Compounds and methods for reducing APP expression
Modified oligonucleotides targeting APP RNA and protein reduce APP expression, addressing the lack of effective treatments for Alzheimer's disease and related disorders by improving cognitive function and amyloid deposition.
Patent Information
- Application Number
- JP2025546606
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-17
- Filing Date
- 2024-02-16
- Publication Date
- 2026-02-20
AI Technical Summary
Current treatments for neurodegenerative diseases such as Alzheimer's disease, Alzheimer's disease in Down syndrome, and cerebral amyloid angiopathy lack effective options to reduce amyloid precursor protein (APP) expression, leading to symptoms like cognitive impairment and abnormal amyloid deposition.
Development of compounds, particularly modified oligonucleotides, to reduce APP RNA and protein levels, targeting specific neurodegenerative diseases by hybridizing with APP nucleic acids and modulating its expression.
The compounds effectively ameliorate symptoms of neurodegenerative diseases by decreasing APP expression, improving memory, language skills, and reducing amyloid deposition.
Smart Images

Figure 2026506010000001 
Figure 2026506010000002 
Figure 2026506010000003
Abstract
Description
[Technical Field]
[0001] Sequence Listing
[0001] This application is submitted with an electronic Sequence Listing. The Sequence Listing is provided as the file BIOL0460SEQ.xml, created on January 31, 2024, and is 384 KB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.
[0002] Compounds, methods, and pharmaceutical compositions are provided for reducing the amount or activity of amyloid precursor protein (APP) RNA in cells or animals, and optionally reducing the amount of APP protein in cells or subjects. Certain such compounds, methods, and pharmaceutical compositions are useful for ameliorating at least one symptom or characteristic of APP-related neurodegenerative diseases or disorders. Such symptoms or characteristics include cognitive impairment, including decline in memory and / or language ability, behavioral and psychological symptoms, such as apathy and lack of motivation, gait disturbances, seizures, progressive dementia, and abnormal amyloid deposition. Such APP-related neurodegenerative diseases and disorders include sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, and sporadic and familial cerebral amyloid angiopathy. [Background technology]
[0003] Alzheimer's disease (AD), including both sporadic and genetic / familial forms, is the most common cause of age-related dementia, affecting an estimated 5.7 million Americans each year (Alzheimer's Association. 2018 Alzheimer's Disease Facts and Figures. Alzheimer's Dement. 2018;14(3):367-429). AD is characterized by the accumulation of beta-amyloid plaques in the brain before overt clinical symptoms appear. These overt clinical symptoms include cognitive impairment, including declines in memory and language skills, behavioral and psychological symptoms, such as apathy and lack of motivation, gait disturbances, seizures, and progressive dementia.
[0004] Patients with Down syndrome (DS) can develop Alzheimer's disease (AD in DS) early, with amyloid plaque formation observed in most DS patients by age 40 and Alzheimer's dementia observed in more than 50% of Down syndrome patients by age 50.
[0005] Cerebral amyloid angiopathy (CAA) is a related disorder characterized by the deposition of β-amyloid in blood vessels of the central nervous system. CAA is commonly observed in autopsies of AD patients and is associated with aging, even in the absence of clinical symptoms of AD.
[0006] AD, AD in DS, and CAA are all characterized by the abnormal accumulation of β-amyloid plaques. β-Amyloid (Aβ) is generated from the amyloid precursor protein (APP) upon APP processing by α-, β-, and γ-secretases. In addition to the 42-amino acid fragment Aβ, various other fragments of APP are also formed, some of which have been proposed to contribute to the development of dementia in AD (reviewed in Nhan, et al., “The multifaceted nature of amyloid precursor protein and its proteolytic fragments: friends and foes,” Acta Neuropath., 2015, 129(1):1-19). The increased incidence of AD in DS patients is thought to be directly related to an increased copy number of the APP gene on chromosome 21.
[0007] Currently, there is a lack of acceptable options for treating neurodegenerative diseases and disorders such as AD, AD in DS, CAA, etc. It is therefore an object of the present invention to provide compounds, methods and pharmaceutical compositions for treating such diseases and disorders. Summary of the Invention
[0008] Provided herein are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of APP RNA, and in certain embodiments, for reducing the amount of APP protein in a cell or a subject. In certain embodiments, the subject has or is at risk of developing an APP-related neurodegenerative disease or disorder. In certain embodiments, the subject has Alzheimer's disease (AD). In certain embodiments, the subject has Alzheimer's disease associated with Down's syndrome (AD in DS). In certain embodiments, the subject has cerebral amyloid angiopathy (CAA). In certain embodiments, compounds useful for reducing APP RNA expression are oligomeric compounds. In certain embodiments, compounds useful for reducing APP RNA expression are modified oligonucleotides.
[0009] Also provided are methods useful for ameliorating at least one symptom or characteristic of an APP-associated neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease is Alzheimer's disease. In certain embodiments, the neurodegenerative disease or disorder is Alzheimer's disease in Down's syndrome patients. In certain embodiments, the neurodegenerative disease or disorder is cerebral amyloid angiopathy (CAA). In certain embodiments, the symptom or characteristic comprises cognitive impairment, including decline in memory and language skills, behavioral and psychological symptoms, such as lethargy and lack of motivation, gait disturbance, seizures, progressive dementia, and / or abnormal amyloid deposition. DETAILED DESCRIPTION OF THE INVENTION
[0010] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "comprises" is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components that contain a single unit and elements and components that contain multiple subunits, unless expressly stated otherwise.
[0011] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application (including, but not limited to, patents, patent applications, articles, books, and papers) are expressly incorporated by reference in their entirety, as well as portions of the documents discussed herein.
[0012] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, and other materials referenced throughout the disclosure are incorporated herein by reference in their entirety.
[0013] Unless otherwise stated, the following terms have the following meanings:
[0014] As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyfuranosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside may contain a modified nucleobase or may contain an RNA nucleobase (uracil).
[0015] As used herein, "2'-MOE" refers to an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-MOE sugar moiety" or "2'-O-methoxyethyl sugar moiety" refers to a sugar moiety having an OCH2CHOCH3 group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D-ribosyl configuration. "MOE" refers to O-methoxyethyl.
[0016] As used herein, "2'-MOE nucleoside" or "2'-OCH2CH2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).
[0017] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. A "2'-O-methyl sugar moiety" or "2'-OMe sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, 2'-OMe has the stereochemical configuration of β-D ribosyl.
[0018] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.
[0019] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-F sugar moiety is in the β-D-ribosyl configuration.
[0020] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F modified sugar moiety.
[0021] As used herein, "2'-NMA" refers to a 2'-OCH2C(=O)-N(H)CH3 group at the 2'-position of a furanosyl sugar moiety. A "2-NMA sugar moiety" refers to a sugar moiety having a 2'-OCH2C(=O)-N(H)CH3 group in place of the 2'-OH group of a furanosyl sugar moiety.
[0022] As used herein, "2'-NMA nucleoside" means a nucleoside that includes a 2'-NMA sugar moiety.
[0023] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.
[0024] As used herein, "stop site" refers to the 3'-most nucleotide of a target nucleic acid that is complementary to an oligonucleotide when the oligonucleotide is hybridized to the target nucleic acid.
[0025] As used herein, "initiation site" refers to the 5'-most nucleotide of a target nucleic acid that is complementary to an oligonucleotide when the oligonucleotide is hybridized to the target nucleic acid.
[0026] As used herein, "5-methylcytosine" means a cytosine modified by being attached to a methyl group at position 5. 5-methylcytosine is a modified nucleobase.
[0027] As used herein, "abasic sugar moiety" means a sugar moiety that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."
[0028] As used herein, "administration" or "administering" means providing a pharmaceutical agent to a subject.
[0029] As used herein, "ameliorating," with respect to treatment, means an improvement in at least one symptom or characteristic compared to the same symptom or characteristic in the absence of treatment. In certain embodiments, the improvement is a decrease in the severity or frequency of the symptom, or a delay in the onset or progression of the severity or frequency of the symptom. In certain embodiments, the symptom or characteristic is one or more of: decline in memory and / or language ability, behavioral and psychological symptoms such as lethargy or lack of motivation, gait disturbance, seizures, progressive dementia, or cognitive impairment, including abnormal amyloid deposition.
[0030] As used herein, "antisense activity" refers to a detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.
[0031] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.
[0032] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0033] As used herein, "antisense oligonucleotide" refers to an oligonucleotide (including the oligonucleotide portion of an antisense compound) that can hybridize to a target nucleic acid and have at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.
[0034] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0035] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two atoms of the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.
[0036] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.
[0037] As used herein, "cell targeting moiety" means a conjugate moiety or a portion of a conjugate moiety that is capable of binding to a specific cell type or specific cell types.
[0038] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties (e.g., osmolality, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.
[0039] As used herein, "chiral control" with respect to an internucleoside linkage means that the chirality at that linkage is enriched for a particular stereochemical configuration.
[0040] As used herein, "chiral enrichment" with respect to a population means that there are multiple molecules of the same molecular formula, but the number or percentage of molecules in the population containing a particular stereochemical configuration at a particular chiral center is greater than the number or percentage of molecules expected to contain the same particular stereochemical configuration at the same particular chiral center in the population if the particular chiral center were stereorandom as defined herein. A chiral enriched molecular population having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise specified, the chiral internucleoside linkages of the modified oligonucleotides described herein may be stereorandom or chirally enriched.
[0041] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved upon administration to a subject, e.g., a cell, a subject, or inside a human.
[0042] As used herein, "complementary" with respect to an oligonucleotide means that when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. A "complementary region" with respect to a region of an oligonucleotide means that when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of another nucleic acid are aligned in opposite directions, at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid, or one or more regions thereof, can hydrogen bond with each other. As used herein, "complementary nucleobases" means nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine ( m Certain modified nucleobases that pair with unmodified (natural) or other modified nucleobases are known in the art. For example, hypoxanthine (I) can pair with adenosine, cytosine, thymine, or uracil, but is not considered complementary. As used herein, hypoxanthine (I) is considered to be a nucleobase complementary to thymine (T), adenine (A), uracil (U), and cytosine (C). Complementary oligonucleotides and / or nucleic acids do not need to have nucleobase complementarity at every nucleoside. Rather, some mismatches are tolerated. As used herein, "fully complementary" or "100% complementary" with respect to an oligonucleotide or portion thereof means that the oligonucleotide or portion thereof is complementary to another oligonucleotide or nucleic acid at every nucleobase of the shorter of the two oligonucleotides, or at every nucleoside if the oligonucleotides are the same length.
[0043] As used herein, "region of complementarity" with respect to an oligonucleotide refers to the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.
[0044] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate group moiety to the oligonucleotide.
[0045] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.
[0046] As used herein, "conjugate moiety" means a grouping of atoms that, when covalently attached to a molecule, modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, such properties including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
[0047] As used herein, "constrained ethyl" or "cEt" or "cEt sugar moiety" means a β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.
[0048] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.
[0049] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.
[0050] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, at least 70% of the nucleosides comprising a β-D-2'-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside in the deoxy region is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. The deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.
[0051] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are folded regions of the same molecule (e.g., a hairpin structure).
[0052] As used herein, "duplex" or "duplex region" means the structure formed by two oligonucleotides or portions thereof hybridized to one another.
[0053] As used herein, a "gapmer" refers to a modified oligonucleotide comprising an internal region located between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions, such that the modified oligonucleotide supports RNase H cleavage. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings." In certain embodiments, the internal region is a deoxyribonucleotide region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5'-end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remaining nucleosides in the gap are 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications need not follow the gapmer pattern of sugar modifications.
[0054] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.
[0055] As used herein, "internucleoside linkage" refers to a covalent bond between immediately adjacent (e.g., consecutive) nucleosides within an oligonucleotide. As used herein, "unmodified internucleoside linkage" refers to a phosphodiester internucleoside linkage. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage has been replaced with a sulfur atom. A "mesylphosphoramidate internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage has been replaced with NS(=O)2CH3.
[0056] As used herein, "inverted nucleoside" means a nucleotide having a 3' to 3' and / or a 5' to 5' internucleoside linkage.
[0057] As used herein, "linked nucleosides" are nucleosides joined in contiguous sequence (i.e., nucleosides immediately adjacent to each other, with no additional nucleosides between the linked nucleosides).
[0058] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.
[0059] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first nucleic acid sequence are not complementary to the corresponding nucleobases of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned.
[0060] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.
[0061] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety.
[0062] As used herein, "modified sugar moiety" means a sugar moiety of a nucleoside other than a 2'-β-D-deoxyribosyl sugar moiety (unmodified DNA sugar moiety) or a β-D-ribosyl sugar moiety (unmodified RNA sugar moiety).
[0063] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.
[0064] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.
[0065] As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.
[0066] As used herein, the "nucleobase sequence" of a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO, and therefore includes compounds in which each nucleobase, each sugar moiety, and each internucleoside linkage may be independently modified or unmodified, with or without the modifications shown in the reference SEQ ID NO, unless otherwise specified.
[0067] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which is independently unmodified or modified.
[0068] As used herein, "oligomeric agent" means an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or an oligomeric duplex formed by two complementary oligomeric compounds.
[0069] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.
[0070] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplex oligomeric compound."
[0071] As used herein, "oligonucleotide" refers to a chain of linked nucleosides connected via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides. As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside linkage is modified. As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside or internucleoside modification. An oligonucleotide may or may not be paired with a second oligonucleotide complementary to the oligonucleotide.
[0072] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to a subject. Certain such diluents allow the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.
[0073] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.
[0074] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.
[0075] As used herein, a "population" means a plurality of molecules having the same molecular formula.
[0076] As used herein, "prodrug" refers to a therapeutic agent that is in a first form outside the body and is converted to a second form within the subject or cells thereof. Typically, the conversion of the prodrug within the subject is facilitated by the action of enzymes (e.g., endogenous or viral enzymes) or chemicals present in the cells or tissues and / or physiological conditions. The first form of the prodrug may be less active than the second form.
[0077] As used herein, "RNA" means RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.
[0078] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNAi (ssRNAi), and microRNA (including microRNA mimics). RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, an RNAi agent regulates the amount and / or activity of a target nucleic acid. The term RNAi agent does not include antisense agents that act primarily through RNase H.
[0079] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H compound may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent does not include antisense agents that act primarily through RISC / Ago2.
[0080] As used herein, "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.
[0081] As used herein, "sense oligonucleotide" means an oligonucleotide that comprises the oligonucleotide portion of a sense compound and is capable of hybridizing to an antisense oligonucleotide.
[0082] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. A single-stranded compound can hybridize with a complementary nucleic acid to form a duplex, at which point it is no longer single-stranded.
[0083] As used herein, "standard in vivo assay" means the assay described in Examples 2, 3, 4, 5, 6, or 7, and reasonable variations thereof.
[0084] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis with respect to a specific absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if the stereochemical configuration of the chiral center is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration ("racemic") of the stereorandom chiral center. The stereochemical configuration of a chiral center is random if the stereochemical configuration of the chiral center is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesylphosphoramidate internucleoside linkage with random stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral centers may be, but is not necessarily, the same as the number of molecules having the (R) configuration of the stereorandom chiral centers. The stereochemical configuration of the chiral centers is considered random if it is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral centers are stereorandom phosphorothioate internucleoside linkages or mesyl phosphoramidate internucleoside linkages.
[0085] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.
[0086] In certain embodiments, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.
[0087] As used herein, "sugar surrogate" refers to a modified sugar moiety having a group other than a furanosyl group that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.
[0088] As used herein, "symptom or feature" refers to a physical characteristic or test result that indicates the presence or extent of a disease or disorder. In certain embodiments, the symptom is apparent to the subject or to a medical professional examining or testing the subject. In certain embodiments, the feature is revealed by an invasive diagnostic test, including but not limited to, a post-mortem examination. In certain embodiments, the feature is the result of a diagnostic test, including but not limited to, a post-mortem examination. In certain embodiments, the symptom or feature includes cognitive impairment, including a decline in memory and / or language skills, behavioral and psychological symptoms, such as lethargy and lack of motivation, gait disturbances, seizures, progressive dementia, and abnormal amyloid deposition.
[0089] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an oligomeric compound is designed to affect. Target RNA refers to an RNA transcript, and includes pre-mRNA and mRNA, unless otherwise specified.
[0090] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.
[0091] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.
[0092] As used herein, "treatment" refers to improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.
[0093] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that confers a therapeutic benefit on a subject, e.g., administration of a therapeutically effective amount results in amelioration of disease symptoms.
[0094] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:
[0095] An oligomeric compound comprising a modified oligonucleotide consisting of linked nucleosides of embodiments 1.8 to 80, and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 15 to 18, wherein at least one internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage.
[0096] Embodiment 2. The oligomeric compound of embodiment 1, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 15-18.
[0097] Embodiment 3. The oligomeric compound of either embodiment 1 or embodiment 2, wherein the modified oligonucleotide consists of 20 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18.
[0098] Embodiment 4. The oligomeric compound of any one of Embodiments 1 to 3, wherein said modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO:15 or SEQ ID NO:18.
[0099] Embodiment 5. The oligomeric compound of any one of embodiments 1-4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an APP nucleic acid, wherein the APP nucleic acid has the nucleobase sequence of SEQ ID NO:1 or SEQ ID NO:2.
[0100] Embodiment 6. The modified oligonucleotide is 10 to 25, 10 to 30, 10 to 50, 12 to 20, 12 to 25, 12 to 30, 12 to 50, 13 to 20, 13 to 25, 13 to 30, 13 to 50, 14 to 20, 14 to 25, 14 to 30, 14 to 50, 15 to 20, 15 to 25, 15 to 30, 15 to 50, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 16 to 50, 17 to 20, 17 to 25, 17 to 6. The oligomeric compound of any one of embodiments 1-5, consisting of 30, 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.
[0101] Embodiment 7. The oligomeric compound of any one of embodiments 1 to 6, wherein said modified oligonucleotide consists of 20 linked nucleosides.
[0102] Embodiment 8. The oligomeric compound of any one of embodiments 1 to 7, wherein at least one nucleoside of said modified oligonucleotide is a modified nucleoside.
[0103] Embodiment 9 The oligomeric compound of embodiment 8, wherein said modified nucleoside comprises a modified sugar moiety.
[0104] Embodiment 10 The oligomeric compound of embodiment 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
[0105] Embodiment 11. The oligomeric compound of embodiment 10, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.
[0106] Embodiment 12 The oligomeric compound of embodiment 8 or 9, wherein said modified nucleoside comprises a non-bicyclic modified sugar moiety.
[0107] Embodiment 13 The oligomeric compound of embodiment 12, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
[0108] Embodiment 14 The oligomeric compound of Embodiment 12 or Embodiment 13, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.
[0109] Embodiment 15. The oligomeric compound of any one of embodiments 1 to 14, wherein at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of said modified oligonucleotide are mesylphosphoramidate internucleoside linkages.
[0110] Embodiment 16. The oligomeric compound of any one of embodiments 1 to 15, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage.
[0111] Embodiment 17. The oligomeric compound of embodiment 16, wherein at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.
[0112] Embodiment 18. The oligomeric compound of any one of embodiments 1 to 17, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.
[0113] Embodiment 19. The modified oligonucleotide is selected from the group consisting of: sooossssszzszsooss, soooosssssszszssooss, soooosszsssszsssooss, sooooszsssszzssssooss, soooosssssszzzszsooss, soooosssssszzzzsssooss, soooosszsssszzzzssooss, soooosszsssszzzzssooss, sooooszsssszzzzssooss, sooooszssszzzssssooss, sssosssssszzszsosss, ssoosssssszszssosss, ssoosszsssszssosss, ssoosszsssszssosss, ssoosszsssszssosss, ss 19. The oligomeric compound of any one of embodiments 1-18, having an internucleoside linkage motif (5' to 3') selected from: oszsssszzsssosss, ssoossssszzzszsosss, ssssssssszzzzzssss, sssoszssszzzssssss, sssoszssszzzsssssss, and ssssszssszzzssssss, wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.
[0114] Embodiment 20. The oligomeric compound of any one of embodiments 1 to 19, wherein the modified oligonucleotide comprises at least one modified nucleobase.
[0115] Embodiment 21. The oligomeric compound of embodiment 20, wherein the modified nucleobase is 5-methylcytosine.
[0116] Embodiment 22 The oligomeric compound of embodiment 21, wherein each cytosine is a 5-methylcytosine.
[0117] Embodiment 23 The oligomeric compound of any one of embodiments 1 to 22, wherein one or more nucleosides of the modified oligonucleotide comprise an unmodified nucleobase.
[0118] Embodiment 24. The oligomeric compound of any one of Embodiments 1 to 23, wherein the modified oligonucleotide comprises a deoxy region.
[0119] Embodiment 25. The oligomeric compound of embodiment 24, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.
[0120] Embodiment 26. The oligomeric compound of embodiment 24 or embodiment 25, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
[0121] Embodiment 27. The oligomeric compound of any one of claims 24-26, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
[0122] Embodiment 28. The deoxy region is adjacent on the 5'-side to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides and adjacent on the 3'-side to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides; the 3'-most nucleoside of the 5' exoregion comprises a modified sugar moiety; and 29. The oligomeric compound of any one of embodiments 24-28, wherein the 5'-most nucleoside of said 3' exoregion comprises a modified sugar moiety.
[0123] Embodiment 29 The oligomeric compound of embodiment 28, wherein each nucleoside of said 3' exogenous region comprises a modified sugar moiety.
[0124] Embodiment 30 The oligomeric compound of embodiment 28 or embodiment 29, wherein each nucleoside of the 5' exogenous region comprises a modified sugar moiety.
[0125] Embodiment 31. The modified oligonucleotide comprises: a 5' exoregion consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and having a 3' exoregion consisting of 5 linked nucleosides; 31. The oligomeric compound of embodiment 30, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside and each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.
[0126] Embodiment 32. The oligomeric compound of any one of embodiments 24 to 31, wherein at least three internucleoside linkages in the deoxy region are mesylphosphoramidate internucleoside linkages.
[0127] Embodiment 33. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 19): [ka] or a pharmaceutically acceptable salt thereof.
[0128] Embodiment 34. The modified oligonucleotide of embodiment 33, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0129] Embodiment 35. The modified oligonucleotide of embodiment 34, which is the sodium salt or the potassium salt.
[0130] Embodiment 36. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 19): [ka] or a pharmaceutically acceptable salt thereof.
[0131] Embodiment 37. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 20): [ka] Or its salt.
[0132] Embodiment 38. The modified oligonucleotide of embodiment 37, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0133] Embodiment 39. The modified oligonucleotide of embodiment 38, which is the sodium salt or the potassium salt.
[0134] Embodiment 40. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 20): [ka]
[0135] Embodiment 41. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 21): [ka] or a pharmaceutically acceptable salt thereof.
[0136] Embodiment 42. The modified oligonucleotide of embodiment 41, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0137] Embodiment 43. The modified oligonucleotide of embodiment 42, which is the sodium salt or the potassium salt.
[0138] Embodiment 44. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 21): [ka]
[0139] Embodiment 45. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 22): [ka] or a pharmaceutically acceptable salt thereof.
[0140] Embodiment 46. The modified oligonucleotide of embodiment 45, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0141] Embodiment 47. The modified oligonucleotide of embodiment 46, which is the sodium salt or the potassium salt.
[0142] Embodiment 48. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 22): [ka]
[0143] Embodiment 49. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 23): [ka] or a pharmaceutically acceptable salt thereof.
[0144] Embodiment 50. The modified oligonucleotide of embodiment 49, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0145] Embodiment 51. The modified oligonucleotide of embodiment 50, which is the sodium salt or the potassium salt.
[0146] Embodiment 52. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 23): [ka]
[0147] Embodiment 53. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 24): [ka] or a pharmaceutically acceptable salt thereof.
[0148] Embodiment 54. The modified oligonucleotide of embodiment 53, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
[0149] Embodiment 55. The modified oligonucleotide of embodiment 54, which is the sodium salt or the potassium salt.
[0150] Embodiment 56. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 24): [ka]
[0151] Embodiment 57. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T ds A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 19), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0152] Embodiment 58. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es T es T eo T eo A es m C ds m C ds T ds Tds T dz A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO: 20), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0153] Embodiment 59. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: G es T es T es T es A es m C ds m C ds T ds T ds T dz A dz A dz m C dz A dz T ds T es m C es m C es T esm C e (SEQ ID NO: 21), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0154] Embodiment 60. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 22), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0155] Embodiment 61. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO: 23), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0156] Embodiment 62. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: m C es T es m C es m C es A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 24), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.
[0157] Embodiment 63. A population of oligomeric compounds according to any one of embodiments 1 to 27 or 52 to 57, or a population of modified oligonucleotides according to any one of embodiments 28 to 51, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.
[0158] Embodiment 64. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 1 to 32 or 57 to 62, or a modified oligonucleotide according to any one of embodiments 33 to 56, or a population according to embodiment 63, and a pharmaceutically acceptable diluent.
[0159] Embodiment 65. The pharmaceutical composition of embodiment 64, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid or phosphate buffered saline.
[0160] Embodiment 66. The pharmaceutical composition of embodiment 64 or 65, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.
[0161] Embodiment 67. The pharmaceutical composition of any one of embodiments 64 to 66, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate buffered saline.
[0162] Embodiment 68. A method comprising administering to a subject an oligomeric compound described in any one of embodiments 1 to 32 or 57 to 62, a modified oligonucleotide described in any one of embodiments 33 to 56, a population described in embodiment 63, or a pharmaceutical composition described in any one of embodiments 64 to 67.
[0163] Embodiment 69. The method of embodiment 68, wherein the subject has or is at risk of developing an APP-related disease or disorder.
[0164] Embodiment 70. The method of embodiment 68 or embodiment 69, wherein administering the oligomeric compound, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom or feature of an APP-related disease or disorder.
[0165] Embodiment 71. The method of any one of embodiments 68-70, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or delays the progression of cognitive impairment, reduces or delays memory decline, reduces or delays decline in language ability, improves behavioral and psychological symptoms, reduces anorexia, improves motivation, reduces gait disturbances, reduces seizures, reduces or delays progressive dementia, and / or reduces abnormal amyloid deposition.
[0166] Embodiment 72 The method of any one of embodiments 68 to 71, wherein the subject's APP protein levels are reduced.
[0167] Embodiment 73. The method of any one of embodiments 69-72, wherein the APP-related disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.
[0168] Embodiment 74. A method of treating a disease or disorder associated with APP, comprising administering to a subject having or at risk of developing an APP-related disease or disorder a therapeutically effective amount of an oligomeric compound described in any one of embodiments 1-32 or 57-62, a modified oligonucleotide described in any one of embodiments 33-56, a population described in embodiment 63, or a pharmaceutical composition described in any one of embodiments 64-67, thereby treating the disease or disorder associated with APP.
[0169] Embodiment 75. The method of embodiment 73, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition ameliorates at least one symptom or feature of an APP-related disease or disorder.
[0170] Embodiment 76. The method of embodiment 73 or 74, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or delays the progression of cognitive impairment, reduces or delays memory decline, reduces or delays decline in language ability, improves behavioral and psychological symptoms, reduces anorexia, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, and / or reduces abnormal amyloid deposition.
[0171] Embodiment 77. The method of any one of embodiments 74 to 76, wherein the subject's APP protein levels are reduced.
[0172] Embodiment 78. The method of any one of embodiments 74-77, wherein the APP-related disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.
[0173] Embodiment 79. The method of any one of embodiments 74 to 78, wherein the subject is a human.
[0174] Embodiment 80. A method for reducing expression of APP in a cell, comprising contacting the cell with an oligomeric compound described in any one of embodiments 1 to 32 or 56 to 62, a modified oligonucleotide described in any one of embodiments 33 to 56, a population described in embodiment 63, or a pharmaceutical composition described in any one of embodiments 62 to 65.
[0175] Embodiment 81. The method of embodiment 80, wherein the cell is a cerebral cortex cell or a hippocampal cell.
[0176] Embodiment 82 The method of embodiment 80 or embodiment 81, wherein the cells are human cells.
[0177] Embodiment 83. Use of an oligomeric compound according to any one of embodiments 1 to 32 or 57 to 62, a modified oligonucleotide according to any one of embodiments 33 to 56, a population according to embodiment 63, or a pharmaceutical composition according to any one of embodiments 64 to 67 for the treatment of a disease or disorder associated with APP.
[0178] Embodiment 84. Use of an oligomeric compound according to any one of embodiments 1 to 32 or 57 to 62, a modified oligonucleotide according to any one of embodiments 33 to 56, a population according to embodiment 63, or a pharmaceutical composition according to any one of embodiments 64 to 67 in the manufacture of a medicament for the treatment of a disease or disorder associated with APP.
[0179] Embodiment 85. The use of embodiment 83 or 84, wherein the disease or disorder is associated with elevated levels of APP.
[0180] Embodiment 86. The use according to any one of embodiments 83 to 85, wherein the disease or disorder associated with APP is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.
[0181] Certain Oligomeric Agents and Compounds Certain embodiments provide oligomeric agents that target APP nucleic acids. In certain embodiments, the APP nucleic acid has the sequence set forth in SEQ ID NO: 1 (cDNA of Ensembl transcript ENST00000346798.7, version 94: October 2018) or SEQ ID NO: 2 (GenBank accession number NC_000021.9 truncated from nucleotide 25878001 to 226174000). In certain embodiments, the oligomeric agent is a single-stranded oligomeric compound. In certain embodiments, the oligomeric agent is an oligomeric duplex.
[0182] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide is at least 80% complementary to an equal-length portion of an APP nucleic acid, and at least one internucleoside linkage of the modified oligonucleotide is a mesylphosphoramidate internucleoside linkage. In certain embodiments, the APP nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2. In certain embodiments, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an APP nucleic acid. In any of the oligomeric compounds described herein, the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal-length portion of an APP nucleic acid, and the APP nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO: 2.
[0183] Certain embodiments provide oligomeric compounds comprising modified oligonucleotides consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 15-18. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 15-18.
[0184] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO: 18. In certain embodiments, the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO: 18.
[0185] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising any of SEQ ID NOs: 15 to 18. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide having a nucleobase sequence consisting of any of SEQ ID NOs: 15 to 18.
[0186] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of either SEQ ID NO: 15 or SEQ ID NO: 18. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide having a nucleobase sequence consisting of SEQ ID NO: 15 or SEQ ID NO: 18.
[0187] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 15. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 15.
[0188] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 16. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 16.
[0189] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 17. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 17.
[0190] Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 to 80 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 18. Certain embodiments provide oligomeric compounds comprising a modified oligonucleotide consisting of 20 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide consists of the nucleobase sequence of SEQ ID NO: 18.
[0191] In any of the oligomeric compounds described herein, the modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 16-60, 16-70, 16-80, 16-90, 16-110, 16-120, 16-130, 16-140, 16-150, 16-160, 16-20, 16-25, 16-30, 16-50, 16-180, 16-20, 16-30, 16-50, 16-180, 16-25, 16-30, 16-50, 16-50, 16-60, 16-70, 16-80, 16-90, 16-110, 16-120, 16-140, 16-150, 16-160, 16-180, 16-20, 16-25, 16-30, 16-50, 16-180, 16-190, 16-210, 16-220, 16-230, 16-240, 16-2 The modified oligonucleotide can consist of 50, 17-20, 17-25, 17-30, 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 20 linked nucleosides.
[0192] In any of the oligomeric compounds provided herein, the modified oligonucleotide comprises at least one modified internucleoside linkage, wherein at least one modified internucleoside linkage of the modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. In any of the oligomeric compounds provided herein, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 internucleoside linkages of the modified oligonucleotide are mesyl phosphoramidate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises 1, 2, 3, 4, 5, 6, or 1 to 6 mesyl phosphoramidate internucleoside linkages. In any of the oligomeric compounds provided herein, the modified oligonucleotide has an internucleoside linkage motif comprising at least one mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising at least two, at least three, at least four, at least five, at least six, at least seven, or at least eight mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising one, two, three, four, five, six, or one to six mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising two to five mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising two mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising three mesyl phosphoramidate internucleoside linkages. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif comprising four mesyl phosphoramidate internucleoside linkages. In certain embodiments, the modified oligonucleotide comprises an internucleoside linkage motif comprising five mesyl phosphoramidate internucleoside linkages.
[0193] In any of the oligomeric compounds provided herein, at least one internucleoside linkage of the modified oligonucleotide can be a phosphorothioate internucleoside linkage. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising at least one mesyl phosphoramidate internucleoside linkage and at least one phosphorothioate internucleoside linkage. In certain embodiments, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of the modified oligonucleotide are phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 9 to 18 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 10 to 14 phosphorothioate internucleoside linkages. In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif comprising 14 phosphorothioate internucleoside linkages.
[0194] In certain embodiments, at least one internucleoside linkage of a modified oligonucleotide can be a phosphodiester internucleoside linkage. In certain embodiments, a modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and at least one phosphodiester internucleoside linkage. In certain embodiments, a modified oligonucleotide has an internucleoside linkage motif comprising at least one phosphodiester internucleoside linkage. In certain embodiments, a modified oligonucleotide has an internucleoside linkage motif comprising at least one, at least two, at least three, at least four, at least five, or at least six phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide has an internucleoside linkage motif comprising one to three phosphodiester internucleoside linkages. In certain embodiments, a modified oligonucleotide has an internucleoside linkage motif comprising one phosphodiester internucleoside linkage. In certain embodiments, modified oligonucleotides have an internucleoside linkage motif comprising two phosphodiester internucleoside linkages.
[0195] In certain embodiments, a modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage and at least one of a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, a modified oligonucleotide comprises at least one mesyl phosphoramidate internucleoside linkage, at least one phosphorothioate internucleoside linkage, and at least one phosphodiester internucleoside linkage.
[0196] In any of the oligomeric compounds provided herein, at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, the modified sugar moiety comprises a non-bicyclic sugar moiety, such as a 2'-MOE sugar moiety or a 2'-OMe sugar moiety. In certain embodiments, the modified sugar moiety is a 2'-MOE sugar moiety.
[0197] In any of the oligomeric compounds provided herein, at least one nucleobase of the modified oligonucleotide can be a modified nucleobase, such as 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.
[0198] In any of the oligomeric compounds described herein, the modified oligonucleotide can comprise a deoxy region consisting of 5 to 12 consecutive 2'-deoxynucleosides. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety. In certain embodiments, the deoxy region is adjacent on the 5'-side to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides and on the 3'-side to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides, wherein the 3'-most nucleoside of the 5'-exoregion comprises a modified sugar moiety and the 5'-most nucleoside of the 3'-exoregion comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 3'-external region comprises a modified sugar moiety. In certain embodiments, each nucleoside of the 5'-external region comprises a modified sugar moiety. In certain embodiments, each of the 5'-external region nucleosides and each of the 3'-external region nucleosides is a 2'-MOE nucleoside. In certain embodiments, a modified oligonucleotide has a 5'-external region consisting of 5 linked nucleosides, a deoxy region consisting of 10 linked nucleosides, and a 3'-external region consisting of 5 linked nucleosides, and each of the 5'-external region nucleosides and each of the 3'-external region nucleosides is a 2'-MOE nucleoside.
[0199] 1. Compound No. 1620705 Compound No. 1620705 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having the nucleobase sequence (5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 18), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkages between nucleosides 4 and 5 and 16 and 17 are 2'-β-D-deoxynucleosides. is a phosphodiester internucleoside linkage; the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 5 and 6, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 13 and 14, 14 and 15, 15 and 16, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages; the internucleoside linkages between nucleosides 6 and 7, 11 and 12, and 12 and 13 are mesylphosphoramidate linkages; and each cytosine is a 5-methylcytosine.
[0200] Compound number 1620705 has the following chemical notation (5' to 3'): m C es T es m C es m C eo A es A dz T ds T ds T ds T ds A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 19), wherein: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'MOE sugar moiety, d=2'-β-D deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.
[0201] Compound No. 1620705 has the following chemical structure (SEQ ID NO: 19) (Structure 1): [ka] or a pharmaceutically acceptable salt thereof.
[0202] In certain embodiments, compound 1620705 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, compound 1620705 is a sodium or potassium salt.
[0203] The sodium salt of compound number 1620705 is represented by the following chemical structure (SEQ ID NO: 19) (Structure 2). [ka]
[0204] 2. Compound No. 1681029 Compound No. 1681029 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having the nucleobase sequence (5' to 3') GTTTACCTTTAACATTCCT (SEQ ID NO: 15), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkages between nucleosides 3 and 4, 4 and 5, and 16 and 17 are 2'-β-D-deoxynucleosides. between nucleosides 1 and 2, 2 and 3, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 13 and 14, 15 and 16, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages; between nucleosides 10 and 11, 11 and 12, 12 and 13, and 14 and 15 are mesylphosphoramidate internucleoside linkages; and each cytosine is a 5-methylcytosine.
[0205] Compound number 1681029 has the following chemical notation (5' to 3'): G es T es T eo T eo A es m C ds m C ds T ds T ds T dz A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO: 20), wherein: A = unmodified adenine nucleobase; m C=5-methylcytosine nucleobase, G = unmodified guanine nucleobase; T=unmodified thymine nucleobase, e=2'-MOE sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain conjugates or terminal groups.
[0206] Compound No. 1681029 has the following chemical structure (SEQ ID NO: 20) (Structure 3): [ka] or a pharmaceutically acceptable salt thereof.
[0207] In certain embodiments, compound 1621029 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, compound 1621029 is a sodium or potassium salt.
[0208] The sodium salt of compound number 1621029 is represented by the following chemical structure (SEQ ID NO: 20) (Structure 4). [ka]
[0209] 3. Compound No. 1681031 Compound No. 1681031 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having the nucleobase sequence (5' to 3') GTTTACCTTTAACATTCCTC (SEQ ID NO: 15), in which nucleosides 1 to 5 and 16 to 20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6 to 15 are each 2'-β-D-deoxynucleosides, and nucleosides 1, 2, and 3 are each 2'-β-D-deoxynucleosides. The internucleoside linkages between nucleosides 10 and 11, 11 and 12, 12 and 13, 13 and 14, and 14 and 15 are mesylphosphoramidate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0210] Compound number 1681031 has the following chemical notation (5' to 3'): G es T es T es T es A es m C ds m C ds T ds T ds T dz A dz A dz m C dz A dz T ds T es m C es m C es T es m C e (SEQ ID NO: 21), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'MOE sugar moiety, d=2'-β-D deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.
[0211] Compound No. 1681031 has the following chemical structure (SEQ ID NO: 21) (Structure 5): [ka] or a pharmaceutically acceptable salt thereof.
[0212] In certain embodiments, compound 1681031 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, compound 1681031 is a sodium or potassium salt.
[0213] The sodium salt of compound number 1681031 is represented by the following chemical structure (SEQ ID NO: 21) (Structure 6). [ka]
[0214] 4. Compound No. 1683009 Compound No. 1683009 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides having the nucleobase sequence (5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 18), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkages between nucleosides 4 and 5 and 16 and 17 are phosphorus. The internucleoside linkages are acid diester internucleoside linkages, the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 5 and 6, 7 and 8, 8 and 9, 9 and 10, 13 and 14, 14 and 15, 15 and 16, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, the internucleoside linkages between nucleosides 6 and 7, 10 and 11, 11 and 12, and 12 and 13 are mesylphosphoramidate internucleoside linkages, and each cytosine is a 5-methylcytosine.
[0215] Compound number 1683009 has the following chemical notation (5' to 3'): m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 22), wherein: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'MOE sugar moiety, d=2'-β-D deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.
[0216] Compound No. 1683009 has the following chemical structure (SEQ ID NO: 22) (Structure 7): [ka] or a pharmaceutically acceptable salt thereof.
[0217] In certain embodiments, compound 1683009 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium. In certain embodiments, compound 1683009 is a sodium or potassium salt.
[0218] The sodium salt of compound number 1683009 is represented by the following chemical structure (SEQ ID NO: 22) (Structure 8). [ka]
[0219] 5. Compound No. 1683010 Compound No. 1683010 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having the nucleobase sequence (5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 18), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkage between nucleosides 4 and 5 is a phosphodiester nucleoside. The internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 5 and 6, 7 and 8, 8 and 9, 9 and 10, 13 and 14, 14 and 15, 15 and 16, 16 and 17, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages, the internucleoside linkages between nucleosides 6 and 7, 10 and 11, 11 and 12, and 12 and 13 are mesylphosphoramidate internucleoside linkages, and each cytosine is 5-methylcytosine.
[0220] Compound number 1683010 has the following chemical notation (5' to 3'): m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO: 23), wherein: A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'MOE sugar moiety, d=2'-β-D deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.
[0221] Compound No. 1683010 has the following chemical structure (SEQ ID NO: 23) (Structure 9): [ka] or a pharmaceutically acceptable salt thereof.
[0222] In certain embodiments, compound 1683010 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium, hi certain embodiments, compound 1683010 is a sodium or potassium salt.
[0223] The sodium salt of compound number 1683010 is represented by the following chemical structure (SEQ ID NO: 23) (Structure 10). [ka]
[0224] 6. Compound No. 1683011 Compound No. 1683011 is characterized as a 5-10-5 MOE gapmer consisting of 20 linked nucleosides and having the nucleobase sequence (5' to 3') CTCCAATTTTAACTTGCACC (SEQ ID NO: 18), wherein nucleosides 1-5 and 16-20 (5' to 3') are each 2'-MOE nucleosides, nucleosides 6-15 are each 2'-β-D-deoxynucleosides, and the internucleoside linkage between nucleosides 16 and 17 is a phosphodiesterase (PDE)-1. the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 7 and 8, 8 and 9, 9 and 10, 13 and 14, 14 and 15, 15 and 16, 17 and 18, 18 and 19, and 19 and 20 are phosphorothioate internucleoside linkages; the internucleoside linkages between nucleosides 6 and 7, 10 and 11, 11 and 12, and 12 and 13 are mesylphosphoramidate internucleoside linkages; and each cytosine is 5-methylcytosine.
[0225] Compound number 1683011 has the following chemical notation (5' to 3'): m C es T es m C es m C es A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 24), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'MOE sugar moiety, d=2'-β-D deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.
[0226] Compound No. 1683011 has the following chemical structure (SEQ ID NO: 24) (Structure 11): [ka] or a pharmaceutically acceptable salt thereof.
[0227] In certain embodiments, compound 1683011 is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium, hi certain embodiments, compound 1683011 is a sodium or potassium salt.
[0228] The sodium salt of compound number 1683011 is represented by the following chemical structure (SEQ ID NO: 24) (Structure 12). [ka]
[0229] I. Certain Oligonucleotides In certain embodiments, the present disclosure provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Specific modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.
[0230] A. Certain modified nucleosides Modified nucleosides contain a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides containing the following modified sugar moieties and / or the following modified nucleobases may be incorporated into antisense oligonucleotides:
[0231] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of modified sugar moieties.
[0232] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety comprising one or more acyclic substituents, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more of the acyclic substituents of the non-bicyclic modified sugar moiety is branched.
[0233] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 2'-position. Examples of suitable substituents at the 2'-position of the modified sugar chain include, but are not limited to, F, OCH ("OMe" or "O-methyl"), and OCHCHOCH ("MOE" or "O-methoxyethyl"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF, OCF, O-Ci-Ci. 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ) and each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 Alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), or 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), as well as 2'-substituents described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087.
[0234] Methods for the synthesis of some of these 2'-substituents can be found, for example, in Cook et al., US 6,531,584, and Cook et al., US 5,859,221. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0235] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein R m and R n each independently represents H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.
[0236] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent selected from F, OCF3, OCH3, OCH2CHOCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").
[0237] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").
[0238] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.
[0239] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the natural β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2020 / 072991. 2'-modified sugar moieties have an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety, thus allowing a total of 16 isomeric configurations for such sugar moieties. The modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.
[0240] In certain embodiments, the non-bicyclic modified sugar moiety is a stereoisomer of DNA, such as a 2'-β-D-deoxyxylosyl sugar moiety, [ka]
[0241] In certain embodiments, the non-bicyclic modified nucleoside comprises a 2'-α-L-deoxyribosyl sugar moiety, [ka]
[0242] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 3'-position. Examples of suitable substituents for the 3'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).
[0243] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 4'-position. Examples of suitable substituents for the 4'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.
[0244] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 5'-position. Examples of suitable substituents for the 5'-position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).
[0245] In certain embodiments, the non-bicyclic modified sugar moiety comprises one or more non-bridging sugar substituents, such as, for example, a 2'-F-5'-methyl sugar moiety as described in Migawa et al., US 2010 / 0190837, or an alternative 2'- and 5'-modified sugar moiety as described in Rajeev et al., US 2013 / 0203836.
[0246] In natural nucleic acids, sugars are linked to each other from 3' to 5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as the 2' position, or inverted 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.
[0247] Certain modified sugar moieties are bicyclic sugar moieties that contain a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety contains a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Examples of such 4' to 2' bridged sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', 4'-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH 2-N(R)-2', 4'-CH(CHOCH)-O-2' ("constrained MOE" or "cMOE") and its analogs, 4'-C(CH)(CH)-O-2' and its analogs, 4'-CH-N(OCH)-2' and its analogs, 4'-CH-ON(CH)-2', 4'-CH-C(H)(CH), 4'-CH-C(=CH)-2' and its analogs), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a and R b are independently H, a protecting group, or C1-C 12 Representative U.S. patents that teach methods for the preparation of such bicyclic sugar moieties include, but are not limited to, Imanishi et al., U.S. Pat. No. 7,427,672; Swayze et al., U.S. Pat. No. 7,741,457; and Swayze et al., U.S. Pat. No. 8,022,193; Seth et al., U.S. Pat. No. 8,278,283; Prakash et al., U.S. Pat. No. 8,278,425; Seth et al., U.S. Pat. No. 8,278,426.
[0248] In certain embodiments, such a 4' to 2' bridge is -[C(R a )(R b)] n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1 or 2, n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.
[0249] Additional bicyclic sugar moieties are known in the art, see, e.g., Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., US8,080,644; Ramasamy et al., US6,525,191; Seth et al., US7,547,684; and Seth et al., US7,666,854.
[0250] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka]
[0251] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNA has been shown to improve the stability of siRNA in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mal Cane Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In exemplary embodiments herein, where positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified, they are in the β-D configuration unless otherwise specified.
[0252] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted sugar and a 4'-2'-bridging sugar).
[0253] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'- and / or 5'-positions.
[0254] In certain embodiments, the sugar surrogate contains a ring other than five atoms. For example, in certain embodiments, the sugar surrogate contains a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA"), fluoroHNA, [ka] ("F-HNA", see Egli, et al., J Am Chem (2011) 133(41):16642-16649, Swayze et al., US 8,088,904; and Swayze et al., US 8,440,803). F-HNA may also be referred to as F-THP or 3'-fluorotetrahydropyran, or 3'-FHNA, and nucleosides containing additional modified THP compounds having the formula: [ka] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'- or 3'-terminal group; and q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C 6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, and R1 and R2 are each independently hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, or CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.
[0255] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.
[0256] In certain embodiments, the sugar surrogate comprises a ring having five or more atoms and one or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported. As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka]
[0257] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."
[0258] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids, and the nucleosides and oligonucleotides described in Manoharan et al., U.S. Pat. No. 10,913,767. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082, 5,714,331, and 5,719,262.
[0259] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is a nucleoside in which one of the bonds of the sugar moiety has been removed to form the unlocked sugar surrogate. Representative U.S. publications teaching the preparation of UNAs include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.
[0260] In certain embodiments, the sugar substitute is glycerol, found in GNA (glycol nucleic acid) nucleosides, as shown below: [ka] In the formula, Bx represents any nucleic acid base.
[0261] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art that can be used in modified nucleosides.
[0262] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides contain one or more nucleosides containing unmodified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides containing modified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase (referred to as abasic nucleosides). In certain embodiments, modified oligonucleotides contain one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleobases). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.
[0263] In certain embodiments, the modified adenine has the structure (I): [ka] In the formula, R 2A is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, or substituted C1-C6 thioalkyl, C1-C6 alkyloxy, or substituted C1-C6 alkyloxy, and R 6A is H,N(R a )(R b ), oxo, acetyl, formyl, or O-phenyl; Y 7A is N and R 7A is absent or is C1-C6 alkyl, or Y 7A is C and R 7A is H, C1-C6 alkyl, or CN(R a )(R b ) or Y 8A is N and R 8A does not exist or Y 8A is C and R 8Ais H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl, and R a and R b are independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, but Y 7A N, Y 8A C, R 8A H, R 2A H, R 6A The case where is NH2 (unmodified adenine) is excluded.
[0264] In certain embodiments, the modified guanine has the structure (II): [ka] In the formula, R 2G is N(R a )(R b ) is R 6G is oxo and R 1G is H or R 6G is selected from O—C1-C6 alkyl or S—C1-C6 alkyl, and R 1G does not exist, Y 7G is N and R 7A is absent or is C1-C6 alkyl, or Y 7G is C and R 7G is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8G is N and R 8G does not exist or Y 8G is C and R 8G is H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl, and R a and R b are independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, but Y 7G is N and Y8G C, R 8G H, R 2G is NH2, R 6G The case where =O (unmodified guanosine) is excluded.
[0265] In certain embodiments, the modified thymine or uracil has the structure (III): [ka] wherein each X is independently O or S, and R 5U H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl or substituted C1-C 12 alkenyl and each X is O, R 5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).
[0266] In certain embodiments, the modified cytosine has the structure (IV): [ka] where X is O or S, and R 4C is N(R a )(R b ) and R 5C H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl or substituted C1-C 12 alkenyl, and R a and R b are independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that X is not O, R4C is NH2, R 5C However, H (unmodified cytosine) is excluded.
[0267] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza, and others. 8-substituted purines, 5-halo (especially 5-bromo), 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.
[0268] Publications that teach the preparation of certain of the above-described modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Rogers et al., US 5,134,066; Benner et al., US 5,432,272; Matteucci et al., US 5,502,177; Froehler et al., US 5,594,121; and Cook et al., US 5,681,941.
[0269] In certain embodiments, at least one nucleobase of the modified oligonucleotide is a modified nucleobase selected from a modified adenine (A) having a structure represented by Structure I, a modified guanine (G) having a structure represented by Structure II, a modified thymine (T) or modified uracil (U) having a structure represented by Structure III, and a modified cytosine (C) having a structure represented by Structure IV.
[0270] In certain embodiments, each nucleobase of a modified oligonucleotide is selected from the group consisting of unmodified A, unmodified G, unmodified C, unmodified T, unmodified U, and m C. 5-Methylcytosine is a modified nucleobase having structure IV, where X is selected from O, R 4C is NH2, R 5C is CH3.
[0271] In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified A, an unmodified G, an unmodified C, an unmodified T, an unmodified U, m C, or hypoxanthine. Hypoxanthine is a modified adenine, Y 7A is N and R 7A does not exist, and Y 8A is C, R 8A is H, R 2A is H, R 6A is oxo.
[0272] In certain embodiments, no modified nucleobases are present in a modified oligonucleotide, and each nucleobase of a modified oligonucleotide is selected from unmodified A, unmodified G, unmodified C, unmodified T, and unmodified U.
[0273] 3. Certain modified internucleoside linkages The natural internucleoside linkage in RNA and DNA is a 3'-5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked to each other using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also called unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphodiesters containing phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Compared to natural phosphodiester internucleoside linkages, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.
[0274] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778. In certain embodiments, the modified internucleoside linkage comprises the formula: [ka] wherein, independently, for each such internucleoside linkage group of the modified oligonucleotide: X is O or S; R1 is H, C1-C6 alkyl, or substituted C1-C6 alkyl, and T is SO2R2, C(=O)R3 and P(=O)R4R5, where: R2 is aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, or a conjugate group; R3 is aryl, substituted aryl, CH3, N(CH3)2, OCH3, or a conjugate group; R4 is OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, or a conjugate group; and R5 is OCH3, OH, C1-C6 alkyl, or substituted C1-C6 alkyl.
[0275] In certain embodiments, the modified internucleoside linkage comprises a mesylphosphoramidate linking group having the formula: [ka]
[0276] The mesyl phosphoramidate internucleoside linkage contains a chiral center. In certain embodiments, modified oligonucleotides contain (Rp) and / or (Sp) mesyl phosphoramidate, each represented by the following formula, where "B" represents a nucleobase: [ka]
[0277] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a population of modified oligonucleotides containing stereorandom internucleoside linkages or as a population of modified oligonucleotides containing such internucleoside linkages of a specific stereochemical configuration. In certain embodiments, a population of modified oligonucleotides contains phosphorothioate internucleoside linkages, where all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, a population of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, where all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using synthetic methods that randomly select the stereochemical configuration of each internucleoside linkage having a chiral center. Nevertheless, each individual internucleoside linkage having a chiral center in each individual oligonucleotide molecule has a defined stereochemistry. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate and / or mesyl phosphoramidate internucleoside linkages, each in a specific, independently selected stereochemical configuration. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 90% of the molecules in the population.In certain embodiments, a particular arrangement of phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al., Nuc. Acid. Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. In certain embodiments, modified oligonucleotides comprising (Rp) and / or (Sp) phosphorothioates each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka] Unless otherwise specified, the internucleoside linkages containing chiral centers of the modified oligonucleotides described herein may be stereorandom or may be of a specific stereochemical configuration.
[0278] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Neutral internucleoside linkages further include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., "Carbohydrate Modifications in Antisense Research"; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Neutral internucleoside linkages further include nonionic linkages containing mixed N, O, S, and CH moieties.
[0279] In certain embodiments, modified oligonucleotides comprise one or more inverted nucleosides, as shown below: [ka] In the formula, each Bx independently represents any nucleobase.
[0280] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), so that only one internucleoside linkage is present. In certain embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.
[0281] In certain embodiments, the nucleic acids can be linked in a 2' to 5' manner rather than the standard 3' to 5' manner. Such linkages are shown below: [ka] In the formula, each Bx represents any nucleic acid base.
[0282] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified sugar moieties, unmodified sugar moieties, and differentially modified nucleobases and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to the nucleobases independently of the sequence of the nucleobases).
[0283] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.
[0284] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.
[0285] In certain embodiments, the deoxy region is adjacent on the 5'-side to a 5'-region consisting of linked 5'-region nucleosides and adjacent on the 3'-side to a 3'-region consisting of linked 3'-region nucleosides, the 3'-most nucleoside of the 5'-region being a modified nucleoside, and the 5'-most nucleoside of the 3'-region being a modified nucleoside. At least one nucleoside in the 5'-region comprises a modified sugar moiety, and at least one nucleoside in the 3'-region comprises a modified sugar moiety. The three regions (5'-region, deoxy region, and 3'-region) form a continuous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3'-most nucleoside in the 5'-region and the sugar moiety of the 5'-most nucleoside in the 3'-region are different from the sugar moieties of adjacent nucleosides in the deoxy region, thus defining the boundaries between the 5'-region, the deoxy region, and the 3'-region. In certain embodiments, each nucleoside in the 5'-region and each nucleoside in the 3'-region comprises a modified sugar moiety. In certain embodiments, the nucleosides in the 5'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5'-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3'-region comprise two or more different sugar modifications.
[0286] In certain embodiments, the 5'-region and 3'-region of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5'-region comprises 1 to 7 nucleosides. In certain embodiments, the 5'-region comprises 1 to 6 nucleosides. In certain embodiments, the 5'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3'-region comprises 1 to 7 nucleosides. In certain embodiments, the 3'-region comprises 1 to 6 nucleosides. In certain embodiments, the 3'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.
[0287] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif defined by two outer regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a continuous sequence of nucleosides, with at least some of the sugar moieties of the nucleosides in each wing being different from at least some of the sugar moieties of the nucleosides in the gap. In particular, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides within the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).
[0288] In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety.
[0289] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.
[0290] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a modified sugar moiety. In certain embodiments, one nucleoside of the gap comprises a modified sugar moiety, and each remaining nucleoside of the gap comprises a 2'-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gap of a gapmer comprises a 2'-MOE sugar moiety.
[0291] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be represented using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and 10 linked nucleosides in the gap. When a specific modification is followed by this nomenclature, the modification is in the sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. A 5-8-5 gapmer consists of 5 linked nucleosides containing a modified sugar moiety in the 5'-wing, 8 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked nucleosides containing a modified sugar moiety in the 3'-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings.
[0292] In certain embodiments, the modified oligonucleotides disclosed herein are modified with specific sugar modifications. In certain embodiments, the modified oligonucleotides are 5-10-5 MOE gapmers.
[0293] In certain embodiments, the modified oligonucleotides disclosed herein are modified with two or more sugar modifications. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside in the gap comprises a sugar moiety selected from a 2'-β-D-deoxyxylosyl sugar moiety, a 2'-α-L-deoxyribosyl sugar moiety, and a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-MOE sugar moiety, and each nucleoside in the gap comprises a 2'-β-D-deoxyribosyl sugar moiety.
[0294] In certain embodiments, modified oligonucleotides have a sugar motif selected from 5' to 3': eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety.
[0295] In certain embodiments, each nucleobase of a modified oligonucleotide disclosed herein is selected from the group consisting of A, G, C, T, U, and m C is selected.
[0296] In certain embodiments, each nucleobase of a modified oligonucleotide disclosed herein is selected from the group consisting of A, G, T, and m C (i.e., unmodified purines and 5-methylpyrimidines).
[0297] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, at least one nucleobase is modified. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified nucleobases. In certain embodiments, each nucleobase is independently selected from 5-methylcytosine, unmodified cytosine, unmodified thymine, unmodified uracil, unmodified adenine, unmodified guanine, and unmodified hypoxanthine.
[0298] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.
[0299] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.
[0300] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, at least one internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, at least one internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, at least one internucleoside linkage group of a modified oligonucleotide is a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage, a phosphodiester internucleoside linkage, and a mesyl phosphoramidate internucleoside linkage. In certain embodiments, each internucleoside bond of the modified oligonucleotide is independently selected from a phosphorothioate internucleoside bond and a mesyl phosphoramidate internucleoside bond. In certain embodiments, each phosphorothioate internucleoside bond is independently selected from a stereorandom random phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate. In certain embodiments, each mesyl phosphoramidate internucleoside bond is independently selected from a stereorandom mesyl phosphoramidate, (Sp) mesyl phosphoramidate, and (Rp) mesyl phosphoramidate.
[0301] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain such embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified, with at least 1, at least 2, at least 3, or at least 4 internucleoside linkages within the gap being mesyl phosphoramidate linkages and the remaining internucleoside linkages being phosphorothioate internucleoside linkages. In certain such embodiments, 1, 2, 3, 4, or 1 to 4 internucleoside linkages within the gap are mesyl phosphoramidate linkages. In certain such embodiments, some or all of the wing internucleoside linkages are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkages are modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage being non-terminal, and the remaining internucleoside linkages being phosphorothioate internucleoside linkages and mesyl phosphoramidate linkages. In certain such embodiments, the phosphorothioate internucleoside linkages and mesyl phosphoramidate internucleoside linkages are all stereorandom. In certain embodiments, the phosphorothioate internucleoside linkages and mesyl phosphoramidate internucleoside linkages in the wings are all (Sp) phosphorothioate, and the gap comprises at least one Sp,Sp,Rp motif. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides comprising such internucleoside linkage motifs.
[0302] In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssszzszsooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooossssszszssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosszsssszsssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soooszsssszzsssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosszzssszsssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssszzzszsooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosssszzzzssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sooosszssszzsssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of soooszssszzzsssooss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sssossssszzszsosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of ssoossssszszssosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of ssoosszssszsssosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.In certain embodiments, modified nucleotides have an internucleoside linkage motif of sssoszsssszzsssosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of ssoosssszzzszsosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sssssssszzzzzssssss, where each "s" represents a phosphorothioate internucleoside linkage and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sssoszssszzssssosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of sssoszssszzzssssssss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified nucleotides have an internucleoside linkage motif of ssssszssszzssssoss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage.
[0303] In certain embodiments, the modified oligonucleotide is: sooossssszzszsooss, soooosssssszszssooss, soooosszsssszssssooss, sooooszsssszzssssooss, soooosszzssszsssooss, soooosssssszzzzsssooss, soooosssssszzzzssooss, soooosszsssszzssooss, soooosszssszzzzssooss, sooooszssszzzssssooss, sssosssssszzszsosss, ssoossssssszszsosss, ssoosssssszszsosss, ssoosssssszs and sssssssss, sssoszssssszzssssosss, ssoossssszzzszsosss, ssssssssszzzzzssss, sssoszsssszzzzzssss, sssoszssszzzzsssss, sssoszssszzzzsssss, sssoszssszzzsssssss, and ssssszssszzzssssss, wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, a modified oligonucleotide comprises an internucleoside linkage motif (5' to 3') selected from sssssszzssss, ssoosssszzzszsosss, ssssssssszzzzzsssss, sssssssszzzzsssss, sssssssszzzzsssss, and ssssszssszzzsssssss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesyl phosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides comprise an internucleoside linkage motif (5' to 3') of sssoszsssszzsssosss, where each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesylphosphoramidate internucleoside linkage.
[0304] C. A certain length The length of oligonucleotides can be increased or decreased without compromising activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce target RNA cleavage in an oocyte injection model. Oligonucleotides 25 nucleobases long with 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides containing 1 or 3 mismatches.
[0305] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have a range of lengths. In certain embodiments, oligonucleotides consist of X and Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19 9, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17 ~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26,19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, It consists of 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.
[0306] In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.
[0307] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, these parameters are independent of each other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.
[0308] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom within the stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom among the modified oligonucleotides in the population. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for β-D ribosyl sugar moieties, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage and / or mesyl phosphoramidate internucleoside linkage in a specific stereochemical configuration.
[0309] F. Nucleic Acid Sequence In certain embodiments, the oligonucleotide (unmodified or modified oligonucleotide) is further described by its nucleobase sequence. In certain embodiments, the oligonucleotide (or a portion thereof) has a nucleobase sequence that is complementary to a specified reference nucleic acid (or a portion thereof), such as a second oligonucleotide or target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to a second oligonucleotide or nucleic acid (or a portion thereof), such as a target nucleic acid.
[0310] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide and, optionally, one or more conjugate groups and / or terminal groups. A conjugate group comprises one or more conjugate moieties and a conjugate linker connecting the conjugate moieties to the oligonucleotide. A conjugate group can be attached to one or both termini of an oligonucleotide and / or any internal position. In certain embodiments, a conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, a conjugate group is attached to one or both termini of an oligonucleotide (such conjugate groups are also terminal groups). In certain embodiments, a conjugate group or terminal group is attached to the 3'-terminus and / or 5'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 3'-terminus of an oligonucleotide. In certain embodiments, a conjugate group is attached near the 3'-terminus of an oligonucleotide. In certain such embodiments, a conjugate group (or terminal group) is attached to the 5'-terminus of an oligonucleotide.
[0311] Examples of terminal groups include, but are not limited to, a conjugate group, a capping group, a phosphate group, a protecting group, a modified or unmodified nucleoside, and two or more nucleosides that are independently modified or unmodified.
[0312] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups, which modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
[0313] In certain embodiments, one or more properties of a modified oligonucleotide can be altered by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier attached to a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a modified sugar moiety, a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.
[0314] In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide (e.g., a fluorophore or reporter group that allows for detection of the oligonucleotide). Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or the palmityl moiety of adamantaneacetic acid (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J.Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).
[0315] In certain embodiments, a conjugate group may comprise a conjugate moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
[0316] In certain embodiments, the conjugate group may comprise a conjugate group moiety selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds. In certain embodiments, the conjugate group is a lipid having the following structure: [ka]
[0317] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.
[0318] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.
[0319] In certain embodiments, the conjugate moiety is selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.
[0320] In certain embodiments, the conjugate moiety is selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, and C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.
[0321] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In some oligomer compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In some oligomer compounds, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.
[0322] In certain embodiments, the conjugate linker comprises pyrrolidine.
[0323] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.
[0324] In certain embodiments, the conjugate linker (including the conjugate linkers described above) is a bifunctional linking moiety, known in the art to be useful for attaching a conjugate group to a compound, such as the oligonucleotides provided herein. Typically, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
[0325] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10 Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.
[0326] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.
[0327] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker containing linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising nucleosides of the modified oligonucleotide and 1 to 10 consecutive linker nucleosides. The total number of consecutively linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutively linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.
[0328] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but after the oligomeric compound is taken up, it is desirable to cleave the conjugate group to release the unconjugated or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved within cells or intracellular compartments such as lysosomes.In certain embodiments, the cleavable moiety is selectively cleaved by endogenous enzymes such as nucleases.
[0329] In certain embodiments, the cleavable bond is selected from among an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, the cleavable bond is one or both esters of a phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.
[0330] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain embodiments, the cleavable moiety is 2'-deoxyadenosine.
[0331] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the conjugate group has the general formula: [ka] In the formula, n is 1 to about 3, when n is 1, m is 0, when n is 2 or more, m is 1, j is 1 or 0, and k is 1 or 0.
[0332] In certain embodiments, n is 1, j is 1, and k is 0. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 0, and k is 1. In certain embodiments, n is 1, j is 1, and k is 1. In certain embodiments, n is 2, j is 1, and k is 0. In certain embodiments, n is 2, j is 0, and k is 1. In certain embodiments, n is 2, j is 1, and k is 1. In certain embodiments, n is 3, j is 1, and k is 0. In certain embodiments, n is 3, j is 0, and k is 1. In certain embodiments, n is 3, j is 1, and k is 1.
[0333] In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO 2011 / 131693, WO 2014 / 064257.
[0334] In certain embodiments, the conjugate group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including but not limited to those described in WO 1991 / 004753, WO 2013 / 103800, WO 2014 / 144060, WO 2016 / 081643, WO 2016 / 179257, WO 2016 / 207240, WO 2017 / 221883, WO 2018 / 129384, WO 2018 / 124121, WO 2019 / 151539, WO 2020 / 132584, WO 2020 / 028864, US 7,208,174, US 9,034,329, and US 10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.
[0335] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2019 / 140050, WO 2020 / 037150, WO 2020 / 124032, and US 10,138,483.
[0336] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO 2013 / 163303, WO 2019 / 033051, and WO 2020 / 245198.
[0337] B. Certain end groups In certain embodiments, an oligomeric compound comprises one or more terminal groups. In certain such embodiments, an oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates (including, but not limited to, 5'-vinylphosphonates). In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises an inverted abasic sugar moiety. In certain embodiments, the inverted abasic sugar moiety can be further attached to a conjugate group. In certain embodiments, the terminal group comprises one or more 2'-linked nucleosides or sugar moieties. In certain embodiments, the 2'-linked group is an abasic sugar moiety. Such terminal abasic sugar moieties can be attached to either or both ends of the oligonucleotide.
[0338] III. Antisense Activity In certain embodiments, oligomeric compounds and oligomeric duplexes can hybridize to target nucleic acids and produce at least one antisense activity, and such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds have antisense activity when they reduce or inhibit the amount or activity of target nucleic acids by 25% or more in a standard in vivo assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds comprise a nucleobase sequence that hybridizes to one or more target nucleic acids to produce one or more desired antisense activities, and does not hybridize to one or more non-target nucleic acids, or does not produce significant undesired antisense activity even when hybridized to one or more non-target nucleic acids.
[0339] In certain antisense activities, hybridization of an antisense compound with a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that have sufficient "DNA-likeness" to induce RNase H activity. In certain embodiments, the gapmer gap can be tolerated by one or more non-DNA-like nucleosides.
[0340] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), and finally target nucleic acid is cut.For example, certain antisense compound causes target nucleic acid to be cut by Argonaute.The antisense compound that is loaded into RISC is RNAi compound.RNAi compound is double-stranded (siRNA or dsRNAi) or single-stranded (ssRNA).
[0341] In certain embodiments, the hybridization of an antisense compound with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid alters the splicing of the target nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid inhibits the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid alters the translation of the target nucleic acid.
[0342] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or animal.
[0343] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA comprising introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from a long non-coding RNA, a short non-coding RNA, or an intronic RNA molecule.
[0344] A. Complementarity / Mismatch and Double-Stranded Complementarity to Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the length of the fully complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleobases.
[0345] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was capable of reducing the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo. Maher and Dolnick (Nuc. Acid. Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 nucleobase and 42 nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, for their ability to inhibit translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, but to a lesser extent than the 28 or 42 nucleobase oligonucleotides.
[0346] In certain embodiments, oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, this mismatch reduces the antisense activity of target, but further reduces the activity of non-target.Therefore, in certain embodiments, the selectivity of oligonucleotide is improved.
[0347] In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3'-end of the gap region. In certain embodiments, the mismatch is located at position 1, 2, 3, or 4 from the 5'-end of the wing region. In certain embodiments, the mismatch is located at position 4, 3, 2, or 1 from the 3'-end of the wing region.
[0348] B.APP In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is APP. In certain embodiments, the APP nucleic acid has the sequence set forth in SEQ ID NO: 1 (cDNA of Ensembl transcript ENST00000346798.7, version 94: October 2018) or the complement of SEQ ID NO: 2 (GenBank Accession No. NC_000021.9 truncated from nucleotides 25878001 to 26174000). In certain embodiments, the APP nucleic acid is selected from the group consisting of SEQ ID NO: 3 (cDNA of Ensembl transcript ENST00000357903.7, version 94:October 2018), SEQ ID NO: 4 (cDNA of Ensembl transcript ENST00000348990.9, version 94:October 2018), SEQ ID NO: 5 (cDNA of Ensembl transcript ENST00000440126.7, version 94:October 2018), SEQ ID NO: The oligomeric compound has a sequence set forth in any of the known splice variants of APP, including, but not limited to, SEQ ID NO:6 (cDNA of Ensembl transcript ENST00000354192.7, version 94:October 2018), SEQ ID NO:7 (cDNA of Ensembl transcript ENST00000358918.7, version 94:October 2018), and / or SEQ ID NO:8 (GENBANK Accession No. NM_201414.2). In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 described herein reduces the amount of APP RNA, and in certain embodiments, reduces the amount of APP protein. In certain embodiments, the oligomeric compound consists of modified oligonucleotides. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, or SEQ ID NO:8 described herein reduces β-amyloid aggregation. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide. In certain embodiments, the oligomeric compound consists of a modified oligonucleotide and a conjugate group.
[0349] In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 described herein reduces the amount of APP RNA in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 described herein reduces the amount of APP protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, contacting a subject's cells with an oligomeric compound complementary to SEQ ID NO:1 or SEQ ID NO:2 described herein ameliorates one or more symptoms or characteristics of an APP-related disease or disorder. In certain embodiments, the APP-related disease or disorder is any of sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, and cerebral amyloid angiopathy. In certain embodiments, the symptom or characteristic is any of cognitive impairment, including decline in memory and language ability, behavioral and psychological symptoms, such as apathy and lack of motivation, gait disturbances, seizures, progressive dementia, and / or abnormal amyloid deposition.
[0350] In certain embodiments, oligomeric compounds described herein complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of APP RNA detected in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% in a standard in vivo assay. In certain embodiments, oligomeric compounds described herein complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of APP protein detected in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, oligomeric compounds described herein complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of APP RNA detected in a subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. In certain embodiments, an oligomeric compound complementary to SEQ ID NO: 1 or SEQ ID NO: 2 can reduce the amount of APP protein detected in a subject's CSF by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.
[0351] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, the target nucleic acid being expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant cell is an APP-expressing cell. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system. Such tissues include the cortex and hippocampus. Such cells include cortical brain cells and hippocampal cells. In certain embodiments, such cells include cells within the limbic system, e.g., cells within the hippocampus, amygdala, and / or parahippocampal gyrus.
[0352] V. Certain Methods and Uses Certain embodiments provided herein relate to methods for reducing or inhibiting the expression or activity of APP, which may be useful for treating, preventing, or ameliorating diseases or disorders associated with overexpression of APP in a subject by administering an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent, each of which comprises a modified oligonucleotide having a nucleobase sequence complementary to an APP nucleic acid. In certain embodiments, the APP-related disease or disorder is a neurodegenerative disease or disorder. In certain embodiments, the neurodegenerative disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.
[0353] In certain embodiments, the method comprises administering to a subject an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an APP nucleic acid. In certain embodiments, the subject has or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.
[0354] In certain embodiments, the method for treating APP-related neurodegenerative disease or disorder comprises administering to subject a therapeutically effective amount of oligomeric agent, oligomeric compound, oligomeric duplex or antisense agent, which has the nucleic acid base sequence complementary to APP nucleic acid, thereby treating subject.In certain embodiments, subject has or is at risk of developing APP-related neurodegenerative disease or disorder.In certain embodiments, disease or disorder is associated with the increase in APP level in subject.
[0355] In certain embodiments, the subject has or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy. In certain embodiments, at least one symptom or characteristic of an APP-related neurodegenerative disease or disorder is improved. Typical symptoms or characteristics include, but are not limited to, cognitive impairment, including memory and language impairment, behavioral and psychological symptoms, such as lethargy and lack of motivation, gait disturbances and seizures, progressive dementia, and abnormal amyloid deposition.
[0356] In certain embodiments, a method for reducing expression of an APP nucleic acid, e.g., RNA, or for reducing expression of an APP protein in a cell comprises administering to a subject an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an APP nucleic acid, thereby inhibiting expression of the APP nucleic acid in the subject. In certain embodiments, administration of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent inhibits expression of APP in the brain or spinal cord of the subject. In certain embodiments, the subject has a neurological disease or condition associated with APP. In certain embodiments, the subject has and / or is at risk of developing sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in individuals with Down's syndrome, or cerebral amyloid angiopathy.
[0357] In certain embodiments, a method for inhibiting the expression of an APP nucleic acid in a cell comprises contacting the cell with an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to the APP nucleic acid, thereby inhibiting the expression of the APP nucleic acid in the cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a cerebral cortex cell or a hippocampus cell. In certain embodiments, the cell is obtained from a subject who has, for example, an APP-related disease or disorder or is at risk of developing such a disease or disorder. In certain embodiments, the cell in the subject has an APP-related disease or condition, such as sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in patients with Down's syndrome, or cerebral amyloid angiopathy.
[0358] Certain embodiments relate to oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents having a nucleobase sequence complementary to an APP nucleic acid for use in treating a disease or disorder associated with elevated APP signaling or overexpression of APP. In certain embodiments, the disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome, or cerebral amyloid angiopathy. In certain embodiments, the oligomeric compounds, oligomeric duplexes, or antisense agents are used to ameliorate symptoms or characteristics of a disease or disorder associated with sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome, or cerebral amyloid angiopathy. In certain embodiments, the symptoms or characteristics are selected from cognitive impairment, including decline in memory and language skills; behavioral and psychological symptoms, such as apathy and lack of motivation; gait disturbances and seizures; progressive dementia; and abnormal amyloid deposition. In certain embodiments, an oligomeric agent, oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent is used to reduce APP expression in a subject.
[0359] Certain embodiments relate to oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents comprising modified oligonucleotides having a nucleobase sequence complementary to an APP nucleic acid for the manufacture or preparation of a medicament for treating a disease or disorder associated with APP. In certain embodiments, the disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is for the manufacture or preparation of a medicament for ameliorating a symptom or characteristic associated with APP. In certain embodiments, the symptom or characteristic is selected from seizures, cognitive impairment including decline in memory and language skills, behavioral and psychological symptoms such as apathy and lack of motivation, gait disturbances and seizures, progressive dementia, and abnormal amyloid deposition. In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is for the manufacture or preparation of a medicament for use in reducing APP expression in a subject.
[0360] In any of the methods or uses described herein, the oligomeric compound, oligomeric duplex, or antisense agent may be any of those described herein.
[0361] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents each comprise a modified oligonucleotide. In certain embodiments, one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents each consist of a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds, oligomeric duplexes, or antisense agents. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents and phosphate buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical grade PBS. In certain embodiments, a pharmaceutical composition comprises or consists of one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade artificial cerebrospinal fluid.
[0362] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists of an oligomeric compound and PBS. In certain embodiments, the pharmaceutical composition consists essentially of an oligomeric compound and PBS. In certain embodiments, the PBS is pharmaceutical grade. In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists of a modified oligonucleotide and PBS. In certain embodiments, the pharmaceutical composition consists essentially of a modified oligonucleotide and PBS. In certain embodiments, the PBS is pharmaceutical grade.
[0363] In certain embodiments, the pharmaceutical composition comprises an oligomeric compound and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists essentially of the oligomeric compound and aCSF. In certain embodiments, the aCSF is pharmaceutical grade. In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and aCSF. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and aCSF. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade. In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, disodium phosphate anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1 to 7.3, or about 7.2, with an appropriate pH adjuster, for example, an acid such as hydrochloric acid and an alkali such as sodium hydroxide.
[0364] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.
[0365] In certain embodiments, an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare a pharmaceutical composition or formulation. The formulation and method of pharmaceutical composition depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.
[0366] In certain embodiments, a pharmaceutical composition comprising an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent includes either a pharmaceutically acceptable salt of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent, an ester of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent, or a salt of such an ester. In certain embodiments, a pharmaceutical composition comprising an oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent comprising one or more modified oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure also relates to oligomeric agents, oligomeric compounds, oligomeric duplexes, or antisense agents, their prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium salts, and the like. In certain embodiments, the prodrug comprises one or more conjugate groups attached to the oligonucleotide, wherein the conjugate groups are cleaved by endogenous nucleases in the body.
[0367] In certain embodiments, the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric agent, oligomeric compound, oligomeric duplex, or antisense agent is mixed with aCSF. In certain embodiments, the sodium salt of the oligomeric compound, oligomeric duplex, or antisense agent is the sodium salt of a modified oligonucleotide.
[0368] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes are formed with monocationic or polycationic lipids in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.
[0369] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.
[0370] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents disclosed herein to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.
[0371] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Such a cosolvent system may include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a cosolvent system can be varied significantly without significantly altering the solubility or toxicity characteristics. Furthermore, the types of cosolvent components can be varied, for example, by substituting other surfactants for Polysorbate 80™, varying the proportion of polyethylene glycol, substituting other biocompatible polymers such as polyvinylpyrrolidone for polyethylene glycol, or substituting other sugars or polysaccharides for dextrose.
[0372] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that enhance solubility or act as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain injectable pharmaceutical compositions are provided in unit dosage form, e.g., in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents. Certain vehicles suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.
[0373] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in a protonated (free acid) form or in an ionized, cationic (salt) form; however, aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphate linkages of oligonucleotides in aqueous solution exist in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. Furthermore, certain oligonucleotides may have multiple such linkages, each in equilibrium. Thus, oligonucleotides in solution may exist in multiple locations as a collection of various forms, all in equilibrium. The term "oligonucleotide" is intended to encompass all such forms. Drawn structures necessarily represent a single form. However, unless otherwise specified, such drawings are intended to include corresponding forms as well. Herein, when a structure depicting the free acid of a compound is followed by the term "or salts thereof," all possible forms, whether fully or partially protonated, deprotonated, or associated with a cation, are expressly included. In some cases, one or more specific cations are identified.
[0374] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.
[0375] Certain specific dosage amounts are described herein. Dosage amounts can be in the form of dosage units. For clarity, the milligram dosage (or dosage unit) of a modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anion and salt form. However, for the purpose of calculating dosage amounts, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid.
[0376] For example, if a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions. However, while the mass of the protons counts toward the dose weight, the mass of the sodium ions does not. Thus, for example, a 10 mg dose or dosage unit is the number of fully protonated molecules weighing 10 mg. This corresponds to 10.57 mg of solvent-free, sodium acetate-free, anhydrous sodium-substituted Compound No. 1620705. If the oligomeric compound contains a conjugate group, the mass of the conjugate group is included in the calculation of the dose of such oligomeric compound. If the conjugate group also contains an acid, it is assumed that the conjugate group is also fully protonated for the purposes of calculating the dose.
[0377] In certain embodiments, when a modified oligonucleotide or oligomeric compound is present in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium, but the mass of the protons is counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.
[0378] In certain embodiments, when an oligomeric compound includes a conjugate group, the mass of the conjugate group may be included in calculating the dosage of such an oligomeric compound. If the conjugate group also contains an acid, it is assumed that the conjugate group is also fully protonated for the purposes of calculating the dosage.
[0379] VII. Certain Comparative Compositions Compound 1353884 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1353884 consists of the sequence (5' to 3'): GTTTACCTTTAACATTCCTC and is designated herein as SEQ ID NO: 15. The sugar motif of compound number 1353884 is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a ribo-2'-MOE sugar moiety. The internucleoside linkage motif of compound number 1353884 is (5' to 3'): sooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 1353884 is a 5-methylcytosine.
[0380] Compound 1398227 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1398227 consists of the sequence (5' to 3'): CTCCAATTTTAACTTGCACC and is designated herein as SEQ ID NO: 18. The sugar motif of compound number 1398227 is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a ribo-2'-MOE sugar moiety. The internucleoside linkage motif of compound number 1398227 is (5' to 3'): soooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 1398227 is a 5-methylcytosine.
[0381] In certain embodiments, the compounds described herein are superior to the compounds described in WO 2022 / 026589 because they exhibit one or more improved properties, such as duration of action and potency.
[0382] For example, compound No. 1620705 demonstrated a longer duration of action in vivo compared to compound Nos. 1353884 and 1398227 in the assays described in Example 7. Specifically, at 112 days (16 weeks) post-administration, compound No. 1620705 achieved an 88% reduction in human APP RNA in the cortex, whereas compound No. 1353884 achieved a 54% reduction in human APP RNA in the cortex, and compound No. 1393227 achieved a 32% reduction in human APP RNA in the cortex. Furthermore, at 140 days (20 weeks) post-administration, compound No. 1620705 achieved a 60% reduction in human APP RNA in the cortex, whereas compound No. 1353884 achieved a 43% reduction in human APP RNA in the cortex, and compound No. 1393227 achieved a 37% reduction in human APP RNA in the cortex. Thus, compound no. 1620705 exhibited a longer duration of action compared to compound nos. 1353884 and 1393227.
[0383] Furthermore, compound No. 1620705 exhibited higher in vivo efficacy compared to compound Nos. 1353884 and 1398227 in the assays shown in Example 4. In particular, in transgenic mice expressing the full-length human APP gene (APP YAC transgenic mice), the half-maximal effective dose (ED ) of compound No. 1620705 was measured in the spinal cord, cortex, and hippocampus of the APP YAC transgenic mice 4 weeks after administration. 50 ) are 48 μg, 57 μg, and 62 μg, respectively. In comparison, the ED of compound 1353884 measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice at 4 weeks post-administration was 1.2 μg. 50 The EDs of compound 1398227 measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice 4 weeks after administration were 95 μg, 116 μg, and 76 μg, respectively. 50 Furthermore, as shown in Examples 5 and 6, the EDs of Compound No. 1620705 measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice 12 weeks after administration were 72 μg, 190 μg, and 120 μg, respectively. 50 The EDs of compound no. 1398227 measured in the spinal cord, cortex, and hippocampus of APP YAC transgenic mice at 12 weeks post-administration were 89 μg, 57 μg, and 71 μg, respectively. 50 are 157 μg, 206 μg, and 210 μg, respectively. Thus, in these assays, compound no. 1620705 demonstrated improved potency compared to compound nos. 1353884 and 1393227.
[0384] Non-Limiting Disclosure and Incorporation by Reference Each of the references and patent publications mentioned herein is incorporated by reference in its entirety.
[0385] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are intended only to illustrate the compounds described herein and are not intended to limit the compounds. Each reference, GenBank accession number, ENSEMBL identifier, etc., mentioned in this application is incorporated herein by reference in its entirety.
[0386] Although the sequence listing accompanying this application identifies each nucleic acid sequence as "RNA" or "DNA" as appropriate, those of skill in the art will readily understand that the designation "RNA" or "DNA" to describe modified oligonucleotides is, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside having a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH instead of a single 2'-H in DNA) or as an RNA with a modified base (thymine (5-methyluracil) instead of uracil in RNA), and certain nucleic acid compounds described herein contain one or more nucleosides containing a modified sugar moiety having 2'-substituent(s) that are neither OH nor H. Those of skill in the art will readily understand that labeling such nucleic acid compounds as "RNA" or "DNA" does not alter or limit the description of such nucleic acid compounds.
[0387] Herein, when a compound is described as "having the nucleobase sequence of a SEQ ID NO," only the nucleobase sequence is described. Thus, unless otherwise specified, the description of a compound referring to the nucleobase sequence of a SEQ ID NO does not limit the presence or absence of additional substituents such as sugar or internucleoside linkage modifications or conjugate groups. Furthermore, unless otherwise specified, the nucleobase of a compound "having the nucleobase sequence" of a SEQ ID NO includes compounds having modified forms of the specific nucleobases described herein.
[0388] As used herein, when a compound is described by chemical notation (subscripts and / or superscripts indicating chemical modifications) without reference to a specific compound number, it includes only each modification described, but may include additional substituents such as conjugate groups unless otherwise specified. For example, "A es T ko m C ez G ds C d " indicates a nucleotide sequence in which a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked via a phosphorothioate bond to a second nucleoside, which second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked via a phosphodiester bond to a third nucleoside, which third nucleoside comprises a 2'-MOE sugar moiety and a mesylphosphoramidate linkage (denoted by the subscript "o"). and a 5-methyl-modified cytosine nucleobase (denoted by the superscript "m") linked via a phosphorothioate linkage to a fourth nucleoside (denoted by the letter "z"), the fourth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety (denoted by the subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate linkage, and the fifth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and which compounds may include additional substituents such as conjugate groups.
[0389] As used herein, when a particular compound (e.g., see Compound Number) is described by chemical notation (as in the Examples), each nucleobase, sugar, and internucleoside linkage of such particular compound is modified only as shown. Thus, in the context of describing a particular compound having a particular Compound Number, "A es T ko m C ez G ds C d" refers to a chemical notation in which a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked via a phosphorothioate bond to a second nucleoside, which second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked via a phosphodiester bond to a third nucleoside, which third nucleoside comprises a 2'-MOE sugar moiety and a mesylphosphoramidate bond. and a 5-methyl-modified cytosine nucleobase (denoted by superscript "m") linked to a fourth nucleoside via a phosphorothioate bond (denoted by subscript "z"), wherein the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (denoted by subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate bond, and wherein the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and wherein the compound does not include any additional substituents.
[0390] As used herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within the nucleotide or nucleobase sequence (e.g., in superscript or subscript, as described above) or may be indicated in text accompanying the sequence (e.g., in separate text displayed above or below in a table of compounds).
[0391] Where a particular compound is described herein by a depicted chemical structure, each nucleobase, sugar, and internucleoside linkage of such particular compound contains only the modifications shown in the depicted chemical structure. However, one of ordinary skill in the art will understand that the depicted compound may exist in equilibrium between tautomers and / or as a salt in equilibrium with a protonated or ionic form. The depicted structure is intended to capture all forms of such compounds.
[0392] While every effort has been made to accurately describe the compounds in the attached Sequence Listing, in the event of any discrepancy between the description in this specification and the description in the attached Sequence Listing, the description in this specification, and not the Sequence Listing, shall prevail.
[0393] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds containing hydrogen atoms as described herein include 1 Isotopic substitutions encompassed in the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution can confer new properties to oligomeric compounds, making them useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make compounds suitable for research or diagnostic purposes, such as imaging. [Example]
[0394] The following examples show certain specific embodiments of the present disclosure, but are not limited thereto. Furthermore, when specific embodiments are provided, the inventors consider the general applicability of these specific embodiments. For example, the disclosure of an oligonucleotide having a specific motif provides reasonable support for additional oligonucleotides having the same or similar motif. And, for example, when a specific high-affinity modification appears at a specific position, other high-affinity modifications at the same position are also considered suitable, unless otherwise specified.
[0395] Example 1: Design of modified oligonucleotides complementary to human APP RNA Modified oligonucleotides complementary to human APP RNA were designed as shown in the table below.
[0396] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 2 (complement of GENBANK Accession No. NC_000021.9, truncated from nucleoside 25878001 to 26174000).
[0397] The modified oligonucleotides in the table below are 5-10-5 MOE gapmers with mixed internucleoside linkage motifs. The modified oligonucleotides in the table below are 20 nucleosides in length, and the sugar motif of the modified oligonucleotides is (5' to 3'): eeeeeddddddddddeeeee, where each "e" represents a ribo-2'-MOE sugar moiety and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif of the modified oligonucleotides is shown in the "Internucleoside Linkage (5' to 3')" column of the table below, where each "s" represents a phosphorothioate internucleoside linkage, each "z" represents a mesylphosphoramidate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine. [Table 1-1] [Table 1-2]
[0398] Example 2: Duration of Action Study of Modified Oligonucleotides Complementary to Human APP in APP YAC Transgenic Mice, Single Dose The modified oligonucleotides were tested in APP YAC transgenic mice expressing the full-length human APP gene (Lamb BT et al., PubMed: 8220418, B6.129S2-Tg(APP)8.9Btla / J, strain 005301 from the Jackson Laboratory). APP YAC mice were generated using a 650 kb YAC transgene containing the entire human amyloid beta (A4) precursor protein (APP) gene, with approximately 250 kb of flanking sequences modified to contain the Swiss mutations APPK670N / M671L associated with familial Alzheimer's disease. This transgene was injected into R1 embryonic stem (ES) cells derived from a (129X1 / SvJ x 129S1 / Sv)F1 cross. Founder animals (strain R1.40) were crossed to C57BL / 6J for 21 generations.
[0399] APP YAC transgenic mice were divided into groups of three, or as otherwise specified in the "Number of Animals" column of the table below. Each mouse received a single ICV bolus of 300 μg of modified oligonucleotide. Groups of 3-4 mice received a single ICV bolus of PBS as a negative control.
[0400] Mice were sacrificed at various time points, as shown in the table below. RNA was extracted from cortical brain tissue, spinal cord, and hippocampus, and the amount of APP RNA was measured by RT-PCR analysis using human primer probe set RTS35571 (forward sequence: CCCACTTTGTGATTCCCTACC (designated herein as SEQ ID NO: 9), reverse sequence: ATCCATCCTCTCCTGGTGTAA (designated herein as SEQ ID NO: 10), probe sequence: TGATGCCTTCTCGTTCCTGACAA (designated herein as SEQ ID NO: 11)). Results are presented as the percent of human APP RNA relative to the amount of APP in PBS-treated control animals and are normalized to mouse PPIA (% control). Mouse PPIA was amplified using primer probe set m_cyclo24 (forward sequence: TCGCCTTGCTGCA (designated herein as SEQ ID NO: 12), reverse sequence: ATCGGCGTGATGTCGA (designated herein as SEQ ID NO: 13), probe sequence: CCATGGTCAACCCCACCGTGTTC (designated herein as SEQ ID NO: 14)). [Table 2] [Table 3] [Table 4]
[0401] Example 3: Activity of modified oligonucleotides complementary to human APP in APP YAC transgenic mice The APP YAC transgenic mouse model (described above) was used to test the activity of the modified oligonucleotides.
[0402] APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 300 μg of modified oligonucleotide. A group of four mice received a single ICV bolus of PBS as a negative control.
[0403] After 20 weeks of treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, and hippocampus. APP RNA levels were measured by RT-PCR analysis using the human primer probe set RTS35571 (described above). Results are shown as the percentage of human APP RNA relative to the amount of APP in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using the primer probe set m_cyclo24 (described above). [Table 5]
[0404] Example 4: Efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 4 weeks The modified oligonucleotides were tested in the APP YAC transgenic mouse model described herein above.
[0405] process APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of modified oligonucleotide at the dose shown in the table below. A group of four mice received a single ICV bolus with PBS as a negative control.
[0406] RNA analysis After 4 weeks of treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, and hippocampus. APP RNA levels were measured by RT-PCR analysis using the human primer probe set RTS35571 (described above). Results are shown as the percentage of human APP RNA relative to the amount of APP in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using the primer probe set m_cyclo24 (described above).
[0407] The half-maximal effective dose (ED) of each modified oligonucleotide 50) were calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). NC indicates not calculated values.
[0408] Compound 1353884 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1353884 consists of the sequence (5' to 3'): GTTTACCTTTAACATTCCTC and is designated herein as SEQ ID NO: 15. The sugar motif of compound number 1353884 is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a ribo-2'-MOE sugar moiety. The internucleoside linkage motif of compound number 1353884 is (5' to 3'): sooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 1353884 is a 5-methylcytosine.
[0409] Compound 1398227 is a comparative compound and was previously described in WO 2022 / 026589. Compound 1398227 consists of the sequence (5' to 3'): CTCCAATTTTAACTTGCACC and is designated herein as SEQ ID NO: 18. The sugar motif of compound number 1398227 is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a ribo-2'-MOE sugar moiety. The internucleoside linkage motif of compound number 1398227 is (5' to 3'): sooosssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 1398227 is a 5-methylcytosine. [Table 6] [Table 7]
[0410] Example 5: Efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 12 weeks The modified oligonucleotides were tested in the APP YAC transgenic mouse model described herein above.
[0411] process APP YAC transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of modified oligonucleotide at the dose shown in the table below. A group of four mice received a single ICV bolus with PBS as a negative control.
[0412] RNA analysis After 12 weeks of treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, and hippocampus. APP RNA levels were measured by RT-PCR analysis using the human primer probe set RTS35571 (described above). Results are shown as the percentage of human APP RNA relative to the amount of APP in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using the primer probe set m_cyclo24 (described above).
[0413] The half-maximal effective dose (ED) of each modified oligonucleotide 50 ) was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). [Table 8]
[0414] Example 6: Efficacy of modified oligonucleotides complementary to human APP in APP YAC transgenic mice, 12 weeks The modified oligonucleotides were tested in the APP YAC transgenic mouse model described herein above.
[0415] process APP YAC transgenic mice were divided into groups of 3-4 mice each. Each mouse received a single ICV bolus of modified oligonucleotide at the dose shown in the table below. A group of 4 mice received a single ICV bolus with PBS as a negative control.
[0416] RNA analysis After 12 weeks of treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue, spinal cord, and striatum. APP RNA levels were measured by RT-PCR analysis using the human primer probe set RTS35571 (described above). Results are shown as the percentage of human APP RNA relative to the amount of APP RNA in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using the primer probe set m_cyclo24 (described above).
[0417] The half-maximal effective dose (ED) of each modified oligonucleotide 50 ) was calculated using GraphPad Prism 10 software (GraphPad Software, San Diego, CA). [Table 9]
[0418] Example 7: Duration of Action Study of Modified Oligonucleotides Complementary to Human APP in APP YAC Transgenic Mice, Single Dose The modified oligonucleotides were tested in APP YAC transgenic mice. The mice were divided into groups of 3-6 mice. Each mouse received a single ICV bolus of 300 μg of the modified oligonucleotide. Groups of 3-4 mice received a single ICV bolus with PBS as a negative control.
[0419] Mice were sacrificed at various time points, as shown in the table below, and RNA was extracted from cortical brain tissue and the amount of APP RNA was measured by RT-PCR analysis using human primer probe set RTS35571 (described above). Results from several different experiments were combined and presented in the table below as the percentage of human APP RNA relative to the amount of APP in PBS-treated control animals, normalized to mouse PPIA (% control). Mouse PPIA was amplified using primer probe set m_cyclo24 (described above). [Table 10]
Claims
1. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 8 to 80 linked nucleosides and having a nucleobase sequence comprising at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or 20 consecutive nucleobases of the nucleobase sequence of any of SEQ ID NOs: 15-18, wherein at least one internucleoside linkage of the modified oligonucleotide is a mesylphosphoramidate internucleoside linkage.
2. 2. The oligomeric compound of claim 1, wherein the modified oligonucleotide has a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 15-18.
3. 3. The oligomeric compound of claim 1, wherein the modified oligonucleotide consists of 20 to 80 linked nucleosides and has a nucleobase sequence comprising the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO:
18.
4. 4. The oligomeric compound of any one of claims 1 to 3, wherein the modified oligonucleotide has a nucleobase sequence consisting of the nucleobase sequence of SEQ ID NO: 15 or SEQ ID NO:
18.
5. 5. The oligomeric compound of any one of claims 1 to 4, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an APP nucleic acid, wherein the APP nucleic acid has the nucleobase sequence of SEQ ID NO: 1 or SEQ ID NO:
2.
6. The modified oligonucleotides may be 10-25, 10-30, 10-50, 12-20, 12-25, 12-30, 12-50, 13-20, 13-25, 13-30, 13-50, 14-20, 14-25, 14-30, 14-50, 15-20, 15-25, 15-30, 15-50, 16-18, 16-20, 16-25, 16-30, 16-50, 17-20, 17-25, 17-30, 6. The oligomeric compound of any one of claims 1-5, consisting of 17-50, 18-20, 18-22, 18-25, 18-30, 18-50, 19-20, 19-25, 19-30, 19-50, 20-25, 20-30, 20-50, 21-25, 21-30, 21-50, 22-25, 22-30, 22-50, 23-25, 23-30, or 23-50 linked nucleosides.
7. The oligomeric compound of any one of claims 1 to 6, wherein the modified oligonucleotide consists of 20 linked nucleosides.
8. The oligomeric compound of any one of claims 1 to 7, wherein at least one nucleoside of said modified oligonucleotide is a modified nucleoside.
9. 9. The oligomeric compound of claim 8, wherein the modified nucleoside comprises a modified sugar moiety.
10. 10. The oligomeric compound of claim 9, wherein the modified sugar moiety comprises a bicyclic sugar moiety.
11. The bicyclic sugar moiety is —O—CH 2 - and -O-CH(CH 3 11. The oligomeric compound of claim 10, comprising a 2'-4' bridge selected from:
12. 10. The oligomeric compound of claim 8 or 9, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.
13. 13. The oligomeric compound of claim 12, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.
14. 14. The oligomeric compound of claim 12 or claim 13, wherein the non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety.
15. 15. The oligomeric compound of any one of claims 1 to 14, wherein at least 2, at least 3, at least 4, at least 5, or at least 6 internucleoside linkages of said modified oligonucleotide are mesylphosphoramidate internucleoside linkages.
16. The oligomeric compound of any one of claims 1 to 15, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphorothioate internucleoside linkage.
17. 17. The oligomeric compound of claim 16, wherein at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, or at least 18 internucleoside linkages of said modified oligonucleotide are phosphorothioate internucleoside linkages.
18. 18. The oligomeric compound of any one of claims 1 to 17, wherein at least one internucleoside linkage of said modified oligonucleotide is a phosphodiester internucleoside linkage.
19. The modified oligonucleotide is: sooossssszzszsoooss, sooossssszszssoooss, sooosszsssszsssoooss, soooszsssszzsssoooss, sooosszzssszzsssoooss, sooosszzssszsssoooss, sooossssszzszs ooss, sooossssszzzzssooss, sooosszssszzssssooss, sooossssszzzzsssooss, sssosssssszzszsosss, ssosssssszszssosss, ssosszsssszsssosss, sssosz 19. The oligomeric compound of any one of claims 1 to 18, comprising an internucleoside linkage motif (5' to 3') selected from: sssszzsssss, ssoossssszzzsssss, ssssssszzzzzssss, sssoszssszzzzzsssss, sssoszsssszzzzzsssss, sssoszsssszzzzzssssss, and ssssszssszzzzzsssss, wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesylphosphoramidate internucleoside linkage.
20. The oligomeric compound of any one of claims 1 to 19, wherein the modified oligonucleotide comprises at least one modified nucleobase.
21. 21. The oligomeric compound of claim 20, wherein said modified nucleobase is 5-methylcytosine.
22. 22. The oligomeric compound of claim 21, wherein each cytosine is a 5-methylcytosine.
23. 23. The oligomeric compound of any one of claims 1 to 22, wherein one or more nucleosides of said modified oligonucleotide comprises an unmodified nucleobase.
24. The oligomeric compound of any one of claims 1 to 23, wherein the modified oligonucleotide comprises a deoxy region.
25. 25. The oligomeric compound of claim 24, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside.
26. 26. The oligomeric compound of claim 24 or claim 25, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.
27. 23. The oligomeric compound of any one of claims 19 to 22, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.
28. the deoxy region is adjacent on the 5'-side to a 5'-exoregion consisting of 1 to 6 linked 5'-exoregion nucleosides and adjacent on the 3'-side to a 3'-exoregion consisting of 1 to 6 linked 3'-exoregion nucleosides; the 3'-most nucleoside of the 5' exoregion comprises a modified sugar moiety; and 28. The oligomeric compound of any one of claims 24 to 27, wherein the 5'-most nucleoside of said 3' exoregion comprises a modified sugar moiety.
29. 29. The oligomeric compound of claim 28, wherein each nucleoside of said 3' exogenous region comprises a modified sugar moiety.
30. 30. The oligomeric compound of claim 28 or claim 29, wherein each nucleoside of said 5' exogenous region comprises a modified sugar moiety.
31. The modified oligonucleotide comprises: a 5' exoregion consisting of 5 linked nucleosides; a deoxy region consisting of 10 linked nucleosides, and a 3' exoregion consisting of 5 linked nucleosides; 31. The oligomeric compound of claim 30, wherein each of the 5' exoregion nucleosides and each of the 3' exoregion nucleosides is a 2'-MOE nucleoside.
32. 32. The oligomeric compound of any one of claims 24 to 31, wherein at least three internucleoside linkages of said deoxy region are mesylphosphoramidate internucleoside linkages.
33. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 19): 【Chemistry 1】 or a pharmaceutically acceptable salt thereof.
34. 34. The modified oligonucleotide of claim 33, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
35. 35. The modified oligonucleotide of claim 34, wherein the sodium salt or the potassium salt.
36. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 19): 【Chemistry 2】
37. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 20): 【Transformation 3】 or a pharmaceutically acceptable salt thereof.
38. 38. The modified oligonucleotide of claim 37, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
39. 39. The modified oligonucleotide of claim 38, wherein the sodium salt or the potassium salt.
40. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 20): 【Chemistry 4】
41. A modified oligonucleotide according to the following chemical structure (SEQ ID NO:21): 【Transformation 5】 or a pharmaceutically acceptable salt thereof.
42. 42. The modified oligonucleotide of claim 41, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
43. 43. The modified oligonucleotide of claim 42, wherein the modified oligonucleotide is the sodium salt or the potassium salt.
44. A modified oligonucleotide according to the following chemical structure (SEQ ID NO:21): 【Transformation 6】
45. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 22): 【Transformation 7】 or a pharmaceutically acceptable salt thereof.
46. 46. The modified oligonucleotide of claim 45, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
47. 47. The modified oligonucleotide of claim 46, wherein the sodium salt or the potassium salt.
48. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 22): 【Transformation 8】
49. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 23): 【Chemistry 9】 Or its salt.
50. 48. The modified oligonucleotide of claim 47, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
51. 49. The modified oligonucleotide of claim 48, wherein the sodium salt or the potassium salt.
52. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 23): 【Chemistry 10】
53. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 24): 【Chemistry 11】 or a pharmaceutically acceptable salt thereof.
54. 54. The modified oligonucleotide of claim 53, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.
55. 55. The modified oligonucleotide of claim 54, wherein the sodium salt or the potassium salt.
56. A modified oligonucleotide according to the following chemical structure (SEQ ID NO:24): 【Chemistry 12】
57. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T ds A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 19), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; The oligomeric compound optionally comprises a conjugate group or a terminal group.
58. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: G es T es T eo T eo A es m C ds m C ds T ds T ds T dz A dz A dz m C ds A dz T ds T eo m C es m C es T es m C e (SEQ ID NO: 20), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; The oligomeric compound optionally comprises a conjugate group or a terminal group.
59. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: G es T es T es T es A es m C ds m C ds T ds T ds T dz A dz A dz m C dz A dz T ds T es m C es m C es T es m C e (SEQ ID NO: 21), During the ceremony, A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; The oligomeric compound optionally comprises a conjugate group or a terminal group.
60. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 22), During the ceremony, A = adenine nucleobase; m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; The oligomeric compound optionally comprises a conjugate group or a terminal group.
61. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: m C es T es m C es m C eo A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G es m C es A es m C es m C e (SEQ ID NO: 23), During the ceremony, A = adenine nucleobase; m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; = An oligomeric compound, wherein said oligomeric compound optionally comprises a conjugate group or a terminal group.
62. 1. An oligomeric compound comprising a modified oligonucleotide according to the chemical notation: m C es T es m C es m C es A es A dz T ds T ds T ds T dz A dz A dz m C ds T ds T ds G eo m C es A es m C es m C e (SEQ ID NO: 24), During the ceremony, A = adenine nucleobase; m C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; o = phosphodiester internucleoside linkage; z = mesylphosphoramidate internucleoside linkage; The oligomeric compound optionally comprises a conjugate group or a terminal group.
63. 62. A population of oligomeric compounds according to any one of claims 1 to 32 or 57 to 62, or a population of modified oligonucleotides according to any one of claims 33 to 56, wherein each of the phosphorothioate internucleoside linkages of the modified oligonucleotides is stereorandom.
64. 64. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 1 to 32 or 57 to 62, or a modified oligonucleotide according to any one of claims 33 to 56, or a population according to claim 63, and a pharmaceutically acceptable diluent.
65. 65. The pharmaceutical composition of claim 64, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid, phosphate buffered saline, or water.
66. 66. The pharmaceutical composition of claim 64 or 65, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and artificial cerebrospinal fluid.
67. 67. The pharmaceutical composition of any one of claims 64 to 66, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide, the oligomeric compound, or the population and phosphate buffered saline.
68. 62. A method comprising administering to a subject an oligomeric compound according to any one of claims 1 to 32 or 56 to 62, a modified oligonucleotide according to any one of claims 33 to 56, a population according to claim 63, or a pharmaceutical composition according to any one of claims 64 to 67.
69. 69. The method of claim 68, wherein the subject has or is at risk of developing an APP-related disease or disorder.
70. The method of claim 68 or claim 69, wherein administering the oligomeric compound, the modified oligonucleotide, the population, or the pharmaceutical composition ameliorates at least one symptom or feature of an APP-related disease or disorder.
71. 71. The method of any one of claims 68-70, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or delays the progression of cognitive impairment, reduces or delays memory decline, reduces or delays decline in language ability, improves behavioral and psychological symptoms, reduces anorexia, improves motivation, reduces gait disturbances, reduces seizures, reduces or delays progressive dementia, and / or reduces abnormal amyloid deposition.
72. 72. The method of any one of claims 68 to 71, wherein the subject's APP protein levels are reduced.
73. 73. The method of any one of claims 69 to 72, wherein the APP-related disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.
74. 62. A method of treating a disease or disorder associated with APP, comprising administering to a subject having or at risk of developing an APP-related disease or disorder a therapeutically effective amount of the oligomeric compound of any one of claims 1-32 or 57-62, the modified oligonucleotide of any one of claims 33-56, the population of claim 63, or the pharmaceutical composition of any one of claims 64-67, thereby treating the disease or disorder associated with APP.
75. 75. The method of claim 74, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition ameliorates at least one symptom or feature of an APP-related disease or disorder.
76. The method of claim 73 or claim 75, wherein administering the modified oligonucleotide, the oligomeric compound, the population, or the pharmaceutical composition reduces or delays the progression of cognitive impairment, reduces or delays memory decline, reduces or delays decline in language ability, improves behavioral and psychological symptoms, reduces anorexia, improves motivation, reduces gait disturbance, reduces seizures, reduces or delays progressive dementia, and / or reduces abnormal amyloid deposition.
77. 77. The method of any one of claims 74 to 76, wherein the subject's APP protein levels are reduced.
78. 78. The method of any one of claims 74 to 77, wherein the APP-related disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.
79. 79. The method of any one of claims 74 to 78, wherein the subject is a human.
80. 62. A method of reducing expression of APP in a cell, said method comprising contacting said cell with an oligomeric compound of any one of claims 1-32 or 57-62, a modified oligonucleotide of any one of claims 33-56, a population of claim 63, or a pharmaceutical composition of any one of claims 64-67.
81. 81. The method of claim 80, wherein the cell is a cerebral cortex cell or a hippocampal cell.
82. 82. The method of claim 80 or claim 81, wherein the cell is a human cell.
83. 62. Use of an oligomeric compound according to any one of claims 1 to 32 or 57 to 62, a modified oligonucleotide according to any one of claims 33 to 56, a population according to claim 63, or a pharmaceutical composition according to any one of claims 64 to 67 for the treatment of a disease or disorder related to APP.
84. 62. Use of an oligomeric compound according to any one of claims 1 to 32 or 56 to 62, a modified oligonucleotide according to any one of claims 33 to 56, a population according to claim 63, or a pharmaceutical composition according to any one of claims 64 to 67 in the manufacture of a medicament for the treatment of a disease or disorder associated with APP.
85. 85. The use of claim 83 or 84, wherein the APP-related disease or disorder is associated with elevated APP levels.
86. The use according to any one of claims 83 to 85, wherein the APP-related disease or disorder is sporadic Alzheimer's disease, hereditary / familial Alzheimer's disease, Alzheimer's disease in Down's syndrome patients, or cerebral amyloid angiopathy.