociation constant (K D In some embodiments, the antibody or fragment has a -9 etc., 8 x 10 -9 , 7×10 -9 , 6×10 -9 , 5×10 -9 , 4×10 -9 , 3×10 -9 , 2 × 10 -9 . etc., 9×10 -9 Dissociation constant (K D )

[0055] Binding specificity can be determined experimentally by methods known in the art, including, but not limited to, biophysical biolayer interferometry (BLI), isothermal titration calorimetry (ITC), Western blot, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), electrochemiluminescence (ECL), immunoradiometric assay (IRMA), enzyme immunoassay (EIA), and the use of surface plasmon resonance (SPR), such as by using Biacore™. In one embodiment, the KD is determined by biophysical biolayer interferometry (BLI). In one embodiment, the KD is determined by SPR.

[0056] In one embodiment, the half-maximal binding (EC) between the antibody or antigen-binding fragment thereof and TGFβR1 is 50The concentration of antibody that provides an EC50 of 1.5 ng / ml or less is 150 ng / ml. In some embodiments, the antibody or fragment has an EC50 of less than 150 ng / ml, such as less than 20 ng / ml, less than 100 ng / ml, 90 ng / ml, 80 ng / ml, 70 ng / ml, 60 ng / ml, 50 ng / ml, 40 ng / ml, 30 ng / ml, or 20 ng / ml. In some embodiments, the antibody or fragment has an EC50 of less than 40 ng / ml, such as less than 30 ng / ml, less than 39 ng / ml, 38 ng / ml, 37 ng / ml, 36 ng / ml, 35 ng / ml, 34 ng / ml, 33 ng / ml, 32 ng / ml, or 31 ng / ml. In some embodiments, the antibody or fragment has an EC50 of less than 30 ng / ml, such as less than 20 ng / ml, less than 29 ng / ml, 28 ng / ml, 27 ng / ml, 26 ng / ml, 25 ng / ml, 24 ng / ml, 23 ng / ml, 22 ng / ml, 21 ng / ml, etc. 50 is determined by ELISA.

[0057] Affinity measurements and EC of antibody 19 and its variants 50 The values ​​are shown in Table 1. Antibody affinity was measured using huECD 133 myc(His) and EC 50 The determination was carried out against a positive antigen containing a human Fc tag.

[0058] [Table 1]

[0059] The antibody format did not affect the binding affinity of the parent antibody (Antibody 19). Chimeric mouse IgG1 mAb #19 showed affinity comparable to that of a fully human IgG1 version carrying the silencing amino acid mutations of Pavilizumab.

[0060] Variant EC 50 The values ​​were reduced by more than six-fold compared to the parent antibody, but the affinity was increased by three-fold compared to the parent antibody, Antibody 19.

[0061] The present invention includes antibodies or fragments having the FW and / or CDR amino acid sequence of the VH domain (SEQ ID NO: 4) and / or VL domain (SEQ ID NO: 12) of antibody 19 with, for example, 20 or less, 15 or less, 10 or less, 8 or less, 6 or less, or 4 or less amino acid substitutions relative to any of the FW and / or CDR amino acid sequences disclosed herein. The present invention includes antibodies or fragments having the HCDR amino acid sequence of the VH domain of antibody 19 [SEQ ID NO: 4] with 5 or less, 4 or less, 3 or less, 2 or less, 1 or less (i.e., 0) amino acid substitutions relative to any of the HCDR amino acid sequences disclosed herein.

[0062] In one embodiment, the antibody or fragment comprises: a) the heavy chain complementarity determining region 1 (HCDR1) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR1 sequence comprising up to two amino acid substitutions, and / or b) the heavy chain complementarity determining region 2 (HCDR2) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR2 sequence comprising up to three amino acid substitutions, and / or c) The heavy chain complementarity determining region 3 (HCDR3) sequence of the VH domain of SEQ ID NO: 4, or a variant of the HCDR3 sequence comprising up to five amino acid substitutions.

[0063] Our development of "Antibody 19" allows for the development of further advantageous antibodies or fragments by directed substitution of one or more CDR and / or framework (FW) regions or residues thereof. Antibody 19, also referred to as "mAb #19," consists of fully human variable regions fused to the constant portion of human IgG1. Chimeric mouse antibody 19 contains fully human variable regions fused to the constant portion of mouse IgG1.

[0064] Antibodies or fragments containing one or more mutations to the CDRs described herein can be readily tested for one or more desired properties, such as those described herein, e.g., improved binding specificity, increased binding affinity, improved or enhanced biological properties, etc. Antibodies or fragments obtained in this general manner are encompassed within the present invention. Thus, starting from the exemplary sequences disclosed herein, one skilled in the art can produce a large number of antibodies or fragments that share the same function as the exemplary antibodies or fragments and contain one or more individual mutations or combinations thereof.

[0065] Thus, the present invention encompasses antibodies or fragments having amino acid sequences that differ from those of the described antibodies or fragments, but which reduce and / or inhibit proteolytic cleavage of TGFβR1 and / or reduce and / or inhibit translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of the cell to a similar extent as the exemplified antibodies or fragments.

[0066] Methods and techniques for identifying CDRs within variable region amino acid sequences are well known in the art and can be used to identify CDRs within the amino acid sequences of the identified antibodies or fragments disclosed herein. Exemplary conventions that can be used to identify CDR boundaries include, for example, the Kabat definition, the Chothia definition, the IMGT definition, and the AbM definition. Generally, the Kabat definition is based on sequence variability, the Chothia definition is based on the location of structural loop regions, and the AbM definition is a hybrid of the Kabat and Chothia approaches (Kabat, "Sequences of Proteins of Immunological Interest," National Institutes of Health, Bethesda, Md. (1991); Chothia C, Lesk a M. "Canonical structures for the hypervariable regions of immunoglobulins." J. Mol. Biol. (1987) 196:901-17; Al-Lazikani et al., J. Mol. Biol. 273:927-948 (1997); and Martin et al., Proc. Natl. Acad. Sci. USA 86:9268-9272 (1989)). Public databases are also available to those skilled in the art to identify CDR sequences within antibodies.

[0067] CDR sequences can be defined using any one of the AbM, IMGT, Chothia, and KABAT numbering schemes, or a combination of numbering schemes. In one embodiment, the CDRs are defined using the IMGT numbering system. In one embodiment, the CDRs are defined using the Kabat numbering system. Preferably, the CDR sequences are defined using the Kabat numbering system.

[0068] In one embodiment, the antibody or fragment comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 6, or a variant thereof comprising up to two amino acid substitutions, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 8, or a variant thereof comprising up to three amino acid substitutions, and / or iii. Comprises an HCDR3 comprising the sequence of SEQ ID NO: 10, or a variant thereof comprising up to five amino acid substitutions.

[0069] In one embodiment, the antibody or fragment comprises: i. HCDR1 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20, and / or ii. the HCDR2 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or iii. Comprises the HCDR3 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20.

[0070] In yet another embodiment, the antibody or fragment comprises at least one, two, or three complementarity determining regions (CDRs) (or collectively all of the CDRs) from the heavy chain variable region of an antibody described herein, e.g., an antibody selected from YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19. The present invention includes antibodies or fragments having the LCDR amino acid sequence of the VL domain of antibody 19 [SEQ ID NO: 12] with no more than five, no more than four, no more than three, no more than two, no more than one (i.e., no more than 0) amino acid substitutions relative to any of the LCDR amino acid sequences disclosed herein.

[0071] In one embodiment, the antibody or fragment comprises: a) the light chain complementarity determining region 1 (LCDR1) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR1 sequence comprising up to three amino acid substitutions, and / or b) the light chain complementarity determining region 2 (LCDR2) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR2 sequence comprising up to three amino acid substitutions, and / or c) comprising the light chain complementarity determining region 3 (LCDR3) sequence of the VL domain of SEQ ID NO: 12, or a variant of the LCDR3 sequence comprising up to one amino acid substitution.

[0072] In one embodiment, the antibody or fragment comprises: i. LCDR1 comprising the sequence of SEQ ID NO: 14, or a variant thereof comprising up to three amino acid substitutions, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 16, or a variant thereof comprising up to three amino acid substitutions, and / or iii. Comprises an LCDR3 comprising the sequence of SEQ ID NO: 18, or a variant thereof comprising up to one amino acid substitution.

[0073] Table 2 provides examples of amino acid substitutions within the CDR regions of both the VH domain (SEQ ID NO: 4) and the VL domain (SEQ ID NO: 12) of antibody 19. Thus, in preferred embodiments, variants of the CDR sequences described herein comprise one or more amino acid substitutions at the positions set out in Table 2. More preferably, variants of the CDR sequences described herein comprise one or more of the specific amino acid substitutions set out in Table 2. For example, where an antibody or fragment comprises a variant of HCDR1 comprising the sequence of SEQ ID NO: 6, comprising up to two amino acid substitutions, it will be understood that the two amino acid substitutions may be at positions S31 and / or A33. It will further be understood that the two amino acid substitutions may be selected from any of S31P, S31T, S31K, S31A, A33P, and A33G.

[0074] [Table 2]

[0075] In one embodiment, the antibodies or antigen-binding fragments thereof described herein comprise: i. LCDR1 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-F11, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20, and / or ii. LCDR2 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or iii. Comprises the LCDR3 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20.

[0076] In yet another embodiment, the antibody or fragment comprises at least one, two, or three complementarity determining regions (CDRs) (or collectively all of the CDRs) from the light chain variable region of an antibody described herein, e.g., an antibody selected from YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19. In yet another embodiment, the antibody or fragment comprises at least one, two, three, four, five, or six CDRs according to Kabat numbering (e.g., at least one, two, three, four, five, or six CDRs according to the Kabat definitions set forth in the Sequence Listing) from the heavy and light chain variable regions of an antibody described herein, e.g., an antibody chosen from YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19. In one embodiment, the antibody or fragment comprises HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, and LCDR3 of antibody YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or any of antibody 19.

[0077] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 6, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 8, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 10; i. LCDR1 comprising the sequence of SEQ ID NO: 14, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 16, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 18.

[0078] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 126, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 128, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 130; and i. LCDR1 comprising the sequence of SEQ ID NO: 134, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 136, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 138.

[0079] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 26, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 28, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 30; and i. LCDR1 comprising the sequence of SEQ ID NO: 34, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 36, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 38.

[0080] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 46, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 48, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 50; and i. LCDR1 comprising the sequence of SEQ ID NO: 54, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 56, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 58.

[0081] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 66, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 68, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 70; and i. LCDR1 comprising the sequence of SEQ ID NO: 74, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 76, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 78.

[0082] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 86, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 88, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 90; and i. LCDR1 comprising the sequence of SEQ ID NO: 94, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 96, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 98.

[0083] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 106, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 108, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 110; and i. LCDR1 comprising the sequence of SEQ ID NO: 114, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 116, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 118.

[0084] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 146, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 148, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 150; and i. LCDR1 comprising the sequence of SEQ ID NO: 154, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 156, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 158.

[0085] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 166, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 168, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 170; and i. LCDR1 comprising the sequence of SEQ ID NO: 174, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 176, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 178.

[0086] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 186, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 188, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 190; and i. LCDR1 comprising the sequence of SEQ ID NO: 194, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 196, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 198.

[0087] In one embodiment, the antibody or antigen-binding fragment thereof comprises: i. HCDR1 comprising the sequence of SEQ ID NO: 206, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 208, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 210; and i. LCDR1 comprising the sequence of SEQ ID NO: 214, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 216, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO: 218.

[0088] In one embodiment, the antibody or fragment comprises a heavy chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO:4, or a heavy chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO:4, and / or the antibody or fragment comprises a light chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO:12, or a light chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO:12.

[0089] In one embodiment, the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence that is at least 80% identical to SEQ ID NO: 4, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4. In one embodiment, the antibody or fragment comprises a heavy chain variable domain amino acid sequence that is at least 95% identical to SEQ ID NO: 4. In one embodiment, the antibody or fragment comprises a heavy chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 4.

[0090] In one embodiment, the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO: 12, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12. In one embodiment, the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 96% identical to SEQ ID NO: 12. In one embodiment, the antibody or fragment comprises a light chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 12.

[0091] In one embodiment, the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence that is at least 80% identical to SEQ ID NO: 124, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 124. In one embodiment, the antibody or fragment comprises a heavy chain variable domain amino acid sequence that is at least 95% identical to SEQ ID NO: 124. In one embodiment, the antibody or fragment comprises a heavy chain variable (VH) domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 124.

[0092] In one embodiment, the antibody or fragment comprises a light chain variable (VL) domain amino acid sequence that is at least 80% identical to SEQ ID NO: 132, such as at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 132. In one embodiment, the antibody or fragment comprises a light chain variable domain amino acid sequence that is at least 96% identical to SEQ ID NO: 132. In one embodiment, the antibody or fragment comprises a light chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 132.

[0093] In one embodiment, certain variations in sequence identity to a given SEQ ID NO of a VH or VL domain are outside of the CDR sequences.

[0094] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO:24 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO:32.

[0095] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO:44 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO:52.

[0096] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 64 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO: 72.

[0097] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO:84 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO:92.

[0098] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO:104 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO:112.

[0099] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 144 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO: 152.

[0100] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 164 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO: 172.

[0101] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO: 184 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO: 192.

[0102] In one embodiment, the antibody or fragment comprises the heavy chain variable domain (VH) amino acid sequence of SEQ ID NO:204 and / or the light chain variable domain (VL) amino acid sequence of SEQ ID NO:212.

[0103] "Percent (%) amino acid sequence identity" and "homology," with respect to peptide, polypeptide, or antibody sequences, are defined as the percentage of amino acid residues in a candidate sequence that are identical with amino acid residues in a particular peptide or polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be accomplished in a variety of ways that are within the skill of the art, for example, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEG ALIGN™ (DNASTAR) software.

[0104] In one embodiment, the antibody or fragment has a heavy chain constant region selected from the heavy chain constant regions of IgG1, IgG2, IgG3, IgG4, IgM, IgA1, IgA2, IgD, and IgE. Specifically, for example, the heavy chain constant regions are selected from the heavy chain constant regions of IgG1, IgG2, IgG3, and IgG4, more specifically, the heavy chain constant region of IgG1 or IgG4 (e.g., human IgG1, IgG2, or IgG4). In one embodiment, the antibody has a heavy chain constant region that is IgG.

[0105] In one embodiment, the antibody has a heavy chain constant region that is IgG1. In one embodiment, the heavy chain constant region is human IgG1. For example, an IgG1 heavy chain may have the sequence of (SEQ ID NO: 223). In some embodiments, the heavy chain constant region is mouse IgG1. For example, an IgG1 heavy chain may have the sequence of (SEQ ID NO: 225).

[0106] In another embodiment, the antibody or fragment has a light chain constant region chosen from, for example, a kappa or lambda light chain constant region.

[0107] In one embodiment, the antibody or fragment comprises a kappa light chain constant region. In one embodiment, the antibody or fragment comprises a human kappa light chain constant region. For example, the light chain constant region may comprise or consist of the sequence of SEQ ID NO: 224 or 226 shown in Table 20.

[0108] In one embodiment, the constant region can be altered, e.g., mutated, to modify the properties of the antibody or fragment (e.g., to increase or decrease one or more of Fc receptor binding, antibody glycosylation, number of cysteine ​​residues, effector cell function, complement function, half-life, aggregation, and stability).

[0109] In one embodiment, the antibody or fragment comprises a mutated human IgG1. In one embodiment, the antibody or fragment comprises a mutated mouse IgG1.

[0110] In one embodiment, the antibody or antigen-binding fragment comprises the IgG Fc receptors FcγRI, FcγRII, and / or FcγRIII and a heavy chain constant region with reduced binding to complement component C1q.

[0111] In one embodiment, the antibody or fragment has a heavy chain constant region that has increased binding to the neonatal Fc receptor (FcRn).

[0112] In one embodiment, the antibody or antigen-binding fragment further comprises a LALA or LALA-PG mutation in its heavy chain constant region. One of the most widely used IgG1 variants is L234A / L235A (LALA) (J. Lund et al., J Immunol October 15, 1991, 147(8)2657-2662). These substitutions reduce binding to the IgG Fc receptors FcγRI, FcγRII, and FcγRIII, as well as to the complement component C1q. Such antibodies are useful when Fc receptor binding and activation is undesirable, for example, when the product is used as an antagonist of a cytokine or similar. More recently, L234A / L235A / P329G (LALAPG) was said to "completely abolish" immune effector function (T. Schlothauer et al., Protein Eng Des Sel. 2016 Oct;29(10):457-466).

[0113] In one embodiment, the antibody or antigen-binding fragment further comprises the STR mutations L234S, L235T, G236R in the heavy chain constant region of IgG1, as described in Wilkinson et al (2021), Fc-engineered antibodies with immune effector functions completely abolished. PLOS ONE 16(12).

[0114] In one embodiment, the mutations in the heavy chain constant region IgG1 are selected from E233P, L234V, L235A, deletion of G236, D265G, A327Q, and A330S, and deletion of the C-terminal lysine.

[0115] In one embodiment, the antibody or fragment comprises any of the heavy chain amino acids of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19 listed in Table 20. and / or the light chain amino acid sequence of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19 listed in Table 20.

[0116] In one embodiment, the antibody or antigen-binding fragment thereof has a heavy chain amino acid sequence of SEQ ID NO:20 and / or a light chain amino acid sequence of SEQ ID NO:22.

[0117] In one embodiment, the antibody or antigen-binding fragment thereof has a heavy chain amino acid sequence of SEQ ID NO:140 and / or a light chain amino acid sequence of SEQ ID NO:142.

[0118] In one embodiment, the antibody or antigen-binding fragment thereof further comprises a detectable moiety.

[0119] By "detectable moiety" is meant that the moiety, when localized at a target site after administration of an antibody or fragment of the invention to a patient, can be detected, typically non-invasively, from outside the body where the target site is located. Thus, antibodies or fragments containing detectable moieties can be useful in imaging and diagnostics, or in drug discovery.

[0120] In one embodiment, the detectable moiety comprises a fluorophore, an enzyme, or a radioisotope.

[0121] Thus, in one embodiment, the detectable moiety may be a radioactive atom that is useful in imaging. Suitable radioactive atoms include technetium-99m or iodine-123 for scintigraphic studies. Others may be selected from the group consisting of iodine-124, iodine-125, iodine-126, iodine-131, iodine-133, indium-111, indium-113m, fluorine-18, fluorine-19, carbon-11, carbon-13, copper-64, nitrogen-13, nitrogen-15, oxygen-15, oxygen-17, arsenic-72, gadolinium, ferrous manganese, deuterium, tritium, yttrium-86, zirconium-89, bromine-77, gallium-67, gallium-68, ruthenium-95, ruthenium-97, ruthenium-103, ruthenium-105, mercury-107, rhenium-99m, rhenium-101, rhenium-105, scandium-47. Suitable methods for coupling such radioisotopes to antibodies, either directly or via a chelating agent, such as EDTA or DTPA, can be used as known in the art.

[0122] Other readily detectable moieties include, for example, spin labels for magnetic resonance imaging (MRI), such as iodine-123, iodine-131, indium-111, fluorine-19, carbon-13, nitrogen-15, oxygen-17, gadolinium, manganese, or iron, again. Clearly, the antibody or fragment of the invention must have a sufficient number of the appropriate atomic isotopes in order for the molecule to be detectable.

[0123] Radioactive or other labels can be incorporated into the compounds by known methods, for example, when antibodies are biosynthesized or synthesized by chemical amino acid synthesis using suitable amino acid precursors, for example, containing fluorine-19 instead of hydrogen. 99m Tc, 123 I, 186 Rh, 188 Rh, and 111 Labels such as In can be attached, for example, via cysteine ​​residues of the antibody. Yttrium-90 can be attached via lysine residues. The IODOGEN method (Fraker et al (1978) Biochem. Biophys. Res. Comm. 80, 49-57) can be used to incorporate iodine-123. References ("Monoclonal Antibodies in Immunoscintigraphy", JF Chatal, CRC Press, 1989) describe other methods in detail.

[0124] Many suitable fluorophores and detection methods are known in the art and are described, for example, by Stefan Andersson-Engels et al. (1997) "In vivo fluorescence imaging for tissue diagnostics. Phys. Med. Biol. 42:815-824; Altinoglu et al. (2008) "Near-Infrared Emitting Fluorophore-Doped Calcium Phosphate Nanoparticles for In Vivo Imaging of Human Breast Cancer," ACS Nano 2(10):2075-84; and Chin et al. (2009) "In-vivo optical detection of cancer using chlorin e6-polyvinylpyrrolidone induced fluorescence imaging and spectroscopy," BMC Medical Imaging 9:1 (doi:10.1186 / 1471-2342-9-1). Examples include fluorescein and its derivatives, fluorescent dyes, rhodamine and its derivatives, green fluorescent protein (Green Fluorescent Protein), and the like. Protein (GFP), dansyl, umbelliferone, etc. In such conjugates, the antibody of the present invention or a functional fragment thereof can be prepared by methods known to those skilled in the art.

[0125] The detectable moiety can comprise a detectable enzyme such as peroxidase, alkaline phosphatase, beta-D-galactosidase, glucose oxidase, glucose amylase, carbonic anhydrase, acetylcholinesterase, lysozyme, malate dehydrogenase, or glucose 6-phosphate dehydrogenase.

[0126] The detectable moiety may comprise a molecule such as biotin, digoxigenin, or 5-bromodeoxyuridine.

[0127] Detectable moieties can include chemiluminescent labels, such as luminol and dioxetanes, or bioluminescent labels, such as luciferase and luciferin.

[0128] In one embodiment, the antibody or antigen-binding fragment is conjugated to a therapeutic moiety, such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant, or a radioisotope.

[0129] Such conjugates may be referred to as "immunoconjugates" or "antibody-drug conjugates." Typically, the cytotoxic moiety is selected from a directly cytotoxic chemotherapeutic agent, a directly cytotoxic polypeptide, a moiety capable of converting a prodrug into a cytotoxic drug, a radiosensitizer, a directly cytotoxic nucleic acid, a nucleic acid molecule encoding a direct or indirect cytotoxic polypeptide, or a radioactive atom. Examples of such cytotoxic moieties, as well as methods for making conjugates comprising an antibody and a cytotoxic moiety, are provided in our previous publications WO 02 / 36771, WO 2004 / 046191, and WO 2011 / 027132, which are incorporated herein by reference.

[0130] A cytotoxin or cytotoxic agent includes any agent that is detrimental to (e.g., kills) cells. Examples include taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin, as well as analogs or homologs thereof. In one embodiment, the cytotoxic moiety is a cytotoxic chemotherapeutic agent.

[0131] Suitable chemotherapeutic agents for forming the immunoconjugate are known in the art and include antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, fludarabine, 5-fluorouracil, dacarbazine, hydroxyurea, azathiprine, gemcitabine, and cladribine), alkylating agents (e.g., mechlorethamine, thioepa, chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis-dichlorodiamineplatinum(II) (cis-dichlorodiamine These include, but are not limited to, platinum(II), DDP (cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, docetaxel, paclitaxel, and vinorelbine).

[0132] Antibody-drug conjugates for cancer therapy and the like have been reviewed by Carter & Senter (2008), Cancer J. 14(3):154-69, and Chari et al (2014) Angewandte Chemie International Edition 53:3751, which are incorporated herein by reference, and it will be understood that the compounds of this aspect of the invention may be considered as such antibody-drug conjugates (see U.S. Pat. Nos. 5,773,001; 5,767,285; 5,739,116; 5,693,762; 5,585,089; U.S. Patent Application Publication Nos. 2006 / 0088522; 2011 / 0008840; U.S. Pat. No. 7,659,241; Hughes (2010) Nat Drug Discov 9:665; Lash (2010); In vivo: The Business & (See, e.g., J. Med. Pharmacol. 2011, 1:111-122, 2011; ...

[0133] Various cytotoxic moieties, such as cytotoxic chemotherapeutic agents, have previously been conjugated to antibodies and other targeting agents, and therefore, compounds of the present invention containing these agents can be readily prepared by those skilled in the art. For example, carbodiimide conjugates (Bauminger & Wilchek (1980) Methods Enzymol. 70, 151-159) can be used to conjugate various drugs, including doxorubicin, to antibodies. Other methods for conjugating cytotoxic moieties to antibodies can also be used. For example, sodium periodate oxidation followed by reductive alkylation of appropriate reactants can be used, as well as glutaraldehyde crosslinking. Methods for crosslinking polypeptides are known in the art and are described in WO 2004 / 046191. However, regardless of which method is selected to produce the compounds of the present invention, it is recognized that a determination must be made that the antibody maintains its targeting ability and the conjugated moiety maintains its relevant function.

[0134] In further embodiments of the present invention, the cytotoxic moiety may be a cytotoxic peptide or polypeptide moiety, including any moiety that causes cell death. Cytotoxic peptide and polypeptide moieties are well known in the art and include, for example, ricin, abrin, Pseudomonas exotoxin, tissue factor, and the like. Methods for linking them to targeting moieties such as antibodies are also known in the art and include, for example, traditional methods of cross-linking polypeptides and production of compounds as fusion polypeptides using recombinant DNA technology. The use of ricin as a cytotoxic agent is described in Burrows & Thorpe (1993) Proc. Natl. Acad. Sci. USA 90, 8996-9000, and the use of tissue factor to cause local blood clotting and infarction of tumors is described by Ran et al. (1998) Cancer Res. 58, 4646-4653 and Huang et al. (1997) Science 275, 547-550. Tsai et al (1995) Dis. Colon Rectum 38, 1067-1074 describe abrin A chain conjugated to a monoclonal antibody. Other ribosome-inactivating proteins are described as cytotoxic agents in WO 96 / 06641. Pseudomonas exotoxin can also be used as a cytotoxic polypeptide moiety (Aiello et al (1995) Proc. Natl. Acad. Sci. USA 92, 10457-10461). Certain cytokines, such as TNFα, INFγ, and IL-2, can also be useful as cytotoxic agents.

[0135] Certain radioactive atoms can also be cytotoxic when delivered in sufficient doses. Thus, a cytotoxic moiety can include a radioactive atom that delivers a sufficient amount of radioactivity to a target site so as to be cytotoxic when used. Suitable radioactive atoms include phosphorus-32, iodine-125, iodine-131, indium-111, rhenium-186, rhenium-188, or yttrium-90, or any other isotope that releases sufficient energy to destroy adjacent cells, organelles, or nucleic acids. Preferably, the isotope and density of the radioactive atom in the compound of the present invention are such that a dose of more than 4000 cGy (preferably at least 6000, 8000, or 10000 cGy) is delivered to the target site, preferably to cells at the target site.

[0136] The radioactive atom can be attached to the antibody in known manner. For example, EDTA or another chelating agent can be attached to the antibody. 111 In or 90 A tyrosine residue can be used to attach Y. 125 I or 131 It can be labeled with I.

[0137] The cytotoxic moiety can be a radiosensitizer. Radiosensitizers include fluoropyrimidines, thymidine analogs, hydroxyurea, gemcitabine, fludarabine, nicotinamide, halogenated pyrimidines, 3-aminobenzamides, 3-aminobenzodiamides, etanixadol, pimonidazole, and misonidazole (see, e.g., McGinn et al (1996) J. Natl. Cancer Inst. 88, 1193-11203; Shewach & Lawrence (1996) Invest. New Drugs 14, 257-263; Horsman (1995) Acta Oncol. 34, 571-587; Shenoy & Singh (1992) Clin. Invest. 10, 533-551; Mitchell et al (1989) Int. J. Radiat. Biol. 56, 827-836; Iliakis & See Kurtzman (1989) Int. J. Radiat. Oncol. Biol. Phys. 16, 1235-1241; Brown (1989) Int. J. Radiat. Oncol. Biol. Phys. 16, 987-993; Brown (1985) Cancer 55, 2222-2228).

[0138] The cytotoxic moiety can be a procoagulant such as the extracellular domain of tissue factor (Rippmann et al (2000) "Fusion of the tissue factor extracellular domain to a tumor stroma specific single-chain fragment variable antibody results in an antigen-specific coagulation-promoting molecule." Biochem J. 349:805-12; Huang et al (1997) "Tumor infarction in mice by antibody-directed targeting of tissue factor to tumor vasculature." Science. 275(5299):547-550).

[0139] The cytotoxic moiety can be an indirect cytotoxic polypeptide. In a particularly preferred embodiment, the indirect cytotoxic polypeptide is a polypeptide that has enzymatic activity and can convert a relatively non-toxic prodrug into a cytotoxic drug. When the targeting moiety is an antibody, this type of system is often referred to as ADEPT (Antibody-Directed Enzyme Prodrug Therapy). This system requires that the targeting moiety positions the enzymatic moiety at a desired site in the patient's body (e.g., the site of new vascular tissue associated with a tumor), and after allowing time for the enzyme to localize at the site, a prodrug that is a substrate for the enzyme is administered, the end product of which is a cytotoxic compound. The goal of this approach is to maximize drug concentration at the desired site and minimize drug concentration in normal tissues (Senter et al. (1988) "Anti-tumor effects of antibody-alkaline phosphatase conjugates in combination with etoposide phosphate" Proc. Natl. Acad. Sci. USA 85, 4842-4846; Bagshawe (1987) Br. J. Cancer 56, 531-2; and Bagshawe, et al. (1988) "A cytotoxic agent can be generated selectively at cancer sites" Br. J. Cancer. 58, 700-703). Bagshawe (1995) Drug Dev. Res. 34, 220-230, and WO 2004 / 046191 describe various enzyme / prodrug combinations that may be suitable in the context of the present invention.

[0140] Typically, the prodrug is relatively non-toxic compared to the cytotoxic drug, typically having less than 10% toxicity, preferably less than 1% toxicity, as measured in a suitable in vitro cytotoxicity test.

[0141] The moiety capable of converting the prodrug into a cytotoxic drug is likely to be active independently of the rest of the compound, but it need only be active (a) in combination with the rest of the compound and (b) when the compound is bound to, adjacent to, or internalized by a target cell.

[0142] The cytotoxic moiety may be one that becomes cytotoxic or releases a cytotoxic moiety upon irradiation, for example, the boron-10 isotope, when suitably irradiated, emits alpha particles that are cytotoxic (U.S. Patent No. 4,348,376; Primus et al (1996) Bioconjug. Chem. 7:532-535).

[0143] Similarly, the cytotoxic moiety may be one useful in photodynamic therapy, such as Photofrin (see, eg, Dougherty et al (1998) J. Natl. Cancer Inst. 90, 889-905).

[0144] In certain embodiments, the cytotoxic moiety is an antibody, such as one that specifically binds to an immune cell, such as a cytotoxic immune cell (e.g., a T cell). Thus, in this case, the compound of the invention may be an asymmetric IgG-like antibody (e.g., triomab / quadroma, Trion Pharma / Fresenius Biotech; knobs-into-holes, Genentech; Cross MAbs, Roche; electrostatically matched antibodies, AMGEN; LUZ-Y, Genentech; strand exchange engineered domain (SEED) antibodies, EMD Serono; biolonic, erus; and Fab-exchange antibodies, Genmab), a symmetric IgG-like antibody (e.g., dual targeting (DT)-Ig, GSK / Domantis; two-in-one antibody, Genentech; cross-linked MAb, karmanos cancer center; mAb <2> , F-star; and Cov X-body, Cov X / Pfizer), IgG fusions (e.g., dual variable domain (DVD)-Ig, Abbott; IgG-like bispecific antibodies, Eli Lilly; Ts2Ab, Mediimmune / AZ; BsAb, ZymoGenetics; HERCULES, Biogen Idee; TvAb, Roche), Fc fusions (e.g., ScFv / Fc fusions, academic institutions; SCORPION, Emergent BioSolutions / Trubion, ZymoGenetics / BMS; dual affinity retargeting technology (Fc-DART), MacroGenics; dual (ScFv)2-Fab, National Research Center for Antibody Medicine) Fab fusions (e.g., F(ab)2, Medarex / AMGEN; dual-action or Bis-Fab, Genentech; Dock-and-Lock (DNL), ImmunoMedics; bivalent bispecific, Biotechnol;and Fab-Fv, UCB-Celltech), ScFv and diabody-based antibodies (e.g., bispecific T cell engager (BiTE), Micromet; tandem diabody (Tandab), Affimed; DARTs, MacroGenics; single-chain diabody, Academic; TCR-like antibody, AIT, Receptor Logics; human serum albumin ScFv fusion, Merrimack; and COMBODIES, Epigen Biotech), IgG / non-IgG fusions (e.g., immunocytokines, EMDSerono, Philogen, ImmunGene, ImmunoMedics; superantigen fusion proteins, Active Biotech; and immune mobilizing mTCR Against Cancer, ImmTAC), and oligoclonal antibodies (e.g., Symphogen and Merus);

[0145] In another embodiment, the cytotoxic moiety is a pyrrolobenzodiazepine dimer (PBD). PBDs are potent anticancer drugs that have been shown to have broad-spectrum antitumor activity in vivo. These drugs exert their activity by binding to the minor groove of DNA and linking two DNA strands together in a manner that proves difficult for cells to recognize and repair. Thus, the compounds of the present invention can be ADCs containing PBDs. Further information regarding PBDs can be found in Hartley et al., 2012 (Invest New Drugs 30:950-958).

[0146] In one aspect, the invention provides an antibody or antigen-binding fragment thereof, optionally as defined in any of the embodiments herein, that specifically binds to transforming growth factor beta receptor I (TGFβR1), wherein the antibody or fragment binds to a region of TGFβR1 comprising amino acid residues 126-133, and wherein the antibody or fragment competes with any of the antibodies defined in any of the embodiments described herein for binding to that region of TGFβR1.

[0147] Competition between antibodies can be assayed in vitro, for example, using ELISA, FACS, and / or by tagging one antibody with a specific reporter molecule that can be detected in the presence of the other, untagged antibody, allowing for the identification of specific binding members that bind to the same or overlapping epitopes. Cross-competition between binding members can be readily assayed by performing a reverse assay, for example, by reversing the tagged and untagged binding members to identify pairs that block binding in both directions. Competition can be determined by surface plasmon resonance (SPR), and such techniques are readily apparent to those skilled in the art. SPR can be performed using Biacore™, Proteon™, or another standard SPR technique. Such competition can result, for example, from antibodies / fragments that bind to the same or overlapping epitopes of TGFβR1.

[0148] In one aspect, the invention provides a pharmaceutical composition comprising an antibody or antigen-binding fragment thereof defined in any of the embodiments herein and a pharmaceutically acceptable carrier, excipient, or diluent.

[0149] As will be appreciated by those skilled in the art, the route and / or mode of administration will vary depending on the desired results. The pharmaceutical composition is preferably administered parenterally. "Parenteral administration" and "administered parenterally" include modes of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, epidural, and intrasternal injection, inhalation, and infusion. In one embodiment, the pharmaceutical composition is administered by intravenous or subcutaneous injection or infusion, or by inhalation.

[0150] Regardless of the selected route of administration, the antibodies and fragments of the present invention, which may be used in the form of a pharmaceutically acceptable salt or a suitable hydrated form, and / or the pharmaceutical compositions of the present invention are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those skilled in the art. As used herein, "pharmaceutically acceptable carrier" means any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents, antioxidants, absorption delaying agents, and the like that are physiologically compatible. Pharmaceutically acceptable carriers include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, its use in the pharmaceutical compositions of the present invention is contemplated. Preferably, the carrier is suitable for parenteral administration, e.g., intravenous or subcutaneous injection or infusion. Pharmaceutical compositions typically must be sterile and stable under the conditions of manufacture and storage. The composition can be formulated as a solution, microemulsion, liposome, or other regular structure suitable for high drug concentration.The examples of suitable aqueous and non-aqueous carriers that can be used in the pharmaceutical composition of the present invention include water, ethanol, polyol (glycerol, propylene glycol, polyethylene glycol, etc.), and their suitable mixtures, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.For example, the appropriate fluidity can be maintained by using coating materials such as lecithin, by maintaining the required particle size in the case of dispersion, and by using surfactants.

[0151] These pharmaceutical compositions may also contain auxiliary agents such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of the presence of microorganisms can be ensured both by sterilization procedures and by the inclusion of various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol sorbic acid, etc. It may also be preferable to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride in the compositions. Pharmaceutically acceptable antioxidants may also be used, for example, (1) water-soluble antioxidants such as ascorbic acid, cysteine ​​hydrochloride, sodium bisulfate, sodium metabisulfite, and sodium sulfite; (2) oil-soluble antioxidants such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, and α-tocopherol; and (3) metal chelating agents such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, and phosphoric acid. Prolonged absorption of injectable compositions can be achieved by including in the composition an agent that delays absorption, such as monostearate salts and gelatin. Sterile injectable solutions can be prepared by incorporating the required amount of active compound in an appropriate solvent, optionally containing one or a combination of the above-listed ingredients, followed by sterile microfiltration. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle containing a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum drying and freeze-drying (lyophilization), which yield a powder of the active ingredient and any additional desired ingredients from a previously sterile-filtered solution thereof. Where appropriate, the antibody can be used in a suitable hydrated form or in the form of a pharmaceutically acceptable salt. The term "pharmaceutically acceptable salt" includes salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects (see, for example, Berge, SM, et al. (1977) J. Pharm. Sci. 66:1-19).Examples of such salts include acid addition salts and base addition salts. Acid addition salts include those derived from non-toxic inorganic acids such as hydrochloric acid, nitric acid, phosphoric acid, sulfuric acid, hydrobromic acid, hydroiodic acid, and phosphorous acid, as well as non-toxic organic acids such as aliphatic mono- and dicarboxylic acids, phenyl-substituted alkanoic acids, hydroxyalkanoic acids, aromatic acids, and aliphatic and aromatic sulfonic acids. Base addition salts include those derived from alkaline earth metals such as sodium, potassium, magnesium, and calcium, as well as non-toxic organic amines such as N,N'-dibenzylethylenediamine, N-methylglucamine, chloroprocaine, choline, diethanolamine, ethylenediamine, and procaine. Depending on the route of administration, the active compound, i.e., antibody, may be coated with a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound. For example, the compound may be administered to a subject in a suitable carrier, such as liposomes. Liposomes include water-in-oil-in-water CGF emulsions and conventional liposomes (Strejan et al. (1984) J. Neuroimmunol. 7:27). The active compound can be prepared with a carrier that will protect the compound from rapid release, such as a controlled-release formulation, including implants, transdermal patches, and microencapsulated delivery systems. Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used. Methods for preparing such formulations are generally known to those skilled in the art. See, for example, *Sustained and Controlled Release Drug Delivery Systems*, JR Robinson, ed., Marcel Dekker, Inc., New York, 1978. The pharmaceutical composition can be administered using medical devices known in the art. For example, therapeutic compositions of the invention can be administered using a needleless hypodermic injection device, such as those disclosed in U.S. Pat. Nos. 5,399,163, 5,383,851, 5,312,335, 5,064,413, 4,941,880, 4,790,824, or 4,596,556.Examples of well-known implants and modules useful in the present invention include U.S. Pat. No. 4,487,603, which discloses an implantable microinfusion pump for dispensing drugs at a controlled rate; U.S. Pat. No. 4,486,194, which discloses a therapeutic device for administering drugs through the skin; U.S. Pat. No. 4,447,233, which discloses an infusion pump for delivering drugs at a precise infusion rate; U.S. Pat. No. 4,447,224, which discloses a variable flow rate implantable infusion device for continuous drug delivery; U.S. Pat. No. 4,439,196, which discloses an osmotic drug delivery system with multi-chamber compartments; and U.S. Pat. No. 4,475,196, which discloses an osmotic drug delivery system. Many other such implants, delivery systems, and modules are known to those skilled in the art. In certain embodiments, the human monoclonal antibodies of the present invention can be formulated to ensure proper distribution in vivo. For example, the blood-brain barrier (BBB) ​​excludes many highly hydrophilic compounds. To ensure that the therapeutic compounds of the invention cross the BBB (if desired), they can be formulated, for example, in liposomes. For methods of making liposomes, see, e.g., U.S. Patent Nos. 4,522,811, 5,374,548, and 5,399,331. Liposomes can contain one or more moieties that selectively transport to particular cells or organs, thus enhancing targeted drug delivery (see, e.g., V. V. Ranade (1989) J. Clin. Pharmacol.

[0152] In one aspect, the invention provides a method of formulating an antibody or antigen-binding fragment thereof into a pharmaceutical composition, the method comprising admixing an antibody or antigen-binding fragment thereof defined in any of the embodiments herein with a pharmaceutically acceptable carrier, excipient, or diluent.

[0153] Pharmaceutical compositions can be formulated with pharmaceutically acceptable carriers or diluents and any other known adjuvants and excipients according to conventional techniques, such as those disclosed in Remington: The Science and Practice of Pharmacy, 19th Edition, Gennaro, Ed., Mack Publishing Co., Easton, PA, 1995.

[0154] In one aspect, the invention provides an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, for use in medicine.

[0155] The antibody or antigen-binding fragment thereof may be for use in a method of treatment or diagnosis of the human or animal body, such as a method of treatment (which may include prophylactic treatment) of a disease or disorder in a human or animal patient, comprising administering to the patient an effective amount.

[0156] Therapeutic administration is preferably a "therapeutically effective amount" sufficient to show benefit to the patient. Such benefit may be at least amelioration of at least one symptom of a particular disease or condition. The actual amount administered, as well as the rate and time-course of administration, will depend on the nature and severity of the disease or condition being treated. The precise dose will depend on several factors, including whether the antibody or antigen-binding fragment thereof is diagnostic or therapeutic, the size and location of the area to be treated, the precise nature of the antibody or antigen-binding fragment thereof, e.g., whole antibody, Fab, or scFv fragment, and the nature of any detectable label or other molecule attached to the antibody or antigen-binding fragment thereof. Typical doses of whole antibodies, for example, can range from 100 μg to 1 g / kg body weight for systemic application.

[0157] The term "subject" or "patient" refers to any animal, including, but not limited to, mammals. As used herein, the term "mammal" refers to any vertebrate animal that either nurses its young and gives birth to live young (eutherian or placental mammals) or lays eggs (metatherian or non-placental mammals). Examples of mammalian species include, but are not limited to, humans and other primates, including non-human primates such as chimpanzees and other ape and monkey species; livestock, such as cows, sheep, pigs, goats, and horses; domestic mammals, such as dogs and cats; laboratory animals, including rodents, such as mice, rats (including cotton rats), and guinea pigs; and birds, including chickens, turkeys, and other galliformes, poultry, such as ducks and geese, wild birds, and game birds. Preferably, the subject is a human.

[0158] In one aspect, the invention provides an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, for use in the treatment and / or prevention of a disease or disorder mediated by proteolytic cleavage of TGFβR1.

[0159] The antibody or fragment of the present invention can reduce and / or inhibit the proteolytic cleavage of TGFβR1 as shown above. Therefore, such an antibody or fragment can be used to treat and / or prevent a disease or condition in a subject in which reduction and / or inhibition of the proteolytic cleavage of TGFβR1 is desired. Treatable diseases or conditions include any in which proteolytic cleavage of TGFβR1 plays a role, such as fibrotic diseases, cancer, immune-mediated diseases, and wound healing (such as keloids). The antibody or antigen-binding fragment thereof is useful for treating and / or preventing diseases and conditions that result directly or indirectly from the proteolytic cleavage of TGFβR1.

[0160] The terms "treat," "treatment," and "treating" refer to the reduction or amelioration of the progression, severity, and / or duration of a disease or disorder mediated by proteolytic cleavage of TGFβR1 (e.g., cancer) resulting from the administration of one or more therapies (including, but not limited to, one or more prophylactic or therapeutic agents, such as an antibody of the invention) to a subject. In the context of cancer therapy, "treatment" includes any medical intervention that results in partial remission of the cancer, such as slowing tumor growth or reducing tumor metastasis, and extending the patient's life expectancy.

[0161] In one embodiment, the proteolytic cleavage of TGFβR1 is in a region including amino acid residues 126-133 of TGFβR1, such as the region corresponding to amino acid residues 126-133 of human TGFβR1 (SEQ ID NO: 1), as described above.

[0162] In one aspect, the invention provides a method for treating and / or preventing a disease or disorder mediated by proteolytic cleavage of TGFβR1 in a subject, the method comprising administering to the subject an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein.

[0163] One skilled in the art can determine whether a cancer is mediated by cleavage of TGFβR1 by demonstrating the presence of nuclear TβRI-ICD by immunohistochemistry performed on the sample being tested, by in situ PLA performed on the sample being tested, or by detecting cleaved TβRI-ICD by immunoblotting performed on the sample being tested.

[0164] The method of treatment involves administering to the subject the antibody or antigen-binding fragment thereof, or a pharmaceutical composition comprising the antibody or antigen-binding fragment thereof.

[0165] The dosage for a single treatment of an adult patient may be adjusted proportionally for children and infants, and may also be adjusted for other antibody formats in proportion to their molecular weight and activity. Treatment may be repeated daily, twice weekly, weekly, monthly, or at other intervals, at the discretion of the physician. Treatment may be periodic, with the period between administrations being about 2 weeks or more, preferably about 3 weeks or more, more preferably about 4 weeks or more, or about once a month.

[0166] In one aspect, the invention provides the use of an antibody or antigen-binding fragment thereof as defined in any of the embodiments herein, or a pharmaceutical composition as defined in any of the embodiments herein, in the manufacture of a medicament for treating and / or preventing a disease or disorder mediated by proteolytic cleavage of TGFβR1.

[0167] In one embodiment, the disease or disorder is cancer, non-limiting examples of cancer include prostate cancer, oral cancer, renal cancer, kidney cancer, bladder cancer, breast cancer, lung cancer, endometrial cancer, stomach cancer, brain cancer, and colorectal cancer, as well as recurrence or metastasis of such tumors.

[0168] Types of kidney cancer include adrenocortical carcinoma. Types of brain cancer include brain low-grade glioma. Types of stomach cancer include gastric carcinoma. Types of kidney cancer include clear cell renal cell carcinoma (ccRCC). Types of breast cancer include triple-negative breast cancer.

[0169] Types of prostate cancer include castration-resistant prostate cancer. Types of oral cancer include oral squamous cell carcinoma. In one embodiment, the cancer is prostate cancer, optionally castration-resistant prostate cancer. In one embodiment, the cancer is colorectal cancer. In one embodiment, the cancer is oral squamous cell carcinoma.

[0170] In one embodiment, the disease is fibrosis. Non-limiting examples of fibrotic diseases include glomerulonephritis, nerve scarring, skin scarring, pulmonary fibrosis, lung fibrosis, radiation-induced fibrosis, liver fibrosis (such as NASH), myelofibrosis, burns, immune-mediated diseases, inflammatory diseases (including rheumatoid arthritis), transplant rejection, cancer, Dupuytren's contracture, atherosclerosis, and gastric ulcers.

[0171] In one embodiment, at least one additional therapeutic agent is administered to the subject.

[0172] As used herein, the term "therapeutic agent" refers to any agent that can be used in the treatment, management, or amelioration of a disease or disorder mediated by proteolytic cleavage of TGFβR1 and / or symptoms associated therewith. In certain embodiments, the term "therapeutic agent" refers to any antibody of the invention. In certain other embodiments, the term "therapeutic agent" refers to an agent other than an antibody of the invention. A therapeutic agent can be an agent that is known to be, has been used, or is currently being used to be useful in the treatment, management, or amelioration of a disease or disorder mediated by proteolytic cleavage of TGFβR1 or one or more symptoms associated therewith. Additional therapeutic agents include chemotherapeutic agents, such as those described herein.

[0173] In a further aspect, the present invention provides a method for identifying an agent for use in the treatment and / or prevention of a disease or disorder mediated by proteolytic cleavage of TGFβR1, the method comprising: providing TGFβR1 or a portion or variant thereof, wherein the portion or variant comprises amino acid residues 126 to 133 of TGFβR1; Providing a candidate drug; and determining whether the candidate agent reduces and / or inhibits proteolytic cleavage of TGFβR1 or a portion or variant thereof, in a region comprising amino acid residues 126 to 133 of TGFβR1.

[0174] The ability of the candidate agent to reduce and / or inhibit proteolytic cleavage of TGFβR1 or a portion or variant thereof may be assessed by any of the methods discussed herein. In one embodiment, the method includes selecting the candidate agent for further investigation.

[0175] Preferably, the identified agent reduces the level of proteolytic cleavage of TGFβR1 by at least 10%, 20%, 30%, 40%, or 50% compared to the level of proteolytic cleavage of TGFβR1 in the absence of the agent, or the identified agent reduces the level of proteolytic cleavage of TGFβR1 by at least 70%, 80%, 90%, 95%, or 99% compared to the level of proteolytic cleavage of TGFβR1 in the absence of the agent. Most preferably, the identified agent reduces the level of proteolytic cleavage of TGFβR1 to an undetectable level or eliminates proteolytic cleavage of TGFβR1 compared to the level of proteolytic cleavage of TGFβR1 in the absence of the agent.

[0176] The candidate agent may be any of an antibody, peptide, peptidomimetic, natural product, carbohydrate, aptamer, or small organic molecule.

[0177] Preferably, TGFβR1 or a portion or variant thereof comprises a TACE and / or PS1 cleavage site.

[0178] It will be appreciated that identifying an agent that reduces and / or inhibits the proteolytic cleavage of TGFβR1, or a portion or variant thereof, may be a first step in a drug screening pathway, and that the identified agent may be further selected for, for example, its ability to prevent nuclear translocation of TGFβR1-ICD and / or its ability to inhibit tumor growth. Thus, the method may further comprise testing the candidate agent in an assay described herein and / or testing the candidate agent for efficacy in an animal model of cancer. It will be appreciated that the antibody or fragment of the invention may be used as a positive control, i.e., a positive control for reducing and / or inhibiting the proteolytic cleavage of TGFβR1.

[0179] In one embodiment, the candidate agent is tested for efficacy in an animal model of cancer, hi one embodiment, the cancer is mediated by proteolytic cleavage of TGFβR1.

[0180] The method may include the further step of synthesizing and / or purifying the identified agent. The method may further include the step of formulating the agent into a pharmaceutically acceptable composition.

[0181] In a further aspect, the present invention provides the use of an antibody or antigen-binding fragment thereof defined in any of the embodiments herein for reducing and / or inhibiting proteolytic cleavage of TGFβR1 and / or reducing and / or inhibiting translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of a cell.

[0182] Reduction and / or inhibition of proteolytic cleavage of TGFβR1 and reduction and / or inhibition of translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of a cell, and methods for determining such reduction and / or inhibition, are as described herein.

[0183] In a further aspect, the present invention provides a kit comprising an antibody or antigen-binding fragment thereof as defined herein, or a pharmaceutical composition as defined herein.

[0184] Kits are provided that include antibodies or antigen-binding fragments thereof. The antibodies or antigen-binding fragments thereof may be labeled to allow for their reactivity in a sample to be determined. The kits may be used in diagnostic assays. The kits may include instructions for use of the components. Ancillary materials that aid in or enable the performance of such methods may be included in the kit. In one embodiment, the kit contains an additional therapeutic agent.

[0185] In one embodiment, the kit contains components for detecting biomarkers that specifically determine the activation status of the non-canonical TGFβR1 pathway in cells. Protein biomarkers can be detected, for example, by ELISA or in situ PLA. RNA biomarkers can be detected by qRT-PCR, digital PCR, or droplet PCR. An example of such an assay is the in situ PLA assay for detecting nuclear TβRI complexed with APPL described in Song et al., Oncotarget, 2016 Jan 5;7(1):279-92.

[0186] In a further aspect of the invention, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof as defined herein.

[0187] The invention provides a nucleic acid molecule comprising a nucleotide sequence encoding any of the antibodies or fragments described herein.

[0188] Nucleic acids can be RNA, DNA, or cDNA. Nucleic acids can be in essentially isolated or purified form. An "isolated" nucleic acid molecule includes a nucleic acid molecule that is separated from other nucleic acid molecules that are present in the natural source of the nucleic acid molecule. An "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium if produced by recombinant techniques, or substantially free of chemical precursors or other chemicals if chemically synthesized. As used herein, the terms "polynucleotide," "nucleotide," "nucleic acid," "nucleic acid molecule," and other similar terms are used interchangeably and include DNA, RNA, mRNA, etc.

[0189] The present invention provides a nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGFβR1), wherein the nucleotide sequence is selected from the group consisting of antibody YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01. VL, or YU772-A11, or antibody 19. Also included are nucleic acid molecules containing nucleotide substitutions, wherein each substitution results in either no amino acid change or a conservative amino acid change in the corresponding protein sequence (i.e., the nucleotide substitution is a synonymous substitution).

[0190] In one embodiment, the nucleic acid molecule comprises a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO:3 and / or a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO:11.

[0191] In one embodiment, the nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGFβR1) comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to a heavy chain variable region as defined in the Sequence Listing, such as the heavy chain variable region of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19.

[0192] In one embodiment, the nucleic acid comprising a nucleotide sequence encoding an antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGFβR1) comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to a light chain variable region as defined in the Sequence Listing, such as the heavy chain variable region of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19.

[0193] Also provided are two nucleic acid molecules, wherein the first nucleic acid molecule is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to a heavy chain variable region (VH) as defined in the Sequence Listing, such as the VH of any of antibodies YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or antibody 19. The second nucleic acid molecule comprises a nucleotide sequence that is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical, or 100% identical, to a light chain variable region (VL) as defined in the Sequence Listing, such as the VL of antibody YU772-F11, or YU772-G12, or YU771-A01, or YU772-D10, or YU771-E01, or YU771-B12, or YU772-G04-VH / YU771-A09VL, or YU772-H05, or YU772-D10VH / YU772-C01VL, or YU772-A11, or any of antibody 19.

[0194] The nucleic acids of the present invention can be prepared or obtained by methods known in the art (e.g., by automated DNA synthesis and / or recombinant DNA techniques) based on the information on the amino acid sequences of the polypeptides of the present invention provided herein, and / or can be isolated from suitable natural sources.

[0195] In a further aspect, the present invention provides a vector comprising a nucleic acid molecule as defined herein.

[0196] The nucleic acids of the present invention may be in the form of a vector such as a plasmid, cosmid, or YAC. The vector may be of any type, for example, a recombinant vector such as an expression vector. A suitable vector containing appropriate regulatory sequences, including promoter sequences, terminator sequences, polyadenylation sequences, enhancer sequences, marker genes, and other sequences, may be selected or constructed as needed. The vector may be a plasmid, a virus, such as a phage or phagemid, or an adenovirus, AAV, lentivirus, or the like, as needed. Many known techniques and protocols for manipulating nucleic acids are known in the art, for example, in preparing nucleic acid constructs, mutagenesis, sequencing, introducing DNA into cells, and analyzing gene expression and proteins.

[0197] It is understood that in certain embodiments, the nucleic acid molecules and expression vectors may be used in the therapeutic aspects of the invention via a gene therapy approach using formulations and methods described below and known in the art.

[0198] In a further aspect, the present invention provides a host cell comprising a nucleic acid as defined herein or a vector as defined herein.

[0199] In another aspect, the present invention relates to a host cell that expresses or is capable of expressing one or more antibodies or antigen-binding fragments thereof that specifically bind to transforming growth factor beta receptor I (TGFβR1) and / or that contains a vector of the invention and / or a nucleic acid of the invention. According to a particularly preferred embodiment, the host cell is a bacterial cell; other useful cells are yeast, fungal, or mammalian cells.

[0200] Suitable bacterial cells include gram-negative bacteria such as Escherichia coli (eg, BL21), Proteus and Pseudomonas, and gram-positive bacteria such as Bacillus, Streptomyces, Staphylococcus, and Lactococcus.

[0201] Suitable fungal cells include cells from species of the genera Trichoderma, Red-headed mold, and Aspergillus. Suitable yeast cells include Saccharomyces (e.g., Saccharomyces cerevisiae), Schizosaccharomyces (e.g., Schizosaccharomyces pombe), Pichia (e.g., Pichia pastoris, Pichia methanolica), and Hansenula species.

[0202] Suitable mammalian cells include, for example, HEK293 cells, CHO cells, BHK cells, HeLa cells, COS cells, and the like.

[0203] However, it will be understood that amphibian cells, avian cells, insect cells, plant cells, and any other cells used by those skilled in the art for expression of heterologous proteins may be used. Examples of plant cells include Physcomitrium patens.

[0204] Any available technique can be used to introduce nucleic acid molecules into host cells. For eukaryotic cells, suitable techniques include calcium phosphate transfection, DEAE-dextran, electroporation, liposome-mediated transfection, and transduction using retroviruses or other viruses, such as vaccinia, or, in the case of insect cells, baculovirus. Introduction of nucleic acids into host cells, particularly eukaryotic cells, can also use viral or plasmid-based systems.

[0205] In a further aspect, the present invention provides a method of producing an antibody or antigen-binding fragment thereof defined herein, the method comprising expressing a nucleic acid molecule defined in any embodiment herein, optionally comprising culturing a host cell defined herein, and optionally further comprising isolating the antibody or antigen-binding fragment thereof from the host cell.

[0206] In a further aspect, the present invention provides an antibody or antigen-binding fragment thereof, pharmaceutical composition, method, use, kit, nucleic acid molecule, vector, or host cell substantially as herein described with reference to the accompanying description, examples, and drawings.

[0207] The invention will now be described with reference to the following non-limiting figures and examples. [Brief explanation of the drawings]

[0208] [Figure 1] Periplasmically expressed scFvs from individual clones 11 to 20 screened for binding to recombinant TGFbR1-ECD-133-myc(His)6 and TGFbR1-ECD-125-myc(His)6 and TGFbR1-derived peptides spanning amino acids 106-120 and 106-125 of SEQ ID NO: 1 are shown. [Figure 2] 1 shows a graph depicting concentration-dependent inhibition of TβRI-ICD translocation to the nucleus of human castration-resistant prostate cancer (PC-3U) cells. [Figure 3] 1 shows a graph depicting inhibition of TGFβ-induced invasion of PC-3U cells by chimeric mouse mAb #19. [Figure 4] Determination of the dissociation constant (Kd) of chimeric mouse antibody #19 against recombinant human TGFbR1-ECD133-myc(His)6. Chimeric mouse mAb #19 was loaded at 200 nM (run 1), 100 nM (run 2), 50 nM (run 3), and 20 nM (run 4). Chimeric mouse mAb #19 at 100 nM in the absence of immobilized TGFbR1-ECD133-myc(His)6 (run 5) was used as a reference. [Figure 5] Determination of the equilibrium dissociation constant (Kd) of chimeric mouse antibody #19 against human TGFbRI-133-huFc is shown. Mouse control antibody (#4-4-20 with specificity for fluorescein) was loaded at 200 nM (run 1), and chimeric mouse mAb #19 was loaded at 200 nM (run 2), 100 nM (run 3), 50 nM (run 4), and 25 nM (run 5). Run 1 was used as a reference for Kd analysis, while run 6 (400 nM of mouse control antibody (#4-4-20 with specificity for fluorescein) (run 6) was not included in the analysis. [Figure 6] 1 shows a graph depicting the concentration-dependent inhibition (IC50) of TβRI-ICD translocation to the nucleus of PC-3U cells. [Figure 7] A table showing the alignment of the C-terminal human and mouse Alk5 sequences (aa 101-147) from recombinant proteins tested for epitope mapping. Single point amino acid mutations in each construct are shown in bold. [Figure 8A] Figure 1 shows the binding of mouse chimeric mAb #19 to titrated recombinant TGFbRI mutants with alanine mutations at positions 127 (A), 128 (B), and 131 (C). The affinity results obtained for the single mutations are summarized in the table in (D). Recombinant ECD proteins with mutations that abolished binding by mouse chimeric antibody #19 are indicated as nf. [Figure 8B] Figure 1 shows the binding of mouse chimeric mAb #19 to titrated recombinant TGFbRI mutants with alanine mutations at positions 127 (A), 128 (B), and 131 (C). The affinity results obtained for the single mutations are summarized in the table in (D). Recombinant ECD proteins with mutations that abolished binding by mouse chimeric antibody #19 are indicated as nf. [Figure 8C] Figure 1 shows the binding of mouse chimeric mAb #19 to titrated recombinant TGFbRI mutants with alanine mutations at positions 127 (A), 128 (B), and 131 (C). The affinity results obtained for the single mutations are summarized in the table in (D). Recombinant ECD proteins with mutations that abolished binding by mouse chimeric antibody #19 are indicated as nf. [Figure 8D] Figure 1 shows the binding of mouse chimeric mAb #19 to titrated recombinant TGFbRI mutants with alanine mutations at positions 127 (A), 128 (B), and 131 (C). The affinity results obtained for the single mutations are summarized in the table in (D). Recombinant ECD proteins with mutations that abolished binding by mouse chimeric antibody #19 are indicated as nf. [Figure 9A] Recombinant ECD mutants separated by SDS-PAGE and stained with Coomassie blue or immunoblotted with mouse chimeric Ab #19 are shown. [Figure 9B] Recombinant ECD mutants separated by SDS-PAGE and stained with Coomassie blue or immunoblotted with mouse chimeric Ab #19 are shown. [Figure 10A] The amino acids that define the epitope of mouse chimeric mAb #19 as determined by binding to recombinant ECD are shown (FIGS. 8 and 9). [Figure 10B] Epitope mapping of mAb#19 and #F11 using an alignment of the human ECD-TGFbR1 protein sequence from aa 1 to 147. The putative transmembrane region at amino acids 127 to 147 is shaded. (A) Summary of mAb#19 epitope mapping performed by introducing single point mutation exchanges into the recombinant protein (ECD-protein) spanning amino acids 126 to 133. Substitutions at amino acid positions that substantially reduce mAb binding in ELISA or Western blot are underlined and shown in bold. (B) Summary of mAb#19 epitope mapping using a library of overlapping synthetic TGFbR1 peptides. The core epitope based on the consensus sequence in the overlapping peptides is underlined, and residues affected by alanine mutations are shown in bold and italic. (C) Summary of mAb#F11 epitope mapping using a library of overlapping synthetic TGFbR1 peptides, as in (B). [Figure 11A]Mean (±SD) plasma concentration versus time profiles for murine chimeric mAb19 after ip administration to athymic nude Foxn1nu mice (n=3 per time point) at nominal dose levels of 10 and 50 mg / kg. (A) represents the time scale from 0 to 72 hours post-dose, and (B) represents the entire time course of the study. [Figure 11B] Mean (±SD) plasma concentration versus time profiles for murine chimeric mAb19 after ip administration to athymic nude Foxn1nu mice (n=3 per time point) at nominal dose levels of 10 and 50 mg / kg. (A) represents the time scale from 0 to 72 hours post-dose, and (B) represents the entire time course of the study. [Figure 12A] Graphs showing the effect of treatment with murine chimeric mAb #19 on tumor growth (A, C), lymph nodes (B), and lymph node metastasis (D) in a human PC3U orthotopic prostate cancer model are shown. [Figure 12B] Graphs showing the effect of treatment with murine chimeric mAb #19 on tumor growth (A, C), lymph nodes (B), and lymph node metastasis (D) in a human PC3U orthotopic prostate cancer model are shown. [Figure 12C] Graphs showing the effect of treatment with murine chimeric mAb #19 on tumor growth (A, C), lymph nodes (B), and lymph node metastasis (D) in a human PC3U orthotopic prostate cancer model are shown. [Figure 12D] Graphs showing the effect of treatment with murine chimeric mAb #19 on tumor growth (A, C), lymph nodes (B), and lymph node metastasis (D) in a human PC3U orthotopic prostate cancer model are shown. [Figure 13A] Shown are histological sections from tumor tissue and regional lymph nodes treated from mice treated with mouse chimeric mAb #19. [Figure 13B] Shown are histological sections from tumor tissue and regional lymph nodes treated from mice treated with mouse chimeric mAb #19. [Figure 14A]In situ PLA to visualize nuclear complex formation of TGFbRI-ICD (by detection of the C-terminal HA tag) and p300 (detected by anti-HA and goat polyclonal anti-p300 (R&D Cat. AF3789), respectively) in histological sections from tumor tissue removed from mice treated with PBS (blank control), 50 mg / kg isotype control IgG1 mAb (anti-fluorescein), or two concentrations of chi-mAb#19 (10 mg / kg and 50 mg / kg). A: Representative IHC sections. B: Numerical representation of analysis of tissue sections: Complex formation is statistically reduced upon treatment with 50 mg / kg and 10 mg / kg chim-mAb#19 compared to treatment with vehicle control or 50 mg / kg isotype control IgG1. **p<0.01 and ****p<0.001 Student's T-test. [Figure 14B] In situ PLA to visualize nuclear complex formation of TGFbRI-ICD (by detection of the C-terminal HA tag) and p300 (detected by anti-HA and goat polyclonal anti-p300 (R&D Cat. AF3789), respectively) in histological sections from tumor tissue removed from mice treated with PBS (blank control), 50 mg / kg isotype control IgG1 mAb (anti-fluorescein), or two concentrations of chi-mAb#19 (10 mg / kg and 50 mg / kg). A: Representative IHC sections. B: Numerical representation of analysis of tissue sections: Complex formation is statistically reduced upon treatment with 50 mg / kg and 10 mg / kg chim-mAb#19 compared to treatment with vehicle control or 50 mg / kg isotype control IgG1. **p<0.01 and ****p<0.001 Student's T-test. [Figure 15] 1 shows the plasma concentration of mouse mAb #19 in the blood as measured by mass spectrometry at the end of a treatment period lasting 30 days. Blood samples were taken from the mice 72 hours after the last intraperitoneal injection. [Figure 16] 1 shows an analysis of weight gain in tumor-burdened mice by measuring the total weight of the mice during the treatment period. [Figure 17A]mAb#19 binding to its endogenous target in PC-3U (A) and RWPE (B) cells, respectively. [Figure 17B] mAb#19 binding to its endogenous target in PC-3U (A) and RWPE (B) cells, respectively. [Figure 18A] 1 shows IC50 determination of (A) mouse chimeric mAb #19 and (B) fully human mAb #19 (carrying the LALA mutation) against recombinant human TGFbRI ECD-133-myc-(His)6 protein. [Figure 18B] 1 shows IC50 determination of (A) mouse chimeric mAb #19 and (B) fully human mAb #19 (carrying the LALA mutation) against recombinant human TGFbRI ECD-133-myc-(His)6 protein. [Figure 19A] 1 shows concentration-dependent inhibition of nuclear translocation of TβRI-ICD in PC3U cells treated with various concentrations of human mAb#19-IgG1-LALA or chimeric mAb#19-IgG1. [Figure 19B] 1 shows concentration-dependent inhibition of nuclear translocation of TβRI-ICD in PC3U cells treated with various concentrations of human mAb#19-IgG1-LALA or chimeric mAb#19-IgG1. [Figure 20A] PC-3U cells were treated with various antibodies (#4, #16, #19) or Lily compound (Ly, galunisertib) at the indicated concentrations for 6 hours, with or without TGF-beta stimulation. Graphs show the mean ± SEM from three independent experiments. The intensity of the immunoblots was measured, and the ratio of pSmad2 / total Smad2 was considered as the normalized signal of pSmad2. Student's t-test, *between different sample sets (TGF-beta stimulated cells vs. unstimulated cells). **P<0.01, ***P<0.001, ▲within one set of experiments (Lily compound treated vs. untreated cells). ▲▲<0.01, ▲▲▲P<0.001. [Figure 20B]PC-3U cells were treated with various antibodies (#4, #16, #19) or Lily compound (Ly, galunisertib) at the indicated concentrations for 6 hours, with or without TGF-beta stimulation. Graphs show the mean ± SEM from three independent experiments. The intensity of the immunoblots was measured, and the ratio of pSmad2 / total Smad2 was considered as the normalized signal of pSmad2. Student's t-test, *between different sample sets (TGF-beta stimulated cells vs. unstimulated cells). **P<0.01, ***P<0.001, ▲within one set of experiments (Lily compound treated vs. untreated cells). ▲▲<0.01, ▲▲▲P<0.001. [Figure 21A] : Staining of TGFβRI in PC3U cells. The selected antibody candidates were used for staining of TGFβRI in PC3U cells. The geometric mean fluorescence intensity (MFI) of PE (linear scale) is plotted against the corresponding concentration of the antibody candidate (logarithmic scale). [Figure 21B] : Staining of TGFβRI in PC3U cells. The selected antibody candidates were used for staining of TGFβRI in PC3U cells. The geometric mean fluorescence intensity (MFI) of PE (linear scale) is plotted against the corresponding concentration of the antibody candidate (logarithmic scale). [Figure 22A] Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22B]Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22C] Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22D] Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22E]Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22F] Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 22G] Evaluation of the inhibitory effect of affinity-matured antibodies on the generation of nuclear TβRI-ICD complexed with p300. Nuclear TβRI-ICD complexed with endogenous p300 assay in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) (HA-tagged) were reconstituted with stable expression of TβRI-HA-tagged (C-terminally tagged) and treated with affinity-matured antibodies (mAbF11 (22A), mAb19 (22B), mAbG12 (22C), D10 (22D), Yumab19 (22E), A09 (22F), and B12 (22G). [Figure 23]Invasion assay showing the invasion of human breast cancer MDA MB-231 cells. MDA MB-231 cells were treated with mAb #F11 (200 nM), mAb #A19 (200 nM), control mAb pavilizumab (200 nM), and galunisertib (10 μM). mAbs #F11, A19, and pavilizumab carry the same Fc-silencing mutations as described. After 1 hour, cells were treated with TGF-β1 for 24 hours. Bars represent the optical density (OD) of invaded cells measured at 560 nm. Error bars represent the mean ± SEM from three independent experiments. **P ≤ 0.005, *P ≤ 0.05 (Student's t-test). [Figure 24] In situ PLA assay to show the number of nuclear TβRI-ICD complexed with p300 in human prostate cancer (PC3U) cells treated as indicated. mAb #19 was more effective than mAb #4 and antibody 82.18 in preventing the generation of nuclear TβRI-ICD. Error bars represent the mean ± SEM from three independent experiments. ***P ≤ 0.001 (Student's t-test). [Figure 25] The amino acid sequence of human ALK5 containing the transmembrane domain is shown in bold. Arrows labeled 1 and 2 indicate where recombinant ALK5 was cleaved by recombinant TACE. The first cleavage site (arrow 1) was between amino acids A and A. The second cleavage site (arrow 2) was between amino acids A and V. The identity of the cleavage sites was determined by mass spectrometry. [Figure 26]A: Schematic diagram of recombinant TGFbRI-ECD-128-myc(His)6 protein with the point mutation shown at amino acid position 133. B: SDS-PAGE (12% in MES buffer) of recombinant TGFbRI-ECD-133-myc(His)6 protein (wt, A128G-, and A128I-mutated) in the absence and presence of TACE. Recombinant wt TGFbRI-ECD-133-myc(His)6 protein is cleaved by TACE. Cleavage is strongly inhibited by substituting alanine at position 128 with glycine or isoleucine. Lane 1: wt TGFbRI-ECD-133-myc(His)6 protein after overnight incubation with TACE enzyme at 24°C. The apparent molecular weight corresponds to the calculated molecular weight of 10,981 Da after cleavage at amino acid position 128 (A). Lane 2: Wild-type TGFbRI-ECD-133-myc(His)6 protein after overnight incubation at 24°C in the absence of TACE enzyme. The apparent molecular weight corresponds to a calculated molecular weight of 13,658 Da. Lane 3: Molecular mass ladder (Cat#26616, ThermoFisherScientific). Lane 4: TGFBRI-ECD-A128G-133-myc(His)6 protein after overnight incubation with TACE enzyme at 24°C. Lane 5: TGFBRI-ECD-A128G-133-myc(His)6 protein after overnight incubation at 24°C in the absence of TACE enzyme. Lane 6: Molecular mass ladder (Cat# 26616, ThermoFisherScientific). Lane 7: TGFBRI-ECD-A128I-133-myc(His)6 protein after overnight incubation with TACE enzyme at 24°C. Lane 8: TGFBRI-ECD-A128I-133-myc(His)6 protein after overnight incubation at 24°C in the absence of TACE enzyme. Lane 9: Molecular mass ladder (Cat# 26616, ThermoFisherScientific). [Figure 27-1]Prostate cancer tumors and lymph nodes in mice injected with prostate cancer cells after treatment with 50 mg / kg control (control) mAb, 50 mg / kg mAb19, 50 mg / kg mAbF11, and 10 mg / kg mAbF11, respectively. Representative photographs of prostate cancer tumors after treatment (Figure a). Prostate tumor weight after treatment: All treatments resulted in a reduction in tumor weight compared to the control mAb, 50 mg / kg (N = 4): 50 mg / kg mAb19: N = 4, difference 183 mg, p = 0.05; 50 mg / kg mAbF11: N = 5, difference 192 mg, p > 0.05; and 10 mg / kg mAbF11: N = 6, difference 158 mg, p = 0.05) (Figure b). Prostate tumor volume after treatment was compared with the control mAb, 50 mg / kg (N = 4). 50 mg / kg mAb19 did not significantly reduce tumor volume (N = 5, p = 0.07), 50 mg / kg mAbF11 significantly reduced tumor volume (N = 4, difference 185 mm3, p > 0.05), and 10 mg / kg mAbF11 also significantly reduced tumor volume (N = 4, difference 170 mm3, p > 0.05) (Figure c). Representative photographs of lymph nodes after treatment (Figure d). Lymph node weight compared with the control mAb, 50 mg / kg (N = 7). Treatment with 50 mg / kg mAb19 significantly reduced lymph node weight compared to the control (N = 5, difference 9 mg, p > 0.05). The same was observed with 50 mg / kg mAbF11 treatment (N = 7, difference 9 mg, p > 0.05). 10 mg / kg mAbF11 did not significantly reduce weight (N = 9, p = 0.16) (Figure e). Lymph node volume was significantly reduced with all treatments with mAb19 and mAb F11 compared to the control mAb 50 mg / ml (N = 6): 50 mg / kg mAb19: N = 8, difference 13 mm3, p = 0.05; 50 mg / kg mAbF11: N = 7, difference 17 mm3, p > 0.05; and 10 mg / kg mAbF11: N = 8, difference 15 mm3, p > 0.05) (Figure f). The various treatments did not affect mouse weight compared to the control mAb 50 mg / kg (Figure g). [Figure 27-2]Prostate cancer tumors and lymph nodes in mice injected with prostate cancer cells after treatment with 50 mg / kg control (control) mAb, 50 mg / kg mAb19, 50 mg / kg mAbF11, and 10 mg / kg mAbF11, respectively. Representative photographs of prostate cancer tumors after treatment (Figure a). Prostate tumor weight after treatment: All treatments resulted in a reduction in tumor weight compared to the control mAb, 50 mg / kg (N = 4): 50 mg / kg mAb19: N = 4, difference 183 mg, p = 0.05; 50 mg / kg mAbF11: N = 5, difference 192 mg, p > 0.05; and 10 mg / kg mAbF11: N = 6, difference 158 mg, p = 0.05) (Figure b). Prostate tumor volume after treatment was compared with the control mAb, 50 mg / kg (N = 4). 50 mg / kg mAb19 did not significantly reduce tumor volume (N = 5, p = 0.07), 50 mg / kg mAbF11 significantly reduced tumor volume (N = 4, difference 185 mm3, p > 0.05), and 10 mg / kg mAbF11 also significantly reduced tumor volume (N = 4, difference 170 mm3, p > 0.05) (Figure c). Representative photographs of lymph nodes after treatment (Figure d). Lymph node weight compared with the control mAb, 50 mg / kg (N = 7). Treatment with 50 mg / kg mAb19 significantly reduced lymph node weight compared to the control (N = 5, difference 9 mg, p > 0.05). The same was observed with 50 mg / kg mAbF11 treatment (N = 7, difference 9 mg, p > 0.05). 10 mg / kg mAbF11 did not significantly reduce weight (N = 9, p = 0.16) (Figure e). Lymph node volume was significantly reduced with all treatments with mAb19 and mAb F11 compared to the control mAb 50 mg / ml (N = 6): 50 mg / kg mAb19: N = 8, difference 13 mm3, p = 0.05; 50 mg / kg mAbF11: N = 7, difference 17 mm3, p > 0.05; and 10 mg / kg mAbF11: N = 8, difference 15 mm3, p > 0.05) (Figure f). The various treatments did not affect mouse weight compared to the control mAb 50 mg / kg (Figure g). [Figure 28-1]TGFβR1 expression in mCRPC tumors after treatment with mAb19 50 mg / kg, F11 mAb (10 or 50 mg / kg), or control mAb (50 mg / kg). High expression of TGFβR1 was reduced after treatment with mAb19 at 50 mg / kg (difference = 180,608 cells, p > 0.05), mAb F11 at 50 mg / kg (difference = 178,955 cells, p > 0.05), or mAb F11 at 10 mg / kg (difference = 138,022 cells, p > 0.05) compared to the control mAb (Figures a and b). Low expression of Ki67 was reduced after treatment with mAb19 (difference = 45,903 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 34,113 cells, p > 0.05), or 10 mg / kg mAb F11 (difference = 32,955 cells, p > 0.05) compared to control mAb. Medium expression of Ki67 was reduced after treatment with 10 mg / kg mAb F11 (difference = 14,545 cells, p > 0.05) compared to control mAb. Treatment with 50 mg / kg mAb19 or 50 mg / kg mAb F11 showed no difference in medium expression of Ki67. Finally, high Ki67 expression was reduced after treatment with mAb F11 at both 50 mg / kg (difference = 12,763 cells, p > 0.05) and 10 mg / kg (difference = 17,994 cells, p > 0.05) compared to the control mAb. No difference was observed after treatment with mAb19 at 50 mg / kg (Figures c and d). Low vimentin expression was reduced after treatment with mAb19 at 50 mg / kg (difference = 63,262 cells, p > 0.05), mAb F11 at 50 mg / kg (difference = 34,534 cells, p > 0.05), or mAb F11 at 10 mg / kg (difference = 54,443 cells, p > 0.05) compared to the control mAb. Furthermore, moderately expressed vimentin was decreased after treatment with 50 mg / kg mAb19 (difference = 46,192 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 44,331 cells, p > 0.05), and 10 mg / kg mAb F11 (difference = 69,962 cells, p > 0.001) compared with the control mAb (Figures e and f). [Figure 28-2]TGFβR1 expression in mCRPC tumors after treatment with mAb19 50 mg / kg, F11 mAb (10 or 50 mg / kg), or control mAb (50 mg / kg). High expression of TGFβR1 was reduced after treatment with mAb19 at 50 mg / kg (difference = 180,608 cells, p > 0.05), mAb F11 at 50 mg / kg (difference = 178,955 cells, p > 0.05), or mAb F11 at 10 mg / kg (difference = 138,022 cells, p > 0.05) compared to the control mAb (Figures a and b). Low expression of Ki67 was reduced after treatment with mAb19 (difference = 45,903 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 34,113 cells, p > 0.05), or 10 mg / kg mAb F11 (difference = 32,955 cells, p > 0.05) compared to control mAb. Medium expression of Ki67 was reduced after treatment with 10 mg / kg mAb F11 (difference = 14,545 cells, p > 0.05) compared to control mAb. Treatment with 50 mg / kg mAb19 or 50 mg / kg mAb F11 showed no difference in medium expression of Ki67. Finally, high Ki67 expression was reduced after treatment with mAb F11 at both 50 mg / kg (difference = 12,763 cells, p > 0.05) and 10 mg / kg (difference = 17,994 cells, p > 0.05) compared to the control mAb. No difference was observed after treatment with mAb19 at 50 mg / kg (Figures c and d). Low vimentin expression was reduced after treatment with mAb19 at 50 mg / kg (difference = 63,262 cells, p > 0.05), mAb F11 at 50 mg / kg (difference = 34,534 cells, p > 0.05), or mAb F11 at 10 mg / kg (difference = 54,443 cells, p > 0.05) compared to the control mAb. Furthermore, moderately expressed vimentin was decreased after treatment with 50 mg / kg mAb19 (difference = 46,192 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 44,331 cells, p > 0.05), and 10 mg / kg mAb F11 (difference = 69,962 cells, p > 0.001) compared with the control mAb (Figures e and f). [Figure 29]Figure 1 shows the size and volume of prostate tumors after treatment with F11 mAb (3 / 10 / 30 mg / kg IP twice weekly) or control mAb (30 mg / kg IP twice weekly). Representative diagram showing prostate tumors after treatment (Figure a). Prostate tumor volumes were measured after these treatments. Compared with the control mAb, treatment with mAb F11 at 3 mg / kg did not significantly reduce tumor volume (p-value = 0.75), whereas treatment with mAb F11 at 10 mg / kg significantly reduced tumor volume (difference = 147 mm3, p-value > 0.05). Increasing the concentration of mAb F11 at 30 mg / kg also reduced tumor volume compared with the control mAb (difference = 138 mm3, p-value > 0.05) (Figure b). Representative figures show lymph nodes after treatment with 30 mg / kg control mAb, 3 mg / kg mAbF11, 10 mg / kg mAbF11, and 30 mg / kg mAbF11 (Figure c). Lymph node volume was also measured. Treatment with 10 mg / kg mAbF11 reduced lymph node volume compared to control mAb (difference = 10 mm3, p-value > 0.05). Treatment with 30 mg / kg mAbF11 similarly reduced volume compared to control mAb (difference = 8 mm3, p-value > 0.05). Decreasing concentrations of 3 mg / kg mAbF11 did not significantly reduce lymph node volume compared to control mAb (difference = -3 mm3, p-value = 0.59) (Figure d). Measurement of mouse body weight after treatment with 30 mg / kg control mAb, 3 mg / kg mAbF11, 10 mg / kg mAbF11, and 30 mg / kg mAbF11 (Figure e). [Figure 30-1]TGFβR1 expression in mCRPC tumors after treatment with F11 mAb (3 / 10 / 30 mg / kg) or control mAb (30 mg / kg). Medium-score TGFβR1 expression was reduced in mAbF11 at 3 mg / kg (difference = 71,468 cells, p = 0.017), mAbF11 at 10 mg / kg (difference = 76,653 cells, p = 0.017), and mAbF11 at 30 mg / kg (difference = 88,622 cells, p = 0.007) compared to control mAb. High TGFβR1 expression was reduced after 3 mg / kg mAbF11 (difference = 214,031 cells, p = 0.001), 10 mg / kg mAbF11 (difference = 208,635 cells, p > 0.001), and 30 mg / kg mAbF11 (difference = 202,263 cells, p = 0.002) (a and b). Low Ki67 expression was reduced after 3 mg / kg mAbF11 (difference = 56,055 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) compared to the control mAb. Reduction of Ki67 medium expression after mAbF11 treatment: 3 mg / kg (difference = 21,498 cells, p = 0.005), 10 mg / kg (difference = 20,845 cells, p > 0.0001), 30 mg / kg (difference = 24,357 cells, p > 0.0001). Reduction of Ki67 high expression after mAbF11 treatment: 3 mg / kg mAbF11 (difference = 56,054 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) (c and d). Expression of the EMT marker vimentin was reduced only with 30 mg / kg mAbF11 treatment: low (difference = 100784, p = 0.002), medium (difference = 100416, p = 0.003), and high (difference = 98960, p = 0.035) (e and f). [Figure 30-2]TGFβR1 expression in mCRPC tumors after treatment with F11 mAb (3 / 10 / 30 mg / kg) or control mAb (30 mg / kg). Medium-score TGFβR1 expression was reduced in mAbF11 at 3 mg / kg (difference = 71,468 cells, p = 0.017), mAbF11 at 10 mg / kg (difference = 76,653 cells, p = 0.017), and mAbF11 at 30 mg / kg (difference = 88,622 cells, p = 0.007) compared to control mAb. High TGFβR1 expression was reduced after 3 mg / kg mAbF11 (difference = 214,031 cells, p = 0.001), 10 mg / kg mAbF11 (difference = 208,635 cells, p > 0.001), and 30 mg / kg mAbF11 (difference = 202,263 cells, p = 0.002) (a and b). Low Ki67 expression was reduced after 3 mg / kg mAbF11 (difference = 56,055 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) compared to the control mAb. Reduction of Ki67 medium expression after mAbF11 treatment: 3 mg / kg (difference = 21,498 cells, p = 0.005), 10 mg / kg (difference = 20,845 cells, p > 0.0001), 30 mg / kg (difference = 24,357 cells, p > 0.0001). Reduction of Ki67 high expression after mAbF11 treatment: 3 mg / kg mAbF11 (difference = 56,054 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) (c and d). Expression of the EMT marker vimentin was reduced only with 30 mg / kg mAbF11 treatment: low (difference = 100784, p = 0.002), medium (difference = 100416, p = 0.003), and high (difference = 98960, p = 0.035) (e and f). [Figure 30-3]TGFβR1 expression in mCRPC tumors after treatment with F11 mAb (3 / 10 / 30 mg / kg) or control mAb (30 mg / kg). Medium-score TGFβR1 expression was reduced in mAbF11 at 3 mg / kg (difference = 71,468 cells, p = 0.017), mAbF11 at 10 mg / kg (difference = 76,653 cells, p = 0.017), and mAbF11 at 30 mg / kg (difference = 88,622 cells, p = 0.007) compared to control mAb. High TGFβR1 expression was reduced after 3 mg / kg mAbF11 (difference = 214,031 cells, p = 0.001), 10 mg / kg mAbF11 (difference = 208,635 cells, p > 0.001), and 30 mg / kg mAbF11 (difference = 202,263 cells, p = 0.002) (a and b). Low Ki67 expression was reduced after 3 mg / kg mAbF11 (difference = 56,055 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) compared to the control mAb. Reduction of Ki67 medium expression after mAbF11 treatment: 3 mg / kg (difference = 21,498 cells, p = 0.005), 10 mg / kg (difference = 20,845 cells, p > 0.0001), 30 mg / kg (difference = 24,357 cells, p > 0.0001). Reduction of Ki67 high expression after mAbF11 treatment: 3 mg / kg mAbF11 (difference = 56,054 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) (c and d). Expression of the EMT marker vimentin was reduced only with 30 mg / kg mAbF11 treatment: low (difference = 100784, p = 0.002), medium (difference = 100416, p = 0.003), and high (difference = 98960, p = 0.035) (e and f). [Figure 31]Representative diagram showing mCRPC prostate tumor size after control (vehicle) and 10 mg / kg docetaxel treatment (Figure a). Prostate tumor volume after treatment with 10 mg / kg docetaxel shows a significant reduction in tumor volume compared to control docetaxel (p-value > 0.001, difference = 64 mm3) (Figure b). Measurement of mouse weight after control docetaxel treatment and 10 mg / kg docetaxel treatment. Approximately 2-3 weeks after treatment, approximately 50% of the docetaxel-treated mice had to be sacrificed due to severe side effects and weight loss (Figure c). [Figure 32-1] Protein expression levels after docetaxel treatment. Treatment with 10 mg / kg docetaxel reduced low-score (difference = 15,746 cells, p > 0.0001) and medium-score (difference = 11,795 cells, p = 0.008) TGFβR1 compared to the control mAb (Figures a and b). Ki67 low expression was reduced after 10 mg / kg docetaxel treatment (difference = 13,705 cells, p > 0.05). Finally, vimentin low (difference = 12,642 cells, p = 0.015) and medium (difference = 9,958 cells, p = 0.03) expression was reduced compared to the control mAb (Figures c and d). Finally, vimentin low (difference=12642 cells, p=0.015) and medium (difference=9958 cells, p=0.03) expression was reduced compared to controls (Figures e and f). [Figure 32-2] Protein expression levels after docetaxel treatment. Treatment with 10 mg / kg docetaxel reduced low-score (difference = 15,746 cells, p > 0.0001) and medium-score (difference = 11,795 cells, p = 0.008) TGFβR1 compared to the control mAb (Figures a and b). Ki67 low expression was reduced after 10 mg / kg docetaxel treatment (difference = 13,705 cells, p > 0.05). Finally, vimentin low (difference = 12,642 cells, p = 0.015) and medium (difference = 9,958 cells, p = 0.03) expression was reduced compared to the control mAb (Figures c and d). Finally, vimentin low (difference=12642 cells, p=0.015) and medium (difference=9958 cells, p=0.03) expression was reduced compared to controls (Figures e and f). [Figure 33-1] Experimental Phase Schedule [Figure 33-2] Experimental Phase Schedule [Figure 34-1] (a) Photographs of wound healing assays at T0, T0 + 4 hours, T0 + 24 hours, T0 + 48 hours, and T0 + 72 hours for the conditions of control, galunisertib, 50, 100, and 200 nM control Ab (CTL Ab), and 50, 100, and 200 nM CDD Ab (without TGFβ1 stimulation). (b) Photographs of wound healing assays at T0, T0 + 4 hours, T0 + 24 hours, T0 + 48 hours, and T0 + 72 hours for the conditions of TGFβ1, galunisertib, 50, 100, and 200 nM CTL Ab, and 50, 100, and 200 nM CDD Ab (with TGFβ1 stimulation). [Figure 34-2] (a) Photographs of wound healing assays at T0, T0 + 4 hours, T0 + 24 hours, T0 + 48 hours, and T0 + 72 hours for the conditions of control, galunisertib, 50, 100, and 200 nM control Ab (CTL Ab), and 50, 100, and 200 nM CDD Ab (without TGFβ1 stimulation). (b) Photographs of wound healing assays at T0, T0 + 4 hours, T0 + 24 hours, T0 + 48 hours, and T0 + 72 hours for the conditions of TGFβ1, galunisertib, 50, 100, and 200 nM CTL Ab, and 50, 100, and 200 nM CDD Ab (with TGFβ1 stimulation). [Figure 35] Mean normalized percentage of area compared to T0 area [Figure 36] HCT116 cells (ATCC) were cultured on sterile coverslips in McCoy's 5A medium. Cells were starved for 16 hours in medium containing 1% FBS and then stimulated with TGFβ (10 ng / ml) at the indicated time points: 0, 3, 6, and 24 hours. [Figure 37] Immunohistochemical analysis of TbRI expression in tissue sections from OSCC. TbRI expression was analyzed by IHC using Capra C 1183 antibody. The indicated area (within the black box) is shown at higher magnification in the bottom panel. The scale bar is 50 micrometers. [Figure 38]Histological and immunohistochemical analysis of TbRI expression in OSCC. TbRI expression was analyzed by IHC, and expression was determined as weak, moderate, or strong using the software program Image J. Expression significantly increased with increasing OSCC stage. One-way ANOVA p**>0.001. Scale bar = 50 micrometers. [Figure 39] Treatment of OSCC patient-derived organoids with TGFβ1 and two different inhibitors. A. Patient-derived organoids (PDOs) containing tumor epithelial cells or adjacent normal epithelial cells were isolated from clinical samples according to the protocol Wang B. et al. An organoid library of salivary gland tumors reveals subtype-specific characteristics and biomarkers. J Exp Clin Cancer Res, 2022(41):350. Cells were seeded on Matrigel to form organoids. Organoids were then treated for 48 hours with the following conditions: Ctr Ab (100 nM), Ctr Ab (100 nM) + TGFβ1 (10 ng / ml), F11 Ab (100 nM) + TGFβ1 (10 ng / ml), or LY2109761 (10 ng / ml) + TGFβ1 (10 ng / ml). Black arrowheads indicate isotype-specific control antibodies (control Abs). Figure 1 shows tumor cell budding into Matrigel in response to TGFβ1 stimulation in the presence of 100 nM TGFβ1. B. Budding tumors or budding satellite clones from primary PDOs were counted as the budding rate. Treatment with 100 nM of the therapeutic antibody F11 and 10 ng / ml of galunisertib (LY2109761) inhibited both TGFβ1-induced budding (pseudopodia) of OSCCs as shown in b. Raw data were analyzed with Graphpad Prism9 software, and statistical analysis was performed by one-way ANOVA. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001. Data are shown as mean ± SD. [Example]

[0209] Example 1 - Generation of a construct expressing the extracellular domain (ECD) of TGFbRI 1.1 Cloning of the plasmid for expression of the TGFbRI-ECD-133-myc-(His)6 antigen Ten micrograms of the periplasmic expression vector pOPE101-215(Yol) (Genbank Y14585.1) was digested with the restriction enzymes NcoI (ThermoFisherScientific) and BamHI (ThermoFisherScientific) in the presence of 1x FastDigest buffer overnight at 37°C. The vector backbone was separated from the 215 insert by separation in a 1% agarose gel and isolated using a "Gel extraction and PCR clean up kit" from Machery-Nagel (Düren, Germany). For the generation of a PCR fragment encoding the extracellular domain (ECD) of human TGFbRI (Uniprot: P36897), 5 μl of 10× buffer, 100 ng of the plasmid pcDNA3-TGFbRI-HA (encoding the entire TGFbRI gene (SEQ ID NO: 1)), μl of 2 mM dNTP mix, 1 μl of polymerase, 1.5 μl of the sense primer S-huTbRI-NcoI-QVQ9-pOPE(gaataggccatggcgcaggtgcaggcgttacagtgtttctgccac) (SEQ ID NO: 231) and 1.5 μl of amplicons, respectively, were added. The reaction mixture consisted of the antisense primers AS-huTbRI-133BamHI-pOPE (ccgatagggatcctggtccagcaatgacagctgc (SEQ ID NO: 232) (the last amino acid residue of the ECD ends at position 133 (P)) and AS-huTbRI-125BamHI-pOPE (ccgatagggatccttccacaggaccaaggccagg (SEQ ID NO: 233) (the last amino acid of the ECD ends at position 125 (E))). For cloning of the mouse ECD, the sense primer S-mouseTbRI-NcoI-1-pOPE gaatagg gcc atg gcg acg ctg ctc ccg ggg gcg (SEQ ID NO: 234) was combined with the human antisense primer AS-huTbRI-133BamHI-pOPE in the presence of a synthetic plasmid covering the mouse ECD (R&D Systems, #RDC0709).The PCR reaction consisted of denaturation at 96°C for 5 minutes, followed by 32 cycles of denaturation at 96°C for 15 seconds, annealing at 62°C for 20 seconds, and extension at 72°C for 30 seconds, followed by a final extension at 72°C for 5 minutes. The PCR product was purified on a 1% agarose gel as described for vector preparation. 2 μg of the gel-purified PCR fragment was digested with NcoI and BamHI at 37°C for 2 hours. The digested PCR fragment was subjected to column purification according to the kit instructions. 25 ng of the purified PCR fragment was ligated with 200 ng of the appropriately prepared pOPE101 plasmid in ligation buffer and 1 μl of ligase (T4 DNA ligase, ThermoFisher Scientific) overnight at 4°C. 7 μl of the ligation mixture was transformed into heat shock competent XL10 Gold bacteria (Stratagene, USA), plated onto selective LB-GAT plates (0.1 M glucose, 100 μg / ml ampicillin, 12 μg / ml tetracycline) and incubated overnight at 37°C. Single colonies were picked and overnight cultures were started in selective LB-GAT medium. The pOPE101 vector was isolated using a plasmid isolation kit, and the insert was sequenced using the sequencing primer (attaaagaggagaaattaacc) (SEQ ID NO: 235).

[0210] 1.2 Expression and purification of TGFβRI-myc-(His)6-tagged proteins Plasmid pOPE101 encoding the myc- and (His)6-tagged TGFβRI genes was transformed into E. coli XL10 Gold (Stratagene, USA), and transformants were selected on LB agar plates containing 100 μg / ml carbenicillin, 12.5 μg / ml tetracycline, and 0.1 M glucose as a repressor. For expression, overnight cultures in selective LB medium (100 μg / ml carbenicillin, 12.5 μg / ml tetracycline, and 0.1 M glucose) were diluted into freshly prepared similar selective medium and grown at 37°C until an optical density (at 600 nm) of 0.6 was reached. Protein expression was then induced by the addition of IPTG to a final concentration of 75 μM. After 12 h of induction at 24°C (230 rpm), proteins were harvested from the periplasmic space. The pelleted bacteria were resuspended in 1 / 16 culture volume of cold spheroblast solution (50 mM Tris-HCl pH = 8.0, 20% sucrose, 1 mM EDTA) and gently shaken at 4°C for 1 h. The suspension was centrifuged at 30,000 g for 1 h at 4°C, and the supernatant, representing the periplasmic extract, was dialyzed twice against 5 L of PBS overnight at 4°C. The solution was passed through a 0.45 μm filter and adjusted to 0.5 M NaCl and 20 mM imidazole for loading onto a Ni-NTA FPLC-column (GE-Healthcare, USA). The (His)6-tagged protein was eluted with elution buffer (PBS adjusted to 0.5 M NaCl and 0.5 M imidazole), and the protein-containing fraction was dialyzed twice against 2 L of PBS overnight at 4°C. Aliquots were adjusted to 1 mg / ml with PBS and stored at −80° C. Protein purity and integrity were confirmed by Coomassie gel staining and immunoblotting using the c-Myc tag-specific mAb 9E10.

[0211] 1.3 Cloning and expression of biotinylated ECD33-133-Avi-(His)6 Plasmid pOPE101 TGFbR1 ECD-QVQ33~133 clone F1 was propagated in XL10-Gold E. coli. Plasmid DNA was isolated using Thermo Scientific GeneJET Plasmid Miniprep Kit #K0503. The 81-nt oligonucleotides Avi-cassette-cs (GATCCGGAGGTAGTGGTCTGAACGACATCTTCGAGGCTCAGAAAATCGAATGGCACGAACATCATCACCACCATCACTAAT) (SEQ ID NO: 236) and Avi-cassette-ncs (CTAGATTAGTGATGGTGGTGATGATGTTCGTGCCATTCGATTTTCTGAGCCTCGAAGATGTCGTTCAGACCACTACCTCCG) (SEQ ID NO: 237) were synthesized by Sigma-Aldrich. The bacterial strain used was XL10-Gold Ultracompetent cells. Stratagene 200314d-biotin was from Supelco 4-7868 100mg (Sigma-Aldrich). Biotin quantification was performed using the Pierce Biotin Quantitation Kit, Thermo Scientific 28005. A plasmid construct for expression of the ECD (amino acids 33-133 in TGFbR1) fused to an Avi-His tag in E. coli was constructed by inserting a codon-optimized construct with a C-terminal Avi-6xHis tag into vector pOPE101. The two oligos were annealed and ligated into the BamHI+Nhe1-digested vector. The mixture was used to transform XL10 Gold bacteria, colonies were screened, and correct clones were isolated.

[0212] 1.4 Expression of a protein of the expected size was confirmed by Western blot. Biotinylated ECD of TGFbR1 was obtained by co-expression of biotin ligase BirA and purification using Ni-NTA affinity chromatography. The degree of biotinylation was determined using a biotin quantification kit.

[0213] 1.5 Peptides Peptide 4095-272 consisting of biotin-SGSGPGLGPVELAAVIAGP-NH2 (SEQ ID NO: 238) containing aa's 119-133 of TGFβRI was synthesized by Bachem AG, Switzerland.

[0214] Example 2 - Phage display selection on ECD33-133-Avi-(His)6 using a phage library. Phage display was performed, allowing the isolation of scFv fragments with specificity for the extracellular domain of human TGFβR1.

[0215] 2.1 Phage display selection Biopanning was performed using four rounds of enrichment selection using two human synthetic scFv phage libraries, SciLifeLib1 and SciLifeLib2 (SciLifeLab, Stockholm, Sweden). SciLifeLab1 and SciLifeLab2 are naive human synthetic scFv libraries similar in design and construction to previously reported libraries (Sall, et al., Protein Eng Des Sel (2016) 29:427-437). Briefly, human germline genes IGHV3-23 and IGKV1-39 were used as library scaffolds, and Kunkel mutagenesis was used to introduce diversity into four of the six complementarity-determining regions (CDRs): CDR-H1, CDR-H2, CDR-H3, and CDR-L3. Selection was performed using biotinylated ECD33-133-Avi-(His)6 (aa 33-133, see Example 1 for details) and streptavidin-coated magnetic beads (Dynabeads M-280, ThermoFisher Scientific, #11206D). Selection pressure was increased by gradually decreasing the antigen amount (33-177 nM) and increasing the number of washes between different rounds. To remove nonspecific or streptavidin-binders, preselection was performed by incubating phage stocks against empty streptavidin-coated magnetic beads before rounds 1 and 2. 1% bovine serum albumin (BSA) was also included as a blocking agent throughout the selection procedure. Elution of antigen-bound phages was performed using a trypsin-aprotinin approach. Recovered phage were grown in XL1 Blue E. coli either overnight on agar plates at 37°C (rounds 1 and 2) or in solution at 30°C overnight (rounds 3 and 4). Phage stocks were generated by infection with an excess of M13K07 helper phage (New England Biolabs, #N0315S), and scFv display was induced by the addition of IPTG. Overnight cultures were PEG / NaCl precipitated, resuspended in selection buffer, and used for the next selection round.

[0216] 2.2 Recloning and expression of scFv Phagemid DNA was isolated from the third and fourth rounds of each selection track to enable the production of soluble scFvs. In the pools, the genes encoding the scFv fragments were restriction enzyme digested and subcloned into the screening vector pHAT-6, along with a C-terminal triple FLAG tag and a hexahistidine (His6) tag to provide signals for scFv secretion. The constructs were then transformed into TOP10 E. coli. Single colonies were picked, cultured, and IPTG-induced for soluble scFv expression in a 96-well format. A total of 278 scFv clones present in the bacterial supernatant were prepared for primary ELISA screening.

[0217] 2.3 ELISA screening Human ECD33-133-Avi-(His)6 (see Example 1) and the negative control protein streptavidin were coated in a 384-well ELISA plate at 1 μg / ml in PBS overnight at 4°C. The plate was washed twice and blocked for 2 hours in blocking buffer (phosphate-buffered saline (PBS) supplemented with 0.5% bovine serum albumin (BSA) + 0.05% Tween 20). Triple-FLAG-tagged scFv present in bacterial supernatants were diluted 1:5 in blocking buffer and allowed to bind. Binding detection was enabled via incubation with an HRP-conjugated anti-FLAG M2 antibody (Sigma-Aldrich #A8592) followed by 1-step Ultra TMB ELISA substrate (ThermoFisher Scientific #34029). Colorimetric signal development was stopped by adding 1 M sulfuric acid and plates were read at 450 nm. All samples were assayed in duplicate.

[0218] 2.4 DNA sequencing Seventy-five positive scFv clones showing binding to TGFbR1-ECD were sent to GATC Biotech (Ebersberg, Germany) for Sanger DNA sequencing.

[0219] 2.5 Results Two selection tracks were performed in parallel on human TGFβR1-ECD-AviHis using phage scFv libraries SciLifeLib1 and 2. After recloning of selected scFv clones, a total of 278 clones (colonies) were picked from selection rounds 3 and 4. Primary ELISA screening yielded 75 potential hits. These DNA sequences led to the identification of 17 sequence-unique clones: B-ML012-4, B-ML012-5, B-ML012-6, B-ML012-7, B-ML012-8, B-ML012-9, B-ML012-10, B-ML012-11, B-ML012-12, B-ML012-13, B-ML012-14, B-ML012-15, B-ML012-17, B-ML012-18, B-ML012-19, and B-ML012-20.

[0220] Example 3 - Affinity characterization of selected scFvs This example describes an experiment that progressed to the selection of 8 of the 17 clones. Seventeen unique scFv clones from Example 2 were selected for further characterization by ELISA and biolayer interferometry (BLI) in a kinetic screening-based approach to allow ranking of the various clones.

[0221] 3.1 Expression and purification of scFv Expression of 17 scFvs was carried out in TOP10 E. coli cells. 50 ml cultures were initiated, and protein expression was induced in logarithmic growth phase by the addition of isopropyl thiogalactoside (IPTG) overnight at 30°C. Cell lysis was performed via B-PER Bacterial Protein Extraction Reagent (Thermo-Fisher), and purification was carried out using immobilized metal affinity chromatography (IMAC) (Nickel Sepharose 6 Fast Flow, GE Healthcare). SDS-PAGE was performed to determine the purity and integrity of the purified scFvs, and concentrations were determined by a BCA (bicinchoninic acid) assay kit (Pierce).

[0222] 3.2 ELISA Streptavidin and various human TGFbR1 constructs (125, 131, 133, Example 1) diluted to 1 μg / ml in PBS were added to the wells of an ELISA plate and incubated overnight at 4°C. The plate was washed twice and blocked for 2 hours in blocking buffer (phosphate-buffered saline (PBS) supplemented with 0.5% bovine serum albumin (BSA) and 0.05% Tween 20). The biotinylated 4095-272 peptide (Example 1), containing the sequence corresponding to amino acids 119-133 of the ECD, was added to the streptavidin surface and incubated for an additional 1-2 hours. Purified scFv diluted to 1 μg / ml was allowed to bind for 1-2 hours. Binding was detected via incubation with HRP-conjugated anti-FLAG M2 antibody (Sigma-Aldrich #A8592) followed by 1-step Ultra TMB ELISA substrate (ThermoFisher Scientific #34029). Colorimetric signal development was stopped by adding 1 M sulfuric acid, and plates were read at 450 nm. All samples were assayed in duplicate.

[0223] 3.3 Biolayer Interferometry (BLI) Kd estimation of selected scFvs against recombinant human TGFbRI-ECD133-myc(His)6. Kd was monitored in real time by interferometric biolayer detection using the BLItz system from Fortebio, USA. All dilutions were performed in PBS containing TGFbRI antigen, scFv dilutions, and also baseline and wash buffers. Target antigen loading was performed in 4 μl at a concentration of 1 mg / ml. Each scFv was loaded in 4 μl and measured only at a concentration of 5 μM. As a control, measurements were performed using scFv #16, which did not show any binding to immobilized TGFbRI-ECD133-myc(His)6 in ELISA. Antigen immobilization was performed using a biosensor Ni-NTA chip (cat#18-5101). Subtraction of the control run was not performed. Initial baseline: 30 seconds, 4 μl Antigen load: 120 seconds, 4 μl Baseline: 80 seconds, 250 μl Meeting: 120 seconds, 4μl Dissociation: 120 seconds, 250 μl

[0224] 3.4 Results

[0225] [Table 3]

[0226] Periplasmic scFvs from individual clones (shown here as clones 11–20, Figure 1 ) were screened for binding to recombinant TGFbR1-ECD-133-myc(His)6 (dark bars) and TGFbR1-ECD-125-myc(His)6 (gray bars), as well as TGFbR1-derived peptides spanning amino acids 106–120 (checked bars) and 106–125 (dashed bars). Wells were coated with coating buffer alone (empty bars) as a negative control. scFv clone 19 showed binding to recombinant TGFbR1 protein ending at amino acid 133 but lacked binding to the shorter version ending at amino acid 125. None of the control peptides bound.

[0227] Example 4 - IgG conversion of eight scFvs to IgG and validation of binding In this experiment, eight of the most promising scFv clones from phage selection (Example 2) and subsequent binding analysis (Example 3) were converted to the mouse IgG1 (mIgG1) subclass: B-ML012-4, B-ML012-5, B-ML012-14, B-ML012-15, B-ML012-16, B-ML012-17, B-ML012-19, and B-ML012-20. Upon conversion, they were given new names to better reflect their new formats: mouse mAb#4, mAb#5, mAb#14, mAb#15, mAb#16, mAb#17, mAb#19, and mAb#20, respectively. A control antibody was cloned into the same mouse IgG1 framework and directed against fluorescein.

[0228] 4.1 Cloning After amplification by polymerase chain reaction (PCR) using the primers listed in Table 4, the gene construct containing the VH region of the scFv of interest was incorporated into the pFUSE-CHIg-mG1 (Invivogen) plasmid containing the constant region of mouse IgG1 using standard cloning by restriction digestion (AflII and AfeI) and ligation.

[0229] [Table 4]

[0230] Based on strong ECD binders based on binding to the c-terminal portion of the ECD and / or binding to P3CU cells in immunostaining and / or affinity seen in BLITZ data, the following eight scFvs were selected for initial testing in cellular assays after being converted into chimeric mouse IgG1 (mIgG1) antibodies: #4, 5, 14, 15, 16, 17, 19, and 20.

[0231] Similarly, the gene construct containing the VL region of the scFv of interest was inserted into the pFUSE-CLIg-mkappa plasmid (Invivogen), which contains the constant region of the mouse kappa chain, using the enzymes AgeI / XhoI, followed by ligation. All constructs were verified by sequencing performed at GATC Biotech (Ebersberg, Germany). The converted scFv clones and the corresponding mouse IgG1 are listed in Table 5A.

[0232] [Table 5]

[0233] 4.2 Expression and purification Plasmid DNA transfection into expiHEK293 cells was performed in 300 ml cultures using the ExpiFectamine™ 293 Transfection Kit (ThermoFisher Scientific #A14525). After 8 days of culture at 37°C, 6% CO2, 80% rH2O, and 400 rpm, the culture supernatant was mixed with 1 ml of Protein G Sepharose Fast Flow (GE Healthcare, #17-0618-02) at 120 rpm for 1 hour at room temperature, collected on a gravity-flow column, and washed with 10 ml of buffer (20 mM NaH2PO4, 50 mM NaCl, pH 7.4). Immediately after elution in 0.1 M glycine, pH 2.7, neutralization was performed by adding 1 M Tris-HCl, pH 8.8, and the buffer was exchanged into PBS using a spin filter. SDS-PAGE was performed to determine the purity and integrity of the purified IgG, and the protein concentration was determined by BCA assay kit (Pierce).

[0234] 4.3 ELISA Streptavidin diluted to 2 μg / ml in PBS was added to wells of a 384-well ELISA plate and incubated overnight at 4°C, followed by washing and an additional 1-2 hour incubation at room temperature in blocking buffer (PBS supplemented with 3% BSA). ECD33-133-Avi-(His)6 (see Example 1) diluted in assay buffer (PBS supplemented with 0.3% BSA and 0.05% Tween 20) was added to half of the wells at 0.1 μg / ml. To the other half, assay buffer alone was added. After a further 1 hour of incubation, 12 concentrations of purified mIgG1 antibodies were added (1:2 dilutions, starting at 1 μg / ml). After cycles of incubation and washing, binding was detected via incubation with HRP-conjugated goat anti-mouse kappa antibody (Southern Biotech, #1050-05) followed by 1-step Ultra TMB ELISA substrate (ThermoFisher Scientific, #34029). Colorimetric signal development was stopped by adding 1 M sulfuric acid, and plates were read at 450 nm. All samples were assayed in duplicate. Two clones in the set previously shown to bind to the 4095-272 peptide, namely B-ML012-4 and B-ML012-19 (see Example 3), were again evaluated for binding to this peptide. The same protocol as above was used, except that ECD33-133-Avi-(His)6 was replaced with 0.1 μg / ml of biotinylated 4095-272 peptide (Example 1).

[0235] 4.4 Results All clones were successfully produced (0.1-1.8 mg) except for B-ML012-15, which did not yield any measurable amounts after purification. Therefore, this clone was excluded from further study. Candidate #15 did not express sufficiently in mammalian cells and was replaced by candidate #17. Binding to the extracellular domain of TGFbR1 was confirmed for all produced IgGs in Table 5.

[0236] From the ELISA results, it can be seen that only candidates #4 and #19 showed binding to both ECD33-133 and peptide #4095-272. All candidates except #3 and #16 showed binding to ECD33-133.

[0237] [Table 6]

[0238] In summary, the ELISA binding patterns as summarized in Table 3 for TGFbR1-ECD-33-133-avi and scFv against peptide #4095-272 (Example 3) were confirmed for the corresponding IgG molecules.

[0239] Example 5 - Selection of final candidate, B-ML012-19 (ab#19) To further distinguish between the candidates, functional assays described in Examples 5.1-5.3 were performed.

[0240] 5.1 Translocation of the intracellular domain (ICD) of TGFβ to the cell nucleus material The following cell lines were used: (1) wild-type PC3U cell line (an androgen-independent human prostate cancer cell line), (2) A9, an isogenic PC3U cell line in which TGFβR1 expression (in exon 2) had been silenced by using CRISPR-Cas9 technology, and (3) the A9 cell line in which expression of full-length TGFβR1 was reconstituted by transformation with an expression plasmid encoding C-terminally HA-tagged human TGFβR1.

[0241] The A9 TGFβRI (CRISPR-Cas9 gene editing) cell line was used to silence TGFβRI / ALK5 in human prostate cancer (PC3U) cells, followed by reconstitution of the TGFβRI-HA tag (the C-terminal portion of the protein). The A9 cell line was generated by Anders Wallenius. The primary antibodies used were anti-HA rabbit Ab (Cell Signaling Cat. 3724) and anti-p300 goat Ab (R&D Cat. AF3789). The PLA kits used were Duo92002, Duo92006, and Duo92007 (Sigma). TGF-β1 (Cat. No. 100-21, Peprotech Ltd.) was applied at a concentration of 10 ng / ml. RPMI1640 medium and FBS were from Sigma, and ultrapure water was from a Sartorius AriumPro UV system.

[0242] Treatment Ab: Mouse chimeric #19 Ab: mAb #19, cAb1114-1.1 mouse antibody, and control antibody, anti-fluorescein Ab00102-1.1 mIgG1.

[0243] method Step 1 Cell culture On day 1, A9 (ALK5-HA) reconstituted cells were seeded into 8-well chamber slides on sterile glass slides (5 × 10 per well). 4 cell).

[0244] On day 2, cells were starved for 16 hours in medium supplemented with 1% FBS.

[0245] On day 3, cells were pretreated with mouse chimeric #19 Ab, human #19 Ab, and human isotype-specific control Ab for 1 hour, and then stimulated with 10 ng / ml TGF-β1 for 6 hours.

[0246] Step 2. Fix and Permeabilize Slides 1. Slides were washed four times with PBS and then fixed in 4% paraformaldehyde (pre-warmed to 37°C) for 30 minutes at room temperature. 2. After washing four times with PBS, the slides were permeabilized in 0.1% TritonX-100 in PBS for 10 minutes.

[0247] Step 3 PLA staining was performed according to the PLA kit instructions as previously reported [4].

[0248] Step 4. Acquire images for PLA staining Digital images were taken using a fluorescence microscope (Axioplan2, Carl Zeiss) equipped with a digital camera (C4742-95, Hamamatsu) with a ×40 objective (Carl Zeiss Micro-Imaging). Digital photograph settings and PLA analysis were automatically saved as part of the raw data.

[0249] Step 5. Analyze PLA signaling Analysis of PLA signaling for nuclear TβRI-ICD complexed with p300 was performed by using the Duolink Image Tool, which was specifically developed for quantification of PLA signaling.

[0250] Positive control used in the experiment: TGF-β1 treatment in the absence of antibody, number #19, indicated as 0 nM.

[0251] Negative control used in this experiment: staining without antibody (A9 cells only) in the presence or absence of TGF-beta. All samples were examined in triplicate.

[0252] statistics GraphPad Prism7 was used to calculate half-maximal inhibitory concentration values ​​(IC 50 ) was used for the analysis.

[0253] The concentration-dependent inhibition of TβRI translocation to the nucleus is shown in Figure 2. The relative nuclear TβRI-ICD (visualized by in situ PLA) in PC3U cells treated with TGFβ1 and various concentrations of mouse chimeric mAb #19 is shown.

[0254] 5.2 Infiltration, measuring cell mobility PC3U invasion assay protocol Day 1: PC3U cells were plated in 10 cm plates at 8 × 10 5 cells.

[0255] Day 2: To starve the cells, the 10% FBS medium was removed and replaced with 1% FBS medium.

[0256] Day 3: 1. 0.5 ml of warm medium (serum-free) was added to the inner well of the insert in a Rehydration Matrigel Invasion Chamber (Corning, Cat. 354483) and rehydrated for 2 hours at 37°C in the presence of 5% CO2. 2. Prepare a cell suspension by trypsinization and disperse 1 x 10 cells in 1% FBS medium. 5 The cells were resuspended at a concentration of 1000 cells / ml. 3. Antibodies (Abs) were diluted in the media of the upper and lower chambers. Lower chamber: Antibodies were diluted directly in 5% FBS medium at 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, and 25 nM (0.75 ml in each well). Upper chamber: Abs were diluted in 1% FBS medium at 800 nM, 400 nM, 200 nM, 150 nM, 100 nM, and 50 nM (0.25 ml in each well). NOTE: Antibodies were first added to the upper chamber at 2x the concentration, followed by the same volume of cell suspension (0.25 ml). The final antibody concentrations were 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, and 25 nM. 4. The invasion chamber was incubated at 37°C with 5% CO2 for 1 hour. 6. Cells were stimulated with TGFβ1 10 ng / ml (Peprotech).

[0257] Day 4 After 1.30 hours of TGFβ1 stimulation, non-invading cells in the upper wells were removed by scrubbing. 2. The inserts were immediately stained with 400 μl of cell staining solution for imaging and quantification.

[0258] Day 5 The stained cells were lysed with 200 μl of extraction solution, and the OD value at 560 nm was measured.

[0259] Concentration-dependent inhibition of TGFβ1-induced invasion of PC-3U cells treated with 10 ng / ml TGFβ (purchased from Peprotech Ltd.) for 30 hours and various concentrations of mouse mAb #19 is shown in Figure 3. Quantification of cell-free areas of the bottom filter using ImageJ script on bright-field images of the transwell filters. Mean values ​​± SEM are calculated from three independent experiments. PC3U cells treated with TGFβ1 alone, with isotype-specific IgG1 (IgG), or untreated (CNTR) are shown as controls.

[0260] 5.3 Overview Based on the results of the above assays and previous ELISA results, a convergent view of the data led to two antibody (AB) candidates #4 and #19 being selected for further progression: Galunisertib (LY2157299 at 10 μM).

[0261] Data are calculated based on the response ratio of control antibody / candidate antibody.

[0262] [Table 7]

[0263] 5.4 Biophysical Characterization of Antibody Candidates #4 and #19 Further characterization of the biophysical properties of the two remaining candidates was performed on candidates #4 and #19.

[0264] Materials and Methods: Size exclusion chromatography (SEC) was performed using two different systems: 1. Superdex Increase 200 3.2 / 300 (Cytiva) connected to an Agilent 1100 HPLC system equipped with a DAD detector. The running buffer was 20 mM HEPES and 150 mM NaCl at pH 7.5. 2. BioSEC3 column, 300 Å, 7.8 × 300 mm (Agilent) connected to an Agilent 1100 HPLC system equipped with a DAD detector. The running buffer was 150 mM NaCl. x H y PO4, pH 6.8.

[0265] Samples: Antibodies were diluted to approximately 0.5 mg / ml in running buffer and 50 μL was applied to the column. Samples were analyzed on both systems.

[0266] Isoelectric focusing gel electrophoresis (IEF): IEF was performed using Novex™ pH 3-10 IEF Protein Gel (ThermoFisher) according to the supplier's recommendations.

[0267] The samples were 1 and 4 μL of undiluted antibody with a concentration of 2.5 mg / ml. Tm measurement by Differential Scanning Fluorimetry (DSF): A Prometheus NT.48 (Nanotemper) was used to determine the protein melting curve. Signals at wavelengths of 350 nm and 330 nm were recorded, and the 350 / 330 offset was plotted against temperature. The scan rate was 1 degree / min, and the protein concentration was 0.5 mg / ml.

[0268] Chemical denaturation was performed using guanidinium hydrochloride (Sigma (G405 Lot #SLBC7059V) and PBS was from Sigma (D8537-500ml Lot RFNB7745).

[0269] The 350 and 330 signals were measured on a Prometheus instrument by running a gradient from 20 to 21 degrees in steps of 0.2 degrees / min. The average signal was calculated and plotted against the concentration of GmdCl.

[0270] Samples were incubated with different concentrations of guanidinium hydrochloride, incubated for 1 hour, and the A350 / 330 ratio was determined and plotted against the concentration of guanidinium hydrochloride in the sample to generate a chemical denaturation graph.

[0271] result Two candidate mAb#4 and mAb#19 were characterized by the biophysical methods described above with the aim of identifying distinguishing properties that would allow for a decision on selecting a preferred candidate. The key difference observed between mAb#4 and mAb#19 was their behavior in size-exclusion chromatography; mAb#4 was significantly delayed on both columns used, while mAb#19 eluted at the expected retention time. Neither thermal nor chemical denaturation studies revealed any differences between the two candidates that would affect candidate selection. These results suggest that mAb#4 is prone to aggregation, and therefore mAb#19 was selected as the final candidate.

[0272] Example 6 - Detailed characterization of mAb #19 6.1 Affinity Measurements Biacore (SPR) and Blitz 6.1.1 Biacore (Surface Plasmon Resonance, SPR) Measurement

[0273] Materials and Methods Biotinylation of chimeric mAb #19 Biotinylation of chimeric mAb #19 was performed using EZ-Link Sulfo-NHS-LC-LC-Biotin Reagent (Cat#21338, Thermo Fisher Scientific). 10 μl of 10 mM biotinylation reagent (dissolved in HO) was added to 200 μl (1 mg) of mouse chimeric mAb #19 at a concentration of 5 mg / ml and incubated on ice for 2 hours (corresponding to a 13-fold excess). The reaction was stopped by adding 20 μl of 1 M glycine. To remove unreacted biotin, the biotinylated protein was dialyzed multiple times against PBS (overnight at 4°C). The concentration of the biotinylated Ab was determined spectrophotometrically.

[0274] Affinity measurements were performed using a BiaCore T200 (Cytiva).

[0275] Covalent immobilization of mAB#19 on a CM5 chip Immobilization of mAB#19 was performed on a CM5 chip using manual manipulation. The antibody was diluted to 25 μg / ml in 10 mM NaAc buffer, pH 5.0. The surface was activated by injecting a mixture of EDC / NHS at a flow rate of 10 μl / min for 7 minutes. The antibody was injected over the activated surface at a flow rate of 2 μl / min for 30-45 seconds. The surface was deactivated by injecting 1 M ethanolamine at a flow rate of 10 μl / min for 7 minutes. Typical immobilization levels were approximately 800 RU.

[0276] Immobilization of biotinylated mAB#19 on a streptavidin chip (SA) Immobilization of biotinylated antibodies was performed on SA chips using manual manipulation. Antibodies were diluted 1:200 in 1x HBS-P, pH 7.4. Prior to immobilization, the chip surface was preconditioned with 1 M NaCl, 50 mM NaOH at a flow rate of 10 μl / min for 1 min three times, and the antibodies were injected at a flow rate of 2 μl / min for approximately 40 s, resulting in an immobilization level of approximately 800 RU.

[0277] Antigen preparation ECD133-myc-His (6) was diluted to a starting concentration of 100 nM in 1x HBS-P running buffer, followed by a 1:1 serial dilution in the same buffer to obtain five concentrations ranging from 100 nM to 6.25 nM. Single-cycle kinetic experiments were used. Run parameters were: contact time - 60 s, dissociation time - 600 s, start cycle - 5, flow rate - 30 μl / min, blank injections - 2, and temperature - 25 °C. After completion of the cycle with ECD133-myc-His antigen, the surface was regenerated by a 30-s injection of 146 mM H3PO4 at a flow rate of 30 μL.

[0278] result The binding of ECD133-myc-His to immobilized biotinylated and covalently immobilized non-biotinylated antibodies was examined. A 1:1 binding model analysis was performed to obtain the dissociation constant (Kd) of the interaction. ECD133-myc-His bound to covalently immobilized mAb#19 with affinities of 5.6 and 6.5 nM, as determined by two independent experiments. ECD133-myc-His interacted with immobilized biotinylated mAb#19 similarly to that observed for covalently immobilized non-biotinylated antibodies, with Kds determined to be 2.5, 1.8, and 2.3 nM in three independent experiments.

[0279] 6.2 Kd determination by interferometry (Blitz measurement) Kd determination of antibody mAb#19 against recombinant human / mouse TGFbRI-ECD133-myc(His)6 and TGFβRI-133-huFc.

[0280] Kd was monitored in real time by interferometric biolayer detection using the BLItz system (Fortebio, USA). All dilutions were performed in PBS containing 10 μg / ml biocytin, including TGFβRI antigen, antibody dilutions, and baseline and wash buffers. Target antigen loading was performed in 4 μl at a concentration of 0.5 mg / ml. Antibodies were loaded in 4 μl at the indicated concentrations. As a control, measurements were performed at the second highest concentration in the absence of antigen. Antigen immobilization was performed using a Biosensor Ni-NTA chip (cat#18-5101) for human and mouse TGFβRI-ECD133-myc(His)6 and a Biosensor AHC chip (cat#18-5060) for TGFβRI-133-human Fc protein. Initial baseline: 30 seconds Antigen loading: 120 seconds Baseline: 80 seconds Meeting: 120 seconds Dissociation: 120 seconds

[0281] Mouse chimeric IgG1-#19 against human TGFβRI-ECD133-myc(His)6: Kd was measured at four mAb#19 concentrations (200 nM, 100 nM, 50 nM, and 20 nM) and the background determined at an antibody concentration of 100 nM in the absence of target antigen was subtracted (see Figure 4). Kon (1 / M seconds) = 1.7 x 10^5 (Ka error = 1.4 x 10^3), Koff (1 / second) = 6.4 x 10^-4 (Koff error = 1.9 x 10^-5) Kd=3.7×10^-9M

[0282] [Table 8]

[0283] [Table 9]

[0284] 6.3-Concentration-dependent inhibition of TβRI-ICD translocation (IC 50 ) Materials and Methods: A9 cells: TGFβRI / ALK5 was silenced in human PC3U cells using CRISPR-Cas gene editing. A9-ALK5-HA cells: The HA-tagged C-terminal portion of TGFβRI was reconstituted in A9 cells. Both cell lines were developed by Anders Wallenius in the Landstrom laboratory (Wallenius A., Mu Y., Rudolfsson S., Schmidt A., Zang G., and Landstrom M. Manuscript in preparation). Both cell lines were grown in RPMI 1640 medium with 10% FBS (Sigma). The following primary antibodies were used: anti-HA rabbit Ab (Cell Signaling Cat. 3724) and anti-p300 goat Ab (R&D Cat. AF3789). PLA kits (Duo92002, Duo92006, and Duo92007) were purchased from Sigma.

[0285] Treatment Ab: Mouse mAb #19 Ab (B-ML_012-19, cAb1114-1.1, mouse IgG1), and mouse mAb control; isotype-specific IgG1 (Cat. #MAB001, Clone 11711, Lot #IX241811A, R&D Systems) or #fluorescein Ab (control Ab) from Absolute Antibodies. TGF-β1 was purchased from Peprotech Ltd. (Cat. 100-21) and used at 10 ng / ml.

[0286] Step 1 Cell culture On day 1, A9-ALK5-HA reconstituted cells were seeded into 8-well chamber slides (5 × 10 per well). 4 cell). On day 2, cells were starved for 16 hours in medium supplemented with 1% FBS. On the third day, the cells were pretreated with #control fluorescein or mouse mAb #19Ab for 1 hour, and then the cells were stimulated with TGF-β1 10 ng / ml for 6 hours.

[0287] Step 2. Fix and Permeabilize Slides 1. Slides were washed four times with PBS and then fixed in 4% paraformaldehyde (pre-warmed to 37°C) for 30 minutes at room temperature. 2. After washing four times with PBS, the slides were permeabilized in 0.1% TritonX-100 in PBS for 10 minutes.

[0288] Step 3: PLA staining, followed by the PLA kit instructions [4].

[0289] Step 4. Collect images for PLA staining Digital images were taken by using a fluorescence microscope (Axioplan2, Carl Zeiss) equipped with a digital camera (C4742-95, Hamamatsu) with a X40 objective (Carl Zeiss MicroImaging).

[0290] Step 5. Analyze PLA signaling Analysis of in situ PLA signaling for nuclear TβRI-ICD complexed with p300 (via detection of the HA tag) was performed using the Duolink Image Tool, which was specifically developed for quantifying PLA signaling. Two positive controls were used in the experiment: TGF-β1 treatment without antibody and TGF-β1 treatment + control fluorescein at 200 nM. The two positive controls had the same level of in situ PLA signal. Values ​​are presented as 19 0 nM without mAb. The negative control used in this experiment was A9 cells without treatment but with all staining Abs to control for staining background.

[0291] Concentration-dependent inhibition of nuclear translocation of TβRI-ICD is shown in Figure 6. The relative nuclear TβRI-ICD levels (visualized by in situ PLA) in PC3U cells treated with TGFβ1 and various concentrations of mouse mAb #19 are shown. The data show the percentage of control (TGFβ-treated cells, TGFβ1 was purchased from Peprotech Ltd.) after treatment with six different concentrations of mouse mAb #19, e.g., 12.5, 25, 50, 100, 200, and 400 nM, respectively. Black circles represent the average of triplicates, while open circles represent individual points from the actual concentrations. The control (black dots) at 200 nM was used to calculate the percentage of the control value, and individual points are found at the zero point of the concentration curve. Isotype-specific mouse IgG1; catalog number #MAB001, clone 11711, lot number: IX241811A from R&D.

[0292] These results indicate that treatment with mouse mAb #19 prevented TGFβ1-induced translocation of TβRI-ICD to the nucleus, with an IC of 39 nM. 50 It was concluded that this shows

[0293] 6.4 Concentration-dependent inhibition of TGFβ1-induced invasion of PC-3U cells.

[0294] Materials and Methods: Invasion assay. The invasion assay was performed by using Matrigel Invasion Chamber (Corning, Cat. 354483). The basement membrane layer of the cell culture insert was rehydrated in 500 μl of serum-free RPMI-1640, and 1 × 10 cells in cell suspension in 1% FBS medium were added. 5Cells were seeded in the upper chamber with or without TGFβ1. The following antibodies were used: mouse mAb #19 from Absolute Antibodies LNT1733A02 and isotype-specific mouse IgG1; catalog #MAB001, clone 11711, lot #IX241811A from R&D was used as a control. Antibodies were diluted in the medium for the upper and lower chambers as follows: Lower chamber: Abs were diluted directly in 5% FBS medium at 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, and 25 nM (0.75 ml per well).

[0295] Upper chamber: Abs are diluted in 1% FBS medium to 800 nM, 400 nM, 200 nM, 150 nM, 100 nM, 50 nM (0.25 ml per well).

[0296] NOTE: First, a 2x concentration of ab was added to the upper chamber, followed by an equal volume of cell suspension (250 ml). The final concentrations were 400 nM, 200 nM, 100 nM, 75 nM, 50 nM, and 25 nM. The medium was then removed from the insert.

[0297] After incubation of the invasion chamber for 1 hour at 37°C and 5% CO2, cells were stimulated with 10 ng / ml TGFβ1 (Peprotech). After 30 hours of TGFβ stimulation, non-invading cells were removed by scrubbing, and then the inserts were immediately stained with 400 microliters of cell staining solution for imaging and quantification. Stained cells were lysed with 200 μl of extraction solution, and optical density (OD) values ​​were measured at 560 nM, adapted from Mu et al., Nature Communications 2011 [4]. Figure 3 shows the concentration-dependent inhibition of TGFβ-induced invasion of PC-3U cells treated with 10 ng / ml TGFβ1 (purchased from Peprotech Ltd.) for 40 hours and various concentrations of mouse mAb #19. Quantification of cell-free areas of the bottom filter was performed using ImageJscript on bright-field images of the transwell filters. Mean values ​​± SEM are calculated from three independent experiments. PC3U cells treated with TGFβ alone, together with isotype-specific IgG1 (IgG), or untreated (CNTR) are shown as controls.

[0298] From these results, it was concluded that treatment with mouse mAb #19 prevented TGFβ-induced invasion of PC-3U cells.

[0299] 6.5 Treatment with human mA#19 showed no concentration effect on pSMAD levels. Human IgG1 LALA (L234A / L235A) in PC3U cells Immunoblot data for p-Smad2 / total Smad2 indicate that treatment with mAb19# does not affect the canonical TGFβ-induced phosphorylation of its substrate Smad2. Thus, treatment with mAb#19 is selective and does not affect the canonical physiological TGFβ-Smad signaling pathway (see Figure 20). Therefore, treatment with mAb#19 is likely to have fewer unwanted side effects than competing agents targeting TβRI kinase (e.g., galunisertib or next-generation TβRI-kinase inhibitors).

[0300] Methods: PC-3U cells were treated with different antibodies or galunisertib (a small molecule inhibitor of TβRI / ALK5 kinase activity) at the indicated concentrations with or without TGF-β stimulation for 6 hours. Graphs show the mean ± SEM from three independent experiments. The intensity of the immunoblots was measured, and the ratio of pSmad2 / total Smad2 was considered as the normalized signal of pSmad2. Student's t-test. * Between different sample sets (TGF-β stimulated vs. unstimulated cells). ** P<0.01, *** P<0.001, within one set of experiments (lily compound-treated vs. untreated cells). ▲▲P<0.01, ▲▲▲P<0.001.

[0301] 6.6 In silico prediction of immunogenicity Determining the immunogenicity risk of antibody candidates using in silico methodologies to count T cell epitopes. A central part of generating anti-drug antibodies (ADA:s) against mAbs is the presence of T-helper (Th) epitopes in the product. The presence and associated risk of Th epitopes can be assessed using in silico methods. These methods can be used to predict Th epitopes given the product sequence and rank candidate products by immunogenicity. Both the EMA and FDA have guidelines for systematically investigating immunogenic risk [EMA guideline on immunogenicity assessment of therapeutic proteins] and [EMA Guideline on immunogenicity assessment of monoclonal antibodies intended for in vivo clinical use]. The immunogenicity of the variable heavy and light chains of mAb #19 was assessed using in silico methods at SciCross AB (https: / / www.scicross.com / ). The in silico method used scans candidate sequences for T cell epitopes. The method is trained on a dataset of known epitopes and scores likelihood on a normalized scale, with a score of 1 corresponding to a highly likely T cell epitope. Generally, scores in the range of 1 to 5 are most relevant for ranking candidates. The total number of predicted epitopes for a candidate can then be used as a measure of overall immunogenicity risk.

[0302] result The variable heavy chain exhibits three regions with predicted strong promiscuous T cell epitopes (binding to several different alleles). In addition, the variable heavy chain exhibits numerous T cell epitopes with scores of 4-5, i.e., epitopes with weaker but still relevant scores. The variable light chain of mAb #19 contains two regions with promiscuous T cell epitopes. This pattern of many weak T cell epitopes is not seen in the light chain.

[0303] conclusion Both the variable light and heavy chains of mAb #19 were evaluated for immunogenicity. Furthermore, the scores of both chains were combined into a total score. Overall, the light chain did not exhibit a high content of predicted T cell epitopes. Using in silico methodology, mAb #19 possesses signals for potentially inducing antidrug antibodies (ADA). However, it ranks similarly to Avastin, which is known to have low immunogenicity in clinical settings.

[0304] [Table 10]

[0305] 6.7 Epitope Mapping Epitope mapping of mouse mAb #19 via sequential substitution of amino acids 126 to 133 within a recombinant TGFβRI-myc-(His)6-tagged protein. Mouse mAb #19 binds to a recombinant TGFβRI ECD extending from the N-terminus to amino acid 133. However, binding is abolished to the corresponding slightly shorter recombinant ECD-TGFβRI ending at position 125. Thus, the antibody epitope is located within amino acids 126 and 133. The epitope was further restricted by engineering a recombinant ECD bearing sequential amino acid substitutions. Single amino acid substitutions within the ECD of recombinant TGFβRI were introduced by using the sense primer S-huTβRI-NcoI-pOPE in combination with the antisense primer listed in Table 10. The ECD was recombinantly produced as described in Example 1 and purified using Ni-NTA-coupled Sepharose (GE Healthcare). The concentration of the purified ECD-myc-(His)6-tagged protein was determined by specific absorbance at 260 nm (spectrophotometer) and analyzed for purity by Coomassie-stained 12% SDS-PAGE gel. IC of mouse mAb #19 against the coated recombinant amino acid mutants 50 Binding affinity was assessed by ELISA (1), and binding reactivity to denatured proteins was assessed by immunoblotting (2).

[0306] [Table 11]

[0307] Figure 7 shows the alignment of the C-terminal human and mouse Alk5 sequences (aa 101-147) from the recombinant proteins tested for epitope mapping. Single point amino acid mutations in each construct are shown in bold. The predicted transmembrane region is boxed.

[0308] 6.8. IC of mAb #19 against mutant TGFbRI-ECD 50 Rating The recombinant protein concentration was normalized (5 ng / μl) and titrated for coating on ELISA plates. Mouse antibodies were incubated overnight and detected with HRP-conjugated polyclonal goat anti-mouse antibody (DAKO, #P0447), and IC was calculated by nonlinear regression fit according to GraphPad Prism 9. 50 was determined (inhibitor vs. normalized response - variable slope).

[0309] ELISA assays of mouse mAb #19 against titrating amounts of recombinant TGFbRI mutants are shown in Figures 8A-8C. The amount of coated recombinant protein sufficient to obtain half-maximal binding (IC 50 ) was calculated by nonlinear regression. Alanine (A) at position 127 was mutated to three amino acids: glycine, leucine, and valine. Compared to the wild type (wt), affinity was either maintained (G) or reduced two-fold (L, V). Alanine (B) at position 128 was mutated to seven amino acids: glycine, isoleucine, leucine, valine, serine, glutamic acid, and lysine. Compared to the wt, affinity was either maintained (V), (E), improved (K), (L), (S), reduced two-fold (I), or lost (G) (not shown). Alanine (C) at position 131 was mutated to the amino acid glycine, resulting in a two-fold decrease in affinity. The table in Figure 8D summarizes the affinities obtained for the single mutations. Calculations for proteins whose IC50 was not within the (95%) confidence interval are not shown in the graph and are marked as nf (not feasible) in Figure 8D (L126A, A128G, V129G, I130G, G132A, P133A).

[0310] 6.9 Evaluation of mAb#19 binding to recombinant ECD protein by immunoblotting Recombinant ECD mutants and wild-type ECDs were separated on SDS-PAGE gels and stained with PAGE blue to ensure equal loading. Equivalent gels were blotted onto nitrocellulose membranes (ThermoFisherScientific, iBlot2), blocked with 2% M-PBS, and incubated with mouse mAb #19 overnight at 4°C. Detection was performed using an HRP-conjugated goat antibody (DAKO, #P0447) and ECL substrate (ECL Select Western Blotting Detection Reagent, Cytiva Cat#RPN2235) according to the manufacturer's instructions. Binding could be detected for recombinant ECD wild-type (wt) protein (see Figure 9, lanes 14 and 15 (A), lanes 11 and 12 (B)), and for recombinant proteins carrying the mutations A127G (lane 2A), A127L (lane 3A), A127V (lane 4A), A128L (lane 5A), A128V (lane 6A), A128S (lane 7A), A128E (lane 9A), A128K (lane 10A), A128G (lanes 5 and 6B), A128I (lanes 7 and 8B), and A131G (lane 13A). Binding was abolished for the mutations L126A (lane 1A), V129G (lane 11A), and I130G (lane 12A), and was strongly impaired for the mutations G132A (lane 2B) and P133A (lane 3B). 50 This is consistent with the results obtained from measurements. When loaded at a higher amount (5 μg), binding of mAb#19 could be detected to the ECD-substituted A128G (lanes 5 and 6B). Binding to A128G at a normalized amount (2.5 μg) was nearly abolished (consistent with the IC50 results). The recombinant mutants (2.5 μg each) were separated by SDS-PAGE and stained with Coomassie blue or blotted and immunoblotted with chimeric mAb#19, followed by detection with an HRP-conjugated polyclonal goat anti-mouse antibody, as shown in Figures 9A and 9B. The recombinant ECD to which mAb#19 is believed to bind is shown in bold.

[0311] conclusion Sequential substitutions of amino acids within positions 126 and 133 were made to restrict the epitope of mAb#19 to recombinant TGFβRI-ECD. Binding of these ECD recombinant mutants and the wt to mAb#19 was assessed using IC 50 As assessed by concentration determination and Western blot analysis, both methods gave concordant results. Binding of mAb#19 was abolished when substitutions occurred at positions L126, V129, I130, G132, and P133.

[0312] FIG. 10A shows the five amino acids involved in binding of mouse mAb #19 to its target: L126, V129, I130, G132, and P133 (numbered as in SEQ ID NO: 1).

[0313] Example 7 - Epitope mapping using a synthetic human TGF beta receptor type 1 peptide library. The epitopes of mAb #19 (chimeric mouse) and mAb #F11 (silenced Fc) were restricted using an array screening library of human TGFbR1 with synthetic overlapping peptides (Geysen HM, Meloen RH, Barteling (1984). Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. SJ. Proc Natl Acad Sci U S A. 1984 Jul;81(13):3998-4002).

[0314] To target linear epitopes, the TGFbR1 sequence was converted into a library of overlapping linear peptides synthesized directly on a dedicated solid support called a "minicard." Three different libraries were synthesized with linear peptide lengths of 7, 10, and 15 amino acids, offset by one residue. To further restrict the binding contribution of specific amino acids at that position, a fourth linear synthetic library was constructed, also 15 amino acids long, but with the 10th residue substituted by alanine.

[0315] To target discontinuous or conformation-dependent epitopes, conformational epitopes of TGFBR1 were mimicked using CLIPS chemistry (Timmerman et al. (2007). Functional reconstruction and synthetic mimicry of a conformational epitope using CLIPS™ technology. J. Mol. Recognit. 20:283-299). Four human TGFBR1-derived libraries were constructed: (1) For a constrained peptide length of 10, an 8-mer peptide with a one-residue offset was incorporated at positions 2–9. Cysteine ​​residues were inserted at positions 1 and 10 and ligated by mP2 CLIPS to create a loop mimic. The native cysteine ​​was replaced with Cys-acm. (2) Similarly, for a constrained peptide length of 17, a 15-mer peptide with a one-residue offset was incorporated at positions 2–16. Cysteine ​​residues were inserted at positions 1 and 17 and ligated by mP2 CLIPS to create a loop mimic. (3) A library mimicking a β-turn peptide with a length of 20 was constructed. An 18-mer peptide with a one-residue offset was incorporated at positions 2–19. Residues at positions 10 and 11 were replaced by a “PG” motif to induce β-turn formation. Cysteine ​​residues were inserted at positions 1 and 20 and ligated by mP2 CLIPS to stabilize the mimic. The natural cysteine ​​was replaced by Cys-acm. (4) A library mimicking an α-helical peptide with a length of 19 and a one-residue offset was constructed. Cysteines were inserted at positions 1 and 5 and ligated by mP2 CLIPS to nucleate an α-helical structure. The natural cysteine ​​was replaced by Cys-acm.

[0316] The chip was blocked and each antibody was incorporated overnight at 4°C. As controls for nonspecific binding, a mouse antibody against fluorescein and the Fc-silenced fully human antibody, pavilizumab, were used for mAb19 and F11, respectively. Antibody binding was quantified using an automated ELISA-type readout. Binding events were recorded only if multiple overlapping peaks were present within this binding region. Putative core epitopes were identified from neighboring peptides with similar or up to 30% lower intensity than the top peak within the binding region.

[0317] Example 8 - Pharmacokinetic Data Materials and Methods Analysis work The concentration of mAb #19 was determined using a surrogate peptide approach, in which protein concentration was quantified based on LC / MS / MS quantification of unique proteolytic peptides. Target proteins were enriched from plasma samples using Protein G and digested with trypsin. The unique heavy chain peptide ASQSISSYLNWYQQKPGK (SEQ ID NO: 258) was used for quantification, while three other peptides from both the light chain (NTLYLQMNSLR (SEQ ID NO: 259) and EVQLLESGGGLVQPGGSLR (SEQ ID NO: 260)) and heavy chain (LLIYAASSLQSGVPSR (SEQ ID NO: 261)) were used as confirmatory peptides. Trastuzumab and its unique peptide VVSVLTVLHQDWLNGK were used as internal standards to correct for variations in the measurement process.

[0318] Sample preparation IgG was purified from mouse plasma using protein G paramagnetic beads on a KingFisher Flex purification system (Thermo Fisher Scientific, Vantaa, Finland). A minor modification to the protocol used in study ADM-18-1965b was upgrading the instrument's magnetic head to one more suitable for processing standard and deep-well plates. The change in magnetic head increased the sample processing volume (incubation and wash) from 200 μl to 500 μl. Briefly, 20 μl of plasma sample and 20 μl of internal standard (trastuzumab, 20 μg / ml) were diluted with phosphate-buffered saline to a final volume of 500 μl. Protein G beads (50 μl of 10% slurry) were washed with 500 μl of PBS and incubated with the diluted sample for 60 minutes. The beads were washed three times with 500 μl of PBS, and IgG was eluted from the beads in 100 μl of 0.5 M acetic acid. Finally, 80 μl of the eluted fraction was dried in an SPD111 vacuum concentrator (Thermo Fisher Scientific). Samples were processed undiluted and at a 5-fold (1 + 4) dilution with commercially available blank mouse plasma.

[0319] For surrogate peptide analysis, purified IgG was digested with trypsin. Briefly, 20 μl of denaturing solution (8 M urea, 50 mM Tris-HCl, 20 mM dithiothreitol, pH 7.5) was added to the dried sample and incubated at 37°C for 60 min. Freshly diluted iodoacetamide (4 μl, 0.27 M in water) was added to a final concentration of 45 mM, and the sample was incubated at room temperature for 30 min. The sample was diluted to 110 μl with 0.25 M Tris-HCl (pH 7.5), and 0.5 μg of trypsin (trypsin-to-protein ratio 1:40) was added in 10 μl of 1 mM HCl. The sample was digested overnight at 37°C and acidified with 10 μl of 10% formic acid before analysis by LC-MS. All incubations were performed in a thermomixer at 500 rpm.

[0320] Standard plasma samples were prepared by spiking the pure standard into blank CD1 mouse plasma using 1 volume of spiking solution and 9 volumes of plasma to obtain concentrations ranging from 0.122 to 250 μg / ml in plasma. Similarly, quality control (QC) samples were prepared in plasma at concentrations of 1.6, 8.0, 40, and 200 μg / ml. The standards and controls were then prepared for analysis in the same manner as the samples.

[0321] Pharmacokinetic analysis Pharmacokinetic parameters were calculated using the non-compartmental method (NCA) with Phoenix 64 (Build 6.4.0.768) WinNonlin (Version 6.4) software. The dose reported by the sponsor was used for all animals. The terminal phase half-life (T1 / 2) was calculated by least-squares regression analysis of the terminal linear portion of the logarithmic concentration-time curve. The area under the plasma concentration-time curve (AUC) was determined using the linear trapezoidal rule for increasing values ​​and the logarithmic trapezoidal rule for decreasing values ​​to the last measurable concentration (AUC0-last). When possible, extrapolation of the terminal elimination phase to infinity (to calculate AUC0-infinity) was used. The following criteria were used: The minimum of the three points used to calculate lambda (not including Cmax) (adjusted R2 > 0.85) T1 / 2, which is shorter than the time span used to calculate lambda AUClast-infinity <AUC0-infinityの20%

[0322] The maximum plasma concentration (Cmax) and time to reach Cmax (tmax) were derived directly from the plasma concentration data.

[0323] result Analysis of plasma samples The performance of the analytical method during the sample analysis is shown in Appendix I. The results obtained from each individual analyzed sample are shown in Appendix II (50 mg / ml dose) and Appendix III (10 mg / ml dose, data from Mannila 2019, ADM-18-1965c).

[0324] The concentration of mAb #19 was determined using a previously developed surrogate peptide approach. The heavy chain-derived peptide ASQSISSYLNWYQQKPGK was used for quantification, and three other peptides (heavy chain: LLIYAASSLQSGVPSR, light chain: NTLYLQMNSLR and EVQLLESGGGLVQPGGSLR) were used as confirmatory peptides. Good correlations of the confirmatory peptides to the ASQS peptides were observed (NTLY r2 = 0.944, LLIY r2 = 0.945, and EVQL r2 = 0.991).

[0325] Back-calculated data from standard and plasma-spiked QC samples were used to assess the performance (intra-assay accuracy, precision, and range) of the method under study. For standards, the accuracy target is ±20% (±30% at the limit of quantification). For QC samples, ≥67% must be within ±20% of the nominal value. The precision target is ≤20%. Acceptable accuracy (standard 87.5–112.2%, 118.1% at the LOQ), control 71.6–112.2% (87.5%, within 20% of the nominal), precision (10.2%), and range (0.12–250 μg / ml) were observed. All concentrations in the three analyzed blank Foxn1nu mouse plasma samples were below the limit of detection.

[0326] Because the results for undiluted samples taken between 2 and 72 hours exceeded the upper limit of quantitation, mAb #19 concentrations were calculated from diluted samples (by multiplying the results by the dilution factor). All results obtained with diluted samples were within the measurement range. Results obtained with diluted and undiluted samples between 216 and 1176 hours were compared. Good linearity of dilution was observed (mean bias -0.6 μg / ml, slope 0.987, intercept 0.841, r2 = 0.992).

[0327]

Table 12

[0328]

Table 13

[0329]

Table 14

[0330] Pharmacokinetic analysis The mean (±SD) plasma concentration-time profiles for mAb#19 for the 72-hour and full-time studies are shown in Figures 11A and 11B, respectively. The calculated pharmacokinetic parameters are shown in Table 11. The measured plasma concentrations are shown in Appendices II and III. After i.p. administration of mAb#19 at 10 mg / kg, the plasma concentration reached a peak at 8 hours after dosing, with Cmax being 94.4 μg / ml, AUClast being 21700 hour * μg / ml, and the mean half-life being 354 hours. After i.p. administration at 50 mg / kg, the plasma concentration reached a peak at 4 hours after dosing, with Cmax being 448 μg / ml, AUClast being 158000 hour * μg / ml, and the mean half-life being 315 hours. After administration at 10 and 50 mg / kg, the Cmax / dose values were 9.44 and 8.96 μg / ml, suggesting that the increase in exposure was proportional to the dose. Dose proportionality was supported by the fact that the respective values of AUC0-last / dose were somewhat consistent at 2170 and 3150 hour * μg / ml. Furthermore, the fact that the half-life was equivalent between dose levels suggests that the pharmacokinetics were not dose-dependent.

[0331] [[ID= forty]]

Table 15

[0332] summary Monoclonal antibody #19 (mAb#19) was administered intraperitoneally (ip) at 10 and 50 mg / kg to athymic nude Foxn1 mice, and plasma samples collected after dosing were analyzed using LC-MS / MS.

[0333] After ip administration at 10 mg / kg, the apparent C of 94.3 μg / ml max was achieved 8 hours after dosing, and AUC last The value is 21700h * The apparent terminal half-life was 354 hours. After ip administration at 50 mg / kg, the apparent C of 448 μg / ml was max was achieved 4 hours after dosing, and AUC last The value is 158000h * The apparent terminal half-life was 315 hours. After administration of 10 and 50 mg / kg, C max The values ​​for 0.01 mg / dose were 9.43 and 8.96 μg / ml, suggesting that the increase in exposure was proportional to dose. Furthermore, the fact that the half-life was comparable between dose levels suggests that the pharmacokinetics were dose-independent.

[0334] Example 9 - Proof of concept study mIgG1 Mouse antibody #19 in vivo study (ethics approval: DnrA7-18).

[0335] Repeated intraperitoneal (ip) administration of mAb#19 to athymic nude mice xenografted with human PC3U: Effects on tumor size, TβRI-ICD levels, and invasiveness were determined. The effects of mAb#19 on tumor size, invasiveness, and TβRI-ICD levels after ip administration twice weekly for 30 days were evaluated in male athymic nude mice implanted with human PC3U cells in the ventral prostate.

[0336] Materials and Methods Animals: Male athymic nude foxn1 nu mice, 5-6 weeks old, weighing 25-30 g, implanted with Hsd:human PC3U cells into the ventral prostate (purchased from Harlan Laboratories, Inc.).

[0337] mAb#19 and isotype-specific control ab from Absolute Antibodies.

[0338] Vehicle: Phosphate-buffered saline (PBS) Isotype control: IgG1, anti-fluorescein [4-4-20 enhanced Ab 00102-10.16 mouse IgG1 LALA, kappa), 50 mg / kg 50 mg / kg and 10 mg / kg mAb were administered by ip injection twice a week for 30 days in a volume of 10 ml / kg. Mice were sacrificed 72 hours after the final dose on the 30th day after the start of treatment. · Tumor weight / size, invasion, metastasis, effect on nuclear TβRI-ICD by in situ PLA, and antigen concentration in plasma (determined by Admescope).

[0339] [Table 16] (Satellite animals are extra animals that are dosed according to protocol but are not subjected to toxicological and pathological observations and testing.)

[0340] Experimental procedure Animals: Sixty-four male athymic nude foxn1 nu mice, 5-6 weeks old, from Hsd:Harlan, were used in the study. Seven days before compound administration, the mice were injected with human PC3U cells into the ventral prostate. The mice were randomized into different cages before the start of the study, housed in conventional housing, and provided with standard rodent chew (CRM; 801730, Special Dietary Services, SDS) and tap water ad libitum. Animal health monitoring was performed throughout the study. Ethics approval: DnrA7-18.

[0341] Drug administration: Mice were weighed and administered a dose of vehicle (10 mL / kg, ip), isotype control (50 mg / kg, ip), or mAb#19 (50 or 10 mg / kg, 10 mL / kg, ip) twice weekly for 30 days. Formulations were made fresh daily and mixed well before administration. Endotoxin levels in the formulations were monitored before administration. No loading dose was used.

[0342] Blood Sampling: Blood was sampled 72 hours after the last dose. Blood was collected from anesthetized mice by cardiac puncture into pre-labeled, pre-chilled microtainer tubes containing EDTA. Blood samples were immediately placed on ice and then centrifuged. It is important that the exact sampling time is recorded. Plasma was prepared within 20 minutes of sampling by centrifugation at approximately 3000 g for 10 minutes at +4°C.

[0343] Plasma was transferred to a pre-chilled polypropylene tube (50 μL) and then transferred to a 1.4 ml Thermo Screenmate tube. The tubes were immediately frozen on dry ice and stored frozen at -70°C.

[0344] 1.4ml PK sampling for satellite animals: To obtain information on the PK profile, there were two satellite animals per dose group. Blood samples were collected from the tail vein 8 hours (or 4 hours) after administration on Day 1 of dosing (two animals per dose group). Additional blood samples were collected. - 1 hour (or 30 minutes) before the second dose - 1 hour (or 30 minutes) before dose number 6 - 8 hours (or more practically 4 hours) after administration of Dose #6.

[0345] The results are shown in Figures 12A-12D. Effects on tumor growth (A) and lymph node metastasis (B) upon treatment with murine mAb #19 in a human PC3U orthotopic prostate cancer model [6]. 2 x 10 5PC3U cells were injected into the ventral prostate of athymic nude mice. One week later, the mice were intraperitoneally (ip) injected twice weekly for four weeks with vehicle PBS, isotype-specific control mAb IgG (anti-fluorescein 50 mg / kg), mouse-mAb #19 (10 mg / kg), or mouse-mAb #19 (50 mg / kg). Thirty days later, tumors were harvested and weighed. The tumor weight and area of ​​both the 10 mg / kg and 50 mg / kg mouse mAb #19 treatment groups were significantly lower than that of the vehicle group (P<0.05). Furthermore, tumors from mice treated with 50 mg / kg mouse mAb #19 were significantly smaller than those treated with the same amount of isotype-specific control mAb IgG1 at 50 mg / kg. No significant difference in tumor weight is observed between treatment with 10 mg / kg mouse mAb #19 and the 50 mg / kg control mAb IgG1 group.

[0346] Figures 12C and 12D show that the tumor and lymph node areas in both groups treated with 10 mg / kg and 50 mg / kg mouse mAb #19 were significantly lower than those in the vehicle group and the isotype-specific control mAb IgG1 50 mg / kg group (P<0.02**, P<0.001***). Furthermore, lymph nodes from mice treated with 50 mg / kg mouse mAb #19 were significantly smaller than those treated with the same amount of isotype-specific control mAb IgG1 50 mg / kg. No significant difference in tumor weight was observed between the 10 mg / kg mouse mAb #19 and 50 mg / kg control mAb IgG1 groups. Histological sections from tumor tissues and local lymph nodes are shown in Figures 13A and 13B, respectively.

[0347] In situ PLA was used to visualize nuclear complex formation of endogenous TGFβRI-ICD (by detection of the HA tag) and p300 (detected by anti-HA and p300 (R&D Cat. AF3789), respectively) in histological sections from tumor tissues treated with PBS (blank control), 50 mg / kg of isotype control IgG1 mAb (anti-fluorescein), or two concentrations of mouse-mAb#19 (10 mg / kg and 50 mg / kg).

[0348] Figure 14A shows representative in situ PLA data for endogenous nuclear TβRI-ICD (by detection of the HA tag) complexed with endogenous p300, and Figure 14B shows a numerical representation of the analysis of tissue sections. Complex formation is statistically reduced upon treatment with 50 mg / kg of mouse mAb #19 compared to treatment with vehicle control or 50 mg / kg of isotype control IgG1. ** p<0.01, *** p<0.001 Student's T-test. Plasma concentrations of mouse mAb#19 in the blood measured by mass spectrometry (Admescope®, Finland) are shown in Figure 15. Blood was sampled into pre-chilled EDTA tubes 72 hours after the last dose. Analysis of weight gain in mice with tumor burden by measuring the total weight of the mice during the treatment period is shown in Figure 16. Bar graphs show the mean ± SEM from the vehicle group (n=14), isotype-specific control (n=11), mouse-mAb#19 10 mg / kg (n=13), and mouse-mAb#19 50 mg / kg (n=12).

[0349] Example 10 - Mouse mAb #19 binding to endogenous targets analyzed by FACS Materials and Methods Human PC3-U cells were incubated in human Fc blocking / viability dye solution on ice for 10 minutes. After washing, the cells were fixed and permeabilized on ice for 20 minutes. They were then stained with different concentrations (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μg / ml) of mouse mAb #19 or isotype-specific IgG1 control mouse antibody #4-4-20 for 30 minutes on ice. After washing, the cells were incubated with PE-conjugated goat anti-mouse IgG secondary antibody solution on ice for 30 minutes. CytoFlex (Beckman Coulter) was used for analysis.

[0350] The graphs show the MFI(PE) signal from mouse mAb #19 antibody at different concentrations (nM) minus the MFI(PE) signal from an isotype-specific control antibody (#4-4-20, #anti-fluorescein) on single live cells (Figures 17A and 17B). The binding of mAb #19 to endogenous targets in PC-3U and RWPE cells analyzed by FACS is shown in Figures 17A and 17B, respectively. PC-3U (A) and RWPE (B) cells were incubated in human Fc block / viability dye solution for 10 minutes on ice. After washing, the cells were fixed and permeabilized for 20 minutes on ice, after which they were stained with mouse mAb #19 or control #4-4-20 antibody at different concentrations (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μg / ml) for 30 minutes on ice. After washing, the cells were incubated with a PE-conjugated goat anti-mouse IgG secondary antibody solution on ice for 30 minutes. Analysis was performed using CytoFlex (Beckman Coulter). The graph shows the MFI(PE) signal from mAb#19 on live single cells at different concentrations (nM) minus the MFI(PE) signal from the control. Analysis was performed at Truly Translational. From these results, we concluded that mAb#19 binds to its target, endogenous TβRI, with a Kd of 10.70 (A) and 7.81 nM (B) in PC3U and RPWE cells, respectively (Figure 17).

[0351] Example 11-IC 50 Determination of: Comparison of human mAb #19 LALA-IgG1 vs. mouse mAb #19 IgG1 I C 50 Decision: IC, the concentration sufficient to achieve 50% of maximal binding 50 was determined by ELISA. Recombinant human TGFβRI ECD133-myc-(His)6 was coated onto Nunc ELISA plates (Maxisorp, #439454, ThermoScientific, USA) at 500 ng / well (in 0.1 M NaCO3 buffer, pH 9.6, overnight at 4°C) and blocked with 2% milk-PBS (1 h at room temperature). Serial dilutions of mouse or human mAb #19 were incubated overnight at 4°C. Bound antibody was detected with HRP-conjugated polyclonal goat anti-mouse antibody (DAKO, #P0447) or HRP-conjugated polyclonal rabbit anti-human antibody (DAKO, #P0212), respectively. TMB-color formation was blocked by the addition of HSO (after approximately 30 seconds), and absorbance was measured at 450 nm. After each incubation step, the ELISA plate was washed three times with T-PBS. IC 50 For the calculation of IC, the concentration sufficient to obtain 50% saturation, maximum and minimum values ​​were set to 100% and 0%, respectively, and nonlinear regression was modeled (Prism7, GraphPad, USA). The option of "inhibitor vs. normalized response" with variable slope was used to calculate IC. 50 was selected for the calculation.

[0352] Figure 18 shows the IC of mouse mAb #19 (A) and fully human mAb #19 (B) against recombinant human TGFβRI ECD-133-myc-(His)6 protein. 50 The determination shows the IC of both mAb#19 versions. 50 The values ​​(% of maximum binding) were found to be very similar in the sub-nanomolar range and are also summarized in Table 13.

[0353] [Table 17]

[0354] Materials and Methods A9 PC3U cells, as described in Section 6.3, were reconstituted with a TGFβRI-HA tag (the C-terminal portion of the protein). hu-mAb#19 LALA-IgG1 and mouse-mAb#19 were described above. In situ PLA techniques, antibodies, and imaging were used as described above. Cell culture conditions were as described above. In summary, hu-mAb#19 LALA-IgG1 and mouse-mAb#19 exhibit very similar biophysical properties, as shown in Figures 20A and 20B, respectively. The relative nuclear TβRI-ICD (visualized by in situ PLA) values ​​in PC3U cells treated with TGFβ1 and various concentrations of Ab#19 are shown. PLA was performed on HA-ALK5-reconstituted A9 (PC3U ALK5- / -) cells using rabbit anti-HA pAb and mouse anti-p300 for detection. Treatment with the same concentration of isotype control did not affect the translocation of TβRI-ICD to the nucleus. The functionality of hu-mAb#19 and mouse-mAb#19, as well as their respective control antibodies, was investigated and compared in an established cell-based assay (nuclear HA-tagged TβRI-ICD complexed with endogenous p300 in A9 cells) and as described in Section 6.3 above. Using this method, we investigated the effects of drugs on nuclear TβRI-ICD complexed with the transcriptional coregulator p300 (this complex was first described by the inventors in [4]). As shown in Figure 19, we found that both antibodies significantly increased the translocation of TβRI-ICD to the nucleus, with IC for hu-mAb#19 (A). 50 is 45 nM, and for mouse-mAb#19(B) IC 50 We observed that it worked well at 42 nM.

[0355] From these data, it was concluded that hu-mAb#19 LALA-IgG1 and mouse-mAb#19 exhibit very similar biophysical properties as demonstrated above.

[0356] Example 12 - Mouse mAb #19 binding to endogenous targets analyzed by FACS Materials and Methods Human PC3-U cells were incubated in human Fc blocking / viability dye solution on ice for 10 minutes. After washing, the cells were fixed and permeabilized on ice for 20 minutes. They were then stained with different concentrations (100, 30, 10, 3, 1, 0.3, 0.1, 0.03, 0.01, and 0.003 μg / ml) of mouse mAb #19 or isotype-specific IgG1 control mouse antibody #4-4-20 for 30 minutes on ice. After washing, the cells were incubated with PE-conjugated goat anti-mouse IgG secondary antibody solution on ice for 30 minutes. CytoFlex (Beckman Coulter) was used for analysis. The graphs show the MFI(PE) signal from mouse mAb #19 antibody minus the MFI(PE) signal from an isotype-specific control antibody (#4-4-20, #anti-fluorescein) on single live cells at different concentrations (nM) (Figures 17A and 17B).

[0357] Example 13 - Affinity maturation of mAb19 YUMAB, GmbH (Braunschweig, Germany) generated an affinity-matured antibody (cAb1114-1.1) using mAb#19 provided by MetaCurUm Biotech AB as the parent template antibody. The parent mAb#19 was expressed as soluble phage and Fab fragments to test its feasibility in the applied selection system. The VH and VL genes of mAb#19 were synthesized and cloned into the YUMAB phagemid vector in Fab format. The Fab fragment was then packaged in E. coli as phage particles and soluble Fab antibody for antigen-binding testing in ELISA. Thus, the antigen target antigens used were recombinant hu-extracellular domain (ECD)-133-huFc and hu-ECD-133-myc(His)6.

[0358] The parent antibody Fc region was modeled to determine the surface CDR residues likely involved in target binding. The most similar templates from the database were then screened and used to graft the parent CDRs, followed by de novo modeling of the HCDR3. The amino acids predicted to be most important for binding were selected for mutation, resulting in the selection of positions 18 (HCDR1, HCDR2, and HCDR3) in the VH domain and 12 (LCDR1, LCDR2, and LCDR3) in the VK domain.

[0359] Then, 1-2 x 10 of each germline 6 NGS libraries of IgG sequences were examined for amino acid usage at each position, and degenerate codons at each position were selected based on the following considerations: (a) wild-type amino acids and amino acids with a frequency of 0.1% or higher were included, (b) the use of C, M, N, and W was avoided / reduced, (c) on average, 12 amino acids were allowed at each position, and (d) four mutations in VH or VK were allowed. Primers were designed based on the selected degenerate codons, and overlap extension PCR was used to introduce mutations into all CDRs. The mutated VH / VL genes were cloned into the YUMAB phagemid vector, and a total of three libraries were generated: VH and VK. mut / VL mut , V.H. wt / VL mut , V.H. mut / VL wt .

[0360] Quality control of each library was performed by analyzing PCR-amplified inserts for the expected size and by Sanger sequencing using 24 randomly selected colonies. Overall, the libraries showed an average of 78% functional clones, with an overall size of 14 × 10 8 Colony forming units (cfu) were used. mut / VL mut , V.H. wt / VL mut , V.H. mut / VL wt The libraries were packaged into phages and yielded 2.1×, 1.7×, and 1.8×1012 It was revealed that the size of the phage particles was 10 ...

[0361] Affinity-driven in vitro selection (panning) was performed using four variable strategies, with increasing stringency through antigen restriction and competition in the second panning round. The first panning round was performed in the presence of Strept beads and human Fc, huAlk1-mFc, huAlk4-mFc, and huAlk7-mFc for negative selection and 50 nM biotinylated huTGFβR1-huFc for positive selection. The second panning round was performed in the presence of 500 nM huTGFβR1-huFc for binding competition, and in the presence of 50 nM, 5 nM, 0.5 nM, and 0.05 nM biotinylated huTGFβR1-huFc for strategies 1 to 4, respectively.

[0362] 384 soluble Fab antibodies from each strategy were then expressed in soluble form and screened for ELISA binding against four different antigens: 1. huTGFβR1-huFc (positive); 2. human Fc (negative); 3. huAlk1-mFc (negative); 4. huAlk4-mFc (negative).

[0363] A positive hit was defined as an ELISA binding signal for the positive antigen greater than 0.1 while the signal for the negative antigen was less than 0.1. Furthermore, the signal-to-noise ratio between the positive and negative antigens had to be greater than 3. On average, 514 binding clones were identified, yielding approximately 33% positive hits. The 96 clones with the best signal-to-noise ratios from each strategy were sequenced, yielding a total of 253 unique mutant antibodies.

[0364] 192 unique Fab fragments were expressed and their affinities were measured by BLI (biolayer interferometry) by immobilizing biotinylated huECD-133-huFc on a streptavidin sensor. Clones were ranked according to their lowest Koff rates, and the best 25 candidates were converted to full IgG1 for mammalian expression. Full IgG was purified by protein A chromatography and quality controlled by reducing SDS-PAGE and UV / VIS.

[0365] The ranking of expressed IgGs was performed by (a) EC50 determination by ELISA using ECD-huFc as the coated antigen and (b) BLI affinity measurements by Protein A immobilization of IgG candidates and using huECD-133-myc(His)6 as the analyte at concentrations ranging from 500 to 0.5 nM.

[0366] Compared to the parent antibody, 24 of the tested IgGs had improved EC50 values, with up to a 6-fold reduction. In affinity ranking, the top 10 antibodies show very similar EC50 values, with an approximate affinity increase of at least 2-fold. The best antibody showed an affinity increase of a factor 3.

[0367] The five best IgG candidates were further tested for nonspecific binding to representative biomolecules by ELISA. DNA, LPS, lysozyme, and mammalian cell lysate were coated onto ELISA plates, and bound antibody was detected with an antibody directed against human Fc. All candidates showed binding ratios ranging from 0.9 to 1.7 compared to palivizumab, a human IgG with a silenced Fc that was used as a negative control (data not shown).

[0368] Example 14 - Flow cytometry evaluation of human affinity matured antibody 19 variants Methods: Adherent PC3-U cells were stained for TGFβRI expression with affinity-matured antibody candidates detected using a PE-conjugated anti-human IgG antibody. Flow cytometry analysis of TGFβRI staining in PC3U cells was used as the primary evaluation method for antibody candidates. Antibody affinity was assessed using the 50% effective concentration (EC50) and dissociation constant (Kd). To test antibody stability, candidate antibodies were kept at 45°C for 48 and 168 hours, after which their binding efficiency to TGFβRI in PC3U cells was assessed by flow cytometry.

[0369] result Twenty-four matured antibodies were selected for further selection of top candidates. Flow cytometry staining of TGFβRI in PC3U cells was used as a method for evaluating antibody affinity. After initial experiments, 14 antibody candidates were selected based on EC50 and Kd values ​​(see Table 14).

[0370] The second validation allowed us to select the top 5 candidates to be further tested for antibody stability (see Table 15, Figures 21A and 21B): YU772-G12 (EC50=3.9Kd=2.8), YU772-D10 (EC50=3.5Kd=2.6), YU771-B12 (EC50=3.6Kd=1.8), YU772-F11 (EC50 = 0.4Kd = 0.4), and YU772-G04-VH YU771-A09-VL(EC50=2.2Kd=2.0).

[0371] Antibody stability tests were conducted over a 7-day period, with the selected antibodies kept at either 45°C or 4°C (control). After 48 and 168 hours, flow cytometry staining of TGFbRI in PC3U cells was performed, and the antibodies were evaluated by their EC50 and Kd values ​​(see Tables 16 and 17). Considering both affinity and stability, the YU772-F11 antibody was selected as the best antibody candidate.

[0372] [Table 18] Best antibody candidate in this study

[0373] [Table 19] * Best antibody candidate in this study

[0374] [Table 20]

[0375] [Table 21] * Best antibody candidate in this study

[0376] Methods and definitions: Evaluation of results / calculations The average geometric mean fluorescence intensity (MFI) was calculated using FlowJo software. The MFI of the isotype control was subtracted from the MFI of each sample and used for further analysis.

[0377] Data were plotted in Graph Pad Prizm 7.0. EC50 values ​​were generated using a nonlinear regression fit model (agonist vs. response—variable slope (four parameters) with default fitting method—least squares regression. Kd values ​​were generated using a nonlinear regression fit model (one site-specific binding). Specific constraints were applied to improve curve fitting in some of the samples.

[0378] Example 15 - Proximity ligation assay (PLA) of HA-TβRI and p300 The affinity-matured antibodies were used to treat cells, and their inhibitory effect on the generation of nuclear TβRI-ICD complexed with p300 (HA-TβRI+p300) was assessed.

[0379] Nuclear TβRI-ICD HA-tagged expression in complex with endogenous p300 was assayed in PC3U A9 cells (KO for TβRI by CRISPR / Cas9) by stable expression of TβRI-HA-tagged C-terminal fragments and treated with affinity-matured antibody clones (F11 (Figure 22A), G12 (Figure 22C), A09 (Figure 22F), B12 (Figure 22G), D10 (Figure 22D), mAb19 (Figure 22B), and YumabA19 (Figure 22E).

[0380] [Table 22]

[0381] material A9 (TGFβRI (TGFβRI / ALK5 silenced using CRISPR-Cas gene editing) human PC3U cells were reconstituted with a TGFβRI-HA tag (the C-terminal part of the protein). The CRISPR / Cas9 method was developed by Anders Wallenius in the Landstrom laboratory. Reconstituted cells are generated in our own laboratory (Anders Wallenius). RPMI 1640 medium and FBS (Sigma).

[0382] Primary Ab: anti-HA rabbit Ab (Cell Signaling Cat. 3724) and anti-p300 goat antibody (R&D Cat. AF3789). PLA kits (Duo92002, Duo92006, Duo92007 Sigma).

[0383] Treatment Abs: #19Ab and #fluorescein Ab (control ab) were ordered from Absolute Antibodies Summer 2019 and delivered to our laboratory in August 2019. TGF-β1 was purchased from Peprotech and used at 10 ng / ml.

[0384] Device 1. Fluorescence microscope (Zeiss, Axioplan2) 2.37℃ cell incubator 3. Orbital shaker 4. Heated Humidity Chamber 5. Hydrophobic pen to define reaction area 6. Freezer block (for enzymes) 7. Blob Finder Image Analysis Software 8. Prisma7 Software

[0385] Methods and Protocols Step 1 Cell culture On day 1, A9 (ALK5-HA) reconstituted cells were seeded into 8-well chamber slides (5 × 10 per well). 4 cell). On day 2, cells were starved for 16 hours in medium supplemented with 1% FBS. On day 3, cells were pretreated with #control fluorescein or #19 Ab for 1 hour, and then stimulated with TGF-β1 10 ng / ml for 6 hours.

[0386] Step 2. Fix and Permeabilize Slides 1. Slides were washed four times with PBS and then fixed in 4% paraformaldehyde (pre-warmed to 37°C) for 30 minutes at room temperature. 2. After washing four times with PBS, the slides were permeabilized in 0.1% TritonX-100 in PBS for 10 minutes.

[0387] Step 3 PLA staining, followed by the PLA kit instructions. 1. Blocking a) Vortex the Duolink® Blocking Solution. b) Add one drop of Duolink® Blocking Solution (approximately 40 μL) to each 1 cm 2 Add the blocking solution to the sample. Make sure to cover the entire sample with the blocking solution. c) Incubate the slides in a heated humidity chamber at 37° C. for 60 minutes. 2. Primary Antibody Incubation a) Vortex the Duolink® antibody diluent. b) Dilute the primary antibody or antibodies to the appropriate concentration in Duolink® Antibody Diluent. c) Gently remove Duolink® Blocking Solution from the slides. d) Add the primary antibody solution to each sample. e) Incubate the slides in a humidity chamber. Use the incubation temperature and time optimal for the primary antibody. 3. Duolink® PLA Probe Incubation a) Vortex Plus and Minus PLA Probes b) Dilute the plus and minus PLA probes 1:5 in Duolink® Antibody Diluent. c) Gently remove the primary antibody solution from the slide. d) Wash slides in 1× Wash Buffer A for 2×5 minutes at room temperature. e) Gently remove excess wash buffer and apply PLA probe solution. f) Incubate the slides in a preheated humidity chamber at 37° C. for 1 hour. 4. Ligation NOTE: Wait to add the ligase until immediately prior to addition to the sample. Ensure the ligation buffer is completely thawed and thoroughly mixed before use. a) Dilute 5x Duolink® Ligation Buffer 1:5 in high purity water and mix. b) Gently wipe off the PLA probe solution from the slide. c) Wash slides in 1× Wash Buffer A for 2×5 minutes at room temperature. d) During the washes, retrieve the ligase from the freezer using a freezer block (-20°C). e) Add ligase to the 1× ligation buffer from step (a) at a 1:40 dilution and mix. f) Gently remove excess wash buffer and apply ligation solution. g) The slides are incubated in a preheated humidity chamber at 37° C. for 30 minutes. 5. Amplification a) Dilute 5x Amplification Buffer 1:5 in high purity water and mix. b) Gently remove the ligation solution from the slide. c) Wash slides in 1× Wash Buffer A for 2×5 minutes at room temperature. d) During the washes, retrieve the polymerase from the freezer using a freezer block (-20°C). e) Add the polymerase at a 1:80 dilution to the 1× Amplification Buffer from step (a) and mix. f) Gently remove excess wash buffer and apply amplification solution. g) The slides are incubated in a preheated humidity chamber at 37° C. for 100 minutes. 6. Final Wash a) Gently wipe the amplification solution off the slide. b) Wash slides in 1× Wash Buffer B for 2×10 minutes at room temperature. c) Wash the slides in 0.01x Wash Buffer B for 1 minute. 7. Imaging Preparation a) Gently remove excess wash buffer from the slide. b) Mount the slides with a coverslip using in situ mounting medium containing a minimal amount of Duolink® DAPI. c) Wait 15 minutes and then analyze under a fluorescent or confocal microscope using an objective of at least 20x. d) After imaging, store slides in the dark at 4°C for up to 4 days or at -20°C for up to 6 months.

[0388] Step 4. Collect images for PLA staining Digital images were taken by using a fluorescence microscope (Axioplan2, Carl Zeiss) equipped with a digital camera (C4742-95, Hamamatsu) with a X40 objective (Carl Zeiss MicroImaging).

[0389] Step 5. Analyze PLA signaling Analysis of PLA signaling for nuclear TβRI-ICD complexed with p300 was performed by using the Duolink Image Tool, which was specifically developed for quantification of PLA signaling.

[0390] Step 6 Statistics Prisma7 was used for IC50 analysis

[0391] Two positive controls were used in this experiment: TGF-β treatment without antibody and TGF-β treatment + control fluorescein 200 nM. The two positive controls had the same level of in situ proximity ligation signal. The value is shown as number #19 0 nM.

[0392] Negative control used in this experiment: staining without antibody (A9 cells only).

[0393] Example 16 - Invasion assay from prostate and breast cancer cells We observed that TGFβ-induced invasion in response to TGFβ in human triple-negative breast cancer cells (MDA MB231 cells) was significantly inhibited when treated with affinity-matured F11 and A19 at 200 nM compared to the control antibody pavilizumab at 200 nM (Figure 23). Galunisertib (a TGFβ type I receptor kinase inhibitor) was used at 10 μM as a control in the experiment.

[0394] Methods—Invasion Assay—MDA MB-231: MDA MB-231 cells were seeded onto 10 cm plates. Cells were grown in DMEM medium containing 10% FBS, 1% PEST, and 1% L-glutamine at 37°C in the presence of 5% CO2 until the cells reached 70-80% confluence. Cells were then starved for 12 hours in DMEM medium containing 1% FBS, 1% PEST, and 1% L-glutamine. Cells were then trypsinized, washed in 1x PBS, and suspended in serum-free medium to remove traces of trypsin. Cells were then counted. 2x10 51000 / ml of cells were used for the experiment. Further experimental procedures were performed according to the invasion assay protocol from the Corning™ BioCoat™ Matrigel™ Invasion Chamber (Fisher Scientific 11573570). Cells were treated with control Ab pavilizumab (200 nM), F11 Yumab ​​Ab (200 nM), clone A19 Ab (200 nM), and galunisertib 10 μM. Cells were stimulated with TGF-β1 (10 ng / ml) 1 hour after antibody treatment and then stimulated accordingly for 24 hours. They were then incubated in the invasion chamber at 37°C in the presence of 5% CO2 for 24 hours. Results were obtained by analyzing the protein concentration (optical density (OD) at 560 nm) of the invaded cells. Images were taken using a Zeiss light microscope. Graphs were plotted from the OD values ​​obtained for different treatments.

[0395] Example 17 - Epitope Mapping Summary: We employed Pepscan©, a CRO that performs linear and conformational epitope mapping analysis of human TβRI, to identify the binding of mAb#19. The results from Pepscan©, set forth below in Table 19, show which amino acids mAb#19 was found to bind to.

[0396] Materials and Methods Epitope mapping was performed as described in Example 7 above.

[0397] result Putative core epitopes were identified and are listed in Table 19.

[0398] To investigate which residues within these epitopes may be important for the interaction, linear 15-mer peptides with a single alanine mutation at position 10 were generated. Multiple mutations were found to reduce binding and may be considered important for binding. Residues potentially involved in the interaction are underlined and marked in bold (Table 19).

[0399] [Table 23]

[0400] The core epitope is based on the consensus sequence among overlapping peptides (overlapping sequences within 30% of the top peptide intensity in the peak). Residues affected by alanine mutations (>70% binding loss compared to the native sequence) are underlined and shown in bold. * It is likely to contain multiple smaller portions of the epitope.

[0401] Example 18 - Comparative Data Summary: We investigated the functional activity of Capra antibody 82.18 using several antibodies produced in collaboration with SciLifeLab DDDp, including mAb #19, using the in situ PLA assay (described above in Example 15) to measure nuclear TbRI-ICD complexed with p300. Cells were treated with the antibodies shown in Figure 24 to assess their inhibitory effect on the production of nuclear TbRI-ICD complexed with p300 (HA-TbRI + p300). Antibody 16 was used as the isotype-specific IgG antibody in this experiment.

[0402] The present inventors compared antibody #19 with an antibody (antibody 82.18) raised against a peptide consisting of amino acids 114 to 124 of TGFβR1.

[0403] In an in situ PLA assay, a functional assay showing the presence of nuclear TβRI-ICD, performed in wild-type (WT) castration-resistant prostate cancer (PC3U) cells, we showed that antibody 19 was better at preventing TβRI cleavage and subsequent release of TβRI-ICD (Figure 24).

[0404] Example 19 - Results of MS analysis of TACE cleavage of TGFBR1 peptide The present inventors, in collaboration with the SciLifeLab Drug Discovery Development Platform, used mass spectrometry (MS) analysis to investigate potential TACE cleavage sites in recombinant TbR1 peptides. Two novel potential cleavage sites were identified, as described below.

[0405] Determination of the TACE cleavage site on the recombinant ECD of human TGFbR1.

[0406] TGFbR1 133 -myc-(His)6 was expressed as described in Section 1.2 and dialyzed twice against deionized water. 5.5 ml (13 mg) of recombinant TGFbR1 133 To the -myc-(His)6, 3 ml of TACE (300 ng) (R&D Systems cat#930-ADB) was added, and the reaction volume was brought up to 30 ml with 21.5 μl of TACE cleavage buffer (50 mM Tris pH 7.4, 2 mM CalCl, 0.1% Triton X-100). Digestion was carried out for 9 hours at 27°C.

[0407] The TACE cleavage reaction was stopped by the addition of 12 μl of reducing Lammli buffer (4× concentrated NuPage sample buffer (cat# NP0007) and 4.6 μl of NuPage reducing agent (cat# NP0009)), followed by heating at 95° C. for 10 minutes. 15 μl of sample (4.1 μg of recombinant TGFbR11) was added. 33- myc-(His)6) was loaded onto NuPAGE Gel 4-12% (cat#NP0336BOX) and separated at U=130V, I=500mA using MES buffer (cat#NP0002).

[0408] After separation was complete, the gel was then (1) fixed in 46% MeOH, 7% HAc for 1 hour, (2) stained in 46% MeOH, 7% HAc, 0.1% filtered Coomassie R-250 for 1 hour, (3) destained in 5% MeOH, 7.5% HAc for 36 hours, and (4) incubated in 1.5% HAc for 5 hours. Bands were excised, 20 μl of HO was added, and the samples were stored at -20°C.

[0409] The eluted protein samples were hydrolyzed by microwave exposure at 80% power for 6 minutes, followed by reduction and alkylation to disrupt disulfide bonds. After acid hydrolysis using 3 M HCl, samples were desalted using OASIS HLB elution plates (Waters) and analyzed by LC-MS / MS. Data were searched against the Uniprot / E. coli and EMBL customer user databases. Eighteen peptides (Mascot score 763.5 and 18% sequence coverage) were identified, suggesting a C-terminus of VELA or VELAA. Thus, TACE cleavage occurred after amino acid positions 127 (alanine) and / or 128 (alanine) of human TGFbR1.

[0410] TACE cleavage of recombinant ECD-133-TGFbR1 myc(His)6 is strongly inhibited by the introduction of A128G or A128I mutation. Two recombinant ECD-133-TGFbR1 myc(His)6 proteins bearing the point mutations A128G or A128I were produced as described for wild-type production. TACE assays were performed as described in Section X. Samples were separated on an SDS-PAGE gel and visualized by PAGE Blue (Figure 26B). Exposure of the wild-type ECD-133-TGFbR1 myc(His)6 protein (13,658 Da) to TACE resulted in the appearance of smaller fragments corresponding to cleavage after the C-terminus of amino acids 127 or 128 (10,891 Da or 10,981 Da, respectively). In contrast, ECD-133-TGFbR1 myc(His)6 proteins bearing either the A128G or A18I mutation largely maintained their original apparent molecular weights (13,644 Da and 13,700 Da, respectively), indicating that TACE cleavage did not occur. This is shown in Figure 26B.

[0411] Example 20 - Treatment with a monoclonal antibody against the TGFβ type I receptor prevents the growth and metastasis of castration-resistant prostate cancer in vivo Prostate cancer (PCa) is the second most common cancer in men and the fifth most deadly form of cancer in men. In 2018, approximately 1.3 million men were diagnosed with PCa, resulting in approximately 360,000 deaths (1). PCa growth is dependent on the androgen testosterone, which is therefore also the target of androgen deprivation therapy (ADT). ADT is used at various stages of PCa, including to prevent PCa metastasis, in combination with radiation therapy for localized and advanced localized PCa, and also when radiation therapy is not the optimal treatment for PCa (2). In advanced PCa, tumors no longer respond to ADT and are classified as castration-resistant prostate cancer (CRPC) (3). When chemotherapy is not an option for PCa patients and CRPC has metastasized, the new antiandrogens enzalutamide and abiraterone acetate are used. Chemotherapy with docetaxel and cabazitaxel is frequently used for metastatic CRPC (mCRPC). Collectively, this range of treatments only increases the survival of PCa patients by a few months, ranging from 11 to 74 months (4). The most common site of metastasis for PCa is bone. Patient survival rates decrease dramatically when PCa metastasizes to bone. 90% of all PCa patients have bone metastases, and 70% of all PCa-related deaths are caused by bone metastases (5). Therefore, prevention of mCRPC represents a means to increase the survival of PCa patients.

[0412] Transforming growth factor-β (TGF-β) plays a key role in epithelial-mesenchymal transition (EMT) and induces PCa migration / invasion by stabilizing snail family transcriptional repressor 1 (SNAI1), downregulating E-cadherin, and increasing vimentin expression (6). Other TGF-β interactions are related to the PI3 / AKT pathway, the RAS / MAPK kinase pathway, angiogenesis, and metastasis (7). For several years, different therapies using various targets of the TGF-β signaling pathway have been investigated. Targeting the TGF-β signaling pathway can be achieved, for example, by interfering with the activation of latent TGF-β, ligand-receptor interaction, and TGF-β receptor kinase inhibitors. Some of these therapies have been shown to improve patient survival (8). Our group has demonstrated that TβRI undergoes proteolytic cleavage, resulting in the formation of a soluble intracellular domain (TβRI-ICD), which enters the nucleus and drives the expression of pro-invasive genes such as Snail and MMP2 / 9, as well as TβR1. Recently, we have reported that this oncogenic pathway regulates the proliferation of mCRPC cells (9-13). The monoclonal antibodies mAb19 and mAbF11 can prevent proteolytic cleavage of TGFβRI by steric hindrance. Targeting the cleavage of TGFβRI effectively inhibits the non-canonical TGF-β signaling pathway.

[0413] method Athymic male nude mice (Envigo, 6-8 weeks old) were used in the orthotopic prostate xenograft model. A lower midline incision was performed on the mice. In the first in vivo experiment, 300,000 PC-3U cells in 10 microliters of sterile PBS were injected into the right anterior prostate lobe of 18 mice. One week after injection, the mice were randomized into four treatment groups: four mice with 50 mg / kg control mAb, five mice with 50 mg / kg mAb19, four mice with 50 mg / kg mAb, 50 mg / kg mAbF11, and five mice with 10 mg / kg mAbF11. Mice were treated with 50 mg / kg control (control) mAb, 50 mg / kg mAb19, 50 mg / kg mAbF11, or 10 mg / kg mAbF11 by intraperitoneal injection twice weekly for 4 weeks. In a second in vivo experiment, 300,000 PC-3U cells in 10 μl of sterile PBS were injected into the right anterior prostate lobe of 59 mice. One week after injection, the mice were randomized into six treatment groups: 13 mice with control mAb, 15 mice with 3 mg / kg mAbF11, 10 mice with 10 mg / kg mAbF11, 10 mice with 30 mg / kg mAbF11, 6 mice with control, and 5 mice with 10 mg / kg docetaxel. Mice were treated twice weekly for 4 weeks with 30 mg / kg control mAb, 3 mg / kg mAbF11, 10 mg / kg mAbF11, 30 mg / kg mAbF11, control for docetaxel, and 10 mg / kg docetaxel. Treatments were administered intraperitoneally. After 4 weeks of treatment, the mice were sacrificed. The tumors and lymph nodes were weighed and the volumes were measured with a vernier caliper.

[0414] Immunohistochemical analysis of specific proteins was performed by incubating sections at 60°C for 1 hour. They were then rehydrated twice in xylene for 15 minutes each, 100% ethanol for 5 minutes, 95%, 70% ethanol, and deionized H2O for 5 minutes. The sections were then treated with Antigen Retrieval Reagent for 15 minutes at 95°C, followed by rinsing with deionized H2O. The sections were then placed in 0.75% H2O2 / 75% methanol for 15 minutes, rinsed with deionized H2O for 5 minutes, and washed three times with PBS. The sections were then blocked with 5% goat serum for 1 hour at room temperature. The sections were then incubated overnight at 4°C with primary antibodies: TGFβR1 (1:500), Ki67 (1:250), and vimentin (1:100) diluted in 5% goat serum. After overnight incubation with the primary antibody, the sections were washed three times in PBS and then incubated with the secondary antibody. The sections were then washed three times in PBS, developed with the DAKO REAL EnVision detection system (substrate), counterstained with hematoxylin, and mounted in aqueous mounting medium. Digital images for IHC were obtained by scanning with a Pannoramic 250 Flash II (3DHistech, Hungary). The number of positive cells (difference) relative to the negative control mAb was quantified using the software QuPath and subdivided into low, medium, and high expression levels of the target antibody.

[0415] Results and Discussion: We used the preclinical orthotopic mCRPC mouse model described in Zang et al., 2019, to test treatment (injection) with the monoclonal antibodies (mAb), mAb19 and mAbF11. Both mAb candidates prevent proteolytic cleavage of TGFβR through steric hindrance. Our results show that both mAb19 and mAbF11 reduced tumor weight. Treatment with 50 mg / kg of mAb19 resulted in a significant reduction in tumor weight compared to the control mAb (difference = 183 mg, p > 0.05). The same effect was observed for 50 mg / kg of mAbF11 (difference = 192 mg, p > 0.05) and for 10 mg / kg of F11 mAb (difference = 158 mg, p = 0.05) (Figure 1b).

[0416] Similar results were observed for tumor volume. Our data showed that treatment with 50 mg / kg mAb19 reduced tumor volume by 169 mm compared to the control mAb. 3 The results show that mAbF11 at 50 mg / kg resulted in a reduction in tumor volume of 185 mm, but this reduction was not significant (p=0.07). 3 , p>0.05), and for mAbF11 at 10 mg / kg (difference=170 mm3, p>0.05) (Table 21, Figure 27c).

[0417] We then performed an analysis of lymph node weight and volume to investigate whether these treatments affected regional metastasis to lymph nodes. The analysis shows that 50 mg / kg mAb19 and 50 mg / kg mAbF11 significantly reduced lymph node weight compared to the control mAb (difference = 9 mg, p = 0.05, and difference = 9 mg, p > 0.05, respectively). Body weight was also reduced with 10 mg / kg mAbF11 (difference = 6 mg), but at a non-significant level (p = 0.16) (Fig. 1d). Lymph node volume also showed a significant reduction compared to the control for all mAb treatments. 50 mg / kg mAb19 (difference = 13 mm 3 , p = 0.05), 50 mg / kg mAbF11 (difference = 17 mm 3, p>0.05), and 10 mg / kg mAb (difference = 15 mm 3 , p>0.05) (Table 21, Figure 27e). Collectively, these results indicate that treatment with both mAb19 and mAbF11 reduced the growth of primary prostate tumors and regional metastasis to lymph nodes. Notably, treatment with different concentrations of mAbF11 did not affect the body weight of mice (Figure 28a).

[0418] IHC was performed on tumors and stained for TGFβR1, Ki67, and vimentin. Using the software program QuPath, scores were assigned to low (+1), intermediate (+2), and high (+3) expression. TGFβR1 expression in mCRPC tumors was analyzed after treatment with mAb19 50 mg / kg, F11 mAb (10 or 50 mg / kg), or control mAb (50 mg / kg). High TGFβR1 expression was reduced after treatment with mAb19 50 mg / kg (difference = 180,608 cells, p > 0.05), mAb F11 50 mg / kg (difference = 178,955 cells, p > 0.05), or mAb F11 10 mg / kg (difference = 138,022 cells, p > 0.05) compared with the control mAb. No difference was observed in low or medium expression of TGFβR1 after treatment with mAb19 or both mAbs F11 (Figures 28a and 28b). We then investigated whether the proliferation marker Ki67 was affected after treatment. Low expression of Ki67 was observed after treatment with mAb19 (difference = 45,903 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 34,113 cells, p > 0.05), or 10 mg / kg mAb F11 (difference = 32,955 cells, p > 0.05) compared to the control mAb. Furthermore, medium expression of Ki67 was reduced after treatment with 10 mg / kg mAb F11 (difference = 14,545 cells, p > 0.05) compared to the control mAb. Treatment with 50 mg / kg mAb19 or 50 mg / kg mAb F11 showed no difference in medium-expressed Ki67. Finally, high-expressed Ki67 was reduced after mAb F11 treatment at both 50 mg / kg (difference = 12,763 cells, p > 0.05) and 10 mg / kg (difference = 17,994 cells, p > 0.05) compared to the control mAb. No difference was observed after 50 mg / kg mAb19 treatment (Figures 28c and d). The EMT marker vimentin was analyzed to assess whether it was affected after treatment. Lower expression of vimentin was observed after treatment with 50 mg / kg mAb19 (difference = 63,262 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 34,534 cells, p > 0.05), or 10 mg / kg mAb F11 (difference = 54,443 cells, p > 0.05) compared to the control mAb.Furthermore, moderately expressed vimentin was decreased after treatment with 50 mg / kg mAb19 (difference = 46,192 cells, p > 0.05), 50 mg / kg mAb F11 (difference = 44,331 cells, p > 0.05), and 10 mg / kg mAb F11 (difference = 69,962 cells, p > 0.001) compared to the control mAb (Figures 28e and 28f).

[0419] We then performed a dose-response in vivo study using mAb F11 at 30 mg / kg, 10 mg / kg, and 3 mg / kg. Results from this study show a reduction in tumor weight at both 30 mg / kg and 10 mg / kg (difference = 138 mm, respectively). 3 , p>0.05, and difference=147mm 3 , p>0.05) (Table 22, Figures 29a and b). Similar results were obtained for tumor volume at 30 mg / kg and 10 mg / kg (difference = 8 mm, respectively). 3 、 p>0.05, and difference = 10 mm 3 , p>0.05) (Table 22, Figures 29c and 29d). Notably, treatment with mAbF11 at these concentrations did not affect the body weight of the mice (Figure 29e).

[0420] At low scores for TGFβR1 expression, expression was reduced for 3 mg / kg mAbF11 (difference = 53,131 cells, p = 0.045), 10 mg / kg mAbF11 (difference = 55,902 cells, p = 0.035), and 30 mg / kg mAbF11 (difference = 72,039 cells, p = 0.03) compared to the control mAb. The same trend was observed at medium scores for TGFβR1, where expression was reduced for 3 mg / kg mAbF11 (difference = 71,468 cells, p = 0.017), 10 mg / kg mAbF11 (difference = 76,653 cells, p = 0.017), and 30 mg / kg mAbF11 (difference = 88,622 cells, p = 0.007) compared to the control mAb. Finally, highly expressed TGFβR1 was decreased in expression for 3 mg / kg mAbF11 (difference = 214,031 cells, p = 0.001), 10 mg / kg mAbF11 (difference = 208,635 cells, p > 0.001), and 30 mg / kg mAbF11 (difference = 202,263 cells, p = 0.002) compared to the control mAb (Table 3, Figures 30a and 30b).

[0421] We then investigated whether mAbF11 could affect the proliferation of mCRPC cells by using the marker Ki67. At low Ki67 expression scores, expression was reduced in the groups treated with 3 mg / kg mAbF11 (difference = 56055 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72849 cells, p > 0.0001) compared with the control mAb. The same trend was seen for Ki67 medium scores, where expression was reduced for 3 mg / kg mAbF11 (difference = 21,498 cells, p = 0.005), 10 mg / kg mAbF11 (difference = 20,845 cells, p > 0.0001), and 30 mg / kg mAbF11 (difference = 24,357 cells, p > 0.0001) compared to the control mAb. Finally, Ki67 high score expression was reduced for 3 mg / kg mAbF11 (difference = 56,054 cells, p = 0.02), 10 mg / kg mAbF11 (difference = 64,585 cells, p = 0.001), and 30 mg / kg mAbF11 (difference = 72,849 cells, p > 0.0001) compared to the control mAb (Figures 30c and d). Surprisingly, we were able to confirm that 30 mg / kg mAbF11 had higher expression of ki67 compared to the control mAb 30 mg / kg. One explanation is that cells are trying to divide in 30 mg / kg mAbF11 but are unable to divide, which is why there is such high expression of Ki67. This needs to be further analyzed in in vitro experiments using FACS analysis of the cell cycle.

[0422] Tumors were stained for the EMT marker vimentin to assess its expression after treatment with mAbF11. We concluded that only 30 mg / kg mAbF11 treatment reduced all three distinct vimentin scores: low (difference = 100784, p = 0.002), medium (difference = 100416, p = 0.003), and high (difference = 98960, p = 0.035) (Table 23, Figures 30e and f).

[0423] In this in vivo study, docetaxel was included as a comparative treatment group, and 10 mg / kg docetaxel reduced tumor size compared to control (difference = 64 mm 3 , p-value >0.001) (Figures 31a and b). However, docetaxel treatment affected body weight, with some mice losing more than 20% of their body weight and exhibiting fatigue, affecting the overall health of the mice. Due to these severe side effects, the mice had to be sacrificed (Figure 31c). The overall condition of the mice deteriorated, showing signs of fatigue, tremors, intestinal stiffness, and weight loss. Immunohistochemistry was performed, and tumors were stained for TGFβR1 and vimentin and scored as low (+1), medium (+2), and high (+3) expression. TGFβR1 expression was reduced at low (difference = 15,746 cells, p > 0.0001) and medium (difference = 11,795 cells, p = 0.008) levels compared to controls (Figures 32a and b). Ki67 low expression was also reduced after 10 mg / kg docetaxel treatment (difference = 13,705 cells, p > 0.05) (Figures 32c and 32d). Expression of vimentin, an EMT marker, was reduced in low (difference = 12,642 cells, p = 0.015) and medium (difference = 9,958 cells, p = 0.03) cells compared to controls (Figures 32e and 32f).

[0424] [Table 24] N=9 mice per treatment group, (ns=not significant).

[0425] [Table 25]

[0426] [Table 26]

[0427] References for Example 20 1.Organization WH.Global cancer facts and figures,4th edition 2018[4 th:[ 2.S AMEB,Salawu A,Brown JE.Bone Health in Men with Prostate Cancer:Review Article.Curr Osteoporos Rep.2019;17(6):527-37。 3.Body A,Pranavan G,Tan TH,Slobodian P.Medical management of metastatic prostate cancer.Aust Prescr.2018;41(5):154-9。 4.Hoy SM.Abiraterone acetate:a review of its use in patients with metastatic castration-resistant prostate cancer.Drugs.2013;73(18):2077-91。 5.Teo MY,Rathkopf DE,Kantoff P.Treatment of Advanced Prostate Cancer.Annu Rev Med.2019;70:479-99。 6.Semenas J,Allegrucci C,Boorjian SA,Mongan NP,Persson JL.Overcoming drug resistance and treating advanced prostate cancer.Curr Drug Targets.2012;13(10):1308-23。 7.Cao Z,Kyprianou N.Mechanisms navigating the TGF-beta pathway in prostate cancer.Asian J Urol.2015;2(1):11-8。 8.Teixeira AF,Ten Dijke P,Zhu HJ.On-Target Anti-TGF-beta Therapies Are Not Succeeding in Clinical Cancer Treatments:What Are Remaining Challenges?Front Cell Dev Biol.2020;8:605。 9.Mu Y,Sundar R,Thakur N,Ekman M,Gudey SK,Yakymovych M,et al.TRAF6 ubiquitinates TGFbeta type I receptor to promote its cleavage and nuclear translocation in cancer.Nat Commun.2011;2:330。 10.Gudey SK,Sundar R,Mu Y,Wallenius A,Zang G,Bergh A,et al.TRAF6 stimulates the tumor-promoting effects of TGFbeta type I receptor through polyubiquitination and activation of presenilin 1.Sci Signal.2014;7(307):ra2. 11.Song J,Mu Y,Li C,Bergh A,Miaczynska M,Heldin CH,et al.APPL proteins promote TGFbeta-induced nuclear transport of the TGFbeta type I receptor intracellular domain.Oncotarget.2016;7(1):279-92。 12. Song J, Zhou Y, Yakymovych I, Schmidt A, Li C, Heldin CH, et al.The ubiquitin-ligase TRAF6 and TGFbeta type I receptor form a complex with Aurora kinase B contributing to mitotic progression and cytokinesis in cancer cells.EBioMedicine.2022;82:104155. 13. Zang G, Mu Y, Gao L, Bergh A, Landstrom M. PKCzeta facilitates lymphatic metastatic spread of prostate cancer cells in a mice xenograft model. Oncogene.2019;38(22):4215-31.

[0428] Example 21 - Evaluation of the effect of human mAb antibody F11 on cell migration in vitro The effect of the human monoclonal antibody F11 (50 nM to 200 nM), which targets the TGF-β signaling pathway, on cell migration was assessed in a wound-healing assay performed on HCT-116-RedFluc cells (human colorectal cancer cells) with or without TGF-β1 stimulation (10 ng / ml). Cell migration was compared to untreated cells and a control group using a human isotype control antibody (50 nM to 200 nM) and a known inhibitor of TGF-βRI kinase (galunisertib at 10 μM) with or without TGF-β1 stimulation. Cell migration was assessed by monitoring recolonization of scratched areas (two areas per well for three wells per condition) to quantify cell migration.

[0429] mAb F11 inhibited cell migration of HCT-116-RedFluc cells. This cell migration inhibition was comparable at all concentrations with TGF-β1 stimulation or at 200 nM without TGF-β1 stimulation, with nearly complete inhibition ranging from 84.8% ± 14.5% to 91.2% ± 11.8% at T0 + 72 h, whereas migration occurred relative to untreated cells with a free cell area of ​​6.2% ± 4.2%. The inhibition of cell migration by mAb F11 was lower at 50 nM and 100 nM without TGF-β1 stimulation, 73.4% ± 21.7% and 54.1% ± 17.1%, respectively.

[0430] The human monoclonal antibody F11 inhibited HCT-116-RedFluc cell migration at all concentrations, regardless of whether TGFβ1 stimulation was present or absent.

[0431] Introduction Cell migration is fundamental to physiological (morphogenesis, regeneration, and inflammation) and pathological processes such as cancer during invasion and metastasis.

[0432] Aberrant TGFβ signaling is involved in several human diseases, including malignancies such as lung cancer, hepatocellular carcinoma, pancreatic cancer, and colorectal cancer (CRC).

[0433] TGF-β has been shown to promote and maintain CRC metastasis through the regulation of immune and cell-cell contact mechanisms.

[0434] CRC is one of the leading causes of cancer death in Western countries. The metastatic distribution of the primary tumor is directly related to patient survival and accounts for approximately 90% of all colon cancer deaths. Therefore, more effective and less toxic therapies for CRC are needed.

[0435] The effect of human mAb F11 (designated by CDD Ab at three concentrations: 50, 100, and 200 nM) targeting the cancerous TGF-β signaling pathway on cell migration was evaluated in a wound-healing assay performed on HCT-116-RedFluc cells (human CRC cells). The wound-healing assay consists of an artificial cleft created on a cell monolayer, and two-dimensional cell migration is tracked by capturing images at regular intervals up to TO + 72 hours after scratching. Cell migration was compared to untreated cells and a reference control using an isotype control antibody (designated by CTL Ab at three concentrations: 50, 100, and 200 nM) and a known inhibitor of TGF-βR1 kinase (galunisertib at 10 μM). These conditions were tested with or without TGF-β1 stimulation. Cell migration was assessed by monitoring recolonization of the scratched area to quantify cell migration.

[0436] material Candidate antibodies (CDD Abs): mAb F11: Fully human Ab IgG1 (immunoglobulin G1) with several mutations in the Fc (fragment crystallisable) region (to silence ADCC). Specificity for human TGF-βR1 formulated in phosphate-buffered saline (PBS). Protein A purified, >95% Isotype control antibody (CTL Ab): Humanized mAb IgG1 with the same mutations in the Fc region (to silence ADCC) as the CDD Ab. Specificity against RSV (respiratory syncytial virus), formulated in PBS, protein A purified, >95% Galunisertib TGF-β inhibitor (LY2157299): Targets and binds to the kinase domain of TGF-β receptor 1 (TGF-βR1) 22 H 19 N5O, CAS number: 700874-72-2, in 1% DMSO, purity 99.84%. TGF-β1 Transforming growth factor beta ligand 1 (TGF-β1): ligand for TGFβ receptor (Peprotech Ltd) ≥ 98% by SDS-PAGE gel and HPLC analysis Tumor cells HCT-116-RedFluc (human colorectal tumor-116-RedFluc): The HCT-116-RedFluc cell line is a luciferase-expressing human colorectal tumor, allowing the establishment of a CRC mouse model and tracking of tumor cell distribution within the mouse by bioluminescence imaging.

[0437] method Tumor cell amplification Thawing and Amplification: A vial of HCT-116-RedFluc cells was resuspended in prewarmed complete culture medium consisting of McCoy's 5a medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P / S) (CM10%). Centrifugation was performed at 400 g for 5 minutes at room temperature. To determine cell number and viability at each cell passage, cells were mixed with an equal volume of erythrosin B stain, and 10 μl was loaded onto a LUNA cell counting slide. Images and counts were performed using the LUNA-FX7 in brightfield mode and the default protocol.

[0438] Tumor cell seeding for wound healing assay HCT-116-RedFluc cells were cultured in a 24-well plate at 2.5 × 10 cells per well with pre-warmed 10% CM. 5 cells.

[0439] Wound healing assay and serum starvation Confluent monolayers of HCT-116-RedFluc were scratched with a sterile 1000 μl tip to create cell-free wounds (a new tip was used for each well). The medium was removed and prewarmed culture medium consisting of McCoy's 5a medium supplemented with 1% FBS and 1% P / S was added, designated CM1%.

[0440] Preparation of test and reference items Test and reference items were prepared and added according to the experimental study design in Table 24.

[0441] [Table 27]

[0442] mAb F11 and isotype control antibody (CTL Ab) solution preparation: Solutions containing mAb F11 alone or isotype CTLAb alone were prepared at 50 nM, 100 nM, and 200 nM in McCoy's 5a medium CM1% supplemented with 1% FBS and P / S. Preparation of galunisertib solution: 10 μM galunisertib solution

[0443] Processing of Exams and Reference Items The medium was removed, and the cells were washed twice with sterile PBS. Then, 1 ml of test and reference solution was dispensed into the appropriate wells containing either medium alone (1% CM), 10 μM galunisertib, or the indicated concentrations of mAb F11 or ctr antibody. The cells were then incubated at 1-6% CO. 2. and incubated at 35°C to 40°C.

[0444] TGF-β1 stimulation Stimulation with TGF-β1 was performed by adding 100 μl of TGF-β1 solution (110 ng / ml in 1% CM) according to the experimental phase schedule in Table 25. 100 μl of the 1% CM solution was added to wells of unstimulated cells. The cells were then incubated at 1-6% CO 2. and incubated at 35-40°C.

[0445] [Table 28]

[0446] photograph Images were captured using a camera (Axiocam208 color from ZEISS) attached to a ZEISS Primovert inverted cell culture microscope (4x objective on the microscope, 0.5x objective on the camera, 2 fields per well (top and bottom of each well) at the same brightness, for 3 replicates) according to the experimental phase schedule in Figure 33. Particular care was taken to take all photographs at exactly the same position as the baseline photograph using the same parameters.

[0447] Data analysis Images were analyzed with the image processing program ImageJ using an optimized processing macro (MRI Wound Healing Tool) to identify and quantitate the wound area, which served to measure and plot the gap area as a function of time to determine the area of ​​cell migration.

[0448] The extent of closure at T0 + 4 h, T0 + 24 h, T0 + 48 h, and T0 + 72 h was calculated by subtracting the area at T0. The change in area was determined by normalizing the difference to the area at T0. Cell migration was quantified and expressed as the average percentage of closure of the scratch area over three replicates or two replicates only for some conditions detailed on DEV2.

[0449] The area normalized to the TO area for each replicate of the condition, and the mean normalized to the TO area±SD for each condition at each time point were calculated and graphed.

[0450] The means normalized to the TO area of ​​the reference and test conditions (condition 3: CTD Ab, condition 4: CDD Ab, condition 7: CTD Ab stimulated by TGF-β1, and condition 8: CDD AB stimulated by TGF-β1) were compared with the control condition (condition 1: untreated and not stimulated by TGF-β1) and the reference conditions (condition 2: galunisertib, condition 5: stimulated by TGF-β1, and condition 6: galunisertib stimulated by TGF-β1).

[0451] Results and Discussion: Representative photographs of each condition for each time point were selected and presented in Figures 34a (TGFβ stimulation) and 34b (TGFβ stimulation): Images of wound healing assays at TO, TO+4 h, TO+24 h, TO+48 h, and TO+72 h. The mean ± SD of the normalized percentage of area compared to TO area for each group at each time point was quantified and presented in Figure 35.

[0452] The normalized percentage of area compared to the TO area progressively decreased for conditions 1 (untreated cells), 2 (galunisertib), 5 (TGF-β1 stimulation), and 6 (galunisertib stimulated with TGF-β1), reaching an average of 6.2% ± 4.2%, 4.3% ± 2.0%, 5.7% ± 1.8%, and 8.0% ± 3.9%, respectively, at TO + 72 h. Under these conditions, HCT116-RedFluc cells migrated and progressively formed colonies in the scratch.

[0453] Compared to untreated cells, the normalized percentage of area relative to the TO area progressively decreased for condition 3 (CTL Ab): 3C (50 nM CTL Ab), 3B (100 nM CTL Ab), and 3A (200 nM CTL Ab), reaching an average of 4.8% ± 3.7%, 3.7% ± 1.0%, and 13.0% ± 9.1%, respectively, at TO + 72 h, indicating scratch colonization at the same rate as the control untreated condition.

[0454] The normalized percentage of area compared to the TO area was slightly reduced for conditions 4C (50 nM F11mAb), 4B (100 nM F11mAb), and 4A (200 nM F11mAb), reaching an average of 73.4% ± 21.7%, 54.1% ± 17.1%, and 87.3% ± 19.8%, respectively, at TO + 72 h. In these conditions without TGF-β1, HCT116-RedFluc cell migration was reduced, with the most significant effect observed at the highest concentrations of candidate compounds.

[0455] Compared to untreated cells, the normalized percentage of area relative to the TO area progressively decreased for condition 7 (TGF-β1-stimulated CTL Ab), regardless of dose (50 nM, 100 nM, or 200 nM), reaching an average of 11.9% ± 6.2%, 20.9% ± 13.0%, and 9.6% ± 6.2%, respectively, at TO + 72 h, which was close to that of control untreated cells.

[0456] In contrast, a very low decrease in the normalized percentage of area compared to the TO area was observed for condition 8 (F11mAb): 8C (50 nM F11mAb stimulated with TGF-β1), 8B (100 nM F11mAb stimulated with TGF-β1), and 8A (200 nM F11mAb stimulated with TGF-β1) reached an average of 84.8% ± 14.5%, 91.0% ± 15.8%, and 91.2 ± 11.8%, respectively, at TO + 72 h.

[0457] Without TGF-β1 stimulation, inhibition of migration was greater with 200 nM F11mAb than with the lowest concentrations of 50 nM and 100 nM, but when cells were stimulated with TGF-β1, inhibition of migration of cells treated with all concentrations of F11mAb was equivalent.

[0458] Inhibition of HCT-116-RedFluc cell migration was similar with or without stimulation with TGF-β1 by 200 nM F11mAb.

[0459] conclusion The effect of the human monoclonal antibody F11, which targets the oncogenic TGF-β signaling pathway, on cell migration was assessed using a wound healing assay performed on HCT-116 RedFluc cells (human colorectal cancer cells) with or without TGF-β1 stimulation. Cell migration was compared with untreated cells and a control group using a human isotype control antibody and a known inhibitor of TGF-βRI kinase (galunisertib) with or without TGF-β1 stimulation. Cell migration was assessed by monitoring recolonization of the scratched area to quantify cell migration.

[0460] F11 inhibited the migration of HCT-116-RedFluc cells. This cell migration inhibition was comparable at all concentrations with TGF-β1 stimulation or at 200 nM without TGF-β1 stimulation, with nearly complete inhibition ranging from 84.8% ± 14.5% to 91.2% ± 11.8% at TO + 72 hours, whereas migration occurred relative to untreated cells with a free cell area of ​​6.2% ± 4.2%. The F11 antibody inhibited cell migration less at 50 nM and 100 nM without TGF-β1 stimulation, at 73.4% ± 21.7% and 54.1% ± 17.1%, respectively. The results presented herein demonstrate that F11 inhibited cell migration of HCT116-RedFluc cells. This cell migration inhibition was comparable at all concentrations with TGF-β1 stimulation or at 200 nM without TGF-β1 stimulation, with near complete inhibition ranging from 84.8% ± 14.5% to 91.2% ± 11.8% at T0 + 72 h, whereas migration occurred relative to untreated cells with a free cell area of ​​6.2% ± 4.2%.

[0461] As expected, cell migration similar to that observed in the control untreated condition was observed for all other treatments (control antibody and TGF-β inhibitors, stimulated or not with TGF-β1).

[0462] Example 22 - Expression of nuclear transforming growth factor beta (TGFβ) type I receptor in human colorectal cancer HCT116 cells stimulated with TGFβ1 method HCT116 cells (ATCC) were cultured on sterile coverslips in McCoy's 5A medium. Cells were starved for 16 hours in medium containing 1% FBS and then stimulated with TGFβ1 (10 ng / ml) at the indicated time points: 0, 3, 6, and 24 hours.

[0463] Results and Conclusions TGFβR1 localization was observed when stained with a primary antibody (TGFβR1 polyclonal rabbit antibody - Thermofischer PA598192) (157-244aa) at a dilution of 1:300. Alexa fluor 555 (red) anti-rabbit was used as the secondary antibody (1:600 ​​dilution), and DAPI (blue) was used for nuclear staining. Nuclear colocalization of TGFβR1 was analyzed by confocal and z-stack imaging. Images were acquired using an LSM710 confocal microscope. From these data, we conclude that nuclear TGFβR1 can be observed in human colorectal cancer HCT116 cells (Figure 36).

[0464] Example 23 - Role of TGFβ signaling in human oral squamous cell carcinoma We investigated the protein expression of transforming growth factor type I receptor (TbRI) in tissues derived from patients with oral squamous cell carcinoma (OSCC) and observed that high TbRI expression correlated strongly with higher tumor grade. Treatment of human-derived OSCC organoids with transforming growth factor type I (TGFβ1) resulted in tumor cell migration into Matrigel, visualized as budding. Treatment with the therapeutic antibody F11, directed against a specific epitope in TbRI, and a TbRI kinase inhibitor significantly prevented TGFβ1-induced budding of OSCC organoids, demonstrating that therapeutic interference with the TGFβ signaling pathway in OSCC with F11 may be valuable in future precision medicine for these patients.

[0465] Materials and Methods For immunohistochemistry (IHC): To examine the expression of transforming growth factor type I receptor (TbRI) in tissues from patients with oral squamous cell carcinoma (OSCC), we followed the protocol described in Zang et al., 2019. We used rabbit polyclonal Capra C 11-83, purchased from Capra Science in the Landstrom Laboratory, at a dilution of 1:100.

[0466] Organoid culture: The process of generating human organoids derived from patient tissue with OSCC follows the protocol previously described in Wang et al. 2022. An organoid library of salivary gland tumors reveals subtype-specific characteristics and biomarkers. J Exp Clin Cancer Res, 2022(41):350. Briefly, patient tissue (oral squamous cell carcinoma, OSCC) was collected and cultured in 1-3 mm sections. 3 The tissue was trimmed into small pieces, and then incubated with 1x dispase at 37°C for up to 60 minutes with gentle agitation. After dissociation, the cell suspension was centrifuged at 800 rpm / min for 3 minutes. The pellet was passed through a 100 μm cell strainer and then centrifuged at 1000 rpm for 5 minutes. The pellet was embedded in Matrigel and cultured in organoid culture medium. After digestion with TrypLE, tumor OSCC organoid cells were seeded onto Matrigel.

[0467] The experimental groups were divided into five groups: blank control, TGFβ1 (10 ng / ml), 100 nM isotype-specific control antibody palivizumab + TGFβ1 (10 ng / ml), 100 nM fully human antibody F11 + TGFβ1 (10 ng / ml), and LY2157299 (10 ng / ml) + TGFβ1 (10 ng / ml). After 3 days, the inhibitors were removed from the culture medium. Antibodies and LY were added to the medium, followed by TGFβ1 one hour later. Patient-derived organoids (PDOs) derived from patients with OSCC were treated for 48 hours.

[0468] Tumor buds or satellite clones around the PDO were counted microscopically to assess the biological effect of treatment with TGFβ1 and F11 antibodies or LY2157299 in this model.

[0469] The antibody palivizumab (control antibody) was purchased from Yumab. LY2157299 (galunisertib) was purchased from MedChemExpress NJ, USA. TGFβ1 was purchased from Prospec, Ness-Ziona, Israel. Zang G, Mu Y * , Gao L, Bergh A, Landstrom M. PKCζ facilitates lymphatic metastatic spread of prostate cancer cells in a mice xenograft model. Oncogene 38, 22, p 4215-4231 Used as previously described in 2019.

[0470] Statistical analysis: The number of tumors or satellite clones emerging from the primary PDOs was counted as the budding rate. Raw data were analyzed using Graphpad Prism 9 software, and statistical analysis was performed using one-way ANOVA. * p<0.05, ** p<0.01, *** p<0.001, **** p<0.0001. Data are presented as mean±SD.

[0471] Results and Discussion We performed immunohistochemical staining of TbRI in tissue sections from patients with OSCC and evaluated the results, grouping them into three categories: weak, moderate, and strong, as shown in Figure 37. We then examined the expression of TbRI in OSCC tissue sections from patients and investigated the correlation between tumor grade and TbRI expression, as shown in Figure 38. As shown in the stapled diagram in the right part of Figure 38, there was a significant increase in TbRI expression in tumors with higher grades.

[0472] We next investigated whether treatment of OSCC patient-derived organoids grown in Matrigel with TGFb1 could stimulate tumor cell migration (sprouting) into Matrigel. As expected, a significant sprouting response was observed when treated with TGFb1 for 48 hours in the presence of an isotype-specific control antibody. Treatment with 100 nM F11 antibody and the TbRI kinase inhibitor galunisertib (LY2109761) inhibited TGFb1-induced sprouting in both cases, as shown in Figures 39a and 39b. From these data, we conclude that high TbRI expression in tissue sections from patients with OSCC correlates with the higher malignancy seen in more aggressive forms of cancer. Furthermore, treatment with F11 antibody and galunisertib inhibited sprouting in OSCC patient-derived organoids grown in Matrigel, demonstrating that these compounds can inhibit tumor growth.

[0473] Table 20 - Sequence Listing [Table 29-1]

[0474] (Continued from Table 20) [Table 29-2]

[0475] (Continued from Table 20) [Table 29-3]

[0476] (Continued from Table 20) [Table 29-4]

[0477] (Continued from Table 20) [Table 29-5]

[0478] (Continued from Table 20) [Table 29-6]

[0479] (Continued from Table 20) [Table 29-7]

[0480] (Continued from Table 20) [Table 29-8]

[0481] (Continued from Table 20) [Table 29-9]

[0482] (Continued from Table 20) [Table 29-10]

[0483] (Continued from Table 20) [Table 29-11]

[0484] (Continued from Table 20) [Table 29-12]

[0485] (Continued from Table 20) [Table 29-13]

[0486] (Continued from Table 20) [Table 29-14]

[0487] (Continued from Table 20) [Table 29-15]

[0488] (Continued from Table 20) [Table 29-16]

[0489] (Continued from Table 20) [Table 29-17]

[0490] (Continued from Table 20) [Table 29-18]

[0491] (Continued from Table 20) [Table 29-19]

[0492] (Continued from Table 20) [Table 29-20]

[0493] (Continued from Table 20) [Table 29-21]

[0494] (Continued from Table 20) [Table 29-22]

[0495] (Continued from Table 20) [Table 29-23]

[0496] (Continued from Table 20) [Table 29-24]

[0497] (Continued from Table 20) [Table 29-25]

[0498] (Continued from Table 20) [Table 29-26]

[0499] (Continued from Table 20) [Table 29-27]

[0500] (Continued from Table 20) [Table 29-28]

[0501] (Continued from Table 20) [Table 29-29]

[0502] (Continued from Table 20)

Table 29 - 30

[0503] References 1. Coffey, R. J. Jr. et al. Growth modulation of mouse keratinocytes by transforming growth factors. Cancer Res. 48, 1596 - 1602 (1988). 2. Akhurst and Hata Nature Reviews Drug Discovery 2012 Vol 11, p. 790. 3. Gudey et al., 2014. Science Signalling, 7 Jan 2014, Vol 7, Issue 307, p. ra2 4. Mu Y, Sundar R, Thakur N, Ekman M, Kumar S, Yakymovych M, Dimitrou L, Hermansson A, Bengoechea - Alonso MT, Ericsson J, Heldin C - H, Landstrom M. TRAF6 ubiquitinates TGF - beta type I receptor to promote its cleavage and nuclear translocation in cancer. Nature Communications 2, 2011, 330 DOI: i.10.1038 / ncomms1332. 5. Song J, Mu Y, Li C, Bergh A, Miaczynska M, Heldin CH, Landstrom M. APPL proteins promote TGFβ - induced nuclear transport of the TGFβ type I receptor intracellular domain. Oncotarget Nov 18, 2015. doi:10.18632 / oncotarget.6346 6. Zang et al., Oncogene. 2019;38(22):4215 - 4231. 7.Colak S and ten Dijke P.Targeting TGF-βSignaling in Cancer.Trends in Cancer January 2017,Vol.3,No.1。 8.Derynck R,Turley SJ,Akhurst RJ.Nat Rev Clin Oncol.2021 Jan;18(1):9-34.doi:10.1038 / s41571-020-0403-1.TGFβbiology in cancer progression and immunotherapy。 9.Battle E,Massague J.Transforming Growth Factor-βSignaling in Immunity and Cancer.Immunity.2019 Apr 16;50(4):924-940.doi:10.1016 / j.immuni.2019.03.024

Claims

1. An antibody or antigen-binding fragment thereof that specifically binds to transforming growth factor beta receptor I (TGFβR1), wherein the antibody or fragment binds to a region of TGFβR1 that includes amino acid residues 126-133.

2. The antibody or antigen-binding fragment thereof of claim 1 , wherein the antibody or fragment reduces and / or inhibits proteolytic cleavage of TGFβR1.

3. The antibody or antigen-binding fragment thereof of claim 1 or 2, wherein the antibody or fragment reduces and / or inhibits the translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of a cell.

4. The antibody or fragment has an IC ５０ The antibody or antigen-binding fragment thereof according to any one of claims 1 to 3, which reduces and / or inhibits the translocation of the intracellular domain (ICD) of TGFβR1 into the nucleus of a cell.

5. The equilibrium dissociation constant (Kd) between the antibody or antigen-binding fragment thereof and TGFβR1 is 1×10 －８ The antibody or antigen-binding fragment thereof according to any one of claims 1 to 4, wherein the nucleotide sequence is (M) or less.

6. the antibody or fragment a) the heavy chain complementarity determining region 1 (HCDR1) sequence of the VH domain of SEQ ID NO: 4, or a variant of said HCDR1 sequence comprising up to two amino acid substitutions, and / or b) the heavy chain complementarity determining region 2 (HCDR2) sequence of the VH domain of SEQ ID NO: 4, or a variant of said HCDR2 sequence comprising up to three amino acid substitutions, and / or c) The antibody or antigen-binding fragment thereof according to any one of claims 1 to 5, comprising the heavy chain complementarity determining region 3 (HCDR3) sequence of the VH domain of SEQ ID NO: 4, or a variant of said HCDR3 sequence comprising up to five amino acid substitutions.

7. the antibody or fragment i. HCDR1 comprising the sequence of SEQ ID NO: 6, or a variant thereof comprising up to two amino acid substitutions, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 8, or a variant thereof comprising up to three amino acid substitutions, and / or iii. The antibody or antigen-binding fragment thereof of any one of claims 1 to 6, comprising an HCDR3 comprising the sequence of SEQ ID NO: 10, or a variant thereof comprising up to five amino acid substitutions.

8. the antibody or fragment i. HCDR1 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or ii. the HCDR2 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or iii. The antibody or antigen-binding fragment thereof of any one of claims 1 to 7, comprising an HCDR3 of any one of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20.

9. the antibody or fragment a) the light chain complementarity determining region 1 (LCDR1) sequence of the VL domain of SEQ ID NO: 12, or a variant of said LCDR1 sequence comprising up to three amino acid substitutions, and / or b) the light chain complementarity determining region 2 (LCDR2) sequence of the VL domain of SEQ ID NO: 12, or a variant of said LCDR2 sequence comprising up to three amino acid substitutions, and / or c) The antibody or antigen-binding fragment thereof according to any one of claims 1 to 8, comprising the light chain complementarity determining region 3 (LCDR3) sequence of the VL domain of SEQ ID NO: 12, or a variant of said LCDR3 sequence comprising at most one amino acid substitution.

10. the antibody or fragment i. LCDR1 comprising the sequence of SEQ ID NO: 14, or a variant thereof comprising up to three amino acid substitutions, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 16, or a variant thereof comprising up to three amino acid substitutions, and / or iii. The antibody or antigen-binding fragment thereof of any one of claims 1 to 9, comprising an LCDR3 comprising the sequence of SEQ ID NO: 18, or a variant thereof comprising at most one amino acid substitution.

11. the antibody or fragment i. LCDR1 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or ii. the LCDR2 of any of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20; and / or iii. The antibody or antigen-binding fragment thereof of any one of claims 1 to 10, comprising an LCDR3 of any one of antibodies YU772-F11, YU772-G12, YU771-A01, YU772-D10, YU771-E01, YU771-B12, YU772-G04-VH / YU771-A09VL, YU772-H05, YU772-D10VH / YU772-C01VL, YU772-A11, and antibody 19 shown in Table 20.

12. the antibody or fragment i. HCDR1 comprising the sequence of SEQ ID NO: 126, and / or ii. HCDR2 comprising the sequence of SEQ ID NO: 128, and / or iii. A VH domain comprising an HCDR3 comprising the sequence of SEQ ID NO: 130; i. LCDR1 comprising the sequence of SEQ ID NO: 134, and / or ii. LCDR2 comprising the sequence of SEQ ID NO: 136, and / or iii. A VL domain comprising an LCDR3 comprising the sequence of SEQ ID NO:

138.

13. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 12, wherein the antibody or fragment comprises a heavy chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 4, or a heavy chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO: 4, and / or the antibody or fragment comprises a light chain variable domain amino acid sequence comprising the amino acid sequence of SEQ ID NO: 12, or a light chain variable domain amino acid sequence that is at least 80% identical to SEQ ID NO:

12.

14. 14. The antibody or antigen-binding fragment thereof of any one of claims 1 to 13, wherein the antibody or fragment comprises a heavy chain variable domain amino acid sequence having the amino acid sequence of SEQ ID NO: 124, and / or the antibody or fragment comprises a light chain variable domain amino acid sequence having the amino acid sequence of SEQ ID NO:

132.

15. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 14, wherein the antibody or fragment binds to a region comprising amino acid residues 118 to 133 of TGFβR1.

16. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 15, wherein the antibody has a heavy chain constant region that is IgG.

17. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, wherein the antibody has a heavy chain constant region that is IgG1.

18. 18. The antibody or antigen-binding fragment thereof according to any one of claims 1 to 17, having a heavy chain amino acid sequence of SEQ ID NO: 20 and a light chain amino acid sequence of SEQ ID NO:

22.

19. The antibody or antigen-binding fragment thereof of any one of claims 1 to 18, further comprising a detectable moiety.

20. 20. The antibody or antigen-binding fragment thereof of claim 19, wherein the detectable moiety comprises a fluorophore, an enzyme, or a radioisotope.

21. 21. The antibody or antigen-binding fragment thereof of any one of claims 1 to 20 conjugated to a therapeutic moiety, such as a cytotoxin, a chemotherapeutic drug, an immunosuppressant, or a radioisotope.

22. 22. An antibody or antigen-binding fragment thereof, optionally described in any one of claims 1 to 21, that specifically binds to transforming growth factor beta receptor I (TGFβR1), wherein the antibody or fragment binds to a region comprising amino acid residues 126 to 133 of the TGFβR1, and the antibody or fragment competes with any of the antibodies of any one of claims 1 to 21 for binding to said region of TGFβR1.

23. A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of any one of claims 1 to 22 and a pharmaceutically acceptable carrier, excipient, or diluent.

24. 23. A method of formulating an antibody or antigen-binding fragment thereof into a pharmaceutical composition, the method comprising mixing the antibody or antigen-binding fragment thereof of any one of claims 1 to 22 with a pharmaceutically acceptable carrier, excipient, or diluent.

25. An antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, or a pharmaceutical composition according to claim 23, for use in medicine.

26. The antibody or antigen-binding fragment thereof of any one of claims 1 to 22, or the pharmaceutical composition of claim 23, for use in the treatment and / or prevention of a disease or disorder mediated by proteolytic cleavage of TGFβR1.

27. A method for treating and / or preventing a disease or disorder mediated by proteolytic cleavage of TGFβR1 in a subject, the method comprising administering to the subject an antibody or antigen-binding fragment thereof described in any one of claims 1 to 22, or a pharmaceutical composition described in claim 23.

28. Use of the antibody or antigen-binding fragment thereof of any one of claims 1 to 22, or the pharmaceutical composition of claim 23, in the manufacture of a medicament for treating and / or preventing a disease or disorder mediated by proteolytic cleavage of TGFβR1.

29. 27. The antibody or antigen-binding fragment thereof for use according to claim 26, or the pharmaceutical composition for use according to claim 26, or the method according to claim 27, or the use according to claim 28, wherein the disease or disorder is cancer.

30. 27. The antibody or antigen-binding fragment thereof for use according to claim 26, or the pharmaceutical composition for use according to claim 26, or the method according to claim 27, or the use according to claim 28, wherein the disease is fibrosis.

31. The antibody or antigen-binding fragment thereof for use according to any one of claims 26, 29 and 30, or the pharmaceutical composition for use according to any one of claims 26, 29 and 30, or the method of any one of claims 27, 29 and 30, or the use according to any one of claims 28 to 30, wherein at least one further therapeutic agent is administered to the subject.

32. 1. A method for identifying an agent for use in the treatment and / or prevention of a disease or disorder mediated by proteolytic cleavage of TGFβR1, said method comprising: providing TGFβR1 or a portion or variant thereof, wherein said portion or variant comprises amino acid residues 126-133 of TGFβR1; Providing a candidate drug; determining whether the candidate agent reduces and / or inhibits proteolytic cleavage of TGFβR1 or said portion or variant thereof, in a region comprising amino acid residues 126-133 of TGFβR1.

33. 33. The method of claim 32, wherein the candidate agent is tested for efficacy in an animal model of cancer.

34. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22 for reducing and / or inhibiting the proteolytic cleavage of TGFβR1 and / or for reducing and / or inhibiting the translocation of the intracellular domain (ICD) of TGFβR1 to the nucleus of a cell.

35. A kit comprising the antibody or antigen-binding fragment thereof according to any one of claims 1 to 22, or the pharmaceutical composition according to claim 21.

36. A nucleic acid molecule comprising a nucleotide sequence encoding the antibody or antigen-binding fragment thereof of any one of claims 1 to 22.

37. 37. The nucleic acid molecule of claim 36, comprising a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO: 3 and / or a nucleotide sequence that is at least 80% identical to the sequence of SEQ ID NO:

11.

38. A vector comprising the nucleic acid molecule of claim 36 or 37.

39. 39. A host cell comprising a nucleic acid according to claim 36 or 37 or a vector according to claim 38.

40. 40. A method for producing the antibody or antigen-binding fragment thereof of any one of claims 1 to 22, said method comprising expressing the nucleic acid molecule of claim 36 or 37, optionally culturing the host cell of claim 39, and optionally further comprising isolating the antibody or antigen-binding fragment thereof from the host cell.

41. 10. An antibody or antigen-binding fragment thereof, pharmaceutical composition, method, use, kit, nucleic acid molecule, vector, or host cell substantially as herein described with reference to the accompanying description, examples, and drawings.

Images