RNAi agents for inhibiting influenza A virus gene expression, compositions thereof, and methods of use
Specific RNAi agents targeting conserved influenza A virus regions provide effective inhibition and treatment across multiple subtypes, addressing the limitations of current treatments by reducing viral expression and symptoms.
Patent Information
- Application Number
- JP2025540799
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-11-06
- Filing Date
- 2024-01-12
- Publication Date
- 2026-01-23
AI Technical Summary
Current treatments for influenza A virus infections, including vaccines and antiviral compounds, are inadequate in preventing severe illness and death, especially in high-risk populations, and there is a need for novel RNA interference (RNAi) agents that can selectively and efficiently inhibit influenza A virus genome expression across various subtypes.
Development of specific RNAi agents, such as small interfering RNAs (siRNAs), designed to target conserved regions of the influenza A virus genome, combined with targeting ligands for efficient delivery to lung cells, to inhibit viral mRNA expression and reduce disease symptoms.
The RNAi agents effectively inhibit influenza A virus expression, providing therapeutic and prophylactic treatment for a range of subtypes, including H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8, reducing viral load and associated symptoms.
Smart Images

Figure 2026502546000203 
Figure 2026502546000204 
Figure 2026502546000205
Abstract
Description
[Technical Field]
[0001] The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded RNAi agents such as small interfering RNAs (siRNAs), for the inhibition of influenza A (IAV) viral genome (or gene) expression, including compositions comprising the IAV RNAi agents, and methods of use thereof.
[0002] Sequence Listing This application contains a Sequence Listing which has been submitted in XML format and is incorporated herein by reference in its entirety. The XML copy is named 30715-WO_SeqListing.xml, created on January 9, 2024, and is 6136kb in size. [Background technology]
[0003] Influenza, more commonly known as "the flu," is a contagious respiratory illness caused by the influenza virus, which infects the nose, throat, and sometimes the lungs. It can cause a wide range of illnesses, from relatively mild to very severe, and in some cases, can be fatal. A 2018 study from the Centers for Disease Control and Prevention (CDC) concluded that, on average, approximately 8% of the U.S. population becomes ill from the flu each season, with a range of 3% to 11%, depending on the season.
[0004] Influenza viruses are members of the Orthomyxoviridae family and are classified into four types: A, B, C, and D (Li, X., Gu, M., Zheng, Q. et al. Packaging signal of influenza A virus. Virol J 18, 36 (2021)). Influenza virus particles consist of a viral envelope, matrix protein, and viral ribonucleocapsid (vRNP). The influenza A and B viral genomes each contain eight negative-sense single-stranded viral RNA (vRNA) segments: M1 / M2, NS1, NA, NP, HA, PA, PB1, and PB2 (Bouvier NM, Palese P. The biology of influenza viruses. Vaccine. 2008 Sept. 12;26 Suppl 4 (Suppl 4):D49-53). Influenza C has a seven-segment genome. These viral segments encode various proteins necessary to facilitate the influenza virus cycle of viral entry, viral RNA synthesis, viral protein synthesis, viral RNA packaging and assembly, and viral budding and release.
[0005] Influenza is reported to cause 290,000 to 650,000 deaths per year (https: / / www.cdc.gov / media / releases / 2017 / p1213-flu-death-estimate.html, last accessed March 1, 2023). Influenza places a tremendous economic burden on healthcare systems, with estimated annual direct medical costs exceeding $3 billion in the United States alone. While influenza vaccines that can be administered annually are widely available and can reduce illness and symptoms in many individuals, they do not prevent influenza-related deaths in high-risk populations. Furthermore, while there are currently four FDA-approved antiviral compounds indicated for administration within 48 hours of symptom onset, they are not recommended for influenza prevention. Furthermore, although these products target either the NA vRNA segment (oseltamivir (Tamiflu®), zanamivir (Relenza®), and peramivir (Rapivab®)) or the PA vRNA segment (baloxavir marboxil (Xofluza®)), influenza strains that are resistant to approved antiviral treatments are becoming more prevalent. Thus, there is an urgent need to develop new, effective alternative treatments for influenza.
[0006] Influenza A viruses are classified into subtypes based on two proteins on the surface of the virus: hemagglutinin (H) and neuraminidase (N). (https: / / www.cdc.gov / flu / about / viruses / types.htm, Centers for Disease Control and Prevention). There are 18 different hemagglutinin subtypes and 11 different neuraminidase subtypes (H1-H18 and N1-N11, respectively). Over 130 influenza A subtype combinations have been identified in nature, primarily in wild birds; however, given the tendency of viruses to "reassort," potentially many additional influenza A subtype combinations exist. Reassortment is the process by which influenza viruses exchange gene segments. Reassortment can occur when two influenza viruses simultaneously infect a host and exchange genetic information.
[0007] Influenza A viruses circulate and cause seasonal epidemics of disease. Currently known circulating viruses in humans include subtypes A H1N1, A H2N2, and A H3N2. (Belser JA, Maines TR, Tumpey TM, Katz JM. Influenza A virus transmission: contributing factors and clinical implications. Expert. Rev. Mol. Med. 12:e39) In recent years, an increasing number of IAV subtypes have been detected in humans, including H5N1, H7N9, and H10N8. (Rejmanek D,Hosseini PR,Mazet JA,Daszak P,Goldstein T.Evolutionary Dynamics and Global Diversity of Influenza A Virus.J Virol.2015 Nov;89(21):10993-1001.doi:10.1128 / JVI.01573-15.Epub 2015 Aug 26.PMID:26311890;PMCID:PMC4621101).
[0008] Notably, avian H5N1 viruses often cause severe illness when they infect humans. (Wang Y, Song T, Li K, Jin Y, Yue J, Ren H, Liang L. Different Subtypes of Influenza Viruses Target Different Human Proteins and Pathways Leading to Different Pathogenic Phenotypes. Biomed Res Int. 2019 Oct 22;2019:4794910.doi:10.1155 / 2019 / 4794910. PMID:31772934; PMCID:PMC6854240). For example, in 1996, highly pathogenic avian influenza (HPAI) H5N1 viruses were first identified in domestic waterfowl in southern China. In 1997, an H5N1 poultry outbreak occurred in China and Hong Kong, resulting in 18 associated human cases (6 deaths) in Hong Kong. This viral outbreak has caused over 860 human infections, with a mortality rate exceeding 50% (https: / / www.cdc.gov / flu / avianflu / communication-resources / bird-flu-origin-infographic.html, Centers for Disease Control and Prevention). The first human case of avian influenza A (H5N1) virus in the United States was reported on April 28, 2022. While the current risk of H5N1 human infection remains low, people with occupational or recreational exposure to birds or infected mammals should take appropriate precautions to protect against avian influenza H5N1. Currently, the H5N1 avian influenza situation remains primarily an animal health issue. However, CDC is closely monitoring the situation and taking routine preparedness and prevention measures in case this virus mutates and poses a greater human health risk. Summary of the Invention
[0009] There is a need for novel RNA interference (RNAi) agents (referred to as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents such as small interfering RNAs (siRNAs), that can selectively and efficiently inhibit the expression of the influenza A virus genome, including, for example, but not limited to, those that can selectively and efficiently inhibit influenza A mRNA expression and, therefore, the replication of the influenza A virus genome. Furthermore, there is a need for novel influenza A genome-specific RNAi agent compositions for use as therapeutics or pharmaceuticals for the treatment of influenza A and / or for the treatment of diseases or disorders (including the alleviation of symptoms) that may be mediated, at least in part, by reduced influenza A virus genome expression. While the concept of targeting influenza with RNAi agents such as siRNAs, including the advantages of using this approach, has long been proposed (see, e.g., Sailen Barik, siRNA for Influenza Therapy, Viruses (2010) 2(7):1448-1457), there are still no anti-influenza A siRNA drugs that have received market approval for treatment in humans.
[0010] The nucleotide sequences and chemical modifications of influenza A virus (IAV) RNAi agents disclosed herein, and their combination with certain specific targeting ligands suitable for selectively and efficiently delivering IAV RNAi agents to lung cells in vivo, including by inhalation, are unlike those previously disclosed or known in the art and overcome challenges and obstacles that others have not been able to overcome. The IAV RNAi agents disclosed herein provide highly potent and efficient in vivo inhibition of influenza A mRNA (or transcript) expression, and the conserved nature of the RNAi agent antisense strand sequences disclosed herein is predicted to effectively inhibit the vast majority of the thousands of known and unknown variants of influenza A mRNA (or transcript).
[0011] Generally, the present disclosure features IAV RNAi agents that are specific to the influenza A virus genome and target portions of the genome that are conserved across other influenza genomes, compositions comprising IAV RNAi agents, and methods for inhibiting expression of the influenza A virus genome in vivo using the IAV RNAi agents and compositions comprising IAV RNAi agents described herein. The IAV RNAi agents described herein can selectively and efficiently reduce expression of the influenza A virus genome. The IAV RNAi agents can be used to inhibit expression of the influenza A virus genome of influenza A subtypes, including, but not limited to, H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0012] The described IAV RNAi agents can be used in methods for the therapeutic treatment (including potentially prophylactic or preventative treatment) of symptoms or diseases associated with influenza A virus infection, including, but not limited to, infection of the nose, throat, lungs, and other parts of the respiratory system.
[0013] The described IAV RNAi agents can be used in methods for the therapeutic treatment (including potentially prophylactic or preventative treatment) of symptoms or diseases associated with influenza A virus infection, including, but not limited to, influenza A subtypes H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0014] Because the described IAV RNAi agents are designed to inhibit expression of the influenza A virus genome by targeting highly conserved genomic regions of the influenza A virus genome, the IAV RNAi agents can inhibit expression of multiple subtypes of influenza A virus, including, but not limited to, H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0015] In one aspect, the disclosure features an RNAi agent for inhibiting expression of an influenza A virus genome, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense strand and antisense strand can be partially, substantially, or fully complementary to one another. The length of the sense strand of an RNAi agent described herein can each be 15 to 49 nucleotides in length. The length of the antisense strand of an RNAi agent described herein can each be 18 to 49 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 18 to 26 nucleotides in length. The sense strand and antisense strand can be either the same length or different lengths. In some embodiments, the sense strand and antisense strand are independently 21 to 26 nucleotides in length. In some embodiments, the sense strand and antisense strand are independently 21 to 24 nucleotides in length. In some embodiments, both the sense strand and antisense strand are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more influenza A virus genomes in vivo and / or in vitro via RNA-induced silencing complex (RISC)-mediated cleavage of viral RNA transcripts upon delivery to cells expressing the influenza A virus genome, such as lung cells.
[0016] The IAV RNAi agents disclosed herein are designed to target the influenza A virus genome (see, e.g., SEQ ID NOS: 1-6) in regions that are expected to be conserved across a variety of different influenza viruses. In some embodiments, the IAV RNAi agents disclosed herein are designed to target a portion of an influenza A virus gene having a sequence of any of the sequences disclosed in Table 1A, Table 1B, Table 1C, Table 1D, Table 1E, or Table 1F.
[0017] In another aspect, the disclosure features compositions, including pharmaceutical compositions, comprising one or more of the disclosed IAV RNAi agents that can selectively and efficiently reduce expression of influenza A viral genes. Compositions comprising one or more IAV RNAi agents described herein can be administered to a subject, such as a human or animal subject, for the treatment (including potential preventative treatment or inhibition) of symptoms and diseases associated with influenza A viral infection, including, but not limited to, infections of the nose, throat, lungs, and other parts of the respiratory system.
[0018] Examples of IAV RNAi agent sense and antisense strands that can be used in an IAV RNAi agent are provided in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F. Examples of IAV RNAi agent duplexes are provided in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, and 10A, 10B, 10C, 10D, 10E, and 10F. Examples of 19-nucleotide core stretch sequences that may consist of or be included in the sense and antisense strands of certain IAV RNAi agents disclosed herein are provided in Tables 2A, 2B, 2C, 2D, 2E, and 2F.
[0019] In another aspect, the disclosure features methods for delivering an IAV RNAi agent to lung epithelial cells in a subject, e.g., a mammal, in vivo. Compositions for use in such methods are also described herein.
[0020] Disclosed herein, in some embodiments, are methods for in vivo delivery of an IAV RNAi agent to lung cells in a subject, including epithelial cells (including airway epithelial cells, alveolar type I and type II pneumocytes), mesenchymal cells (including smooth muscle cells and fibroblasts), immune cells (including macrophages and mast cells), and endothelial cells. In some embodiments, the subject is a human subject.
[0021] The methods disclosed herein include administering one or more IAV RNAi agents to a subject, e.g., a human or animal subject, by any suitable means known in the art. The pharmaceutical compositions disclosed herein comprising one or more IAV RNAi agents can be administered in several ways, depending on whether local or systemic treatment is desired. Administration can be, for example, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implantable device), and intraparenchymal. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder inhalation or aerosol inhalation), intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
[0022] In some embodiments, the IAV RNAi agents described herein are desired to inhibit expression of the influenza A viral genome in the pulmonary epithelium, and to that end, administration is by inhalation (e.g., by an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).
[0023] In some embodiments, the described IAV RNAi agents can selectively and efficiently inhibit expression of influenza A viral genomes. The IAV RNAi agents described herein can be used to inhibit expression of influenza A viral genomes, including, but not limited to, H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0024] IAV RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technology known in the art. In some embodiments, IAV RNAi agents are delivered to cells or tissues by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin alpha-v-beta-6 (αvβ6) is an epithelial-specific integrin known to be a receptor for ECM proteins and TGF-beta latency-associated peptide (LAP) and is expressed in a variety of cells and tissues. Integrin αvβ6 is known to be highly upregulated in injured lung epithelium. In some embodiments, the IAV RNAi agents described herein are linked to an integrin targeting ligand with affinity for integrin αvβ6. As referred to herein, an "αvβ6 integrin targeting ligand" is a compound having affinity for integrin αvβ6, which can be utilized as a ligand to facilitate targeting and delivery of an RNAi agent bound to a desired cell and / or tissue (i.e., a cell expressing integrin αvβ6, such as a lung cell). In some embodiments, multiple αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are linked to an IAV RNAi agent. In some embodiments, the IAV RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells via receptor-mediated endocytosis or by other means.
[0025] Examples of targeting groups useful for delivering IAV RNAi agents, including αvβ6 integrin targeting ligands, are disclosed, for example, in WO 2018 / 085415 and WO 2019 / 089765, each to Arrowhead Pharmaceuticals, Inc., the contents of each of which are incorporated herein by reference in their entirety.
[0026] The targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of the IAV RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is linked internally to a nucleotide on the sense and / or antisense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.
[0027] In another aspect, the disclosure features a composition that includes one or more IAV RNAi agents having a duplex structure disclosed in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, and 10A, 10B, 10C, 10D, 10E, and 10F.
[0028] The use of IAV RNAi agents provides a method for the therapeutic (including preventative) treatment of diseases or disorders associated with influenza A virus infection, including, but not limited to, infection of the nose, throat, lungs, and other parts of the respiratory system caused by the influenza A virus genome. The IAV RNAi agents disclosed herein can be used to treat various respiratory diseases and injuries associated with influenza infection. In some embodiments, the IAV RNAi agents disclosed herein can be used to treat or prevent pulmonary inflammatory diseases or conditions caused by influenza infection. The use of the IAV RNAi agents described herein can be used for the therapeutic (including preventative) treatment of diseases or disorders associated with influenza A virus infection caused by influenza A virus subtypes, including, but not limited to, H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0029] definition
[0030] As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may or may not be independently modified.
[0031] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a chemical composition of matter containing an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can degrade RNA in a sequence-specific manner or inhibit (e.g., degrade or inhibit under appropriate conditions) translation of viral RNA (all viral RNA and viral messenger RNA (mRNA) transcripts) of a target influenza virus. As used herein, an RNAi agent may act via the RNA interference mechanism (i.e., induce RNA interference via interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells) or by any alternative mechanism or pathway. Although RNAi agents, as that term is used herein, are believed to act primarily via the RNA interference mechanism, the RNAi agents of the present disclosure are not bound to or limited to any particular pathway or mechanism of action. The RNAi agents disclosed herein are composed of a sense strand and an antisense strand, and include, but are not limited to, small (or short) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the targeted RNA (e.g., influenza A virus mRNA). The RNAi agent can include one or more modified nucleotides and / or one or more non-phosphodiester bonds.
[0032] As used herein, the terms "silencing," "reducing," "inhibiting," "downregulating," or "knockdown," when referring to the expression of a given gene or viral genome, mean that the expression of a viral gene or genome (including viral genomic RNA or subgenomic RNA) as measured by the level of RNA transcribed from the viral gene or genome, the number of viral genomes, or the level of polypeptide, protein, or protein subunit translated from the viral RNA in a cell, group of cells, tissue, organ, or subject in which the gene or genome is transcribed, is reduced when the cell, group of cells, tissue, organ, or subject is treated with an RNAi agent described herein compared to a second cell, group of cells, tissue, organ, or subject that is not so treated.
[0033] As used herein, the terms "sequence" and "nucleotide sequence" mean the sequence or order of nucleic acid bases or nucleotides written as a sequence of letters using standard nomenclature.
[0034] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified, including, but not limited to, universal bases, hydrophobic bases, promiscuous bases, size-expanded bases, and fluorinated bases. (See, for example, Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P.ed. Wiley-VCH, 2008). The synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.
[0035] As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleobase or nucleotide sequence (e.g., an RNAi agent sense strand or target RNA) in relation to a second nucleobase or nucleotide sequence (e.g., an RNAi agent antisense strand or single-stranded antisense oligonucleotide), refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize (form base-pair hydrogen bonds under mammalian physiological conditions (or other suitable in vivo or in vitro conditions)) and form a duplex or double-helix structure with an oligonucleotide comprising the second nucleotide sequence under specific standard conditions. Those skilled in the art will be able to select the most appropriate set of conditions for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.
[0036] As used herein, "fully complementary" or "sufficiently complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.
[0037] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.
[0038] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.
[0039] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matching between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of an influenza RNA, such as an influenza A virus genomic RNA.
[0040] As used herein, the term "substantially identical" or "substantial identity" as applied to a nucleic acid sequence means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity, e.g., at least 90%, at least 95%, or at least 99% identity, compared to a reference sequence. The percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase is present in both sequences to obtain the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein.
[0041] As used herein, the terms "treat," "treatment," and the like refer to methods or steps taken to provide relief or alleviation of the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include prevention, management, preventative measures, and / or inhibition or reduction of the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0042] As used herein, the phrase "introducing into a cell," when referring to an RNAi agent, means functionally delivering the RNAi agent to a cell. The phrase "functional delivery" means delivering the RNAi agent to a cell in a manner that allows the RNAi agent to have the expected biological activity, for example, sequence-specific inhibition of gene or viral genome expression.
[0043] Unless otherwise stated, symbols used herein [ka] The use of means that any group according to the scope of the invention described herein can be attached thereto.
[0044] As used herein, the term "isomers" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers" or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."
[0045] As used herein, for each structure in which asymmetric centers exist and thus give rise to enantiomers, diastereomers, or other stereoisomeric configurations, unless the structure is specifically identified as having a particular configuration, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms thereof. For example, the structures disclosed herein are intended to encompass mixtures of diastereomers as well as single stereoisomers.
[0046] As used in the claims herein, the phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. As used in the claims herein, the phrase "consisting essentially of" limits the claim to particular materials or steps, and those that do not materially affect the basic and novel characteristics of the claimed invention.
[0047] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have certain atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein contemplate that certain functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as will be readily understood by those skilled in the art. Correspondingly, compounds described herein having labile protons or basic atoms should also be understood to represent salt forms of the corresponding compounds. The compounds described herein may be in the form of a free acid, a free base, or a salt. It should be understood that pharmaceutically acceptable salts of the compounds described herein are within the scope of the present invention.
[0048] As used herein, the terms "linked" or "conjugated," when referring to a connection between two compounds or molecules, mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "conjugated," as used herein, can refer to a connection between a first compound and a second compound with or without any intervening atoms or groups of atoms.
[0049] As used herein, the term "including" is used herein to mean, and is used interchangeably with, the phrase "including but not limited to." Unless context clearly indicates otherwise, the term "or" is used herein to mean, and is used interchangeably with, the term "and / or."
[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.
[0051] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]
[0052] [Figure 1] 1 depicts the chemical structure of a tridentate αvβ6 epithelial cell targeting ligand referred to herein as Tri-SM6.1-αvβ6-(TA14).
[0053] [Figure 2]Immunohistochemistry (IHC) staining for anti-hemagglutinin (anti-HA) of mice administered saline (no IAV RNAi agent) and the RNAi agent AC002564, as more fully described in Example 4.
[0054] [Figure 3] 1 is a bar graph showing lung viral load of CA07 H1N1 in mice infected with PBS or CA07 and then administered saline, an IAV RNAi agent, or oseltamivir, as more fully described in Example 32.
[0055] [Figure 4] 1 is a bar graph showing percent of total inflammation in the lungs of mice infected with PBS or CA07 and then administered saline, an IAV RNAi agent, or oseltamivir, as more fully described in Example 32.
[0056] [Figure 5] 10 is a histology of lung inflammation in mice infected with PBS or CA07 and then administered saline, an IAV RNAi agent, or oseltamivir, as more fully described in Example 32.
[0057] [Figure 6A] Lung viral load in mouse test animals administered IAV RNAi agents before and after infection with H5N1, as more fully described in Example 36.
[0058] [Figure 6B] Body weights of mouse test animals administered IAV RNAi agents before and after infection with H5N1, as more fully described in Example 36.
[0059] [Figure 6C] 1C is a clinical score of mouse test animals administered IAV RNAi agents before and after infection with H5N1, as more fully described in Example 36.
[0060] [Figure 7A] Body weights of mouse test animals administered IAV RNAi agents prior to infection with H5N1, as more fully described in Example 37.
[0061] [Figure 7B] Body weights of mouse test animals administered IAV RNAi agents following infection with H5N1, as more fully described in Example 37.
[0062] [Figure 7C] 1C is a clinical score of mouse test animals administered IAV RNAi agents before and after infection with H5N1, as more fully described in Example 37.
[0063] [Figure 7D] 1 is a survival index for test animals treated with IAV RNAi agents before and after infection with H5N1, as more fully described in Example 37.
[0064] [Figure 7E] Lung viral load in mouse test animals administered IAV RNAi agents before and after infection with H5N1, as more fully described in Example 37.
[0065] [Figure 8] Lung weights and lung weights as a percentage of total body weight for test animals administered IAV RNAi agents, as more fully described in Example 38. DETAILED DESCRIPTION OF THE INVENTION
[0066] RNAi agents Described herein are RNAi agents (herein referred to as IAV RNAi agents or IAV RNAi triggers) for inhibiting expression of influenza A virus gene transcripts or genomes. Each IAV RNAi agent disclosed herein includes a sense strand and an antisense strand. The sense strand can be 15-49 nucleotides in length, and the antisense strand can be 18-49 nucleotides in length. The sense strand and antisense strand can be either the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 18-27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 19-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is approximately 19 nucleotides in length, and the antisense strand is approximately 21 nucleotides in length. In some embodiments, the sense strand is approximately 21 nucleotides in length, and the antisense strand is approximately 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the sense strand of the RNAi agent is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides in length. In some embodiments, the antisense strand of the RNAi agent is 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 nucleotides in length. In some embodiments, the double-stranded RNAi agent has a duplex length of about 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides.
[0067] Examples of nucleotide sequences for use in forming IAV RNAi agents are provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. Examples of RNAi agent duplexes comprising the sense and antisense strand sequences in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F are shown in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, and 10A, 10B, 10C, 10D, 10E, and 10F.
[0068] In some embodiments, the region of fully, substantially, or partially complementary between the sense and antisense strands is 15 to 26 (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and occurs at or near the 5' end of the antisense strand (e.g., this region can be separated from the 5' end of the antisense strand by 0, 1, 2, 3, or 4 nucleotides that are not fully, substantially, or partially complementary).
[0069] The sense strand of an IAV RNAi agent described herein comprises at least 15 contiguous nucleotides that are at least 85% identical to a core stretch sequence (also referred to herein as a "core stretch" or "core sequence") of the same number of nucleotides in influenza A virus genomic RNA (including all viral RNAs and viral mRNAs). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand. Thus, the sense strand core stretch sequence is typically fully identical or at least about 85% identical to a nucleotide sequence of the same length present in an influenza A virus genomic RNA target (e.g., sometimes referred to as a target sequence), which is a target sequence known to be conserved across various influenza A virus genomes, as described elsewhere. In some embodiments, the sense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length.
[0070] The antisense strand of an IAV RNAi agent described herein comprises at least 17 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the targeted influenza A virus genomic RNA or another influenza RNA, and at least 15 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length (e.g., a target sequence) present in the influenza A virus genomic RNA target. In some embodiments, the antisense strand core stretch is 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. The sense strand core stretch sequence can be the same length as the corresponding antisense core sequence, or can be a different length.
[0071] The sense and antisense strands of an IAV RNAi agent anneal to form a duplex. The sense and antisense strands of an IAV RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the sense strand core stretch sequence is at least 85% complementary or 100% complementary to the antisense core stretch sequence. In some embodiments, the sense strand core stretch sequence contains a sequence of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of an IAV RNAi agent have a region of at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).
[0072] In some embodiments, the antisense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the sense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0073] In some embodiments, the sense strand and / or the antisense strand can optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3' end, the 5' end, or both the 3' and 5' ends of the core stretch sequence. The additional nucleotides of the antisense strand, if present, may or may not be complementary to a corresponding sequence in the influenza A virus genomic RNA. The additional nucleotides of the sense strand, if present, may or may not be identical to a corresponding sequence in the influenza A virus genomic RNA. The additional nucleotides of the antisense strand, if present, may or may not be complementary to the corresponding additional nucleotides (if present) of the sense strand.
[0074] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5' and / or 3' end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extension nucleotides on the sense strand may or may not be complementary to the nucleotides (either the core stretch sequence nucleotides or the extension nucleotides) in the corresponding antisense strand. Conversely, the extension nucleotides on the antisense strand may or may not be complementary to the nucleotides (either the core stretch nucleotides or the extension nucleotides) in the corresponding sense strand. In some embodiments, both the sense and antisense strands of an RNAi agent comprise a 3' extension and a 5' extension. In some embodiments, one or more of the 3' extension nucleotides of one strand are base-paired with one or more of the 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand are not base-paired with one or more of the 5' extension nucleotides of the other strand. In some embodiments, an IAV RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extension nucleotides are unpaired and form an overhang. As used herein, "overhang" refers to a stretch of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand that does not form part of the hybridized or duplex portion of an RNAi agent disclosed herein.
[0075] In some embodiments, an IAV RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, an IAV RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is complementary to a corresponding influenza A virus genomic RNA sequence. In some embodiments, one or more of the antisense strand extension nucleotides comprises a nucleotide that is not complementary to a corresponding influenza A virus genomic RNA sequence.
[0076] In some embodiments, an IAV RNAi agent comprises a sense strand having a 3' extension 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in an influenza A virus genomic RNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of, but is not limited to, one of the following sequences: T, UT, TT, UU, UUT, TTT, or TTTT (each listed 5' to 3').
[0077] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, an IAV RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises a nucleotide that corresponds to or is identical to a nucleotide in an influenza A virus genomic RNA sequence.
[0078] Examples of sequences for use in forming an IAV RNAi agent are provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. In some embodiments, the antisense strand of an IAV RNAi agent comprises any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In certain embodiments, the antisense strand of an IAV RNAi agent comprises or consists of any one of the modified sequences in Table 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the antisense strand of an IAV RNAi agent comprises the sequence of nucleotides (5' to 3') 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the sense strand of an IAV RNAi agent comprises any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F. In some embodiments, the sense strand of an IAV RNAi agent comprises the sequence of nucleotides (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F. In certain embodiments, the sense strand of an IAV RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0079] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein contain a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form blunt ends. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairs).
[0080] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form frayed ends. In some embodiments, both ends of an RNAi agent form frayed ends. In some embodiments, neither end of an RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of a double-stranded RNAi agent form an overhang. The unpaired nucleotides may be on the sense strand or the antisense strand and form either a 3' overhang or a 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.
[0081] The IAV RNAi agents disclosed herein may also be composed of one or more modified nucleotides. In some embodiments, substantially all of the nucleotides in the sense strand of the IAV RNAi agent and substantially all of the nucleotides in the antisense strand of the RAGE RNAi agent are modified nucleotides. The IAV RNAi agents disclosed herein may further comprise one or more modified internucleoside linkages, such as one or more phosphorothioate or phosphorodithioate linkages. In some embodiments, the IAV RNAi agent contains one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, 2'-modified nucleotides are combined with modified internucleoside linkages.
[0082] In some embodiments, the IAV RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the IAV RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the IAV RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms, which are well known in the art, are within the scope of the invention disclosed herein.
[0083] Modified Nucleotides Modified nucleotides, when used in various oligonucleotide constructs, can maintain the activity of compounds in cells while increasing the serum stability of these compounds and can also minimize the potential for interferon activation in humans following administration of the oligonucleotide construct.
[0084] In some embodiments, an IAV RNAi agent contains one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. As used herein, modified nucleotides may include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, inverted nucleotides, nucleotides containing modified nucleobases, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2' internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-Me,2'-fluoronucleotides, morpholino nucleotides, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also referred to as 2'-methoxy nucleotides), 2'-fluoro nucleotides (also referred to herein as 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxylethyl) nucleotides (also referred to as 2'-MOE), 2'-amino nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, two or more modifications may be incorporated into a single IAV RNAi agent, or even into that single nucleotide. IAV RNAi agent sense and antisense strands can be synthesized and / or modified by methods known in the art. A modification at one nucleotide is independent of a modification at another nucleotide.
[0085] Modified nucleobases include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thio Included are synthetic and natural nucleobases such as cytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine and 3-deazaadenine.
[0086] In some embodiments, the 5' and / or 3' end of the antisense strand can include an abasic residue (Ab), which may also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1' position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203.) In some embodiments, the abasic residue can be positioned internally in the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3' end of the antisense strand. In some embodiments, the 5' end of the sense strand can include one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3' end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
[0087] In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides is an RNAi agent that has four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides that are ribonucleotides (unmodified) in both the sense strand and the antisense strand. As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides is a sense strand that has two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the sense strand. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides is an antisense strand that has two or fewer (i.e., 0, 1, or 2) nucleotides that are unmodified ribonucleotides in the antisense strand. In some embodiments, one or more nucleotides of an RNAi agent are unmodified ribonucleotides. The chemical structures of certain modified nucleotides are listed in Table 11 herein.
[0088] Modified internucleoside linkages In some embodiments, one or more nucleotides of an IAV RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein as a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with reverse polarity in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
[0089] In some embodiments, the sense strand of an IAV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of an IAV RNAi agent can contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of an IAV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of an IAV RNAi agent can contain 1, 2, 3, or 4 phosphorothioate linkages, or both the sense strand and the antisense strand can independently contain 1, 2, 3, or 4 phosphorothioate linkages.
[0090] In some embodiments, the sense strand of an IAV RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are located at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain any phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends and the optional inverted abasic residue end cap. In some embodiments, a targeting ligand is linked to the sense strand via a phosphorothioate linkage.
[0091] In some embodiments, the IAV RNAi agent antisense strand contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are located between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is located between positions 20-21 from the 5' end of the antisense strand. In some embodiments, the IAV RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
[0092] Capping residues or moieties In some embodiments, the sense strand may include one or more capping residues or moieties, sometimes referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" is a non-nucleotide compound or other moiety that can be incorporated at one or more ends of a nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, provide an RNAi agent with certain beneficial properties, such as protection against exonuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art and include, for example, inverted abasic residues and carbon chains, such as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dodecyl) group. In some embodiments, the capping residue is present at either the 5'-end, the 3'-end, or both the 5'- and 3'-ends of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain two or more inverted abasic deoxyribose moieties as capping residues.
[0093] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, inclusion of one or more inverted abasic residues or inverted abasic sites at or near one or more ends of the sense strand of the RNAi agent allows for enhanced activity or other desired properties of the RNAi agent.
[0094] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5' end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near one or more ends of the sense strand of the RNAi agent can enhance the activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be replaced with an inverted ribitol (abasic ribose) residue. In some embodiments, the 3' end of the antisense strand core stretch sequence or the 3' end of the antisense strand sequence can include an inverted abasic residue. The chemical structure of an inverted abasic deoxyribose residue is shown in Table 11 below.
[0095] IAV RNAi agents The IAV RNAi agents disclosed herein are designed to target specific locations on the influenza A virus genome (e.g., SEQ ID NO:1 (NC_026431.1) and SEQ ID NOs:2-6); these specific target locations were chosen in part because they also have conserved sequences across various other influenza genomes. As defined herein, the antisense strand sequence is designed to target the influenza A virus genome at a given location on the genome such that, when base-paired to a gene or viral genome, the 5'-terminal nucleobase of the antisense strand aligns with a position 21 nucleotides downstream (towards the 3' end) from that location on the genome. For example, as exemplified in Tables 1A, 1B, 1C, 1D, 1E, 1F, 2A, 2B, 2C, 2D, 2E, and 2F herein, an antisense strand sequence designed to target the influenza A virus genome at position 150 requires that the 5'-terminal nucleobase of the antisense strand align with position 170 of the influenza A virus genome when base-pairing to the genome.
[0096] As provided herein, an IAV RNAi agent does not require that the nucleobase at position 1 (5' to 3') of the antisense strand be complementary to the viral genome, so long as there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the viral genome over a core stretch sequence of at least 17 contiguous nucleotides. For example, for an IAV RNAi agent disclosed herein designed to target position 150 of the influenza A virus genome, the 5'-terminal nucleobase of the antisense strand of the IAV RNAi agent should be aligned with position 170 of the respective genome. However, the 5'-terminal nucleobase of the antisense strand can, but need not, be complementary to position 170 of the influenza A virus genome, so long as there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the viral genome transcript over a core stretch sequence of at least 17 contiguous nucleotides. Notably, as demonstrated by various examples disclosed herein, the specific binding site of a gene by the antisense strand of an IAV RNAi agent (e.g., whether the IAV RNAi agent is designed to target the influenza A virus genome at position 150, 429, 1217, or some other position) is an important factor for the level of inhibition achieved by the IAV RNAi agent. (See, for example, Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).
[0097] In some embodiments, an IAV RNAi agent disclosed herein targets an influenza A virus genome at or near the location of each influenza A virus genome sequence shown in Tables 1A, 1B, 1C, 1D, 1E, and 1F. In some embodiments, the antisense strand of an IAV RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to a target influenza A virus genome 19-mer sequence disclosed in Tables 1A, 1B, 1C, 1D, 1E, and 1F.
[0098] [Table 1]
[0099] [Table 2]
[0100] [Table 3]
[0101] [Table 4]
[0102] [Table 5]
[0103] [Table 6]
[0104] Influenza A virus (A / California / 07 / 2009 (H1N1) segment 7 matrix protein 2 (M2) and matrix protein 1 (M1) genes, complete cds (NC_026431.1) (SEQ ID NO: 1), viral genome transcript (982 bases): 1 atgagtcttc taaccgaggt cgaaacgtac gttctttcta tcatcccgtc aggccccctc 61 aaagccgaga tcgcgcagag actggaaagt gtctttgcag gaaagaacac agatcttgag 121 gctctcatgg aatggctaaa gacaagacca atcttgtcac ctctgactaa gggaatttta 181 ggatttgtgt tcacgctcac cgtgcccagt gagcgaggac tgcagcgtag acgctttgtc 241 caaaatgccc taaatgggaa tggggacccg aacaacatgg atagagcagt taaactatac 301 aagaagctca aaagagaaat aacgttccat ggggccaagg aggtgtcact aagctattca 361 actggtgcac ttgccagttg catgggcctc atatacaaca ggatgggaac agtgaccaca 421 gaagctgctt ttggtctagt gtgtgccact tgtgaacaga ttgctgattc acagcatcgg 481 tctcacagac agatggctac taccaccaat ccactaatca ggcatgaaaa cagaatggtg 541 ctggctagca ctacggcaaa ggctatggaa cagatggctg gatcgagtga acaggcagcg 601 gaggccatgg aggttgctaa tcagactagg cagatggtac atgcaatgag aactattggg 661 actcatccta gctccagtgc tggtctgaaa gatgaccttc ttgaaaattt gcaggcctac 721 cagaagcgaa tgggagtgca gatgcagcga ttcaagtgat cctctcgtca ttgcagcaaa 781 tatcattggg atcttgcacc tgatattgtg gattactgat cgtctttttt tcaaatgtat 841 ttatcgtcgc tttaaatacg gtttgaaaag agggccttct acggaaggag tgcctgagtc 901 catgagggaa gaatatcaac aggaacagca gagtgctgtg gatgttgacg atggtcattt 961 tgtcaacata gagctagagt aa
[0105] Influenza AM genome segments include both M1 and M2, however, as used herein, when referring to inhibiting expression of the influenza AM1 viral genome segment, it refers to an RNAi agent that targets the viral genome transcript anywhere in SEQ ID NO:1.
[0106] Influenza A virus (A / California / 07 / 2009 (H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) gene, complete cds (NC_026432.1) (SEQ ID NO: 2), viral genome transcript (863 bases): 1 atggactcca acaccatgtc aagctttcag gtagactgtt tcctttggca tatccgcaag 61 cgatttgcag acaatggatt gggtgatgcc ccattccttg atcggctccg ccgagatcaa 121 aagtccttaa aaggaagagg caacaccctt ggcctcgata tcgaaacagc cactcttgtt 181 gggaaacaaa tcgtggaatg gatcttgaaa gaggaatcca gcgagacact tegatgaca 241 attgcatctg tacctactc gcgctacctt tctgacatga ccctcgagga atgtcacga 301 gactggttca tgctcatgcc taggcaaag atataggcc ctcttgcgt gcgattggac 361 caggcgatca tggaaagaa catagtactg aaagcgaact tcagtgtaat ctttaaccga 421 tagagacct tgatactact aagggctttc actgaggagg gagcaatagt tggagaatt 481 tcaccattac cttctcttcc aggacatact tatgaggatg tcaaaatgc agttggggtc 541 ctcatcggag gacttgaatg gatggtaac acggttcgag tctctgaaaa tatacagaga 601 ttcgcttgga gaactgtga tgagaatggg agaccttcac tacctccaga gcagaatga 661 aaagtggcga gagcaatttgg gagagaatt tgaggaata aggtggttaa tgagagaat 721 gcggcacaga ttgaagcga cagagaatag ttcgacaa atacattta tgcaagcctt 781 acactactg cttgaagtag aacaagagat aagagcttc tcgtttcagc tttaatg 841 aaaaaaca cccttgtttc tac
[0107] Influenza A virus (A / California / 07 / 2009(H1N1)) segment 2 polymerase PB1 (PB1) gene, complete cds; and non-functional PB1-F2 protein (PB1-F2) gene, complete sequence (NC_026435.1) (SEQ ID NO: 3), viral genome transcript (2274 bases): 1 atggatgtca atccgactct acttttccta aaaattccag cgcaaaatgc cataagcacc 61 acattccctt atactggaga tcctccatac agccatggaa caggaacagg atacaccatg 121 gacacagtaa acagaacaca ccaatactca gaaaagggaa agtggacgac aaacacagag 181 actggtgcac cccagctcaa cccgattgat ggaccactac ctgaggataa tgaaccaagt 241 gggtatgcac aaacagactg tgttctagag gctatggctt tccttgaaga atcccaccca 301 ggaatatttg agaattcatg ccttgaaaca atggaagttg ttcaacaaac aagggtagat 361 aaactaactc aaggtcgcca gacttatgat tggacattaa acagaaatca accggcagca 421 actgcattgg ccaacaccat agaagtcttt agatcgaatg gcctaacagc taatgagtca 481 ggaaggctaa tagatttctt aaaggatgta atggaatcaa tgaacaaaga ggaaatagag 541 ataacaaccc actttcaaag aaaaaggaga gtaagagaca acatgaccaa gaagatggtc 601 acgghaagaaaagggaa gaaaaaaaaaaactgaata agagaggcta tctaataga 661 gcactgacat taaatacgat gaccaagat gcagagagag gcaagttaaa aagaagggct 721 atcgcacac ctgggatgca gattagaggt ttcgtatact ttgttgaac tttagctagg 781 agcatttgcg aaagcttga acagtctggg ctcccagtag ggggcaatga aaagaaggcc 841 aactggcaa atgttgtgag aagatgatg actattcac aagacacaga gatttctttc 901 acatcactg gggacacac taagtggaat gaaatcaa atcctcgaat gttcctggcg 961 atgattacat atatcaccag aaatcaaccc gagtggttca gaaacatcct gagcatggca 1021cccataatgt tctcaacaa aatggcaaga ctagggaag ggtacatgtt cgagagtaaa 1081 agaatgaga ttcgacaca ataccagca gaatgctag caagcattga cctgaagtac 1141 ttcaatgaat siaaagaa gaaattgag aaaataggc ctctctaat agatggcaca 1201 gcatcactga gtcctgggat gatgatgggc atgttcaca tgctaagtac ggtcttggga 1261 gtctcgaac tgaatcttgg aaaaagaa tacaccaga caatactg gtgggatgg 1321 ctccaatcat ccgacgattt tgctctcata gtgaatgcac caaaccatga gggaatacaa 1381 gcaggagtgg acagattcta caggacctgc aagttagtgg gaatcaacat gagcaaaaag 1441 aagtcctata taaataagac agggacattt gaattcacaa gcttttttta tcgctatgga 1501 tttgtggcta attttagcat ggagctaccc agctttggag tgtctggagt aaatgaatca 1561 gctgacatga gtattggagt aacagtgata aagaacaaca tgataaacaa tgaccttgga 1621cctgcaacgg cccagatggc tcttcaattg ttcatcaaag actacagata cacatatagg 1681 tgccataggg gagacacaca aattcagacg agaagatcat ttgagttaaa gaagctgtgg 1741 gatcaaaccc aatcaaaggt agggctatta gtatcagatg gaggaccaaa cttatacaat 1801 atacggaatc ttcacattcc tgaagtctgc ttaaaatggg agctaatgga tgatgattat 1861 cggggaagac tttgtaatcc cctgaatccc tttgtcagtc ataaagagat tgattctgta 1921 aacaatgctg tggtaatgcc agcccatggt ccagccaaaa gcatggaata tgatgccgtt 1981 gcaactacac attcctggat tcccaagagg aatcgttcta ttctcaacac aagccaaagg 2041 ggaattcttg aggatgaaca gatgtaccag aagtgctgca atctattcga gaaatttttc 2101cctagcagtt catataggag accggttgga atttctagca tggtggaggc catggtgtct 2161 agggcccgga ttgatgccag ggtcgacttc gagtctggac ggatcaagaa agaagagttc 2221 tctgagatca tgaagatctg ttccaccatt gaagaactca gacggcaaaa ataa
[0108] Influenza A virus (A / California / 07 / 2009 (H1N1)) segment 1 polymerase PB2 (PB2) gene, complete cds (NC_026438.1) (SEQ ID NO: 4), viral genome transcript (2280 bases): 1 atggagagaa taaaagaact gagagatcta atgtcgcagt cccgcactcg cgagatactc 61 actaagacca ctgtggacca tatggccata atcaaaaagt acacatcagg aaggcaagag 121 aagaaccccg cactcagaat gaagtggatg atggcaatga gatacccaat tacagcagac 181 aagagaataa tggacatgat tccagagagg aatgaacaag gacaaacccct ctggagcaaa 241 acaaacgatg ctggatcaga ccgagtgatg gtatcacctc tggccgtaac atggtggaat 301 aggaatggcc caacaacaag tacagttcat taccctaagg tatataaaac ttatttcgaa 361 aaggtcgaaa ggttgaaca tggtaccttc ggccctgtcc acttcagaaa tcaagttaaa 421 aaggagga gagttgatac aaaccctggc catgcagatc tcagtgccaa ggaggcacag 481 gatgtgatta tggagttgt ttcccaat gaagtgggggg caagaatact gatcagag 541 tcacagctgg caatacaaagagaaa gagagctcc aggattgtaa aattgctccc 601 ttgatggtgg cgtacatgct agaaagagaa ttggtccgta aacaaggtt tctcccagta 661 gccggcggaa caggcagtgt ttatattgaa gtgttgcact taaccagg gacgtgctgg 721 gagcagatgt acactccagg aggaagtg agaatgatg atgttgacca aagttgatt 781 atcgctgcta gaacatagt aagagagca gcagtgtcag cagacccatt agcatctctc 841 tggaatgt gccacagcac acagattgga ggagtagga tggtgacat ccttagacag 901 atccaactg aggaacaagc cgtagacata tgcaggcag caataggtt gaggattagc 961 tcatcttca gttttggtgg gttcacttc aaaaggacaa gcgatcatc agtcagaaa 1021 gagagaag tgctaacgggg siacctccaa acctgaaaa tagagtaca tgaagggtat 1081 gaagaattca caatggttgg gagagagca acagctattc tcagaaaggc aaccaggaga 1141 ttgatccagt tgatagtag cgggagagac gagcagtcaa ttgctgaggc aataattgtg 1201 gccatggtat tctcacagga ggattgcatg atcaaggcag ttaggggcga tctgaacttt 1261 gtcaataggg caaaccagcg actgaacccc atgcaccaac tcttgaggca tttccaaaaa 1321 gatgcaaaag tgcttttcca gaactggggga attgaatcca tcgacaatgt gatgggaatg 1381 atcggaatac tgcccgacat gaccccaagc acggagatgt cgctgagagg gataagagtc 1441 1501 tttttaaggg ttagagatca aagagggaac gtactattgt ctcccgaaga agtcagtgaa 1561 1621 1681 aaaattcaat ggtcacaaga tcccacaatg ttatacaaca aaatggaatt tgaaccattt 1741 cagtctcttg tccctaaggc aaccagaagc cggtacagtg gattcgtaag gacactgttc 1801 cagcaaatgc gggatgtgct tgggacattt gacactgtcc aaataataaa acttctcccc 1861 tttgctgctg ccccaccaga acagagtagg atgcaatttt cctcattgac tgtgaatgtg 1921 agaggatcag ggttgaggat actggtaaga ggcaattctc cagtattcaa ttacaacaag 1981 gcaaccaaac gacttacagt tcttggaaag gatgcaggtg cattgactga agatccagat 2041 gaaggcacat ctggggtgga gtctgctgtc ctgagaggat ttctcatttt gggcaaagaa 2101 gacaagagat atggcccagc attaagcatc aatgaactga gcaatcttgc aaaaggagag 2161 aaggctaatg tgctaattgg gcaaggggac gtagtgttgg taatgaaacg aaaacgggac 2221 tctagcatac ttactgacag ccagacagcg accaaaagaa ttcggatggc catcaattag
[0109] Influenza A virus (A / California / 07 / 2009 (H1N1)) segment 5 nucleocapsid protein (NP) gene, complete cds (NC_026436.1) (SEQ ID NO: 5), viral genome transcript (1497 bases): 1 atggcgtctc aaggcaccaa acgatcatat gaacaaatgg agactggtgg ggagcgccag 61 gatgccacag aaatcagagc atctgtcgga agaatgattg gtggaatcgg gagattctac 121 atccaatgt gcaactgaact caactcagt gattatgatg gacgactaat ccagaatagc 181 atacaatag agaggatggt gctttctgct tttgatgaga gaagaata atacctagaa 241 gagcatccca gtgctgggaa ggacctaag aaaacaggag gacccatata tagagagta 301 gacggaaagt ggatgagaga actcatcctt tatgacaag raggaataag gagagttttgg 361 cgcctagcaa acatggcga agatgcaca gcaggtctta ctcatatcat gatttggcat 421 tccaacctga atgatgccac atatcagaga acagagcgc ttgttcgcac cggaatggat 481cccagaatgt gctcttaat gcaagttca acactccca gaagtctgg tgccgcaggt 541 gctgcggtga aaggagttgg aacaatagca atggagttaa tcagaatgat caacgtgga 601 atcaatgacc gaatttctg gaggggtgaa atcaatgacgaa ggacaagggt tgcttatgaa 661 agatgtgca atatcctca aggaaattt caacagctg cccagagggc atgatggat 721 caagtaagag aaagtcgaaa cccaggaac gctgagattg aagacctcat ttcctggca 781 cggtcagcac tcattctgag gggatcagtt gcacataaat cctgcctgcc tgcttgtgtg 841 tatgggcttg footgcaag tgggcatgac tttgaaaggg aagggtactc actggtcggg 901 atagacccat tcaaattact ccaaaacagc caagtggtca gcctgatgag accaaatgaa 961 aacccagctc aaagagtca attggtgtgg atggcatgcc actctgctgc atttgaagat 1021 ttaagagtat caagtttcat aaggaaag aaagtgattc caaggaaa gctttccaca 1081 agaggggtcc agattgcttc aaatgagaat gtggaaacca tggactccaa taccctggaa 1141 ctgagaagca gatactgggc cataaggacc aggagtggag gaataccaa tcaacaaaag 1201 gcatccgcag gccagatcag tgtgcagcct acattctcag tgcagcggaa tctccctttt 1261 gaagagcaa ccgttatggc agcattcagc gggaacaatg aaggacggac atccgacatg 1321 cgaacagaag ttataagaat gatggaaagt gcaaagccag aagatttgtc cttccagggg 1381 cggggagtct tcgagctctc ggacgaaaag gcaacgaacc cgatcgtgcc ttcctttgac 1441
[0110] Influenza A virus (A / California / 07 / 2009 (H1N1)) segment 3 polymerase PA (PA) gene, complete cds (NC_026437.1) (SEQ ID NO: 6), viral genome transcript (2151 bases): 1 atggaagact ttgtgcgaca atgcttcaat ccaatgatcg tcgagcttgc ggraaaggca 61 atgaaagaat atggggaaga tccgaaaatc gaaactaaca agtttgctgc aatatgcaca 121 catttggaag tttgtttcat gtattcggat ttccatttca tcgacgaacg gggtgaatca 181 ataattgtag aatctggtga cccgaatgca ctattgaagc accgatttga gataattgaa 241 ggaagagacc gaatcatggc ctggacagtg gtgaacagta tatgtaacac aacaggggta 301 gagaagccta aatttcttcc tgatttgtat gattacaaag agaaccggtt cattgaaatt 361 ggagtaacac ggagggaagt ccacatatat tacctagaga aagccaacaa aataaaatct 421 gagaagacac acattcacat cttttcattc actggagagg agatggccac caaagcggac 481 tacacccttg acgaagagag cagggcaaga atcaaaacta ggcttttcac tataagacaa 541 gaaatggcca gtaggagtct atgggattcc tttcgtcagt ccgaaagagg cgaagagaca 601 attgaagaa aatttgagat tacaggaact atgcgcaagc ttgccgacca aagtctccca 661ccgaacttcc ccagccttga aaactttaga gcctatgtag atggattcga gccgaacggc 721 tgcattgagg gcaagctttc ccaaatgtca aaagagtga acgccaaaat tgaaccattc 781 ttgaggacga caccacgcccc cctcagattg cctgatgggc ctctttgcca tcagcggtca 841 aagttcctgc tgatggatgc tctgaaatta agtattgaag acccgagtca cgagggggag 901 ggataccac tatatgatgc aatcaaatgc atgaagacat tctttggctg gaagagcct 961 aacatagtca aaccacatga gaaaggcata aatcccaatt acctcatggc ttggaagcag 1021 gtgctagcag agctacagga cattgaaaat gaagagaa tcccaaggac aaagaacatg 1081 aagagaacaa gccaattgaa gtgggcactc ggtgaaaaata tggcaccaga aaaagtagac 1141 tttgatgact gcaaagatgt tggagacctt aaacgtatg acagtgatga gccagagcc 1201 agatctctag caagctgggt ccaaaatgaa ttcaataagg catgtgaatt gactgattca 1261 1321 atgaggagga actattttac agcagaagtg tcccactgca gggctactga atacataatg 1381 aagggagtgt acataaatac ggccttgctc aatgcatcct gtgcagccat ggatgacttt 1441 cagctgatcc caatgataag caaatgtagg accaaagaag gaagacggaa aacaaacctg 1501 tatgggttca ttataaaagg aaggtctcat ttgagaaatg atactgatgt ggtgaacttt 1561 gtaagtatgg agttctcact cactgacccg agactggagc cacacaaatg ggaaaaatac 1621 tgtgttcttg aaataggaga catgctcttg aggactgcga taggccaagt gtcgaggccc 1681 atgttcctat atgtgagaac caatggaacc tccaagatca agatgaaatg gggcatggaa 1741 atgaggcgct gccttcttca gtctcttcag cagattgaga gcatgattga ggccgagtct 1801 tctgtcaaag agaaagacat gaccaaggaa ttctttgaaa acaaatcgga aacatggcca 1861 atcggagagt cacccagggg agtggaggaa ggctctattg ggaaagtgtg caggacctta 1921 ctggcaaaat ctgtattcaa cagtctatat gcgtctccac aacttgaggg gttttcggct 1981 gaatctagaa aattgcttct cattgttcag gcacttaggg acaacctgga acctggaacc 2041 ttcgatcttg gggggctata tgaagcaatc gaggagtgcc tgattaatga tccctgggtt 2101 ttgcttaatg catcttggtt caactccttc ctcacacatg cactgaagta g
[0111] In some embodiments, an IAV RNAi agent comprises an antisense strand, wherein position 19 (5'→3') of the antisense strand can base pair to position 1 of a 19-mer target sequence disclosed in Table 1A, 1B, 1C, 1D, 1E, or 1F. In some embodiments, an IAV RNAi agent comprises an antisense strand, wherein position 1 (5'→3') of the antisense strand can base pair to position 19 of a 19-mer target sequence disclosed in Table 1A, 1B, 1C, 1D, 1E, or 1F.
[0112] In some embodiments, an IAV RNAi agent comprises an antisense strand, wherein position 2 (5'→3') of the antisense strand can base pair with position 18 of a 19-mer target sequence disclosed in Table 1A, 1B, 1C, 1D, 1E, or 1F. In some embodiments, an IAV RNAi agent comprises an antisense strand, wherein positions 2 through 18 (5'→3') of the antisense strand can base pair with each of the respective complementary bases located at positions 18 through 2 of a 19-mer target sequence disclosed in Table 1A, 1B, 1C, 1D, 1E, or 1F.
[0113] In the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the influenza A virus genome or can be non-complementary to the targeted influenza A virus genome. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or UA base pair with the sense strand.
[0114] In some embodiments, the antisense strand of an IAV RNAi agent comprises the sequence of nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. In some embodiments, the sense strand of an IAV RNAi agent comprises the sequence of nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F.
[0115] In some embodiments, an IAV RNAi agent is composed of (i) an antisense strand comprising the sequence of nucleotides 2 to 18 or 2 to 19 (5' end to 3' end) of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising the sequence of nucleotides 1 to 17 or 1 to 18 (5' end to 3' end) of any of the sense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F.
[0116] In some embodiments, the IAV RNAi agent comprises a core 19-mer nucleotide sequence shown in Tables 2A, 2B, 2C, 2D, 2E, and 2F below.
[0117] [Table 7-1] [Table 7-2] [Table 7-3]
[0118] [Table 8-1] [Table 8-2] Table 8-3 Table 8-4 Table 8-5 Table 8-6
[0119] Table 9-1 Table 9-2 Table 9-3 Table 9-4
[0120] Table 10-1 Table 10-2
[0121] Table 11-1 Table 11-2 Table 11-3
[0122] Table 12-1 [Table 12-2]
[0123] The sense and antisense strands of an IAV RNAi agent comprising or consisting of a nucleotide sequence in Tables 2A, 2B, 2C, 2D, 2E, and 2F can be modified or unmodified nucleotides. In some embodiments, an IAV RNAi agent having a sense and antisense strand sequence comprising or consisting of any of the nucleotide sequences in Tables 2A, 2B, 2C, 2D, 2E, and 2F is all or substantially all modified nucleotides.
[0124] In some embodiments, the antisense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Tables 2A, 2B, 2C, 2D, 2E, and 2F. In some embodiments, the sense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Tables 2A, 2B, 2C, 2D, 2E, and 2F.
[0125] As used herein, each N listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F can be independently selected from any and all nucleobases (including nucleobases found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Tables 2A, 2B, 2C, 2D, 2E, and 2F have a different nucleobase than the N nucleotide at the corresponding position on the other strand.
[0126] The sense and antisense strands of certain modified IAV RNAi agents are provided in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. The antisense strands of certain modified IAV RNAi agents and their underlying unmodified nucleobase sequences are provided in Tables 3A, 3B, 3C, 3D, 3E, 3F. The sense strands of certain modified IAV RNAi agents and their underlying unmodified nucleobase sequences are provided in 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F. In forming an IAV RNAi agent, each of the nucleotides in each of the underlying base sequences listed in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F above, and Tables 2A, 2B, 2C, 2D, 2E, 2F, can be a modified nucleotide.
[0127] The IAV RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F can hybridize to any antisense strand containing a sequence listed in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F, as long as the two sequences, the sense strand and the antisense strand, have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0128] In some embodiments, the antisense strand of an IAV RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F.
[0129] In some embodiments, an IAV RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0130] Examples of antisense strands containing modified nucleotides are provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F. Examples of sense strands containing modified nucleotides are provided in Tables 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, and 6F.
[0131] As used in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F, the following notations are used to indicate modified nucleotides, targeting groups, and linking groups: A = adenosine-3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t=2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate A UNA 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA 2',3'-seco-cytidine-3'-phosphate C UNA s=2',3'-seco-cytidine-3'-phosphorothioate G UNA 2',3'-seco-guanosine-3'-phosphate G UNA s=2',3'-seco-guanosine-3'-phosphorothioate U UNA 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = See Table 11 a_2Ns = See Table 11 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 11 s = phosphorothioate bond p = terminal phosphate (as synthesized) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 11) CPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) CPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 11) (Alk-SS-C6) = See Table 11 (C6-SS-Alk) = See Table 11 (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (C6-SS-Alk-Me) = See Table 11 (NH2-C6) = See Table 11 (TriAlk14) = See Table 11 (TriAlk14)s = See Table 11 -C6- = See Table 11 -C6s- = See Table 11 -L6-C6-=See Table 11 -L6-C6s- = See Table 11 -Alk-cyHex- = See Table 11 -Alk-cyHexs- = See Table 11 (TA14) = See Table 11 (structure of (TriAlk14)s after conjugation) (TA14)s = See Table 11 (structure of (TriAlk14)s after conjugation)
[0132] As those skilled in the art will readily understand, unless otherwise indicated by the sequence (e.g., by a phosphorothioate linkage "s"), nucleotide monomers, when present in an oligonucleotide, are linked to one another by a 5'-3'-phosphodiester bond. As those skilled in the art will clearly understand, the inclusion of a phosphorothioate linkage, as shown in the modified nucleotide sequences disclosed herein, replaces the phosphodiester linkage typically present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence will typically have a hydroxyl (-OH) group instead of a phosphate moiety at the 3' position of each given monomer ex vivo. Additionally, for the embodiments disclosed herein, when viewing each strand from 5' to 3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked to the 3' end of the preceding monomer on each strand (see, e.g., Table 11). Furthermore, as one of ordinary skill in the art will readily understand and appreciate, while the phosphorothioate chemical structures depicted herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom bears a double bond and the anion is on the oxygen atom). Unless otherwise expressly indicated herein, this understanding of one of ordinary skill in the art will be used when describing the IAV RNAi agents and compositions of IAV RNAi agents disclosed herein.
[0133] Specific examples of targeting groups and linking groups for use in the IAV RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense and / or antisense strand can have any targeting or linking group listed herein, as well as other targeting or linking groups, conjugated to the 5' and / or 3' ends of the sequence.
[0134] [Table 13-1] [Table 13-2]
[0135] [Table 14-1] [Table 14-2] [Table 14-3]
[0136] [Table 15] [Table 16]
[0137] [Table 17]
[0138] [Table 18]
[0139] [Table 19] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0140] [Table 20] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0141] [Table 21] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0142] [Table 22] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0143] [Table 23] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0144] [Table 24] a_2N = 2-aminoadenosine nucleotide, I = hypoxanthine (inosine) nucleotide
[0145] [Table 25] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0146] [Table 26] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0147] [Table 27] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0148] [Table 28] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0149] [Table 29] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0150] [Table 30] (A 2N ) = 2-aminoadenosine nucleotide; I = hypoxanthine (inosine) nucleotide
[0151] [Table 31]
[0152] [Table 32]
[0153] [Table 33]
[0154] [Table 34]
[0155] [Table 35]
[0156] [Table 36]
[0157] The IAV RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, or 6F can hybridize to any antisense strand containing a sequence listed in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F, so long as the two sequences, the sense strand and the antisense strand, have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence.
[0158] As shown in Tables 5A, 5B, 5C, 5D, 5E, and 5F above, certain exemplary IAV RNAi agent nucleotide sequences are shown to further comprise a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the IAV RNAi agent sense strand sequences shown in Tables 5A, 5B, 5C, 5D, 5E, and 5F above have a (TriAlk14) linking group at the 5' end of the nucleotide sequence. Other linking groups, such as an (NH2-C6) linking group or a (6-SS-6) or (C6-SS-C6) linking group, may also or instead be present in certain embodiments. Such reactive linking groups are positioned to facilitate the attachment of targeting ligands, targeting groups, and / or PK / PD modulators to the IAV RNAi agents disclosed herein. Linking or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the invention herein include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, reverse demand Diels-Alder cycloaddition reactions, oxime ligation, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.
[0159] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the Examples and Figures disclosed herein, can be synthesized as activated esters, e.g., tetrafluorophenyl (TFP) esters, which can be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to an IAV RNAi agent disclosed herein. In some embodiments, the targeting ligand is synthesized as an azide, which can be conjugated to a propargyl (e.g., TriAlk14) or DBCO group, e.g., via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reaction.
[0160] In addition, certain nucleotide sequences can be synthesized with a dT nucleotide at the 3'-end of the sense strand, followed by a (3'→5') linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate linking to additional components, such as a PK / PD modulator or one or more targeting ligands. As described herein, the C6-SS-C6 disulfide bond is first reduced to remove the dT from the molecule, which can then facilitate conjugation of the desired PK / PD modulator. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.
[0161] In some embodiments, the antisense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In some embodiments, the sense strand of an IAV RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0162] In some embodiments, an IAV RNAi agent antisense strand comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, an IAV RNAi agent antisense strand comprises the sequence of nucleotides (5' to 3') 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In certain embodiments, an IAV RNAi agent antisense strand comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0163] In some embodiments, the sense strand of an IAV RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the IAV RNAi agent antisense strand comprises nucleotides 1-17, 2-17, 3-17 (5' end to 3' end) of any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F. , 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24. In certain embodiments, the sense strand of the IAV RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0164] In the RNAi agents disclosed herein, the nucleotide at position 1 (5'->3') of the antisense strand can be perfectly complementary to the influenza A virus genome or can be non-complementary to the influenza A virus genome. In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand is U, A, or dT (or a modified version of U, A, or dT). In some embodiments, the nucleotide at position 1 (5'->3') of the antisense strand forms an A:U or UA base pair with the sense strand.
[0165] In some embodiments, the IAV RNAi agent antisense strand comprises the sequence of nucleotides 2-18 or 2-19 (5' end to 3' end) of any of the antisense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In some embodiments, the influenza A virus genome RNAi sense strand comprises the sequence of nucleotides 1-17 or 1-18 (5' end to 3' end) of any of the sense strand sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0166] In some embodiments, an IAV RNAi agent comprises: (i) an antisense strand comprising the sequence of nucleotides 2-18 or 2-19 (5' end to 3' end) of any of the antisense strand sequences in Table 2, Table 3, or Table 10; and (ii) a sense strand comprising the sequence of nucleotides 1-17 or 1-18 (5' end to 3' end) of any of the sense strand sequences in 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0167] A sense strand comprising a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand comprising a sequence listed in Table 2 or Table 3, so long as the two sequences, the sense strand and the antisense strand, have a region of at least 85% complementarity over a contiguous 16, 17, 18, 19, 20, or 21 nucleotide sequence. In some embodiments, an IAV RNAi agent has a sense strand consisting of any of the modified sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of any of the modified sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. Certain representative sequence pairings are exemplified by the duplex ID numbers shown in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, and 9F.
[0168] In some embodiments, an IAV RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers presented herein. In some embodiments, an IAV RNAi agent consists of any of the duplex ID numbers presented herein. In some embodiments, an IAV RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, an IAV RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers presented herein, and a targeting group, linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached (i.e., conjugated) to the sense or antisense strand. In some embodiments, an IAV RNAi agent comprises the sense and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein. In some embodiments, an IAV RNAi agent comprises the sense strand and antisense strand modified nucleotide sequences of any of the duplex ID numbers presented herein, and a targeting group, linking group, and / or other non-nucleotide group, which are covalently attached to the sense strand or the antisense strand.
[0169] In some embodiments, an IAV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and comprises a targeting group. In some embodiments, an IAV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and comprises one or more αvβ6 integrin targeting ligands.
[0170] In some embodiments, an IAV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and comprises a targeting group that is an integrin-targeting ligand. In some embodiments, the IAV RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2A, 2B, 2C, 2D, 2E, 2F, 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F, and also comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).
[0171] In some embodiments, an IAV RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F.
[0172] In some embodiments, an IAV RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense strand / sense strand duplexes in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F, and comprises an integrin-targeting ligand.
[0173] In some embodiments, an IAV RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F.
[0174] [Table 37]
[0175] [Table 38]
[0176] [Table 39]
[0177] [Table 40]
[0178] [Table 41]
[0179] [Table 42]
[0180] Table 43
[0181] Table 44
[0182] Table 45
[0183] Table 46
[0184] Table 47
[0185] Table 48
[0186] Table 49
[0187] Table 50
[0188] Table 51
[0189] Table 52
[0190] [Table 53]
[0191] [Table 54]
[0192] [Table 55]
[0193] [Table 56]
[0194] [Table 57]
[0195] [Table 58]
[0196] [Table 59]
[0197] [Table 60]
[0198] Table 10A. Conjugate ID numbers and chemically modified antisense and sense strands (including linkers and conjugates) of RNAi agents (targeting M1)
[0199] [Table 61]
[0200] [Table 62]
[0201] [Table 63]
[0202] [Table 64]
[0203] [Table 65]
[0204] [Table 66]
[0205] In some embodiments, the IAV RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the IAV RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the IAV RNAi agent is prepared or provided as a pharmaceutically acceptable sodium or potassium salt. The RNAi agents described herein inhibit or knock down expression of one or more influenza A virus genomes in vivo and / or in vitro upon delivery to cells expressing the influenza A virus genome.
[0206] Targeting Groups, Linking Groups, Pharmacokinetic / Pharmacodynamic (PK / PD) Modulators, and Delivery Vehicles In some embodiments, an IAV RNAi agent contains or is conjugated to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modulator, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or binding of the RNAi agent. The non-nucleotide group can be covalently attached to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, an IAV RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the IAV RNAi agent. The non-nucleotide group can be linked to the RNAi agent directly or indirectly via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0207] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving tissue-specific distribution and cell-specific uptake of the conjugate, hi some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.
[0208] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugate or RNAi agent to which they are attached, improving cell-specific (including, in some cases, organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugate or RNAi agent. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or can have a higher valency relative to the target to which they are directed. Representative targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker, such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can function as the linker in some instances.
[0209] With or without a linker, the targeting group can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F. Linkers, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F.
[0210] The IAV RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods typical in the art.
[0211] For example, in some embodiments, the IAV RNAi agents disclosed herein are synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted to form a conjugate with a group comprising, for example, an αvβ6 integrin targeting ligand. In some embodiments, the IAV RNAi agents disclosed herein are synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted to form a conjugate with a group comprising, for example, an αvβ6 integrin targeting ligand.
[0212] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells having αvβ6 on their respective surfaces, and binding of the integrin targeting ligand can facilitate entry of a therapeutic agent, such as an RNAi agent, to which it is linked into cells, e.g., epithelial cells such as lung epithelial cells and renal epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety), or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. Preparation of targeting groups such as αvβ6 integrin targeting ligands is described, for example, in WO 2018 / 085415 and WO 2019 / 089765, the contents of each of which are incorporated herein in their entirety.
[0213] In some embodiments, the targeting group is linked to the IAV RNAi agent without using an additional linker. In some embodiments, the targeting group is designed to easily have a linker present to facilitate linking to the IAV RNAi agent. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents can be linked to their respective targeting groups using the same linker. In some embodiments, when two or more RNAi agents are included in the composition, two or more RNAi agents are linked to their respective targeting groups using different linkers.
[0214] In some embodiments, a linking group is conjugated to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modulator, delivery polymer, or delivery vehicle. The linking group can be attached to the 3' and / or 5' end of the RNAi agent sense strand or antisense strand. In some embodiments, the linking group is attached to the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' or 3' end of the RNAi agent sense strand. In some embodiments, the linking group is conjugated to the 5' end of the RNAi agent sense strand. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6) and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, tri-alkyne functionalized groups, ribitol, and / or PEG groups. Examples of specific linking groups are provided in Table 11.
[0215] A linker or linking group is a connection between two atoms that links one chemical group (such as an RNAi agent) or segment of interest to another chemical group (such as a targeting group, a pharmacokinetic modulator, or a delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage includes a labile bond. A linkage can optionally include a spacer that increases the distance between the two linked atoms. The spacer may further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups, each of which may contain one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are well known in the art, and the preceding list is not meant to limit the scope of the description. In some embodiments, an IAV RNAi agent is conjugated to a polyethylene glycol (PEG) moiety or to a hydrophobic group having 12 or more carbon atoms, such as a cholesterol or palmitoyl group.
[0216] In some embodiments, an IAV RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modulators. PK / PD modulators can extend the circulation time of the conjugated drug and / or increase the activity of the RNAi agent through improved cell receptor binding, improved cellular uptake, and / or other means. A variety of PK / PD modulators suitable for use with RNAi agents are known in the art. In some embodiments, the PK / PD modulator can be a cholesterol or cholesteryl derivative, or in some circumstances, the PK / PD modulator can be comprised of an alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, or aralkynyl group, each of which can be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the attachment position of these moieties is at the 5' or 3' end of the sense strand, the 2' position of the ribose ring of any given nucleotide of the sense strand, and / or is attached to a phosphate or phosphorothioate backbone at any position of the sense strand.
[0217] Any of the IAV RNAi agent nucleotide sequences listed in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F, whether modified or unmodified, can contain a 3' and / or 5' targeting group, a linking group, and / or a PK / PD modulator. Any of the IAV RNAi agent sequences listed in Tables 3A, 3B, 3C, 3D, 3E, 3F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, and 10F, or otherwise described herein, that contain a 3' or 5' targeting group, linking group, and / or PK / PD modulator may alternatively not contain a 3' or 5' targeting group, linking group, or PK / PD modulator, or may contain a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator, including but not limited to those depicted in Table 11. Any of the IAV RNAi agent duplexes listed in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, and 10F, whether modified or unmodified, can further comprise a targeting group or linking group, including but not limited to, those depicted in Table 11, which can be attached to the 3' or 5' end of either the sense or antisense strand of the IAV RNAi agent duplex.
[0218] Examples of specific modified nucleotides, capping moieties, and linking groups are provided in Table 11.
[0219] [Table 67-1] [Table 67-2] [Table 67-3] [Table 67-4] [Table 67-5] [Table 67-6]
[0220] Alternatively, other linking groups known in the art can be used. In many cases, linking groups are commercially available or incorporated into commercially available nucleotide phosphoramidites. (See, for example, International Publication No. 2019 / 161213, the entirety of which is incorporated herein by reference).
[0221] In some embodiments, IAV RNAi agents are delivered without being conjugated to a targeting ligand or a pharmacokinetic / pharmacodynamic (PK / PD) modulator (referred to as "naked" or "naked RNAi agent").
[0222] In some embodiments, the IAV RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate delivery of the IAV RNAi agent to selected cells or tissues in vivo, for example, to epithelial cells. In some embodiments, the IAV RNAi agent is conjugated to a targeting group comprising an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. In some embodiments, the targeting group comprises one or more αvβ6 integrin targeting ligands.
[0223] In some embodiments, a delivery vehicle can be used to deliver an RNAi agent to a cell or tissue. A delivery vehicle is a compound that improves delivery of an RNAi agent to a cell or tissue. The delivery vehicle can include or consist of, but is not limited to, a polymer, such as an amphiphilic polymer, a membrane-active polymer, a peptide, a melittin peptide, a melittin-like peptide (MLP), a lipid, a reversibly modified polymer or peptide, or a reversibly modified membrane-active polyamine.
[0224] In some embodiments, the RNAi agent can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery. RNAi agents can also be chemically conjugated to targeting groups, lipids (including, but not limited to, cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, conjugated to polymers or DPCs (see, e.g., WO 2000 / 053722, WO 2008 / 022309, WO 2011 / 104169, and WO 2012 / 083185, WO 2013 / 032829, WO 2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by incorporation into other delivery vehicles or systems available in the art, such as hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors. In some embodiments, the RNAi agent can be conjugated to an antibody with affinity for lung epithelial cells. In some embodiments, the RNAi agent can be linked to a targeting ligand that has affinity for pulmonary epithelial cells or receptors present on pulmonary epithelial cells.
[0225] Pharmaceutical Compositions and Formulations The IAV RNAi agents disclosed herein can be prepared as pharmaceutical compositions or formulations (also referred to herein as "medications"). In some embodiments, the pharmaceutical compositions comprise at least one IAV RNAi agent. These pharmaceutical compositions are particularly useful in inhibiting the expression of influenza A virus genomic RNA or influenza RNA transcripts in target cells, cell populations, tissues, or organisms. The pharmaceutical compositions can be used to treat subjects with diseases, disorders, or conditions that would benefit from reduced levels of target influenza virus genomic mRNA or RNA transcripts or inhibited expression of a target viral genome. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease or disorder that would benefit from reduced levels of target RNA or target viral genomes. In one embodiment, the method comprises administering to the subject to be treated an IAV RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition comprising an IAV RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, e.g., a human.
[0226] Pharmaceutical compositions and methods including the IAV RNAi agents disclosed herein involve administering a therapeutically effective amount of an IAV RNAi agent described herein to a subject, thereby reducing the level of a target influenza A virus RNA in a cell, a group of cells, a tissue, an organ, or a subject, such as by inhibiting expression of influenza A virus genomic RNA or another influenza RNA or RNA transcript in the subject. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder associated with influenza infection, including influenza A virus genome infection, such as symptoms and diseases associated with influenza A virus infection, including, but not limited to, infection of the nose, throat, lungs, and other parts of the respiratory system. In some embodiments, the subject has previously been diagnosed with lung inflammation or other pulmonary symptoms consistent with influenza infection.
[0227] Embodiments of the present disclosure include pharmaceutical compositions for delivering IAV RNAi agents to lung epithelial cells in vivo. Such pharmaceutical compositions can include, for example, an IAV RNAi agent conjugated to a targeting group comprising an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin ligand.
[0228] In some embodiments, the described pharmaceutical compositions comprising an IAV RNAi agent are used to treat or manage clinical symptoms in a subject who would benefit from inhibition of expression of the influenza A viral genome. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed IAV RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.
[0229] In some embodiments, the described IAV RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another IAV RNAi agent (e.g., an IAV RNAi agent that targets a different sequence within the influenza A virus genome). In some embodiments, the second therapeutic agent can be an RNAi agent that targets the influenza A virus genome or the genome of a different influenza virus. The additional therapeutic agent can also be a small molecule drug, an antibody, an antibody fragment, a peptide, a vaccine, and / or an aptamer. The IAV RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.
[0230] The described pharmaceutical compositions comprising an IAV RNAi agent can be used to treat at least one symptom in a subject with a disease or disorder caused by influenza virus infection. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising an IAV RNAi agent, thereby treating the symptom. In other embodiments, the subject is administered a preventatively effective amount of one or more IAV RNAi agents, thereby preventing or inhibiting at least one symptom by preventing the influenza virus from establishing itself and replicating in the cells of the organism.
[0231] The described pharmaceutical compositions comprising an IAV RNAi agent can be used to treat (including potentially prophylactic or preventative treatment) at least one symptom in a subject with a disease or disorder caused by influenza virus infection, which can be caused by influenza A subtypes, including, but not limited to, H1N1, H2N2, H3N2, H5N1, H7N9, and H10N8.
[0232] In some embodiments, one or more of the described IAV RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
[0233] The route of administration is the route by which the IAV RNAi agent comes into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are well known in the art and can be applied to the administration of the compositions described herein. The IAV RNAi agents disclosed herein can be administered via any suitable route, in preparations appropriately tailored for the particular route. Thus, in some embodiments, the pharmaceutical compositions described herein are administered via inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, for example, intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, intraocularly, or intraperitoneally, or topically.
[0234] Pharmaceutical compositions containing the IAV RNAi agents described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes, such as intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intramuscular, transdermal, respiratory (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration. In some embodiments, the compositions are administered via inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration. For example, in some embodiments, it is desired that the IAV RNAi agents described herein inhibit expression of the influenza A viral genome or another influenza virus in the pulmonary epithelium, for which administration by inhalation (e.g., via an inhalation device such as a metered dose inhaler, or a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.
[0235] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0236] As used herein, a pharmaceutical composition or medicament comprises a pharmacologically effective amount of at least one described therapeutic compound and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient is a substance other than the active pharmaceutical ingredient (API, therapeutic product, e.g., IAV RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dose. An excipient may a) aid in the operation of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the API; c) aid in product identification; and / or d) act to enhance any other attribute of the overall safety, efficacy, or efficacy of the delivery of the API during storage or use. A pharmaceutically acceptable excipient may or may not be an inert substance.
[0237] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, dextrose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavorings, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.
[0238] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). The carrier should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of the injectable compositions can be achieved by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
[0239] Sterile injection solution can be prepared by incorporating the required amount of active compound into suitable solvent with one or combination of the ingredients listed above as necessary, and then sterilize by filtration.Generally, dispersion is prepared by incorporating active compound into sterile vehicle that contains basic dispersion medium and other ingredients listed above as necessary.For the preparation of sterile powder for sterile injection solution, the preparation method includes vacuum drying and freeze-drying, and obtains powder of active ingredient and any other desired ingredients from the solution that has been previously sterilized and filtered.
[0240] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ocular administration.
[0241] The formulation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration.Generally, the formulation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5cP).Salt can be added to the formulation to balance tonicity.Optionally, surfactant or cosolvent can be added to increase the solubility of active compound and improve aerosol properties.Optionally, excipient can be added to adjust viscosity and ensure the size and distribution of sprayed droplets.
[0242] In some embodiments, pharmaceutical formulations comprising an IAV RNAi agent disclosed herein suitable for inhaled administration can be prepared in water for injection (sterile water) or aqueous sodium phosphate buffer (e.g., an IAV RNAi agent formulated in 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic in water).
[0243] The active compound can be prepared with a carrier that protects the compound from rapid elimination from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid can be used.The method for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0244] For ease of administration and uniformity of dosage, IAV RNAi agent can be formulated into a composition in unit dosage form.Unit dosage form refers to a physically separate unit suitable as a single dose for the subject to be treated, and each unit contains a predetermined amount of active compound calculated to produce the desired therapeutic effect in association with the necessary pharmaceutical carrier.The specification of the unit dosage form of the present disclosure is determined and directly influenced by the inherent characteristics of the active compound and the therapeutic effect to be achieved, and the inherent limitations of the technical field of compounding such active compound for the treatment of individuals.
[0245] Pharmaceutical compositions can contain other additional ingredients that are commonly found in pharmaceutical compositions.Such additional ingredients include, but are not limited to, antipruritic agents, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.).It is also envisioned that cells, tissues, or isolated organs that express or contain the RNAi agent defined herein can be used as a "pharmaceutical composition".As used herein, "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refers to the amount of RNAi agent that produces pharmacological, therapeutic, or preventive results.
[0246] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another IAV RNAi agent (e.g., an IAV RNAi agent that targets a different sequence within the influenza A virus genome target). In other embodiments, the second therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, a peptide, a vaccine, and / or an aptamer.
[0247] In some embodiments, compositions comprising a combination or cocktail of at least two IAV RNAi agents having different sequences are described herein. In some embodiments, two or more IAV RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more IAV RNAi agents are each linked to a targeting group that comprises or consists of an integrin targeting ligand. In some embodiments, two or more IAV RNAi agents are each linked to a targeting group that comprises or consists of an αvβ6 integrin targeting ligand.
[0248] Described herein are compositions for the delivery of IAV RNAi agents to lung epithelial cells.
[0249] Generally, an effective amount of an IAV RNAi agent disclosed herein ranges from about 0.0001 to about 30 mg / kg of body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of an IAV RNAi agent ranges from about 0.01 mg / kg to about 3.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of an IAV RNAi agent ranges from about 0.03 mg / kg to about 2.0 mg / kg of body weight / deposited dose. In some embodiments, an effective amount of an IAV RNAi agent ranges from about 0.01 to about 1.0 mg / kg of deposited dose / body weight. In some embodiments, an effective amount of an IAV RNAi agent ranges from about 0.50 to about 1.0 mg / kg of deposited dose / body weight. The amount administered will also likely depend on variables such as the patient's overall health, the relative biological potency of the compound being delivered, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dosage administered may be increased beyond the upper levels noted above to rapidly achieve desired blood or tissue levels, or the initial dosage may be less than optimal. In some embodiments, the dose is administered daily. In some embodiments, the dose is administered weekly. In further embodiments, the dose is administered every other week, every three weeks, once a month, or once a quarter (i.e., once every three months).
[0250] For the treatment of a disease or to form a medicament or composition for treating a disease, the pharmaceutical compositions described herein comprising an IAV RNAi agent may be combined with an excipient or with a second therapeutic agent or treatment, such as, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, a vaccine, and / or an aptamer.
[0251] The described IAV RNAi agents, when added to a pharmaceutically acceptable excipient or adjuvant, may be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein may be packaged in a dry powder or aerosol inhaler, other metered-dose inhaler, nebulizer, pre-filled syringe, or vial.
[0252] Methods for treating and inhibiting influenza A virus genomes The IAV RNAi agents disclosed herein can be used to treat a subject (e.g., a human or other mammal) having a disease or disorder that would benefit from administration of the RNAi agent. In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) that would benefit from a reduction and / or inhibition of expression of influenza A virus genomic mRNA and / or viral transcripts and / or a reduction in another influenza virus that infects the subject.
[0253] In some embodiments, the RNAi agents disclosed herein can be used to treat a subject (e.g., a human) with a disease or disorder caused by influenza virus infection, including, but not limited to, pulmonary inflammation or symptoms, and diseases associated with influenza A virus infection, including, but not limited to, infection of the nose, throat, lungs, and other parts of the respiratory system. Treatment of a subject can include therapeutic and / or preventative treatment. The subject is administered a therapeutically effective amount of any one or more IAV RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. Administration of the pharmaceutical compositions described herein can be to a human or an animal.
[0254] In certain embodiments, the present disclosure provides methods for treating a disease, disorder, condition, or pathological state mediated at least in part by influenza A viral genome expression in a patient in need thereof, comprising administering to the patient any of the IAV RNAi agents described herein.
[0255] In some embodiments, an IAV RNAi agent is used to treat or manage a clinical symptom or pathological condition in a subject, wherein the clinical symptom or pathological condition is caused by influenza virus infection. The subject is administered a therapeutically effective amount of one or more of the IAV RNAi agents or compositions containing an IAV RNAi agent described herein. In some embodiments, a method includes administering a composition containing an IAV RNAi agent described herein to the subject to be treated.
[0256] In a further aspect, the disclosure features a method of treating (including preventative or prophylactic treatment) a disease or condition that can be addressed by reducing influenza mRNA or RNA transcripts, including, for example, reducing influenza A virus genomic mRNA or RNA transcripts, the method comprising administering to a subject in need thereof an IAV RNAi agent comprising an antisense strand comprising any of the sequences in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. Compositions for use in such methods are also described herein.
[0257] In another aspect, the present disclosure provides a method for treating (including preventative treatment) a pathological condition (such as a pathology or disease) caused by influenza virus infection, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0258] Disclosed herein, in some embodiments, is a method for inhibiting expression of an influenza A virus genome, the method comprising administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0259] Disclosed herein in some embodiments are methods for treating (including preventative treatment) a pathological condition mediated at least in part by influenza A virus RNA, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0260] Disclosed herein in some embodiments is a method for inhibiting expression of an influenza A virus genome, the method comprising administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0261] Disclosed herein in some embodiments are methods for treating (including preventative treatment) a pathological condition mediated at least in part by influenza A virus genomic viral RNA, the method comprising administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand comprising any of the sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0262] Disclosed herein in some embodiments is a method for inhibiting expression of an influenza A virus genome, comprising administering to a cell an RNAi agent comprising: a sense strand comprising any of the sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F; and an antisense strand comprising any of the sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0263] Disclosed herein in some embodiments is a method of inhibiting expression of an influenza A viral genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F. In other embodiments, disclosed herein is a method of inhibiting expression of an influenza A viral genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of any of the modified sequences in Table 4A, 4B, 4C, 4D, 4E, 4F, 5A, 5B, 5C, 5D, 5E, 5F, 6A, 6B, 6C, 6D, 6E, 6F, 10A, 10B, 10C, 10D, 10E, or 10F, and an antisense strand consisting of any of the modified sequences in Table 3A, 3B, 3C, 3D, 3E, 3F, 10A, 10B, 10C, 10D, 10E, or 10F.
[0264] Disclosed herein in some embodiments are methods for inhibiting expression of an influenza A virus genome in a cell, the method comprising administering one or more IAV RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, and 9F.
[0265] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering one or more IAV RNAi agents directed to influenza A virus (A / California / 07 / 2009(H1N1)) segment 7 matrix protein 2 (M2) and matrix protein 1 (M1) genes (referred to herein as M1). In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4A, 5A, 6A, or 10A, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3A or 10A. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4A, 5A, 6A, or 10A, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3A or 10A.
[0266] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering one or more IAV RNAi agents directed to influenza A virus (A / California / 07 / 2009 (H1N1)) segment 8 nuclear export protein (NEP) and nonstructural protein 1 (NS1) genes. In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Tables 4B, 5B, 6B, or 10B and an antisense strand consisting of the nucleobase sequence of any of the sequences in Tables 3B or 10B. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4B, 5B, 6B, or 10B and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3B or 10B.
[0267] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering one or more IAV RNAi agents directed to the influenza A virus (A / California / 07 / 2009(H1N1)) segment 2 polymerase PB1 (PB1) gene and the non-functional PB1-F2 protein (PB1-F2) gene. In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Tables 4C, 5C, 6C, or 10C, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Tables 3C or 10C. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4C, 5C, 6C, or 10C, and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3C or 10C.
[0268] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering one or more IAV RNAi agents directed to the influenza A virus (A / California / 07 / 2009(H1N1)) segment 1 polymerase PB2 (PB2) gene. In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4D, 5D, 6D, or 10D, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3D or 10D. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4D, 5D, 6D, or 10D, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3D or 10D.
[0269] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering one or more IAV RNAi agents directed to the influenza A virus (A / California / 07 / 2009 (H1N1)) segment 5 nucleocapsid protein (NP) gene. In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Tables 4E, 5E, 6E, or 10E and an antisense strand consisting of the nucleobase sequence of any of the sequences in Tables 3E or 10E. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, the methods comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Tables 4E, 5E, 6E, or 10E and an antisense strand consisting of a modified sequence of any of the modified sequences in Tables 3E or 10E.
[0270] In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering one or more IAV RNAi agents directed to the influenza A virus (A / California / 07 / 2009(H1N1)) segment 3 polymerase PA (PA) gene. In some embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4F, 5F, 6F, or 10F and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3F or 10F. In other embodiments, disclosed herein are methods for inhibiting expression of an influenza A virus genome, comprising administering to a subject an IAV RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4F, 5F, 6F, or 10F and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3F or 10F.
[0271] Disclosed herein, in some embodiments, are methods for inhibiting expression of an influenza A viral genome, the method comprising administering one or more IAV RNAi agents directed to a single influenza A viral gene selected from the group consisting of M1 (including M2), NEP, NS1, PB1, PB1-F2, PB2, NP, and PA.
[0272] Disclosed herein, in some embodiments, are methods for inhibiting expression of an influenza A viral genome, the method comprising administering one or more IAV RNAi agents directed to a combination of two or more influenza A viral genomes selected from the group consisting of M1 (including M2), NEP, NS1, PB1, PB1-F2, PB2, NP, and PA.
[0273] In some embodiments, influenza A virus RNA levels in specific epithelial cells of a subject to which a described IAV RNAi agent is administered are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject before administration of the IAV RNAi agent or compared to a subject not administered the IAV RNAi agent. In some embodiments, influenza A virus subgenomic RNA levels in specific epithelial cells of a subject administered a described IAV RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or greater than 99% compared to the subject before administration of the IAV RNAi agent or compared to a subject not administered the IAV RNAi agent. Viral RNA transcript levels, mRNA levels, and / or subgenomic RNA levels in a subject can be reduced in cells, cell populations, and / or tissues of the subject. In some embodiments, influenza mRNA levels in specific epithelial cells of a subject administered a described IAV RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject before administration of the IAV RNAi agent or compared to a subject not administered the IAV RNAi agent.
[0274] Reduction of viral RNA can be assessed by any method known in the art and is collectively referred to herein as reduction, reduction, or inhibition of influenza A viral genome. The examples described herein illustrate known methods for assessing inhibition of influenza A viral genome viral RNA.
[0275] Cells, tissues, organs, and non-human organisms Contemplated are cells, tissues, organs, and non-human organisms comprising at least one of the IAV RNAi agents described herein, wherein the cell, tissue, organ, or non-human organism is produced by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.
[0276] Further Exemplary Embodiments Certain further exemplary embodiments of the disclosed technology are provided herein, which are merely illustrative and do not limit the scope of the disclosure or the claims appended hereto. 1. An RNAi agent for inhibiting the expression of influenza A virus genome, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F; a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; an RNAi agent comprising: 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences provided in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F. 3. The RNAi agent of embodiment 1 or embodiment 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, or 4F, and the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand. 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of the IAV RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. 5. The RNAi agent of any one of embodiments 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides. 6. The RNAi agent of embodiment 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides. 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof. 8. The RNAi agent of any one of embodiments 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F. 9. The RNAi agent of any one of embodiments 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E, and 4F. 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E, and 4F. 11. The RNAi agent of any one of embodiments 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length. 15. The RNAi agent of embodiment 14, having two blunt ends. 16. The RNAi agent of any one of embodiments 1 to 15, wherein the sense strand comprises one or two terminal caps. 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues. 18. The RNAi agent of embodiment 1, wherein the RNAi agent is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F. 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides. 20. The RNAi agent of embodiment 1, comprising an antisense strand that consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from the following nucleotide sequence (5'→3'): UUACGUUUCGACCUCGGUUAG (SEQ ID NO: 1590). 21. The RNAi agent of embodiment 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from the following nucleotide sequence (5'→3'): CUAACCGAGGUCGAAACGUAA (SEQ ID NO: 1706). 22. The RNAi agent of embodiment 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides. 23. The following nucleotide sequence (5'→3'): cPrpusUfsascguUfucgaCfcUfcGfguuasg (SEQ ID NO: 1176), or cPrpusUfsascGfuuucgaCfcUfcGfguuasg (SEQ ID NO: 1175), wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine, A represents 2'-fluoro adenosine, C represents 2'-fluoro cytidine, G represents 2'-fluoro guanosine, U represents 2'-fluoro uridine, cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; and all or substantially all of the nucleotides on the sense strand are modified nucleotides. 2. The RNAi agent of embodiment 1. 24. The sense strand has the following nucleotide sequence (5'→3'): csuaaccgaGfgUfcGfaaacguaa (SEQ ID NO: 1373), or csuaaccgaGfgUfcgaaacguaa (SEQ ID NO: 1374), wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine, A represents 2'-fluoro adenosine, C represents 2'-fluoro cytidine, G represents 2'-fluoro guanosine, U represents 2'-fluoro uridine, cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; and s represents a phosphorothioate linkage, and all or substantially all of the nucleotides on the antisense strand are modified nucleotides. 2. The RNAi agent of embodiment 1. 25. The RNAi agent of any one of embodiments 20-24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both. 26. The RNAi agent of any one of embodiments 1 to 25, which is linked to a targeting ligand. 27. The RNAi agent of embodiment 26, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells. 28. The RNAi agent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand. 29. The RNAi agent of embodiment 28, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand. 30. The targeting ligand has the following structure: [ka] or a pharmaceutically acceptable salt thereof, or [ka] or a pharmaceutically acceptable salt thereof, During the ceremony, [ka] indicates the point of attachment to the RNAi agent, 30. The RNAi agent of embodiment 29. 31. The targeting ligand is: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] having a structure selected from the group consisting of: During the ceremony, [ka] indicates the point of attachment to the RNAi agent, 30. The RNAi agent according to any one of embodiments 26 to 29. 32. The following structure: [ka] 32. The RNAi agent of embodiment 31, wherein the RNAi agent is conjugated to a targeting ligand having the following structure: 33. The RNAi agent according to any one of embodiments 26 to 32, wherein the targeting ligand is conjugated to the sense strand. 34. The RNAi agent of embodiment 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand. 35. The influenza A virus genome is H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome, and H10N8 virus genome 35. The RNAi agent of any one of embodiments 1 to 34, wherein the RNAi agent is selected from the viral genome of the group consisting of: 36. A composition comprising the RNAi agent of any one of embodiments 1 to 35, further comprising a pharmaceutically acceptable excipient. 37. The composition of embodiment 36, further comprising a second RNAi agent capable of inhibiting expression of the influenza A viral genome. 38. The influenza A virus genome is H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome, and H10N8 virus genome 38. The composition of embodiment 37, wherein the viral genome is selected from the group consisting of: 39. The composition of any one of embodiments 36-38, further comprising one or more additional therapeutic agents. 40. The composition of any one of embodiments 36-39, which is formulated for administration by inhalation. 41. The composition of embodiment 40, delivered by a metered dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler. 42. The composition of any of embodiments 36-41, wherein the RNAi agent is a sodium salt. 43. The composition of embodiment 36, wherein the pharmaceutically acceptable excipient is water for injection. 44. The composition of embodiment 36, wherein the pharmaceutically acceptable excipient is buffered saline. 45. A method for inhibiting expression of an influenza A virus genome in a cell and / or treating one or more symptoms or diseases associated with influenza A virus infection, comprising introducing into a cell and / or administering to a subject an effective amount of an RNAi agent, wherein the RNAi agent targets an M1 influenza A virus genome segment transcript by having an antisense strand comprising at least 15 contiguous nucleotides that differ in 0, 1, 2, or 3 nucleotides complementary to a stretch of at least 15 contiguous nucleotides of SEQ ID NO:1, and the RNAi agent is optionally linked to a targeting ligand, preferably the targeting ligand has affinity for a cellular receptor expressed on epithelial cells, and most preferably the targeting ligand is an αvβ6 integrin targeting ligand. 46. A method for inhibiting expression of an influenza A virus genome in a cell, the method comprising introducing into the cell an effective amount of an RNAi agent according to any one of embodiments 1 to 35 or a composition according to any one of embodiments 36 to 44. 47. The influenza A virus genome is H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; H7N9 virus genome, and H10N8 virus genome 47. The method of embodiment 45 or 46, wherein the viral genome is selected from the group consisting of: 48. The method of any of embodiments 45-47, wherein the cell is present in a subject. 49. The method of embodiment 48, wherein the subject is a human subject. 50. The method of any one of embodiments 45-49, wherein after administration of the RNAi agent, the influenza A viral genome is inhibited by at least about 30%. 51. A method for treating one or more symptoms or diseases associated with influenza A virus infection, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of embodiments 36-44. 52. The method of embodiment 45 or embodiment 51, wherein the disease is a respiratory disease. 53. The method of embodiment 52, wherein the respiratory disease is lung inflammation. 54. The method of embodiment 52, wherein the disease is influenza A virus infection. 55. Influenza A infection H1N1; H2N2; H3N2; H5N1; H7N9, and 55. The method of embodiment 54, wherein the influenza A virus is caused by an influenza A virus subtype selected from the group consisting of H10N8. 56. The method of any one of embodiments 45-55, wherein the RNAi agent is administered at a deposited dose of about 0.01 mg to about 5.0 mg per kg of subject body weight. 57. The method of any one of embodiments 45-56, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg to about 2.0 mg per kg of subject body weight. 58. The method of any of embodiments 45-57, wherein the RNAi agent is administered in two or more doses. 59. Use of an RNAi agent according to any one of embodiments 1 to 35 for treating a disease, disorder or condition mediated at least in part by influenza A viral genome activity and / or influenza A viral genome expression. 60. Use of a composition according to any one of embodiments 36 to 44 for treating a disease, disorder or condition mediated at least in part by influenza A viral genome activity and / or influenza A viral genome expression. 61. Use of a composition according to any one of embodiments 36 to 44 for the manufacture of a medicament for treating a disease, disorder, or condition mediated at least in part by the influenza A viral genome and / or influenza A viral genome expression. 62. The use according to any one of embodiments 59 to 61, wherein the disease is an influenza infection. 63. A method for producing an RNAi agent according to any one of embodiments 1 to 35, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule. 64. The method of embodiment 63, wherein the sense strand comprises a targeting ligand. 65. The method of embodiment 64, comprising conjugating a targeting ligand to the sense strand.
[0277] The embodiments and items provided above will now be illustrated by the following non-limiting examples. [Example]
[0278] Example 1. Synthesis of IAV RNAi agents. The IAV RNAi agent duplexes disclosed herein were synthesized as follows.
[0279] A. Synthesis. The sense and antisense strands of IAV RNAi agents were synthesized according to the solid-phase phosphoramidite technique used in oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot 100 (GE Healthcare) was used. Synthesis was carried out on a solid support made of controlled pore glass (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). All RNAs and 2′-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2′-O-methyl phosphoramidites used were the following: (5′-O-dimethoxytrityl-N 6 -(benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropyl-amino)phosphoramidite, (5'-O-dimethoxytrityl-N 2The protecting groups used were 5'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyl-uridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-Deoxy-2'-fluorophosphoramidite had the same protecting groups as 2'-O-methyl RNAamidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)- N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite were used. TFA Aminolink phosphoramidite was also purchased commercially (ThermoFisher). Linker L6 was purchased from BroadPharm as propargyl-PEG5-NHS (catalog no. BP-20907) and coupled to the NH2-C6 group from Aminolink phosphoramidite to form -L6-C6- using standard coupling conditions.The linker Alk-cyHex was similarly purchased commercially as a propargyl-containing phosphoramidite compound from Lumiprobe (alkyne phosphoramidite, 5'-end) to form the linker-Alk-cyHex-. In each case, a phosphorothioate bond was introduced as specified using the conditions described herein. The cyclopropylphosphonate phosphoramidite was synthesized according to International Publication No. WO 2017 / 214112 (see also Altenhofer et al., Chem. Communications (Royal Soc. Chem.), 57(55):6808:6811 (July 2021)). The (NAG37)s targeting ligand phosphoramidite compound used in synthesizing the RNAi agents disclosed herein to perform the specific SEAP studies described below was synthesized according to Arrowhead Pharmaceuticals, Inc.'s International Publication No. WO 2018 / 044350. The targeting ligand-containing phosphoramidite compounds were added during the solid phase oligonucleotide synthesis process described herein.
[0280] Tri-alkyne-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM). All other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0281] Alternatively, the tri-alkyne moiety was introduced post-synthetically (see Section E below). For this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA Aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'O-Me), and 60 s (2'F). To introduce the phosphorothioate linkage, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0282] B. Cleavage and deprotection of support-bound oligomers. After completion of solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt% aqueous methylamine and 28%-31% ammonium hydroxide solution (Aldrich) at 30°C for 1.5 hours. The solution was evaporated, and the solid residue was reconstituted in water (see below).
[0283] Figure 7C. Purification. Crude oligomers were purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% acetonitrile, and buffer B was the same as buffer A supplemented with 1.5 M sodium chloride. UV traces at 260 nm were recorded. Appropriate fractions were pooled and then subjected to size-exclusion HPLC using a GE Healthcare XK 16 / 40 column packed with Sephadex G-25 fine, with a running buffer of 100 mM ammonium bicarbonate, pH 6.7, and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system via tangential flow filtration.
[0284] D. Annealing. RNAi agents were formed by mixing the complementary strands by combining equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro). Some RNAi agents were lyophilized and stored at -15 to -25°C. The duplex concentration was determined by measuring the solution absorbance in 1x PBS with a UV-Vis spectrometer. The solution absorbance at 260 nm was then multiplied by a conversion factor (0.050 mg / (mL cm)) and a dilution factor to determine the duplex concentration.
[0285] E. Conjugation of Tri-Alkyne Linkers. In some embodiments, a tri-alkyne linker is conjugated to the sense strand of an RNAi agent on the resin as a phosphoramidite (see Example 1G for synthesis of an exemplary tri-alkyne linker phosphoramidite, and Example 1A for conjugation of the phosphoramidite). In other embodiments, the tri-alkyne linker can be conjugated to the sense strand after cleavage from the resin, as described below: before or after annealing, in some embodiments, a 5' or 3' amine-functionalized sense strand is conjugated to a tri-alkyne linker. Exemplary tri-alkyne linker structures that can be used to form the constructs disclosed herein are as follows: [ka] To conjugate the tri-alkyne linker to the annealed duplex, the amine-functionalized duplex was dissolved at approximately 50-70 mg / mL in 90% DMSO / 10% HO. 40 equivalents of triethylamine were added, followed by 3 equivalents of tri-alkyne-PNP. Upon completion, the conjugate was precipitated twice in a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.
[0286] F. Synthesis of Targeting Ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid) [ka]
[0287] Compound 5 (tert-butyl (4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv.) was dissolved in DMF (17 mL). To the mixture was added NaH (0.116 mg, 3.01 mmol, 1.25 equiv., 60% dispersion in oil). After stirring the mixture for 10 min, compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 h, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with saturated aqueous NaCl (1 × 50 mL), dried over NaSO, filtered, and concentrated. The product was purified on a silica column using a gradient of 0–5% methanol in DCM. [ka]
[0288] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL of acetone:0.1 M NaOH [1:1]. The reaction was monitored by TLC (5% ethyl acetate in hexanes). The organics were concentrated and the residue was acidified to pH 3-4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 × 75 mL). The organics were pooled, dried over NaSO, filtered, and concentrated. The product was used without further purification. [ka]
[0289] To a solution of compound 22 (1.1 g, 3.95 mmol, 1 equiv.), compound 45 (595 mg, 4.74 mmol, 1.2 equiv.), and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 3 h. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase. LC-MS: calculated [M+H] 366.20, found 367. [ka]
[0290] To a solution of compound 61 (2 g, 8.96 mmol, 1 eq.) and compound 62 (2.13 mL, 17.93 mmol, 2 eq.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 eq.) at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase. [ka]
[0291] To a solution of compound 60 (1.77 g, 4.84 mmol, 1 equiv.) in THF (5 mL) and HO (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) portionwise at 0 °C. The reaction mixture was warmed to room temperature. After stirring at room temperature for 3 h, the reaction mixture was acidified to pH 3.0 with HCl (6 N). The aqueous phase was extracted with ethyl acetate (3 × 20 mL), and the organic layers were combined, dried over NaSO, and concentrated. LC-MS: calculated [M+H] 352.18, found 352. [ka]
[0292] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv.) in anhydrous THF (20 mL) was added n-BuLi (3.6 mL, 9.0 mmol, 1.5 equiv.) in hexanes dropwise at −78° C. The reaction was maintained at −78° C. for an additional 1 h. Triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equiv.) was then added to the mixture at −78° C. The reaction was then warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with EtOAc (3×20 mL), and the organic phases were combined, dried over Na2SO4, and concentrated. [ka]
[0293] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv.), compound 65 (349 mg, 1.256 mmol, 1.5 equiv.), XPhos Pd G2 (13 mg, 0.0167 mmol, 0.02 equiv.), and K3PO4 (355 mg, 1.675 mmol, 2.0 equiv.) were mixed in a round-bottom flask. The flask was sealed with a screw-cap septum, then evacuated and backfilled with nitrogen (this process was repeated a total of three times). THF (8 mL) and water (2 mL) were then added via syringe. Nitrogen was bubbled through the mixture for 20 minutes, and the reaction was maintained at room temperature overnight. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (3 × 10 mL). The organic phase was dried over Na2SO4, concentrated and purified by CombiFlash® using silica gel as the stationary phase and eluted with 15% EtOAc / hexane. LC-MS: calculated [M+H] 512.24, found 512.56. [ka]
[0294] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv) was cooled in an ice bath. HCl in dioxane (8.4 mL, 33.54 mmol, 20 equiv) was added to the flask. The reaction was allowed to warm to room temperature and stirred for an additional hour. The solvent was removed on a rotary evaporator and the product was used directly without further purification. LC-MS: calculated [M+H] 412.18, found 412.46. [ka]
[0295] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.), compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated aqueous NaHCO (10 mL), and the product was extracted with ethyl acetate (3 × 20 mL). The organic phases were combined, dried over NaSO, and concentrated. The product was purified by CombiFlash® using silica gel as the stationary phase and eluted with 3–4% methanol in DCM. The yield was 96.23%. LC-MS: calculated [M+H] 745.35, found 746.08. [ka]
[0296] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv.) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% HO) at room temperature. The reaction mixture was warmed to room temperature and the reaction was monitored by LC-MS. The reaction was maintained at room temperature overnight. The solid was filtered through Celite® and the solvent was removed by rotary evaporation. The product was used directly without further purification. LC-MS: [M+H]+ 655.31, found 655.87. [ka]
[0297] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEG5-OTs (128 mg, 0.305 mmol, 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0 °C. The reaction mixture was stirred at 80 °C for 6 h. The reaction was quenched with saturated NaHCO3 solution, and the aqueous layer was extracted with ethyl acetate (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. LC-MS: calculated [M+H] 900.40, found 901.46. [ka]
[0298] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv.) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv.) at room temperature. The mixture was stirred for another 1 h at room temperature. The pH was adjusted to 3.0 with HCl (6 N), and the aqueous phase was extracted with EtOAc (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. TFA (0.5 mL) and DCM (0.5 mL) were added to the residue, and the mixture was stirred for another 3 h at room temperature. The solvent was removed on a rotary evaporator. LC-MS: calculated [M+H]+ 786.37, found 786.95.
[0299] G. Synthesis of TriAlk 14
[0300] TriAlk14s and (TriAlk14)s, as shown in Table 11 above, can be synthesized using the synthetic routes shown below: Compound 14 can be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 can be conjugated to an amine-containing sense strand in an amide coupling reaction. [ka]
[0301] To a 3 L jacketed reactor was added 500 ml of DCM and 4 (75.0 g, 0.16 mol). The internal temperature of the reaction was cooled to 0 °C, and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol), maintaining the internal temperature below 5 °C. The reaction was then slowly treated with DIPEA (72.3 g, 0.56 mol), maintaining the internal temperature below 5 °C. After the addition was complete, the reaction was warmed to 23 °C over 1 h and stirred for 3 h. A 10% kicker charge of all three reagents was added and stirred for an additional 3 h. The reaction was deemed complete when less than 1% of 4 remained. The reaction mixture was washed with saturated ammonium chloride solution (2 × 500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. The crude oil was carried on to the next step. 46 H 60 N4O 11 The calculated mass was 845.0 m / z. The observed mass [M+H] was 846.0. [ka]
[0302] 121.2 g of crude oil containing 72% by weight of compound 6 (86.0 g, 0.10 mol) was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20 v / v%) while maintaining the internal temperature below 23 °C. The formation of dibenzofulvene (DBF) relative to the consumption of Fmoc-amine 6 was monitored by HPLC Method 1 (Figure 2), and the reaction was complete within 10 h. Glutaric anhydride (12.8 g, 0.11 mol) was added to this solution, and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, DMF and TEA were removed under reduced pressure at 30 °C to give 100 g of crude oil. Due to the high solubility of compound 7 in water, an aqueous workup could not be used, and chromatography was the only method for removing DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three batches using a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-20% methanol / DCM over 30 min to give 42 g of compound 8 (54% yield over three steps). 36 H 55 N4O 12 The calculated mass was 736.4 m / z. The observed mass [M+H] was 737.0. [ka]
[0303] Compound 8 (42.0 g, 0.057 mol) was co-stripped with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent prior to use. The oil was redissolved in DMF (210 mL) and cooled to 0°C. This solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC-hydrochloride (12.0 g, 0.063 mol) and was confirmed to be complete within 10 hours. The solution was cooled to 0°C, and 10 volumes of ethyl acetate, followed by 10 volumes of saturated ammonium chloride solution, were added while maintaining the internal temperature below 15°C. The layers were separated, and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give an oil. The crude oil (55 g) was purified in three batches on a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-10% methanol / DCM over 30 min to give 22 g of pure 9 (compound 22) (50% yield). 42 H 59 N5O 14 The calculated mass was 857.4 m / z. The observed mass [M+H] was 858.0. [ka]
[0304] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was monitored by HPLC Method 1 by observing the disappearance of compound 9 and was found to be complete in 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic layer was dried over sodium sulfate and concentrated to give an oil. The crude oil was purified on a Teledyne ISCO Combi-Flash® purification system using a 330 g silica column. 4-Nitrophenol was eluted with 100% ethyl acetate, and 10 was washed off the column with 20% methanol / DCM to give a colorless oil (39 g, 81% yield). 42 H 69 N5O 12 The calculated mass was 836.0 m / z. The observed mass [M+H] was 837.0. [ka]
[0305] Alcohol 10 was co-stripped twice with 10 volumes of acetonitrile to remove any residual methanol from the chromatography solvent, and then co-stripped again with dry dichloromethane (KF < 60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of dry dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was confirmed to be complete within 3-6 h. The reaction mixture was cooled to 0 °C and treated with 10 volumes of a 1:1 solution of saturated ammonium bicarbonate / brine, then warmed to ambient temperature over 1 min and stirred at 20 °C for an additional 3 min. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted bisphosphonate reagent. The organic layer was dried over sodium sulfate and concentrated to an oil, yielding 3.08 g of 94% by weight of compound 14. 51 H 86 N7O 13 The calculated mass of P was 1035.6 m / z. The observed mass [M+H] = 1036.
[0306] H. Conjugation of Targeting Ligand. Either before or after annealing, a 5' or 3' tridentate alkyne-functionalized sense strand is conjugated to a targeting ligand. The following example describes the conjugation of a targeting ligand to an annealed duplex: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO4·5H2O), and 2 M sodium ascorbate solution were prepared in deionized water. A 75 mg / mL DMSO solution of the targeting ligand was made. 25 μL of 1 M Hepes pH 8.5 buffer was added to a 1.5 mL centrifuge tube containing the tri-alkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol). After vortexing, 35 μL of DMSO was added and the solution was vortexed. The targeting ligand was added to the reaction (6 equivalents / duplex, 2 equivalents / alkyne, approximately 15 μL) and the solution was vortexed. The pH was checked using pH paper to confirm that the pH was approximately 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO₄·5H₂O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equivalents 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately after, 2 M ascorbate (5 μL, 50 equivalents per duplex, 16.7 equivalents per alkyne) was added to the reaction vial and vortexed. Upon reaction completion (typically within 0.5–1 hour), the reaction was immediately purified by non-denaturing anion exchange chromatography.
[0307] Example 2. Influenza A / Puerto Rico / 8 / 34 PR8 Mouse Model. To study the effects of IAV RNAi agents, we established an influenza A / Puerto Rico / 8 / 34 PR8 mouse model (the "PR8 mouse model"). The influenza A / Puerto Rico / 8 / 34 (PR8) strain is a Biosafety Level 2 (BSL2) virus widely used in laboratories as a mouse influenza model for studying acute lung injury and inflammation. PR8 has previously been shown to cause severe pathogenicity in mice (C.F. Basler, et al., "Sequence of the 1918 pandemic influenza virus nonstructural gene (NS) segment and characterization of recombinant viruses bearing the 1918 NS genes." Proc Natl Acad Sci USA 98, 2746-2751 (2001)). PR8 has been passaged more than 100 times in mice, ferrets, and embryonated chicken eggs, respectively, resulting in complete attenuation of the virus and its inability to replicate in humans (Annex 5, WHO Technical Report Series No 941, 2007).
[0308] C57BL / 6 mice were infected with PR8, and then the PR8-infected mice were administered an IAV RNAi agent. C57BL / 6 mice were also first administered an IAV RNAi agent, and then subsequently infected with PR8. The optimal sublethal dose of PR8 infection was determined by examining weight loss after PR8 infection. If the animal's weight loss exceeded 20% of its pre-administration weight, the viral dose was deemed lethal and not optimal. Therefore, the dose of PR8 was subsequently adjusted to the optimal sublethal dose.
[0309] Example 3. Influenza A / California / 07 / 2009 H1N1 Mouse Model. To study the effects of IAV RNAi agents, we established an influenza A / California / 07 / 2009 H1N1 mouse model (the "CA07 H1N1 mouse model"). The influenza A / California / 07 / 2009 (H1N1) (hereafter "CA07 H1N1") strain is a Biosafety Level 2 (BSL2)-level virus that emerged with rapid human-to-human transmission and caused the first pandemic of the 21st century. Rockman S, Laurie K, Barr I. Pandemic Influenza Vaccines: What Did We Learn from the 2009 Pandemic and Are We Better Prepared Now? Vaccines (Basel). 2020 May 7;8(2):211. doi:10.3390 / vaccines8020211. PMID:32392812; PMCID:PMC7349738. This virus has replaced the earlier A(H1N1) and continues to circulate today as a seasonal virus.
[0310] C57BL / 6 mice were infected with CA07 H1N1 and then administered an IAV RNAi agent to the CA07 H1N1-infected mice. C57BL / 6 mice were also first administered an IAV RNAi agent and then infected with CA07 H1N1. The optimal sublethal dose of CA07 H1N1 infection was determined by examining body weight loss after CA07 H1N1 infection. If the animals lost more than 20% of their pre-infection weight, the virus dose was deemed lethal and suboptimal. Therefore, the dose of CA07 H1N1 was subsequently adjusted to the optimal sublethal dose.
[0311] Example 4. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-6) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 12 below.
[0312] [Table 68]
[0313] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0314] On day 14, the animals were sacrificed. Bronchoalveolar lavage fluid (BALF) and lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the right lung was determined using qPCR, using 18S rRNA as an endogenous control gene, and normalized to Group 2. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 13 below.
[0315] [Table 69]
[0316] Groups 3, 5, and 6 showed a reduction in H1N1, with Group 3 (AC02564) specifically showing approximately 90% inhibition (0.093) of H1N1. Similarly, Groups 3, 5, and 6 showed a reduction in M1, with Group 3 (AC02564) again showing an approximately 87% (0.135) reduction. As shown in Tables 8A, 8C, 8D, and 8E above, the IAV RNAi agent in Group 3 (AC002564) targets the M1 vRNA segment of influenza A (Table 8A). The IAV RNAi agent in Group 4 (AC002567) targets the PB1 vRNA segment of influenza A (Table 8C). The IAV RNAi agent in Group 5 (AC002568) targets the PB2 vRNA segment of influenza A (Table 8D). An IAV RNAi agent in Group 6 (AC002569) targets the influenza A NP vRNA segment (Table 8E). While targeting any specific vRNA segment of the influenza A genome that is conserved across multiple viral genome variants could potentially provide therapeutic benefit, targeting the M1 vRNA segment, such as the IAV RNAi agent in Group 3 (AC002564), holds particular promise. M1 is the most abundant protein in influenza virions and plays a key role in many aspects of the viral life cycle, including influenza A viral ribonucleoprotein (vRNP) transport between the cytoplasm and nucleus, regulating vRNP transcription and replication, interacting with viral envelope proteins, and recruiting viral and host components to assembly sites and initiating budding. Mutations in M1 are extremely rare. For at least these reasons, M1 is highly conserved and generally considered the optimal vRNA segment target for a broad-spectrum influenza A vaccine, although no vaccine targeting M1 is yet available. Furthermore, several attempts have been made to develop small molecules that target M1, but none have been successful to date.
[0317] Figure 2 shows immunohistochemistry (IHC) of PR8-infected (or uninfected PBS) mouse lungs at day 6 or day 14 post-infection. Mouse lung tissue was stained for anti-hemagglutinin (anti-HA) influenza A virus H1N1 IgG according to the manufacturer's instructions. The anti-HA immunogen is a recombinant protein encompassing a sequence within the C-terminal region of influenza A virus H1N1 HA (hemagglutinin) (A / WSN / 1933 (H1N1)) (GeneTex, catalog number: GTX127357). As shown in Figure 2, at day 14 (6 days after PR8 infection), the RNAi agent AC002564 significantly reduced influenza A virus replication, as evidenced by reduced anti-HA staining in mice treated with AC002564 + PR8 compared to mice treated with saline (no IAV RNAi agent) + PR8, which is consistent with the reduction reported in Table 13 above.
[0318] Example 5. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-6) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 7, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 14 below.
[0319] [Table 70]
[0320] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0321] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 in the right lung was determined using qPCR, using 18S rRNA as an endogenous control gene. The average H1N1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 15 below.
[0322] [Table 71]
[0323] In this example, no reduction in H1N1 was observed.
[0324] Example 6. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-6) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 15, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 16 below.
[0325] [Table 72]
[0326] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0327] On day 18, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 in the lungs was determined using qPCR, using B2M as an endogenous control gene. The average H1N1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 17 below.
[0328] [Table 73]
[0329] In this example, only very limited reduction of H1N1 (ie, group 4) was seen.
[0330] Example 7. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-5) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 18 below.
[0331] [Table 74]
[0332] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0333] On day 13, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, with B2M as the endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 19 below.
[0334] [Table 75]
[0335] Groups 3 and 5 showed reduction in H1N1, with Group 3 (AC002564) showing nearly 96% (0.041) reduction in H1N1. Groups 3 and 5 also showed reduction in M1, with Group 3 (AC002564) showing approximately 95% (0.054) reduction in M1.
[0336] Example 8. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 4, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-9) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On days 9, 16, 23, or 30, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 20 below.
[0337] [Table 76]
[0338] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0339] On days 16, 23, 30, or 37, animals were sacrificed according to Table 20 above. Bronchoalveolar lavage fluid (BALF) and lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using B2M as the endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection on day 9). The results are shown in Table 21 below.
[0340] [Table 77]
[0341] Reduction of H1N1 and M1 from IAV RNAi agent AC002564 (groups 6-9) demonstrated significant knockdown sustained out to at least day 23 in this PR8 mouse model in this example.
[0342] Example 9. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. Female C57Bl / 6 mice were administered an IAV RNAi agent and then infected with PR8. On days 1 and 4, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-7) were administered either saline or an IAV RNAi agent (0.5 mg / kg, 1 mg / kg, or 3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 22 below.
[0343] [Table 78]
[0344] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0345] On day 14 or 21, animals were sacrificed according to Table 22 above. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, with B2M as the endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection on day 8). The results are shown in Table 23 below.
[0346] [Table 79]
[0347] Groups 4-6 showed reductions in H1N1 and M1 in the PR8 mouse model by day 14. No data were available for the mice animals sacrificed on day 21 (Groups 3 and 7).
[0348] Example 10. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-3) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 24 below.
[0349] [Table 80]
[0350] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0351] On day 15, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene, and normalized to Group 2. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 25 below.
[0352] [Table 81]
[0353] Group 3 showed a reduction in H1N1 and M1 at a dose of 2 x 3.0 mg / kg prior to PR8 virus challenge, with an approximate 90-91% reduction in H1N1 and M1 at day 15 (0.094, 0.088).
[0354] Example 11. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and six (n=6) mice (for Groups 2-3) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 7, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 26 below.
[0355] [Table 82]
[0356] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0357] On day 15, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 27 below.
[0358] [Table 83]
[0359] Group 3 showed a reduction in H1N1 and M1 at a dose of 2 x 3.0 mg / kg prior to PR8 virus challenge, with an approximate 92-93% reduction in H1N1 and M1 (0.076, 0.083) at day 15.
[0360] Example 12. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 28 below.
[0361] [Table 84]
[0362] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0363] On day 15, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 29 below.
[0364] [Table 85]
[0365] A fairly modest reduction of H1N1 and M1 was seen in groups 4 and 5, with virtually no reduction from the IAV RNAi agent in groups 3, 6, 7, and 8.
[0366] Example 13. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 30 below.
[0367] [Table 86]
[0368] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0369] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 31 below.
[0370] [Table 87]
[0371] Groups 3-8 showed only relatively modest reductions in H1N1 and M1.
[0372] Example 14. In vivo administration of IAV RNAi agents to mice subsequently infected with PR8. According to Example 3, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with PR8 ("PR8 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or PR8 (BEI) formulated in PBS via intranasal (IN) injection. Administration was according to Table 32 below.
[0373] [Table 88]
[0374] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0375] On day 15, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + PR8 infection). The results are shown in Table 33 below.
[0376] [Table 89]
[0377] Groups 3, 4, 6, and 7 showed only relatively modest reductions in H1N1 and M1.
[0378] Example 15. In vivo administration of IAV RNAi agents to mice pre-infected with PR8. According to Example 3, female C57B1 / 6 mice were infected with PR8 and then administered an IAV RNAi agent ("PR8 model mice"). On day 1, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-11) were administered either PBS or PR8 (BEI) formulated in PBS by intranasal (IN) injection. On day 5, the animals were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. Administration was according to Table 34 below.
[0379] [Table 90]
[0380] PR8 doses were quantified as EID50 (50% egg infectious dose), which was determined to be the optimal sublethal dose according to the PR8 mouse model described in Example 2 above.
[0381] On days 5, 6, 7, 8, 9, or 10, animals were sacrificed according to Table 34 above. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as the endogenous control gene. Average H1N1 and M1 expression in lung tissue from each animal was normalized to each saline-administered control group. Group 3 is normalized to Group 2, Group 5 is normalized to Group 4, Group 7 is normalized to Group 6, Group 9 is normalized to Group 8, and Group 11 is normalized to Group 10. The results are shown in Table 35 below.
[0382] [Table 91]
[0383] Groups 3, 5, 7, 9, and 11 showed reductions in H1N1 and M1. Specifically, Group 11 showed approximately a 92% reduction in H1N1 (0.074) and an approximately 93% reduction in M1 (0.065) on day 9.
[0384] Example 16. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 36 below.
[0385] [Table 92]
[0386] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0387] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 37 below.
[0388] [Table 93]
[0389] Groups 3-8 each showed reductions in H1N1 and M1.
[0390] Example 17. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 38 below.
[0391] [Table 94]
[0392] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0393] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 39 below.
[0394] [Table 95]
[0395] Groups 3-8 each showed reductions in H1N1 and M1.
[0396] Example 18. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were infected via intranasal (IN) injection with either PBS or 4240 TCID50 of CA07 H1N1 formulated in PBS. Administration was according to Table 40 below.
[0397] [Table 96]
[0398] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0399] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 41 below.
[0400] [Table 97]
[0401] The IAV RNAi agent in group 3 (AC002601) was particularly potent, showing a greater than 86% reduction in both H1N1 and M1, whereas the IAV RNAi agents in the remaining groups (i.e., groups 4-8) showed only moderate, or in some cases no, inhibition of H1N1 and M1.
[0402] Example 19. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 42 below.
[0403] [Table 98]
[0404] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0405] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 43 below.
[0406] [Table 99]
[0407] Groups 3 and 8 showed substantial reductions in H1N1 and M1. Groups 4 and 5 showed more modest reductions in H1N1 and M1; Groups 6 and 7 showed no reduction in H1N1 and only very limited reduction in M1.
[0408] Example 20. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (1.5 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 44 below.
[0409] [Table 100]
[0410] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0411] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 45 below.
[0412] [Table 101]
[0413] Groups 3-8 each showed significant reductions in both H1N1 and M1.
[0414] Example 21. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, eight mice (n=8) (for groups 1-5) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 46 below.
[0415] [Table 102]
[0416] CA07 dose was quantified as TCID50 (50% tissue culture infectious dose).
[0417] The animals were sacrificed on day 22. Mice were monitored for weight and survival rate after CA07 infection. The survival rates are shown in Table 47 below.
[0418] [Table 103]
[0419] Administration of AC002601 followed by infection with CA07 (12,000 TCID50) achieved 100% survival at day 11 post-infection. Administration of AC002601 followed by infection with CA07 (24,000 TCID50) achieved 87.5% survival at day 11 post-infection. This contrasts with 12.5% survival at day 11 post-infection in group 2 and 0% survival at day 7 post-infection in group 4; in both cases, mice received the same infection but no IAV RNAi agent.
[0420] Example 22. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 48 below.
[0421] [Table 104]
[0422] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0423] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 49 below.
[0424] [Table 105]
[0425] Group 3 showed substantial reductions in H1N1 and M1.
[0426] Example 23. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 50 below.
[0427] [Table 106]
[0428] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0429] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 51 below.
[0430] [Table 107]
[0431] Group 3 (AC002601) showed substantial reduction of H1N1 and M1. Group 4 (AC002564) showed more modest reduction of H1N1 and M1. The remaining groups (Groups 5-8) showed limited or no inhibition of H1N1 and M1.
[0432] Example 24. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On days 1 and 3, eight mice (n=8) (for groups 1-5) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 52 below.
[0433] [Table 108]
[0434] CA07 dose was quantified as TCID50 (50% tissue culture infectious dose).
[0435] The animals were sacrificed on day 22. Mice were monitored for weight and survival rate after CA07 infection. The survival rates are shown in Table 53 below.
[0436] [Table 109]
[0437] Treatment with AC002564 followed by infection with CA07 (12,000 TCID50) achieved a survival rate of 83.3% at day 15 post-infection. Treatment with AC002564 followed by infection with CA07 (24,000 TCID50) achieved a survival rate of 75% at day 15 post-infection. This is in contrast to Group 2 (only 33% survival at day 15 post-infection) and Group 4 (only 25% survival at day 15 post-infection), which did not receive RNAi agents.
[0438] Example 25. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 54 below.
[0439] [Table 110]
[0440] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0441] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 55 below.
[0442] [Table 111]
[0443] Groups 3-8 each showed reductions in H1N1 and M1.
[0444] Example 26. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (3 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 56 below.
[0445] [Table 112]
[0446] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0447] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 57 below.
[0448] [Table 113]
[0449] Groups 3-8 showed some reduction in H1N1 and M1.
[0450] Example 27. In vivo administration of IAV RNAi agents to mice pre- and post-infection with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1, 2, and / or 3, five mice (n=5) (for groups 1-8) were administered either saline or an IAV RNAi agent (3 mg / kg or 6 mg / kg) formulated in saline via intratracheal (IT) or intranasal (IN) administration. On day 1, animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 58 below.
[0451] [Table 114]
[0452] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0453] On day 7, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 59 below.
[0454] [Table 115]
[0455] Groups 3, 4, 6, and 7 showed substantial reductions in H1N1, while groups 5 and 8 showed more modest reductions in H1N1.
[0456] Example 28. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On days 1 and 3, five mice (n=5) (for groups 1-8) were administered either saline or an IAV RNAi agent (0.75 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 60 below.
[0457] [Table 116]
[0458] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0459] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 61 below.
[0460] [Table 117]
[0461] Groups 3-8 each showed reductions in H1N1 and M1.
[0462] Example 29. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On days 1 and 3, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (1 mg / kg or 2 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 62 below.
[0463] [Table 118]
[0464] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0465] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 63 below.
[0466] [Table 119]
[0467] Groups 3-8 each showed reductions in H1N1 and M1.
[0468] Example 30. In vivo administration of IAV RNAi agents to mice pre-infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were first infected with CA07 and then subsequently administered an IAV RNAi agent ("CA07 H1N1 model mice"). On day 1, five (n=5) mice (for groups 1-7) were administered either saline or an IAV RNAi agent (3 mg / kg or 6 mg / kg) formulated in saline via intratracheal (IT) administration. On day 1, animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 64 below.
[0469] [Table 120]
[0470] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0471] On day 7, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 65 below.
[0472] [Table 121]
[0473] Groups 4-7 each showed reductions in H1N1 and M1.
[0474] Example 31. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. Female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice") according to Example 4. On day 1, four (n=4) mice (for Group 1) and five (n=5) mice (for Groups 2-8) were administered either saline or an IAV RNAi agent (0.75 mg / kg) formulated in saline via intratracheal (IT) administration. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 66 below.
[0475] [Table 122]
[0476] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0477] On day 14, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of murine H1N1 and M1 in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 67 below.
[0478] [Table 123]
[0479] Groups 3-8 each showed reductions in H1N1 and M1.
[0480] Example 32. In vivo administration of IAV RNAi agents to mice pre-infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were infected with CA07 and then administered an IAV RNAi agent ("CA07 H1N1 model mice"). On day 1, five (n=5) mice (for Group 1) and ten (n=10) mice (for Groups 2-5) were administered either saline or an IAV RNAi agent formulated in saline (at 3 mg / kg), or oseltamivir (Tamiflu®; at 20 mg / kg) by intranasal (IN) administration or oral gavage (Group 5, administered on days 1, 2, 3, 4, and 5). On day 1, prior to administration of the IAV RNAi agent, the animals were administered either PBS or CA07 H1N1 formulated in PBS by intranasal (IN) injection. Administration was according to Table 68 below.
[0481] [Table 124]
[0482] The CA07 dose was quantified as TCID50 (50% tissue culture infective dose), which was determined to be the optimal sublethal dose according to the CA07 mouse model described in Example 3 above.
[0483] On day 7, the animals were sacrificed. Lungs (both left and right) were collected and harvested. Expression of mouse H1N1 (measuring genomic RNA) and M1 (measuring mRNA reduction) in the lungs was determined using qPCR, using 18s rRNA as an endogenous control gene. The average H1N1 and M1 expression in lung tissue for each animal was normalized to Group 2 (no RNAi agent + CA07 infection). The results are shown in Table 69 below.
[0484] [Table 125]
[0485] Groups 3 and 4, which received the IAV RNAi agent, showed substantial reductions of H1N1 and M1 by approximately 80% or more, generally comparable to the saline-treated model mice, especially when compared to commercially available oseltamivir (Tamiflu®), which showed no reduction in either H1N1 or M1.
[0486] CA07 H1N1 viral load was quantified in the lungs of mouse animals. Figure 3 shows the viral load in the lungs of test animals at the time of sacrifice on day 7. The IAV RNAi agent AC002869 reduced lung viral load by approximately 2 logs. 10 In comparison, the group receiving oseltamivir alone reduced lung viral load by 1 log 10 The reduction was less than TCID50 / mL.
[0487] The lungs of mouse test animals were prepared for H&E staining, IHC staining, and RNA scopy. Mouse test animal lung samples were processed and paraffin-embedded (formalin-fixed paraffin-embedded FFPE). Lung sections were collected using a microtome and mounted on slides. Histological inflammation assays were performed on slides using an automated IHC stainer (Ventana Discovery Ultra) and detected by DAB color development. The inflammation assay utilized the antibody pan-inflammatory marker Iba1 (Wako, catalog number: 019-19741, 1:400), which detects all inflammatory cells, secondary from Roche (DISC.OmniMap anti-Rb HRP, catalog number: 05269679001), and visual detection with color development from Roche (DISC.ChromoMap DAB, catalog number: 05266645001). For image analysis, lung samples were scanned using an Olympus VS2000 autoscanner. The images were then loaded into the image analysis software Halo-Indica Lab using the cell detection module to detect inflammatory cells (Iba1+ cells).
[0488] Inflammation in the lungs of the test animals was quantified, and the % inflammation of the test groups was normalized to Group 2 saline + CA07, and the results are shown in Figure 4. As shown in Figure 4, the RNAi agent AC002869 reduced lung inflammation by approximately 50%, compared to the approximately 36% reduction achieved by oseltamivir treatment. Figure 5 further shows the lung histology of the murine test animals, demonstrating that the IAV RNAi agent AC002869 achieved a reduction in inflammation in the lungs of the murine test animals.
[0489] Example 33. In vivo administration of IAV RNAi agents to mice subsequently infected with CA07 H1N1. According to Example 4, female C57B1 / 6 mice were administered an IAV RNAi agent and then infected with CA07 ("CA07 H1N1 model mice"). On days 1 and 3 (for groups 1-4) and days 3+4+5+6+7 (for group 5), 10 mice (n=10) (for groups 1-5) were administered either saline or an IAV RNAi agent formulated in saline (at 3 mg / kg), or oseltamivir (Tamiflu®); at 40 mg / kg) via intranasal (IN) administration or oral gavage. On day 8, the animals were administered either PBS or CA07 H1N1 formulated in PBS via intranasal (IN) injection. Administration was according to Table 70 below.
[0490] [Table 126]
[0491] CA07 dose was quantified as TCID50 (50% tissue culture infectious dose).
[0492] On day 15, the animals were sacrificed. Mice were monitored for weight and survival rate after CA07 infection. Survival rate is determined at the time of sacrifice of any test animal that lost more than 20% of its initial weight (>20% weight loss = death of the test animal). Survival rates are shown in Table 71 below.
[0493] [Table 127]
[0494] Administration of the IAV RNAi agents AC002866 or AC002869, followed by subsequent infection with CA07 (12,000 TCID), achieved a 100% survival rate at day 15 post-infection (Groups 3 and 4). Test animals administered saline and subsequently infected with CA07 (12,000 TCID) exhibited only a 10% survival rate at day 8 post-infection (Group 2). Similarly, test animals administered oseltamivir (Tamiflu®) exhibited only a 20% survival rate at day 15 post-infection (Group 5). Thus, the IAV RNAi agents AC002866 and AC002869 achieved an approximately 90% reduction in mortality compared to the saline-treated group infected with CA07, and an approximately 80% reduction in mortality compared to the oseltamivir (Tamiflu®)-treated group.
[0495] Example 34. In vivo administration of IAV RNAi agents to mice infected with CA07 H1N1. Female C57B1 / 6 mice were infected with CA07 and then administered an IAV RNAi agent ("CA07 H1N1 model mice") according to Example 4. On day 1, 10 mice (n=10) in each group were administered either saline or an IAV RNAi agent formulated in saline (3 mg / kg), or oseltamivir (Tamiflu®; 40 mg / kg) by intranasal (IN) administration or oral gavage according to the dosing in Table 72 below.
[0496] [Table 128]
[0497] CA07 dose was quantified as TCID50 (50% tissue culture infectious dose).
[0498] On day 15, the animals were sacrificed. Mice were monitored for weight and survival rate after CA07 infection. Survival rate is determined at the time of sacrifice of any test animal that lost more than 20% of its initial weight (>20% weight loss = death of the test animal). Survival rates are shown in Table 73 below.
[0499] [Table 129]
[0500] Administration of a therapeutic agent after initial infection of animals represents a more severe model of IAV infection. As shown in Table 73 above, infection with CA07 (12,000 TCID50) followed by administration of the IAV RNAi agents AC002866 or AC002869 resulted in improved survival compared with either oseltamivir-treated or untreated groups. Test animals infected with CA07 (12,000 TCID50) followed by saline treatment exhibited only a 10% survival rate at days 8 and 14 post-infection (Group 2). Similarly, test animals administered oseltamivir (Tamiflu®) exhibited only a 20% survival rate at day 8 post-infection (Group 5) and a 10% survival rate at day 14 post-infection. In comparison, the group treated with the RNAi agent AD002869 after infection with CA07, which targets the M1 influenza A genome segment, showed a 60% survival rate at 2 weeks post-infection.
[0501] Example 35. Identification of conserved RNAi agent sequences across influenza A subtypes and assessment of viral vulnerability. To identify the RNAi agent sequences disclosed in various embodiments herein, approximately 10,000 influenza genomes of different subtypes, including H1N1, H3N2, H5N1, H5N6, H5N8, H7N2, H7N3, H7N4, H7N7, H7N9, and H9N2, were bioinformatically evaluated to locate the most highly conserved regions. By utilizing RNAi agents with sequences that can target conserved regions across different influenza genome subtypes, RNAi agent therapeutics can provide therapeutic benefits to patients suffering from various influenza subtypes, and thus address a larger patient population.
[0502] For the RNAi agents described herein, as described elsewhere herein, candidate sequences targeting these highly conserved regions were identified in six genomic segments: PB1, PB2, PA, NP, NS, and M (referred to herein as M1, but including transcripts of M1 and M2). Genomic segments HA and NA were not evaluated due to the high genetic variation in these regions across different subtypes.
[0503] As described in various Examples herein, throughout various evaluations of RNAi agents, IAV RNAi agents targeting the influenza A M1 genome segment (i.e., targeting the influenza A genome segment transcript of SEQ ID NO: 1) consistently demonstrated the most significant antiviral activity compared to IAV RNAi agents targeting other genome segments.
[0504] Example 36. In vivo administration of IAV RNAi agents to H5N1-infected mice. Female C57Bl / 6 mice were first administered an IAV RNAi agent and then infected with H5N1 IAV virus. Different groups of female C57Bl / 6 mice were also administered the IAV RNAi agent after H5N1 virus infection. On days -7 and -5, 10 mice (n = 10) in groups 3 and 4 were administered the IAV RNAi agent (3 mg / kg) formulated in saline via intranasal (IN) or intratracheal (IT) administration. Five mice (n = 5) in group 1 and 10 animals (n = 10) in group 2 were administered saline IN. On day 0, groups 2 to 5 were administered the H5N1 virus via intranasal (IN) administration. On day 0, 4 hours and 8 hours after H5N1 challenge, 10 mice (n=10) in Group 5 were administered IAV RNAi agent (3 mg / kg) formulated in saline via intranasal (IN) administration. Test animals in Group 1 were administered PBS IN and no H5N1 was administered. H5N1 dose was quantified in PFU (plaque forming units). Dosing was according to Table 74 below.
[0505] [Table 130]
[0506] The administered H5N1 virus was influenza A virus (type A / Viet Nam / 1203 / 2004 (H5N1)).
[0507] All mouse test animals were sacrificed on day 5 (day 5 post-infection). Daily body weight measurements were collected. Lungs were harvested and quantified and analyzed for lung viral load via PFU / TCID50 and lung histopathology.
[0508] [Table 131]
[0509] Lung viral load, quantified in PFU / lobe, is shown in Table 75 and Figure 6A. In mouse test animals, preventative treatment with the IAV RNAi agent AC002869 prior to H5N1 infection demonstrated a significant reduction in lung viral load. Preventative treatment with AC002869 via IT (Group 3) and IN (Group 4) both achieved a significant reduction in lung viral load compared to saline-administered test animals (Group 2). Additionally, therapeutic treatment with AC002869 (Group 5) following H5N1 infection also demonstrated a significant reduction in lung viral load compared to saline-administered test animals (Group 2). Groups 3-5 all demonstrated a reduction in lung viral load of approximately 10% compared to saline-administered test animals (Group 2). 2 After analysis of variance, Tukey's honestly significant difference HSD test showed p-values of p<0.01 for Group 2 vs. Group 3, Group 2 vs. Group 4, and Group 2 vs. Group 5 ( ** p<0.01).
[0510] Body weights of the mouse test animals were collected and are shown in Table 76 below and in Figure 6B.
[0511] [Table 132]
[0512] As shown in Table 76 and Figure 6B, following H5N1 infection, mouse test animals treated with AC002869 demonstrated improved weight change compared to saline-treated test animals (Group 2). Preventative treatment using AC002869 via IT (Group 3) and IN (Group 4) both achieved significant improvements in weight change compared to saline-administered test animals (Group 2). Both Groups 3 and 4 achieved approximately 94-95% weight retention compared to saline-administered test animals (Group 2, approximately 76%). Additionally, therapeutic treatment using AC002869 following H5N1 infection (Group 5) also demonstrated significant improvements in weight retention of approximately 91% compared to saline-administered test animals (Group 2, approximately 76%).
[0513] A "clinical score" was also observed for the mouse test animals. For the purposes of this study, the clinical score is defined as follows: 0=normal, 1 = suspected illness; 2 = mild but definite disease; 3 = moderate to severe disease; 4 = obviously severely ill, moribund - euthanasia, and 5=Confirmed dead.
[0514] The clinical scores of the mouse test animals are shown in Figure 6C. Test groups 3-5, which were treated with the IAV RNAi agent AC002869 via either intranasal (groups 4 and 5) or intratracheal administration (group 3) either before (groups 3 and 4, preventative) or after (group 5, therapeutic) H5N1 infection, all showed significant improvements in clinical scores compared to saline-treated test animals (group 2). After H5N1 infection, test animals in groups 3-5 showed clinical scores similar to those of test animals in group 1 that had not received H5N1 virus and maintained a clinical score of 0 until day 5 after H5N1 infection.
[0515] The above experimental data and results demonstrate that the IAV RNAi agent AC002869 described herein also has potent antiviral activity against the H5N1 variant of influenza A virus, because AC002869 is designed to exhibit antiviral activity that targets a highly conserved region of the influenza A virus (specifically, AC002869 targets M1). Furthermore, the IAV RNAi agent AC002869 exhibits both preventative and therapeutic antiviral activity against H5N1. Thus, the IAV RNAi agent AC002869, and other IAV RNAi agents described herein, can have potent antiviral activity across different influenza subtypes, thus providing greater therapeutic benefit to patients.
[0516] Example 37. In vivo administration of IAV RNAi agents to H5N1-infected mice. Female Balb / c mice were first administered an IAV RNAi agent and then infected with H5N1 IAV virus. Different groups of female Balb / c mice were also administered the IAV RNAi agent after H5N1 virus infection. On days -7 and -5, 10 mice (n = 10) in Group 3 were administered the IAV RNAi agent AC002869 (3 mg / kg) formulated in saline via intranasal (IN) administration. Ten mice (n = 10) in Groups 1 and 2 were administered saline via IN administration. On day 0, H5N1 virus was administered via intranasal (IN) administration to Groups 2-4. On day 0, 4 and 8 hours after H5N1 administration, 10 mice (n = 10) in Group 4 were administered the IAV RNAi agent (3 mg / kg) formulated in saline via intranasal (IN) administration. Test animals in Group 1 were administered PBS IN and no H5N1. H5N1 dose was quantified in TCID50 (50% tissue culture infectious dose). Dosing was according to Table 77 below.
[0517] [Table 133]
[0518] The administered H5N1 virus was influenza A (virus type A / whooper swan / Mongolia / 244 / 2005(H5N1)).
[0519] All mouse test animals were sacrificed on day 14 (14 days post-H5N1 infection). Daily body weight measurements were collected. Lungs were harvested and quantified and analyzed for lung viral load via PFU / TCID50 and lung histopathology.
[0520] Figure 7A shows the body weight of mouse test animals at time points prior to H5N1 infection. The IAV RNAi agent AC002869 does not appear to cause significant side effects that affect the body weight of the animals.
[0521] Figure 7B shows the body weights of mouse test animals at time points after H5N1 infection. All test animals in Group 2, which were administered saline (without IAV RNAi agent) and infected with H5N1, died from H5N1 infection. Test animals in Group 3, which were treated with the IAV RNAi agent AC002869 on days -7 and -5 and infected with H5N1, exhibited weight loss from days 5 to 10 but recovered to approximately 100% of their starting weight by days 12 to 14. Test animals in Group 4, which were treated with the IAV RNAi agent AC002869 4 and 8 hours after H5N1 infection, exhibited greater weight loss compared to Group 3 after a short period of recovery between days 10 and 11, but still showed improved weight loss compared to Group 2.
[0522] A clinical score is also observed for the mouse test animals. For the purposes of this study, the clinical score is defined as follows: 1=health, 2 = disheveled hair, rapid, shallow breathing, lethargy (trigger a second observation); 3 = a score of 2 plus 1, for example, any additional clinical signs such as hunched posture, eye socket tightening, increased respiratory rate, or weight loss of more than 15% (triggering a third observation); 4 = respiratory distress and / or cyanosis, resistance to movement when stimulated, or >25% weight loss - immediate euthanasia
[0523] Figure 7C shows the clinical scores of mouse test animals. Both test animals in Group 3 (treated with the IAV RNAi agent AC002869 before H5N1) and Group 4 (treated with the IAV RNAi agent AC002869 after H5N1) showed improved clinical scores compared to test animals in Group 2 (not treated with an IAV RNAi agent and infected with H5N1). Group 4 also showed improved clinical scores compared to Group 3. This indicates that both preventative and therapeutic treatment with AC002869 showed improved clinical scores compared to Group 2 (treated with saline and not with an IAV RNAi agent), while the AC002869 preventative treatment showed better clinical scores than the therapeutic treatment. Test animals in Group 3 showed a healthy clinical score (score = 1) from day 12.
[0524] Figure 7D shows the survival index of the test animals. All animals in Group 2, which were not treated with an IAV RNAi agent and infected with H5N1, showed 100% mortality by day 10. At day 14, Group 3 (prophylactic treatment AC002869) showed a 60% survival rate, while Group 4 (therapeutic treatment AC002869) showed an 80% survival rate. Both preventative treatment (Group 3) and therapeutic treatment (Group 4) with the IAV RNAi agent AC002869 showed significant improvements in mortality, at 60% and 80%, respectively, compared to Group 2, which was not treated with an IAV RNAi agent.
[0525] Figure 7E shows lung viral load in TCID50. In mouse test animals, preventative and therapeutic treatment of H5N1 using the IAV RNAi agent AC002869 demonstrated a significant reduction in lung viral load. Both preventative treatment Group 3 and therapeutic treatment Group 4 achieved significant antiviral activity in the lung, reducing H5N1 lung viral load by approximately 1.5 log10 compared to test animals that did not receive the IAV RNAi agent (Group 2). Significance was ** Shown as p<0.01.
[0526] The above experimental data and results demonstrate that the IAV RNAi agent AC002869 described herein also has potent antiviral activity against the H5N1 variant of influenza A virus, because AC002869 is designed to exhibit antiviral activity that targets a highly conserved region of the influenza A virus (specifically, AC002869 targets M1). Furthermore, the IAV RNAi agent AC002869 exhibits both preventative and therapeutic antiviral activity against H5N1. Thus, the IAV RNAi agent AC002869, and other IAV RNAi agents described herein, can have potent antiviral activity across different influenza subtypes, thus providing greater therapeutic benefit to patients.
[0527] Other embodiments While the invention has been described in conjunction with the detailed description, it should be understood that the foregoing description is intended to be illustrative, and not limiting, of the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. 1. An RNAi agent for inhibiting expression of an influenza A virus genome, comprising: an antisense strand comprising at least 17 contiguous nucleotides that differ by 0 or 1 nucleotide from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F; a sense strand comprising a nucleotide sequence that is at least partially complementary to the antisense strand; 10. An RNAi agent comprising:
2. 2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2-18 of any one of the sequences provided in Table 2A, 2B, 2C, 2D, 2E, 2F, 3A, 3B, 3C, 3D, 3E, or 3F.
3. 3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences provided in Tables 2A, 2B, 2C, 2D, 2E, 2F, 4A, 4B, 4C, 4D, 4E, or 4F, and the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand.
4. 4. The RNAi agent of any one of claims 1-3, wherein at least one nucleotide of the IAV RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.
5. The RNAi agent of any one of claims 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides.
6. 6. The RNAi agent of claim 4 or 5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'-O-methyl nucleotides.
7. The RNAi agent of claim 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.
8. 8. The RNAi agent of any one of claims 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F.
9. 9. The RNAi agent of any one of claims 1-8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E, and 4F.
10. 2. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 3A, 3B, 3C, 3D, 3E, and 3F, and the sense strand comprises the nucleotide sequence of any one of the modified sequences provided in Tables 4A, 4B, 4C, 4D, 4E, and 4F.
11. The RNAi agent of any one of claims 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.
12. The RNAi agent of claim 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.
13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.
14. The RNAi agent of claim 13 , wherein the sense strand and the antisense strand are each 21 nucleotides in length.
15. The RNAi agent of claim 14 having two blunt ends.
16. The RNAi agent of any one of claims 1 to 15, wherein the sense strand comprises one or two terminal caps.
17. The RNAi agent of any one of claims 1 to 16, wherein the sense strand comprises one or two inverted abasic residues.
18. The RNAi agent of claim 1, which is composed of a sense strand and an antisense strand that form a duplex having the structure of any one of the duplexes in Table 7A-1, 7A-2, 7A-3, 7A-4, 7A-5, 7A-6, 7B-1, 7B-2, 7B-3, 7B-4, 7B-5, 7B-6, 8A, 8B, 8C, 8D, 8E, 8F, 9A, 9B, 9C, 9D, 9E, 9F, 10A, 10B, 10C, 10D, 10E, or 10F.
19. 19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.
20. 2. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from the following nucleotide sequence (5'→3'): UUACGUUUCGACCUCGGUUAG (SEQ ID NO: 1590).
21. 21. The RNAi agent of claim 20, wherein the sense strand consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from the following nucleotide sequence (5'→3'): CUAACCGAGGUCGAAACGUAA (SEQ ID NO: 1706).
22. 22. The RNAi agent of claim 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.
23. The following nucleotide sequence (5' to 3'): cPrpusUfsascguUfucgaCfcUfcGfguuasg (SEQ ID NO: 1176), or cPrpusUfsascGfuuucgaCfcUfcGfguuasg (SEQ ID NO: 1175), wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine, Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, Uf represents 2'-fluoro uridine, cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; and s represents a phosphorothioate linkage; and the RNAi agent of claim 1, wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides.
24. The sense strand has the following nucleotide sequence (5' to 3'): csuaaccgaGfgUfcGfaaacguaa (SEQ ID NO: 1373); or csuaaccgaGfgUfcgaaacguaa (SEQ ID NO: 1374), wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, Uf represents 2'-fluoro uridine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; and all or substantially all of the nucleotides on the antisense strand are modified nucleotides. The RNAi agent of claim 1.
25. 25. The RNAi agent of any one of claims 20 to 24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.
26. The RNAi agent of any one of claims 1 to 25, which is linked to a targeting ligand.
27. 27. The RNAi agent of claim 26, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells.
28. 28. The RNAi agent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.
29. The RNAi agent of claim 28, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
30. The targeting ligand has the following structure: 【Chemistry 1】 or a pharmaceutically acceptable salt thereof, or 【Chemistry 2】 or a pharmaceutically acceptable salt thereof, During the ceremony, 【Transformation 3】 indicates the point of attachment to the RNAi agent; 30. The RNAi agent of claim 29.
31. The targeting ligand is: 【Chemistry 4】 【Transformation 5】 【Transformation 6】 【Transformation 7】 【Transformation 8】 【Chemistry 9】 【Chemistry 10】 【Chemistry 11】 【Chemistry 12】 having a structure selected from the group consisting of: During the ceremony, 【Chemistry 13】 indicates the point of attachment to the RNAi agent; The RNAi agent according to any one of claims 26 to 29.
32. The following structure: 【Chemistry 14】 32. The RNAi agent of claim 31 , wherein the RNAi agent is conjugated to a targeting ligand having the following structure:
33. The RNAi agent of any one of claims 26 to 32, wherein the targeting ligand is conjugated to the sense strand.
34. 34. The RNAi agent of claim 33, wherein the targeting ligand is conjugated to the 5' end of the sense strand.
35. The influenza A virus genome H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; the H7N9 viral genome, and H10N8 virus genome The RNAi agent of any one of claims 1 to 34, selected from the group consisting of viral genomes:
36. 36. A composition comprising the RNAi agent of any one of claims 1 to 35, further comprising a pharmaceutically acceptable excipient.
37. 37. The composition of claim 36, further comprising a second RNAi agent capable of inhibiting expression of the influenza A viral genome.
38. The influenza A virus genome H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; the H7N9 viral genome, and H10N8 virus genome 38. The composition of claim 37, selected from the group consisting of viral genomes.
39. 39. The composition of any one of claims 36 to 38, further comprising one or more additional therapeutic agents.
40. 40. The composition of any one of claims 36 to 39, formulated for administration by inhalation.
41. 41. The composition of claim 40, delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.
42. 42. The composition of any one of claims 36-41, wherein the RNAi agent is a sodium salt.
43. 37. The composition of claim 36, wherein the pharmaceutically acceptable excipient is water for injection.
44. 37. The composition of claim 36, wherein the pharmaceutically acceptable excipient is buffered saline.
45. 1. A method for inhibiting expression of an influenza A virus genome in a cell and / or treating one or more symptoms or diseases associated with influenza A virus infection, comprising introducing into a cell and / or administering to a subject an effective amount of an RNAi agent, wherein the RNAi agent targets an M1 influenza A virus genome segment transcript by having an antisense strand comprising at least 15 contiguous nucleotides that differ in 0, 1, 2, or 3 nucleotides complementary to a stretch of at least 15 contiguous nucleotides of SEQ ID NO:1, and wherein the RNAi agent is optionally linked to a targeting ligand, preferably the targeting ligand has affinity for a cellular receptor expressed on epithelial cells, and most preferably the targeting ligand is an αvβ6 integrin targeting ligand.
46. 46. A method for inhibiting expression of an influenza A virus genome, the method comprising introducing into a cell an effective amount of an RNAi agent of any one of claims 1 to 35 or a composition of any one of claims 36 to 44.
47. The influenza A virus genome H1N1 virus genome; H2N2 virus genome; H3N2 virus genome; H5N1 virus genome; the H7N9 viral genome, and H10N8 virus genome 47. The method of claim 45 or 46, wherein the viral genome is selected from the group consisting of:
48. The method of any one of claims 45 to 47, wherein the cell is present in a subject.
49. 49. The method of claim 48, wherein the subject is a human subject.
50. 50. The method of any one of claims 45-49, wherein after administration of the RNAi agent, the influenza A viral genome is inhibited by at least about 30%.
51. 45. A method of treating one or more symptoms or diseases associated with influenza A virus infection, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 36 to 44.
52. 52. The method of claim 45 or claim 51, wherein the disease is a respiratory disease.
53. 53. The method of claim 52, wherein the respiratory disease is pulmonary inflammation.
54. 53. The method of claim 52, wherein the disease is influenza A virus infection.
55. The influenza A virus infection is H1N1; H2N2; H3N2; H5N1; H7N9; and 55. The method of claim 54, caused by an influenza A virus subtype selected from the group consisting of H10N8.
56. 56. The method of any one of claims 45-55, wherein the RNAi agent is administered at a deposited amount of about 0.01 mg / kg to about 5.0 mg / kg body weight of the subject.
57. 57. The method of any one of claims 45-56, wherein the RNAi agent is administered at a deposited amount of about 0.03 mg / kg to about 2.0 mg / kg of body weight of the subject.
58. 58. The method of any one of claims 45-57, wherein the RNAi agent is administered in two or more doses.
59. 36. Use of the RNAi agent of any one of claims 1 to 35 for treating a disease, disorder, or condition mediated at least in part by influenza A viral genome activity and / or influenza A viral genome expression.
60. 45. Use of a composition according to any one of claims 36 to 44 for treating a disease, disorder or condition mediated at least in part by influenza A viral genome activity and / or expression.
61. 45. Use of a composition according to any one of claims 36 to 44 for the manufacture of a medicament for treating a disease, disorder or condition mediated at least in part by influenza A viral genome and / or influenza A viral genome expression.
62. The use according to any one of claims 59 to 61, wherein the disease is influenza infection.
63. 36. A method for producing the RNAi agent of any one of claims 1 to 35, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.
64. 64. The method of claim 63, wherein the sense strand comprises a targeting ligand.
65. 65. The method of claim 64, comprising conjugating a targeting ligand to the sense strand.