RNAi agents that inhibit the expression of thymic stromal lymphopoietin (TSLP), compositions thereof, and methods of use
TSLP-specific RNAi agents with targeted delivery to lung cells offer a potent and efficient treatment for pulmonary inflammation by inhibiting TSLP gene expression, addressing the limitations of existing treatments and providing therapeutic benefits for asthma and allergic asthma.
Patent Information
- Application Number
- JP2025546882
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2024-01-26
- Filing Date
- 2024-02-14
- Publication Date
- 2026-02-20
AI Technical Summary
There is a need for novel RNA interference (RNAi) agents that can selectively and efficiently inhibit the expression of the Thymic Stromal Lymphopoietin (TSLP) gene to treat pulmonary inflammation-related diseases such as asthma and allergic asthma, as existing treatments like tezepelumab require frequent subcutaneous injections.
Development of TSLP-specific RNAi agents with specific nucleotide sequences and chemical modifications, combined with targeting ligands for selective delivery to lung cells, allowing inhalation administration and less frequent dosing.
The TSLP RNAi agents provide highly potent and efficient inhibition of TSLP gene expression, reducing airway inflammation and offering therapeutic benefits for various pulmonary conditions, including asthma and allergic asthma, with potential for quarterly administration.
Smart Images

Figure 2026506048000149 
Figure 2026506048000150 
Figure 2026506048000151
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority to U.S. Provisional Patent Application No. 63 / 485,081, filed February 15, 2023, U.S. Provisional Patent Application No. 63 / 516,300, filed July 28, 2023, and U.S. Provisional Patent Application No. 63 / 625,543, filed January 26, 2024, the contents of which are incorporated herein by reference in their entireties.
[0002] Sequence Listing This application contains a Sequence Listing (compliant with standard ST26) that has been submitted in xml format and is incorporated herein by reference in its entirety. The xml Sequence Listing file is named 30723-WO_SeqListing.xml, was created on February 7, 2024, and is 3252kb in size.
[0003] FIELD OF THE INVENTION The present disclosure relates to RNA interference (RNAi) agents, e.g., double-stranded oligonucleotide RNAi agents, compositions comprising TSLP RNAi agents, and methods of their use, for inhibiting expression of the Thymic Stromal Lymphopoietin ("TSLP") gene. [Background technology]
[0004] background Thymic stromal lymphopoietin (TSLP) is an epithelial cell-derived cytokine thought to be involved in the initiation and maintenance of inflammatory pathways in asthma (Parnes, et al. 2022). TSLP is a member of the four-helix bundle cytokine family and a distant paralog of interleukin (IL)-7. It is expressed by human epithelial cells in the thymus, lung, small intestine, skin, and interstitium, as well as in tonsils and mast cells (Hu, et al. 2017). TSLP acts on various cell types via a heterodimeric receptor consisting of the IL-7 receptor chain (IL-7Ra) and a specific subunit, the TSLP-specific receptor (TSLPR) (Pandey, et al. 2000).
[0005] Two variants of human TSLP (short and long forms) have been identified. Short-chain TSLP ("sfTSLP") (60 amino acids) is constitutively expressed and maintains homeostasis in the skin, intestinal tract, oral mucosal epithelium, and salivary glands, but is downregulated under inflammatory conditions. In contrast, long-chain TSLP ("lfTSLP") (159 amino acids) is inducible and can be significantly upregulated in inflammatory diseases such as atopic dermatitis (AD) and allergic asthma (AA) (Adhikary, et al. 2021, Pelaia, et al. 2021). sfTSLP does not bind to the TSLPR and cannot block lfTSLP binding to this receptor (Adhikary, Tan et al. 2021).
[0006] TSLP stimulates dendritic cells, directing naive Th cells toward the Th2 lineage, but can also promote Th17 differentiation (Gauvreau, Sehmi et al. 2020). Furthermore, TSLP activates ILC2s, mast cells, and basophils, induces eosinophil survival and transmigration, and influences the function of airway structural cells such as fibroblasts and airway smooth muscle cells (Gauvreau, Sehmi et al. 2020). In allergic asthma, TSLP activates dendritic cells to promote the differentiation of Th2 lymphocytes, which secrete IL-4, IL-5, IL-9, and IL-13, which target B cells, eosinophils, mast cells, and airway smooth muscle cells, respectively (Pelaia et al. 2021). Because TSLP is at the apex of the inflammatory cascade, it may exert broad effects on airway inflammation by affecting multiple cell types and pathways. Therefore, therapies that can target TSLP may represent a novel approach to treating inflammation in asthma.
[0007] Overexpression of TSLP has been detected on both the outer and inner surfaces of bronchial epithelial biopsies from asthmatic patients and asthmatic mice, as well as in serum, induced sputum, bronchoalveolar lavage fluid (BALF), and exhaled breath condensate (Al-Shami et al. 2005; Ying, et al. 2005; Zhou et al. 2005). Furthermore, airway expression levels of TSLP correlate with asthma severity and airflow (Ying, et al. 2008; Gauvreau, et al. 2020).
[0008] Genomic studies have shown that several single nucleotide polymorphisms (SNPs) in the TSLP gene are associated with the risk of developing asthma (Torgerson, et al. 2011).
[0009] Tezepelumab is a human anti-TSLP monoclonal antibody for the treatment of asthma. In the PATHWAY Phase 2b trial (NCT02054130) and the NAVIGATOR Phase 3 trial (NCT03347279), tezepelumab significantly reduced exacerbation rates compared with placebo in patients with severe, uncontrolled asthma (Corren, et al. 2017; Menzies-Gow, et al. 2021). The reported clinical benefits were associated with reductions in a wide range of cytokines (e.g., interleukin [IL]-5, IL-13) and baseline biomarkers (e.g., blood eosinophils, immunoglobulin [Ig]E, exhaled fractional nitric oxide [FeNO]) and were observed across a range of severe asthma phenotypes (including eosinophilic and non-eosinophilic) (Diver, et al. 2021; Puzzovio, et al. 2022). TSLP-neutralizing antibodies have also been reported to attenuate airway inflammation in various asthma models, including murine house dust mite (HDM), ovalbumin (OVA), and toluene diisocyanate (TDI)-induced models (Li, et al. 2010; Chen, et al. 2018; Yu, et al. 2019). However, tezepelumab must be administered by subcutaneous injection every 4 weeks. A sufficiently safe, potent, and active RNAi therapeutic targeting TSLP would provide an alternative treatment option for patients, and would be an improved and more desirable treatment option for patients, especially if the RNAi agent could be administered by inhalation and / or less frequently (e.g., quarterly or every two months).
[0010] overview There is a need for novel RNA interference (RNAi) agents (also referred to as RNAi agents, RNAi triggers, or triggers), e.g., double-stranded RNAi agents, that can selectively and efficiently inhibit expression of the TSLP gene, including for use as therapeutics or pharmaceuticals. Additionally, there is a need for novel TSLP-specific RNAi agent compositions for the treatment of diseases or disorders associated with pulmonary inflammation, such as asthma (including particularly allergic asthma), and / or disorders that may be mediated, at least in part, by decreased TSLP gene expression.
[0011] The nucleotide sequences and chemical modifications of the TSLP RNAi agents disclosed herein, and their combination with certain specific targeting ligands suitable for selectively and efficiently delivering the TSLP RNAi agents to relevant lung cells in vivo, are distinct from those previously disclosed or known in the art. The TSLP RNAi agents disclosed herein provide highly potent and efficient inhibition of TSLP gene expression.
[0012] In general, the disclosure features TSLP gene-specific RNAi agents, compositions comprising TSLP RNAi agents, and methods for inhibiting TSLP gene expression in vitro and / or in vivo using the TSLP RNAi agents and compositions comprising TSLP RNAi agents described herein. The TSLP RNAi agents described herein can selectively and efficiently reduce TSLP gene expression, thereby inhibiting translation of TSLP protein or cytokines that are involved in the initiation of the inflammatory cascade and reducing airway inflammation.
[0013] The described TSLP RNAi agents can be used in methods of therapeutic treatment (including preventative or prophylactic treatment) of the following conditions and diseases, including but not limited to asthma (including but not limited to allergic asthma), chronic obstructive pulmonary disease (including but not limited to chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including but not limited to systemic sclerosis (SSc)), and multiple inflammatory diseases (including but not limited to atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis).
[0014] In one aspect, the disclosure features an RNAi agent for inhibiting expression of the TSLP gene, the RNAi agent including a sense strand (also referred to as a passenger strand) and an antisense strand (also referred to as a guide strand). The sense and antisense strands can be partially, substantially, or fully complementary to each other. The sense strands of the RNAi agents described herein can each be 12 to 49 nucleotides in length. The antisense strands of the RNAi agents described herein can each be 18 to 30 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 18 to 26 nucleotides in length. The sense and antisense strands can be the same length or different lengths. In some embodiments, the sense and antisense strands are each independently 21 to 26 nucleotides in length. In some embodiments, the sense and antisense strands are each independently 21 to 24 nucleotides in length. In some embodiments, both the sense and antisense strands are 21 nucleotides in length. In some embodiments, the antisense strands are independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the sense strands are independently 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. The RNAi agents described herein inhibit expression of one or more TSLP gene variants in vivo and / or in vitro when delivered to cells that express TSLP, such as lung cells.
[0015] The TSLP RNAi agents disclosed herein target the human TSLP gene (see, e.g., SEQ ID NO: 1). In some embodiments, the TSLP RNAi agents disclosed herein target a portion of the TSLP gene having any of the sequences disclosed in Table 1.
[0016] In another aspect, the disclosure features compositions (including pharmaceutical compositions) comprising one or more of the disclosed TSLP RNAi agents that can selectively and efficiently reduce expression of the TSLP gene. Compositions comprising one or more TSLP RNAi agents described herein can be administered to a subject (e.g., a human or animal subject) for the treatment (prophylactic treatment or inhibition) of conditions and diseases, including, but not limited to, asthma (including, but not limited to, allergic asthma), chronic obstructive pulmonary disease (including, but not limited to, granulation, chronic bronchitis, and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including, but not limited to, systemic sclerosis (SSc)), and polyinflammatory diseases (including, but not limited to, atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis).
[0017] Examples of TSLP RNAi agent sense and antisense strands that can be used in TSLP RNAi agents are provided in Tables 3, 4, 5, and 6. Examples of TSLP RNAi agent duplexes are shown in Tables 7A, 7B, 8, 9, and 10. Examples of 19-nucleotide core stretch sequences that can be comprised of or included in the sense and antisense strands of several TSLP RNAi agents disclosed herein are provided in Table 2.
[0018] In another aspect, the present disclosure features a method for in vivo delivery of a TSLP RNAi agent to epithelial cells of a subject (e.g., a mammal). Also described herein are compositions for use in such methods. In some embodiments, disclosed herein is a method for in vivo delivery of a TSLP RNAi agent to lung cells (e.g., epithelial cells, macrophages, smooth muscle, endothelial cells) of a subject. In some embodiments, the subject is a human subject.
[0019] The methods disclosed herein include administering one or more TSLP RNAi agents to a subject (e.g., a human or animal subject) by any suitable means known in the art. Pharmaceutical compositions disclosed herein containing one or more TSLP RNAi agents can be administered in a variety of ways, depending on whether local or systemic treatment is desired. Administration can be, for example, but is not limited to, intravenous, intraarterial, subcutaneous, intraperitoneal, subdermal (e.g., via an implantable device), and intraparenchymal. In some embodiments, the pharmaceutical compositions described herein are administered by inhalation (such as dry powder inhalation or aerosol inhalation), or by use of a nebulizer, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration.
[0020] In some embodiments, the TSLP RNAi agents described herein desirably inhibit expression of the TSLP gene in pulmonary epithelium and are administered by inhalation (e.g., an inhaler, such as a metered dose inhaler, or a nebulizer, such as a jet or vibrating mesh nebulizer, or a soft mist inhaler).
[0021] One or more TSLP RNAi agents can be delivered to target cells or tissues using any oligonucleotide delivery technique known in the art. In some embodiments, the TSLP RNAi agent is delivered to a cell or tissue by covalently linking the RNAi agent to a targeting group. In some embodiments, the targeting group can include a cell receptor ligand, such as an integrin targeting ligand. Integrins are a family of transmembrane receptors that promote cell-extracellular matrix (ECM) adhesion. In particular, integrin αvβ6 (αvβ6) is known to be a receptor for ECM proteins and TGF-β latency-associated peptide (LAP) and is an epithelial-specific integrin expressed in various cells and tissues. Integrin αvβ6 is known to be highly upregulated in damaged lung epithelium. In some embodiments, the TSLP RNAi agent described herein is linked to an integrin targeting ligand with affinity for integrin αvβ6. As used herein, an "αvβ6 integrin targeting ligand" refers to a compound that has affinity for integrin αvβ6 and can be used as a ligand to facilitate targeting and delivery of an RNAi agent to desired cells and / or tissues (i.e., cells that express integrin αvβ6). In some embodiments, multiple αvβ6 integrin targeting ligands or a cluster of αvβ6 integrin targeting ligands are linked to a TSLP RNAi agent. In some embodiments, the TSLP RNAi agent-αvβ6 integrin targeting ligand conjugate is selectively internalized by lung epithelial cells by receptor-mediated endocytosis or other means.
[0022] Examples of targeting groups useful for delivery of TSLP RNAi agents, including αβ integrin targeting ligands, are disclosed, for example, in International Patent Application Publication No. WO2018 / 085415 and International Patent Application Publication No. WO2019 / 089765, the contents of each of which are incorporated herein by reference in their entirety.
[0023] The targeting group can be linked to the 3' or 5' end of the sense strand or antisense strand of the TSLP RNAi agent. In some embodiments, the targeting group is linked to the 3' or 5' end of the sense strand. In some embodiments, the targeting group is linked to the 5' end of the sense strand. In some embodiments, the targeting group is internally linked to a nucleotide on the sense strand and / or antisense strand of the RNAi agent. In some embodiments, one or more targeting ligands are internally linked to one or more nucleotides on the sense strand of the RNAi agent. In some embodiments, the targeting group is linked to the RNAi agent via a linker.
[0024] In another aspect, the disclosure features a composition that includes one or more TSLP RNAi agents having a double-stranded structure disclosed in Tables 7A, 7B, 8, 9, and 10.
[0025] The use of TSLP RNAi agents provides therapeutic (including prophylactic) treatment methods for diseases or disorders in which reduction of TSLP can provide a therapeutic benefit. The TSLP RNAi agents disclosed herein can be used to treat a variety of diseases, such as asthma (including, but not limited to, allergic asthma), chronic obstructive pulmonary disease (including, but not limited to, chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including, but not limited to, systemic sclerosis (SSc)), and multiple inflammatory diseases (including, but not limited to, atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis). In some embodiments, the TSLP RNAi agents disclosed herein can be used to treat pulmonary inflammatory diseases or conditions. In some embodiments, the TSLP RNAi agents disclosed herein can be used to treat asthma. TSLP RNAi agents can be used, for example, to treat allergic asthma. Such treatment methods include administering a TSLP RNAi agent to a human or animal in which a reduction in TSLP levels is desired.
[0026] definition As used herein, the terms "oligonucleotide" and "polynucleotide" refer to a polymer of linked nucleosides, each of which may independently be modified or unmodified.
[0027] As used herein, an "RNAi agent" (also referred to as an "RNAi trigger") refers to a composition comprising an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that can sequence-specifically reduce or inhibit (e.g., degrade or inhibit under appropriate conditions) translation of a messenger RNA (mRNA) transcript of a target mRNA. As used herein, an RNAi agent may act via the RNA interference mechanism (i.e., induce RNA interference via interaction with the RNA interference pathway machinery (RNA-induced silencing complex, or RISC) in mammalian cells) or may act via any alternative mechanism or pathway. While the term RNAi agent as used herein is believed to act primarily via the RNA interference mechanism, the disclosed RNAi agents are not constrained or limited to a particular pathway or mechanism of action. RNAi agents disclosed herein are composed of a sense strand and an antisense strand and include, but are not limited to, short (or small) interfering RNA (siRNA), double-stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), and Dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary to the target mRNA (i.e., TSLP mRNA). The RNAi agents may contain one or more modified nucleotides and / or one or more non-phosphodiester linkages.
[0028] As used herein, the terms "silence," "reduce," "inhibit," "downregulate," or "knock down," when referring to the expression of a given gene, mean that expression of that gene, as measured by the level of RNA transcribed from that gene or the level of polypeptide, protein, or protein subunit translated from mRNA, is reduced in a cell, group of cells, tissue, organ, or subject in which that gene is transcribed, when that cell, group of cells, tissue, organ, or subject is treated with an RNAi agent as described herein, compared to a second cell, group of cells, tissue, organ, or subject that has not been treated.
[0029] As used herein, the terms "sequence" and "nucleotide sequence" refer to a sequence or order of nucleic acid bases or nucleotides represented by a sequence of letters using standard nomenclature.
[0030] As used herein, a "base," "nucleotide base," or "nucleobase" refers to a heterocyclic pyrimidine or purine compound that is a component of a nucleotide, including the primary purine bases adenine and guanine, and the primary pyrimidine bases cytosine, thymine, and uracil. Nucleobases can be further modified to include, but are not limited to, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. (See, e.g., Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008). Synthesis of such modified nucleobases (including phosphoramidite compounds containing modified nucleobases) is known in the art.
[0031] As used herein, unless otherwise stated, the term "complementary" when describing a first nucleobase or nucleotide sequence (e.g., the sense strand of an RNAi agent or a target mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., the antisense strand of an RNAi agent or a single-stranded antisense oligonucleotide). Hybridization refers to the ability of an oligonucleotide or polynucleotide containing a first nucleotide sequence to hybridize (form base-pair hydrogen bonds under physiological mammalian conditions (or other suitable in vivo or in vitro conditions)) with an oligonucleotide containing a second nucleotide sequence and to form a double-stranded or double-helical structure with the second nucleotide sequence under specific standard conditions. Those skilled in the art will be able to select the most appropriate set of conditions for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs, and include natural or modified nucleotides or nucleotide mimetics, so long as at least the above hybridization requirements are met. Sequence identity or complementarity is independent of modifications. For example, a and Af, as defined herein, are complementary to U (or T) and identical to A for purposes of determining identity or complementarity.
[0032] As used herein, "completely complementary" or "fully complementary" means that in a hybridized pair of nucleic acid base or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.
[0033] As used herein, "partially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 70% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may include all or a portion of the first or second nucleotide sequence.
[0034] As used herein, "substantially complementary" means that in a hybridized pair of nucleic acid or nucleotide sequence molecules, at least 85% (but not all) of the bases in a contiguous sequence of a first oligonucleotide hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence can include all or a portion of the first or second nucleotide sequence.
[0035] As used herein, the terms "complementary," "fully complementary," "partially complementary," and "substantially complementary" are used in reference to nucleobase or nucleotide matches between the sense and antisense strands of an RNAi agent, or between the antisense strand of an RNAi agent and the sequence of TSLP mRNA.
[0036] As used herein, the term "substantially identical" or "substantial identity" as applied to nucleic acid sequences means that a nucleotide sequence (or a portion of a nucleotide sequence) has at least about 85% or more sequence identity compared to a reference sequence, e.g., at least 90%, at least 95%, or at least 99% identity. The percentage of sequence identity is determined by comparing two optimally aligned sequences over the entire comparison window. The percentage is calculated by determining the number of positions where the same type of nucleobase occurs in both sequences to calculate the number of matching positions, dividing the number of matching positions by the total number of positions in the comparison window, and multiplying the result by 100 to obtain the percentage of sequence identity. The invention disclosed herein encompasses nucleotide sequences substantially identical to those disclosed herein.
[0037] As used herein, the terms "treat," "treatment," and the like refer to a method or step taken to reduce or alleviate the number, severity, and / or frequency of one or more symptoms of a disease in a subject. As used herein, "treat" and "treatment" can include preventing, managing, prophylactic treatment, and / or inhibiting or reducing the number, severity, and / or frequency of one or more symptoms of a disease in a subject.
[0038] As used herein, the term "introducing into cells" when referring to RNAi agents means that RNAi agents are functionally delivered into cells.The term "functional delivery" means that RNAi agents are delivered into cells so that they can exert their expected biological activity, such as sequence-specific inhibition of gene expression.
[0039] Unless otherwise stated, symbols used herein [ka] The use of means that any group or groups may be attached thereto in accordance with the scope of the invention described herein.
[0040] As used herein, the term "isomer" refers to compounds that have identical molecular formulae but differ in the nature or sequence of bonding of their atoms or the arrangement of their atoms in space. Isomers that differ in the arrangement of their atoms in space are called "stereoisomers." Stereoisomers that are not mirror images of one another are called "diastereoisomers," and stereoisomers that are non-superimposable mirror images are called "enantiomers," or sometimes optical isomers. A carbon atom bonded to four non-identical substituents is called a "chiral center."
[0041] Unless a structure is specifically identified herein as having a particular conformation, for each structure in which asymmetric centers exist, thereby giving rise to enantiomers, diastereoisomers, or other stereoisomeric configurations, each structure disclosed herein is intended to represent all such possible isomers, including optically pure and racemic forms. For example, a structure disclosed herein is intended to encompass mixtures of diastereoisomers as well as single stereoisomers.
[0042] The phrase "consisting of," as used in the claims herein, excludes any element, step, or ingredient not specified in the claim. The phrase "consisting essentially of," as used in the claims herein, limits the scope of the claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention.
[0043] Those skilled in the art will readily understand and appreciate that the compounds and compositions disclosed herein may have some atoms (e.g., N, O, or S atoms) in a protonated or deprotonated state depending on the environment in which the compound or composition is placed. Therefore, as used herein, the structures disclosed herein contemplate that some functional groups, such as OH, SH, or NH, may be protonated or deprotonated. The disclosure herein is intended to encompass the disclosed compounds and compositions regardless of their protonation state based on the environment (e.g., pH), as readily understood by those skilled in the art. Similarly, it should be understood that compounds described herein having labile protons or basic atoms represent salt forms of the corresponding compounds. The compounds described herein may be in the form of a free acid, a free base, or a salt. It should be understood that pharmaceutically acceptable salts of the compounds described herein are within the scope of the present invention.
[0044] As used herein, the terms "linked" or "bonded," when referring to a connection between two compounds or molecules, mean that the two compounds or molecules are joined by a covalent bond. Unless otherwise stated, the terms "linked" and "bonded," as used herein, can refer to a connection between a first compound and a second compound with or without an intervening atom or group of atoms.
[0045] As used herein, the term "including" means, and is used interchangeably with, the phrase "including but not limited to." The term "or" means, and is used interchangeably with, the phrase "and / or," unless the context clearly indicates otherwise.
[0046] Unless otherwise specified, all technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated herein by reference in their entirety. In the case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.
[0047] Other objects, features, aspects, and advantages of the present invention will become apparent from the following detailed description, the accompanying drawings, and the claims. [Brief explanation of the drawings]
[0048] [Figure 1] FIG. 1 is a chemical structure diagram of the tridentate αvβ6 epithelial cell targeting ligand designated herein as Tri-SM6.1-αvb6-(TA14).
[0049] [Figure 2] FIG. 2 is a graph plotting the reduction of hTSLP protein in the lungs of AAV-transduced mice by several TSLP RNAi agents tested (see also Example 5).
[0050] [Figure 3A-3B]Figures 3A and 3B are graphs plotting the reduction of hTSLP protein in the lungs of AAV-transduced mice by the RNAi agents tested (see also Example 7). Samples were analyzed for protein expression on separate plates (Plate 1 shown in Figure 3A and Plate 2 shown in Figure 3B). The same controls were used on both plates.
[0051] [Figures 4A-4C] Figures 4A, 4B, and 4C are graphs plotting the reduction in lung TSLP mRNA (Figure 4A) and BAL inflammatory cell counts in rats treated with TSLP RNAi agents. BAL samples were assessed for eosinophils (Figure 4B) and total BAL cell counts (Figure 4C) (see also Example 10).
[0052] [Figures 5A-5C] Figures 5A, 5B, and 5C are graphs plotting lung mRNA levels of TSLP (Figure 5A), IL-13 (Figure 5B), and IL-33 (Figure 5C) in rats administered rat-specific TSLP RNAi agents (see also Example 3).
[0053] [Figure 5D-5F] Figures 5D, 5E, and 5F are graphs plotting BAL soluble collagen (Figure 5D), BAL IL-5 (Figure 5E), and BAL IL-13 (Figure 5F) in rats administered a rat-specific TSLP RNAi agent (see also Example 3).
[0054] [Figures 6A-6C] Figures 6A, 6B, and 6C are graphs plotting human TSLP mRNA in the lungs of transduced mice (Figure 6A), human TSLP protein in the lungs of AAV-transduced mice (Figure 6B), and human TSLP protein in the serum of AAV-transduced mice (Figure 6C) (see also Example 11).
[0055] [Figure 7] FIG. 7 is a graph plotting human TSLP protein in the lungs of AAV-transduced mice (see also Example 15).
[0056] [Figure 8] FIG. 8 is a graph plotting human TSLP protein in the lungs of AAV-transduced mice (see also Example 16).
[0057] [Figure 9A-9B] 9A and 9B are graphs plotting human TSLP protein in the lungs of AAV-transduced mice (FIG. 9A) and in mouse serum (FIG. 9B) (see also Example 18).
[0058] [Figures 10A-10B] 10A and 10B are graphs plotting human TSLP protein in the lungs of AAV-transduced mice (FIG. 10A) and in mouse serum (FIG. 10B) (see also Example 19).
[0059] [Figures 11A-11B] 11A and 11B are graphs plotting human TSLP protein in the lungs of AAV-transduced mice (FIG. 11A) and in mouse serum (FIG. 11B) (see also Example 25).
[0060] [Figures 12A-12B] 12A and 12B are graphs plotting human TSLP protein in the lungs of AAV-transduced mice (FIG. 12A) and in mouse serum (FIG. 12B) (see also Example 26). DETAILED DESCRIPTION OF THE INVENTION
[0061] Detailed Description
[0062] RNAi agents Described herein are RNAi agents (referred to herein as TSLP RNAi agents or TSLP RNAi triggers) for inhibiting expression of the TSLP gene. Each TSLP RNAi agent disclosed herein includes a sense strand and an antisense strand. The sense strand can be 12-49 nucleotides in length. The antisense strand can be 18-49 nucleotides in length. The sense strand and antisense strand can be the same length or different lengths. In some embodiments, the sense strand and antisense strand are each independently 18-27 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21-26 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each 21-24 nucleotides in length. In some embodiments, the sense strand and the antisense strand are each independently 19-21 nucleotides in length. In some embodiments, the sense strand is about 19 nucleotides in length, while the antisense strand is about 21 nucleotides in length. In some embodiments, the sense strand is about 21 nucleotides in length and the antisense strand is about 23 nucleotides in length. In some embodiments, the sense strand is 23 nucleotides in length, and the antisense strand is 21 nucleotides in length. In some embodiments, both the sense strand and the antisense strand are each 21 nucleotides in length. In some embodiments, the sense strands of the RNAi agent are each independently 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, or 49 nucleotides in length. In some embodiments, the antisense strands of the RNAi agent are each independently 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. In some embodiments, the RNAi agent is double-stranded and the duplex is about 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length.In some embodiments, the RNAi agent is double-stranded and the duplex is 19, 20, 21, 22, or 23 nucleotides in length.
[0063] Exemplary nucleotide sequences used to form TSLP RNAi agents are shown in Tables 2, 3, 4, 5, 6, and 10. Exemplary RNAi agent duplexes comprising the sense and antisense strand sequences of Tables 2, 3, 4, 5, and 6 are shown in Tables 7A, 7B, 8, 9, and 10.
[0064] In some embodiments, the region of complete, substantial, or partial complementarity between the sense strand and the antisense strand is 16 to 26 (e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) nucleotides in length and is located at or near the 5' end of the antisense strand (e.g., the region is 0, 1, 2, 3, or 4 nucleotides away from the 5' end of the antisense strand and is not complete, substantial, or partial complementarity).
[0065] The sense strand of a TSLP RNAi agent described herein comprises at least 12 contiguous nucleotides that are at least 85% identical to a core stretch sequence of the same number of nucleotides in a TSLP mRNA (also referred to herein as a "core stretch" or "core sequence"). In some embodiments, the sense strand core stretch sequence is 100% (fully) complementary or at least about 85% (substantially) complementary to the core stretch sequence in the antisense strand; thus, the sense strand core stretch sequence is typically fully identical or at least about 85% identical to a nucleotide sequence of the same length present in a TSLP mRNA target (e.g., sometimes referred to as a target sequence). In some embodiments, the sense strand core stretch is 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the sense strand core stretch is 17 nucleotides in length. In some embodiments, the sense strand core stretch is 19 nucleotides in length. In some embodiments, the sense strand core stretch is 21 nucleotides in length.
[0066] The antisense strand of a TSLP RNAi agent described herein comprises at least 15 contiguous nucleotides that are at least 85% complementary to a core stretch of the same number of nucleotides in the TSLP mRNA and to a core stretch of the same number of nucleotides in the corresponding sense strand. In some embodiments, the antisense strand core stretch is 100% (fully) complementary or at least about 85% (substantially) complementary to a nucleotide sequence of the same length present in the TSLP mRNA target (e.g., target sequence). In some embodiments, the antisense strand core stretch is 17, 18, 19, 20, 21, 22, or 23 nucleotides in length. In some embodiments, the antisense strand core stretch is 19 nucleotides in length. In some embodiments, the antisense strand core stretch is 17 nucleotides in length. The sense strand core stretch sequence may be the same length as the corresponding antisense core sequence, or may be a different length.
[0067] The sense and antisense strands of a TSLP RNAi agent anneal to form a duplex. The sense and antisense strands of a TSLP RNAi agent can be partially, substantially, or fully complementary to each other. Within the complementary duplex region, the core extension sequence of the sense strand is at least 85% complementary, or 100% complementary, to the core extension sequence of the antisense strand. In some embodiments, the sense strand core stretch sequence comprises a sequence of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that is at least 85% or 100% complementary to a corresponding 16, 17, 18, 19, 20, 21, 22, or 23 nucleotide sequence of the antisense strand core stretch sequence (i.e., the sense and antisense core stretch sequences of the TSLP RNAi agent have a region of at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, or at least 23 nucleotides that are at least 85% base-paired or 100% base-paired).
[0068] In some embodiments, the antisense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0069] In some embodiments, the sense strand and / or antisense strand may optionally and independently comprise an additional 1, 2, 3, 4, 5, or 6 nucleotides (extensions) at the 3'-end, 5'-end, or both the 3'-end and 5'-end of the core stretch sequence. The additional nucleotides in the antisense strand, if present, may or may not be complementary to the corresponding sequence in the TSLP mRNA. The additional nucleotides in the sense strand, if present, may or may not be identical to the corresponding sequence in the TSLP mRNA. The additional nucleotides in the antisense strand (if present) may or may not be complementary to the corresponding additional nucleotides in the sense strand (if present).
[0070] As used herein, an extension comprises 1, 2, 3, 4, 5, or 6 nucleotides at the 5'-end and / or 3'-end of the sense strand core stretch sequence and / or the antisense strand core stretch sequence. The extended nucleotides on the sense strand may or may not be complementary to the corresponding nucleotides in the antisense strand (either the core stretch sequence nucleotides or the extended nucleotides). Conversely, the extended nucleotides on the antisense strand may or may not be complementary to the corresponding nucleotides in the sense strand (either the core extension nucleotides or the extended nucleotides). In some embodiments, both the sense and antisense strands of an RNAi agent comprise 3' and 5' extensions. In some embodiments, one or more of the 3' extension nucleotides of one strand base-pair with one or more of the 5' extension nucleotides of the other strand. In other embodiments, one or more of the 3' extension nucleotides of one strand do not base-pair with one or more of the 5' extension nucleotides of the other strand. In some embodiments, the TSLP RNAi agent has an antisense strand with a 3' extension and a sense strand with a 5' extension. In some embodiments, the extended nucleotides are unpaired and form an overhang. As used herein, the term "overhang" refers to a sequence of one or more unpaired nucleotides located at the end of either the sense strand or the antisense strand, which do not form part of the hybridized portion or double-stranded portion of the RNAi agent disclosed herein (see, e.g., U.S. Patent No. 8,362,231).
[0071] In some embodiments, the TSLP RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In other embodiments, the TSLP RNAi agent comprises an antisense strand having a 3' extension that is 1, 2, or 3 nucleotides in length. In some embodiments, one or more of the nucleotides in the antisense strand extension comprise nucleotides that are complementary to the corresponding TSLP mRNA sequence. In some embodiments, one or more of the nucleotides in the antisense strand extension comprise nucleotides that are not complementary to the corresponding TSLP mRNA sequence.
[0072] In some embodiments, a TSLP RNAi agent comprises a sense strand having a 3' extension that is 1, 2, 3, 4, or 5 nucleotides in length. In some embodiments, one or more of the sense strand extension nucleotides comprises an adenosine, uracil, or thymidine nucleotide, an AT dinucleotide, or a nucleotide that corresponds to or is identical to a nucleotide in the TSLP mRNA sequence. In some embodiments, the 3' sense strand extension comprises or consists of any of the following sequences, including but not limited to: T, UT, TT, UU, UUT, TTT, or TTTT (each listed from 5' to 3').
[0073] The sense strand can have a 3' extension and / or a 5' extension. In some embodiments, a TSLP RNAi agent comprises a sense strand having a 5' extension that is 1, 2, 3, 4, 5, or 6 nucleotides in length. In some embodiments, one or more of the nucleotides in the sense strand extension correspond to or comprise identical nucleotides to nucleotides in the TSLP mRNA sequence.
[0074] Examples of sequences used to form TSLP RNAi agents are shown in Tables 2, 3, 4, 5, 6, and 10. In some embodiments, the antisense strand of the TSLP RNAi agent comprises any of the sequences in Table 2, 3, or 10. In some embodiments, the antisense strand of the TSLP RNAi agent comprises or consists of any one of the modified sequences in Table 3. In some embodiments, the antisense strand of the TSLP RNAi agent comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-15, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, or 2-21 of any of the sequences in Table 2 or 3. In some embodiments, the sense strand of the TSLP RNAi agent comprises any of the sequences in Table 2, 4, 5, or 6. In some embodiments, the sense strand of a TSLP RNAi agent comprises a nucleotide sequence (5' end to 3' end) 1-18, 1-19, 1-20, 1-21, 2-19, 2-20, 2-21, 3-20, 3-21, or 4-21 of any of the sequences in Table 2, 4, 5, or 6. In some embodiments, the sense strand of a TSLP RNAi agent comprises or consists of a modified sequence of any of Table 4, 5, 6, or 10.
[0075] In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise the same number of nucleotides. In some embodiments, the sense strand and antisense strand of an RNAi agent described herein comprise a different number of nucleotides. In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of an RNAi agent form a blunt end. In some embodiments, both ends of an RNAi agent form blunt ends. In some embodiments, neither end of an RNAi agent is blunt. As used herein, "blunt end" refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are complementary (form complementary base pairing).
[0076] In some embodiments, the 5' end of the sense strand and the 3' end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, the 3' end of the sense strand and the 5' end of the antisense strand of the RNAi agent form frayed ends. In some embodiments, both ends of the RNAi agent form frayed ends. In some embodiments, neither end of the RNAi agent is a frayed end. As used herein, a frayed end refers to the end of a double-stranded RNAi agent in which the terminal nucleotides of the two annealed strands are paired (i.e., do not form an overhang) but are not complementary (i.e., form a non-complementary pair). In some embodiments, one or more unpaired nucleotides at the end of one strand of the double-stranded RNAi agent form an overhang. The unpaired nucleotides can be present on the sense strand or the antisense strand and form a 3' or 5' overhang. In some embodiments, the RNAi agent comprises a blunt end and a frayed end, a blunt end and a 5' overhanging end, a blunt end and a 3' overhanging end, a frayed end and a 5' overhanging end, a frayed end and a 3' overhanging end, two 5' overhanging ends, two 3' overhanging ends, a 5' overhanging end and a 3' overhanging end, two frayed ends, or two blunt ends. Typically, if present, the overhangs are located at the 3' end of the sense strand, the antisense strand, or both the sense and antisense strands.
[0077] The TSLP RNAi agents disclosed herein may also be comprised of one or more modified nucleotides. In some embodiments, substantially all nucleotides of the sense strand and substantially all nucleotides of the antisense strand of the TSLP RNAi agent are modified nucleotides. The TSLP RNAi agents disclosed herein may further comprise one or more modified internucleoside linkages, for example, one or more phosphorothioate linkages. In some embodiments, the TSLP RNAi agent comprises one or more modified nucleotides and one or more modified internucleoside linkages. In some embodiments, a 2'-modified nucleotide is combined with a modified internucleoside linkage.
[0078] In some embodiments, the TSLP RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the TSLP RNAi agent is prepared as a pharmaceutically acceptable salt. In some embodiments, the TSLP RNAi agent is prepared as a pharmaceutically acceptable sodium salt. Such forms known in the art are within the scope of the invention disclosed herein.
[0079] Modified Nucleotides When used in various oligonucleotide constructs, modified nucleotides can increase the serum stability of these compounds while maintaining their activity in cells and can minimize the potential for activating interferon activity in humans upon administration of the oligonucleotide construct.
[0080] In some embodiments, the TSLP RNAi agent comprises one or more modified nucleotides. As used herein, a "modified nucleotide" is a nucleotide other than a ribonucleotide (2'-hydroxyl nucleotide). In some embodiments, at least 50% (e.g., at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%) of the nucleotides are modified nucleotides. Modified nucleotides as used herein include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 2'-modified nucleotides, 3'-modified nucleotides (2'-internucleoside linkage), inverted nucleotides, modified nucleobase-containing nucleotides, bridged nucleotides, peptide nucleic acids (PNAs), 2',3'-seconucleotide mimics (unlocked nucleobase analogs), locked nucleotides, 3'-O-methoxy (2'-internucleoside linkage) nucleotides, 2'-F-arabinonucleotides, 5'-methyl-2'-fluoronucleotides, morpholinonucleotides (modified nucleotides having a morpholine ring), nucleotides in which the typical five-membered sugar ring of a nucleotide has been modified, vinylphosphonate deoxyribonucleotides, vinylphosphonate-containing nucleotides, and cyclopropylphosphonate-containing nucleotides. 2'-modified nucleotides (i.e., nucleotides having a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (also called 2'-methoxy nucleotides), 2'-fluoro nucleotides (also called 2'-deoxy-2'-fluoro nucleotides), 2'-deoxy nucleotides, 2'-methoxyethyl (2'-O-2-methoxyethyl) nucleotides (also called 2'-MOE nucleotides), 2'-amino nucleotides, 2'-halo nucleotides, and 2'-alkyl nucleotides. Not all positions in a given compound need be uniformly modified. Conversely, multiple modifications can be incorporated into a single TSLP RNAi agent or a single nucleotide thereof.The sense and antisense strands of a TSLP RNAi agent can be synthesized and / or modified by methods known in the art, with modification of one nucleotide being independent of modification of another nucleotide.
[0081] Modified nucleobases include synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines, N-2, N-6, and O-6 substituted purines (e.g., 2-aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, inosine, xanthine, hypoxanthine, 2-aminoadenine, 6-alkyl (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2-methyl, 2-ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, Included are 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyluracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl, and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5-trifluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine.
[0082] In some embodiments, the 5'-end and / or 3'-end of the antisense strand can contain an abasic residue (Ab), which can also be referred to as an "abasic site" or "abasic nucleotide." An abasic residue (Ab) is a nucleotide or nucleoside lacking a nucleobase at the 1'-position of the sugar moiety. (See, e.g., U.S. Pat. No. 5,998,203.) In some embodiments, the abasic residue can be positioned within the nucleotide sequence. In some embodiments, Ab or AbAb can be added to the 3'-end of the antisense strand. In some embodiments, the 5'-end of the sense strand can contain one or more additional abasic residues (e.g., (Ab) or (AbAb)). In some embodiments, UUAb, UAb, or Ab is added to the 3'-end of the sense strand. In some embodiments, the abasic (deoxyribose) residue can be replaced with a ribitol (abasic ribose) residue.
[0083] In some embodiments, all or substantially all of the nucleotides of the RNAi agent are modified nucleotides. As used herein, an RNAi agent in which substantially all of the nucleotides present are modified nucleotides refers to an RNAi agent in which four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand are ribonucleotides (i.e., unmodified). As used herein, a sense strand in which substantially all of the nucleotides present are modified nucleotides refers to a sense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the sense strand are unmodified nucleotides. As used herein, an antisense strand in which substantially all of the nucleotides present are modified nucleotides refers to an antisense strand in which two or fewer (i.e., 0, 1, or 2) nucleotides in the antisense strand are unmodified ribonucleotides. In some embodiments, one or more nucleotides of the RNAi agent are unmodified ribonucleotides. The chemical structures of some modified nucleotides are shown in Table 11 herein.
[0084] Modified internucleoside linkages In some embodiments, one or more nucleotides of a TSLP RNAi agent are linked by a non-canonical bond or backbone (ie, a modified internucleoside bond or a modified backbone). Modified internucleoside linkages or backbones include, but are not limited to, phosphorothioate groups (represented herein by a lowercase "s"), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkylphosphonates (e.g., methylphosphonates or 3'-alkylenephosphonates), chiral phosphonates, phosphinates, phosphoramidates (e.g., 3'-aminophosphoramidate, aminoalkylphosphoramidate, or thionophosphoramidate), thionoalkylphosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates with normal 3'-5' linkages, 2'-5' linked analogs of boranophosphates, or boranophosphates with inverted polarity in which pairs of adjacent nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. In some embodiments, the modified internucleoside linkage or backbone lacks a phosphorus atom. Modified internucleoside linkages lacking a phosphorus atom include, but are not limited to, short-chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl intersugar linkages, or one or more short-chain heteroatom or heterocyclic intersugar linkages. In some embodiments, modified internucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones containing mixed N, O, S, and CH moieties.
[0085] In some embodiments, the sense strand of a TSLP RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, the antisense strand of a TSLP RNAi agent can include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages, or both the sense and antisense strands can independently include 1, 2, 3, 4, 5, or 6 phosphorothioate linkages. In some embodiments, the sense strand of a TSLP RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, the antisense strand of a TSLP RNAi agent can include 1, 2, 3, or 4 phosphorothioate linkages, or both the sense and antisense strands can independently include 1, 2, 3, or 4 phosphorothioate linkages.
[0086] In some embodiments, the sense strand of a TSLP RNAi agent contains at least two phosphorothioate internucleoside linkages. In some embodiments, the phosphorothioate internucleoside linkages are present between nucleotides 1 to 3 from the 3' end of the sense strand. In some embodiments, one phosphorothioate internucleoside linkage is at the 5' end of the sense strand nucleotide sequence, and another phosphorothioate linkage is at the 3' end of the sense strand nucleotide sequence. In some embodiments, two phosphorothioate internucleoside linkages are at the 5' end of the sense strand, and another phosphorothioate linkage is at the 3' end of the sense strand. In some embodiments, the sense strand does not contain phosphorothioate internucleoside linkages between nucleotides, but does contain one, two, or three phosphorothioate linkages between the terminal nucleotides at both the 5' and 3' ends, optionally displaying an inverted abasic residue end cap. In some embodiments, a targeting ligand is attached to the sense strand via a phosphorothioate linkage.
[0087] In some embodiments, the antisense strand of a TSLP RNAi agent contains four phosphorothioate internucleoside linkages. In some embodiments, the four phosphorothioate internucleoside linkages are present between nucleotides 1-3 from the 5' end of the antisense strand and between nucleotides 19-21, 20-22, 21-23, 22-24, 23-25, or 24-26 from the 5' end of the antisense strand. In some embodiments, three phosphorothioate internucleoside linkages are present between positions 1-4 from the 5' end of the antisense strand, and a fourth phosphorothioate internucleoside linkage is present between positions 20-21 from the 5' end of the antisense strand. In some embodiments, a TSLP RNAi agent contains at least three or four phosphorothioate internucleoside linkages in the antisense strand.
[0088] Capping residues or moieties In some embodiments, the sense strand can include one or more capping residues or moieties, which may be referred to in the art as "caps," "terminal caps," or "capping residues." As used herein, a "capping residue" refers to a non-nucleotide compound or other moiety that can be incorporated into one or more ends of the nucleotide sequence of an RNAi agent disclosed herein. Capping residues can, in some cases, confer beneficial properties to the RNAi agent, such as protection against nuclease degradation. In some embodiments, an inverted abasic residue (invAb) (also referred to in the art as an "inverted abasic site") is added as a capping residue (see Table 11). (See, e.g., F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16). Capping residues are generally known in the art, and include, for example, inverted abasic residues, as well as carbon chains, such as terminal C3H7 (propyl), C6H 13 (hexyl), or C 12 H 25(dodecyl) groups. In some embodiments, the capping residue is present at the 5'-end, the 3'-end, or both the 5'-end and the 3'-end of the sense strand. In some embodiments, the 5'-end and / or the 3'-end of the sense strand may contain two or more inverted abasic deoxyribose moieties as capping residues.
[0089] In some embodiments, one or more inverted abasic residues (invAb) are added to the 3'-end of the sense strand. In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues or inverted abasic sites are inserted between the target ligand and the nucleotide sequence of the sense strand of the RNAi agent. In some embodiments, the activity or other desired properties of the RNAi agent can be enhanced by including one or more inverted abasic residues or inverted abasic sites at or near one or more ends of the sense strand of the RNAi agent.
[0090] In some embodiments, one or more inverted abasic residues (invAb) are added to the 5'-end of the sense strand. In some embodiments, one or more inverted abasic residues can be inserted between the targeting ligand and the nucleotide sequence of the sense strand of the RNAi agent. The inverted abasic residues can be linked via phosphate, phosphorothioate (e.g., referred to herein as (invAb)s), or other internucleoside linkages. In some embodiments, including one or more inverted abasic residues at or near one or more termini of the sense strand of the RNAi agent can enhance the activity or other desired properties of the RNAi agent. In some embodiments, the inverted abasic (deoxyribose) residue can be substituted with an inverted ribitol (abasic ribose) residue. In some embodiments, an inverted abasic residue can be included at the 3'-end of the antisense strand core stretch sequence or the 3'-end of the antisense strand sequence. The chemical structures of inverted abasic deoxyribose residues are shown in Table 11 below.
[0091] TSLP RNAi agent The TSLP RNAi agents disclosed herein are designed to target specific positions on the TSLP gene (e.g., SEQ ID NO: 1 (NM_0033035.5)). As defined herein, an antisense strand sequence is designed to target the TSLP gene at a specific position on the gene when the 5'-terminal nucleobase of the antisense strand, upon base pairing with the gene, is aligned to a position 21 nucleotides downstream (toward the 3' end) from that position on the gene. For example, as shown in Tables 1 and 2 herein, an antisense strand sequence designed to target position 571 of the TSLP gene must have the 5'-terminal nucleobase of the antisense strand aligned with position 591 of the TSLP gene upon base pairing with the gene.
[0092] As provided herein, a TSLP RNAi agent does not require that the nucleobase at position 1 (5'→3') of the antisense strand be complementary to the gene; rather, there need only be at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene over a core stretch sequence of at least 16 contiguous nucleotides. For example, in the case of a TSLP RNAi agent disclosed herein and designed to target position 571 of the TSLP gene, the 5'-terminal nucleobase of the antisense strand of the TSLP RNAi agent must align with position 591 of the gene. However, the 5'-terminal nucleobase of the antisense strand may, but need not, be complementary to position 591 of the TSLP gene, provided there is at least 85% complementarity (e.g., at least 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% complementarity) between the antisense strand and the gene transcript over a core stretch sequence of at least 16 contiguous nucleotides. Notably, as demonstrated by the various examples disclosed herein, the specific site of gene binding by the antisense strand of a TSLP RNAi agent (e.g., whether the TSLP RNAi agent is designed to target position 571, 520, 570, or another position of the TSLP gene) is an important factor in the level of inhibition exhibited and off-target effects (e.g., potential safety issues) of the TSLP RNAi agent. (See, for example, Kamola et al., The siRNA Non-seed Region and Its Target Sequences are Auxiliary Determinants of Off-Target Effects, PLOS Computational Biology, 11(12), Figure 1 (2015)).
[0093] In some embodiments, a TSLP RNAi agent disclosed herein targets the TSLP gene at or near the location of a TSLP sequence shown in Table 1. In some embodiments, the antisense strand of a TSLP RNAi agent disclosed herein comprises a core stretch sequence that is fully, substantially, or at least partially complementary to the sequence of a target TSLP 19-mer disclosed in Table 1. [Table 1-1] [Table 1-2]
[0094] Homo sapiens thymic stromal lymphopoietin (TSLP) transcript variant 1, GenBank NM_033035.5, gene transcript (2610 bases): 1 atcaggga ctccaactta aggcaacagc atgggtgaat aagggcttcc tgtggactgg 61 caatgagagg caaaacctgg tgcttgagca ctggccccta aggcaggcct tacagatctc 121 ttacactcgt ggtgggaaga gtttagtgtg aaactggggt ggaattgggt gtccacgtat 181 gttccctttt gccttactat atgttctgtc agtttctttc aggaaaatct tcatcttaca 241 acttgtaggg ctggtgttaa cttacgactt cactaactgt gactttgaga agattaaagc 301 agcctatctc agtactattt ctaaagacct gattacatat atgagtggga ccaaaagtac 361 cgagttcaac aacaccgtct cttgtagcaa tcggccacat tgccttactg aaatccagag 421 cctaccttc aatcccaccg ccggctgcgc gtcgctcgcc aaagaatgt tcgccatgaa 481 aactaggct gccttagcta tctgtgccc aggtattcg gaactcaga taatgctac 541 tcaggcaatg agaagagga gaaaaagga agtcacaacc aaaatgtc tggaacaagt 601 gtcacaatta caggattgt ggcgtcgctt caatcgacct ttactgaac aacagtaac 661 catctttatt atggtcatat ttcacagcac CAaataat catctttatt aagtagatga 721 aacattact ctaactgtga caagagac caacatagt tatcttta tacagaga 781 gtttcttaac ttactttgt aagtttat tgtgtaagtt tataatgcag gggaagtact 841 actcctcaa tgttgaggga agcttccata acatgatga ctggctcat gggcagtaatt 901 ctcggctgta gttgcataag cattgctca gaggaaatc caaagtgca gcaggagaac 961 tctttccct gaaaaggaa aaatattgaa ctcaatgata gcacctaac ttacatta 1021 aagacagaca ttccttctac atgtaatgac acttctgtg ttaaactaa atttacaag 1081 agaagaagt gaagcaat ggggtttcac aaatagttgt aatatagtg aagcaatttg 1141 aaatattt caagcaaagt attgtgaaag tattctaagc caagttttaa atattatcta 1201 acagacaaga gtggtatata caagtagatc ctgagaagta cctttgttac agctactata 1261 aatatacata taaattatag aatctacttt aatttatttt gtgaacactt ttgaaaatgt 1321 acatgttcct ttgtaattga cactatatat ttcttaataa aataattctc aaatttgttt 1381 cttatgaatc atctctcaaa tctagttaga caatttgcac acatactttt ctaagggaca 1441 ttatcttcct tcaggttttt acctccactc atccttagag cccactgact gctccccttt 1501 atacctgttg gccctgccta taggagagaa tatttggaga taggcagctt caggatgcat 1561 tgcaatcatc cttttcttaa attatgtcac tagtctttta ttttttcccc tcttgaactt 1621 tcctcacacc tggaagaaac aaagtaggaa aaagtgaaca ggggatgtca aatcgattct 1681 tgaattccg ctgcaagcta gagccgcagg cacccttca ctcaatttcc actcagaacc 1741 ctataaacac cagtgggaag ggcaacccac tgcacgtggg aatgcactga ttttcctag 1801 gagtagacat gttcctctaa ttactccctg agggttagtt ggggctaaac catgacagaa 1861 gtggggaagt tcaatgtcct taaatccatc ttacttgcca acaggtaaga ggaagcttac 1921 attacatgtc cagtccacat ttaaagagca cttactgtgg aacaagcctt cagccaaaca 1981 atggggatag aaaagtaggt aagactcagc cttgtccag agaagctcag ggtatagctg 2041 aataggcagt ttctttgtc ctgaggaaaa tcaggacatg cctgctttct aaaaatcttc 2101 ctctgaagac ctgacccaag ctcttaaatg ctattgtaag agaaatttct ttgtctatta 2161 actccatttt agtagggatt cactgactag atttactga actatgaaaa taatacaca 2221 taatttttca caaaattttg ggcccaattc ccctaaaaga attgaggatt agggagaaag 2281 gagacaactc aaagtcatcc cattaagtgc agttctttg aatcttctgc tttatcttta 2341 aaaatttgta taatttatat attttattct atgtgttcca tagatatctt aatgtaaaat 2401 tagtcattta attacactg tcaattaaaa gtaatgggca agagattgca tcatactaat 2461 ttagtaagaa cgttcccaaa tgttgtaaca atgtggatca tacatctctg gttttttaaa 2521 tgtattgagg ctttcttggt ggactagtat agtatacggt cagttatgtc aatgtttcat 2581 ggtcaataaa aaggaagttg caaattgtga
[0095] In some embodiments, a TSLP RNAi agent comprises an antisense strand, wherein position 19 of the antisense strand (5'→3') can base pair with position 1 of a 19-mer target sequence disclosed in Table 1. In some embodiments, a TSLP agent comprises an antisense strand, wherein position 1 of the antisense strand (5'→3') can base pair with position 19 of a 19-mer target sequence disclosed in Table 1.
[0096] In some embodiments, the TSLP agent comprises an antisense strand, wherein position 2 of the antisense strand (5'→3') can base pair with position 18 of a 19-mer target sequence disclosed in Table 1. In some embodiments, the TSLP agent comprises an antisense strand, wherein positions 2-18 of the antisense strand (5'→3') can base pair with positions 18-2 of a 19-mer target sequence disclosed in Table 1.
[0097] In the case of the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5'->3') may be perfectly complementary to the TSLP gene, or may not be complementary to the TSLP gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') is U, A, or dT. In some embodiments, the nucleotide at position 1 of the antisense strand (5'->3') forms an A:U or U:A base pair with the sense strand.
[0098] In some embodiments, the antisense strand of a TSLP RNAi agent comprises nucleotides 2-18 or 2-19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3. In some embodiments, the sense strand of a TSLP RNAi agent comprises nucleotides 1-17, 1-18, or 2-18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.
[0099] In some embodiments, the TSLP RNAi agent is composed of (i) an antisense strand comprising nucleotides 2 to 18 or 2 to 19 (5' to 3') of any of the antisense strand sequences in Table 2 or Table 3, and (ii) a sense strand comprising nucleotides 1 to 17 or 1 to 18 (5' to 3') of any of the sense strand sequences in Table 2, Table 4, Table 5, or Table 6.
[0100] In some embodiments, the TSLP RNAi agent comprises the core 19-mer nucleotide sequence shown in Table 2 below. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]
[0101] The sense and antisense strands of a TSLP RNAi agent comprising or consisting of a nucleotide sequence in Table 2 can be modified or unmodified nucleotides. In some embodiments, a TSLP RNAi agent having sense and antisense strand sequences comprising or consisting of any of the nucleotide sequences in Table 2 is comprised of all or substantially all modified nucleotides.
[0102] In some embodiments, the antisense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 2. In some embodiments, the sense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 2.
[0103] As used herein, each N listed in the sequences disclosed in Table 2 can be independently selected from any and all nucleobases (including those found in both modified and unmodified nucleotides). In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a nucleobase that is not complementary to the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have the same nucleobase as the N nucleotide at the corresponding position on the other strand. In some embodiments, the N nucleotides listed in the sequences disclosed in Table 2 have a different nucleobase from the N nucleotide at the corresponding position on the other strand.
[0104] The sense and antisense strands of several modified TSLP RNAi agents are shown in Tables 3, 4, 5, 6, and 10. The antisense strands of several modified TSLP RNAi agents and their underlying unmodified nucleobase sequences are shown in Table 3. The sense strands of several modified TSLP RNAi agents and their underlying unmodified nucleobase sequences are shown in Tables 4, 5, and 6. In forming a TSLP RNAi agent, each nucleotide in each underlying base sequence listed in Tables 3, 4, 5, and 6, above, and in Table 2, can be a modified nucleotide.
[0105] The TSLP RNAi agents described herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.
[0106] In some embodiments, the antisense strand of the TSLP RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3.
[0107] In some embodiments, the TSLP RNAi agent comprises or consists of a duplex having the sense and antisense nucleobase sequences of any of the sequences in Table 2, Table 3, Table 4, Table 5, Table 6, or Table 10.
[0108] Examples of antisense strands containing modified nucleotides are shown in Table 3. Examples of sense strands containing modified nucleotides are shown in Tables 4, 5, and 6.
[0109] As used in Tables 3, 4, 5, 6, and 10, the following notation is used to denote modified nucleotides, targeting groups, and linking groups: A = adenosine 3'-phosphate C = cytidine-3'-phosphate G = guanosine-3'-phosphate U = uridine-3'-phosphate I = inosine-3'-phosphate a = 2'-O-methyladenosine-3'-phosphate as = 2'-O-methyladenosine-3'-phosphorothioate c = 2'-O-methylcytidine-3'-phosphate cs = 2'-O-methylcytidine-3'-phosphorothioate g = 2'-O-methylguanosine-3'-phosphate gs = 2'-O-methylguanosine-3'-phosphorothioate i = 2'-O-methylinosine-3'-phosphate is = 2'-O-methylinosine-3'-phosphorothioate t = 2'-O-methyl-5-methyluridine-3'-phosphate ts = 2'-O-methyl-5-methyluridine-3'-phosphorothioate u = 2'-O-methyluridine-3'-phosphate us = 2'-O-methyluridine-3'-phosphorothioate Af = 2'-fluoroadenosine-3'-phosphate Afs = 2'-fluoroadenosine-3'-phosphorothioate Cf = 2'-fluorocytidine-3'-phosphate Cfs = 2'-fluorocytidine-3'-phosphorothioate Gf = 2'-fluoroguanosine-3'-phosphate Gfs = 2'-fluoroguanosine-3'-phosphorothioate Tf = 2'-fluoro-5'-methyluridine-3'-phosphate Tfs = 2'-fluoro-5'-methyluridine-3'-phosphorothioate Uf = 2'-fluorouridine-3'-phosphate Ufs = 2'-fluorouridine-3'-phosphorothioate dT = 2'-deoxythymidine-3'-phosphate dTs = 2'-deoxythymidine-3'-phosphorothioate dA = 2'-deoxyadenosine-3'-phosphate dAs = 2'-deoxyadenosine-3'-phosphorothioate dC = 2'-deoxycytidine-3'-phosphate dCs = 2'-deoxycytidine-3'-phosphorothioate dG = 2'-deoxyguanosine-3'-phosphate dGs = 2'-deoxyguanosine-3'-phosphorothioate A UNA = 2',3'-seco-adenosine-3'-phosphate A UNA s = 2',3'-seco-adenosine-3'-phosphorothioate C UNA = 2',3'-seco-cytidine-3'-phosphate C UNA s = 2',3'-seco-cytidine-3'-phosphorothioate G UNA = 2',3'-seco-guanosine-3'-phosphate G UNA s = 2',3'-seco-guanosine-3'-phosphorothioate U UNA = 2',3'-seco-uridine-3'-phosphate U UNA s = 2',3'-seco-uridine-3'-phosphorothioate a_2N = 2'-O-methyl-2-aminoadenosine-3'-phosphate, see Table 11 a_2Ns = 2'-O-methyl-2-aminoadenosine-3'-phosphorothioate, see Table 11 (invAb) = inverted abasic deoxyribonucleotide-5'-phosphate, see Table 11 (invAb)s = inverted abasic deoxyribonucleotide-5'-phosphorothioate, see Table 11 s = phosphorothioate linkage ss = phosphodithioate bond p = terminal phosphate (as synthesized) vpdN = vinylphosphonate deoxyribonucleotide cPrpa = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphate (see Table 11) cPrpas = 5'-cyclopropylphosphonate-2'-O-methyladenosine-3'-phosphorothioate (see Table 11) cPrpu = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphate (see Table 11) cPrpus = 5'-cyclopropylphosphonate-2'-O-methyluridine-3'-phosphorothioate (see Table 11) cPrpi = 5'-cyclopropylphosphonate-2'-O-methylinosine-3'-phosphate (see Table 11) cPrpis = 5'-cyclopropylphosphonate-2'-O-methylinosine-3'-phosphorothioate (see Table 11) (C6-SS-C6) = See Table 11 (6-SS-6) = See Table 11 (NH2-C6) = See Table 11 (NH2-C6)s = See Table 11 (TriAlk14) = See Table 11 (TriAlk14)s = See Table 11 -C6- = See Table 11 -C6s- = See Table 11 -L6-C6- = See Table 11 -L6-C6s- = Table 11 (TA14) = See Table 11 (structure of (TriAlk14) after binding) (TA14)s = See Table 11 (structure of (TriAlk14)s after binding) TGNA = thymine glycol nucleic acid, see Table 11
[0110] As will be readily understood by those skilled in the art, unless otherwise indicated by the sequence (e.g., a phosphorothioate linkage "s"), when present in an oligonucleotide, nucleotide monomers are linked to one another by 5'-3' phosphodiester linkages. As will be clearly understood by those skilled in the art, the inclusion of phosphorothioate linkages shown in the modified nucleotide sequences disclosed herein replaces the phosphodiester linkages typically present in oligonucleotides. Furthermore, those skilled in the art will readily understand that the terminal nucleotide at the 3' end of a given oligonucleotide sequence typically has a hydroxyl (-OH) group at the 3' position of each given monomer in vitro, rather than a phosphate moiety. Furthermore, in the embodiments disclosed herein, when viewing each strand from 5' to 3', an inverted abasic residue is inserted such that the 3' position of the deoxyribose is linked to the 3' end of the preceding monomer on each strand (see, e.g., Table 11). Furthermore, as one of skill in the art will readily understand and appreciate, while the chemical structures of phosphorothioates shown herein typically show an anion on the sulfur atom, the invention disclosed herein encompasses all phosphorothioate tautomers (e.g., when the sulfur atom bears a double bond and the anion is present on the oxygen atom). Unless expressly stated otherwise herein, this understanding of the art will be used when describing the TSLP RNAi agents and compositions of TSLP RNAi agents disclosed herein.
[0111] Some examples of targeting groups and linking groups used in the TSLP RNAi agents disclosed herein are included in the chemical structures provided below in Table 11. Each sense and / or antisense strand can have any targeting or linking group listed herein, as well as other targeting or linking groups, attached to the 5' and / or 3' ends of the sequence. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 4-1] [Table 4-2] [Table 5-1] [Table 5-2] [Table 6-1] [Table 6-2]
[0112] The TSLP RNAi agents disclosed herein are formed by annealing an antisense strand with a sense strand. A sense strand containing a sequence listed in Table 2, Table 4, Table 5, or Table 6 can hybridize with any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences share a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides.
[0113] As shown in Table 5 above, some exemplary TSLP RNAi agent nucleotide sequences are shown to further comprise a reactive linking group at one or both of the 5' and 3' ends of the sense strand. For example, many of the TSLP RNAi agent sense strand sequences shown in Table 5 above have a (TriAlk14) linking group at the 5' end of the nucleotide sequence. In some embodiments, other linking groups, such as an (NH2-C6) linking group, or a (6-SS-6) or (C6-SS-C6) linking group, may also or alternatively be present. Such reactive linking groups are positioned to facilitate linking of targeting ligands, targeting groups, and / or PK / PD modulators to the TSLP RNAi agents disclosed herein. Ligation or conjugation reactions are well known in the art and result in the formation of a covalent bond between two molecules or reactants. Conjugation reactions suitable for use within the scope of the present invention include, but are not limited to, amide coupling reactions, Michael addition reactions, hydrazone formation reactions, inverse demand Diels-Alder cycloaddition reactions, oxime conjugation reactions, and copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition reactions.
[0114] In some embodiments, targeting ligands, such as the integrin targeting ligands shown in the Examples and Figures disclosed herein, can be synthesized as active esters, such as tetrafluorophenyl (TFP) esters, which can be substituted with a reactive amino group (e.g., NH2-C6) to attach the targeting ligand to a TSLP RNAi agent disclosed herein. In some embodiments, targeting ligands are synthesized as azides, which can be attached to a propargyl (e.g., TriAlk14) or DBCO group, for example, via copper(I)-catalyzed or strain-promoted azide-alkyne cycloaddition.
[0115] Additionally, some nucleotide sequences can be synthesized with a dT nucleotide at the 3' end of the sense strand, followed by a (3'→5')a linker (e.g., C6-SS-C6). The linker can, in some embodiments, facilitate conjugation with additional moieties, such as a PK / PD modulator or one or more targeting ligands. As described herein, the C6-SS-C6 disulfide bond is first reduced to remove the dT from the molecule, thereby facilitating conjugation with the desired PK / PD modulator. Thus, the terminal dT nucleotide is not part of the fully conjugated construct.
[0116] In some embodiments, the antisense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the antisense strand sequences in Table 3 or Table 10. In some embodiments, the sense strand of a TSLP RNAi agent disclosed herein differs by 0, 1, 2, or 3 nucleotides from any of the sense strand sequences in Table 4, Table 5, Table 6, or Table 10.
[0117] In some embodiments, the antisense strand of a TSLP RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 3. In some embodiments, the antisense strand of a TSLP RNAi agent comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-17, 1-18, 2-18, 1-19, 2-19, 1-20, 2-20, 1-21, 2-21, 1-22, 2-22, 1-23, 2-23, 1-24, or 2-24 of any of the sequences in Table 2, Table 3, or Table 10. In some embodiments, the antisense strand of a TSLP RNAi agent comprises or consists of a modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0118] In some embodiments, the sense strand of a TSLP RNAi agent comprises the nucleotide sequence of any of the sequences in Table 2 or Table 4. In some embodiments, the sense strand of a TSLP RNAi agent comprises the nucleotide sequence (5' end to 3' end) 1-17, 2-17, 3-17, 4-17, 1-18, 2-18, 3-18, 4-18, 1-19, 2-19, 3-19, 4-19, 1-20, 2-20, 3-20, 4-20, 1-21, 2-21, 3-21, 4-21, 1-22, 2-22, 3-22, 4-22, 1-23, 2-23, 3-23, 4-23, 1-24, 2-24, 3-24, or 4-24 of any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10. In some embodiments, the sense strand of the TSLP RNAi agent comprises or consists of the modified sequence of any one of the modified sequences in Table 3 or Table 10.
[0119] In the RNAi agents disclosed herein, the nucleotide at position 1 of the antisense strand (5' to 3' end) may or may not be perfectly complementary to the TSLP gene. In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3' end) is U, A, or dT (or modified forms of U, A, or dT). In some embodiments, the nucleotide at position 1 of the antisense strand (5' to 3' end) forms an A:U or U:A base pair with the sense strand.
[0120] In some embodiments, the antisense strand of a TSLP RNAi agent comprises nucleotide sequence (5' to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10. In some embodiments, the sense strand of a TSLP RNAi agent comprises nucleotide sequence (5' to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0121] In some embodiments, the TSLP RNAi agent comprises (i) an antisense strand comprising nucleotide sequence (5' end to 3' end) 2-18 or 2-19 of any of the antisense strand sequences in Table 2, Table 3, or Table 10, and (ii) a sense strand comprising nucleotide sequence (5' end to 3' end) 1-17 or 1-18 of any of the sense strand sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0122] A sense strand containing a sequence listed in Table 2 or Table 4 can hybridize to any antisense strand containing a sequence listed in Table 2 or Table 3, provided that the two sequences have a region of at least 85% complementarity over a sequence of 16, 17, 18, 19, 20, or 21 contiguous nucleotides. In some embodiments, a TSLP RNAi agent has a sense strand consisting of a modified sequence from any of Tables 4, 5, 6, or 10, and an antisense strand consisting of a modified sequence from any of Tables 3 or 10. Some representative sequence pairings are illustrated by the duplex ID numbers shown in Tables 7A, 7B, 8, and 9.
[0123] In some embodiments, the TSLP RNAi agent comprises, consists of, or consists essentially of a duplex represented by any one of the duplex ID numbers set forth herein. In some embodiments, the TSLP RNAi agent consists of any of the duplex ID numbers set forth herein. In some embodiments, the TSLP RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers set forth herein. In some embodiments, the TSLP RNAi agent comprises the sense and antisense strand nucleotide sequences of any of the duplex ID numbers set forth herein, and a targeting group, a linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached (i.e., bound) to the sense or antisense strand. In some embodiments, the TSLP RNAi agent comprises the modified sense and antisense strand nucleotide sequences of any of the duplex ID numbers set forth herein. In some embodiments, a TSLP RNAi agent comprises a modified nucleotide sequence of the sense strand and antisense strand of any of the duplex ID numbers set forth herein, and a targeting group, a linking group, and / or other non-nucleotide group, wherein the targeting group, linking group, and / or other non-nucleotide group is covalently attached to the sense strand or the antisense strand.
[0124] In some embodiments, a TSLP RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, 7A, 7B, 8, 9, or 10, and comprises a targeting group. In some embodiments, a TSLP RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, 7A, 7B, 8, 9, or 10, and comprises one or more αvβ6 integrin targeting ligands.
[0125] In some embodiments, a TSLP RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, 7A, 7B, 8, 9, or 10, and comprises a targeting group that is an integrin targeting ligand. In some embodiments, a TSLP RNAi agent comprises an antisense strand and a sense strand having the nucleotide sequence of any of the antisense strand / sense strand duplexes in Table 2, 7A, 7B, 8, 9, or 10, and comprises one or more αvβ6 integrin targeting ligands or clusters of αvβ6 integrin targeting ligands (e.g., tridentate αvβ6 integrin targeting ligands).
[0126] In some embodiments, a TSLP RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense / sense duplexes in Tables 7A, 7B, 8, 9, and 10.
[0127] In some embodiments, the TSLP RNAi agent comprises an antisense strand and a sense strand having a modified nucleotide sequence of any of the antisense / sense duplexes in Tables 7A, 7B, 8, 9, and 10, and comprises an integrin-targeting ligand.
[0128] In some embodiments, the TSLP RNAi agent comprises, consists of, or consists essentially of any of the duplexes in Tables 7A, 7B, 8, 9, and 10.
[0129] [Table 7A-1] [Table 7A-2] [Table 7A-3]
[0130] [Table 7B-1] [Table 7B-2] [Table 7B-3]
[0131] [Table 8-1] [Table 8-2] [Table 8-3] [Table 8-4]
[0132] [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4]
[0133] Double ID numbers AC001714 and AC002515 contain rat-specific sequences designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and have no homology to the human TSLP gene.
[0134] [Table 10-1] [Table 10-2] [Table 10-3] [Table 10-4] [Table 10-5] [Table 10-6] [Table 10-7] [Table 10-8]
[0135] In some embodiments, the TSLP RNAi agent is prepared or provided as a salt, mixed salt, or free acid. In some embodiments, the TSLP RNAi agent is prepared or provided as a pharmaceutically acceptable salt. In some embodiments, the TSLP RNAi agent is prepared or provided as a pharmaceutically acceptable sodium salt or potassium salt. In some embodiments, the TSLP RNAi agent is prepared or provided as a pharmaceutically acceptable sodium salt. The RNAi agents described herein inhibit or knock down expression of one or more TSLP genes in vivo and / or in vitro when delivered to cells expressing the TSLP gene.
[0136] Targeting Groups, Linking Groups, Pharmacokinetic / Pharmacodynamic (PK / PD) Modifiers, and Delivery Vehicles In some embodiments, the TSLP RNAi agent comprises or is attached to one or more non-nucleotide groups, including, but not limited to, a targeting group, a linking group, a pharmacokinetic / pharmacodynamic (PK / PD) modifier, a delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the RNAi agent. The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the sense strand and / or the antisense strand. In some embodiments, the TSLP RNAi agent comprises a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, the non-nucleotide group is linked to the 5' end of the sense strand of the TSLP RNAi agent. The non-nucleotide group can be linked directly or indirectly to the RNAi agent via a linker / linking group. In some embodiments, the non-nucleotide group is linked to the RNAi agent via a labile, cleavable, or reversible bond or linker.
[0137] In some embodiments, the non-nucleotide group enhances the pharmacokinetic or biodistribution properties of the RNAi agent or conjugate to which it is attached, improving cell- or tissue-specific distribution and cell-specific uptake of the conjugate. In some embodiments, the non-nucleotide group enhances endocytosis of the RNAi agent.
[0138] Targeting groups or targeting moieties enhance the pharmacokinetic or biodistribution properties of the conjugates or RNAi agents to which they are attached, improving cell-specific (and in some cases organ-specific) distribution and cell-specific (or organ-specific) uptake of the conjugates or RNAi agents. Targeting groups can be monovalent, divalent, trivalent, tetravalent, or have higher valency relative to the intended target. Exemplary targeting groups include, but are not limited to, compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies, monoclonal antibodies, antibody fragments, and antibody mimetics with affinity for cell surface molecules. In some embodiments, the targeting group is linked to the RNAi agent using a linker such as a PEG linker or one, two, or three abasic and / or ribitol (abasic ribose) residues, which can optionally function as a linker.
[0139] The targeting group, with or without a linker, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10. The linker, with or without a targeting group, can be attached to the 5' or 3' end of any of the sense and / or antisense strands disclosed in Tables 2, 3, 4, 5, 6, and 10.
[0140] The TSLP RNAi agents described herein can be synthesized with reactive groups, such as amino groups (also referred to herein as amines), at the 5' and / or 3' ends, which can then be used to attach targeting moieties using methods common in the art.
[0141] For example, in some embodiments, a TSLP RNAi agent disclosed herein is synthesized with an NH2-C6 group at the 5'-end of the sense strand of the RNAi agent. The terminal amino group can then be reacted with, for example, a group comprising an αvβ6 integrin targeting ligand to form a conjugate. In some embodiments, a TSLP RNAi agent disclosed herein is synthesized with one or more alkyne groups at the 5'-end of the sense strand of the RNAi agent. The terminal alkyne groups can then be reacted with, for example, a group comprising an αvβ6 integrin targeting ligand to form a conjugate.
[0142] In some embodiments, the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αvβ6 integrin targeting ligand. The use of an αvβ6 integrin targeting ligand facilitates cell-specific targeting to cells bearing αvβ6 on their surface, and binding of the integrin targeting ligand can facilitate entry of a therapeutic agent, such as an RNAi agent, to which it is linked, into cells, such as epithelial cells, including lung epithelial cells and renal epithelial cells. The integrin targeting ligand can be monomeric or monovalent (e.g., having a single integrin targeting moiety), or multimeric or multivalent (e.g., having multiple integrin targeting moieties). The targeting group can be attached to the 3' and / or 5' end of the RNAi oligonucleotide using methods known in the art. Preparation of targeting groups such as αvβ6 integrin targeting ligands is described, for example, in International Patent Application Publication No. WO 2018 / 085415 and International Patent Application Publication No. WO 2019 / 089765, the contents of each of which are incorporated herein by reference in their entirety.
[0143] In some embodiments, targeting group is linked to TSLP RNAi agent without using additional linker.In some embodiments, targeting group is designed with existing linker to facilitate linking to TSLP RNAi agent.In some embodiments, when composition contains more than two kinds of RNAi agent, two or more kinds of RNAi agent can be linked to each targeting group using the same linker.In some embodiments, when composition contains two or more RNAi agent, two or more RNAi agent are linked to each targeting group using different linker.
[0144] In some embodiments, a linking group is attached to the RNAi agent. The linking group facilitates covalent attachment of the agent to a targeting group, pharmacokinetic modifier, delivery polymer, or delivery vehicle. The linking group can be attached to the 3'-end and / or 5'-end of the sense or antisense strand of the RNAi agent. In some embodiments, the linking group is attached to the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5'-end or 3'-end of the sense strand of the RNAi agent. In some embodiments, the linking group is attached to the 5'-end of the sense strand of the RNAi agent. Examples of linking groups include, but are not limited to, C6-SS-C6, 6-SS-6, reactive groups such as primary amines (e.g., NH2-C6), and alkynes, alkyl groups, abasic residues / nucleotides, amino acids, trialkyne functionalized groups, ribitol, and / or PEG groups. Some example linking groups are shown in Table 11.
[0145] A linker or linking group is a bond between two atoms that connects one chemical group (e.g., an RNAi agent) or segment of interest to another chemical group (e.g., a targeting group, a pharmacokinetic modifier, or a delivery polymer) or segment of interest via one or more covalent bonds. A labile linkage includes a labile bond. A linkage can optionally include a spacer, which increases the distance between the two linked atoms. A spacer can further add flexibility and / or length to the linkage. Spacers include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, aralkyl, aralkenyl, and aralkynyl groups. Each of these can include one or more heteroatoms, heterocycles, amino acids, nucleotides, and sugars. Spacer groups are known in the art, and the foregoing list is not intended to limit the scope of this specification. In some embodiments, a TSLP RNAi agent is linked to a hydrophobic group having 12 or more carbon atoms (e.g., a polyethylene glycol (PEG) moiety, or a cholesterol or palmitoyl group).
[0146] In some embodiments, the TSLP RNAi agent is linked to one or more pharmacokinetic / pharmacodynamic (PK / PD) modifiers. PK / PD modifiers can extend the circulation time of the bound drug and / or enhance the activity of the RNAi agent through improved cell receptor binding, improved cellular uptake, and / or other means. A variety of PK / PD modifiers suitable for use with RNAi agents are known in the art. In some embodiments, the PK / PD modifier can be a cholesterol or cholesteryl derivative, or, in some contexts, the PK / PD modifier can include an alkyl group, an alkenyl group, an alkynyl group, an aryl group, an aralkyl group, an aralkenyl group, or an aralkynyl group, each of which may be linear, branched, cyclic, and / or substituted or unsubstituted. In some embodiments, the attachment position of these moieties is at the 5' or 3' end of the sense strand, the 2' position of the ribose ring of specific nucleotides of the sense strand, and / or they are attached to the phosphate or phosphorothioate backbone at any position of the sense strand.
[0147] Any TSLP RNAi agent nucleotide sequence listed in Tables 2, 3, 4, 5, 6, and 10 can include a 3' and / or 5' targeting group, linking group, and / or PK / PD modulator, whether modified or unmodified. Any TSLP RNAi agent sequence listed in Tables 3, 4, 5, 6, and 10 or otherwise described herein that includes a 3' or 5' targeting group, linking group, and / or PK / PD modulator can alternatively not include a 3' or 5' targeting group, linking group, or PK / PD modulator, or can include a different 3' or 5' targeting group, linking group, or pharmacokinetic modulator (including, but not limited to, those shown in Table 11). Any of the TSLP RNAi agent duplexes listed in Tables 7A, 7B, 8, 9, and 10, whether modified or unmodified, can further include a targeting group or linking group (including but not limited to those shown in Table 11), and the targeting group or linking group can be attached to the 3' or 5' end of either the sense or antisense strand of the TSLP RNAi agent duplex.
[0148] Examples of some modified nucleotides, capping moieties, and linking groups are shown in Table 11. [Table 11-1] [Table 11-2] [Table 11-3] [Table 11-4]
[0149] Alternatively, other linking groups known in the art may be used. In many cases, the linking groups are commercially available or are incorporated into commercially available nucleotide phosphoramidites. (See, e.g., International Patent Application Publication No. WO2019 / 161213, which is incorporated herein by reference in its entirety.)
[0150] In some embodiments, the TSLP RNAi agent is delivered unlinked to a targeting ligand or pharmacokinetic / pharmacodynamic (PK / PD) modifier (referred to as "naked" or "naked RNAi agent").
[0151] In some embodiments, the TSLP RNAi agent is conjugated to a targeting group, a linking group, a PK modulator, and / or another non-nucleotide group to facilitate in vivo delivery of the TSLP RNAi agent to selected cells or tissues (e.g., epithelial cells). In some embodiments, the TSLP RNAi agent is conjugated to a targeting group, wherein the targeting group comprises an integrin targeting ligand. In some embodiments, the integrin targeting ligand is an αββ integrin targeting ligand. In some embodiments, the targeting group comprises one or more αββ integrin targeting ligands.
[0152] In some embodiments, RNAi agents can be delivered to cells or tissues using a delivery vehicle. A delivery vehicle is a compound that improves the delivery of RNAi agents to cells or tissues. Delivery vehicles include, but are not limited to, polymers, such as amphiphilic polymers, membrane-active polymers, peptides, melittin peptides, melittin-like peptides (MLPs), lipids, reversibly modified polymers or peptides, or reversibly modified membrane-active polyamines.
[0153] In some embodiments, RNAi agents can be combined with lipids, nanoparticles, polymers, liposomes, micelles, DPCs, or other delivery systems available in the art for nucleic acid delivery.RNAi agents can also be chemically bound to targeting groups, lipids (including but not limited to cholesteryl and cholesteryl derivatives), encapsulated in nanoparticles, liposomes, micelles, bound to polymers or DPCs (see, for example, WO2000 / 053722, WO2008 / 022309, WO2011 / 104169, and WO2012 / 083185, WO2013 / 032829, WO2013 / 158141, each of which is incorporated herein by reference), by iontophoresis, or by being incorporated into other delivery vehicles or systems available in the art (for example, hydrogels, cyclodextrins, biodegradable nanocapsules, bioadhesive microspheres, or proteinaceous vectors). In some embodiments, the RNAi agent can be bound to an antibody with affinity for pulmonary epithelial cells. In some embodiments, the RNAi agent can be bound to a target ligand with affinity for pulmonary epithelial cells or a receptor present on pulmonary epithelial cells.
[0154] Pharmaceutical Compositions and Formulations The TSLP RNAi agents disclosed herein can be prepared as pharmaceutical compositions (also referred to as pharmaceutical formulations or medicaments). The pharmaceutical compositions disclosed herein contain at least one TSLP RNAi agent. These pharmaceutical compositions are particularly useful for inhibiting TSLP mRNA expression in a target cell, cell population, tissue, or organism. The pharmaceutical compositions can be used to treat subjects with a disease, disorder, or condition that would benefit from reduced target mRNA levels or inhibited target gene expression. The pharmaceutical compositions can be used to treat subjects at risk of developing a disease or disorder that would benefit from reduced target mRNA levels or inhibited target gene expression. In one embodiment, the method comprises administering to a subject to be treated a TSLP RNAi agent linked to a targeting ligand described herein. In some embodiments, one or more pharmaceutically acceptable excipients (including vehicles, carriers, diluents, and / or delivery polymers) are added to a pharmaceutical composition containing a TSLP RNAi agent, thereby forming a pharmaceutical formulation or medicament suitable for in vivo delivery to a subject, including a human.
[0155] Pharmaceutical compositions comprising a TSLP RNAi agent and methods disclosed herein involve administering to a subject a therapeutically effective amount of a TSLP RNAi agent described herein, thereby inhibiting expression of TSLP mRNA in the subject, thereby reducing the level of target mRNA in a cell, group of cells, tissue, organ, or subject. In some embodiments, the subject has previously been identified or diagnosed with a disease or disorder that may be mediated, at least in part, by decreased TSLP expression. In some embodiments, the subject has been previously diagnosed with one or more pulmonary diseases, such as asthma (including allergic asthma), chronic obstructive pulmonary disease (including, but not limited to, chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including, but not limited to, systemic sclerosis (SSc)), and multiple inflammatory diseases (including, but not limited to, atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis).
[0156] Embodiments of the present disclosure include pharmaceutical compositions for delivering a TSLP RNAi agent to lung epithelial cells in vivo. Such pharmaceutical compositions can include, for example, a TSLP RNAi agent bound to a targeting group that includes an integrin targeting ligand. In some embodiments, the integrin targeting ligand includes an αβ integrin ligand.
[0157] In some embodiments, the described pharmaceutical compositions comprising TSLP RNAi agents are used to treat or manage clinical conditions in subjects who would benefit from inhibition of TSLP expression. In some embodiments, a therapeutically or prophylactically effective amount of one or more pharmaceutical compositions is administered to a subject in need of such treatment. In some embodiments, administration of any of the disclosed TSLP RNAi agents can be used to reduce the number, severity, and / or frequency of disease symptoms in a subject.
[0158] In some embodiments, the described TSLP RNAi agents are optionally combined with one or more additional (i.e., second, third, etc.) therapeutic agents. The second therapeutic agent can be another TSLP RNAi agent (e.g., a TSLP RNAi agent that targets a different sequence within the TSLP gene). In some embodiments, the second therapeutic agent can be an RNAi agent that targets the TSLP gene. The additional therapeutic agent can be a small molecule drug, an antibody, an antibody fragment, and / or an aptamer. The TSLP RNAi agent, with or without one or more additional therapeutic agents, can be combined with one or more excipients to form a pharmaceutical composition.
[0159] The described pharmaceutical compositions comprising a TSLP RNAi agent can be used to treat at least one symptom in a subject with a disease or disorder that would benefit from reducing or inhibiting TSLP mRNA expression. In some embodiments, the subject is administered a therapeutically effective amount of one or more pharmaceutical compositions comprising a TSLP RNAi agent, thereby treating the symptom. In other embodiments, the subject is administered a prophylactically effective amount of one or more TSLP RNAi agents, thereby preventing or suppressing at least one symptom.
[0160] In some embodiments, one or more of the described TSLP RNAi agents are administered to a mammal in a pharmaceutically acceptable carrier or diluent. In some embodiments, the mammal is a human.
[0161] The route of administration is the route by which a TSLP RNAi agent is brought into contact with the body. Generally, methods for administering drugs, oligonucleotides, and nucleic acids for the treatment of mammals are known in the art and are applicable to the administration of the compositions described herein. The TSLP RNAi agents disclosed herein can be administered by any suitable route in a formulation appropriately adapted for the particular route of administration. Thus, in some embodiments, the pharmaceutical compositions described herein are administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal aspiration administration. In some embodiments, the pharmaceutical compositions can be administered by injection, e.g., intravenously, intramuscularly, intradermally, subcutaneously, intraarticularly, intraocularly, or intraperitoneally, or topically.
[0162] Pharmaceutical compositions containing the TSLP RNAi agents described herein can be delivered to a cell, group of cells, tissue, or subject using oligonucleotide delivery techniques known in the art. Generally, any suitable art-recognized method for delivering nucleic acid molecules (in vitro or in vivo) can be adapted for use with the compositions described herein. For example, delivery can be by local administration (e.g., direct injection, implantation, or topical administration), systemic administration, or by subcutaneous, intravenous, intraperitoneal, or parenteral routes (including intracranial (e.g., intraventricular, intraparenchymal, and intraspinal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration). In some embodiments, the compositions are administered by inhalation, intranasal administration, oropharyngeal aspiration, or intratracheal administration.
[0163] For example, in some embodiments, the TSLP RNAi agents described herein are desired to inhibit TSLP gene expression in pulmonary epithelia, for which administration by inhalation (e.g., an inhaler such as a metered-dose inhaler, a nebulizer such as a jet or vibrating mesh nebulizer, or a soft mist inhaler) is particularly suitable and advantageous.
[0164] In some embodiments, the pharmaceutical compositions described herein comprise one or more pharmaceutically acceptable excipients. The pharmaceutical compositions described herein are formulated for administration to a subject.
[0165] As used herein, a pharmaceutical composition comprises a pharmacologically effective amount of at least one described therapeutic compound and one or more pharmaceutically acceptable excipients. A pharmaceutically acceptable excipient (excipient) is a substance other than an active pharmaceutical ingredient (API, therapeutic agent, e.g., TSLP RNAi agent) that is intentionally included in a drug delivery system. The excipient does not exert, or is not intended to exert, a therapeutic effect at the intended dosage. An excipient can act to a) aid in processing of the drug delivery system during manufacturing; b) protect, support, or enhance API stability, bioavailability, or patient acceptability; c) aid in product identification; and / or d) enhance other characteristics related to the overall safety and efficacy of the API delivery during storage (stoTSLP) or use. Pharmaceutically acceptable excipients may or may not be inert substances.
[0166] Excipients include, but are not limited to, absorption enhancers, anti-adherents, anti-foaming agents, antioxidants, binders, buffers, carriers, coatings, colorants, delivery enhancers, delivery polymers, detergents, dextran, glucose, diluents, disintegrants, emulsifiers, bulking agents, fillers, flavoring agents, glidants, humectants, lubricants, oils, polymers, preservatives, saline, salts, solvents, sugars, surfactants, suspending agents, sustained release matrices, sweeteners, thickeners, tonicity agents, vehicles, water repellents, and wetting agents.
[0167] Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, sterile water, Cremophor® EL™ (BASF, Parsippany, NJ), or phosphate-buffered saline (PBS). It should be stable under the conditions of manufacture and storage and preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, liquid polyethylene glycol), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants. In many cases, it will be preferable to include isotonic agents, such as sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Prolonged absorption of injectable compositions can be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.
[0168] Sterile injectable solutions can be prepared by incorporating the required amount of active compound into a suitable solvent with one or a combination of the ingredients listed above, as needed, followed by filtered sterilization. Generally, dispersions are prepared by adding the active compound to a sterile vehicle (containing a basic dispersion medium and other required ingredients from the ingredients listed above). In the case of sterile powders for preparing sterile injectable solutions, preparation methods include vacuum drying and freeze-drying, which yields a powder of the active ingredient plus any additional desired ingredients from its previously sterile-filtered solution.
[0169] Formulations suitable for intra-articular administration may be in the form of a sterile aqueous preparation of the drug, which may be in microcrystalline form, for example, in the form of an aqueous microcrystalline suspension. Liposomal formulations or biodegradable polymer systems may also be used to present the drug for both intra-articular and ophthalmic administration.
[0170] The formulation suitable for inhalation administration can be prepared by incorporating the desired amount of active compound into a suitable solvent, followed by sterile filtration.Generally, the formulation for inhalation administration is a sterile solution at physiological pH and has low viscosity (<5 cP).Salt can be added to the formulation to adjust tonicity.In some cases, surfactants or cosolvents can be added to increase the solubility of active compound and improve aerosol properties.In some cases, excipients can be added to control viscosity, thereby ensuring the size and distribution of spray droplets.
[0171] In some embodiments, pharmaceutical formulations comprising a TSLP RNAi agent disclosed herein suitable for inhaled administration can be prepared in water for injection (sterile water) or aqueous sodium phosphate buffer (e.g., an aqueous solution comprising a TSLP RNAi agent formulated with 0.5 mM sodium phosphate monobasic, 0.5 mM sodium phosphate dibasic).
[0172] The active compound can be prepared using a carrier that protects the compound from rapid excretion from the body, such as a controlled-release formulation, including implants and microencapsulated delivery systems.Biodegradable, biocompatible polymers, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid, can be used.Methods for preparing such formulations will be clear to those skilled in the art.Liposomal suspensions can also be used as pharmaceutically acceptable carriers.These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Patent No. 4,522,811.
[0173] TSLP RNAi agents can be formulated as dosage unit compositions for ease of administration and uniformity of dosage.Dosage unit form refers to a physically discrete unit suitable as a single administration to a subject to be treated, each unit containing a predetermined amount of active compound calculated to produce a desired therapeutic effect in combination with the necessary pharmaceutical carrier.The specifications of the dosage unit forms of the present disclosure are determined and directly depend on the inherent characteristics of the active compound and the therapeutic effect to be exhibited, as well as the inherent limitations of the technology for compounding such active compounds for individual treatment.
[0174] The pharmaceutical composition may contain other additional ingredients that are typically included in pharmaceutical compositions. Such additional ingredients include, but are not limited to, antipruritics, astringents, local anesthetics, or anti-inflammatory agents (e.g., antihistamines, diphenhydramine, etc.). Cells, tissues, or isolated organs that express or contain the RNAi agent defined herein are also contemplated for use as a "pharmaceutical composition." As used herein, the terms "pharmacologically effective amount," "therapeutically effective amount," or simply "effective amount" refer to the amount of an RNAi agent that produces a pharmacological, therapeutic, or preventative result.
[0175] In some embodiments, the methods disclosed herein further comprise administering a second therapeutic agent or treatment in addition to administering an RNAi agent disclosed herein. In some embodiments, the second therapeutic agent is another TSLP RNAi agent (e.g., a TSLP RNAi agent that targets a different sequence within the TSLP target). In other embodiments, the second therapeutic agent can be a small molecule agent, an antibody, an antibody fragment, and / or an aptamer.
[0176] In some embodiments, compositions comprising a combination or cocktail of at least two TSLP RNAi agents having different sequences are described herein. In some embodiments, two or more TSLP RNAi agents are each separately and independently linked to a targeting group. In some embodiments, two or more TSLP RNAi agents are each linked to a targeting group that comprises or consists of an integrin targeting ligand. In some embodiments, two or more TSLP RNAi agents are each linked to a targeting group that comprises or consists of an αββ integrin targeting ligand.
[0177] Described herein are compositions for delivering TSLP RNAi agents to lung epithelial cells. Additionally, outlined herein are compositions for in vivo delivery of TSLP RNAi agents to cells, including renal epithelial cells, and / or epithelial cells of the digestive tract or reproductive organs, and / or surface epithelial cells of the eye.
[0178] Generally, an effective amount of a TSLP RNAi agent disclosed herein ranges from about 0.0001 to about 20 mg / kg body weight / deposited dose, e.g., from about 0.001 to about 5 mg / kg body weight / deposited dose. In some embodiments, an effective amount of a TSLP RNAi agent ranges from about 0.01 mg / kg body weight to about 3.0 mg / kg body weight / deposited dose. In some embodiments, an effective amount of a TSLP RNAi agent ranges from about 0.03 mg / kg to about 2.0 mg / kg body weight / deposited dose. In some embodiments, an effective amount of a TSLP RNAi agent ranges from about 0.01 mg / kg to about 1.0 mg / kg body weight / deposited dose. In some embodiments, an effective amount of a TSLP RNAi agent ranges from about 0.50 mg / kg to about 1.0 mg / kg body weight / deposited dose. Calculation of the lung deposited dose (PDD) is performed according to methods known in the art. (See Wolff RK, Dorato MA, Toxicologic Testing of Inhaled Pharmaceutical Aerosols, Crit Rev Toxicol., 1993; 23(4):343-369; Tepper et al., International J. Toxicology, 2016, vol. 35(4):376-392.) The amount administered will also depend on variables such as the patient's overall health, the relative biological potency of the administered compound, the drug formulation, the presence and type of excipients in the formulation, and the route of administration. It should also be understood that the initial dose administered may be increased beyond the upper limit set forth above, or the initial dose may be less than optimal, in order to rapidly achieve the desired blood or tissue levels. In some embodiments, the dose is administered daily. In some embodiments, the dose is administered weekly. In further embodiments, the dose is administered every two weeks, every three weeks, once a month, or once a quarter (i.e., once every three months).
[0179] For the treatment of a disease or for formulating a drug or composition for the treatment of a disease, the pharmaceutical compositions described herein containing a TSLP RNAi agent can be combined with an excipient or with a second therapeutic agent or treatment (including, but not limited to, a second or other RNAi agent, a small molecule drug, an antibody, an antibody fragment, a peptide, and / or an aptamer).
[0180] The described TSLP RNAi agents, when added to a pharmaceutically acceptable excipient or adjuvant, can be packaged in a kit, container, pack, or dispenser. The pharmaceutical compositions described herein can be packaged in a dry powder or aerosol inhaler, other metered-dose inhaler, nebulizer, pre-filled syringe, or vial.
[0181] Methods for treating and inhibiting TSLP expression The TSLP RNAi agents disclosed herein can be used to treat subjects (e.g., humans or other mammals) having a disease or disorder for which administration of an RNAi agent would be beneficial. In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) for which reduction and / or inhibition of TSLP mRNA expression and / or reduction of TSLP cytokine levels would be beneficial.
[0182] In some embodiments, the RNAi agents disclosed herein can be used to treat subjects (e.g., humans) with diseases or disorders in which reducing TSLP cytokine levels would be beneficial. Such diseases or disorders include, but are not limited to, chronic obstructive pulmonary disease (including, but not limited to, chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including, but not limited to, systemic sclerosis (SSc)), and multiple inflammatory diseases (including, but not limited to, atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis). In some embodiments, the disease is allergic asthma. In some embodiments, the subject has previously been diagnosed with asthma, more specifically allergic asthma, or other pulmonary inflammatory diseases. Treatment of the subject can include therapeutic and / or prophylactic treatment. The subject is administered a therapeutically effective amount of any one or more TSLP RNAi agents described herein. The subject can be a human, a patient, or a human patient. The subject can be an adult, an adolescent, a child, or an infant. The pharmaceutical compositions described herein can be administered to humans or animals.
[0183] Elevated levels of the TSLP cytokine are known to contribute to abnormalities in the function of epithelial cells, fibroblasts, and immune cells, and have been associated with fibrosis, particularly in lung tissue and cells. In some embodiments, the described TSLP RNAi agents are used to treat at least one symptom in a subject that is mediated, at least in part, by decreased TSLP cytokine levels. The subject is administered a therapeutically effective amount of any one or more of the described TSLP RNAi agents. In some embodiments, the subject is administered a prophylactically effective amount of any one or more of the described RNAi agents, thereby preventing or suppressing at least one symptom, thereby treating the subject.
[0184] In some embodiments, the present disclosure provides a method of treating a disease, disorder, condition, or pathology mediated, at least in part, by TSLP gene expression in a patient in need of treatment, wherein the method comprises administering to the patient any of the TSLP RNAi agents described herein.
[0185] In some embodiments, a TSLP RNAi agent is used to treat or manage a clinical symptom or condition in a subject, wherein the clinical symptom or condition is mediated, at least in part, by decreased TSLP expression. The subject is administered a therapeutically effective amount of any one or more of the TSLP RNAi agents or TSLP RNAi agent-containing compositions described herein. In some embodiments, the method comprises administering to the subject to be treated a composition comprising a TSLP RNAi agent described herein.
[0186] In a further aspect, the disclosure provides methods for treating (including therapeutic or prophylactic treatment of) a disease or condition that can be addressed by reducing TSLP cytokine levels, the methods comprising administering to a subject in need thereof a TSLP RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10. Also described herein are compositions for use in such methods.
[0187] The described TSLP RNAi agents and / or compositions comprising the TSLP RNAi agents can be used in methods for the therapeutic treatment of diseases or conditions caused by enhanced or elevated levels of the TSLP cytokine. Such methods include administering a TSLP RNAi agent described herein to a subject, e.g., a human or animal subject.
[0188] In another aspect, the disclosure provides a method for treating (including prophylactic treatment of) a pathological condition (such as a symptom or disease) mediated at least in part by TSLP expression, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10.
[0189] In some embodiments, disclosed herein are methods for inhibiting expression of the TSLP gene, wherein the method comprises administering to a cell an RNAi agent comprising an antisense strand comprising any of the sequences in Table 2, Table 3, or Table 10.
[0190] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment of) a pathological condition mediated at least in part by expression of the TSLP gene, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0191] In some embodiments, disclosed herein are methods of inhibiting expression of the TSLP gene, wherein the method comprises administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 2, Table 4, Table 5, Table 6, or Table 10.
[0192] In some embodiments, disclosed herein are methods for treating (including prophylactic treatment of) a pathological condition mediated at least in part by expression of the TSLP gene, wherein the method comprises administering to a subject a therapeutically effective amount of an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising any of the sequences in Table 3 or Table 10.
[0193] In some embodiments, disclosed herein are methods of inhibiting expression of the TSLP gene, wherein the method comprises administering to a cell an RNAi agent comprising a sense strand comprising any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand comprising any of the sequences in Table 3 or Table 10.
[0194] In some embodiments, methods of inhibiting expression of the TSLP gene are disclosed herein, wherein the methods comprise administering to a subject an RNAi agent comprising a sense strand consisting of the nucleobase sequence of any of the sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of the nucleobase sequence of any of the sequences in Table 3 or Table 10. In other embodiments, methods of inhibiting expression of the TSLP gene are disclosed herein, wherein the methods comprise administering to a subject a TSLP RNAi agent comprising a sense strand consisting of a modified sequence of any of the modified sequences in Table 4, Table 5, Table 6, or Table 10, and an antisense strand consisting of a modified sequence of any of the modified sequences in Table 3 or Table 10.
[0195] In some embodiments, disclosed herein are methods for inhibiting expression of the TSLP gene in a cell, wherein the method comprises administering one or more RNAi agents comprising a duplex structure of one of the duplexes set forth in Tables 7A, 7B, 8, 9, and 10.
[0196] In some embodiments, TSLP gene expression levels and / or TSLP mRNA levels in some lung epithelial cells of a subject administered a described TSLP RNAi agent are reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99% or more compared to the respective levels in the subject before administration of the TSLP RNAi agent or compared to a different subject not administered the TSLP RNAi agent. In some embodiments, a subject administered a described TSLP RNAi agent has a TSLP cytokine level in some epithelial cells or a circulating TSLP cytokine level that is reduced by at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 99% or more compared to the subject before administration of the TSLP RNAi agent or compared to another subject not administered the TSLP RNAi agent. The subject's gene expression levels, cytokine or protein levels, and / or mRNA levels can be reduced in cells, cell populations, serum, and / or tissues of the subject. In some embodiments, TSLP cytokine levels in a particular subject administered a described TSLP RNAi agent are reduced by at least about 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 98% compared to the subject prior to administration of the TSLP RNAi agent or compared to a subject not administered the TSLP RNAi agent.
[0197] Reductions in gene expression, mRNA, and cytokine or protein levels can be assessed by any method known in the art. A reduction or decrease in TSLP cytokine levels or TSLP mRNA levels may be collectively referred to herein as a decrease, reduction, or inhibition of TSLP gene expression. The examples provided herein demonstrate known methods for assessing TSLP inhibition.
[0198] Cells, tissues, organs, and non-human organisms Contemplated are cells, tissues, organs, and non-human organisms that contain at least one of the TSLP RNAi agents described herein, which are generated by delivering the RNAi agent to the cell, tissue, organ, or non-human organism.
[0199] References Adhikary, PP, et al. (2021). "TSLP as druggable target - a silver-lining for atopic diseases?" Pharmacol Ther 217: 107648. Al-Shami, A., et al. (2005). "A role for TSLP in the development of inflammation in an asthma model." J Exp Med 202(6): 829-839. Adhikary, PP, et al. (2021). "TSLP as druggable target - a silver-lining for atopic diseases?" Pharmacol Ther 217: 107648. Chen, Z. et al. (2018). "Thymic stromal lymphopoietin contribution to the recruitment of circulating fibrocytes to the lung in a mouse model of chronic allergic asthma." J Asthma 55(9): 975-983. Corren, J., et al. (2017). "Tezepelumab in Adults with Uncontrolled Asthma." N Engl J Med 377(10): 936-946. Diver, S., et al. (2021). "Effect of tezepelumab on airway inflammatory cells, remodelling, and hyperresponsiveness in patients with moderate-to-severe uncontrolled asthma (CASCADE): a double-blind, randomised, placebo-controlled, phase 2 trial." Lancet Respir Med 9(11): 1299-1312. Gauvreau, G. M., et al. (2020). "Thymic stromal lymphopoietin: its role and potential as a therapeutic target in asthma." Expert Opin Ther Targets 24(8): 777-792. Hu, Y., et al. (2017). "TSLP signaling blocking alleviates E-cadherin dysfunction of airway epithelium in a HDM-induced asthma model." Cell Immunol 315: 56-63. Li, Y. L., et al. (2010). "Thymic stromal lymphopoietin promotes lung inflammation through activation of dendritic cells." J Asthma 47(2): 117-123. Menzies-Gow, A., et al. (2021). "Tezepelumab in Adults and Adolescents with Severe, Uncontrolled Asthma." N Engl J Med 384(19): 1800-1809. Pandey, A., et al. (2000). "Cloning of a receptor subunit required for signaling by thymic stromal lymphopoietin." Nat Immunol 1(1): 59-64. Parnes, J. R., et al. (2022). "Targeting TSLP in Asthma." J Asthma Allergy 15: 749-765. Pelaia, C., et al. (2021). "Tezepelumab: A Potential New Biological Therapy for Severe Refractory Asthma." Int J Mol Sci 22(9). Puzzovio, P. G., et al. (2022). "Tezepelumab administration in moderate-to-severe uncontrolled asthma: Is it all about eosinophils?" J Allergy Clin Immunol 149(5): 1582-1584. Torgerson, D. G., et al. (2011). "Meta-analysis of genome-wide association studies of asthma in ethnically diverse North American populations." Nat Genet 43(9): 887-892. Ying, S., et al. (2008). "Expression and cellular provenance of thymic stromal lymphopoietin and chemokines in patients with severe asthma and chronic obstructive pulmonary disease." J Immunol 181(4): 2790-2798. Ying, S., et al. (2005). "Thymic stromal lymphopoietin expression is increased in asthmatic airways and correlates with expression of Th2-attracting chemokines and disease severity." J Immunol 174(12): 8183-8190. Yu, G., et al. (2019). "Thymic stromal lymphopoietin (TSLP) and Toluene-diisocyanate-induced airway inflammation: Alleviation by TSLP neutralizing antibody." Toxicol Lett 317: 59-67. Zhou, B., et al. (2005). "Thymic stromal lymphopoietin as a key initiator of allergic airway inflammation in mice." Nat Immunol 6(10): 1047-1053.
[0200] Additional Exemplary Embodiments Some additional exemplary embodiments of the disclosed technology are provided herein, which are illustrative and do not limit the scope of the disclosure or the claims appended hereto. 1. An RNAi agent for inhibiting the expression of the thymic stromal lymphopoietin gene, comprising: an antisense strand comprising at least 17 consecutive nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; an RNAi agent comprising a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand; 2. The RNAi agent of embodiment 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences listed in Table 2 or Table 3. 3. An RNAi agent according to embodiment 1 or embodiment 2, comprising wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences set forth in Table 2 or Table 4; and wherein the sense strand has a region of at least 85% complementarity over the 17 contiguous nucleotides to the antisense strand. 4. The RNAi agent of any one of embodiments 1-3, wherein at least one nucleotide of said TSLP RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage. 5. The RNAi agent of any one of embodiments 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides. 6. The RNAi agent of any one of embodiments 4-5, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, morpholino nucleotides, vinylphosphonate-containing nucleotides, cyclopropylphosphonate-containing nucleotides, and 3'O-methyl nucleotides. 7. The RNAi agent of embodiment 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof. 8. The RNAi agent of any one of embodiments 1 to 7, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 3. 9. The RNAi agent of any one of embodiments 1 to 8, wherein the sense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 4. 10. The RNAi agent of embodiment 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 4. 11. The RNAi agent according to any one of embodiments 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length. 12. The RNAi agent of embodiment 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length. 13. The RNAi agent of embodiment 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length. 14. The RNAi agent of embodiment 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length. 15. The RNAi agent of embodiment 14, having two blunt ends. 16. The RNAi agent of any one of embodiments 1 to 15, wherein the sense strand comprises one or two terminal caps. 17. The RNAi agent of any one of embodiments 1-16, wherein the sense strand comprises one or two inverted abasic residues. 18. The RNAi agent of embodiment 1, which is composed of a sense strand and an antisense strand forming a duplex having the structure of any one of the duplexes in Table 7A, Table 7B, Table 8, Table 9, or Table 10. 19. The RNAi agent of embodiment 18, wherein all or substantially all of the nucleotides are modified nucleotides. 20. The following nucleotide sequence (5'→3'): AGACAUUUAUUGGUUGUGACC (SEQ ID NO: 836); AGACGUUUAUUGGUUGUGACC (SEQ ID NO: 853); UGACAUUUAUUGGUUGUGACC (SEQ ID NO: 837); UGACGUUUAUUGGUUGUGACC (SEQ ID NO: 856); AGACAUUUAUUGGUUGUGA (SEQ ID NO: 196); UGACAUUUAUUGGUUGUGA (SEQ ID NO: 197); UUAGCAUUUAUCUGAGUUU (SEQ ID NO: 137); UUAGCAUUUAUCUGAGUUC (SEQ ID NO: 139); UACAUUUAUUGGUUGUGAC (SEQ ID NO: 192); AGACAUUUAUUGGUUGUGACU (SEQ ID NO: 830); UUAGCAUUUAUCUGAGUUUCC (SEQ ID NO: 825); or UACAUUUAUUGGUUGUGACUU (SEQ ID NO: 826) 2. The RNAi agent of embodiment 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of 21. The sense strand has the following nucleotide sequence (5'→3'): GGUCACAACCAAUAAAUGUCU (SEQ ID NO: 872); GGUCACAACCAAUAAAUGUCA (SEQ ID NO: 873); UCACAACCAAUAAAUGUCU (SEQ ID NO: 461); UCACAACCAAUAAAUGUCA (SEQ ID NO: 462); AAACUCAGAUAAAUGCUAA (SEQ ID NO: 402); G(A 2N )ACUCAGAUAAAUGCUAA (SEQ ID NO: 871); GUCACAACCAAUAAAUGUA (SEQ ID NO: 457) AGUCACAACCAAUAAAUGUCU (SEQ ID NO: 864); GGAAACUCAGAUAAAUGCUAA (SEQ ID NO: 866); or (A 2N )AGUCACAACCAAUAAAUGUA (SEQ ID NO: 863) (where, (A 2N21. The RNAi agent of embodiment 20, consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of: 22. The RNAi agent according to embodiment 20 or 21, wherein all or substantially all nucleotides are modified nucleotides. 23. The RNAi agent according to embodiment 1, comprising the following nucleotide sequence (5'→3'): cPrpasGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 649) cPrpasGfsaCfaUfuUfaUfuGfgUfuGfuGfaCfsu (SEQ ID NO: 609); cPrpasGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 611); cPrpasGfsacguuuaUfuGfgUfuGfugacsc (SEQ ID NO: 681); cPrpasGfsacauuuAfuuGfgUfuGfugacsu (SEQ ID NO: 612); cPrpusUfsagcauuUfauCfuGfaGfuuucsc (SEQ ID NO: 603); cPrpusUfsagcauUfuauCfuGfaGfuuucsc (SEQ ID NO: 606); or cPrpusAfscsAfuUfuAfuUfgGfuUfgUfgAfcUfsu (SEQ ID NO: 594); (wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; cPrpa represents 5'-cyclopropylphosphonate-2'-O-methyl adenosine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides), an RNAi agent comprising an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following: 24. The RNAi agent according to embodiment 1, wherein the sense strand has the following nucleotide sequence (5'→3'): gsgucacaaCfCfAfauaaaugucu (SEQ ID NO: 714); asgucacaaCfCfAfauaaaugucu (SEQ ID NO: 702); gsgaaacucAfGfAfuaaaugcuaa (SEQ ID NO: 704); a_2NsagucacaAfCfCfaauaaaugua (SEQ ID NO: 701); (wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; a_2N represents 2'-O-methyl-2-amino adenosine; s represents a phosphorothioate linkage; and where all or substantially all of the nucleotides on the antisense strand are modified nucleotides). 25. The RNAi agent of any one of embodiments 20-24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both. 26. The RNAi agent according to any one of embodiments 1 to 25, wherein the RNAi agent is linked to a targeting ligand. 27. The RNAi agent according to embodiment 26, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells. 28. The RNAi agent of embodiment 27, wherein the targeting ligand comprises an integrin targeting ligand. 29. The RNAi agent according to embodiment 28, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand. 30. The targeting ligand has the following structure: [ka] or a pharmaceutically acceptable salt thereof, or [ka] or a pharmaceutically acceptable salt thereof (where, [ka] indicates a point of attachment to the RNAi agent. 31. The RNAi agent of any one of embodiments 26-29, wherein the targeting ligand has a structure selected from the group consisting of: [ka] [ka] [ka] [ka] [ka] [ka] [ka] [ka] and [ka] (where, [ka] indicates the point of attachment to the RNAi agent). 32. The RNAi agent has the structure: [ka] 32. The RNAi agent of embodiment 31, wherein the RNAi agent is bound to a target ligand having the formula: 33. The RNAi agent according to any one of embodiments 26 to 32, wherein the targeting ligand is attached to the sense strand. 34. The RNAi agent according to embodiment 33, wherein the targeting ligand is attached to the 5' end of the sense strand. 35. The RNAi agent according to any one of embodiments 1 to 34, which is a pharmaceutically acceptable salt. 36. The RNAi agent according to embodiment 35, which is a sodium salt. 37. A composition comprising an RNAi agent according to any one of embodiments 1 to 36, wherein said composition further comprises a pharmaceutically acceptable excipient. 38. The composition of embodiment 37, further comprising a second RNAi agent capable of inhibiting expression of the thymic stromal lymphopoietin gene. 39. The composition of any one of embodiments 37-38, further comprising one or more additional therapeutic agents. 40. The composition of any one of embodiments 37-39, formulated for inhaled administration. 41. The composition of embodiment 40, delivered by a metered dose inhaler, jet nebulizer, vibrating mesh nebulizer, or soft mist inhaler. 42. The composition of any of embodiments 37-41, wherein the RNAi agent is a sodium salt. 43. The composition of any one of embodiments 37-42, wherein the pharmaceutically acceptable excipient is water for injection. 44. The composition of any of embodiments 37-42, wherein the pharmaceutically acceptable excipient is buffered saline. 45. A method for inhibiting expression of the TSLP gene in a cell, comprising introducing into the cell an effective amount of an RNAi agent according to any one of embodiments 1 to 35 or a composition according to any one of embodiments 37 to 44. 46. The method of embodiment 45, wherein the cell is in a subject. 47. The method of embodiment 46, wherein the subject is a human subject. 48. The method of any one of embodiments 45 to 47, wherein after administration of the RNAi agent, expression of the thymic stromal lymphopoietin gene is inhibited by at least about 30%. 49. A method for treating one or more conditions or diseases associated with enhanced or elevated levels of TSLP cytokine activity, comprising administering to a human subject in need thereof a therapeutically effective amount of a composition described in any one of embodiments 37-44. 50. The method of embodiment 49, wherein the disease is asthma (including but not limited to allergic asthma), chronic obstructive pulmonary disease (including but not limited to chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including but not limited to systemic sclerosis (SSc)), and multiple inflammatory diseases (including but not limited to atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis). 51. The method of embodiment 50, wherein the disease is allergic asthma. 52. The method of any one of embodiments 45 to 51, wherein the RNAi agent is administered at a deposited amount of about 0.01 mg to about 5.0 mg per kg of subject body weight. 53. The method of any one of embodiments 45-52, wherein the RNAi agent is administered at a deposited dose of about 0.03 mg to about 2.0 mg per kg of subject body weight. 54. The method of any of embodiments 45-53, wherein the RNAi agent is administered in two or more doses. 55. Use of an RNAi agent according to any one of embodiments 1 to 36 for the treatment of a disease, disorder, or condition mediated at least in part by TSLP cytokine activity and / or TSLP gene expression. 56. Use of a composition according to any one of embodiments 37 to 44 for the treatment of a disease, disorder, or condition mediated at least in part by thymic stromal lymphopoietin cytokine activity and / or thymic stromal lymphopoietin gene expression. 57. Use of a composition according to any one of embodiments 37 to 44 for the manufacture of a medicament for the treatment of a disease, disorder, or condition mediated at least in part by thymic stromal lymphopoietin cytokines and / or thymic stromal lymphopoietin gene expression. 58. The use according to any one of embodiments 55 to 57, wherein the disease is pulmonary inflammation. 59. A method for producing an RNAi agent according to any one of embodiments 1 to 36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule. 60. The method of embodiment 59, wherein the sense strand comprises a target ligand. 61. The method of embodiment 60, comprising attaching a targeting ligand to the sense strand.
[0201] The above embodiments and items are illustrated by the following non-limiting examples. [Example]
[0202] Example 1. Synthesis of TSLP RNAi Agent The TSLP RNAi agent duplexes disclosed herein were synthesized as follows.
[0203] A. Synthesis. The sense and antisense strands of the TSLP RNAi agent were synthesized using solid-phase phosphoramidite technology used for oligonucleotide synthesis. Depending on the scale, MerMade96E® (Bioautomation), MerMade12® (Bioautomation), or OP Pilot100 (GE Healthcare) was used. Synthesis was performed on a controlled pore glass solid support (CPG, 500 Å or 600 Å, obtained from Prime Synthesis, Aston, PA, USA). The monomers located at the 3' end of each strand, bound to the solid support, were used as the starting point for synthesis and were commercially available. All RNA and 2'-modified RNA phosphoramidites were purchased from Thermo Fisher Scientific (Milwaukee, WI, USA). Specifically, the 2'-O-methyl phosphoramidites used included the following: (5'-O-dimethoxytrityl-N 6 -(Benzoyl)-2'-O-methyl-adenosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, 5'-O-dimethoxy-trityl-N 4 -(acetyl)-2'-O-methyl-cytidine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite, (5'-O-dimethoxytrityl-N 25'-(isobutyryl)-2'-O-methyl-guanosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite and 5'-O-dimethoxytrityl-2'-O-methyluridine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite. 2'-Deoxy-2'-fluorophosphoramidite had the same protecting groups as the 2'-O-methylRNA amidite. 5'-Dimethoxytrityl-2'-O-methyl-inosine-3'-O-(2-cyanoethyl-N,N-diisopropylamino)phosphoramidite was purchased from Glen Research (Virginia). Inverted abasic (3'-O-dimethoxytrityl-2'-deoxyribose-5'-O-(2-cyanoethyl-N,N-diisopropylamino) phosphoramidite) was purchased from ChemGenes (Wilmington, MA, USA). The following UNA phosphoramidites were used: 5'-(4,4'-dimethoxytrityl)-N6-(benzoyl)-2',3'-seco-adenosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-acetyl-2',3'-seco-cytosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, 5'-(4,4'-dimethoxytrityl)-N-isobutyryl-2',3'-seco-guanosine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. The following linkers were used: 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite, and 5'-(4,4'-dimethoxytrityl)-2',3'-seco-uridine, 2'-benzoyl-3'-[(2-cyanoethyl)-(N,N-diisopropyl)]-phosphoramidite. The TFA AminoLink phosphoramidite was also purchased commercially (ThermoFisher). Linker L6 was purchased from BroadPharm as propargyl-PEG5-NHS (catalog no. BP-20907) and coupled to the NH2-C6 group of the AminoLink phosphoramidite to form -L6-C6- using standard coupling conditions. In both cases, phosphorothioate linkages were introduced as specified using the conditions described herein.Cyclopropylphosphonate phosphoramidite was synthesized according to International Patent Application Publication No. WO2017 / 214112 (see also Altenhofer et. al., Chem. Communications (Royal Soc. Chem.), 57(55):6808-6811 (July 2021)).
[0204] Trialkine-containing phosphoramidites were dissolved in anhydrous dichloromethane or anhydrous acetonitrile (50 mM), while other amidites were dissolved in anhydrous acetonitrile (50 mM) and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'-O-Me), and 60 s (2'-F). To introduce phosphorothioate bonds, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0205] Alternatively, trialkyne moieties were introduced post-synthetically (see section E below). In this route, the sense strand was functionalized with 5'- and / or 3'-terminal nucleotides containing primary amines. TFA Aminolink phosphoramidite was dissolved in anhydrous acetonitrile (50 mM), and molecular sieves (3 Å) were added. 5-benzylthio-1H-tetrazole (BTT, 250 mM in acetonitrile) or 5-ethylthio-1H-tetrazole (ETT, 250 mM in acetonitrile) was used as the activator solution. Coupling times were 10 min (RNA), 90 s (2'-O-Me), and 60 s (2'-F). To introduce phosphorothioate linkages, a 100 mM solution of 3-phenyl-1,2,4-dithiazolin-5-one (POS, obtained from PolyOrg, Inc., Leominster, MA, USA) in anhydrous acetonitrile was used.
[0206] B. Cleavage and Deprotection of Support-Bound Oligomers After completion of the solid-phase synthesis, the dried solid support was treated with a 1:1 volume solution of 40 wt % aqueous methylamine and 28%–31% ammonium hydroxide solution (Aldrich) for 1.5 h at 30° C. The solution was evaporated, and the solid residue was reconstituted in water (see below).
[0207] C. Purification The crude oligomer was purified by anion-exchange HPLC using a TSKgel SuperQ-5PW 13 μm column and a Shimadzu LC-8 system. Buffer A was 20 mM Tris, 5 mM EDTA, pH 9.0, containing 20% acetonitrile, and buffer B was the same as buffer A plus 1.5 M sodium chloride. UV spectra were recorded at 260 nm. Appropriate fractions were pooled and then subjected to size-exclusion HPLC using a GE Healthcare XK16 / 40 column packed with Sephadex G25 fine, using a running buffer containing 100 mM ammonium bicarbonate (pH 6.7) and 20% acetonitrile or filtered water. Alternatively, pooled fractions were desalted and exchanged into the appropriate buffer or solvent system by tangential flow filtration.
[0208] D. Annealing RNAi agents were created by combining equimolar RNA solutions (sense and antisense) in 1x PBS (phosphate-buffered saline, 1x, Corning, Cellgro) and mixing the complementary strands. Some RNAi agents were lyophilized and stored at -15 to -25°C. The concentration of the duplex was determined by measuring the absorbance of the solution in 1x PBS using a UV-Vis spectrometer. The absorbance at 260 nm was then multiplied by the conversion factor (0.050 mg / (mL·cm)) and the dilution factor to determine the concentration of the duplex.
[0209] E. Trialkine Linker Attachment In some embodiments, the trialkine linker is attached to the sense strand of the RNAi agent on the resin as a phosphoramidite (see Example 1G for the synthesis of an example trialkine linker phosphoramidite, and see Example 1A for the attachment of the phosphoramidite). In other embodiments, the trialkine linker can be attached to the sense strand after cleavage from the resin, as described below: In some embodiments, the 5' or 3' amine-functionalized sense strand is attached to the trialkine linker before or after annealing. An example of a trialkine linker structure that can be used to form the constructs disclosed herein is as follows: [ka] To attach the trialkyne linker to the annealed duplexes, the amine-functionalized duplexes were dissolved at approximately 50-70 mg / mL in 90% DMSO / 10% HO. 40 equivalents of triethylamine were added, followed by 3 equivalents of trialkyne-PNP. Upon completion, the conjugates were precipitated twice with a solvent system of 1x phosphate-buffered saline / acetonitrile (1:14 ratio) and dried.
[0210] F. Synthesis of Target Ligand SM6.1 ((S)-3-(4-(4-((14-azido-3,6,9,12-tetraoxatetradecyl)oxy)naphthalen-1-yl)phenyl)-3-(2-(4-((4-methylpyridin-2-yl)amino)butanamido)acetamido)propanoic acid) [ka]
[0211] Compound 5 (tert-butyl (4-methylpyridin-2-yl)carbamate) (0.501 g, 2.406 mmol, 1 equiv.) was dissolved in DMF (17 mL). To the mixture was added NaH (0.116 mg, 3.01 mmol, 1.25 equiv., 60% dispersion in oil). The mixture was stirred for 10 min, and then compound 20 (ethyl 4-bromobutyrate (0.745 g, 3.82 mmol, 0.547 mL)) (Sigma 167118) was added. After 3 h, the reaction was quenched with ethanol (18 mL) and concentrated. The concentrate was dissolved in DCM (50 mL), washed with saturated aqueous NaCl (1 × 50 mL), dried over NaSO, filtered, and concentrated. The product was purified on a silica column using a gradient of 0–5% methanol in DCM. [ka]
[0212] Compound 21 (0.80 g, 2.378 mmol) was dissolved in 100 mL of acetone:0.1 M NaOH [1:1]. The reaction was followed by TLC (5% ethyl acetate in hexanes). The organics were concentrated off, and the residue was acidified to pH 3-4 with 0.3 M citric acid (40 mL). The product was extracted with DCM (3 × 75 mL). The organics were pooled, dried over NaSO, filtered, and concentrated. The product was used without further purification. [ka]
[0213] To a solution of compound 22 (1.1 g, 3.95 mmol, 1 equiv.), compound 45 (595 mg, 4.74 mmol, 1.2 equiv.), and TBTU (1.52 g, 4.74 mmol, 1.2 equiv.) in anhydrous DMF (10 mL) was added diisopropylethylamine (2.06 mL, 11.85 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for 3 h. The reaction was quenched with saturated NaHCO3 solution (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the combined organic phases were dried over anhydrous Na2SO4 and concentrated. The product was separated by CombiFlash® using silica gel as the stationary phase. LC-MS: [M+H]+ calculated 366.20, found 367. [ka]
[0214] To a solution of compound 61 (2 g, 8.96 mmol, 1 equiv.) and compound 62 (2.13 mL, 17.93 mmol, 2 equiv.) in anhydrous DMF (10 mL) was added K2CO3 (2.48 g, 17.93 mmol, 2 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred overnight. The reaction was quenched with water (10 mL). The aqueous phase was extracted with ethyl acetate (3 × 10 mL), and the organic phases were combined, dried over anhydrous Na2SO4, and concentrated. The products were separated by CombiFlash® using silica gel as the stationary phase. [ka]
[0215] To a solution of compound 60 (1.77 g, 4.84 mmol, 1 equiv.) in THF (5 mL) and HO (5 mL) was added lithium hydroxide monohydrate (0.61 g, 14.53 mmol, 3 equiv.) in small portions at 0 °C. The reaction mixture was allowed to warm to room temperature. After stirring at room temperature for 3 h, the reaction mixture was acidified to pH 3.0 with HCl (6 N). The aqueous phase was extracted with ethyl acetate (3 × 20 mL), and the organic layers were combined, dried over NaSO, and concentrated. LC-MS: [M+H] calculated 352.18, found 352. [ka]
[0216] To a solution of compound 63 (1.88 g, 6.0 mmol, 1.0 equiv) in anhydrous THF (20 mL) was added n-BuLi (3.6 mL, 9.0 mmol, 1.5 equiv) in hexanes dropwise at −78° C. The reaction was maintained at −78° C. for an additional 1 h. Triisopropyl borate (2.08 mL, 9.0 mmol, 1.5 equiv) was then added to the mixture at −78° C. The reaction was allowed to warm to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated NH4Cl solution (20 mL) and the pH was adjusted to 3. The aqueous phase was extracted with ethyl acetate (3 × 20 mL), and the organic phases were combined, dried over Na2SO4, and concentrated. [ka]
[0217] Compound 12 (300 mg, 0.837 mmol, 1.0 equiv.), compound 65 (349 mg, 1.256 mmol, 1.5 equiv.), XPhosPdG2 (13 mg, 0.0167 mmol, 0.02 equiv.), and K3PO4 (355 mg, 1.675 mmol, 2.0 equiv.) were mixed in a round-bottom flask. The flask was sealed with a screw-cap septum, then evacuated and backfilled with nitrogen gas (this procedure was repeated three times). Next, THF (8 mL) and water (2 mL) were added via syringe. Nitrogen was bubbled through the mixture for 20 minutes, and the reaction was kept at room temperature overnight. The reaction was quenched with water (10 mL), and the aqueous phase was extracted with ethyl acetate (10 mL x 3). The organic phase was dried over Na2SO4, concentrated and purified by Combiflash® using silica gel as the stationary phase and eluting with 15% ethyl acetate in hexane. LC-MS: [M+H]+ calculated 512.24, found 512.56. [ka]
[0218] Compound 66 (858 mg, 1.677 mmol, 1.0 equiv) was cooled in an ice bath. HCl in dioxane (8.4 mL, 33.54 mmol, 20 equiv) was added to the flask. The reaction was allowed to warm to room temperature and stirred for an additional hour. The solvent was removed on a rotary evaporator and the product was used directly without further purification. LC-MS: [M+H]+ calculated 412.18, found 412.46. [ka]
[0219] To a solution of compound 64 (500 mg, 1.423 mmol, 1 equiv.), compound 67 (669 mg, 1.494 mmol, 1.05 equiv.), and TBTU (548 mg, 0.492 mmol, 1.2 equiv.) in anhydrous DMF (15 mL) was added diisopropylethylamine (0.744 mL, 4.268 mmol, 3 equiv.) at 0 °C. The reaction mixture was warmed to room temperature and stirred for an additional 1 h. The reaction was quenched with saturated aqueous NaHCO (10 mL), and the product was extracted with ethyl acetate (3 × 20 mL). The organic phases were combined, dried over NaSO, and concentrated. The product was purified by Combiflash® using silica gel as the stationary phase and eluted with 3–4% methanol in DCM. The yield was 96.23%. LC-MS: [M+H]+ calculated 745.35, found 746.08. [ka]
[0220] To a solution of compound 68 (1.02 g, 1.369 mmol, 1 equiv) in ethyl acetate (10 mL) was added 10% Pd / C (0.15 g, 50% HO) at room temperature. The reaction mixture was warmed to room temperature and the reaction was followed by LC-MS. The reaction was kept at room temperature overnight. The solid was filtered through Celite® and the solvent was removed on a rotary evaporator. The product was used directly without further purification. LC-MS: [M+H]+ calculated 655.31, found 655.87. [ka]
[0221] To a solution of compound 69 (100 mg, 0.152 mmol, 1 equiv.) and azido-PEG5-OTs (128 mg, 0.305 mmol, 2 equiv.) in anhydrous DMF (2 mL) was added K2CO3 (42 mg, 0.305 mmol, 2 equiv.) at 0 °C. The reaction mixture was stirred at 80 °C for 6 h. The reaction was quenched with saturated NaHCO3 solution, and the aqueous layer was extracted with ethyl acetate (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. LC-MS: [M+H]+ calculated 900.40, found 901.46. [ka]
[0222] To a solution of compound 72 (59 mg, 0.0656 mmol, 1.0 equiv) in THF (2 mL) and water (2 mL) was added lithium hydroxide (5 mg, 0.197 mmol, 3.0 equiv) at room temperature. The mixture was stirred for an additional 1 h at room temperature. The pH was adjusted to 3.0 with HCl (6 N) and the aqueous phase was extracted with EtOAc (3 × 10 mL). The organic phases were combined, dried over Na2SO4, and concentrated. To the residue was added TFA (0.5 mL) and DCM (0.5 mL), and the mixture was stirred for an additional 3 h at room temperature. The solvent was removed on a rotary evaporator. LC-MS: [M+H]+ calculated 786.37, found 786.95.
[0223] G. Synthesis of TriAlk14
[0224] TriAlk14 and (TriAlk14)s shown in Table 11 above can be synthesized using the synthetic routes shown below: Compound 14 can be added to the sense strand as a phosphoramidite using standard oligonucleotide synthesis techniques, or compound 22 can be attached in an amide coupling reaction to an amine-containing sense strand. [ka]
[0225] To a 3 L jacketed reactor was added 500 mL of DCM and 4 (75.0 g, 0.16 mol). The internal temperature of the reaction was cooled to 0 °C, and TBTU (170.0 g, 0.53 mol) was added. The suspension was then treated dropwise with amine 5 (75.5 g, 0.53 mol), maintaining the internal temperature below 5 °C. The reaction was then slowly treated with DIPEA (72.3 g, 0.56 mol), maintaining the internal temperature below 5 °C. After the addition was complete, the reaction was warmed to 23 °C over 1 h and stirred for 3 h. All three reagents were added as a 10% kicker charge and stirred for an additional 3 h. The reaction was considered complete when 4 was less than 1%. The reaction mixture was washed twice with saturated ammonium chloride solution (500 mL) and once with saturated sodium bicarbonate solution (500 mL). The organic layer was then dried over sodium sulfate and concentrated to an oil. The crude oil weighed 188 g and contained 72% 6 by QNMR. This crude oil was used in the next step. 46 H 60 N4O 11 Calculated mass = 845.0 m / z. Measured mass [M+H] = 846.0. [ka]
[0226] The crude oil (121.2 g), containing 72% by weight of compound 6 (86.0 g, 0.10 mol), was dissolved in DMF (344 mL) and treated with TEA (86 mL, 20% v / v), maintaining the internal temperature below 23 °C. The reaction was complete within 10 h, as determined by HPLC Method 1 (Figure 2), which monitored the production of dibenzofulvene (DBF) relative to the consumption of Fmoc-amine 6. Glutaric anhydride (12.8 g, 0.11 mol) was added to the solution, and the intermediate amine 7 was converted to compound 8 within 2 h. Upon completion, the DMF and TEA were removed under reduced pressure at 30 °C to yield 100 g of crude oil. Due to the high solubility of compound 7 in water, aqueous workup was not possible, and chromatography was the only method available to remove DBF, TMU, and glutaric anhydride. The crude oil (75 g) was purified in three runs on a Teledyne ISCO Combi-flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-20% methanol / DCM over 30 min to give 42 g of compound 8 (54% yield over three steps). 36 H 55 N4O 12 Calculated mass = 736.4 m / z. Measured value [M+H] = 737.0. [ka]
[0227] Prior to use, compound 8 (42.0 g, 0.057 mol) was evaporated with 10 volumes of acetonitrile to remove residual methanol from the chromatography solvent. This oil was redissolved in DMF (210 mL) and cooled to 0°C. The solution was treated with 4-nitrophenol (8.7 g, 0.063 mol) followed by EDC hydrochloride (12.0 g, 0.063 mol) and was completed within 10 hours. The solution was cooled to 0°C and 10 volumes of ethyl acetate were added, followed by 10 volumes of saturated ammonium chloride solution, maintaining the internal temperature below 15°C. The layers were separated and the ethyl acetate layer was washed with brine. The combined aqueous layers were extracted twice with 5 volumes of ethyl acetate. The combined organic layers were dried over sodium sulfate and concentrated to give an oil. The crude oil (55 g) was purified in three batches using a Teledyne ISCO Combi-Flash® purification system. The crude oil (25 g) was loaded onto a 330 g silica column and eluted with 0-10% methanol / DCM for 30 min to give 22 g of pure 9 (compound 22) (50% yield). 42 H 59 N5O 14 Calculated mass = 857.4 m / z. Measured value [M+H] = 858.0. [ka]
[0228] A solution of ester 9 (49.0 g, 57.1 mmol) and 6-amino-1-hexanol (7.36 g, 6.28 mmol) in dichloromethane (3 volumes) was treated dropwise with triethylamine (11.56 g, 111.4 mmol). The reaction was followed by HPLC method 1 to observe the disappearance of compound 9 and was complete within 10 minutes. The crude reaction mixture was diluted with 5 volumes of dichloromethane and washed with saturated ammonium chloride (5 volumes) and brine (5 volumes). The organic phase was dried over sodium sulfate and concentrated to an oil. The crude oil was purified using a 330 g silica column on a Teledyne ISCO Combi-flash® purification system. 4-Nitrophenol was eluted with 100% ethyl acetate, and 10 was flushed from the column using 20% methanol / DCM to give a colorless oil (39 g, 81% yield). 42 H 69 N5O 12 Calculated mass = 836.0 m / z. Found value [M+H] = 837.0. [ka]
[0229] Alcohol 10 was evaporated twice with 10 volumes of acetonitrile to remove residual methanol from the chromatography solvent, and once more with anhydrous dichloromethane (KF < 60 ppm) to remove traces of water. Alcohol 10 (2.30 g, 2.8 mmol) was dissolved in 5 volumes of anhydrous dichloromethane (KF < 50 ppm) and treated with diisopropylammonium tetrazolide (188 mg, 1.1 mmol). The solution was cooled to 0 °C and treated dropwise with 2-cyanoethyl N,N,N',N'-tetraisopropylphosphoramidite (1.00 g, 3.3 mmol). The solution was removed from the ice bath and stirred at 20 °C. The reaction was complete within 3–6 h. The reaction mixture was cooled to 0 °C and treated with 10 volumes of saturated ammonium bicarbonate / brine (1:1) solution, then warmed to ambient temperature over 1 min and stirred at 20 °C for an additional 3 min. The biphasic mixture was transferred to a separatory funnel and 10 volumes of dichloromethane were added. The organic layer was separated and washed with 10 volumes of saturated sodium bicarbonate solution to hydrolyze the unreacted bisphosphate reagent. The organic layer was dried over sodium sulfate and concentrated to an oil to give 3.08 g, 94% by weight of compound 14. 51 H 86 N7O 13 Calculated mass of P = 1035.6 m / z. Found [M+H] = 1036.
[0230] H. Target ligand binding. The 5' or 3' tridentate alkyne-functionalized sense strand is conjugated to a target ligand either before or after annealing. The following example demonstrates the conjugation of a target ligand to an annealed duplex: Stock solutions of 0.5 M tris(3-hydroxypropyltriazolylmethyl)amine (THPTA), 0.5 M copper(II) sulfate pentahydrate (Cu(II)SO₄·5H₂O), and 2 M sodium ascorbate solution were prepared in deionized water. A 75 mg / mL solution of the target ligand in DMSO was made. 25 μL of 1 M HEPES (pH 8.5) buffer was added to a 1.5 mL centrifuge tube containing the trialkyne-functionalized duplex (3 mg, 75 μL, 40 mg / mL in deionized water, approximately 15,000 g / mol). After vortexing, 35 μL of DMSO was added, and the solution was vortexed. The target ligand was added to the reaction solution (6 equiv / duplex, 2 equiv / alkyne, approximately 15 μL) and vortexed. The pH was checked using pH paper and confirmed to be approximately 8. In a separate 1.5 mL centrifuge tube, 50 μL of 0.5 M THPTA was mixed with 10 μL of 0.5 M Cu(II)SO₄·5H₂O, vortexed, and incubated at room temperature for 5 minutes. After 5 minutes, THPTA / Cu solution (7.2 μL, 6 equiv of 5:1 THPTA:Cu) was added to the reaction vial and vortexed. Immediately after, 2 M ascorbic acid (5 μL, 50 equiv / duplex, 16.7 equiv / alkyne) was added to the reaction vial and vortexed. Immediately after completion of the reaction (typically 0.5–1 h), the reaction solution was purified by non-denaturing anion exchange chromatography.
[0231] Example 2. In vivo anti-inflammatory effects of TSLP knockdown in a rat airway inflammation model, delivered by intratracheal microsprayer Male Sprague-Dawley rats were administered 5 mg / kg of a rat-specific RNAi agent conjugated to Tri-SM6.1-αvβ6 integrin-targeting ligand (referred to as AC001714) or saline vehicle on study days 1 and 3. A 200 μL volume was loaded into a syringe connected to a microsprayer device (Penn Century, Philadelphia, PA) for intratracheal administration.
[0232] AC001714 contains a rat-specific sequence designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2), which has no homology to the human TSLP gene, and was chemically modified as follows: Modified sense strand (5'→3'): Tri-SM6.1-αvb6-(TA14)-gsa_2NaucaaaCfCfUfcacaaauucus(invAb) (SEQ ID NO: 782) Modified antisense strand (5'→3'): cPrpasGfsasAfuUfuGfuGfaGfgUfuUfgAfuUfsc (SEQ ID NO: 587)
[0233] On day 14, rats were challenged with a single intratracheal dose of 400 μg / rat of Alternaria alternata prepared in phosphate-buffered saline (PBS). Group 1 rats received PBS alone as a control.
[0234] [Table 12]
[0235] At 24, 48, or 72 hours after Alternaria administration (i.e., days 15, 16, or 17), rats were anesthetized with isoflurane / oxygen, bled, and euthanized by exsanguination. The sacrifice / euthanasia dates are shown in Table 12. The trachea was cannulated and lavaged twice with 5 mL of ice-cold PBS, after which bronchoalveolar lavage fluid (BAL) was collected. BAL samples were centrifuged, cells were resuspended in 1 mL of ice-cold PBS, and an aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared and stained, and differential cell counts were performed. The supernatant was used for cytokine measurements. The right lung lobe was used to measure rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histological examination (Trichrome and Sirius Red staining, RNAscope).
[0236] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0237] [Table 13]
[0238] As shown in Table 13 above, the groups administered AC001714 (groups 5, 6, and 7) showed approximately 45-65% reductions in rTSLP mRNA compared to the control groups (groups 2, 3, and 4), respectively, at each time point of sacrifice.
[0239] Granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. Total and differential cell counts were counted for BAL samples, and inflammatory cell counts were calculated. The effect of rTSLP inhibition using the rat-specific TSLP RNAi agent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. Groups 5 to 7 (treated with the rat-specific TSLP RNAi agent) showed significantly reduced total BAL cell, lymphocyte, and neutrophil counts at all time points compared with their respective controls. Furthermore, a significant reduction in eosinophil counts was observed at 72 hours (Group 7) compared with Group 4. Furthermore, BAL total protein was significantly reduced at both 24 hours and 72 hours (Groups 5 and 7) compared with the controls, Groups 2 and 4, respectively.
[0240] Other biomarkers, such as IL-18 and VEGF, are also indicators of cellular inflammation. In the Alternaria antigen-stimulated groups, administration of rat-specific RNAi agents (groups 5, 6, and 7) reduced each of these pro-inflammatory biomarkers compared with the group not treated with RNAi agents. This study physiologically supports the notion that a 45% or greater reduction in TSLP gene expression in a rat model leads to phenotypic improvements that reduce lung inflammation, potentially treating diseases such as allergic asthma.
[0241] Example 3. In vivo anti-inflammatory effects of TSLP knockdown in a rat model of airway inflammation, delivered by intratracheal microsprayer On study days 1 and 3, male Brown-Norway rats were administered 5 mg / kg of a rat-specific RNAi agent (5 mg / kg) linked to the Tri-SM6.1-αvβ6 integrin-targeting ligand (referred to as AC001714 or AC002515) or saline vehicle. Additionally, a "RISC-blocked" RNAi trigger was used. This served as a negative control, as it contains a similar construct to AC001714, including the same targeting ligand, but with chemical modifications designed to prevent the antisense strand from loading into RISC. A 200 μL volume was loaded into a syringe connected to a microsprayer device (Penn Century, Philadelphia, PA) for intratracheal administration.
[0242] AC001714 contains a rat-specific sequence designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and has no homology to the human TSLP gene, and its chemical structure is shown in Example 2 above.
[0243] AC002515 is also a rat-specific sequence designed to target a different location on the rat TSLP transcript (NCBI GenBank XM_008772052.2), which has no homology to the human TSLP gene, and was chemically modified as follows: Modified sense strand (5'→3'): Tri-SM6.1-αvb6-(TA14)-csugaaacuGfAfGfagaaaugguas(invAb) (SEQ ID NO: 783) modified antisense strand (5'→3'): cPrpusAfscsCfaUfuucucUfcAfgUfuUfcasg (SEQ ID NO: 588)
[0244] On day 14, rats were challenged with a single intratracheal dose of 500 μg / rat of Alternaria alternata prepared in PBS. Group 1 rats received PBS alone as a control.
[0245] [Table 14]
[0246] Twenty-four hours after Alternaria administration (i.e., day 16), rats were anesthetized with isoflurane / oxygen, bled, and euthanized by exsanguination. The sacrifice / euthanasia date is shown in Table 14 above. The trachea was cannulated and lavaged twice with 5 mL of ice-cold PBS, after which bronchoalveolar lavage fluid (BAL) was collected. BAL samples were centrifuged, cells were resuspended in 1 mL of ice-cold PBS, and an aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared, stained, and cell fractionation was performed. The supernatant was used for cytokine measurement. The right lung lobe was used to measure rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histological examination (Trichrome and Sirius Red staining, RNAscope).
[0247] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0248] [Table 15]
[0249] As shown in Table 15 above, the group administered with AC001714 (Group 4) and the group administered with AC002515 (Group 5) each showed a decrease in TSLP mRNA, with AC001714 showing approximately 62% inhibition, as shown in Figure 6A.
[0250] IL-13 and IL-33 are Th2 cytokines known to be indicators of lung inflammation. Rat IL-13 mRNA expression and rat IL-33 mRNA expression were similarly quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0251] [Table 16]
[0252] [Table 17]
[0253] As shown in Tables 16 and 17, the AC001714-treated group (Group 4) and the AC002515-treated group (Group 5) (each challenged with Alternaria) maintained cytokine levels comparable to those of the unchallenged untreated group (Group 1), demonstrating a preventive effect. In contrast, the Alternaria group without RNAi treatment (Group 2) and the Alternaria group treated with a RISC-blocked RNAi trigger that cannot inhibit rTSLP gene expression both showed significant increases in IL-13 and IL-33, indicating lung inflammation. IL-13 mRNA levels are also shown in Figure 6B, and IL-33 levels are shown in Figure 6C.
[0254] Furthermore, as described in the previous examples, granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. Total and differential cell counts were obtained for BAL samples to obtain inflammatory cell counts. The effect of rTSLP inhibition using the rat-specific TSLP RNAi agent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. Groups 4 and 5 (treated with the rat-specific TSLP RNAi agent) showed a significant decrease in lymphocytes. The negative control group (Group 3) showed no such changes, confirming that these decreases were due to decreased TSLP mRNA. Furthermore, a trend toward decreased BAL total protein, eosinophil counts, and BAL total cell counts was observed only in the two treatment groups (Groups 4 and 5). Furthermore, soluble collagen content was significantly decreased in the two treatment groups (Groups 4 and 5) compared with the Alternaria control group (Group 2).
[0255] Other biomarkers suggestive of cellular inflammation include IL-13, IL-5, leptin, MCP-1, RATES, TNF-α, and IP-10. In the Alternaria antigen-stimulated groups, administration of rat-specific RNAi agents (groups 4 and 5) tended to decrease each of these pro-inflammatory biomarkers compared with the group not administered RNAi agents (group 2) and the negative control trigger group (group 3).
[0256] As shown in Figure 6D, the rat-specific TSLP RNAi agent significantly reduced BAL soluble collagen (Groups 4 and 5) compared with the control Alternaria group without RNAi agent (Group 2) and the negative control RISC-blocked Alternaria group (Group 3). Statistical significance is based on the mean ± SD. * The p-value indicates p<0.05.
[0257] As shown in Figure 6E (BAL IL-5) and Figure 6F (BAL IL-13), the rat-specific TSLP RNAi agents (Groups 4 and 5) also showed reduced IL-5 and IL-13 compared with the Alternaria control group without RNAi agent (Group 2) and the negative control RISC-blocked Alternaria group (Group 3).
[0258] Double-stranded RNAscope analysis of TSLP and ITGB6 confirmed that TSLP is expressed in airway epithelia. Co-staining of TSLP RNAscope and Sftpc IHC demonstrated TSLP expression in alveolar type 2 cells.
[0259] Example 4. AAV9-CAG-hTSLP AAV Mouse Model The following procedure was used to evaluate TSLP RNAi agents in an AAV mouse model. To evaluate several TSLP RNAi agents, we used the AAV9-CAG-hTSLP (adeno-associated virus) mouse model. The transgenic sequence contained the human TSLP CDS with the 3' UTR. Six- to eight-week-old female C57BL / 6 mice were transduced with human TSLP using serotype 9 AAV (specifically, AAV9-CAG-hTSLP) and eGFP using AAV9-CAG-eGFP. Several weeks after intratracheal administration of AAV, the mice were intratracheally administered with the TSLP RNAi agent or a control. The genome of the AAV9-CAG-hTSLP.UTRs construct contains the human TSLP cDNA sequence (GenBank NM_033035.5). Human TSLP mRNA expression was normalized by qPCR using eGFP as a control. A total volume of 50 µL of 2e10GC of each AAV mixed with PBS was administered intratracheally (IT) to mice to generate AAV-hTSLP model mice. Two to three weeks after administration of the RNAi agent, lung tissue was collected.
[0260] Human TSLP mRNA expression in lung tissue was measured by qPCR.
[0261] On days 1 and 3, each mouse was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS or vehicle control (PBS). On days 30 and 31, each mouse was intratracheally administered 50 μL of various dose levels of TSLP RNAi agents or vehicle control (isotonic saline without RNAi agents) prepared in isotonic saline according to Table 18 below. Mice were humanely sacrificed and harvested on day 44. [Table 18]
[0262] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 3 to 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 18 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0263] Five mice (n=5) were studied in each group, except for Group 1, where only four mice were studied. TSLP mRNA expression levels were measured by qPCR. The experimental data are shown in Table 19 below.
[0264] [Table 19]
[0265] As shown in Table 19 above, each TSLP RNAi agent showed some reduction in hTSLP expression compared to the control. Of particular note is that at day 44, Group 7 (AC003100, targeting position 571 of the TSLP gene) showed an approximately 42% (0.576) reduction in hTSLP mRNA, and Group 9 (AC003128, targeting position 520 of the TSLP gene) showed an approximately 48% (0.522) reduction, providing substantially greater knockdown than the other TSLP RNAi agents tested.
[0266] Example 5. AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0267] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0268] On days 1 and 3, each mouse was intratracheally administered 50 μL of an AAV solution containing 2 e10 GC (genomic copies) of AAV9-CAG-eGFP and 3 e10 GC of AAV9-CAG-hTSLP in PBS, or vehicle control (PBS). On day 15, each mouse was intratracheally administered 50 μL of TSLP RNAi agent at different dose levels prepared in isotonic saline, or vehicle control (isotonic saline without RNAi agent), according to Table 20 below. Mice were humanely sacrificed and harvested on day 31. [Table 20]
[0269] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 3 to 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 20 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0270] Five mice (n=5) were studied in each group, except for Group 1, where only four mice were studied. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. All remaining right lung lobes were collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 21 below.
[0271] [Table 21]
[0272] As shown in Table 21 above, each TSLP RNAi agent showed a slight reduction in hTSLP expression compared to the control, with AC003100 and AC003128 demonstrating a dose-response. Group 2 (3.0 mg / kg AC003100, targeting position 571 of the TSLP gene) showed an approximately 55% reduction (0.448) in hTSLP mRNA. Furthermore, in some treatment groups, hTSLP protein expression was measured by MSD assay from the right lower lobe of collected mouse lung tissues, and data for some samples are shown in Figure 2. As shown in Figure 2, Group 6 (3 mg / kg AC003128), targeting position 520 of the TSLP gene, showed an 82% reduction in hTSLP protein, and significant reductions in hTSLP protein were also observed in the other groups.
[0273] Example 6. AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0274] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0275] On days 1 and 3, each mouse was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or vehicle control (PBS). On days 17 and 20, each mouse was intratracheally administered 50 μL of 1.5 mg / kg TSLP RNAi agent prepared in isotonic saline or vehicle control (isotonic saline without RNAi agent) according to Table 22 below. Mice were humanely sacrificed and harvested on day 31. [Table 22]
[0276] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 3 to 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 22 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0277] Five mice (n=5) were studied in each group, except for Group 1, where only four mice were studied. TSLP mRNA expression levels were measured by qPCR. The experimental data are shown in Table 23 below.
[0278] [Table 23]
[0279] As shown above in Table 23, each TSLP RNAi agent tested demonstrated a reduction in hTSLP expression compared to the control. In particular, Group 5 (1.5 mg / kg AC003342, targeting position 520 of the TSLP gene) demonstrated an approximately 55% (0.453) reduction in hTSLP mRNA, and Group 8 (1.5 mg / kg AC003345, also targeting position 520 of the TSLP gene) demonstrated an approximately 57% (0.434) reduction in hTSLP mRNA.
[0280] Example 7. AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0281] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0282] On days 1 and 3, each mouse was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or vehicle control (PBS). On days 15 and 18, each mouse was intratracheally administered 50 μL of 1.5 mg / kg TSLP RNAi agent prepared in isotonic saline or vehicle control (isotonic saline without RNAi agent) according to Table 22 below. Mice were humanely sacrificed and harvested on day 31. [Table 24]
[0283] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 3 to 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 24 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0284] Five mice (n=5) were studied in each group, except for Group 1, where only four mice were studied. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. All remaining right lung lobes were collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 25 below.
[0285] [Table 25]
[0286] As shown in Table 25 above, each of the tested TSLP RNAi agents demonstrated a reduction in hTSLP expression compared to the control. In particular, several TSLP RNAi agents targeting position 571 of the TSLP transcript demonstrated greater than 60% hTSLP mRNA inhibition, with AC003371 demonstrating a 64% knockdown of mRNA (Group 4, 0.363), AC003374 demonstrating a 66% knockdown (Group 7, 0.335), and AC003375 demonstrating a 67% knockdown (Group 8, 0.329). Furthermore, hTSLP protein expression was measured by MSD assay from the right lower lobe of collected mouse lung tissue for each treatment group, and data for several samples are shown in Figures 3A and 3B. As shown in Figures 3A and 3B, Group 4 (3 mg / kg AC003371), targeting position 571 of the TSLP gene, demonstrated a greater than 90% reduction in hTSLP protein. A significant decrease in hTSLP protein was also observed in each of the other groups.
[0287] Example 8. In vivo inhalation aerosolized administration of a rat-specific TSLP RNAi agent in rats On study day 1, male Sprague Dawley rats were administered a single targeted deposition dose of 1.5 mg / kg of the rat-specific RNAi agent AC001714 (the chemical structure of which is shown in Example 2) or a single dose of isotonic saline.
[0288] A jet nebulizer (Misty Max 10) was used to deliver the aerosol to a single-tier flow-past nose-only rodent inhalation exposure chamber (CH Technologies). One of the ports was equipped with a filter housing, allowing assessment of the aerosol concentration of the RNAi agent. The expected respiratory minute volume, allometrically scaled according to rodent body weight, and the aerosol concentration (determined from filter collection and RNAi agent quantification) were used to adjust exposure time to target a dose level of 1.5 mg / kg. The actual lung-deposited dose (PDD) is listed in Table 26.
[0289] [Table 26]
[0290] Five rats were dosed per group. Rats were sacrificed according to Table 26, and total RNA was isolated from both lungs after collection and homogenization. Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0291] [Table 27]
[0292] As shown in the data in Table 27 above, even when administered by inhalation, this particular rat-specific RNAi agent tool using an integrin-targeting ligand (AC001714) demonstrated significant inhibition of TSLP gene expression for at least 84 days.
[0293] Example 9. In vivo intratracheal administration of a rat-specific TSLP RNAi agent in rats On study days 1 and 3, male Sprague-Dawley rats were administered 200 μL of (i) isotonic saline, or (ii) 5 mg / kg of the rat-specific RNAi agent AC001714 (whose chemical structure is described in Example 2), or (iii) a "RISC-blocked" RNAi trigger (which contains a similar construct as AC001714 with the same targeting ligand, but contains chemical modifications designed to prevent the antisense strand from loading into RISC, and thus serves as a negative control) using a microsprayer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration according to Table 28 below.
[0294] [Table 28]
[0295] Five rats were administered per group. Rats were sacrificed according to Table 28, harvested, homogenized, and total RNA was isolated from both lungs. Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the control group (geometric mean, ±95% confidence interval).
[0296] [Table 29]
[0297] As shown in the data in Table 29 above, significant inhibition of TSLP gene expression was evident by at least day 57 with this particular rat-specific RNAi agent tool using an integrin-targeting ligand (AC001714; groups 5, 7, 8, and 9).
[0298] Example 10. In vivo intratracheal administration of a rat-specific TSLP RNAi agent in rats On study days 1 and 3, male Brown Norway rats were administered 200 μL of (i) isotonic saline, or (ii) 5 mg / kg of the rat-specific RNAi agent AC001714 (whose chemical structure is described in Example 2), or (iii) a "RISC-blocked" RNAi trigger (which contains a similar construct as AC001714 with the same targeting ligand, but contains chemical modifications designed to prevent the antisense strand from loading into RISC, and thus serves as a negative control) according to Table 30 below, using a microsprayer device (Penn Century, Philadelphia, PA) suitable for intratracheal (IT) administration.
[0299] [Table 30]
[0300] On day 13, rats were challenged with a single intratracheal infusion of Alternaria alternata prepared in phosphate-buffered saline (PBS) at a dose of 500 μg / rat. Group 1 rats received PBS alone as a control.
[0301] Two or 24 hours after Alternaria administration (i.e., day 13 or 14), rats were anesthetized with isoflurane / oxygen, bled, and humanely euthanized by exsanguination. The sacrifice / euthanasia dates are shown in Table 30. The trachea was cannulated and lavaged twice with 5 mL of ice-cold PBS, after which bronchoalveolar lavage fluid (BAL) was collected. BAL samples were centrifuged, cells were resuspended in 1 mL of ice-cold PBS, and an aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared, stained, and cell fractionation was performed. The supernatant was used for cytokine measurements. The right lung lobe was used to measure rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histological examination (Trichrome and Sirius Red staining, RNAscope).
[0302] Rat TSLP mRNA expression was quantified by probe-based quantitative PCR, normalized to rat B2M expression, and expressed as a percentage of the vehicle control group (geometric mean, ±95% confidence interval).
[0303] [Table 31]
[0304] As shown in Table 31 above, the groups treated with AC001714 (i.e., groups 5 and 7) showed a significant decrease in rTSLP mRNA compared to the control group at each sacrifice time point. These results are also shown in Figure 4A.
[0305] Granulocytes (both eosinophils and neutrophils) are well-known markers of cellular inflammation. Total and differential cell counts were counted for BAL samples, and inflammatory cell counts were calculated. The effect of rTSLP inhibition using the rat-specific TSLP RNAi agent disclosed herein on eosinophilic inflammation induced by Alternaria extract was evaluated. BAL total cell counts and eosinophil counts are shown in Figures 4B and 4C. Groups 5 and 7 (treated with rat-specific TSLP RNAi agents) showed significantly reduced total BAL cell counts and eosinophil counts at all time points compared with their respective controls. As shown in Figure 4B, significant reductions in eosinophil counts were observed at both 2 and 24 hours after challenge with Alternaria (Groups 5 and 7, respectively) compared with Groups 2 and 3, respectively. Furthermore, as shown in Figure 4C, BAL total cell counts were significantly reduced at both 2 and 24 hours after challenge with Alternaria (Groups 5 and 7, respectively) compared with the control groups 2 and 3, respectively. Statistical significance is **** p-values are indicated as p<0.0001.
[0306] This study provides physiological support that reducing TSLP gene expression (rTSLP mRNA) in a rat model may result in phenotypic improvement and reduce lung inflammation, thereby potentially treating diseases such as allergic asthma.
[0307] Example 11. AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0308] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0309] On days 1 and 5, each mouse was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS, or vehicle control (PBS). On days 20 and 22, each mouse was intratracheally administered 50 μL of a 1.0 mg / kg TSLP RNAi agent prepared in isotonic saline, or vehicle control (isotonic saline without RNAi agent), according to Table 32 below. Mice were humanely sacrificed and harvested on day 32. [Table 32]
[0310] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 32 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0311] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 33 below.
[0312] [Table 33]
[0313] As shown in Table 33 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, several TSLP RNAi agents targeting position 571 of the TSLP transcript demonstrated greater than 60% inhibition of hTSLP mRNA, with AC003374 demonstrating approximately 67% mRNA knockdown (Group 2, 0.330) and AC003602 demonstrating approximately 62% knockdown (Group 8, 0.380). These results are also shown in Figure 6A.
[0314] Furthermore, hTSLP protein expression was measured by MSD assay from the right lower lobe of mouse lung tissue collected from each treatment group, and data for some samples are shown in Figures 6B and 6C. As shown in Figure 6B, AC003374 and AC003602 (Groups 2 and 8, respectively) reduced human TSLP protein in the lungs of AAV-transduced mice by approximately 88% and approximately 77%, respectively, at 1.0 mg / kg. Furthermore, as shown in Figure 6C, both AC003374 and AC002603 (Groups 2 and 8, respectively) reduced human TSLP protein in the serum of AAV-transduced mice by approximately 81%.
[0315] Example 12. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0316] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0317] On days 1 and 3, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 14 and 17, each mouse was intratracheally administered 50 μL of 0.4 mg / kg, 0.75 mg / kg, or 1.5 mg / kg of TSLP RNAi agent prepared in isotonic saline according to Table 34 below, or vehicle control (isotonic saline without RNAi agent). Mice were humanely sacrificed and harvested on day 28. [Table 34]
[0318] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 34 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0319] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 35 below.
[0320] [Table 35]
[0321] As shown in Table 35 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC003374 (targeting position 571) demonstrated approximately 62% (0.376) inhibition of TSLP mRNA at 1.5 mg / kg.
[0322] Example 13. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0323] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0324] On days 1 and 3, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 20, each mouse was intratracheally administered 50 μL of 0.5 mg / kg or 1.0 mg / kg of TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 36 below. Mice were humanely sacrificed and harvested on day 29. [Table 36]
[0325] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 36 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0326] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 37 below.
[0327] [Table 37]
[0328] As shown in Table 37 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC003602 demonstrated approximately 56% inhibition (0.440) of TSLP mRNA at 1.0 mg / kg.
[0329] Example 14. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0330] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0331] On days 1 and 3, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 21, each mouse was intratracheally administered 50 μL of 1.5 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 38 below. Mice were humanely sacrificed and harvested on day 31. [Table 38]
[0332] Each TSLP RNAi agent contained a modified nucleotide linked at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 38 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0333] Five mice (n=5) were studied per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 39 below.
[0334] [Table 39]
[0335] As shown in Table 39 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC003602 demonstrated approximately 67% inhibition of TSLP mRNA (0.325) at 1.5 mg / kg, and AC004361 (also targeting position 571 of the TSLP gene) demonstrated approximately 72% inhibition of TSLP mRNA (0.280) at 1.5 mg / kg.
[0336] Example 15. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0337] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0338] On days 1 and 4, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 20 and 22, each mouse was intratracheally administered 50 μL of 1.0 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 40 below. Mice were humanely sacrificed and harvested on day 32. [Table 40]
[0339] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 40 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0340] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 41 below.
[0341] [Table 41]
[0342] As shown in Table 41 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a decrease in hTSLP expression compared to the control (Group 1).
[0343] Furthermore, for each treatment group, hTSLP protein expression was measured by MSD assay from the right lower lobe of collected mouse lung tissue, and data for some samples are shown in Figure 7. As shown in Figure 7, at 1.0 mg / kg, AC004376 reduced human TSLP protein in the lungs of AAV-transduced mice by approximately 79%, while AC004363 and AC004361 both reduced it by 73%.
[0344] Example 16. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0345] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0346] On days 1 and 3, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 17 and 20, each mouse was intratracheally administered 50 μL of 1.0 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 42 below. Mice were humanely sacrificed and harvested on day 31. [Table 42]
[0347] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 42 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0348] Five mice (n=5) were studied per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 43 below.
[0349] [Table 43]
[0350] As shown in Table 43 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC004363 inhibited TSLP mRNA by approximately 62% at 1.0 mg / kg.
[0351] Additionally, for each treatment group, hTSLP protein expression was measured by MSD assay from the right lower lobe of collected mouse lung tissue, and data for some samples are shown in Figure 8. As shown in Figure 8, at 1.0 mg / kg, AC003602 reduced human TSLP protein in the lungs of AAV-transduced mice by approximately 84%, and AC004645 reduced it by approximately 83%.
[0352] Example 17. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0353] Human TSLP mRNA expression in mouse lung tissue was measured by qPCR.
[0354] On days 1 and 4, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 3e10 GC of AAV9-CAG-hTSLP in PBS. On days 22 and 25, each mouse was intratracheally administered 50 μL of 1.0 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 44 below, which contained the groups shown in Table 44 below. Mice were humanely sacrificed and harvested on day 36. [Table 44]
[0355] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 44 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0356] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 45 below.
[0357] [Table 45]
[0358] As shown in Table 45 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC004376 inhibited TSLP mRNA by approximately 67% (0.324) at 1.0 mg / kg, and AC003602 inhibited TSLP mRNA by approximately 62% (0.375) at 1.0 mg / kg.
[0359] Example 18. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0360] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0361] On days 1 and 4, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 20 and 22, each mouse was intratracheally administered 50 μL of 1.5 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 46 below. Mice were humanely sacrificed and harvested on day 34. [Table 46]
[0362] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 46 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0363] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The remaining right lung lobe was collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 47 below.
[0364] [Table 47]
[0365] As shown in Table 47 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a reduction in hTSLP expression compared to the control (Group 1). In particular, AC003602 and AC004568 inhibited TSLP mRNA by approximately 60% (0.399 and 0.400, respectively) at 1.5 mg / kg.
[0366] Furthermore, hTSLP protein expression was measured by MSD assay from the right lower lobe of mouse lung tissue collected for each treatment group, and data for some samples are shown in Figures 9A and 9B. As shown in Figure 9A, AC004565 at 1.5 mg / kg reduced human TSLP protein in the lungs of AAV-transduced mice by approximately 88%. As shown in Figure 9B, at 1.5 mg / kg, AC003602 reduced human TSLP protein in the serum of AAV-transduced mice by approximately 83%, and AC004566 reduced it by approximately 66%.
[0367] Example 19. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0368] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0369] On days 1 and 4, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 18 and 20, each mouse was intratracheally administered 50 μL of 1.5 mg / kg TSLP RNAi agent or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 48 below. Mice were humanely sacrificed and harvested on day 32. [Table 48]
[0370] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein. (See Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6.) Each of the TSLP RNAi agents in Groups 2 through 8 contained a nucleotide sequence designed to inhibit TSLP gene expression by targeting a specific location in TSLP mRNA, as described in Table 48 above. (See, e.g., SEQ ID NO: 1 and Table 2 for the referenced TSLP mRNA sequences.)
[0371] Five mice (n=5) were tested per group. The left lung lobe was collected in 4% PFA for histological analysis. The right lower lung lobe was collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. All remaining right lung lobes were collected for measurement of TSLP mRNA expression by qPCR. The experimental data are shown in Table 49 below.
[0372] [Table 49]
[0373] As shown in Table 49 above, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a decrease in hTSLP expression compared to the control (Group 1).
[0374] Furthermore, for each treatment group, hTSLP protein expression was measured by MSD assay from the right lower lobe of collected mouse lung tissue. Data for some samples are shown in Figures 10A and 10B. As shown in Figure 10A, at 1.5 mg / kg, AC003602 reduced human TSLP protein in the lungs of AAV-transduced mice by approximately 87%, and AC004573 reduced it by approximately 79%. As shown in Figure 10B, at 1.5 mg / kg, AC003602 reduced human TSLP protein in the serum of AAV-transduced mice by approximately 76%, and AC004574 reduced it by approximately 65%.
[0375] Example 20. TSLP-SEAP Mouse Model To evaluate TSLP RNAi agents, we used the TSLP-SEAP mouse model. C57BL6 / albino female mice were transiently transfected in vivo with plasmids by hydrodynamic tail vein (HTV) injection. Mice were injected with the plasmid pMIR0962, which contains nucleotides 179–2610 of the TSLP cDNA sequence (GenBank NM_033035.5 (SEQ ID NO: 1)) inserted into the 3'UTR of the SEAP (secreted human placental alkaline phosphatase) reporter gene, by hydrodynamic tail vein (HTV) injection. TSLP-SEAP model mice were generated by HTV injection of 20 μg of plasmid containing TSLP cDNA in Ringer's solution in a total volume of 10% of the animal's body weight. After transfection with TSLP-SEAP, mice were then administered a TSLP RNAi agent. Inhibition of TSLP gene expression by the TSLP RNAi agent results in concomitant inhibition of SEAP expression. SEAP expression levels were measured using the Phospha-Light® SEAP Reporter Gene Assay System (ThermoFisher Cat. No. T1016). SEAP expression levels in serum were measured before treatment, and mice were grouped according to the average SEAP level.
[0376] Analysis: SEAP levels can be measured before and at various time points after administration of the TSLP RNAi agent.
[0377] i) Serum collection: Mice were anesthetized with 2-3% isoflurane, and blood samples were collected from the submandibular gland region into serum separator tubes (Sarstedt AG & Co., Numbrecht, Germany). Blood was allowed to clot for 20 minutes at ambient temperature. The tubes were centrifuged at 8,000 × g for 3 minutes to separate the serum, which was then stored at 4°C.
[0378] ii) Serum SEAP levels: Serum was collected and measured using the Phospha-Light® SEAP Reporter Gene Assay System (ThermoFisher) according to the manufacturer's instructions. Each animal's serum SEAP level was normalized to that of saline-injected control mice to account for non-treatment-related declines in TSLP sequence expression in this model. First, the SEAP level of each animal at a given time point was divided by that animal's pre-treatment expression level ("pre-treatment") to obtain a "normalized to pre-treatment" expression ratio. Expression at a specific time point was then normalized to the control group by dividing the individual animal's "normalized to pre-treatment" ratio by the average "normalized to pre-treatment" ratio of all mice in the normal saline control group. Alternatively, in some examples described herein, each animal's serum SEAP level was assessed by normalizing to the pre-treatment level only.
[0379] To evaluate the activity of TSLP RNAi agents in the SEAP model described in the Examples below, several TSLP RNAi agents were conjugated to an N-acetylgalactosamine-containing targeting ligand with the chemical structure designated NAG37 (see Table 11 for structural information), as shown in Tables 5, 6, and 10. NAG37 is known to have high binding affinity to the asialoglycoprotein receptor, which is abundantly expressed in liver cells, including hepatocytes (see International Patent Application Publication No. WO2018044350A1). NAG37-conjugated TSLP RNAi agents were used to evaluate SEAP expression in the liver.
[0380] Example 21. In vivo administration of TSLP RNAi agents in TSLP-SEAP mice The TSLP-SEAP model described in Example 20 above was used. On day -21, four (n=4) female C57bl / 6 albino mice received a 20 μg pMIR0962 TSLP-SEAP hydrodynamic tail vein (HTV) injection. On day 1, mouse test animals received a subcutaneous injection (SQ) of either isotonic saline or a TSLP RNAi agent (0.5 mg / kg, 1.0 mg / kg, or 1.5 mg / kg) formulated in saline, with an injection volume of 250 μL per 25 g of body weight. The dosing regimen was according to Table 50 below.
[0381] [Table 50]
[0382] To evaluate the efficacy of this TSLP RNAi agent and the SEAP assay, AC003679 was conjugated to NAG37 (see Table 11 for structural information). NAG37 is known to have high binding affinity to the asialoglycoprotein receptor, which is abundantly expressed in liver cells, including hepatocytes. AC003679 was chemically modified as follows: Modified sense strand (5'→3'): ((NAG37)s(invAb)sagucacaaCfCfAfauaaaugucus(invAb) (SEQ ID NO: 775) Modified antisense strand (5'→3'): asGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 652)
[0383] To evaluate the efficacy of the TSLP RNAi agent and SEAP assay in this example, AC003989 was conjugated to NAG37 (see Table 11 for structural information). NAG37 is known to have high binding affinity to the asialoglycoprotein receptor, which is abundantly expressed in liver cells, including hepatocytes. AC003989 was chemically modified as follows: Modified sense strand (5'→3'): (NAG37)s(invAb)sggaaacucAfGfAfuaaaugcuaas(invAb) (SEQ ID NO: 774) Modified antisense strand (5'→3'): cPrpusUfsagCfauuUfauCfuGfaguuucsc (SEQ ID NO: 628)
[0384] To evaluate the efficacy of the TSLP RNAi agent and SEAP assay in this example, AC003920 was conjugated to NAG37 (see Table 11 for structural information). NAG37 is known to have high binding affinity to the asialoglycoprotein receptor, which is abundantly expressed in liver cells, including hepatocytes. AC003920 was chemically modified as follows: Modified sense strand (5'→3'): (NAG37)s(invAb)sggucacaaCfCfAfauaaaugucus(invAb) (SEQ ID NO: 760) Modified antisense strand (5'→3'): asGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 653)
[0385] Serum was collected on days -7, 1, 8, 15, and 22. SEAP expression levels were measured according to the procedures described above in Example 20. The experimental data are presented in Table 51 below, with the mean SEAP reflecting the normalized average value of SEAP.
[0386] [Table 51]
[0387] Groups 2-12 showed reduced SEAP-TSLP at all time points (days 8, 15, and 22) compared to saline control Group 1. More specifically, AC003920 inhibited SEAP-TSLP by approximately 97% at 1.5 mg / kg on day 22 in this model.
[0388] Example 22. In vivo anti-inflammatory effects of TSLP knockdown in a rat airway inflammation model, delivered by intratracheal microsprayer On study days 1 and 3, male Brown Norway rats were administered 5 mg / kg of a rat-specific RNAi agent (designated AC001714 or AC002515) conjugated with a Tri-SM6.1-αvβ6 integrin-targeting ligand or saline vehicle. Additionally, a "RISC-blocked" RNAi trigger was also used. This has a similar structure to AC001714 and contains the same targeting ligand, but contains chemical modifications designed to prevent the antisense strand from loading into RISC, thus serving as a negative control. A 200 μL volume was loaded into a syringe connected to a microsprayer device (Penn Century, Philadelphia, PA) for intratracheal administration.
[0389] AC001714 and AC002515 contain rat-specific sequences designed to target the rat TSLP transcript (NCBI GenBank XM_008772052.2) and have no homology to the human TSLP gene (the chemical structure of which is shown in Examples 2 and 3 above).
[0390] On day 15, rats were challenged with a single intratracheal instillation of Alternaria alternata prepared in PBS at a dose of 500 μg per rat. Group 1 rats received PBS alone as a control.
[0391] [Table 52]
[0392] Twenty-four hours after administration of Alternaria (i.e., day 16), rats were anesthetized with isoflurane / oxygen, bled, and euthanized by exsanguination. The sacrifice / euthanasia dates are shown in Table 14 above. The trachea was cannulated, and bronchoalveolar lavage fluid (BAL) was collected after two lavages with 5 mL of ice-cold PBS. BAL samples were centrifuged, cells were resuspended in 1 mL of ice-cold PBS, and an aliquot was mixed with Turk's solution (1:1 ratio), and total cell numbers were counted using a hemocytometer. Cytospins were prepared and stained, and differential cell counts were performed. Supernatants were used to measure cytokines. The right lung lobe was used to measure rTSLP mRNA expression, and the left lung lobe was collected in 4% PFA / PBS for histological examination (Trichrome and Sirius Red staining, RNAscope).
[0393] Rat lungs were inflated, fixed in 4% PFA, and processed for mRNA in situ hybridization and immunohistochemical staining. TSLP RNAscope images demonstrate that TSLP is expressed in the airways and alveoli. Z-stack confocal scan images demonstrate TSLP transcripts retained in the nucleus, indicating that silencing cytoplasmic TSLP mRNA does not reduce nuclear-retained pre-mRNA.
[0394] Example 23. Passive uptake of TSLP RNAi agents in human precision-cut lung slices (PCLS) Precision-cut lung slices (PCLS) are an in vitro model and tool for studying lung structure and function in their native 3D environment, allowing for the observation of natural interactions between cells, molecules, and the extracellular matrix (ECM) in vitro (Alsafadi HN et al., Am J Respir Cell Mol Biol 62(6): 681-691 (2020)). PCLS can be generated from various anatomical sites (distal and proximal) of the lung and from various species (including rodents, pigs, monkeys, and humans). To validate the efficacy of an RNAi agent silencing human TSLP mRNA, fresh agarose-expanded lung slices from a single healthy human donor were used.
[0395] Saline or TSLP RNAi agent was added to the cell culture medium, and the medium was changed daily. PCLS were cultured in the medium from day 1 to day 7 and harvested on day 8. PCLS were cultured and administered with TSLP RNAi agent according to Table 53 below.
[0396] The RNAi agent AC003609, a "RISC-blocked" RNAi agent, serves as a negative control because it contains chemical modifications designed to inhibit the loading of the antisense strand into RISC.
[0397] [Table 53]
[0398] TSLP mRNA expression was quantified by qPCR using PPIA as an endogenous control gene and normalized to saline-treated Group 1 samples. Relative qPCR expression data are shown in Table 54 below.
[0399] [Table 54]
[0400] Effective passive uptake of the TSLP RNAi agent was observed. PCLS cultures treated with the TSLP RNAi agent showed significant silencing of hTSLP mRNA. Groups 2–10 showed inhibition of TSLP on day 8. More specifically, AC003546 (10 μM) showed approximately 80% inhibition (0.198) on day 8. Furthermore, a dose-response was observed for AC003374, AC003602, and AC003546.
[0401] Example 24. Passive uptake of TSLP RNAi agents in human precision-cut lung slices (PCLS) Precision-cut lung slices (PCLS) are an in vitro model and tool for studying lung structure and function in their native 3D environment, allowing for the observation of natural interactions between cells, molecules, and the extracellular matrix (ECM) in vitro (Alsafadi HN et al., Am J Respir Cell Mol Biol 62(6): 681-691 (2020)). PCLS can be generated from various anatomical sites (distal and proximal) of the lung and from various species (including rodents, pigs, monkeys, and humans). To validate the efficacy of an RNAi agent silencing human TSLP mRNA, fresh agarose-expanded lung slices from a single healthy human donor were used.
[0402] Saline or TSLP RNAi agent was added to the cell culture medium, and the medium was changed daily. PCLS were cultured in the medium from day 1 to day 7 and harvested on day 8. PCLS were cultured and administered with TSLP RNAi agent according to Table 55 below.
[0403] [Table 55]
[0404] AC001651 is an RNAi agent designed to initiate RISC and inhibit the expression of different genes, but not target the hTSLP gene.
[0405] TSLP mRNA expression was quantified by qPCR using B2M as an endogenous control gene and normalized to saline-treated Group 1 samples. Relative qPCR expression data are shown in Table 56 below.
[0406] [Table 56]
[0407] Effective passive uptake of the TSLP RNAi agent was observed. PCLS cultures treated with the TSLP RNAi agent demonstrated silencing of hTSLP mRNA. Groups 2–6 and 8–10 showed inhibition of TSLP on day 8. Groups 7 and 11 showed negligible inhibition. More specifically, AC003374 (10 μM) demonstrated approximately 63% inhibition (0.362) on day 8. Furthermore, a dose-response was observed for AC003253 and AC003374.
[0408] Example 25. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0409] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0410] On days -17 and -14, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 1 and 3, each mouse was intratracheally administered 50 μL of TSLP RNAi agent (at 0.75, 1.5, or 3.0 mg / kg) or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 57 below. Mice were humanely sacrificed and harvested on day 15.
[0411] [Table 57]
[0412] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein (see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6).
[0413] Five mice (n=5) were studied per group. Serum samples and the right lower lung lobe were collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The left lung lobe and all remaining right lung lobes were collected for measurement of TSLP mRNA expression by qPCR using eGFP as an endogenous control gene and normalized to Group 1. The experimental data are shown in Table 58 below.
[0414] [Table 58]
[0415] As shown above in Table 58, each of the TSLP RNAi agents tested (Groups 2-8) demonstrated a decrease in hTSLP expression compared to the control (Group 1). A dose response was also observed with AC004361.
[0416] Furthermore, hTSLP protein expression was measured by MSD assay from the right lower lobe of mouse lung tissue collected for each treatment group. Data for several samples are shown in Figures 11A and 11B. As shown in Figure 11A, AC003374 at 2 × 3.0 mg / kg doses showed an approximately 89% reduction in human TSLP protein in the lungs of AAV-transduced mice, and AC004361 at 2 × 3.0 mg / kg doses showed an approximately 94% reduction. A dose-response was observed for AC004361 in mouse lungs. As shown in Figure 11B, AC003374 at 2 × 3.0 mg / kg doses showed an approximately 90% reduction in human TSLP protein in the serum of AAV-transduced mice, and AC004361 at 2 × 3.0 mg / kg doses showed an approximately 86% reduction. A dose-response was observed in mouse serum for both AC003374 and AC004361.
[0417] Example 26. TSLP RNAi Agent in the AAV9-CAG-hTSLP AAV Mouse Model To evaluate several TSLP RNAi agents, we used the same AAV9-CAG-hTSLP (adeno-associated virus) mouse model described in Example 4.
[0418] The expression of human TSLP mRNA in mouse lung tissue was measured by qPCR.
[0419] On days -17 and -14, each mouse (female C57Bl / 6) was intratracheally administered 50 μL of an AAV solution containing 2e10 GC (genomic copies) of AAV9-CAG-eGFP and 2e10 GC of AAV9-CAG-hTSLP in PBS. On days 1 and 3, each mouse was intratracheally administered 50 μL of TSLP RNAi agent (at 0.75, 1.5, or 3.0 mg / kg) or vehicle control (isotonic saline without RNAi agent) prepared in isotonic saline according to Table 59 below. Mice were humanely sacrificed and harvested on day 15.
[0420] The RNAi agent AC005329, a "RISC-blocked" RNAi agent, serves as a negative control because it contains chemical modifications designed to inhibit the loading of the antisense strand into RISC. [Table 59]
[0421] Each TSLP RNAi agent contained a modified nucleotide attached at the 5' end of the sense strand to an αvβ6 integrin-targeting ligand having a modified sequence as shown in the duplex structure herein (see Tables 3, 4, 5, 6, 7A, 7B, 8, 9, 10, and 11 for specific modification and structural information for TSLP RNAi agents, including Tri-SM6.1-αvβ6).
[0422] Five mice (n=5) were studied per group. Serum samples and the right lower lung lobe were collected for measurement of human TSLP protein by Meso Scale Discovery (MSD) assay. The left lung lobe and all remaining right lung lobes were collected for measurement of TSLP mRNA expression by qPCR using eGFP as an endogenous control gene and normalized to Group 1. The experimental data are shown in Table 60 below.
[0423] [Table 60]
[0424] As shown above in Table 60, the RNAi agents tested in Groups 2-7 showed a decrease in hTSLP expression compared to the control (Group 1). A dose response was also observed with AC003374.
[0425] Furthermore, hTSLP protein expression was measured by MSD assay from the right lower lobe of mouse lung tissue collected for each treatment group. Data for some samples are shown in Figures 12A and 12B. As shown in Figure 12A, AC003374 at 2 x 3.0 mg / kg doses showed an approximately 94% reduction in human TSLP protein in the lungs of AAV-transduced mice, and AC004361 at 2 x 3.0 mg / kg doses showed an approximately 92% reduction. A dose-response was also observed with AC003374 in the mouse lungs. As shown in Figure 12B, AC003374 at 2 x 1.5 mg / kg doses showed an approximately 91% reduction in human TSLP protein in the serum of AAV-transduced mice, and AC004361 at 2 x 1.5 mg / kg doses showed an approximately 92% reduction.
[0426] Example 27. In vivo administration of TSLP RNAi agents in B-hTSLP / hTSLPR humanized TSLP knock-in mice To evaluate several TSLP RNAi agents, we used the B-hTSLP / hTSLPR mouse model (C57Bl / 6-Tslp, also known as B-hTSLP / hTSLPR mouse). tm1(TSLP) Crlf2 tm2(CRLF2) B-hTSLP / hTSLPR mice (strain name) were purchased and received from Biocytogen (catalog number 121269). The background mice were C57BL / 6 strain. In B-hTSLP / hTSLPR mice, exons 1 to 5 of the mouse TSLP gene, which encodes the full-length protein, were replaced with human TSLP exons 1 to 4, which contain nucleobases 179 to 658 of human TSLP. The extracellular and transmembrane domains of the human thymic stromal lymphopoietin receptor (TSLPR) gene and the cytoplasmic domain of the mouse TSLPR gene were constructed into a chimeric CDS vector and inserted into exon 2 of the mouse. These mice express chimeric TSLP and TSLPR proteins but no longer express mouse TSLP or TSLPR.
[0427] Five (n=5) male B-hTSLP / hTSLPR mice were administered a 50 μL dose of saline (as a vehicle control) or TSLP RNAi agent (at 5.0 mg / kg) prepared in isotonic saline via intratracheal (IT) administration on days 1 and 3. Administration was performed according to Table 61 below.
[0428] The RNAi agent AC005329, a "RISC-blocked" RNAi agent, contains chemical modifications designed to prevent the loading of the antisense strand into RISC and therefore serves as a negative control.
[0429] [Table 61]
[0430] Five mice (n=5) were tested per group. Mouse test animals were humanely sacrificed and harvested on days 15, 29, or 43. Lungs were collected to measure TSLP mRNA expression by qPCR using mGAPDH as the endogenous control gene. Groups 2-4 were normalized to Group 1, Groups 6-7 to Group 5, and Groups 9-10 to Group 8. The experimental data are shown in Table 62 below.
[0431] [Table 62]
[0432] TSLP RNAi agents silenced human TSLP mRNA expression in the lungs of knock-in mice for more than 6 weeks. The RISC-blocking RNAi agent AC005329 (Group 4) failed to silence hTSLP expression. Groups 2, 3, 6, 7, 9, and 10 showed a reduction in hTSLP in mouse test animals. More specifically, AC003374 demonstrated hTSLP inhibition, with approximately 52% (0.475) inhibition at 5.0 mg / kg on Day 43. Groups 9 and 10 demonstrated hTSLP inhibition through at least Day 43.
[0433] Example 28. In vivo administration of TSLP RNAi agents in B-hTSLP / hTSLPR humanized TSLP knock-in mice To evaluate several TSLP RNAi agents, we used the B-hTSLP / hTSLPR mouse model (C57Bl / 6-Tslp, also known as B-hTSLP / hTSLPR mouse). tm1(TSLP) Crlf2 tm2(CRLF2) B-hTSLP / hTSLPR mice (strain name) were purchased and received from Biocytogen (catalog number 121269). The background mouse strain was C57Bl / 6. In B-hTSLP / hTSLPR mice, exons 1 to 5 of the mouse TSLP gene, which encodes the full-length protein, were replaced with human TSLP exons 1 to 4, which contain nucleobases 179 to 658 of human TSLP. The extracellular and transmembrane domains of the human thymic stromal lymphopoietin receptor (TSLPR) gene and the cytoplasmic domain of the mouse TSLPR gene were constructed into a chimeric CDS vector and inserted into exon 2 of the mouse. These mice express chimeric TSLP and TSLPR proteins but no longer express mouse TSLP or TSLPR.
[0434] Five (n=5) male B-hTSLP / hTSLPR mice were administered a 50 μL dose of saline (as a vehicle control) or TSLP RNAi agents (at 1.0, 2.5, or 5.0 mg / kg) prepared in isotonic saline via intratracheal (IT) administration on days 1 and 3. Administration was performed according to Table 63 below.
[0435] The "RISC-blocked" RNAi agents AC005329 and AC006020 contain chemical modifications designed to prevent the loading of the antisense strand into RISC and therefore serve as negative controls.
[0436] [Table 63]
[0437] Five mice (n=5) were tested per group. Mouse test animals were humanely sacrificed and harvested on day 15. Lungs were collected to measure TSLP mRNA expression by qPCR using mB2M as the endogenous control gene. Groups 2-11 were normalized to Group 1. The experimental data are shown in Table 64 below.
[0438] [Table 64]
[0439] Groups 2-7 showed a decrease in hTSLP in mouse test animals. Groups 8-11 showed negligible hTSLP inhibition. More specifically, AC003374 inhibited hTSLP, demonstrating approximately 49% (0.506) inhibition at 5.0 mg / kg on day 15 of treatment. A dose response was observed in mice treated with AC003374. Other embodiments
[0440] While the present invention has been described in conjunction with its detailed description, it is to be understood that the foregoing description is intended to illustrate, but not limit, the scope of the invention, which is defined by the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.
Claims
1. 1. An RNAi agent for inhibiting expression of a thymic stromal lymphopoietin gene, comprising: an antisense strand comprising at least 17 consecutive nucleotides that differ from any one of the sequences provided in Table 2 or Table 3 by 0 or 1 nucleotide; and a sense strand comprising a nucleotide sequence at least partially complementary to the antisense strand.
2. The RNAi agent of claim 1, wherein the antisense strand comprises nucleotides 2 to 18 of any one of the sequences listed in Table 2 or Table 3.
3. 3. The RNAi agent of claim 1 or claim 2, wherein the sense strand comprises a nucleotide sequence of at least 17 contiguous nucleotides that differs by 0 or 1 nucleotide from any one of the sequences set forth in Table 2 or Table 4; and wherein the sense strand has a region of at least 85% complementarity over said 17 contiguous nucleotides to the antisense strand.
4. The RNAi agent of any one of claims 1 to 3, wherein at least one nucleotide of the TSLP RNAi agent is a modified nucleotide or comprises a modified internucleoside linkage.
5. The RNAi agent of any one of claims 1 to 4, wherein all or substantially all of the nucleotides are modified nucleotides.
6. 6. The RNAi agent of claim 4, wherein the modified nucleotide is selected from the group consisting of 2'-O-methyl nucleotides, 2'-fluoro nucleotides, 2'-deoxy nucleotides, 2',3'-seconucleotide mimics, locked nucleotides, 2'-F-arabino nucleotides, 2'-methoxyethyl nucleotides, abasic nucleotides, ribitol, inverted nucleotides, inverted 2'-O-methyl nucleotides, inverted 2'-deoxy nucleotides, 2'-amino modified nucleotides, 2'-alkyl modified nucleotides, morpholino nucleotides, vinyl phosphonate-containing nucleotides, cyclopropyl phosphonate-containing nucleotides, and 3'O-methyl nucleotides.
7. The RNAi agent of claim 5, wherein all or substantially all of the nucleotides are modified with 2'-O-methyl nucleotides, 2'-fluoro nucleotides, or a combination thereof.
8. The RNAi agent of any one of claims 1 to 7, wherein the antisense strand comprises a nucleotide sequence of any one of the modified sequences listed in Table 3.
9. The RNAi agent of any one of claims 1 to 8, wherein the sense strand comprises a nucleotide sequence of any one of the modified sequences listed in Table 4.
10. 2. The RNAi agent of claim 1, wherein the antisense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 3, and the sense strand comprises the nucleotide sequence of any one of the modified sequences listed in Table 4.
11. The RNAi agent of any one of claims 1 to 10, wherein the sense strand is 18 to 30 nucleotides in length and the antisense strand is 18 to 30 nucleotides in length.
12. The RNAi agent of claim 11, wherein the sense strand and the antisense strand are each 18 to 27 nucleotides in length.
13. The RNAi agent of claim 12, wherein the sense strand and the antisense strand are each 18 to 24 nucleotides in length.
14. The RNAi agent of claim 13, wherein the sense strand and the antisense strand are each 21 nucleotides in length.
15. The RNAi agent of claim 14, having two blunt ends.
16. The RNAi agent of any one of claims 1 to 15, wherein the sense strand comprises one or two terminal caps.
17. The RNAi agent of any one of claims 1 to 16, wherein the sense strand comprises one or two inverted abasic residues.
18. The RNAi agent of claim 1, which is composed of a sense strand and an antisense strand that form a duplex having any one of the structures of the duplexes in Table 7A, Table 7B, Table 8, Table 9, or Table 10.
19. 19. The RNAi agent of claim 18, wherein all or substantially all of the nucleotides are modified nucleotides.
20. The following nucleotide sequence (5' to 3'): AGACAUUUAUUGGUUGUGACC (SEQ ID NO: 836); AGACGUUUAUUGGUUGUGACC (SEQ ID NO: 853); UGACAUUUAUUGGUUGUGACC (SEQ ID NO: 837); UGACGUUUAUUGGUUGUGACC (SEQ ID NO: 856); AGACAUUUAUUGGUUGUGA (SEQ ID NO: 196); UGACAUUUAUUGGUUGUGA (SEQ ID NO: 197); UUAGCAUUUAUCUGAGUUU (SEQ ID NO: 137); UUAGCAUUUAUCUGAGUUC (SEQ ID NO: 139); UACAUUUAUUGGUUGUGAC (SEQ ID NO: 192); AGACAUUUAUUGGUUGUGACU (SEQ ID NO: 830); UUAGCAUUUAUCUGAGUUUCC (SEQ ID NO: 825); or UACAUUUAUUGGUUGUGACUU (SEQ ID NO: 826) 10. The RNAi agent of claim 1, comprising an antisense strand consisting of, consisting essentially of, or comprising a nucleotide sequence that differs by 0 or 1 nucleotide from one of
21. The sense strand has the following nucleotide sequence (5' to 3'): GGUCACAACCAAUAAAUGUCU (SEQ ID NO: 872); GGUCACAACCAAUAAAUGUCA (SEQ ID NO: 873); UCACAACCAAUAAAUGUCU (SEQ ID NO: 461); UCACAACCAAUAAAUGUCA (SEQ ID NO: 462); AAACUCAGAUAAAUGCUAA (SEQ ID NO: 402); G(A 2N )ACUCAGAUAAAUGCUAA (SEQ ID NO: 871); GUCACAACCAAUAAAUGUA (SEQ ID NO: 457) AGUCACAACCAAUAAAUGUCU (SEQ ID NO: 864); GGAAACUCAGAUAAAUGCUAA (SEQ ID NO: 866); or (A 2N )AGUCACAACCAAUAAAUGUA (SEQ ID NO: 863) (where, (A 2N 21. The RNAi agent of claim 20, wherein the RNAi agent consists of, consists essentially of, or comprises a nucleotide sequence that differs by 0 or 1 nucleotide from one of the following:
22. 22. The RNAi agent of claim 20 or 21, wherein all or substantially all of the nucleotides are modified nucleotides.
23. 2. The RNAi agent of claim 1, comprising the following nucleotide sequence (5'→3'): cPrpasGfsacauuuaUfuGfgUfuGfugacsc (SEQ ID NO: 649) cPrpasGfsaCfaUfuUfaUfuGfgUfuGfuGfaCfsu (SEQ ID NO: 609); cPrpasGfsacauuuaUfuGfgUfuGfugacsu (SEQ ID NO: 611); cPrpasGfsacguuuaUfuGfgUfuGfugacsc (SEQ ID NO: 681); cPrpasGfsacauuuAfuuGfgUfuGfugacsu (SEQ ID NO: 612); cPrpusUfsagcauuUfauCfuGfaGfuuucsc (SEQ ID NO: 603); cPrpusUfsagcauUfuauCfuGfaGfuuucsc (SEQ ID NO: 606); or cPrpusAfscsAfuUfuAfuUfgGfuUfgUfgAfcUfsu (SEQ ID NO: 594); (wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; cPrpa represents 5'-cyclopropylphosphonate-2'-O-methyl adenosine; cPrpu represents 5'-cyclopropylphosphonate-2'-O-methyl uridine; s represents a phosphorothioate linkage; and wherein all or substantially all of the nucleotides on the sense strand are modified nucleotides), an RNAi agent comprising an antisense strand comprising, consisting of, or consisting essentially of a modified nucleotide sequence that differs by 0 or 1 nucleotide from one of the following:
24. 2. The RNAi agent of claim 1, wherein the sense strand has the following nucleotide sequence (5'→3'): gsgucacaaCfCfAfauaaaugucu (SEQ ID NO: 714); asgucacaaCfCfAfauaaaugucu (SEQ ID NO: 702); gsgaaacucAfGfAfuaaaugcuaa (SEQ ID NO: 704); a_2NsagucacaAfCfCfaauaaaugua (SEQ ID NO: 701); (wherein a represents 2'-O-methyl adenosine, c represents 2'-O-methyl cytidine, g represents 2'-O-methyl guanosine, and u represents 2'-O-methyl uridine; Af represents 2'-fluoro adenosine, Cf represents 2'-fluoro cytidine, Gf represents 2'-fluoro guanosine, and Uf represents 2'-fluoro uridine; a_2N represents 2'-O-methyl-2-amino adenosine; s represents a phosphorothioate linkage; and where all or substantially all of the nucleotides on the antisense strand are modified nucleotides).
25. 25. The RNAi agent of any one of claims 20 to 24, wherein the sense strand further comprises an inverted abasic residue at the 3' end of the nucleotide sequence, at the 5' end of the nucleotide sequence, or both.
26. The RNAi agent of any one of claims 1 to 25, wherein the RNAi agent is linked to a targeting ligand.
27. 27. The RNAi agent of claim 26, wherein the targeting ligand has affinity for a cellular receptor expressed on epithelial cells.
28. 28. The RNAi agent of claim 27, wherein the targeting ligand comprises an integrin targeting ligand.
29. The RNAi agent of claim 28, wherein the integrin targeting ligand is an αvβ6 integrin targeting ligand.
30. The targeting ligand has the following structure: 【Chemistry 1】 or a pharmaceutically acceptable salt thereof, or 【Chemistry 2】 or a pharmaceutically acceptable salt thereof (where, 【Transformation 3】 indicates a point of attachment to the RNAi agent.
31. 30. The RNAi agent of any one of claims 26-29, wherein the targeting ligand has a structure selected from the group consisting of: 【Chemistry 4-1】 【Chemistry 4-2】 【Chemistry 4-3】 【Chemistry 4-4】 [Chemistry 4-5] [Chemistry 4-6] 【Chemistry 4-7】 【Chemistry 4-8】 and 【Chemistry 4-9】 (where, 【Transformation 5】 indicates the point of attachment to the RNAi agent).
32. 1. The RNAi agent has the structure: 【Transformation 6】 32. The RNAi agent of claim 31 , wherein the RNAi agent is bound to a target ligand having the formula:
33. The RNAi agent of any one of claims 26 to 32, wherein the targeting ligand is bound to the sense strand.
34. The RNAi agent of claim 33, wherein the targeting ligand is attached to the 5' end of the sense strand.
35. The RNAi agent of any one of claims 1 to 34, which is a pharmaceutically acceptable salt.
36. 36. The RNAi agent of claim 35, which is a sodium salt.
37. 37. A composition comprising the RNAi agent of any one of claims 1 to 36, wherein the composition further comprises a pharmaceutically acceptable excipient.
38. 38. The composition of claim 37, further comprising a second RNAi agent capable of inhibiting expression of a thymic stromal lymphopoietin gene.
39. The composition of any one of claims 37-38, further comprising one or more additional therapeutic agents.
40. 40. The composition of any one of claims 37 to 39, formulated for inhaled administration.
41. 41. The composition of claim 40, delivered by a metered dose inhaler, a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler.
42. 42. The composition of any of claims 37-41, wherein the RNAi agent is a sodium salt.
43. The composition of any one of claims 37 to 42, wherein the pharmaceutically acceptable excipient is water for injection.
44. 43. The composition of any one of claims 37 to 42, wherein the pharmaceutically acceptable excipient is buffered saline.
45. A method for inhibiting expression of the TSLP gene in a cell, comprising introducing into the cell an effective amount of the RNAi agent of any one of claims 1 to 35 or the composition of any one of claims 37 to 44.
46. 46. The method of claim 45, wherein the cell is in a subject.
47. 47. The method of claim 46, wherein the subject is a human subject.
48. 48. The method of any one of claims 45-47, wherein after administration of the RNAi agent, expression of the thymic stromal lymphopoietin gene is inhibited by at least about 30%.
49. 45. A method of treating one or more conditions or diseases associated with enhanced or elevated levels of TSLP cytokine activity, comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of any one of claims 37 to 44.
50. 50. The method of claim 49, wherein the disease is asthma (including but not limited to allergic asthma), chronic obstructive pulmonary disease (including but not limited to chronic bronchitis and emphysema), pulmonary inflammatory disorders, interstitial lung disease (ILD), cystic fibrosis, various other types of fibrosis, infectious diseases (e.g., SARS-COV-2), acute lung injury (e.g., acute respiratory distress syndrome (ARDS)), pulmonary hypertension, various lung cancers, chronic sinusitis with or without nasal polyps, autoimmune disorders (including but not limited to systemic sclerosis (SSc)), and polyinflammatory diseases (including but not limited to atopic dermatitis, chronic idiopathic urticaria, and eosinophilic esophagitis).
51. 51. The method of claim 50, wherein the disease is allergic asthma.
52. 52. The method of any one of claims 45-51, wherein the RNAi agent is administered at a deposited amount of about 0.01 mg / kg to about 5.0 mg / kg of subject body weight.
53. 53. The method of any one of claims 45-52, wherein the RNAi agent is administered at a deposited amount of about 0.03 mg / kg to about 2.0 mg / kg of subject body weight.
54. 54. The method of any of claims 45-53, wherein the RNAi agent is administered in two or more doses.
55. 37. Use of the RNAi agent of any one of claims 1 to 36 for the treatment of a disease, disorder, or condition mediated at least in part by TSLP cytokine activity and / or TSLP gene expression.
56. 45. Use of the composition of any one of claims 37 to 44 for the treatment of a disease, disorder, or condition mediated at least in part by thymic stromal lymphopoietin cytokine activity and / or thymic stromal lymphopoietin gene expression.
57. 45. Use of the composition of any one of claims 37 to 44 for the manufacture of a medicament for the treatment of a disease, disorder, or condition mediated at least in part by thymic stromal lymphopoietin cytokine and / or thymic stromal lymphopoietin gene expression.
58. The use according to any one of claims 55 to 57, wherein the disease is pulmonary inflammation.
59. A method for producing an RNAi agent according to any one of claims 1 to 36, comprising annealing a sense strand and an antisense strand to form a double-stranded ribonucleic acid molecule.
60. 60. The method of claim 59, wherein the sense strand comprises a target ligand.
61. 61. The method of claim 60, comprising attaching a targeting ligand to the sense strand.