Therapeutic oligonucleotide-containing pharmaceutical compositions and administration regimens using the same

Therapeutic oligonucleotides, particularly double-stranded RNAi agents, effectively modulate LPA expression to reduce Lp(a) levels, addressing the need for safe and effective treatments with minimal adverse events and sustained efficacy.

JP2026502533APending Publication Date: 2026-01-23ELI LILLY & CO
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
JP2025540758
Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
Priority Date
2023-01-13
Filing Date
2024-01-12
Publication Date
2026-01-23

AI Technical Summary

Technical Problem

There is a need for safe and effective formulations comprising therapeutic oligonucleotides that modulate LPA expression to attenuate, prevent, and/or treat diseases, disorders, and/or conditions associated with LPA expression, while maintaining an overall acceptable benefit/risk profile for the individual.

Method used

The use of therapeutic oligonucleotides, particularly double-stranded RNAi agents, administered in specific doses and formulations to modulate LPA expression, which can be packaged for intravenous or subcutaneous delivery, maintaining product stability and other desirable attributes, and administered through defined regimens to reduce LPA-related conditions.

Benefits of technology

The formulations rapidly reduce Lp(a) levels by more than 90% within 14 days and sustain this reduction for up to 48 weeks with minimal adverse events, providing limited exposure periods and sustained therapeutic effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026502533000001
    Figure 2026502533000001
  • Figure 2026502533000002
    Figure 2026502533000002
  • Figure 2026502533000003
    Figure 2026502533000003
Patent Text Reader

Abstract

Pharmaceutical compositions are disclosed that include a double-stranded RNAi agent or a pharmaceutically acceptable salt thereof in water that modulates LPA expression. Dosages and administration regimens for such RNAi agents are also disclosed, including monthly to yearly administration of a dose of about 4 mg to about 608 mg.
Need to check novelty before this filing date? Find Prior Art

Description

[Technical Field]

[0001] (Reference to electronically submitted sequence listing)

[0001] The present disclosure is filed with a Sequence Listing in ST.26 XML format. The Sequence Listing is provided as a file named "30459_US_PRI" created on December 5, 2022, and is 28 kilobytes (kb) in size. The Sequence Listing information in ST.26 XML format is incorporated herein by reference in its entirety.

[0002] FIELD OF THE INVENTION The present disclosure relates generally to biology and medicine, and more specifically to pharmaceutical compositions, such as formulations, having therapeutic oligonucleotides (e.g., ds RNAi agents) that modulate apolipoprotein(a) gene (LPA) expression, and to administration regimens therefor to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression. [Background technology]

[0003] Lipoprotein(a) (Lp(a)) is a heterogeneous low-density lipoprotein (LDL)-like particle containing a lipid core with apolipoprotein B-100 (ApoB) and apolipoprotein(a) (Apo(a)), in which Apo(a) is linked to ApoB via disulfide bonds. LPA is expressed primarily in the liver and is restricted to humans and Old World non-human primates. Lp(a) levels in humans are genetically determined and do not change significantly with diet, exercise, or other lifestyle changes.

[0004] Normal Lp(a) levels range from 0.1 mg / dL to 25 mg / dL, with approximately 25% of the U.S. population having Lp(a) levels above 30 mg / dL. Analysis of Lp(a) levels in multiple studies suggests that high levels of Lp(a) are an independent risk factor for cardiovascular disease, stroke, and other related disorders. Lowering both Lp(a) and LDL levels using therapeutic lipoprotein apheresis in hyperlipidemic individuals has been observed to significantly reduce cardiovascular events.

[0005] In view of this, there is a need for safe and effective formulations comprising therapeutic oligonucleotides that modulate LPA expression, as well as administration regimens using the same to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression, while also maintaining an overall acceptable benefit / risk profile for the individual. Summary of the Invention

[0006] To address this need, the present disclosure describes doses of therapeutic oligonucleotides that modulate LPA expression, which can be from about 4 mg to about 608 mg. In some examples, the therapeutic oligonucleotide is an RNAi agent, particularly a double-stranded (ds) RNAi agent. In particular examples, the ds RNAi agent has a sense strand and an antisense strand, where the sense strand comprises the nucleotide sequence of SEQ ID NO: 1 or 3, and the antisense strand comprises the nucleotide sequence of SEQ ID NO: 2 or 4. Such doses can be used to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression.

[0007] In some examples, the dose can be about 4 mg to about 608 mg. In other examples, the dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0008] Furthermore, to facilitate administration of the doses herein to individuals in need thereof, the present disclosure describes pharmaceutical compositions, such as formulations, comprising at least the ds RNAi agent herein or a pharmaceutically acceptable salt thereof that modulates LPA expression. Such formulations can be used to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression. For example, the formulations can be used to reduce the risk of major adverse cardiovascular events (MACE) in individuals with or at risk for atherosclerotic cardiovascular disease (ASCVD) and / or high Lp(a) levels (e.g., 125 nmol / L or greater; 50 mg / dL), or individuals at risk for a first cardiovascular (CV) event. Furthermore, such formulations can be packaged, for example, for intravenous (IV) or subcutaneous (SC) administration as described herein while maintaining product stability and other desirable attributes.

[0009] In particular, described herein are pharmaceutical compositions comprising a ds RNAi agent or a pharmaceutically acceptable salt thereof in water (H2O).

[0010] In some examples, the ds RNAi agent can be at a concentration of about 100 mg / mL to about 300 mg / mL, hi other examples, the ds RNAi agent can be at a concentration of about 150 mg / mL to about 170 mg / mL, particularly about 160 mg / mL, or about 190 mg / mL to about 210 mg / mL, particularly about 200 mg / mL.

[0011] In some examples, the formulation may have a pH of about 6.0 to about 8.0, and in other examples, the formulation may have a pH of about 7.0.

[0012] In some instances, the pharmaceutical compositions herein may be preservative-free.

[0013] In some instances, the pharmaceutical compositions herein can be diluted with about 0.9% NaCl injection to achieve lower dosages.

[0014] In one particular example, a pharmaceutical composition comprises a ds RNAi agent that modulates LPA expression, the ds RNAi agent having a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2, in a concentration of about 150 mg / mL to about 170 mg / mL, particularly about 160 mg / mL, in HO at pH 7.0, and the pharmaceutical composition does not contain a preservative.

[0015] In another example, a pharmaceutical composition comprises a ds RNAi agent that modulates LPA expression, the ds RNAi agent having a sense strand having a nucleotide sequence of SEQ ID NO: 1 and an antisense strand having a nucleotide sequence of SEQ ID NO: 2, in a concentration of about 190 mg / mL to about 210 mg / mL, particularly about 200 mg / mL, in HO at pH 7.0, and the pharmaceutical composition does not contain a preservative.

[0016] In one particular example, a pharmaceutical composition comprises a ds RNAi agent that modulates LPA expression, the ds RNAi agent having a sense strand having the nucleotide sequence of SEQ ID NO: 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 4, in a concentration of about 150 mg / mL to about 170 mg / mL, particularly about 160 mg / mL, in HO at pH 7.0, and the pharmaceutical composition does not contain a preservative.

[0017] In another specific example, a pharmaceutical composition comprises a ds RNAi agent that modulates LPA expression, the ds RNAi agent having a sense strand having a nucleotide sequence of SEQ ID NO: 3 and an antisense strand having a nucleotide sequence of SEQ ID NO: 4, in a concentration of about 190 mg / mL to about 210 mg / mL, particularly about 200 mg / mL, in HO at pH 7.0, and the pharmaceutical composition does not contain a preservative.

[0018] The present disclosure also describes dosing regimens and methods for attenuating, preventing, and / or treating diseases, disorders, and / or conditions associated with LPA expression, such methods comprising administering to an individual in need thereof a first dose of a ds RNAi agent that modulates LPA expression or a pharmaceutical composition thereof, such as a formulation herein, wherein the dose can be from about 4 mg to about 608 mg.

[0019] In some examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2. In other examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 4.

[0020] In some examples, the first dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0021] In some examples, the method includes administering one or more subsequent doses (i.e., a second, third, fourth, fifth, and subsequent doses) about every month (Q1M), about every three months (Q3M), about every six months (Q6M), about every nine months (Q9M), or about every twelve months (Q12M) from the first dose (or from the dose preceding any other subsequent dose), wherein the one or more subsequent doses can be from about 4 mg to about 608 mg.

[0022] In some examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0023] In some instances, one or more subsequent doses may be the same as the first dose. In other instances, one or more subsequent doses may be different from the first dose. In yet other instances, the second dose may be the same as other subsequent doses (but all different from the first dose). In yet other instances, the second dose may be different from other subsequent doses (but not necessarily all different from the first dose).

[0024] In one particular example, the second dose can be administered about 1 month, about 3 months, about 6 months, about 9 months, or about 12 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q6M, about Q9M, or about Q12M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q6M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q12M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 12 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q12M from the second dose or any subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and the third dose can be administered about 6 months after the second dose, and any other subsequent dose (i.e., the fourth, fifth, or subsequent dose) can be administered about Q12M from the third dose or any subsequent previous dose.

[0025] Alternatively, the present disclosure describes a method of reducing LPA expression, such method comprising administering to an individual in need thereof a first dose of a ds RNAi agent that modulates LPA expression or a pharmaceutical composition thereof, such as a formulation herein, wherein the dose can be from about 4 mg to about 608 mg.

[0026] In some examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2. In other examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 4.

[0027] In some examples, the first dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0028] In some examples, the method includes administering one or more subsequent doses (i.e., second, third, fourth, fifth, and subsequent doses) about every Q1M, about every Q3M, about every Q6M, about every Q9M, or about every Q12M after the first dose (or from the previous dose, in the case of the third, fourth, fifth, and subsequent doses), wherein the one or more subsequent doses can be from about 4 mg to about 608 mg.

[0029] In some examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0030] In some instances, one or more subsequent doses may be the same as the first dose. In other instances, one or more subsequent doses may be different from the first dose. In yet other instances, the second dose may be the same as other subsequent doses (but all different from the first dose). In yet other instances, the second dose may be different from other subsequent doses (but not necessarily all different from the first dose).

[0031] In one particular example, the second dose can be administered about 1 month, about 3 months, about 6 months, or about 12 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q6M, Q9M, or about Q12M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q6M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q12M from the second dose or the subsequent previous dose. In another particular example, the second dose can be administered about 12 months after the first dose, and any other subsequent dose (i.e., the third, fourth, fifth, or subsequent dose) can be administered about Q12M from the second dose or any subsequent previous dose. In another particular example, the second dose can be administered about 6 months after the first dose, and the third dose can be administered about 6 months after the second dose, and any other subsequent dose (i.e., the fourth, fifth, or subsequent dose) can be administered about Q12M from the third dose or any subsequent previous dose.

[0032] In any of the above methods, administration can be by IV or SC administration.

[0033] In any of the above methods, the individual may be identified as having a disease, disorder, and / or condition associated with LPA expression. In some instances, the individual may be at risk for a disease, disorder, and / or condition associated with LPA expression, particularly a major CV event, including myocardial infarction (MI), stroke, coronary revascularization, peripheral vascular events, and CV death. In other instances, the individual may be an adult with elevated Lp(a) and established CV disease. In yet other instances, the individual may be an adult at risk for a first CV event, optionally with elevated Lp(a).

[0034] In any of the above methods, the diseases, disorders, and / or conditions associated with LPA expression include atherosclerosis, calcific aortic valve stenosis (CAVS), cardiometabolic disease, coronary revascularization, CV mortality, cerebrovascular disease, chronic kidney disease, coronary heart disease, dyslipidemia, heart failure, cardiovascular events including MI and stroke, and / or peripheral vascular disease.

[0035] In any of the above methods, the individual may have an Lp(a) level of at least about 75 nmol / L or greater. In some examples, the individual may have an Lp(a) level of at least about 100 nmol / L, about 125 nmol / L, about 150 nmol / L, about 175 nmol / L, or about 200 nmol / L prior to administration of the first dose.

[0036] In any of the above methods, the individual may have a single-nucleotide polymorphism (SNP) in LPA selected from rs10455872 and rs3798220.

[0037] The present disclosure further describes the compositions herein for use as pharmaceuticals.

[0038] The present disclosure further describes the compositions herein for use in treating diseases, disorders and / or conditions associated with LPA expression.

[0039] The present disclosure further describes products comprising the formulations herein. In some examples, the products are single-use or multi-use vials. In some examples, the products are pre-filled syringes. In some examples, the products are automatic injection devices. In some examples, the products are continuous perfusion pumps, particularly subcutaneous infusion pumps.

[0040] The advantages of the doses, regimens, methods and uses herein are that they provide limited exposure periods, sustained therapeutic effects and fewer adverse events (AEs), which may also improve acceptance and compliance given the less frequent administration required. DETAILED DESCRIPTION OF THE INVENTION

[0041] overview Lp(a) is considered a strong genetic risk factor for coronary heart disease. Genetic variation in LPA, which influences the level of Apo(a) production, is strongly correlated with both plasma Lp(a) levels and the risk of MI.

[0042] Mechanistically, elevated plasma Lp(a) levels may increase the risk of cardiovascular disease (CVD) through its atherogenic, inflammatory, and possibly prothrombotic effects. Three non-mutually exclusive mechanisms have been proposed for the role of Lp(a) in CVD: (1) Lp(a) may accelerate atherogenesis as a result of intimal deposition of Lp(a), cholesterol, or oxidized phospholipids, (2) Lp(a) contains oxidized phospholipids that are proinflammatory, and (3) Apo(a) shares structural similarity with plasminogen (PLG) and plasmin but lacks fibrinolytic activity, potentially reducing fibrinolysis by competing for fibrin binding.

[0043] WO 2022 / 032288 describes ds RNAi agents (e.g., LPA-3291-M1) that can be used to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression (i.e., to reduce levels of LPA mRNA and Apo(a), thereby reducing Lp(a) activity / levels).

[0044] Surprisingly, doses of ds RNAi agents and formulations containing same are shown herein to rapidly reduce Lp(a) after a single dose (e.g., within about 4 to about 8 days, depending on the dose), reducing Lp(a) by more than 90% within about 14 days after a single dose, and sustaining this reduction for more than 24 weeks after a single dose. At higher doses, ds RNAi agents and formulations containing same reduce Lp(a) by 70% to 90% for up to 48 weeks. Furthermore, the doses used herein did not show a dose-dependent change in PLG activity.

[0045] Abbreviations and Definitions Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of this invention, the preferred methods and materials are described herein.

[0046] In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one element is present, unless the context clearly requires that there is one and only one element. Thus, the indefinite article "a" or "an" normally means "at least one."

[0047] Furthermore, the use of "including" and other forms such as "including but not limited to," "include," "includes," and "included" is not limiting.

[0048] Certain abbreviations used herein are as follows: "A2AP" refers to alpha 2-antiplasmin, "AE" refers to adverse event, "Apo(a)" refers to apolipoprotein(a), "ApoB" refers to apolipoprotein B-100, "ASCVD" refers to atherosclerotic cardiovascular disease, "AUC" refers to area under the plasma concentration versus time curve, "bp" refers to base pair(s), "CAC" refers to coronary artery calcium, "CAD" refers to coronary artery disease, "CAVS" refers to calcific aortic stenosis (AVS), "CK" refers to creatine kinase, and "C" refers to creatine kinase. max " refers to peak plasma concentration, "CVD" refers to cardiovascular disease, "ECG" refers to electrocardiogram, "HCl" refers to hydrochloric acid, "H2O" refers to water, "hsCRP" refers to high-sensitivity C-reactive protein, "IV" refers to intravenous or intravenously, "LDL" refers to low-density lipoprotein, "LDL-C" refers to low-density lipoprotein cholesterol, "LPA" refers to apolipoprotein(a) gene, "Lp(a)" refers to lipoprotein(a) protein, "MACE" refers to major adverse cardiovascular event(s), "MI" refers to myocardial infarction, and "mRNA" refers to messenger ribonucleic acid (mRNA). "NaOH" refers to sodium hydroxide, "NOAEL" refers to no observed adverse effect level, "NOEL" refers to no observed adverse effect level, "nt" refers to nucleotide(s), "PAD" refers to peripheral arterial disease, "Pal-1" refers to plasminogen activator inhibitor-1, "PD" refers to pharmacodynamics, "PK" refers to pharmacokinetics, "PLG" refers to plasminogen, "PO" refers to phosphodiester, "PS" refers to phosphorothioate, "RISC" refers to RNA-induced silencing complex, "SAE" refers to serious adverse event, "SC" refers to subcutaneous or subcutaneous, "SNP" refers to single nucleotide polymorphism(s), and "t 1 / 2 " refers to half-life, "TC" refers to total cholesterol, "TEAE" refers to treatment-emergent adverse events, "TG" refers to triglyceride(s), "tPA" refers to tissue plasminogen activator, and "t max" refers to time of maximum observed concentration and "WFI" refers to water for injection.

[0049] Certain definitions used herein are defined as follows: As used herein, "about" means within a statistically significant range of a value or values, such as, for example, a specified activity, concentration, dose, length, molecular weight, pH, sequence identity, time frame, temperature, volume, etc. Such values ​​or ranges can be within an order of magnitude, typically within 20%, more typically within 10%, and even more typically within 5% of a given value or range. The allowable variation encompassed by "about" will depend on the particular system under study and can be readily appreciated by one of ordinary skill in the art.

[0050] As used herein, "administer," "administering," "administration," and the like refer to providing a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) to an individual in a pharmacologically useful manner (e.g., to attenuate, prevent, and / or treat a disease, disorder, and / or condition in the individual).

[0051] As used herein, "at risk for a first cardiovascular event" or "at risk for a first CV event" means (1) an individual with documented coronary artery disease (CAD), carotid stenosis, or peripheral artery disease (PAD) without a history of an event or prior revascularization, or (2) an individual with known familial hypercholesterolemia. Alternatively, "at risk for a first cardiovascular event" or "at risk for a first CV event" refers to an individual with at least three high-risk factors selected from elevated coronary artery calcium (CAC; e.g., 100 or greater for individuals assigned female at birth and younger than age 65, or greater than 300 for any individual), current smoking, diabetes, older age (e.g., 70 years or older for individuals assigned female at birth, or 65 years or older for individuals assigned male at birth), renal disease, hypertension, high-sensitivity C-reactive protein (hsCRP; e.g., 2 mg / L or greater), premature ASCVD, and a family history of hyperlipidemia (e.g., low-density lipoprotein cholesterol (LDL-C) 100 mg / dL or greater). The individual may also have an elevated Lp(a) level (greater than 75 nmol / L, e.g., 175 nmol / L or greater).

[0052] As used herein, "attenuate," "attenuating," "attenuation," and the like mean that, upon administration of a substance (when compared to an appropriate control), a qualitative or quantitative measure of a sign and / or symptom and / or biomarker of a given disease, disorder, and / or condition may be reduced in an individual by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. There may be overlap between "attenuating" and "preventing," although the latter contemplates a more rapid (i.e., less subtle) reduction in signs and / or symptoms and / or biomarkers. For example, a disease, disorder, and / or condition is "attenuated" when the intensity and / or frequency of existing signs and / or symptoms and / or biomarkers are reduced, but may not completely disappear.

[0053] As used herein, "chemical stability" refers to the ability of a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) to resist changes in composition that may occur in the composition due to possible chemical reactions, such as aggregation, fragmentation, hydrolysis, isomerization, oxidation, and polymerization.

[0054] As used herein, "diseases, disorders and / or conditions associated with LPA expression" and the like refer to atherosclerosis, CAVS, cardiometabolic disease, coronary revascularization, CV mortality, cerebrovascular disease, chronic kidney disease, coronary heart disease, dyslipidemia, heart failure, cardiovascular events including MI and stroke, and / or peripheral vascular disease.

[0055] As used herein, "dose" or "doses" refers to an amount of a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) administered to an individual in a discrete amount at a particular time. When used in connection with terms such as dose, doses, administration, etc., "adjustment" or "adjusting" refers to any decrease or increase in the amount of a previously administered dose. When used in connection with terms such as dose, doses, administration, etc., "regimen" refers to a set of guidelines for determining and administering one or more doses and / or adjustments thereto.

[0056] As used herein, "effective amount" refers to an amount, concentration, or dosage of one or more substances (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) that, when administered in single or multiple doses to an individual in need thereof, produces a desired effect in such individual under diagnosis or treatment (i.e., can produce a clinically measurable difference in the individual's condition). An effective amount can be readily determined by one of ordinary skill in the art by the use of known techniques and by observing results obtained under similar circumstances. In determining an effective amount for an individual, numerous factors are taken into consideration, including, but not limited to, the individual's species, its size, age, and general health, the particular disease, disorder, and / or condition involved, the extent or involvement or severity of the disease, disorder, and / or condition, the individual's response, the particular active ingredient administered, the mode of administration, the bioavailability characteristics of the administered preparation, the selected dosing regimen, the use of concomitant therapeutic agent(s), and other relevant circumstances.

[0057] As used herein, "individual" means any mammal, including cats, dogs, mice, rats, and primates (human and non-human), particularly humans. Furthermore, "participant," "patient," or "subject" may be used interchangeably with "individual."

[0058] As used herein, "individual in need thereof" refers to a mammal, such as a human, having a disease, disorder, and / or condition in need of treatment or therapy, including, for example, those listed herein. In particular, preferred individuals to be treated are humans, especially those having or suspected of having a disease, disorder, and / or condition associated with LPA expression.

[0059] As used herein, "medicament" refers to an active ingredient (eg, a ds RNAi agent herein) for treating a disease, disorder and / or condition associated with LPA expression.

[0060] As used herein, "microbiological stability" means the ability of an active ingredient, substance, or product to maintain its sterility when exposed to environmental or other microorganisms.

[0061] As used herein, "modulate," "modulating," "modulation," and the like refer to changing, affecting, or interfering with the function of a system component. For example, the ds RNAi agent herein mediates the degradation of LPA mRNA, thereby modulating LPA expression by causing a reduction in LPA mRNA, a reduction in Apo(a) (level / activity), and / or a reduction in Lp(a) (level / activity).

[0062] As used herein, "nucleotide" refers to an organic compound having a nucleoside (e.g., a nucleic acid base such as adenine, cytosine, guanine, thymine, or uracil, and a pentose sugar such as ribose or 2'-deoxyribose) and a phosphate group. "Nucleotides" can function as monomer units of nucleic acids, such as deoxyribonucleic acid (DNA) oligonucleotides and ribonucleic acid (RNA) oligonucleotides.

[0063] As used herein, "oligonucleotide" refers to a short nucleic acid molecule (eg, less than about 100 nucleotides in length) that can be single-stranded (ss) or ds.

[0064] As used herein, "pharmaceutical formulation" or "formulation" refers to a preparation that is in a form that allows the biological activity of an active ingredient (e.g., a ds RNAi agent herein) to be effective and does not contain additional ingredients that have unacceptable toxicity to the individual to whom the formulation is administered. Such formulations are sterile. "Pharmaceutically acceptable" excipients (e.g., additives, vehicles, etc.) refer to those that can reasonably be administered to an individual to provide an effective dose of the active ingredient used.

[0065] As used herein, "preservative" refers to a compound that essentially reduces bacterial activity in a formulation and can therefore be included in a formulation to facilitate the production of a multi-use formulation. Examples of preservatives include, but are not limited to, octadecyldimethylbenzylammonium chloride, hexamethonium chloride, benzalkonium chloride (a mixture of alkylbenzyldimethylammonium chlorides in which the alkyl groups are long-chain compounds), and benzethonium chloride. Other preservatives include aromatic alcohols such as phenol, butyl, and benzyl alcohol, alkylparabens such as methyl or propylparaben, catechol, resorcinol, cyclohexanol, 3-pentanol, and m-cresol.

[0066] As used herein, "preservative-free" or "preservative free" means a composition, e.g., a pharmaceutical composition (i.e., formulation), that does not contain a preservative.

[0067] As used herein, "prevent," "preventing," "prevention," and the like mean that, upon administration of a substance (when compared to an appropriate control), qualitative or quantitative measures of signs and / or symptoms and / or biomarkers of a given disease, disorder, and / or condition may be reduced in an individual by about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%. There may be overlap between "attenuating" and "preventing," although the latter contemplates a more rapid (i.e., less subtle) reduction in signs and / or symptoms and / or biomarkers. For example, a disease, disorder, and / or condition is "prevented" if it does not manifest. In this manner, some individuals may be considered more likely to develop a disease, disorder, and / or condition (for a variety of reasons, including genetics) and may be put on a preventative regimen (i.e., prophylactic treatment) to avoid the disease, disorder, and / or condition.

[0068] As used herein with respect to a gene (e.g., LPA), "reducing expression" means that the amount or level of an RNA transcript (e.g., LPA mRNA) or protein (e.g., Apo(a)) encoded by the gene is reduced in a cell, cell population, sample, organ, tissue, or individual compared to an appropriate reference (e.g., a reference cell, cell population, sample, organ, tissue, or individual), and / or the amount or level of activity of the gene or its protein is reduced. For example, the act of contacting a cell with a substance (e.g., a ds RNAi agent herein or a pharmaceutical composition herein) can result in a reduction in the amount or level of mRNA, protein, and / or activity (e.g., via degradation of LPA mRNA by the RNAi pathway) compared to a cell not treated with the substance. Similarly, as used herein, "reducing expression" refers to the act of reducing expression of a gene (e.g., LPA). Specifically, as used herein, "reduced LPA expression" means that the amount or level of LPA mRNA, Apo(a) protein and / or Lp(a) concentration and / or activity is reduced in a cell, population of cells, sample or individual compared to an appropriate reference (e.g., a reference cell, population of cells, tissue, organ, system or individual).

[0069] As used herein, "iRNA," "iRNA agent," "RNAi," "RNAi agent," and "RNA interfering agent" refer to an oligonucleotide that contains RNA and mediates targeted cleavage of RNA transcripts through RNA interference, e.g., via the RNA-induced silencing complex (RISC) pathway. An RNAi agent can have a sense strand and an antisense strand, which form a duplex. In some examples, the sense and antisense strands of an RNAi agent can be 21-23 nucleotides in length. Alternatively, the sense and antisense strands can be longer, e.g., 25-36 nucleotides in length, with the longer nucleotide sequence being processed first by the Dicer enzyme. An RNAi agent directs the sequence-specific degradation of mRNA through RNA interference. An RNAi agent attenuates, inhibits, modulates, or reduces gene expression (e.g., LPA expression) in a cell, tissue, organ, system, or individual.

[0070] As used herein with respect to a formulation, "stable" means that the active ingredient therein (e.g., a ds RNAi agent herein) essentially retains its biological activity and / or chemical stability and / or physical stability upon storage. In this way, the formulation essentially retains its chemical and physical stability, and also retains its biological activity upon storage. The storage period can generally be based on the intended shelf life of the formulation.

[0071] As used herein with respect to a composition such as a pharmaceutical composition or formulation, "sterile" means aseptic or free or essentially free of all living microorganisms and spores.

[0072] As used herein, a "strand" refers to a single, contiguous sequence of nucleotides linked together by internucleotide bonds (e.g., a PO bond / linkage or a PS bond / linkage). A strand may have two free ends (e.g., a 5' end and a 3' end).

[0073] As used herein, "treat," "treatment," or "treating" refers to a process that may slow, control, delay, or stop the progression of a disease, disorder, or condition disclosed herein, or may ameliorate the symptoms of the disease, disorder, or condition, but does not necessarily indicate the complete disappearance of all symptoms of the disease, disorder, or condition. Treatment and the like includes the administration of a compound, composition, or formulation described herein for the treatment of a disease, disorder, and / or condition in an individual, particularly a human.

[0074] Dosage and Pharmaceutical Composition Compositions herein include dosages and pharmaceutical compositions, such as formulations, comprising an effective amount of a ds RNAi agent that modulates LPA expression, which can be used to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression.

[0075] With regard to dosage, the dosage of the ds RNAi agent can be about 4 mg to about 608 mg. In some examples, the dosage is about 6 mg to about 606 mg, about 8 mg to about 604 mg, about 10 mg to about 602 mg, about 12 mg to about 600 mg, about 14 mg to about 598 mg, about 16 mg to about 596 mg, about 18 mg to about 594 mg, about 20 mg to about 592 mg, about 22 mg to about 590 mg, about 24 mg to about 588 mg, about 26 mg to about 586 mg, about 28 mg to about 584 mg, about 30 mg to about 582 mg, about 32 mg to about 580 mg, about 34 mg to about 578 mg, about 36 mg to about 576 mg, about 38 mg to about 574 mg, or about 40 mg to about 572mg, about 42mg to about 570mg, about 44mg to about 568mg, about 46mg to about 566mg, about 48mg to about 564mg, about 50mg to about 562mg, about 52mg to about 560mg, about 54mg to about 558mg, about 56mg to about 556mg, about 58mg to about 554mg, about 60mg to about 552mg, about 62mg to about 550mg, about 64mg to about 548mg, about 66mg to about 546mg, about 68mg to about 544mg, about 70mg to about 542mg, about 72mg to about 540mg, about 74mg to about 538mg, about 76mg to about 536mg , about 78mg to about 534mg, about 80mg to about 532mg, about 82mg to about 530mg, about 84mg to about 528mg, about 86mg to about 526mg, about 88mg to about 524mg, about 90mg to about 522mg, about 92mg to about 520mg, about 94mg to about 518mg, about 96mg to about 516mg, about 98mg to about 514mg, about 100mg to about 512mg, about 102mg to about 510mg, about 104mg to about 508mg, about 106mg to about 506mg, about 108mg to about 504mg, about 110mg to about 502mg, about 112mg to about 500mg mg, approximately 114 mg to approximately 498 mg, approximately 116 mg to approximately 496 mg, approximately 118 mg to approximately 494 mg, approximately 120 mg to approximately 492 mg, approximately 122 mg to approximately 490 mg, approximately 124 mg to approximately 488 mg, approximately 126 mg to approximately 486 mg, approximately 128 mg to approximately 484 mg, approximately mg ~ approx. 482 mg, approx. 132 mg ~ approx. 480, approx. 134 mg ~ approx. 478 mg, approx. 136 mg ~ approx. 476 mg, approx. 138 mg ~ approx. 474 mg, approx.Approximately 148mg~464mg, approximately 150~462mg, approximately 152mg~460mg, approximately 154mg~458mg, approximately 156mg~456mg, approximately 158mg~454mg, approximately 160mg~452mg, approximately 162mg~450mg, approximately 164mg~448mg, approximately 166mg~446mg, approximately 168mg~444mg, approximately 170mg~442mg, approximately 172mg~440mg, approximately 174mg~438mg, approximately 176mg~436mg, approximately 178mg~434mg, approximately 180~432mg, approximately 182mg~430mg, approximately 184mg Approximately 428 mg, approximately 186 mg, approximately 426 mg, approximately 188 mg, approximately 424 mg, approximately 190 mg, approximately 422 mg, approximately 192 mg, approximately 420 mg, approximately 194 mg, approximately 418 mg, approximately 196 mg, approximately 416 mg, approximately 198 mg, approximately 414 mg, approximately 200 mg, approximately 412 mg, approximately 202 mg, approximately 410 mg, approximately 204 mg, approximately 408 mg, approximately 206 mg, approximately 406 mg, approximately 208 mg, approximately 404 mg, approximately 210 mg, approximately 402 mg, approximately 212 mg, approximately 400 mg, approximately 214 mg, approximately 398 mg, approximately 216 mg, approximately 396 mg, approximately 218 mg, approximately 394 mg, approximately 220 mg, approximately 3 ... mg ~ approx. 392mg, approx. 222mg ~ approx. 390mg, approx. 224mg ~ approx. 388mg, approx. 226mg ~ approx. 386mg, approx. 228mg ~ approx. 384mg, approx. 230mg ~ approx. 382mg, approx. 232mg ~ approx. 380mg, approx. 234mg ~ approx. 378mg, approx. 236mg ~ approx. 376mg, approx. 238mg ~ approx. 374mg, approx. 240mg ~ approx. 372mg, approx. 242mg ~ approx. 370mg, approx. 244mg ~ approx. 368mg, approx. 246mg ~ approx. 366mg, approx. 248mg ~ approx. 364mg, approx. 250mg ~ approx. 362mg, approx. 252mg ~ approx. 360mg, approx. 254mg ~ approx. 358mg, approx. 2 56mg~approx. 356mg, approx. 258mg~approx. 354mg, approx. 260mg~approx. 352mg, approx. 262mg~approx. 350mg, approx. 264mg~approx. 348mg, approx. 266mg~approx. 346mg, approx. 268mg~approx. 344mg, approx. 270mg~approx. 342mg, approx. 272mg~approx. 340mg, approx. 274mg~approx. 338mg, approx. 276mg~approx. 336mg, approx. 278mg~approx. 334mg, approx. 280mg~approx. 332mg, approx. 282mg~approx. 330mg, approx. 284mg~approx. 328mg, approx. 286mg~approx. 326mg, approx. 288mg~approx. 324mg, approx. 290mg~approx. 322mgIt may be about 292 mg to about 320 mg, about 294 mg to about 318 mg, about 296 mg to about 316 mg, about 298 mg to about 314 mg, about 300 mg to about 312 mg, 302 mg to about 310 mg, about 304 mg to about 308 mg, or about 306 mg to about 310 mg. In other examples, the dose is about 4 mg to about 8 mg, about 8 mg to about 12 mg, about 12 mg to about 16 mg, about 16 mg to about 20 mg, about 20 mg to about 24 mg, about 24 mg to about 28 mg, about 28 mg to about 32 mg, about 32 mg to about 36 mg, about 36 mg to about 40 mg, about 40 mg to about 44 mg, about 44 mg to about 48 mg, about 48 mg to about 52 mg, about 52 mg to about 56 mg, about 56 mg to about 60 mg, about 60 mg to about 64 mg, about 64 mg to about 68 mg, about 68 mg to about 72 mg, about 72 mg to about 76 mg mg, about 76 mg to about 80 mg, about 80 mg to about 84 mg, about 84 mg to about 88 mg, about 88 mg to about 92 mg, about 92 mg to about 96 mg, about 96 mg to about 100 mg, about 100 mg to about 104 mg, about 104 mg to about 108 mg, about 108 mg ~112mg, 112mg~116mg, 116mg~120mg, 120mg~124mg, 124mg~128mg, 128mg~132mg, 132mg~136mg, 136~140mg, 140m g~144mg, 144mg~148mg, 148mg~152mg, 152mg~156mg, 156mg~160mg, 160mg~164mg, 164mg~168mg, 168mg~172mg, 17 2mg to about 176mg, about 176mg to about 180mg, about 180mg to about 184mg, about 184mg to about 188mg, about 188mg to about 192mg, about 192mg to about 196mg, about 196mg to about 200mg, about 200mg to about 204mg, about 2 04mg to about 208mg, about 208mg to about 212mg, about 212mg to about 216mg, about 216mg to about 220mg, about 220mg to about 224mg, about 224mg to about 228mg, about 228mg to about 232mg, about 232mg to about 236mg, About 236mg to about 240mg, about 240mg to about 244mg, about 244mg to about 248mg about 248mg to about 252mg, about 252mg to about 256mg, about 256mg to about 260mg, about 260mg to about 264mg, about 264mg to about 268mg,Approximately 268mg~272mg, approximately 272mg~276mg, approximately 276mg~280mg, approximately 280mg~284mg, approximately 284mg~288mg, approximately 288mg~292mg, approximately 292mg~296mg, approximately 296mg~300mg, approximately 300mg~304mg, approximately 304mg~308mg, approximately 308mg~312mg, approximately 312mg~316mg, approximately 316mg~320mg, approximately 320mg~324mg, approximately 324mg~328mg, approximately 328mg~332mg, approximately 332mg~336mg, approximately 336mg~34mg 0mg, approximately 340mg~344mg, approximately 344mg~348mg, approximately 348mg~352mg, approximately 352mg~356mg, approximately 356mg~360mg, approximately 360mg~364mg, approximately 364mg~368mg, approximately 368mg~372mg, approximately 372mg~376mg, approximately 376mg~380mg, approximately 380mg~384mg, approximately 384mg~388mg, approximately 388mg~392mg, approximately 392mg~396mg, approximately 396mg~400mg, approximately 400mg~404mg, approximately 404mg~408mg, approximately 408mg~ Approximately 412mg, approximately 412mg~approximately 416mg, approximately 416mg~approximately 420mg, approximately 420mg~approximately 424mg, approximately 424mg~approximately 428mg, approximately 428mg~approximately 432mg, approximately 432mg~approximately 436mg, approximately 436mg~approximately 440mg, approximately 440mg~approximately 444mg, approximately 444mg~approximately 448mg, approximately 448mg~approximately 452mg, approximately 452mg~approximately 456mg, approximately 456mg~approximately 460mg, approximately 460mg~approximately 464mg, approximately 464mg~approximately 468mg, approximately 468mg~approximately 472mg, approximately 472mg~approximately 476mg, approximately 476mg~approximately 480mg, approximately 48 0mg~approx. 484mg, approx. 484mg~approx. 488mg~approx. 492mg, approx. 492mg~approx. 496mg, approx. 496mg~approx. 500mg, approx. 500mg~approx. 504mg, approx. 504mg~approx. 508mg, approx. 508mg~approx. 512mg, approx. 512mg~approx. 516mg, approx. 516mg~approx. 520mg, approx. 520mg~approx. 524mg, approx. 524mg~approx. 528mg, approx. 528mg~approx. 532mg, approx. 532mg~approx. 536mg, approx. 536mg~approx. 540mg, approx. 540mg~approx. 544mg, approx. 544mg~approx. 548mg, approx. 548mg~approx. 552mgIt may be about 552 mg to about 556 mg, about 556 mg to about 560 mg, about 560 mg to about 564 mg, about 564 mg to about 568 mg, about 568 mg to about 572 mg, about 572 mg to about 576 mg, about 576 mg to about 580 mg, about 580 mg to about 584 mg, about 584 mg to about 588 mg, about 588 mg to about 592 mg, about 592 mg to about 596 mg, about 596 mg to about 600 mg, about 600 mg to about 604 mg, or about 604 mg to about 608 mg. In certain examples, the dose may be about 4 mg, about 8 mg, about 12 mg, about 16 mg, about 20 mg, about 24 mg, about 28 mg, about 32 mg, about 36 mg, about 40 mg, about 44 mg, about 48 mg, about 52 mg, about 56 mg, about 60 mg, about 64 mg, about 68 mg, about 72 mg, about 76 mg, about 80 mg, about 84 mg, about 88 mg, about 92 mg, about 96 mg, about 100 mg, about 104 mg, about 108 mg, about 112 mg, about 116 mg, about 120 mg, about 124 mg, about 130 mg, about 132 mg, about 134 mg, about 136 mg, about 138 mg, about 140 mg, about 142 mg, about 144 mg, about 146 mg, about 148 mg, about 149 mg, about 150 mg, about 152 mg, about 156 mg, about 152 mg, about 156 mg, about 154 mg, about 156 mg, about 158 ​​mg, about 158 ​​mg, about 160 mg, about 164 mg, about 168 mg, about 172 mg, about 176 mg, about 176 mg, about 180 mg, about 184 mg, about 188 mg, about 192 mg, about 196 mg, about 196 mg, about 200 mg, about 204 mg, about 208 mg, about 212 mg, about 216 mg, about 218 mg, about 218 mg, about 220 mg, about 224 mg, about 228 mg, about 230 mg, about 232 mg, about 23 mg, about 128mg, about 132mg, about 136mg, about 140mg, about 144mg, about 148mg, about 152mg, about 156mg, about 160mg, about 164mg, about 168mg, about 172mg, about 176mg, about 180m g, about 184 mg, about 188 mg, about 192 mg, about 196 mg, about 200 mg, about 204 mg, about 208 mg, about 212 mg, about 216 mg, about 220 mg, about 224 mg, about 228 mg, about 232 mg, about 236 mg, About 240mg, about 244mg, about 248mg, about 252mg, about 256mg, about 260mg, about 264mg, about 268mg, about 272mg, about 276mg, about 280mg, about 284mg, about 288mg, about 292mg, about 286mg, about 300mg, about 304mg, about 308mg, about 312mg, about 316mg, about 320mg, about 324mg, about 328mg, about 332mg, about 336mg, about 340mg, about 344mg, about 348mg, about 35 2mg, about 356mg, about 360mg, about 364mg, about 368mg, about 372mg, about 376mg, about 380mg, about 384mg, about 388mg, about 392mg, about 396mg, about 400mg, about 404mg, about 408m g, about 412mg, about 416mg, about 420mg, about 424mg, about 428mg, about 432mg, about 436mg, about 440mg, about 444mg, about 448mg, about 452mg, about 456mg, about 460mg, about 464mg,Approximately 468 mg, approximately 472 mg, approximately 476 mg, approximately 480 mg, approximately 484 mg, approximately 488 mg, approximately 492 mg, approximately 496 mg, approximately 500 mg, approximately 504 mg, approximately 508 mg, approximately 512 mg, approximately 516 mg, approximately 520 mg, approximately 524 mg, approximately 528 mg, approximately 532 mg, approximately 536 mg, approximately 540 mg, approximately, The dosage may be 544 mg, about 548 mg, about 552 mg, about 556 mg, about 560 mg, about 564 mg, about 568 mg, about 572 mg, about 576 mg, about 580 mg, about 584 mg, about 588 mg, about 592 mg, about 596 mg, about 600 mg, about 604 mg, or about 608 mg. In other specific examples, the dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg, particularly about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg.

[0076] Alternatively, the dosage may be about 1 mg to about 5 mg, about 5 mg to about 10 mg, about 10 mg to about 15 mg, about 15 mg to about 20 mg, about 20 mg to about 25 mg, about 25 mg to about 30 mg, about 30 mg to about 35 mg, about 35 mg to about 40 mg, about 40 mg to about 45 mg, about 45 mg to about 50 mg, about 50 mg to about 55 mg, about 55 mg to about 60 mg, about 60 mg to about 65 mg, about 65 mg to about 70 mg, about 70 mg to about 75 mg, about 75 mg to about 80 mg, about 80 mg to about 85 mg, about 85 mg to about 90 mg, about 90 mg to about 95 mg, about 95 mg to about 100 mg, Approx. 100mg to approx. 105mg, approx. 105mg to approx. 110mg, approx. 110mg to approx. 115mg, approx. 115mg to approx. 120mg, approx. 120mg to approx. 125mg, approx. 125mg to approx. mg, approx. 145 mg ~ approx. 150 mg, approx. 150 mg ~ approx. 155 mg, approx. 155 mg ~ approx. 160 mg, approx. 160 mg ~ approx. 165 mg, approx. 165 mg ~ approx. 90mg, about 190mg to about 195mg, about 195mg to about 200mg, about 200mg to about 205mg, about 205mg to about 210mg, about 210mg to about 215mg, about 215mg to about 220mg, about 220mg to about 225mg, about 225mg to about 230mg, about 230mg ~235mg, 235mg~240mg, 240mg~245mg, 245~250mg, 250mg~255mg, 255~260mg, 260mg~265mg, 265~270mg, 270~275mg, 275 mg ~ approx. 280 mg, approx. 280 mg ~ approx. 285 mg, approx. 285 mg ~ approx. 290 mg, approx. 290 mg ~ approx. 295 mg, approx. 20mg to about 325mg, about 325mg to about 330mg, about 330mg to about 335mg, about 335mg to about 340mg, about 340mg to about 345mg, about 345mg to about 350mg, about 350mg to about 355mg, about 355mg to about 360mg, about 360mg to about 365mg,Approximately 365mg to approximately 370mg, approximately 370mg to approximately 375mg, approximately 375mg to approximately 380mg, approximately 380mg to approximately 385mg, approximately 385mg to approximately 390mg, approximately 390mg to approximately 395mg , about 395 mg to about 400 mg, about 400 mg to about 405 mg, about 405 mg to about 410 mg, about 410 mg to about 415 mg, about 415 mg to about 420 mg, about 420 mg to about 425 m g, about 425 mg to about 430 mg, about 430 mg to about 435 mg, about 435 mg to about 440 mg, about 440 mg to about 445 mg, about 445 mg to about 450 mg, about 450 mg to about 455 mg, about 455 mg to about 460 mg, about 460 mg to about 465 mg, about 465 mg to about 470 mg, about 470 mg to about 475 mg, about 475 mg to about 480 mg, about 480 mg to about 48 5mg, about 485mg to about 490mg, about 490mg to about 495mg, about 495mg to about 500mg, about 500mg to about 505mg, about 505mg to about 510mg, about 510mg to about 5 15mg, about 515mg to about 520mg, about 520mg to about 525mg, about 525mg to about 530mg, about 530mg to about 535mg, about 535mg to about 540mg, about 540mg to about The dose may be 545 mg, about 545 mg to about 550 mg, about 550 mg to about 555 mg, about 555 mg to about 560 mg, about 560 mg to about 565 mg, about 565 mg to about 570 mg, about 570 mg to about 575 mg, about 575 mg to about 580 mg, about 580 mg to about 585 mg, about 585 mg to about 590 mg, about 590 mg to about 595 mg, or about 595 mg to about 600 mg.

[0077] Alternatively, the dosage may be about 1 mg to about 20 mg, about 10 mg to about 20 mg, about 20 mg to about 30 mg, about 30 mg to about 40 mg, about 40 mg to about 50 mg, about 50 mg to about 60 mg, about 60 mg to about 70 mg, about 70 mg to about 80 mg, about 80 mg to about 90 mg, about 90 mg to about 100 mg, about 100 mg to about 110 mg, about 110 mg to about 120 mg, about 120 mg to about 130 mg, about 130 mg to about 140 mg, about 140 mg to about 150 mg, or about 150 mg to about 160mg, about 160mg to about 170mg, about 170mg to about 180mg, about 180mg to about 190mg, about 190mg to about 200mg, about 200mg to about 210mg, about 210mg to about 220mg, about 220mg to about 230mg, Approximately 230mg to approximately 240mg, approximately 240mg to approximately 250mg, approximately 250mg to approximately 260mg, approximately 260mg to approximately 270mg, approximately 270mg to approximately 280mg, approximately 280mg to approximately 290mg, approximately 290mg to approximately 300mg, approximately 300mg ~310mg, 310mg~320mg, 320mg~330mg, 330mg~340mg, 340mg~350mg, 350mg~360mg, 360mg~370mg, 370mg~380m g about 380mg to about 390mg, about 390mg to about 400mg, about 400mg to about 410mg, about 410mg to about 420mg, about 420mg to about 430mg, about 430mg to about 440mg, about 440mg to about 450mg, about 450m The dose may be about 460 mg to about 470 mg, about 470 mg to about 480 mg, about 480 mg to about 490 mg, about 490 mg to about 500 mg, about 500 mg to about 510 mg, about 510 mg to about 520 mg, about 520 mg to about 530 mg, about 530 mg to about 540 mg, about 540 mg to about 550 mg, about 550 mg to about 560 mg, about 560 mg to about 570 mg, about 570 mg to about 580 mg, about 580 mg to about 590 mg, or about 590 mg to about 600 mg.

[0078] Alternatively, the dose may be about 10 mg to about 25 mg, about 25 mg to about 50 mg, about 50 mg to about 75 mg, about 75 mg to about 100 mg, about 100 mg to about 125 mg, about 125 mg to about 150 mg, about 150 mg to about 175 mg, about 175 mg to about 200 mg, about 200 mg to about 225 mg, about 225 mg to about 250 mg, about 250 mg to about 275 mg, about 275 mg to about 300 mg, about 3 The dose may be from about 00 mg to about 325 mg, from about 325 mg to about 350 mg, from about 350 mg to about 375 mg, from about 375 mg to about 400 mg, from about 400 mg to about 425 mg, from about 425 mg to about 450 mg, from about 450 mg to about 475 mg, from about 475 mg to about 500 mg, from about 500 mg to about 525 mg, from about 525 mg to about 550 mg, from about 550 mg to about 575 mg, or from about 575 mg to about 600 mg.

[0079] Alternatively, the dose can be from about 1 mg to about 50 mg, from about 50 mg to about 100 mg, from about 100 mg to about 150 mg, from about 150 mg to about 200 mg, from about 200 mg to about 250 mg, from about 250 mg to about 300 mg, from about 300 mg to about 350 mg, from about 350 mg to about 400 mg, from about 400 mg to about 450 mg, from about 450 mg to about 500 mg, from about 500 mg to about 550 mg, or from about 550 mg to about 600 mg.

[0080] Alternatively, the dose can be from about 1 mg to about 75 mg, from about 75 mg to about 150 mg, from about 150 mg to about 225 mg, from about 225 mg to about 300 mg, from about 300 mg to about 375 mg, from about 375 mg to about 450 mg, from about 450 mg to about 525 mg, or from about 525 mg to about 600 mg.

[0081] Alternatively, the dose can be from about 1 mg to about 100 mg, from about 100 mg to about 200 mg, from about 200 mg to about 300 mg, from about 300 mg to about 400 mg, from about 400 mg to about 500 mg, or from about 500 mg to about 600 mg.

[0082] In some examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2. In other examples, the sense strand is the nucleotide sequence of SEQ ID NO: 3 and the antisense strand is the nucleotide sequence of SEQ ID NO: 4.

[0083] To facilitate administration of a dose of a ds RNAi agent to an individual in need thereof, the dose can be incorporated into a pharmaceutical composition, such as a formulation. Such a pharmaceutical composition can include a concentration of the ds RNAi agent or a pharmaceutically acceptable salt thereof (e.g., calcium, magnesium, or sodium) in H2O, particularly water-for-injection (WFI).

[0084] In some examples, the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2. In other examples, the sense strand is the nucleotide sequence of SEQ ID NO: 3 and the antisense strand is the nucleotide sequence of SEQ ID NO: 4.

[0085] In some examples, the concentration of the ds RNAi agent in the pharmaceutical composition can be about 100 mg / mL to about 300 mg / mL. In other examples, the concentration can be about 110 mg / mL to about 290 mg / mL, about 120 mg / mL to about 280 mg / mL, about 130 mg / mL to about 270 mg / mL, about 140 mg / mL to about 260 mg / mL, about 150 mg / mL to about 250 mg / mL, about 160 mg / mL to about 240 mg / mL, about 170 mg / mL to about 230 mg / mL, about 180 mg / mL to about 220 mg / mL, about 190 mg / mL to about 210 mg / mL, or about 200 mg / mL. In still other examples, the concentration is about 100 mg / mL to about 110 mg / mL, about 110 mg / mL to about 120 mg / mL, about 120 mg / mL to about 130 mg / mL, about 130 mg / mL to about 140 mg / mL, about 140 mg / mL to about 150 mg / mL, about 150 mg / mL to about 160 mg / mL, about 160 mg / mL to about 170 mg / mL, about 170 mg / mL to about 180 mg / mL, about 180 mg / mL to about 190 mg / mL, about 190 mg / mL to about 200 mg / mL mL, about 200 mg / mL to about 210 mg / mL, about 210 mg / mL to about 220 mg / mL, about 220 mg / mL to about 230 mg / mL, about 230 mg / mL to about 240 mg / mL, about 240 mg / mL to about 250 mg / mL, about 250 mg / mL to about 260 mg / mL, about 260 mg / mL to about 270 mg / mL, about 270 mg / mL to about 280 mg / mL, about 280 mg / mL to about 290 mg / mL, or about 290 mg / mL to about 300 mg / mL. In particular examples, the concentration can be about 100 mg / mL, about 110 mg / mL, about 120 mg / mL, about 130 mg / mL, about 140 mg / mL, about 150 mg / mL, about 160 mg / mL, about 170 mg / mL, about 180 mg / mL, about 190 mg / mL, about 200 mg / mL, about 210 mg / mL, about 220 mg / mL, about 230 mg / mL, about 240 mg / mL, about 250 mg / mL, about 260 mg / mL, about 270 mg / mL, about 280 mg / mL, about 290 mg / mL, or about 300 mg / mL, particularly about 160 mg / mL or about 200 mg / mL.

[0086] In some examples, the pH of the pharmaceutical composition can be about 6.0 to about 8.0, and in other examples, the pH can be about 6.1 to about 7.9, about 6.2 to about 7.8, about 6.3 to about 7.7, about 6.4 to about 7.6, about 6.5 to about 7.5, about 6.6 to about 7.4, about 6.7 to about 7.3, about 6.8 to about 7.2, about 6.9 to about 7.1, or about 7.0. In still other examples, the pH may be about 6.0 to about 6.1, about 6.1 to about 6.2, about 6.2 to about 6.3, about 6.3 to about 6.4, about 6.4 to about 6.5, about 6.5 to about 6.6, about 6.6 to about 6.7, about 6.7 to about 6.8, about 6.8 to about 6.9, about 6.9 to about 7.0, about 7.0 to about 7.1, about 7.1 to about 7.2, about 7.2 to about 7.3, about 7.3 to about 7.4, about 7.4 to about 7.5, about 7.5 to about 7.6, about 7.6 to about 7.7, about 7.7 to about 7.8, about 7.8 to about 7.9, or about 7.9 to about 8.0. In particular examples, the pH can be about 6.0, about 6.1, about 6.2, about 6.3, about 6.4, about 6.5, about 6.6, about 6.7, about 6.8, about 6.9, about 7.0, about 7.1, about 7.2, about 7.3, about 7.4, about 7.5, about 7.6, about 7.7, about 7.8, about 7.9, or about 8.0, particularly about 7.0. If necessary, the pH can be adjusted using sodium hydroxide (NaOH) or hydrogen chloride (HCl).

[0087] In some instances, pharmaceutical compositions are sterile when initially manufactured. As such, they may optionally contain preservatives, which may be added in sufficient strength to be compatible with the other components of the composition and to satisfy applicable regulatory antimicrobial preservative requirements. Pharmaceutically acceptable preservatives are known to those skilled in the art (see, e.g., Remington: The Science and Practice of Pharmacy (Troy, Ed., 2001)). st (See, Edition, Lippincott, Williams & Wilkins, 2006.) In other examples, the formulations herein are preservative-free.

[0088] In some examples, the pharmaceutical composition can be stored at a temperature of about 2°C to about 8°C. In other examples, the temperature can be about 3°C ​​to about 7°C, about 4°C to about 6°C, or about 5°C. In still other examples, the temperature can be about 2°C to about 3°C, about 3°C ​​to about 4°C, about 4°C to about 5°C, about 5°C to about 6°C, about 6°C to about 7°C, or about 7°C to about 8°C. In particular examples, the temperature can be about 2°C, about 3°C, about 4°C, about 5°C, about 6°C, about 7°C, or about 8°C. In other examples, the formulation can be stored at a temperature of about 20°C to about 22°C (i.e., room temperature) or higher. For example, the pharmaceutical composition can be stored at a temperature of about 30°C to about 40°C. In still other examples, the temperature can be about 31°C to about 39°C, about 32°C to about 38°C, about 33°C to about 37°C, about 34°C to about 36°C, or about 35°C. Alternatively, the temperature can be about 30°C, about 31°C, about 32°C, about 33°C, about 34°C, about 35°C, about 36°C, about 37°C, about 38°C, about 39°C or about 40°C.

[0089] In some instances, for example, to lower the dosage, the pharmaceutical composition can be diluted with about 0.9% NaCl for injection, hi other instances, the pharmaceutical composition can be diluted with mannitol or dextrose for injection.

[0090] In one particular example, the pharmaceutical composition comprises a ds RNAi agent or a pharmaceutically acceptable salt thereof that modulates LPA expression, the ds RNAi agent having a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2, in HO at a pH of 7.0, wherein the ds RNAi agent is at a concentration of about 150 mg / mL to about 170 mg / mL, particularly about 160 mg / mL.

[0091] In another specific example, the pharmaceutical composition comprises a ds RNAi agent or a pharmaceutically acceptable salt thereof that modulates LPA expression, wherein the ds RNAi agent has a sense strand having the nucleotide sequence of SEQ ID NO: 1 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2, in HO at a pH of 7.0, wherein the ds RNAi agent is at a concentration of about 190 mg / mL to about 210 mg / mL, particularly about 200 mg / mL.

[0092] In another specific example, the pharmaceutical composition comprises a ds RNAi agent or a pharmaceutically acceptable salt thereof that modulates LPA expression, wherein the ds RNAi agent has a sense strand having the nucleotide sequence of SEQ ID NO: 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 4, in HO at a pH of 7.0, wherein the ds RNAi agent is at a concentration of about 150 mg / mL to about 170 mg / mL, particularly about 160 mg / mL.

[0093] In another specific example, the pharmaceutical composition comprises a ds RNAi agent or a pharmaceutically acceptable salt thereof that modulates LPA expression, wherein the ds RNAi agent has a sense strand having the nucleotide sequence of SEQ ID NO: 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 4, in HO at a pH of 7.0, wherein the ds RNAi agent is at a concentration of about 190 mg / mL to about 210 mg / mL, particularly about 200 mg / mL.

[0094] Pharmaceutical composition can be administered by IV or SC, especially SC. Pharmaceutical composition can be administered by using pre-filled disposable pen, reusable pen or automatic pen-type injector. Alternatively, pharmaceutical composition can be administered by using single-use vial, multiple-use vial or pump device. In some examples, device is an automatic injection device as described in U.S. Patent No. 8,734,394.

[0095] Thus, the pharmaceutical composition may be provided in a pre-filled syringe / multiple-use vial. Such a pre-filled syringe / multiple-use vial may be useful for administering about 0.5 mL to about 5 mL of the formulation per dose to an individual. The dose may be administered using a dosing schedule determined by a clinician, physician, or other trained medical professional.

[0096] Alternatively, the pharmaceutical composition may be prepared for cartridges and therefore may differ from the above in that it includes an optional preservative, particularly for multiple use.

[0097] Alternatively, the pharmaceutical composition can be prepared as part of a product that includes a ds RNAi agent, which can be a multi-dose vial, a reusable pen-injector, a pre-filled disposable pen, an auto-injector, or a pump.

[0098] In view of the above, the pharmaceutical composition is associated with acceptable shelf-life stability, in-use stability and an acceptable injection site experience.

[0099] Dosage Regimens and Other Methods LPA-modulating ds RNAi agents and compositions thereof, such as the doses and formulations described herein, can be used to attenuate, prevent, and / or treat diseases, disorders, and / or conditions associated with LPA expression. For example, ds RNAi agents or compositions comprising same can be used in individuals to reduce the risk of MACE in individuals with or at high risk for ASCVD and / or high Lp(a) levels, or can be used to reduce such risk in individuals at risk for a first CV event.

[0100] The method may include the steps described herein, which may be, but are not necessarily, performed in the order described. However, other orders are contemplated. Furthermore, individual or multiple steps may be performed in parallel and / or overlapping time, and / or individually or in multiple repeated steps. Furthermore, the method may include additional, unspecified steps.

[0101] Details of various methods are provided below, and each may include an optional step of selecting an individual who has or is predisposed to have a disease, disorder, and / or condition associated with LPA expression. For example, in some instances, the individual is an adult with elevated Lp(a) and established CV disease. In some instances, the individual is an adult at risk for a first CV event and may optionally have elevated Lp(a). In other instances, the individual may have an Lp(a) level of at least about 75 nmol / L or greater before administering the dose. In yet other instances, the individual has an Lp(a) of at least about 100 nmol / L, about 125 nmol / L, about 150 nmol / L, about 175 nmol / L, or about 200 nmol / L before administering the dose. In yet other instances, the individual has an LPA SNP selected from rs10455872 and rs3798220. In some examples, diseases, disorders and / or conditions associated with LPA expression include, but are not limited to, cardiovascular events including atherosclerosis, CAVS, cardiometabolic disease, coronary revascularization, CV mortality, cerebrovascular disease, chronic kidney disease, coronary heart disease, dyslipidemia, heart failure, MI and stroke, and / or peripheral vascular disease, particularly atherosclerosis, cardiometabolic disease and dyslipidemia.

[0102] For example, provided are methods for reducing LPA expression in an individual, such methods comprising administering to the individual a first dose of a ds RNAi agent that modulates LPA expression or a pharmaceutical composition thereof, such as a formulation herein, wherein the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 or 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2 or 4, and the first dose can be from about 4 mg to about 608 mg.

[0103] In some instances, the first dose may be administered IV or may be administered SC, particularly SC.

[0104] In some examples, the sense strand is SEQ ID NO: 3. In other examples, the antisense strand is SEQ ID NO: 4. In particular examples, the sense strand is SEQ ID NO: 3 and the antisense strand is SEQ ID NO: 4.

[0105] In some examples, the first dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg. In other examples, the first dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg.

[0106] The method may also include administering to the individual one or more subsequent doses (i.e., at least a second dose) of the ds RNAi agent, where the one or more subsequent doses may be from about 4 mg to about 608 mg, the one or more subsequent doses may be the same as or different from the first dose, and may be administered about Q1M, about Q3M, about Q6M, about Q9M, or about Q12M after the first dose or a previous dose. Alternatively, the one or more subsequent doses may be administered about 2 months (Q2M), about 4 months (Q4M), about 5 months (Q5M), about 7 months (Q7M), about 8 months (Q8M), about 10 months (Q10M), or about 11 months (Q11M) after the first dose or a previous dose.

[0107] In some instances, one or more subsequent doses may be administered IV or may be administered SC, particularly SC.

[0108] In some examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg. In other examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg.

[0109] When a subsequent dose (i.e., a third, fourth, fifth, or later dose) is administered, the subsequent dose can be the same as the second dose (or any previous dose, in the case of a fourth, fifth, or later dose) or can be different from the second dose (or any previous dose, in the case of a fourth, fifth, or later dose). Further, the subsequent dose can be administered from about Q1M to about Q12M (i.e., about Q1M, Q2M, Q3M, Q4M, Q5M, Q6M, Q7M, Q8M, Q9M, Q10M, Q11M, or Q12M) from the second dose (or any previous dose, in the case of a fourth, fifth, or later dose).

[0110] In some examples, the one or more subsequent doses may be about 4 mg administered every Q1M, about 4 mg administered every Q3M, about 4 mg administered every Q6M, about 4 mg administered every Q9M, or about 4 mg administered every Q12M.

[0111] In some examples, the one or more subsequent doses can be about 12 mg administered every Q1M, about 12 mg administered about every Q3M, about 12 mg administered about every Q6M, about 12 mg administered about every Q9M, or about 12 mg administered about every Q12M.

[0112] In some examples, the one or more subsequent doses can be about 16 mg administered about every Q1M, about 16 mg administered about every Q3M, about 16 mg administered about every Q6M, about 16 mg administered about every Q9M, or about 16 mg administered about every Q12M.

[0113] In some examples, the one or more subsequent doses can be about 32 mg administered about every Q1M, about 32 mg administered about every Q3M, about 32 mg administered about every Q6M, about 32 mg administered about every Q9M, or about 32 mg administered about every Q12M.

[0114] In some examples, the one or more subsequent doses can be about 96 mg administered about every Q1M, about 96 mg administered about every Q3M, about 96 mg administered about every Q6M, about 96 mg administered about every Q9M, or about 96 mg administered about every Q12M.

[0115] In some examples, the one or more subsequent doses can be about 304 mg administered about every Q1M, about 304 mg administered about every Q3M, about 304 mg administered about every Q6M, about 304 mg administered about every Q9M, or about 304 mg administered about every Q12M.

[0116] In some examples, the one or more subsequent doses can be about 400 mg administered about every Q1M, about 400 mg administered about every Q3M, about 400 mg administered about every Q6M, about 400 mg administered about every Q9M, or about 400 mg administered about every Q12M.

[0117] In some examples, the one or more subsequent doses can be about 608 mg administered about every Q1M, about 608 mg administered about every Q3M, about 608 mg administered about every Q6M, about 608 mg administered about every Q9M, or about 608 mg administered about every Q12M.

[0118] In another example, one or more subsequent doses may be about 400 mg, with at least one of the subsequent doses being administered about every Q6M and the other subsequent dose being administered about every Q12M.

[0119] Assuming a pharmaceutical formulation is used in which the concentration of the ds RNAi agent is about 160 mg / mL, exemplary volumes for delivering the above doses are as follows: Approximately 25 μL to deliver a dose of approximately 4 mg Approximately 75 μL to deliver a dose of approximately 12 mg Approximately 0.1 mL to deliver a dose of approximately 16 mg Approximately 0.2 mL to deliver a dose of approximately 32 mg Approximately 0.6 mL to deliver a dose of approximately 96 mg Approximately 1.9 mL to deliver a dose of approximately 304 mg Approximately 2.5 mL to deliver a dose of approximately 400 mg, and Approximately 3.8 mL to deliver a dose of approximately 608 mg.

[0120] Alternatively, using a pharmaceutical formulation in which the concentration of the ds RNAi agent is about 200 mg / mL, exemplary volumes for delivering the above doses are as follows: Approximately 20 μL to deliver a dose of approximately 4 mg Approximately 60 μL to deliver a dose of approximately 12 mg Approximately 80 μL to deliver a dose of approximately 16 mg Approximately 0.2 mL to deliver a dose of approximately 32 mg Approximately 0.5 mL to deliver a dose of approximately 96 mg Approximately 1.5 mL to deliver a dose of approximately 304 mg Approximately 2.0 mL to deliver a dose of approximately 400 mg, and Approximately 3.0 mL to deliver a dose of approximately 608 mg.

[0121] As described above, one or more subsequent doses (e.g., second, third, fourth, fifth, and subsequent doses) may be administered at the same or different dosing frequencies, which may be guided, for example, by the degree of change in the individual's LPA expression. Thus, the method may also include adjusting one or more subsequent doses after comparing the individual's LPA expression after administration with a control or previously measured / recorded LPA expression.

[0122] In addition to the above, there is provided a method for attenuating, preventing, and / or treating a disease, disorder, and / or condition associated with LPA expression, such method comprising administering to an individual in need thereof a first dose of a ds RNAi agent that modulates LPA expression or a pharmaceutical composition thereof, such as a formulation herein, wherein the ds RNAi agent comprises a sense strand having the nucleotide sequence of SEQ ID NO: 1 or 3 and an antisense strand having the nucleotide sequence of SEQ ID NO: 2 or 4, and the first dose can be from about 4 mg to about 608 mg.

[0123] In some instances, the first dose may be administered IV or may be administered SC, particularly SC.

[0124] In some examples, the sense strand is SEQ ID NO: 3. In other examples, the antisense strand is SEQ ID NO: 4. In particular examples, the sense strand is SEQ ID NO: 3 and the antisense strand is SEQ ID NO: 4.

[0125] In some examples, the first dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg.

[0126] The method may also include administering to the individual one or more subsequent doses of the ds RNA agent, where the one or more subsequent doses can be from about 4 mg to about 608 mg, and the one or more subsequent doses can be the same as or different from the first dose, and can be administered about Q1M, about Q3M, about Q6M, about Q9M, or about Q12M after the first dose. Alternatively, at least a second dose can be administered about Q2M, about Q4M, about Q5M, about Q7M, about Q8M, about Q10M, or about Q11M after the first dose.

[0127] In some instances, one or more subsequent doses may be administered IV or may be administered SC, particularly SC.

[0128] In some examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 64 mg, about 96 mg, about 128 mg, about 160 mg, about 192 mg, about 224 mg, about 256 mg, about 288 mg, about 304 mg, about 320 mg, about 352 mg, about 384 mg, about 400 mg, about 416 mg, about 448 mg, about 480 mg, about 512 mg, about 544 mg, about 576 mg, or about 608 mg. In other examples, the one or more subsequent doses can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg.

[0129] When a subsequent dose (i.e., a third, fourth, fifth, or later dose) is administered, the subsequent dose can be the same as the second dose (or any previous dose, in the case of a fourth, fifth, or later dose) or can be different from the second dose (or any previous dose, in the case of a fourth, fifth, or later dose). Further, the subsequent dose can be administered from about Q1M to about Q12M (i.e., about Q1M, Q2M, Q3M, Q4M, Q5M, Q6M, Q7M, Q8M, Q9M, Q10M, Q11M, or Q12M) from the second dose (or any previous dose, in the case of a fourth, fifth, or later dose).

[0130] In some examples, the one or more subsequent doses may be about 4 mg administered every Q1M, about 4 mg administered every Q3M, about 4 mg administered every Q6M, about 4 mg administered every Q9M, or about 4 mg administered every Q12M.

[0131] In some examples, the one or more subsequent doses can be about 12 mg administered every Q1M, about 12 mg administered about every Q3M, about 12 mg administered about every Q6M, about 12 mg administered about every Q9M, or about 12 mg administered about every Q12M.

[0132] In some examples, the one or more subsequent doses can be about 16 mg administered about every Q1M, about 16 mg administered about every Q3M, about 16 mg administered about every Q6M, about 16 mg administered about every Q9M, or about 16 mg administered about every Q12M.

[0133] In some examples, the one or more subsequent doses can be about 32 mg administered about every Q1M, about 32 mg administered about every Q3M, about 32 mg administered about every Q6M, about 32 mg administered about every Q9M, or about 32 mg administered about every Q12M.

[0134] In some examples, the one or more subsequent doses can be about 96 mg administered about every Q1M, about 96 mg administered about every Q3M, about 96 mg administered about every Q6M, about 96 mg administered about every Q9M, or about 96 mg administered about every Q12M.

[0135] In some examples, the one or more subsequent doses can be about 304 mg administered about every Q1M, about 304 mg administered about every Q3M, about 304 mg administered about every Q6M, about 304 mg administered about every Q9M, or about 304 mg administered about every Q12M.

[0136] In some examples, the one or more subsequent doses can be about 400 mg administered about every Q1M, about 400 mg administered about every Q3M, about 400 mg administered about every Q6M, about 400 mg administered about every Q9M, or about 400 mg administered about every Q12M.

[0137] In some examples, the one or more subsequent doses can be about 608 mg administered about every Q1M, about 608 mg administered about every Q3M, about 608 mg administered about every Q6M, about 608 mg administered about every Q9M, or about 608 mg administered about every Q12M.

[0138] In another example, one or more subsequent doses may be about 400 mg, with at least one of the subsequent doses being administered about every Q6M and the other subsequent dose being administered about every Q12M.

[0139] As described above, one or more subsequent doses (e.g., the second, third, fourth, fifth, and subsequent doses) may be administered at the same or different dosing frequencies, which can be guided, for example, by the degree of change in the individual's Lp(a) concentration (or other lipid profile components) after administration. Thus, the method may also include measuring or recording the value of at least one of the individual's lipid profile components, such as Apo(a), ApoB, HDL-C, LDL-C, Lp(a), total cholesterol (TC), and / or triglycerides (TG), and comparing the at least one value with a control value or another measured / recorded value obtained from the individual. In some examples, the method may further include adjusting the dose of one or more subsequent doses after comparing the measured / recorded value with a control or a previous measured / recorded value from the individual.

[0140] In any of the above methods, each dose may be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg, with the first dose being administered on day 0 and each subsequent dose (i.e., the second, third, fourth, fifth, and subsequent doses) being administered at a frequency of about every Q6M thereafter.

[0141] In any of the above methods, each dose can be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg, where the first dose is administered on day 0, the second dose is administered about Q6M from the first dose, and each subsequent dose (i.e., the third, fourth, fifth, and subsequent doses) is administered at a frequency of about every Q12M from the second dose. Alternatively, the first dose is administered on day 0, the second dose is administered about Q6M from the first dose, the third dose is administered about Q6M from the second dose, and each subsequent dose (i.e., the fourth, fifth, and subsequent doses) is administered at a frequency of about every Q12M from the third dose. Alternatively, a first dose is administered on day 0, a second dose is administered about Q6M from the first dose, a third dose is administered about Q6M from the second dose, a fourth dose is administered about Q6M from the third dose, and each subsequent dose (i.e., the fifth, and subsequent doses) is administered at a frequency of about every Q12M from the fourth dose.

[0142] In any of the above methods, each dose may be about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, or about 608 mg, with the first dose being administered on day 0 and each subsequent dose (i.e., the second, third, fourth, fifth, and subsequent doses) being administered at a frequency of about every Q12M thereafter.

[0143] In any of the above methods, the injection can be administered via a 27G needle into the SC tissue of the individual's abdominal wall, approximately 10 cm from the umbilicus. For example, the injection can be administered at an approximately 45° angle without pinching the skin. If more than 2 mL of solution is required to deliver the dose, it can be divided into injections up to a maximum volume of 2 mL per injection. In this way, multiple injections can be administered in rapid succession, each delivered to one of the four quadrants of the anterior abdominal wall. In another example, the dose can be delivered using a single injection of more than 2.0 mL.

[0144] In any of the above, the method may also include measuring / recording the frequency and severity of the individual's AEs after administration. In some examples, the method may further include adjusting one or more subsequent doses of the ds RNAi agent after assessing the frequency and severity of the individual's AEs.

[0145] In any of the above, the individual's Lp(a) levels are reduced to or maintained at less than 150 mg / dL, less than 125 mg / dL, less than 100 mg / dL, less than 75 mg / dL, or less than 50 mg / dL following administration of the ds RNAi agent.

[0146] In either case, the individual's Lp(a) is reduced by about 90% within about 14 days after administration of the ds RNAi agent.

[0147] In any of the above, the individual may be receiving concomitant lipid-lowering therapy, such as a therapy that reduces LDL-C levels (e.g., a PCSK9 inhibitor, a statin, a cholesterol absorption inhibitor, LDL apheresis, or a combination thereof). [Example]

[0148] The following non-limiting examples are offered by way of illustration and not limitation.

[0149] Pharmaceutical preparations Example 1: Pharmaceutical formulations containing ds RNAi agents A formulation is prepared substantially as described herein, comprising a ds RNAi agent (e.g., a sense strand of SEQ ID NO: 3 and an antisense strand of SEQ ID NO: 4; sodium equivalent) at 160 mg / mL or 200 mg / mL in HO (WFI). The formulation is supplied for use as a solution formulation in a glass vial.

[0150] Chemical and physical stability Example 2: In-use stability testing Methods: Formulations were prepared as described in Example 1. The stability of the formulations was evaluated in glass vials over various time periods at various temperatures from 2°C to 8°C, as well as at extreme temperatures of 25°C and 40°C, and 60°C and 80°C. Degradation of the formulations was monitored using denaturing and non-denaturing methods.

[0151] Results: Based on these studies, the formulation had long-term stability of up to 5 years at 2°C-8°C and 25°C, and was stable for several months at 40°C.

[0152] [Table 1]

[0153] [Table 2]

[0154] Administration Example 3: Testing ds RNAi agents to regulate LPA expression in healthy adults Methods: A multicenter study was designed to evaluate the safety, tolerability, pharmacodynamics (PD), and pharmacokinetics (PK) of a ds RNAi agent (sense and antisense strands SEQ ID NO: 3 and SEQ ID NO: 4, respectively) for modulating LPA expression in otherwise healthy individuals (Part A) with elevated Lp(a) (no CVD, Lp(a) ≥ 75 nmol / L or 30 mg / dL) or healthy individuals (Part B). The study was randomized, investigator- and participant-blinded, and placebo-controlled.

[0155] In Part A, individuals received single ascending doses of 4 mg, 12 mg, 32 mg, 96 mg, 304 mg, or 608 mg of ds RNAi agent administered SC. Individuals were randomized in a 6:2 ratio to receive either ds RNAi agent or placebo (0 mg; 0.9% NaCl solution for injection). In Part A, each cohort underwent staggered dosing to receive a new, higher dose of ds RNAi agent.

[0156] In Part B, individuals received a single dose of 304 mg or 608 mg administered SC. Individuals were randomized to receive either ds RNAi agent or placebo (0 mg; 0.9% NaCl solution for injection) in a 1:1:1 ratio.

[0157] All injections were administered intraperitoneally. ds RNAi agents were provided as a 160 mg / mL solution. Placebo was administered as a 2.5 mL injection of 0.9% NaCl solution.

[0158] Blood samples were collected pre-dose and at 0.5, 1.5, 3, 6, 9, 12, 16, 24, 36, 48, and 72 hours after dosing, and on days 8, 15, 22, 29, 85, and 169 after dosing to determine plasma concentrations of the ds RNAi agents. Plasma concentrations were used to calculate PD and / or PK parameters.

[0159] PD analyses included Lp(a), ApoB and lipid panels.

[0160] PK analysis: AUC( 0-tlast ), AUC( 0-∞ ), C max , t max , t1 / 2 and CL / F were included.

[0161] Safety analyses included physical examination, vital sign assessment, 12-lead ECG, clinical laboratory assessment, PLG activity, Pal-1, tPA, A2AP, cytokine panel, evaluation of injection site reactions, immunogenicity, and adverse events.

[0162] Results: No effects on ApoB and lipids were observed up to 169 days.

[0163] [Table 3]

[0164] [Table 4] Abbreviations: NC = not calculated

[0165] [Table 5]

[0166] PD: For PD, single doses of ds RNAi agents (i.e., 4 mg, 12 mg, 32 mg, 96 mg, 304 mg, and 608 mg) resulted in significant, dose-dependent, and sustained reductions in Lp(a). Specifically, Lp(a) levels were reduced by more than 90%, and persisted for more than 24 weeks after a single dose. For example, on day 169, the mean Lp(a) reduction after a single SC administration of 608 mg of ds RNAi agent was -96.99% (mean baseline: 122.70 nmol / L). In contrast, the pooled placebo group experienced a mean Lp(a) reduction of -4% (mean baseline: 110.35 nmol / L).

[0167] PK: PK was approximately dose proportional over the dose range tested. max Approximately 4.6 hours to approximately 10.5 hours (t max median) and the terminal t 1 / 2 The mean time to Lp(a) was approximately 4 to 7 hours. A single dose of the ds RNAi agent resulted in sustained Lp(a) reduction, allowing for dosing every 6 to 12 months.

[0168] Safety: Regarding the safety profile, single doses of ds RNAi agents (ranging from 4 mg to 608 mg) were safe and well-tolerated in healthy individuals with elevated Lp(a) levels. In fact, no serious adverse events (AEs) or discontinuations due to AEs were observed related to the ds RNAi agents. The majority of treatment-emergent AEs (TEAEs) were mild in severity, with no clear dose-related association observed. The most common TEAEs were headache, skin redness (ECG patch), COVID-19 infection, fever, and runny nose. Furthermore, no clinically significant changes in pulse rate, blood pressure, or ECG / QTc interval were observed.

[0169] Other: With the exception of two individuals with elevated liver enzymes (i.e., for Part A, one individual at the 4 mg dose and one individual at the 96 mg dose) and four individuals with elevated CK (i.e., for Part A, one individual at the 4 mg dose and one individual at the 608 mg dose; for Part B, two individuals), there were no treatment-related trends or clinically significant changes in clinical laboratory safety parameters.

[0170] PLG activity levels were monitored throughout the study, and preliminary data indicated no dose-dependent changes in PLG activity after a single dose of ds RNAi agent up to 608 mg.

[0171] Example 4: A randomized, double-blind, placebo-controlled study to investigate the efficacy and safety of ds RNAi agents to regulate LPA expression in adults with elevated Lp(a) Methods: A multicenter study is designed to evaluate the efficacy and safety of repeated administration of a ds RNAi agent (sense and antisense strands SEQ ID NO: 3 and SEQ ID NO: 4, respectively) to regulate LPA expression in a larger population of individuals with higher Lp(a) levels than in Example 3 (i.e., ≥175 nmol / L vs. ≥75 nmol / L). The study is randomized, investigator- and participant-blinded, and placebo-controlled.

[0172] Approximately 254 individuals randomized in a 1:2:2:2:2 ratio to one of the groups in Table 6 will be evaluated for 540 days with doses of ds RNAi agent.

[0173] [Table 6]

[0174] All injections are administered SC into the abdominal wall tissue. The ds RNAi agent is provided as a 160 mg / mL solution. As in Example 3, the placebo is an injectable 0.9% NaCl solution (administered in the range of approximately 0.1 mL to approximately 2.5 mL).

[0175] PD, PK and safety analyses will generally be performed as described in Example 3.

[0176] Results: The interim analysis showed that the ds RNAi agent reduced Lp(a) similarly to that observed in Example 3, and that the reduction in Lp(a) was sustained enough to support less frequent dosing. Similarly, the interim analysis showed that the ds RNAi agent was safe and well tolerated.

[0177] Example 5: A randomized, double-blind, placebo-controlled study to examine the effect of ds RNAi agents on reducing major adverse cardiovascular events in adults with elevated lipoprotein(a) and established atherosclerotic cardiovascular disease or at risk for a first cardiovascular event

[0178] Methods: A multicenter study was designed to investigate the reduction of MACE-4, defined as CV death, nonfatal MI, nonfatal stroke, and urgent coronary revascularization, by repeated administration of a ds RNAi agent (sense and antisense strands of SEQ ID NO: 3 and SEQ ID NO: 4, respectively) to modulate LPA expression, compared with placebo, in adult participants with established ASCVD or at risk for a first CV event. The study is randomized, investigator- and participant-blinded, and placebo-controlled.

[0179] Further objectives include investigating reduction in Lp(a) levels, reduction in MACE-3 (i.e., CV death, non-fatal MI, or non-fatal stroke), reduction in coronary MACE-3 (i.e., coronary cardiac death, non-fatal MI, or urgent coronary revascularization), reduction in MACE-3+MALE (i.e., CV death, non-fatal MI, non-fatal stroke, acute or critical limb ischemia, peripheral arterial revascularization, or major amputation due to ischemia), reduction in MACE-4 in subpopulations with confirmed ASCVD and a history of a CV event or revascularization, reduction in MACE-4 in subpopulations at risk for a first CV event, reduction in MACE-4 in participants with Lp(a) levels ≥ 200 nmol / L, reduction in MI, reduction in CV death, and / or reduction in overall mortality.

[0180] A 400 mg dose of the ds RNAi agent will be evaluated over approximately four years in approximately 12,500 individuals randomized 1:1 to receive the ds RNAi agent or placebo. The first three doses will be administered six months apart (Q6M; e.g., Day 0, Day 180 (Week 26), and Day 360 (Week 52)), and all remaining doses will be administered 12 months apart (Q12M; e.g., Week 104 and Week 156) until the end of the study.

[0181] All injections are administered SC into the abdominal wall tissue. The ds RNAi agent is provided as a 200 mg / mL solution. As in Example 3, the placebo is an injectable 0.9% NaCl solution (administered in the range of approximately 0.1 mL to approximately 2.5 mL).

[0182] PD, PK and safety analyses will generally be performed as described in Example 3.

[0183] Sequence Listing The following nucleotide and / or amino acid sequences are mentioned in the above disclosure and are provided below for reference:

[0184] SEQ ID NO: 1 - Unmodified sense strand (36 nt) UUGCCAAGCUUGGUCAUCUAGCAGCCGAAAGGCUGC

[0185] SEQ ID NO:2 - Unmodified antisense strand (22 nt) UAGAUGACCAAGCUUGGCAAGG

[0186] SEQ ID NO:3 - modified sense strand (36 nt) [mUs][mU][mG][mC][mC][mA][mA][fG][fC][fU][fU][mG][mG][mU][mC][mA][mU][mC][mU][mA][mG][m C][mA][mG][mC][mC][mG][ademA-GalNAc][ademA-GalNAc][ademA-GalNAc][mG][mG][mC][mU][mG][mC]

[0187] SEQ ID NO: 4 - modified antisense strand (22 nt) [MePhosphonate-4O-mUs][fAs][fGs][fA][fU][mG][fA][mC][mC][fA][mA][mG][mC][fU][mU][mG][mG][mC][mA][mAs][mG][mG][mG]

Claims

1. 1. A pharmaceutical composition comprising: Water (H 2 O) a double-stranded (ds) RNAi agent or a pharmaceutically acceptable salt thereof at a concentration of about 100 mg / mL to about 300 mg / mL, said pharmaceutical composition having a pH of about 6.0 to about 8.0, and said ds RNAi agent comprising: (1) a sense strand comprising the nucleotide sequence of SEQ ID NO: 1; (2) an antisense strand comprising the nucleotide sequence of SEQ ID NO: 2; A pharmaceutical composition comprising:

2. 2. The pharmaceutical composition of claim 1, wherein the concentration is from about 150 mg / mL to about 170 mg / mL or from about 190 mg / mL to about 210 mg / mL.

3. 3. The pharmaceutical composition of claim 2, wherein the concentration is about 160 mg / mL or about 200 mg / mL.

4. The pharmaceutical composition according to any one of claims 1 to 3, wherein the sense strand is SEQ ID NO:

3.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the antisense strand is SEQ ID NO:

4.

6. The pharmaceutical composition of any one of claims 1 to 5, wherein the pH is about 7.

0.

7. The pharmaceutical composition of any one of claims 1 to 6, wherein the composition is preservative-free.

8. 1. A pharmaceutical formulation comprising: (1) (a) a sense strand comprising the nucleotide sequence of SEQ ID NO: 1; and (b) an antisense strand comprising the nucleotide sequence of SEQ ID NO: 2 a double-stranded (ds) RNAi agent comprising: (2) Water (H 2 O) and Including, The pharmaceutical formulation, wherein the ds RNAi agent is at a concentration of about 150 mg / mL to about 170 mg / mL or about 190 mg / mL to about 210 mg / mL, and wherein the formulation has a pH of about 7.

0.

9. 1. A pharmaceutical formulation comprising: (1) (a) a sense strand comprising the nucleotide sequence of SEQ ID NO: 3, and (b) an antisense strand comprising the nucleotide sequence of SEQ ID NO: 4 a double-stranded (ds) RNAi agent comprising: (2) Water (H 2 O) and Including, The pharmaceutical formulation, wherein the ds RNAi agent is at a concentration of about 150 mg / mL to about 170 mg / mL or about 190 mg / mL to about 210 mg / mL, and wherein the formulation has a pH of about 7.

0.

10. 10. The pharmaceutical formulation of claim 8 or 9, wherein the ds RNAi agent is at a concentration of about 160 mg / mL or about 200 mg / mL.

11. The pharmaceutical composition according to any one of claims 8 to 10, wherein the formulation is preservative-free.

12. 1. A method of attenuating, preventing and / or treating a disease, disorder and / or condition associated with apolipoprotein(a) gene (LPA) expression in an individual, comprising: (a) administering to the individual a first dose of a double-stranded (ds) RNAi agent that modulates LPA expression, wherein the first dose is from about 4 mg to about 608 mg, and the ds RNAi agent comprises: (i) a sense strand comprising SEQ ID NO: 1, and (ii) comprising an antisense strand comprising SEQ ID NO:2; (b) administering to the individual one or more subsequent doses of the ds RNAi agent at intervals selected from the group consisting of about every 1 month (Q1M), about every 3 months (Q3M), about every 6 months (Q6M), about every 9 months (Q9M), and about every 12 months (Q12M) from the first dose or a previous dose, wherein the one or more subsequent doses are from about 4 mg to about 608 mg; A method comprising:

13. 13. The method of claim 12, wherein the administering is intravenous (IV) or subcutaneous (SC).

14. 14. The method of claim 13, wherein said administering is SC.

15. The method of any one of claims 12 to 14, wherein the sense strand is SEQ ID NO:

3.

16. The method of any one of claims 12 to 15, wherein the antisense strand is SEQ ID NO:

4.

17. 17. The method of any one of claims 12 to 16, wherein the one or more subsequent doses are the same as the first dose.

18. 17. The method of any one of claims 12 to 16, wherein one or more of the subsequent doses is not the same as the first dose.

19. 19. The method of any one of claims 12-18, wherein the first dose is selected from the group consisting of about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, and about 608 mg.

20. 20. The method of any one of claims 12-19, wherein the one or more subsequent doses are independently selected from the group consisting of about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, and about 608 mg.

21. 17. The method of any one of claims 12-16, wherein the first dose is about 4 mg and the one or more subsequent doses are about 4 mg administered about every Q1M, about 4 mg administered about every Q3M, about 4 mg administered about every Q6M, about 4 mg administered about every Q9M, or about 4 mg administered about every Q12M from the first dose or the previous dose.

22. 17. The method of any one of claims 12-16, wherein the first dose is about 12 mg and the one or more subsequent doses are about 12 mg administered about every Q1M, about 12 mg administered about every Q3M, about 12 mg administered about every Q6M, about 12 mg administered about every Q9M, or about 12 mg administered about every Q12M from the first dose or the previous dose.

23. 17. The method of any one of claims 12-16, wherein the first dose is about 16 mg and the one or more subsequent doses are about 16 mg administered about every Q1M, about 16 mg administered about every Q3M, about 16 mg administered about every Q6M, about 16 mg administered about every Q9M, or about 16 mg administered about every Q12M from the first dose or the previous dose.

24. 17. The method of any one of claims 12-16, wherein the first dose is about 32 mg and the one or more subsequent doses are about 32 mg administered about every Q1M, about 32 mg administered about every Q3M, about 32 mg administered about every Q6M, about 32 mg administered about every Q9M, or about 32 mg administered about every Q12M from the first dose or the previous dose.

25. 17. The method of any one of claims 12-16, wherein the first dose is about 96 mg and the one or more subsequent doses are about 96 mg administered about every Q1M, about 96 mg administered about every Q3M, about 96 mg administered about every Q6M, about 96 mg administered about every Q9M, or about 96 mg administered about every Q12M from the first dose or the previous dose.

26. 17. The method of any one of claims 12-16, wherein the first dose is about 304 mg and the one or more subsequent doses are about 304 mg administered about every Q1M, about 304 mg administered about every Q3M, about 304 mg administered about every Q6M, about 304 mg administered about every Q9M, or about 304 mg administered about every Q12M from the first dose or the previous dose.

27. 17. The method of any one of claims 12-16, wherein the first dose is about 400 mg and the one or more subsequent doses are about 400 mg administered about every Q1M, about 400 mg administered about every Q3M, about 400 mg administered about every Q6M, about 400 mg administered about every Q9M, or about 400 mg administered about every Q12M from the first dose or the previous dose.

28. 17. The method of any one of claims 12-16, wherein the first dose is about 608 mg and the one or more subsequent doses are about 608 mg administered Q1M, about 608 mg administered Q3M, about 608 mg administered Q6M, about 608 mg administered Q9M, or about 608 mg administered Q12M from the first dose or the previous dose.

29. 17. The method of any one of claims 12-16, wherein the first dose is from about 4 mg to about 608 mg and the one or more subsequent doses are from about 4 mg to about 608 mg and are administered about every Q6M from the first dose or the previous dose.

30. 17. The method of any one of claims 12-16, wherein the first dose is from about 4 mg to about 608 mg, the second dose is from about 4 mg to about 608 mg and is administered about Q6M from the first dose, and the one or more subsequent doses are from about 4 mg to about 608 mg and are administered about every Q12M from the second dose or the previous dose.

31. 17. The method of any one of claims 12-16, wherein the first dose is from about 4 mg to about 608 mg and the one or more subsequent doses are from about 4 mg to about 608 mg and are administered about every Q12M from the first dose or the previous dose.

32. 13. The method of claim 12, wherein the disease, disorder and / or condition associated with LPA expression is selected from the group consisting of atherosclerosis, calcific aortic stenosis (CAVS), cardiometabolic disease, coronary revascularization, CV mortality, cerebrovascular disease, chronic kidney disease, coronary heart disease, dyslipidemia, heart failure, cardiovascular (CV) events including MI and stroke, and peripheral vascular disease.

33. 1. A method for reducing apolipoprotein(a) gene (LPA) expression in an individual with high lipoprotein(a) (Lp(a)) levels, comprising: (a) administering to the individual a first dose of a double-stranded (ds) RNAi agent that modulates LPA expression, wherein said dose is from about 4 mg to about 608 mg, and wherein said ds RNAi agent comprises: (i) a sense strand comprising SEQ ID NO: 1; and (ii) an antisense strand comprising SEQ ID NO: 2; The method, wherein the individual's Lp(a) levels are reduced by about 90% within about 14 days of the first dose.

34. 34. The method of claim 33, wherein the sense strand is SEQ ID NO:

3.

35. 35. The method of claim 33 or 34, wherein the antisense strand is SEQ ID NO:

4.

36. (b) administering to the individual one or more subsequent doses of the ds RNAi agent, wherein the one or more subsequent doses are from about 4 mg to about 608 mg, and wherein the one or more subsequent doses are administered from about every 1 month (Q1M) to about every 12 months (Q12M) from the first dose or a previous dose; 36. The method of any one of claims 33-35, wherein the individual's Lp(a) levels are maintained at the level after the first dose or are further reduced from the level after the first dose.

37. 37. The method of any one of claims 33-36, wherein the administering is intravenous (IV) or subcutaneous (SC).

38. 38. The method of claim 37, wherein said administering is SC.

39. 39. The method of any one of claims 36 to 38, wherein the one or more subsequent doses are the same as the first dose.

40. 39. The method of any one of claims 36 to 38, wherein the one or more subsequent doses are not the same as the first dose.

41. 41. The method of any one of claims 33-40, wherein the first dose is selected from the group consisting of about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, and about 608 mg.

42. 42. The method of any one of claims 33-41, wherein the one or more subsequent doses are independently selected from the group consisting of about 4 mg, about 12 mg, about 16 mg, about 32 mg, about 96 mg, about 304 mg, about 400 mg, and about 608 mg.

43. 37. The method of claim 36, wherein the first dose is about 4 mg and the one or more subsequent doses are about 4 mg administered about every Q1M, about 4 mg administered about every Q3M, about 4 mg administered about every Q6M, about 4 mg administered about every Q9M, or about 4 mg administered about every Q12M from the first dose or the previous dose.

44. 37. The method of claim 36, wherein the first dose is about 12 mg and the one or more subsequent doses are about 12 mg administered about every Q1M, about 12 mg administered about every Q3M, about 12 mg administered about every Q6M, about 12 mg administered about every Q9M, or about 12 mg administered about every Q12M from the first dose or the previous dose.

45. 37. The method of claim 36, wherein the first dose is about 16 mg and the one or more subsequent doses are about 16 mg administered about every Q1M, about 16 mg administered about every Q3M, about 16 mg administered about every Q6M, about 16 mg administered about every Q9M, or about 16 mg administered about every Q12M from the first dose or the previous dose.

46. 37. The method of claim 36, wherein the first dose is about 32 mg and the one or more subsequent doses are about 32 mg administered about every Q1M, about 32 mg administered about every Q3M, about 32 mg administered about every Q6M, about 32 mg administered about every Q9M, or about 32 mg administered about every Q12M from the first dose or the previous dose.

47. 37. The method of claim 36, wherein the first dose is about 96 mg and the one or more subsequent doses are about 96 mg administered about every Q1M, about 96 mg administered about every Q3M, about 96 mg administered about every Q6M, about 96 mg administered about every Q9M, or about 96 mg administered about every Q12M from the first dose or the previous dose.

48. 37. The method of claim 36, wherein the first dose is about 304 mg and the one or more subsequent doses are about 304 mg administered about every Q1M, about 304 mg administered about every Q3M, about 304 mg administered about every Q6M, about 304 mg administered about every Q9M, or about 304 mg administered about every Q12M from the first dose or the previous dose.

49. 37. The method of claim 36, wherein the first dose is about 400 mg and the one or more subsequent doses are about 400 mg administered about every Q1M, about 400 mg administered about every Q3M, about 400 mg administered about every Q6M, about 400 mg administered about every Q9M, or about 400 mg administered about every Q12M from the first dose or the previous dose.

50. 37. The method of claim 36, wherein the first dose is about 608 mg and the one or more subsequent doses are about 608 mg administered about every Q1M, about 608 mg administered about every Q3M, about 608 mg administered about every Q6M, about 608 mg administered about every Q9M, or about 608 mg administered about every Q12M from the first dose or the previous dose.

51. 37. The method of claim 36, wherein the first dose is from about 4 mg to about 608 mg and the one or more subsequent doses are from about 4 mg to about 608 mg and are administered about every Q6M from the first dose or the previous dose.

52. 37. The method of claim 36, wherein the first dose is from about 4 mg to about 608 mg, the second dose is from about 4 mg to about 608 mg and is administered about Q6M from the first dose, and any subsequent dose is from about 4 mg to about 608 mg and is administered about every Q12M from the second dose or the previous dose.

53. 37. The method of claim 36, wherein the first dose is from about 4 mg to about 608 mg and the one or more subsequent doses are from about 4 mg to about 608 mg and are administered about every Q12M from the first dose or the previous dose.

54. (c) measuring the individual's Lp(a) level at least once during step (a) and / or step (b); (d) optionally, during step (a) and / or step (b), recording the frequency and severity of adverse events (AEs) in said individual; (e) determining an adjusted subsequent dose of the ds RNAi agent from the individual's Lp(a) in step (c) and / or from the frequency and severity of the individual's AEs in step (d); (f) administering the adjusted subsequent dose of the ds RNAi agent to the individual.

55. 55. The method of any one of claims 33-54, wherein the individual's Lp(a) level is maintained below 125 nmol / L after the first dose.

56. 56. The method of any one of claims 33 to 55, wherein said individual has a disease, disorder and / or condition associated with apolipoprotein(a) gene (LPA) expression selected from the group consisting of atherosclerosis, calcific aortic valve stenosis (CAVS), cardiometabolic disease, coronary revascularization, CV mortality, cerebrovascular disease, chronic kidney disease, coronary heart disease, dyslipidemia, heart failure, cardiovascular (CV) events including MI and stroke, and peripheral vascular disease.

57. 1. A method of attenuating, preventing and / or treating a disease, disorder and / or condition associated with LPA expression in an individual, comprising: (a) administering to an individual an effective amount of the pharmaceutical composition of any one of claims 1 to 11.

58. 1. A method for reducing apolipoprotein(a) gene (LPA) expression in an individual with high lipoprotein(a) (Lp(a)) levels, comprising: (a) administering to said individual an effective amount of the pharmaceutical composition of any one of claims 1 to 11.

59. 1. A method of attenuating, preventing and / or treating a disease, disorder and / or condition associated with apolipoprotein(a) gene (LPA) expression in an individual, comprising: (a) administering to the individual a first dose of a double-stranded (ds) RNAi agent that modulates LPA expression, wherein the first dose is about 400 mg, and the ds RNAi agent comprises: (i) a sense strand comprising SEQ ID NO: 1, and (ii) comprising an antisense strand comprising SEQ ID NO:2; (b) administering to said individual at least one subsequent dose of said ds RNAi agent about every six months (Q6M) from said first dose or a previous consecutive dose, wherein said at least one subsequent dose is about 400 mg; (c) administering to the individual an additional dose of the ds RNAi agent about every twelve months (Q12M) after step (b), wherein the additional dose is about 400 mg.

60. 60. The method of claim 59, wherein the at least one subsequent dose in step (b) is a second dose.

61. 60. The method of claim 59, wherein the at least one subsequent dose in step (b) is a second dose and a third dose.

62. 60. The method of claim 59, wherein the at least one subsequent dose in step (b) is a second dose, a third dose, and a fourth dose.

63. 63. The method of any one of claims 59-62, wherein said administering is intravenous (IV) or subcutaneous (SC).

64. 64. The method of claim 63, wherein said administering is SC.

65. 65. The method of any one of claims 59 to 64, wherein the sense strand is SEQ ID NO:

3.

66. The method of any one of claims 59 to 65, wherein the antisense strand is SEQ ID NO:

4.

67. 67. The method of any one of claims 59 to 66, wherein the individual has atherosclerotic cardiovascular disease (ASCVD) and / or an Lp(a) level of about 125 nmol / L or greater.

68. 67. The method of any one of claims 59 to 66, wherein the individual is at risk for a first cardiovascular (CV) event.

69. 69. The method of claim 68, wherein the individual further has an Lp(a) level of about 125 nmol / L or greater.

70. 70. The method of claim 67 or 69, wherein the Lp(a) level is 175 nmol / L or greater.