Novel carnosine synthase and method for producing carnosine using the same

Abstract

The present application relates to a polypeptide having carnosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising one or more of the polypeptide, polynucleotide, and vector containing the polynucleotide; a mutant polypeptide having carnosine synthase activity; a polynucleotide encoding the mutant polypeptide; a microorganism comprising one or more of the mutant polypeptide, polynucleotide, and vector containing the polynucleotide; a composition for producing carnosine comprising one or more of the polypeptide having carnosine synthase activity, the mutant polypeptide, a microorganism, and a culture thereof; a method for producing carnosine using one or more of the polypeptide having carnosine synthase activity, the mutant polypeptide, and a microorganism; and the use of the polypeptide having carnosine synthase activity, the mutant polypeptide, and the microorganism for producing carnosine.

Description

[Technical Field]

[0001] The present application relates to: a polypeptide having carnosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising one or more of the polypeptide, polynucleotide, and vector comprising the polynucleotide; a mutant polypeptide having carnosine synthase activity; a polynucleotide encoding the mutant polypeptide; a microorganism comprising one or more of the mutant polypeptide, polynucleotide, and vector comprising the polynucleotide; a composition for producing carnosine comprising one or more of the polypeptide, mutant polypeptide, microorganism, and culture thereof having carnosine synthase activity; a method for producing carnosine using one or more of the polypeptide, mutant polypeptide, and microorganism having carnosine synthase activity; and the use of the polypeptide, mutant polypeptide, and microorganism having carnosine synthase activity for producing carnosine. [Background technology]

[0002] Carnosine is found in high concentrations in muscle and brain tissues and is known to have antioxidant and muscle fatigue-reducing effects as a physiologically active peptide.

[0003] Carnosine is produced through enzymatic conversion (US Pat. No. 4,359,416), but since it requires a large amount of substrate and ATP, industrial mass production is not easy due to the cost. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] U.S. Patent No. 4,359,416 [Patent Document 2] Korean Patent Registration No. 10-0924065 [Patent Document 3] International Publication No. 2008 / 033001 [Patent Document 4] Korean Registration Patent No. 10-1126041 [Patent Document 5] U.S. Patent No. 7662943 [License 6] U.S. Patent No. 10584338 [License 7] U.S. Patent No. 10273491 [Non-licensed literature]

[0005] [Non-licensed Document 1] Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453 [Non-licensed Document 2] Rice et al., 2000, Trends Genet. 16:276-277 [Non-licensed Document 3] J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989 [Non-licensed Document 4] FM Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, 9.50-9.51,11.7-11.8 [Non-licensed Document 5] Pearson et al (1988)[Proc. Natl. Acad. Sci. USA 85]:2444 [Non-licensed Document 6] Devereux,J.,et al,Nucleic Acids Research 12:387(1984) [Non-licensed Document 7] Atschul,[S.] [F.,] [ET AL,J MOLEC BIOL 215]:403 (1990) [Non-licensed document 8] Guide to Huge Computers,Martin J. Bishop,[ED.,] Academic Press,San Diego, 1994

Non-licensed literature 9

Non-licensed literature 10

Non-licensed Document 11

Non-licensed Document 12

Non-licensed Document 13

Non-licensed Document 14

Non-licensed Document 15

Non-licensed Document 16

[0006] The problem to be solved by this application is to provide: a polypeptide having carnosine synthase activity; a polynucleotide encoding the polypeptide; a microorganism comprising one or more of the polypeptide, polynucleotide, and vector containing the polynucleotide; a mutant polypeptide having carnosine synthase activity; a polynucleotide encoding the mutant polypeptide; a microorganism comprising one or more of the mutant polypeptide, polynucleotide, and vector containing the polynucleotide; a composition for producing carnosine comprising one or more of the polypeptide, mutant polypeptide, microorganism, and culture thereof having carnosine synthase activity; a method for producing carnosine using one or more of the polypeptide, mutant polypeptide, and microorganism having carnosine synthase activity; and use of the polypeptide, mutant polypeptide, and microorganism having carnosine synthase activity for producing carnosine. [Means for solving the problem]

[0007] One object of the present application is to provide a polypeptide having carnosine synthase activity, comprising the amino acid sequence of SEQ ID NO:2.

[0008] Another object of the present application is to provide a polynucleotide encoding the polypeptide having the carnosine synthase activity.

[0009] Another object of the present application is to provide a microorganism containing one or more of the polypeptide having carnosine synthase activity, a polynucleotide encoding the same, and a vector containing the polynucleotide.

[0010] Another object of the present application is to provide a mutant polypeptide having carnosine synthase activity in which the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 are substituted with other amino acids.

[0011] Another object of the present application is to provide polynucleotides encoding the mutant polypeptides.

[0012] Another object of the present application is to provide a microorganism containing any one or more of the mutant polypeptide, a polynucleotide encoding the same, and a vector containing the polynucleotide.

[0013] Another object of the present application is to provide a composition for producing carnosine, comprising one or more of: a polypeptide having carnosine synthase activity; a microorganism containing one or more of the polypeptide having carnosine synthase activity, a polynucleotide encoding the polypeptide, and a vector containing the polynucleotide; a culture thereof; the mutant polypeptide; a microorganism containing one or more of the mutant polypeptide, a polynucleotide encoding the mutant polypeptide, and a vector containing the polynucleotide; and a culture thereof.

[0014] Another object of the present application is to provide a method for producing carnosine, which comprises culturing said microorganism.

[0015] Another object of the present application is to provide uses of the polypeptide having carnosine synthase activity, the mutant polypeptide, and the microorganism for producing carnosine. [Effects of the Invention]

[0016] Efficient carnosine production is possible using the polypeptides, mutant polypeptides, polynucleotides, microorganisms, compositions, and / or methods having carnosine synthase activity of the present application. DETAILED DESCRIPTION OF THE INVENTION

[0017] This will be explained in more detail as follows. Meanwhile, each description and embodiment disclosed in this application can also be applied to each other description and embodiment. In other words, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the specific descriptions described below are not considered to limit the category of this application.

[0018] Additionally, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific aspects of the present application described herein, and such equivalents are intended to be encompassed by this application.

[0019] Furthermore, throughout this specification, numerous papers and patent documents are referenced and citations are provided, the disclosures of which are incorporated herein by reference in their entirety to more clearly explain the state of the art to which this application pertains and the contents of the present invention.

[0020] One aspect of the present application provides a polypeptide having carnosine synthase activity, comprising the amino acid sequence of SEQ ID NO:2.

[0021] In this application, the term "carnosine synthase" refers to an enzyme that can catalyze the reaction of producing carnosine using beta-alanine and L-histidine as substrates, and may be used interchangeably with L-ligase and LAL because it belongs to the ligase family. A specific example of carnosine synthase is an enzyme comprising the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

[0022] In the present application, the term "polypeptide having carnosine synthase activity" means a polypeptide having carnosine synthase activity comprising the amino acid sequence of SEQ ID NO:2.

[0023] In one embodiment, a polypeptide having carnosine synthase activity in the present application may include the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence having 60% or more homology or identity thereto, but is not limited thereto as long as it has carnosine synthase activity. The amino acid sequence may be a polypeptide containing SEQ ID NO: 2 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto, and may have, comprise, consist of, or essentially consist of an amino acid sequence having such homology or identity. Although it is not known whether SEQ ID NO: 2 has carnosine synthase activity, the amino acid sequence of SEQ ID NO: 2 itself can be obtained from publicly known databases such as NCBI's GenBank or KEGG (Kyoto Encyclopedia of Genes and Genomes). For example, the polypeptide having carnosine synthase activity may be derived from the genus Streptococcus or Streptococcus pneumoniae, but is not limited thereto.

[0024] Furthermore, although the present application defines a protein containing the amino acid sequence of SEQ ID NO: 2 as an example of a carnosine synthase, it is clear that polypeptides having an amino acid sequence with partial deletion, modification, substitution, or addition are also included within the scope of the present application, so long as they have the above-mentioned homology or identity and exhibit the same or corresponding activity as the protein consisting of the amino acid sequence of SEQ ID NO: 2. For example, this does not exclude addition of sequences before or after the amino acid sequence of SEQ ID NO: 2 that do not change the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions thereof, and it is clear that even if such additions or mutations are present, they are within the scope of the present application as long as they have the same or corresponding activity as the protein.

[0025] Furthermore, the carnosine synthase protein having the amino acid sequence of SEQ ID NO: 2 may have or contain a base sequence of SEQ ID NO: 11 or a base sequence that is 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homologous or identical to the sequence of SEQ ID NO: 11, or may consist of or be encoded by a polynucleotide that essentially consists of the sequence of SEQ ID NO: 11 or a base sequence that is 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homologous or identical to the sequence of SEQ ID NO: 11, but is not limited thereto.

[0026] Another aspect of the present application provides a mutant polypeptide having carnosine synthase activity, in which one or more of the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 are substituted with other amino acids.

[0027] In the present application, the term "mutant polypeptide having carnosine synthase activity" refers to a mutant polypeptide having carnosine synthase activity in which one or more of the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 are substituted with other amino acids. In the present application, the term "mutant polypeptide having carnosine synthase activity" may be used interchangeably with "mutant polypeptide."

[0028] In one embodiment, the reference carnosine synthase to be mutated in the present application is the same as the polypeptide having carnosine synthase activity described above.

[0029] As used herein, the term "variant" refers to a polypeptide or protein that differs from the recited sequence in one or more amino acids by conservative substitutions and / or modifications, but that retains the functions or properties of the polypeptide or protein.

[0030] The variants can generally be identified by modifying one or more amino acids in the amino acid sequence of the polypeptide or protein and evaluating the properties of the modified polypeptide or protein. That is, the ability of the variant may be increased, unchanged, or decreased compared to the unmutated protein. Some variants may also include variants in which one or more portions, such as an N-terminal leader sequence or a transmembrane domain, have been removed. Other variants may include variants in which portions have been removed from the N- and / or C-termini of the mature protein. The term "variant" may be interchangeable with terms such as "mutated type," "variant," "mutated polypeptide," "mutated protein," "mutant," and "divergent" (in English, "modification," "modified polypeptide," "modified protein," "mutant," "mutein," "divergent," etc.), and is not limited to these terms as long as they are used to mean "mutated."

[0031] As used herein, the term "conservative substitution" refers to the replacement of an amino acid with another amino acid having similar structural and / or chemical properties. Typically, conservative substitutions have little or no effect on the activity of the resulting protein or polypeptide. Furthermore, such variants can have one or more conservative substitutions while still retaining one or more biological activities.

[0032] Such amino acid substitutions may generally be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or the amphipathic nature of the residues. For example, positively charged (basic) amino acids include arginine, lysine, and histidine; negatively charged (acidic) amino acids include glutamic acid and aspartate; aromatic amino acids include phenylalanine, tryptophan, and tyrosine; and hydrophobic amino acids include alanine, valine, isoleucine, leucine, methionine, phenylalanine, tyrosine, and tryptophan. Amino acids can be further classified into those with electrically charged side chains and those with uncharged side chains. Amino acids with electrically charged side chains include aspartic acid, glutamic acid, lysine, arginine, and histidine. Amino acids with uncharged side chains can be further classified into nonpolar amino acids and polar amino acids. Nonpolar amino acids include glycine, alanine, valine, leucine, isoleucine, methionine, phenylalanine, tryptophan, and proline. Polar amino acids include, but are not limited to, serine, threonine, cysteine, tyrosine, asparagine, and glutamine.

[0033] Furthermore, the polypeptides having carnosine synthase activity and the variant polypeptides having carnosine synthase activity may contain amino acid deletions or additions that have minimal effects on the properties and secondary structure of the polypeptides. For example, the polypeptides may be conjugated to N-terminal signal (or leader) sequences of proteins involved in co- or post-translational protein transfer. The polypeptides may also be conjugated to other sequences or linkers that allow the polypeptides to be identified, purified, or synthesized.

[0034] In one embodiment, the mutant polypeptide of the present application may have carnosine synthase activity in which the amino acids corresponding to positions 108 and 378 from the N-terminus of SEQ ID NO: 2 are substituted with other amino acids.

[0035] In the present application, "substitution with another amino acid" is not limited as long as the amino acid is different from the amino acid before substitution. On the other hand, when the expression "a specific amino acid is substituted" is used in the present application, it is self-evident that the amino acid is substituted with an amino acid different from the amino acid before substitution, even if it is not specifically stated that the amino acid is substituted with another amino acid.

[0036] The "Nth position" in the present application may include the Nth position and the amino acid position corresponding to the Nth position. For example, it may include the amino acid position corresponding to any amino acid residue in a mature polypeptide disclosed in a specific amino acid sequence. For example, the specific amino acid sequence may be the amino acid sequence of SEQ ID NO: 2.

[0037] As used herein, the term "corresponding to" refers to the amino acid residue at the recited position in the polypeptide, or an amino acid residue that is similar, identical, or homologous to the recited residue in the polypeptide. Identifying the amino acid at the corresponding position may be determining the particular amino acid in a sequence that references a particular sequence. As used herein, "corresponding region" generally refers to a similar or corresponding position in a related or reference protein.

[0038] For example, any amino acid sequence can be aligned with SEQ ID NO: 2, based on which each amino acid residue in the amino acid sequence can be numbered with reference to the numeric position of the corresponding amino acid residue in SEQ ID NO: 2. For example, a sequence alignment algorithm such as those described herein can identify amino acid positions or positions where variations such as substitutions, insertions, or deletions occur compared to a query sequence (also referred to as a "reference sequence").

[0039] For such alignment, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453) or the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) can be used, but is not limited to these. Sequence alignment programs, pairwise sequence comparison algorithms, and the like known in the art can also be used appropriately.

[0040] In one embodiment, the mutant polypeptide of the present application may have the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 substituted with other amino acids, and may have a sequence identity of 60% or more and less than 100%, specifically, a sequence identity of 80% or more and less than 100%, with the amino acid sequence of SEQ ID NO: 2, but is not limited thereto.

[0041] As one embodiment of the above-mentioned embodiments, the variant polypeptide of the present application may include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% or more homology or identity to the amino acid sequence of SEQ ID NO: 2, in which the amino acid corresponding to the 108th position and the amino acid corresponding to the 378th position from the N-terminus of SEQ ID NO: 2 are substituted with other amino acids. It is also clear that variants having an amino acid sequence in which a portion of the sequence is deleted, modified, substituted, conservatively substituted, or added are also included within the scope of the variant polypeptide of the present application, as long as the amino acid sequence has the above-mentioned homology or identity and exhibits the activity corresponding to the variant polypeptide of the present application.

[0042] In one embodiment, the mutant polypeptide of the present application may have the amino acid corresponding to position 108 from the N-terminus of SEQ ID NO: 2 substituted with glutamic acid and the amino acid corresponding to position 378 substituted with lysine.

[0043] In one embodiment, the mutant polypeptide of the present application may have the asparagine corresponding to the 108th amino acid from the N-terminus of SEQ ID NO: 2 substituted with glutamic acid, and the histidine corresponding to the 378th amino acid from the N-terminus of SEQ ID NO: 2 substituted with lysine.

[0044] In one embodiment of the above-mentioned embodiment, the variant polypeptide of the present application is fixed by substituting the amino acid corresponding to position 108 of the amino acid sequence of SEQ ID NO: 2 with glutamic acid and the amino acid corresponding to position 378 with lysine, and may include an amino acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, 99.8%, or 99.9% or more homology or identity to SEQ ID NO: 2.

[0045] In one embodiment, the variant polypeptide of the present application may comprise the amino acid sequence of SEQ ID NO: 8. The variant polypeptide of the present application may have, comprise, consist of, or essentially consist of an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity to SEQ ID NO: 8.

[0046] Furthermore, it is clear that the mutant polypeptide of the present application also includes proteins having an amino acid sequence in which a portion of the sequence other than the amino acids at positions 108 and 378 has been deleted, modified, substituted, conservatively substituted, or added, so long as it has the same or equivalent activity as a protein consisting of the amino acid sequence of SEQ ID NO: 8. For example, it is clear that the scope of the present application includes additions of sequences that do not change the function of the protein before or after the amino acid sequence, naturally occurring mutations, silent mutations, or conservative substitutions, and even cases in which such additions or mutations of sequences do not affect the function of the protein, are included, so long as they have the same or equivalent activity as the mutant polypeptide.

[0047] In one embodiment, the mutant polypeptide of the present application may have enhanced carnosine synthase activity compared to the polypeptide before mutation, but is not limited thereto.

[0048] Another aspect of the present application provides a polynucleotide encoding a polypeptide having carnosine synthase activity of the present application.

[0049] Another aspect of the present application provides polynucleotides encoding the variant polypeptides of the present application.

[0050] In this application, the term "polynucleotide" refers to a DNA or RNA chain of a certain length or greater, which is a polymer of nucleotides in which nucleotide units are covalently linked in a long chain, and more specifically, refers to a polynucleotide fragment encoding a polypeptide and / or mutant polypeptide having the carnosine synthase activity.

[0051] Polynucleotides encoding the polypeptides and / or mutant polypeptides having carnosine synthase activity of the present application may include, without limitation, any polynucleotide sequence that encodes a polypeptide having activity corresponding to the polypeptides and / or mutant polypeptides having carnosine synthase activity of the present application.

[0052] Polynucleotides encoding the polypeptides and / or variant polypeptides of the present application having carnosine synthase activity may be modified in various ways in the coding region without changing the amino acid sequence of the polypeptides and / or variant polypeptides of the present application having carnosine synthase activity, taking into consideration codon degeneracy or codons preferred in the organism in which the polypeptides and / or variant polypeptides of the present application having carnosine synthase activity are to be expressed. Therefore, it is clear that variants having polynucleotide sequences in which partial sequences have been deleted, modified, substituted, conservatively substituted, or added are also included within the scope of the present application, as long as the polynucleotide sequence is capable of encoding the amino acid sequence of the polypeptides and / or variant polypeptides of the present application having carnosine synthase activity or polypeptides having homology or identity thereto, taking into consideration codon degeneracy or codons preferred in the organism in which the polypeptides and / or variant polypeptides of the present application having carnosine synthase activity are to be expressed.

[0053] In one embodiment, the polynucleotide encoding a polypeptide having carnosine synthase activity of the present application may have, comprise, consist of, or essentially consist of a nucleic acid sequence having a homology or identity of 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more to the sequence of SEQ ID NO: 11, but is not limited thereto.

[0054] As an example, the polynucleotide encoding the polypeptide having carnosine synthase activity of the present application may be SEQ ID NO: 11 or a degenerated sequence thereof.

[0055] In one embodiment, a polynucleotide encoding a variant polypeptide of the present application may include, but is not limited to, a base sequence having 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homology or identity to the sequence of SEQ ID NO: 11, in which the codons encoding the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 are substituted with codons encoding different amino acids (e.g., glutamic acid or lysine).

[0056] As an example, a polynucleotide encoding a variant polypeptide of the present application may have a base sequence that is 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% or more homologous or identical to the sequence of SEQ ID NO: 11, in which the codon encoding the amino acid corresponding to the 108th position from the N-terminus of SEQ ID NO: 2 may be a codon encoding glutamic acid and / or the codon encoding the amino acid corresponding to the 378th position may be a codon encoding lysine.

[0057] As another example, a polynucleotide encoding a variant polypeptide of the present application may be SEQ ID NO: 17 or a degenerated sequence thereof.

[0058] In one embodiment, a polynucleotide encoding a variant polypeptide of the present application may have, comprise, consist of, or essentially consist of SEQ ID NO: 17, or a nucleic acid sequence having at least 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.7%, or 99.9% homology or identity thereto, but less than 100%, but is not limited thereto.

[0059] Furthermore, the polynucleotide encoding the polypeptide having carnosine synthase activity of the present application and the polynucleotide encoding the mutant polypeptide of the present application may include, without limitation, a probe prepared from a known gene sequence, for example, a sequence that can hybridize under stringent conditions with a complementary sequence to all or part of the polynucleotide sequence of the present application.

[0060] The term "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. Such conditions are specifically described in the literature (see J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York, pp. 9.50-9.51, 11.7-11.8). For example, conditions include conditions under which polynucleotides with high homology or identity, such as polynucleotides with a homology or identity of 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more, hybridize with each other, but polynucleotides with lower homology or identity do not hybridize with each other; or conditions under which washing is performed once, specifically two to three times, at a salt concentration and temperature equivalent to the washing conditions for conventional Southern hybridization, such as 60°C, 1X SSC, and 0.1% SDS, specifically 60°C, 0.1X SSC, and 0.1% SDS, more specifically 68°C, 0.1X SSC, and 0.1% SDS.

[0061] Hybridization requires that two nucleic acids have complementary sequences, even if the stringency of the hybridization allows for mismatches between bases. The term "complementary" is used to describe the relationship between nucleotide bases that are capable of hybridizing to one another. For example, in DNA, adenine is complementary to thymine, and cytosine is complementary to guanine. Thus, the polynucleotides of the present application can also include isolated nucleic acid fragments that are complementary to entire sequences, as well as substantially similar nucleic acid sequences.

[0062] Specifically, polynucleotides having homology or identity to the polynucleotides of the present application can be detected using the above-mentioned hybridization conditions, including a hybridization step at a Tm value of 55° C. The Tm value may be, but is not limited to, 60° C., 63° C., or 65° C., and may be appropriately adjusted by those skilled in the art depending on the purpose.

[0063] The appropriate stringency for hybridizing the polynucleotides depends on the length of the polynucleotides and the degree of complementation, variables well known in the art (eg, J. Sambrook et al., supra).

[0064] As used herein, the term "homology" or "identity" refers to the degree of similarity between two given amino acid or nucleotide sequences, and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0065] Sequence homology or identity of conserved polynucleotides or polypeptides can be determined by standard sequence algorithms, with default gap penalties established by the program used. Substantially homologous or identical sequences can generally hybridize to all or part of the sequence under moderately or highly stringent conditions. Hybridization obviously includes hybridization to polynucleotides containing common codons in polynucleotides or codons that take codon degeneracy into account.

[0066] Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined using known computer algorithms such as the "FASTA" program using default parameters, e.g., as in Pearson et al. (1988) [Proc. Natl. Acad. Sci. USA 85]:2444. Alternatively, it can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48:443-453), as implemented in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16:276-277) (version 5.0.0 or later), as implemented in the GCG program package (Devereux, J., et al., Nucleic Acids Research 12:387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.] [ET AL, J MOLEC BIOL 215]:403 (1990); Guide to Huge Computers, Martin J. Bishop, [Ed.] Academic Press, San Diego, 1994, and [CARILLO ETA / .](1988) SIAM J Applied Math 48:1073. For example, BLAST or ClustalW from the National Database Center for Biotechnology Information can be used to determine homology, similarity or identity.

[0067] Homology, similarity, or identity of polynucleotides or polypeptides can be determined by comparing sequence information using a GAP computer program, such as that described in Needleman et al. (1970), J Mol Biol. 48:443, as known in, for example, Smith and Waterman, Adv. Appl. Math (1981) 2:482. Briefly, the GAP program defines a match as the total number of symbols in the shorter of the two sequences divided by the number of similar aligned symbols (i.e., nucleotides or amino acids). Default parameters for the GAP program include: (1) a binary comparison matrix (containing a value of 1 for identity and 0 for non-identity) and the weighted comparison matrix of Gribskov et al. (1986) Nucl. Acids Res. 14:6745 (or the EDNAFULL (the EMBOSS version of NCBI NUC4.4) substitution matrix) as disclosed by Schwartz and Dayhoff, eds., Atlas of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty for end gaps. Thus, as used herein, the terms "homology" or "identity" indicate the relevance between sequences.

[0068] Another aspect of the present application provides a vector comprising a polynucleotide encoding a polypeptide and / or a mutant polypeptide having carnosine synthase activity of the present application.

[0069] The polynucleotide is as described in other embodiments.

[0070] The vector may be, but is not limited to, an expression vector for expressing the polynucleotide in a microorganism.

[0071] In this application, the term "vector" may also include a DNA construct containing a base sequence of a polynucleotide encoding a polypeptide of interest operably linked to a suitable expression control region (or expression control sequence) so as to enable the expression of the polypeptide of interest in a suitable host. The expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosomal binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable microorganism, the vector can replicate or function independently of the host genome, or it can be integrated into the genome itself.

[0072] The vectors used in the present application are not particularly limited, and any vector known in the art can be used. Examples of commonly used vectors include naturally occurring or recombinant plasmids, cosmids, viruses, and bacteriophages. For example, pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage or cosmid vectors, and pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, and pET can be used as plasmid vectors. Specifically, pDZ (Korean Patent Registration No. 10-0924065 and International Patent Publication No. 2008-033001), pDZTn (Korean Patent Registration No. 10-1126041), pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors, etc. can be used.

[0073] For example, a polynucleotide encoding a target polypeptide can be inserted into a chromosome via a vector for chromosomal integration in a cell. The polynucleotide can be inserted into a chromosome by any method known in the art, including, but not limited to, homologous recombination. A selection marker for confirming the presence or absence of insertion into the chromosome may also be included. The selection marker is used to select cells transformed with the vector, i.e., to confirm the presence or absence of insertion of the target nucleic acid molecule. Markers that confer selectable phenotypes, such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface polypeptides, can be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or exhibit other phenotypes, allowing the selection of transformed cells.

[0074] The term "transformation" as used herein refers to the introduction of a vector containing a polynucleotide encoding a target polypeptide into a microorganism or microorganisms, thereby enabling the expression of the polypeptide encoded by the polynucleotide in the microorganism. A transformed polynucleotide may include any polynucleotide, regardless of whether it is located within the chromosome of the microorganism or extrachromosomally, as long as it is expressible in the microorganism. The polynucleotide may also include DNA and / or RNA encoding the target polypeptide. The polynucleotide may be introduced in any form that can be introduced and expressed in the microorganism. For example, the polynucleotide may be introduced into the microorganism in the form of an expression cassette, which is a genetic construct containing all elements necessary for its own expression. The expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal operably linked to the polynucleotide. The expression cassette may also be in the form of a self-replicating expression vector. The polynucleotide may also be introduced into the microorganism in its own form, operably linked to sequences necessary for its expression in the microorganism, but is not limited thereto.

[0075] Methods for transforming the vectors of the present application include any method for introducing nucleic acids into cells, and can be performed by selecting standard techniques appropriate to the host cell as known in the art, including, but not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.

[0076] Furthermore, the term "operably linked" means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the polypeptide and / or mutant polypeptide having carnosine synthase activity of the present application.

[0077] Another aspect of the present application provides a microorganism comprising any one or more of the polypeptide having carnosine synthase activity of the present application, a polynucleotide encoding the same, and a vector comprising the polynucleotide.

[0078] Another aspect of the present application provides a microorganism comprising any one or more of the mutant polypeptides of the present application, polynucleotides encoding the same, and vectors comprising the polynucleotides.

[0079] The polypeptide, mutant polypeptide, polynucleotide, and vector having carnosine synthase activity are as described in other aspects.

[0080] In this application, the term "microorganism (or strain)" includes all wild-type microorganisms and naturally or artificially genetically modified microorganisms, including microorganisms in which a specific mechanism has been weakened or enhanced by inserting an exogenous gene or by enhancing or inactivating the activity of an endogenous gene, and may also include microorganisms that have been genetically modified for the production of carnosine. In this application, the terms "strain" and "microorganism" may be used interchangeably without limitation.

[0081] The microorganism of the present application may be a microorganism in which the panD gene encoding the aspartate 1-decarboxylase protein necessary for converting aspartate to beta-alanine has been introduced to give carnosine production ability to a microorganism that does not inherently have the ability to produce carnosine, or to further enhance the carnosine production ability of a microorganism that does have the ability to produce carnosine. The aspartate 1-decarboxylase protein may be any protein that exhibits the same or similar activity as the panD gene, but is not limited thereto. As a specific example, the aspartate 1-decarboxylase protein may consist of or contain the amino acid sequence of SEQ ID NO: 9. Alternatively, the aspartate 1-decarboxylase protein may consist of or contain an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homologous or identical to the amino acid sequence and exhibits activity corresponding to the aspartate 1-decarboxylase. It is clear that aspartate 1-decarboxylase also includes proteins with the homology or identity, but with partial deletion, modification, substitution, or addition of a sequence, as long as the protein exhibits activity corresponding to the aspartate 1-decarboxylase. As a specific example, the polynucleotide encoding the aspartate 1-decarboxylase protein may consist of or contain the sequence of SEQ ID NO: 18. The polynucleotide may be modified in various ways in the coding region without changing the amino acid sequence, taking into account codon degeneracy or codons preferred in the microorganism of the present application. Specifically, the polynucleotide may consist of or include the nucleotide sequence of SEQ ID NO: 18 or a nucleotide sequence having 60% or more, 70% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or less than 100% homology or identity to the sequence of SEQ ID NO: 18, but is not limited thereto.

[0082] In one embodiment, the microorganism of the present application may be a microorganism belonging to the genus Enterobacter, Escherichia, Erwinia, Serratia, Providencia, Corynebacterium, or Brevibacterium. More specifically, the microorganism may be a microorganism of the genus Corynebacterium, but is not limited thereto.

[0083] In one embodiment of the above-mentioned embodiment, the microorganism of the present application is Corynebacterium glutamicum, Corynebacterium crudilactis, Corynebacterium deserti, Corynebacterium efficiens, Corynebacterium callunae, Corynebacterium stationis, Corynebacterium singulare, Corynebacterium halotolerans, Corynebacterium striatum, Corynebacterium The bacterial strain may be, but is not limited to, Corynebacterium striatum, Corynebacterium ammoniagenes, Corynebacterium pollutisoli, Corynebacterium imitans, Corynebacterium testudinoris, or Corynebacterium flavescens. Specifically, the bacterial strain may be, but is not limited to, Corynebacterium glutamicum.

[0084] As an embodiment of the microorganism of the present application, a microorganism containing one or more of the polypeptide having carnosine synthase activity of the present application, the polynucleotide encoding the same, and the vector containing the polynucleotide may have further enhanced activity of Aromatic amino acid transport protein (AroP), but is not limited thereto.

[0085] As one example of the above-mentioned embodiment, the activity of the AroP protein may be further enhanced in a microorganism containing one or more of the polypeptide having carnosine synthase activity of the present application, the polynucleotide encoding the same, and the vector containing the polynucleotide, thereby increasing the ability to produce carnosine.

[0086] As an embodiment of the microorganism of the present application, a microorganism containing one or more of the mutant polypeptide of the present application, the polynucleotide encoding the same, and the vector containing the polynucleotide may have further enhanced activity of the AroP protein, but is not limited thereto.

[0087] As one embodiment of the above-mentioned embodiment, the activity of the AroP protein may be further enhanced in a microorganism containing one or more of the mutant polypeptide of the present application; the polynucleotide encoding the same; and the vector containing the polynucleotide, thereby increasing the ability to produce carnosine.

[0088] In the present application, the term "AroP protein" refers to an aromatic amino acid transport protein, and may be used interchangeably with "AroP." The aromatic amino acid may include phenylalanine, tryptophan, and tyrosine. The AroP may be encoded by the aroP gene, but is not limited thereto.

[0089] In one embodiment, the AroP protein of the present application may include, but is not limited to, the amino acid sequence of SEQ ID NO: 19 or an amino acid sequence having 60% or more homology or identity thereto. The amino acid sequence may be a polypeptide comprising SEQ ID NO: 19 or an amino acid sequence having at least 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity thereto. The sequence of SEQ ID NO: 19 can be obtained from publicly known databases such as NCBI's GenBank or KEGG (Kyoto Encyclopedia of Genes and Genomes). For example, the AroP protein to be enriched may be derived from, but is not limited to, the genus Corynebacterium or Corynebacterium glutamicum.

[0090] Furthermore, although the present application defines a protein comprising the amino acid sequence of SEQ ID NO: 19 as an example of an AroP protein, it is clear that proteins having an amino acid sequence with partial deletions, modifications, substitutions, or additions are also included within the scope of the AroP protein of the present application, so long as they have the above-mentioned homology or identity and exhibit the same or corresponding activity as the protein consisting of the amino acid sequence of SEQ ID NO: 19. For example, this does not exclude additions of sequences before or after the amino acid sequence of SEQ ID NO: 19 that do not alter the function of the protein, naturally occurring mutations, silent mutations, or conservative substitutions thereof, and it is clear that even if such additions or mutations are present, they are within the scope of the present application as long as they have the same or corresponding activity as the protein.

[0091] Furthermore, the AroP protein having the amino acid sequence of SEQ ID NO: 19 may have, comprise, consist of, or be encoded by a polynucleotide that essentially consists of the sequence of SEQ ID NO: 20 or a nucleotide sequence that has 60% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or less than 100% homology or identity thereto, but is not limited thereto.

[0092] As used herein, the term "enhancement" of polypeptide or protein activity means that the activity of a polypeptide or protein is increased compared to its endogenous activity. The term "enhancement" may be used interchangeably with terms such as "activation," "up-regulation," "overexpression," and "increase." The terms "activation," "enhancement," "up-regulation," "overexpression," and "increase" include the display of an activity that was not originally possessed, or the display of an improved activity compared to the endogenous activity or the activity before modification.

[0093] The term "endogenous activity" refers to the activity of a specific polypeptide or protein that a parent strain or non-transformed microorganism originally possessed before the trait change, when the trait is changed due to a genetic mutation caused by natural or artificial factors. This term may be used interchangeably with "activity before transformation." When the activity of a polypeptide or protein is "enhanced," "up-regulated," "overexpressed," or "increased" compared to the endogenous activity, it means that the activity and / or concentration (expression level) of the specific polypeptide or protein is improved compared to the activity and / or concentration (expression level) that a parent strain or non-transformed microorganism originally possessed before the trait change.

[0094] The enhancement can be achieved by introducing an exogenous polypeptide or protein, or by enhancing the activity and / or concentration (expression level) of an exogenous and / or endogenous polypeptide or protein. The enhancement of the activity of the polypeptide or protein can be confirmed by an increase in the activity level, expression level, or amount of a product secreted from the polypeptide or protein.

[0095] The activity of the polypeptide or protein can be enhanced by various methods well known in the art, and is not limited thereto, as long as the activity of the target polypeptide or protein can be enhanced compared to that of the microorganism before transformation. Specifically, the enhancement may be achieved by using genetic engineering and / or protein engineering, which are routine methods in molecular biology and well known to those skilled in the art, but is not limited thereto (e.g., Sitnicka et al., Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2, pp. 1-16; Sambrook et al., Molecular Cloning 2012, etc.). Specifically, the activity of the polypeptide or protein of the present application is enhanced by: 1) an increase in the intracellular copy number of a polynucleotide encoding a polypeptide or protein; 2) replacing the expression regulatory region of a gene on a chromosome that encodes a polypeptide or protein with a sequence with strong activity; 3) a modification of the nucleotide sequence encoding the initiation codon or 5'-UTR region of a gene transcript encoding a polypeptide or protein; 4) modifying the amino acid sequence of the polypeptide or protein so as to enhance the activity of the polypeptide or protein; 5) modifying a polynucleotide sequence encoding a polypeptide or protein so as to enhance the activity of the protein (e.g., modifying the polynucleotide sequence of the protein gene to encode a protein modified so as to enhance the activity of the protein); 6) introduction of a foreign protein or a foreign polynucleotide encoding the same that exhibits the activity of a polypeptide or protein; 7) codon optimization of a polynucleotide encoding a polypeptide or protein; 8) analyzing the tertiary structure of a polypeptide or protein and selectively deforming or chemically modifying exposed sites; or 9) It may be a combination of two or more selected from the above 1) to 8), but is not particularly limited thereto.

[0096] In the above, the copy number of the gene can be increased by, but is not limited to, operably linking the gene to a vector or by inserting the gene into a chromosome in a host cell. Specifically, a vector capable of replicating and functioning independently of a host and having a polynucleotide encoding the protein of the present application operably linked thereto may be introduced into a host cell. Alternatively, a vector operably linking the polynucleotide and inserting the polynucleotide into a chromosome in a host cell may be introduced into the chromosome of the host cell. The polynucleotide can be inserted into a chromosome by any method known in the art, for example, homologous recombination.

[0097] Next, the expression control sequence can be modified to increase the expression of the polynucleotide by, but not limited to, introducing mutations into the nucleic acid sequence by deletion, insertion, non-conservative or conservative substitution, or a combination thereof, to further enhance the activity of the expression control sequence, or by replacing it with a nucleic acid sequence having stronger activity. The expression control sequence can include, but is not limited to, a promoter, an operator sequence, a sequence encoding a ribosome binding site, a sequence regulating the termination of transcription and translation, etc.

[0098] A strong promoter may be ligated to the top of the polynucleotide expression unit in place of the native promoter, but is not limited thereto. Examples of known strong promoters include, but are not limited to, CJ1 to CJ7 promoters (which may be used interchangeably with cj1 to cj7, respectively; U.S. Patent No. US 7,662,943 B2), pyk promoter, lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13 (sm3) promoter (U.S. Patent No. US 10,584,338 B2), O2 promoter (U.S. Patent No. US 10,273,491 B2), tkt promoter, and yccA promoter.

[0099] In addition, the modification of the polynucleotide sequence on the chromosome may be carried out by, but is not limited to, inducing a mutation in the expression regulatory sequence by deleting, inserting, non-conservative or conservative substitution of the nucleic acid sequence, or a combination thereof, so as to further enhance the activity of the polynucleotide sequence, or by replacing it with an improved polynucleotide sequence so as to have even stronger activity.

[0100] In one embodiment, the mutant polypeptide having carnosine synthase activity of the present application may be a mutant polypeptide having carnosine synthase activity that has been enhanced by modifying its amino acid sequence so that the activity of the unmodified polypeptide having carnosine synthase activity (e.g., SEQ ID NO: 2) is enhanced. The polypeptide and mutant polypeptide having carnosine synthase activity of the present application may be further enhanced (e.g., by exchanging the sequence of its gene expression regulatory region).

[0101] In another embodiment, the activity of the AroP protein of the present application may be enhanced by replacing a promoter, which is one of the expression regulatory regions of the gene on the chromosome encoding the AroP protein, with a sequence with stronger activity (e.g., replacing the wild-type promoter in the expression regulatory region of aroP with a pyk or CJ7 promoter), but is not limited thereto.

[0102] In one embodiment, the microorganism of the present application may produce carnosine.

[0103] As used herein, the term "carnosine" refers to a dipeptide consisting of beta-alanine and L-histidine.

[0104] In this application, the term "carnosine-producing microorganism" refers to a prokaryotic or eukaryotic microorganism capable of producing carnosine within its organism, and includes microorganisms in which the ability to produce carnosine has been imparted to a parent strain that does not have the ability to produce carnosine, or microorganisms that have the ability to produce carnosine endogenously. The ability to produce carnosine can be imparted or enhanced by species improvement.

[0105] For example, the microorganism of the present application may be, but is not limited to, a microorganism naturally containing a mutant polypeptide having carnosine synthase activity, a mutant polypeptide having carnosine synthase activity, and / or the ability to produce carnosine; or a microorganism into which a mutant polypeptide having carnosine synthase activity of the present application, a polynucleotide encoding the same (or a vector containing the same), a mutant of the present application or a polynucleotide encoding the same (or a vector containing the same), and / or carnosine-producing ability has been introduced into a parent strain that does not have the ability to produce the mutant polypeptide, mutant polypeptide, and / or carnosine. Furthermore, the microorganism of the present application may include a microorganism in which a chromosomal gene encoding a polypeptide having carnosine synthase activity has been mutated, thereby containing a polypeptide sequence having carnosine synthase activity of the present application, a microorganism containing a mutant polypeptide sequence having carnosine synthase activity of the present application, and a microorganism that has been introduced with a vector containing a polynucleotide encoding a polypeptide and / or mutant polypeptide having carnosine synthase activity of the present application, thereby containing a polypeptide and / or mutant polypeptide having carnosine synthase activity of the present application.

[0106] As another example, the microorganism of the present application may be, but is not limited to, a microorganism naturally having an AroP protein with enhanced activity, a microorganism having wild-type AroP, or a microorganism in which AroP has been enhanced from a parent strain lacking AroP protein. Furthermore, the microorganism of the present application may include both a microorganism in which AroP has been enhanced by mutating the regulatory region of the aroP gene and a microorganism in which AroP has been enhanced by introducing a vector containing the aroP gene.

[0107] In the present application, the term "non-modified microorganism" does not exclude strains containing mutations that may occur naturally in microorganisms, but refers to a wild-type or naturally occurring strain itself, or a strain before its traits are changed due to genetic mutations caused by natural or artificial factors. For example, the non-modified microorganism refers to a strain into which the polypeptide having carnosine synthase activity and the mutant polypeptide described herein have not been introduced or before their introduction. The term "non-modified microorganism" may be used interchangeably with "pre-modified strain," "pre-modified microorganism," "non-mutated strain," "non-modified strain," "non-mutated microorganism," or "reference microorganism."

[0108] For example, the microorganism with increased carnosine production ability may have an increase of about 1% or more, specifically 30% or more, compared to the carnosine production ability of the parent strain or unmodified microorganism before mutation, but is not limited thereto as long as the increase is a positive value compared to the production ability of the parent strain or unmodified microorganism before mutation. For another example, the recombinant strain with increased carnosine production ability may have an increase of about 1.01-fold or more, specifically about 1.30-fold or more, compared to the parent strain or unmodified microorganism before mutation, but is not limited thereto. The term "about" refers to a range that includes ±0.5, ±0.4, ±0.3, ±0.2, ±0.1, etc., and includes all numerical values ​​in a range that is equal to or similar to the value following the term "about," but is not limited thereto.

[0109] As another example, the non-transformed microorganism, which is the subject strain for comparing the increase in carnosine production ability in the present application, may be, but is not limited to, the wild-type Corynebacterium glutamicum strain ATCC13032.

[0110] In one embodiment, a microorganism containing a polypeptide having carnosine synthase activity, a polynucleotide encoding the polypeptide, or a vector containing the polynucleotide of the present application may have increased carnosine production ability compared to a microorganism containing any one of the polypeptides of SEQ ID NOS: 1 and 3 to 7, a polynucleotide encoding the polypeptide, or a combination thereof, but is not limited thereto. The polynucleotides of SEQ ID NOS: 10 and 12 to 16 of the present application may encode the polypeptides of SEQ ID NOS: 1 and 3 to 7, respectively, and the polypeptides of SEQ ID NOS: 1 and 3 to 7 may be encoded by the polynucleotides of SEQ ID NOS: 10 and 12 to 16, respectively, but are not limited thereto.

[0111] In one embodiment, the mutant polypeptide of the present application, the polynucleotide encoding the same, or a microorganism containing the polynucleotide may have increased carnosine production ability compared to a microorganism containing any one of the polypeptides of SEQ ID NOs: 1 to 7, the polynucleotide encoding the same, or a combination thereof, but is not limited thereto.

[0112] In one embodiment, the microorganism in which the activity of the AroP protein is further enhanced in the present application may have increased carnosine production ability compared to a microorganism in which the activity of the AroP protein is not enhanced.

[0113] Another aspect of the present application provides a composition for producing carnosine, comprising one or more of: a polypeptide having carnosine activity of the present application; a microorganism comprising one or more of the polypeptide having carnosine activity of the present application, a polynucleotide encoding the same, and a vector comprising the polynucleotide; a culture thereof; a mutant polypeptide; a microorganism comprising one or more of the mutant polypeptide, a polynucleotide encoding the same, and a vector comprising the polynucleotide; and a culture of the microorganism.

[0114] The polypeptide having carnosine activity, mutant polypeptide, polynucleotide, vector, microorganism, and carnosine are as described in other aspects.

[0115] The compositions of the present application may further contain any suitable excipients commonly used in compositions for producing carnosine, such as, but not limited to, preservatives, wetting agents, dispersing agents, suspending agents, buffers, stabilizers, or isotonicity agents.

[0116] In one embodiment, each component present in the compositions of the present application can be included in a microbiologically effective amount, or in an amount that can be suitably present in a production composition.

[0117] In the present application, the culture may include any culture such as a dried culture, a dilution, a concentrate, a culture filtrate, or a fermentation product.

[0118] Another aspect of the present application provides a method for producing carnosine, comprising culturing the microorganism of the present application in a medium.

[0119] The microorganisms and carnosine are as described elsewhere.

[0120] In the present application, the term "culturing" refers to growing the microorganism of the present application under appropriately controlled environmental conditions. The culturing process of the present application can be carried out using appropriate media and culture conditions known in the art. Such a culturing process can be easily adjusted and used by those skilled in the art depending on the selected strain. Specifically, the culturing may be, but is not limited to, a batch, continuous, and / or fed-batch culture.

[0121] As used herein, the term "culture medium" refers to a mixture of nutrients, primarily those required for culturing the microorganisms of the present application, and provides nutrients, including water, and growth factors essential for survival and growth. Specifically, the culture medium and other culture conditions used to culture the microorganisms of the present application can be any medium commonly used for culturing microorganisms, without any particular limitations. The microorganisms of the present application can be cultured under aerobic conditions in a conventional medium containing appropriate carbon sources, nitrogen sources, phosphorus sources, inorganic compounds, amino acids, and / or vitamins, while adjusting the temperature, pH, and other parameters. For example, culture media for Corynebacterium strains can be found in the literature ["Manual of Methods for General Bacteriology" by the American Society for Bacteriology (Washington DC, USA, 1981)].

[0122] In the present application, examples of the carbon source include carbohydrates such as glucose, saccharose, lactose, fructose, sucrose, and maltose; sugar alcohols such as mannitol and sorbitol; organic acids such as pyruvic acid, lactic acid, and citric acid; amino acids such as glutamic acid, methionine, and lysine; and glycerol and propanediol. Natural organic nutrient sources such as starch hydrolysate, molasses, blackstrap molasses, rice bran, cassava, bagasse, and corn steeping liquid can also be used. Specifically, carbohydrates such as glucose and sterilized pretreated molasses (i.e., molasses converted into reducing sugars) can be used. A variety of other suitable carbon sources can also be used without limitation. These carbon sources can be used alone or in combination of two or more, and are not limited thereto.

[0123] The nitrogen source may be an inorganic nitrogen source such as ammonia, ammonium sulfate, ammonium chloride, ammonium acetate, ammonium phosphate, ammonium carbonate, ammonium nitrate, etc.; or an organic nitrogen source such as an amino acid such as glutamic acid, methionine, glutamine, etc., peptone, NZ-amine, meat extract, yeast extract, malt extract, corn steeping liquid, casein hydrolysate, fish or its degradation products, defatted soybean cake or its degradation products, etc. These nitrogen sources may be used alone or in combination of two or more, and are not limited thereto.

[0124] The phosphorus source may include monopotassium phosphate, dipotassium phosphate, or the corresponding sodium-containing salts. Inorganic compounds may include sodium chloride, calcium chloride, iron chloride, magnesium sulfate, iron sulfate, manganese sulfate, calcium carbonate, and other compounds. Other compounds may include amino acids, vitamins, and / or appropriate precursors. These components or precursors may be added to the medium in a batch or continuous manner. However, the present invention is not limited to these compounds.

[0125] During the cultivation of the microorganism of the present application, the pH of the medium can be adjusted by adding compounds such as ammonium hydroxide, potassium hydroxide, ammonia, phosphoric acid, sulfuric acid, etc. to the medium in an appropriate manner. Furthermore, during cultivation, foam formation can be suppressed using an antifoaming agent such as a fatty acid polyglycol ester. Furthermore, to maintain an aerobic state in the medium, oxygen or an oxygen-containing gas can be injected into the medium, and to maintain an anaerobic or microaerobic state, no gas can be injected or nitrogen, hydrogen, or carbon dioxide gas can be injected, but this is not limiting.

[0126] In the culture of the present application, the culture temperature can be maintained at 20 to 45°C, specifically 25 to 40°C, and the culture can be performed for about 10 to 160 hours, but is not limited to this.

[0127] Carnosine produced by the culture of the present application is either secreted into the medium or remains intracellularly.

[0128] In one embodiment, the carnosine production method of the present application may further include a step of preparing the microorganism of the present application, a step of preparing a medium for culturing the strain, or a combination thereof (in any order), for example, before the culturing step.

[0129] In one embodiment, the method for producing carnosine of the present application may further include a step of recovering carnosine from the culture medium (the medium in which the culture was performed) or the microorganism of the present application. The recovery step may be further performed after the culturing step.

[0130] The recovery may involve collecting L-carnosine using a suitable method known in the art based on the microbial culture method of the present application, such as batch, continuous, or fed-batch culture. For example, centrifugation, filtration, treatment with a crystallized protein precipitant (salting out), extraction, ultrasonic disruption, ultrafiltration, dialysis, various chromatographies such as molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, and affinity chromatography, HPLC, or a combination of these methods may be used to recover carnosine from the culture medium or the microorganism.

[0131] The carnosine production method of the present application may further include a purification step. The purification can be performed using a suitable method known in the art. In one example, when the carnosine production method of the present application includes both a recovery step and a purification step, the recovery step and the purification step can be performed continuously or discontinuously, regardless of the order, or simultaneously or integrated into one step, but are not limited thereto.

[0132] Another aspect of the present application provides uses of the polypeptides of the present application having carnosine synthase activity; mutant polypeptides; and the microorganisms of the present application for producing carnosine.

[0133] The polypeptide having carnosine synthase activity, the mutant polypeptide, the microorganism, and carnosine are as described in other aspects.

[0134] The present application will be described in more detail below through experimental examples. However, the following examples are merely preferred embodiments for illustrating the present application, and are not intended to limit the scope of the present application. Meanwhile, technical matters not described in this specification can be fully understood and easily performed by those of ordinary skill in the technical field of the present application or a similar technical field.

[0135] Example 1. Search and selection of novel carnosine synthases Using the amino acid sequence of the Bacillus-derived carnosine synthase as the query sequence, a PSI-BLAST search was performed based on the NCBI and Kegg databases. As a result, 20 candidate genes considered to be enzymes capable of synthesizing carnosine and the organisms that possess these genes were selected. Of these, seven microorganisms and their derived enzymes were selected based on their similarity to the query sequence, as shown in Table 1 below.

[0136] [Table 1]

[0137] Example 2. Construction of expression vectors incorporating various carnosine synthases The carnosine synthases derived from the seven species selected in Example 1 (Bacillus subtilis, Streptococcus pneumoniae, alkaliphilic Halobacillus halodurans, Pristia megaterium, Pseudomonas syringae, Pseudomonas syringae pv. phaseolicola, and Bacillus pumilus) have the amino acid sequences set forth in SEQ ID NOs: 1 to 7, respectively. Information on the genes encoding the enzymes and their surrounding nucleotide sequences was obtained from the National Institutes of Health (NIH) GenBank (accession numbers CAB15798.1, CVN04298.1, MBV7318856.1, WP_116516826.1, BAJ15424.1, AAZ37741.1, and GM828960.1, respectively). Then, PCR was performed using the template obtained through gene synthesis based on the confirmed sequence to obtain a gene fragment for vector construction.

[0138] At that time, the polymerase TM Pfu-X DNA polymerase was used, and the PCR amplification conditions were denaturation at 95°C for 3 minutes, followed by denaturation at 95°C for 20 seconds, annealing at 56°C for 40 seconds, and polymerization at 72°C for 2 minutes, repeated 30 times, followed by polymerization at 72°C for 5 minutes.

[0139] To amplify the gene derived from Bacillus subtilis, primers shown in SEQ ID NOs: 21 and 22 in Table 2 below were prepared, and PCR was performed using the polymerase and PCR amplification conditions described above, resulting in a 1,419 bp gene fragment.

[0140] To amplify the gene derived from Streptococcus pneumoniae, primers of SEQ ID NOs: 23 and 24 shown in Table 2 below were prepared and PCR was similarly performed to obtain a 1,422 bp gene fragment.

[0141] To amplify the gene derived from alkaliphilic Halobacillus halodurans, primers of SEQ ID NOs: 25 and 26 shown in Table 2 below were prepared and PCR was performed to obtain a 1,419 bp gene fragment.

[0142] To amplify the gene derived from Pristia megaterium, primers of SEQ ID NOs: 27 and 28 shown in Table 2 below were prepared and PCR was performed in the same manner, resulting in a 1,422 bp gene fragment.

[0143] To amplify the gene derived from Pseudomonas syringae, primers of SEQ ID NOs: 29 and 30 shown in Table 2 below were prepared, and PCR was similarly performed to obtain a 1,260 bp gene fragment.

[0144] To amplify the gene derived from Pseudomonas syringae pv. phaseolicola, primers of SEQ ID NOs: 31 and 32 shown in Table 2 below were prepared and PCR was similarly performed to obtain a 1,245 bp gene fragment.

[0145] To amplify the gene derived from Bacillus pumilus, primers of SEQ ID NOs: 33 and 34 shown in Table 2 below were prepared and PCR was performed in the same manner, resulting in a gene fragment of 1,434 bp.

[0146] [Table 2]

[0147] In addition, to obtain the promoter, PCR was performed using the o2 promoter (US Pat. No. 10,273,491 B2) as a template and primers of SEQ ID NOs: 35 and 36 as shown in Table 2 above.

[0148] The amplified o2 promoter region, gene fragments derived from the seven microorganisms, and the vector pCES208, which had been digested with XbaI restriction enzyme ("Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes," Journal of microbiology and biotechnology 18.4 (2008): 639-647.) were ligated using an In-fusion Cloning Kit to obtain expression vectors for each gene.

[0149] Therefore, the vector containing the gene derived from Bacillus subtilis was named "pCES208-Po2-BsLAL," the vector containing the gene derived from Streptococcus pneumoniae was named "pCES208-Po2-SpLAL," the vector containing the gene derived from alkaliphilic Halobacillus halodurans was named "pCES208-Po2-AhLAL," the vector containing the gene derived from Pristia megaterium was named "pCES208-Po2-PmLAL," the vector containing the gene derived from Pseudomonas syringae was named "pCES208-Po2-PsLAL," the vector containing the gene derived from Pseudomonas syringae pv. phaseolicola was named "pCES208-Po2-PspLAL," and the vector containing the gene derived from Bacillus pumilus was named "pCES208-Po2-BpLAL."

[0150] Example 3. Construction of a Corynebacterium strain producing beta-alanine and L-histidine To evaluate the carnosine synthesis activity of this enzyme, we constructed a Corynebacterium strain that produces beta-alanine and L-histidine. To this end, we constructed a vector to insert the panD gene, which is required to convert aspartic acid produced in Corynebacterium glutamicum to beta-alanine, into the genomic DNA of the strain.

[0151] To amplify the panD gene, the chromosomal DNA of Corynebacterium glutamicum wild-type ATCC13032 was used as a template, and primers shown in SEQ ID NO: 37 and SEQ ID NO: 38 in Table 3 below were prepared. PCR was performed in the same manner as in Example 2, resulting in a 411 bp gene fragment.

[0152] To obtain the o2 promoter derived from Corynebacterium glutamicum, PCR was performed using Corynebacterium glutamicum genomic DNA as a template and primers of SEQ ID NOs: 39 and 40 as shown in Table 3 below.

[0153] [Table 3]

[0154] The amplified o2 promoter and panD gene fragments were cloned into the chromosomal transformation vector pDZTn (Korean Patent No. 10-1126041) digested with SpeI restriction enzyme using the Gibson assembly method (DG Gibson et al., NATURE METHODS, VOL. 6 NO. 5, MAY 2009, NEBuilder HiFi DNA Assembly Master Mix) to obtain a recombinant plasmid designated pDZTn-Po2-panD. Cloning was performed by mixing the Gibson assembly reagent with each gene fragment in the calculated molar amounts and storing at 50°C for 1 hour.

[0155] The constructed pDZTn-Po2-panD vector was transformed into wild-type Corynebacterium glutamicum ATCC13032 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and a strain with one copy of the Po2-panD gene inserted between the transposon genes on the chromosome was obtained through a secondary crossover process. Genetic manipulation was confirmed by PCR using primers (SEQ ID NOs: 41 and 42, Table 3) that can amplify the upstream and downstream exons of the homologous recombination where the gene was inserted, respectively, and genome sequencing. The strain obtained in this way was named Corynebacterium glutamicum "ATCC13032::Po2-panD."

[0156] Example 4. Construction of Corynebacterium strains carrying various carnosine synthases The vectors prepared in Example 2 were transformed into the Corynebacterium glutamicum ATCC13032::Po2-panD strain prepared in Example 3 by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), and seven strains carrying each gene were obtained.

[0157] At that time, the strain into which pCES208-Po2-BsLAL was introduced was called "ATCC13032::Po2-panD-BsLAL", the strain into which pCES208-Po2-SpLAL was introduced was called "ATCC13032::Po2-panD-SpLAL", the strain into which pCES208-Po2-AhLAL was introduced was called "ATCC13032::Po2-panD-AhLAL", and the strain into which pCES208-Po2-PmLAL was introduced was called "ATCC The strain into which pCES208-Po2-PsLAL was introduced was named "ATCC13032::Po2-panD-PmLAL," the strain into which pCES208-Po2-PsLAL was introduced was named "ATCC13032::Po2-panD-PsLAL," the strain into which pCES208-Po2-PspLAL was introduced was named "ATCC13032::Po2-panD-PspLAL," and the strain into which pCES208-Po2-BpLAL was introduced was named "ATCC13032::Po2-panD-BpLAL."

[0158] Example 5. Confirmation of carnosine production in Corynebacterium strains into which various carnosine synthases have been introduced A fermentation titer experiment was conducted to confirm the carnosine production of the seven Corynebacterium glutamicum strains prepared in Example 4. Colonies of each strain were subcultured in a nutrient medium and then cultured in a fermentation medium for 48 hours. The medium composition used was as follows:

[0159] <Nutrient medium> Glucose 1%, meat juice 0.5%, polypeptone 1%, sodium chloride 0.25%, yeast extract 0.5%, agar 2%, urea 0.2%, pH 7.2

[0160] <Fermentation medium> Glucose 6%, calcium carbonate 3%, ammonium sulfate 2%, sugarcane molasses 1%, yeast extract 0.1%, potassium monophosphate 0.4%, magnesium sulfate 0.3%, isoleucine 0.026%, nicotinamide 36 mg / L, iron sulfate 2.5 mg / L, manganese sulfate 1.175 mg / L, biotin 0.05 mg / L

[0161] After the cultivation was completed under the above conditions, the carnosine concentration in each medium was measured using HPLC. The carnosine concentrations produced by the seven strains are shown in Table 4 below.

[0162] [Table 4]

[0163] As shown in Table 4, among various carnosine synthases, ATCC13032::Po2-panD-SpLAL, which contained the Streptococcus pneumoniae enzyme, produced 1.5 g / L of carnosine. This was approximately 0.6 g / L (approximately 67%) higher than the carnosine concentration produced by ATCC13032::Po2-panD-BsLAL, which contained the Bacillus subtilis enzyme, as previously reported, and 0.4 g / L (approximately 36%) higher than the carnosine concentration produced by ATCC13032::Po2-panD-BpLAL, which contained the Bacillus pumilus enzyme.

[0164] These results confirmed that the enzyme derived from Streptococcus pneumoniae has the highest carnosine synthesis activity, and that carnosine may not be produced depending on the source of the carnosine synthesis enzyme.

[0165] Example 6. Carnosine production by Corynebacterium sp. strains carrying mutant Streptococcus pneumoniae-derived enzymes Example 6-1. Construction of a strain incorporating a mutant Streptococcus pneumoniae-derived enzyme Two amino acid mutations were introduced into the Streptococcus pneumoniae enzyme with the highest carnosine synthesis activity, which was selected in Example 5. Specifically, the 108th amino acid, asparagine, in the enzyme sequence was substituted with glutamic acid, and the 378th amino acid, histidine, was substituted with lysine to verify the improvement of carnosine synthesis activity.

[0166] To do this, first, in order to replace the 108th amino acid, asparagine, in SEQ ID NO: 2 with glutamic acid, a set of mutagenic primers, SEQ ID NO: 43 and 44, as shown in Table 5, was prepared using pCES208-Po2-SpLAL prepared in Example 2 as a template.

[0167] [Table 5]

[0168] Using the primer set, a PCR mixture as shown in Table 6 below was prepared, and site-directed mutagenesis PCR was performed using the cycles as shown in Table 7 below.

[0169] [Table 6]

[0170] [Table 7]

[0171] After PCR, 1 μl of DpnI restriction enzyme was added to the mixture and incubated at 37° C. for 1 hour. DH5a competent cells were transformed with 3 μl of the DpnI-treated DNA to obtain the pCES208-Po2-SpLAL N108E plasmid.

[0172] Furthermore, to replace the 378th amino acid, histidine, with lysine, the pCES208-Po2-SpLAL N108E / H378 plasmid was obtained in the same manner as above using the prepared pCES208-Po2-SpLAL N108E plasmid as a template and the mutagenic primer sets shown in SEQ ID NOs: 45 and 46 in Table 5. Sequencing confirmed that the mutations shown in Table 5 had been replaced, resulting in the sequence shown in SEQ ID NO: 8.

[0173] The pCES208-Po2_SpLAL N108E / H378K vector was electroporated into the Corynebacterium glutamicum ATCC13032::Po2-panD strain constructed in Example 3 to obtain a strain carrying the mutant SpLAL gene (N108E / H378K). This strain was designated "ATCC13032::Po2-panD-SpLAL N108E / H378K."

[0174] Example 6-2: Confirmation of carnosine production in Corynebacterium sp. strains introduced with mutant Streptococcus pneumoniae-derived enzymes To confirm the amount of carnosine produced by the Corynebacterium glutamicum ATCC13032::Po2-panD-SpLAL N108E / H378K strain prepared in Example 6-1, the strain was cultured in the same manner as in Example 5, and the amount of carnosine produced was measured using HPLC.

[0175] [Table 8]

[0176] As shown in Table 8, the concentration of carnosine produced by the microorganism into which the mutant SpLAL enzyme (N108E / H378K) was introduced was found to be approximately 0.6 g / L (approximately 40%) higher than the concentration of carnosine produced by the microorganism into which the wild-type SpLAL enzyme was introduced.

[0177] These results confirmed that the N108E / H378K mutation increases the ability of microorganisms containing the enzyme to produce carnosine.

[0178] Example 7. Enhanced carnosine productivity in AroP-enhanced Corynebacterium strains Example 7-1. Construction of an AroP-enhanced strain To enhance AroP expression in Corynebacterium strains, vectors for introducing the pyk promoter and cj7 promoter (US 7662943 B2) were constructed.

[0179] To amplify the pyk promoter, primers shown in SEQ ID NOS: 47 and 48 in Table 9 below were prepared using the chromosomal DNA of Corynebacterium glutamicum wild-type ATCC13032 as a template, and PCR was performed in the same manner as in Example 2 to obtain a 500 bp gene fragment. To obtain the gene fragments necessary for insertion into host genomic DNA, primers shown in SEQ ID NOS: 49 and 50 and SEQ ID NOS: 51 and 52 in Table 9 below were prepared, and PCR was performed in the same manner as in Example 2 to obtain 501 bp and 500 bp gene fragments.

[0180] [Table 9]

[0181] The amplified pyk promoter region and the two gene fragments obtained above were ligated to the pDZ vector (Korean Patent Registration No. 10-0924065 and International Patent Publication No. 2008-033001) cleaved with the restriction enzymes BamHI and XbaI using an In-fusion Cloning Kit to construct a gene transfer vector, which was named "pDZ-pyk(AroP)."

[0182] To amplify the CJ7 promoter, primers shown in SEQ ID NOs: 53 and 54 in Table 10 below were prepared using the chromosomal DNA of Corynebacterium glutamicum wild-type ATCC13032 as a template, and PCR was performed in the same manner as in Example 2, resulting in a 317 bp gene fragment. To obtain gene fragments necessary for insertion into host genomic DNA, primers shown in Table 9 above and Table 10 below with SEQ ID NOs: 49 and 55 and SEQ ID NOs: 56 and 52 were prepared, and PCR was performed in the same manner as in Example 2, resulting in 501 bp and 500 bp gene fragments.

[0183] [Table 10]

[0184] The amplified CJ7 promoter region and the two gene fragments obtained above were ligated to the pDZ vector (Korean Patent Registration No. 10-0924065 and International Patent Publication No. 2008-033001) cleaved with the restriction enzymes BamHI and XbaI using an In-fusion Cloning Kit to construct a gene transfer vector, which was named "pDZ-cj7(AroP)."

[0185] The ATCC13032::Po2-panD-SpLAL N108E / H378K strain constructed in Example 6-1 was transformed with the pDZ-pyk(AroP) vector and the pDZ-cj7(AroP) vector, respectively, by electroporation (Appl. Microbiol. Biotechnol. (1999) 52:541-545), followed by a second crossover process to obtain a strain with a promoter inserted in front of the AroP gene on the chromosome. The genetic manipulation was confirmed by PCR using primers with SEQ ID NOs: 57 (check_AroP_F; CTCTGCGGTCCCGCGGAC) and 58 (check_AroP_R; CGTGATCACCGATGAAGTTTG), which amplify the upstream and downstream exons of homologous recombination where the gene was inserted, respectively, and genome sequencing.

[0186] The Corynebacterium glutamicum strains obtained in this manner were designated "ATCC13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP" and "ATCC13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP," respectively.

[0187] Example 7-2. Confirmation of carnosine production in AroP-enhanced strains To confirm the amount of carnosine produced by the ATCC13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP and ATCC13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP strains, each strain was cultured in the same manner as in Example 5, and the amount of carnosine produced was measured using HPLC.

[0188] [Table 11]

[0189] As shown in Table 11, the concentration of carnosine produced by ATCC13032::Po2-panD-SpLAL(N108E / H378K)-PpykAroP, which had the pyk promoter introduced, was approximately 0.4 g / L (approximately 19%) higher than the concentration of carnosine produced by ATCC13032::Po2-panD-SpLAL N108E / H378K. The concentration of carnosine produced by ATCC13032::Po2-panD-SpLAL(N108E / H378K)-Pcj7AroP, which had the cj7 promoter introduced, was approximately 0.6 g / L (approximately 29%) higher than the concentration of carnosine produced by ATCC13032::Po2-panD-SpLAL N108E / H378K.

[0190] These results confirmed that AroP enhancement increased the ability of microorganisms to produce carnosine.

[0191] From the above description, those skilled in the art to which the present application pertains will understand that the present application may be embodied in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the above-described embodiments are merely illustrative and not limiting. The scope of the present application should be interpreted as including within the meaning and scope of the claims below, and any modifications or variations derived from the equivalent concepts thereof, rather than the above detailed description.

Claims

1. A polypeptide having carnosine synthase activity, comprising the amino acid sequence of SEQ ID NO:

2.

2. A polynucleotide encoding a polypeptide having carnosine synthase activity according to claim 1.

3. A microorganism comprising one or more of the polypeptide having carnosine synthase activity described in claim 1, a polynucleotide encoding the same, and a vector containing the polynucleotide.

4. The microorganism according to claim 3, wherein the microorganism produces carnosine.

5. The microorganism according to claim 3, wherein the activity of Aromatic amino acid transport protein (AroP) protein is further enhanced.

6. The microorganism of claim 5 , wherein the AroP protein comprises the amino acid sequence of SEQ ID NO:

19.

7. The microorganism according to claim 3 , wherein the microorganism is a Corynebacterium microorganism.

8. The microorganism according to claim 3 , wherein the microorganism is Corynebacterium glutamicum.

9. A mutant polypeptide having carnosine synthase activity, in which the amino acids corresponding to the 108th position and the 378th position from the N-terminus of SEQ ID NO: 2 are replaced with other amino acids.

10. The mutant polypeptide of claim 9, wherein the amino acid corresponding to the 108th position from the N-terminus of SEQ ID NO: 2 is substituted with glutamic acid and the amino acid corresponding to the 378th position is substituted with lysine.

11. The mutant polypeptide of claim 9, wherein the asparagine amino acid corresponding to the 108th position from the N-terminus of SEQ ID NO: 2 is replaced with glutamic acid, and the histidine amino acid corresponding to the 378th position is replaced with lysine.

12. The mutant polypeptide of claim 9, wherein the mutant polypeptide comprises the amino acid sequence of SEQ ID NO:

8.

13. A polynucleotide encoding the mutant polypeptide of claim 9.

14. A microorganism comprising at least one of the mutant polypeptide of claim 9, a polynucleotide encoding the same, and a vector containing the polynucleotide.

15. The microorganism of claim 14, wherein the microorganism produces carnosine.

16. The microorganism according to claim 14, wherein the activity of the AroP protein is further enhanced.

17. A composition for producing carnosine, comprising one or more of: a polypeptide having carnosine activity described in claim 1; a microorganism comprising one or more of the polypeptide having carnosine activity of claim 1, a polynucleotide encoding the same, and a vector comprising said polynucleotide; a culture thereof; a mutant polypeptide described in any one of claims 9 to 12; a microorganism comprising one or more of the mutant polypeptide described in any one of claims 9 to 12, a polynucleotide encoding the same, and a vector comprising said polynucleotide; and a culture thereof.

18. The composition according to claim 17, wherein the microorganism has further enhanced activity of AroP protein.

19. A method for producing carnosine, comprising culturing the microorganism according to any one of claims 3 to 8 and claims 14 to 16 in a medium.

20. 20. The method for producing carnosine according to claim 19, further comprising recovering carnosine from any one or more of the microorganism, its culture, and medium.

21. Use of the microorganism according to any one of claims 3 to 8 and claims 14 to 16 for producing carnosine.

Images