Allele-selective compounds and methods for modulating huntingtin expression

Abstract

Provided herein are compounds, pharmaceutical compositions, and methods of use for selectively reducing the amount or activity of HTT RNA containing SNP rs7685686 in a cell or subject, and optionally reducing the amount of mutant HTT protein in a cell or subject. Such compounds, pharmaceutical compositions, and methods of use are useful for ameliorating at least one symptom or feature of Huntington's disease.

Description

[Technical Field]

[0001] Sequence Listing

[0001] This application is submitted with an electronic Sequence Listing. The Sequence Listing is provided as the file BIOL0471SEQ.xml, created on January 31, 2024, and is 262 KB in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.

[0002] Compounds, pharmaceutical compositions, and methods are provided for selectively reducing the amount or activity of huntingtin (HTT) RNA containing SNP rs7685686 in a cell or subject, and optionally reducing the amount of mutant huntingtin (mHTT) protein encoded by HTT containing SNP rs7685686 in a cell or subject. Such compounds and pharmaceutical compositions are more selective than non-target nucleic acids, such as wild-type HTT or bone morphogenetic protein receptor 1 (BMPR1). Such compounds, pharmaceutical compositions, and methods are also useful for ameliorating at least one symptom or characteristic of Huntington's disease (HD). Symptoms or characteristics of Huntington's disease include, but are not limited to, brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory impairment, and depression. [Background technology]

[0003] Huntington's disease (HD) is an autosomal dominant disorder caused by an expansion of a cytosine-adenine-guanine (CAG) trinucleotide repeat region within HTT (also known as interest transcript 15, or IT15), the gene that encodes the huntingtin protein (HTT). The resulting expanded CAG repeat region encodes an abnormally long polyglutamine (PolyQ) tract within the HTT protein, leading to the expression of mutant HTT (mHTT) protein. Due to the excessive polyglutamine length, mHTT protein forms aggregates in the cytoplasm and nucleus of neurons in the central nervous system (Davies et al., Cell 1997, 90:537-548). Due to genomic instability, the expanded CAG repeat region can further expand with aging and during meiotic transmission to include additional CAG repeats. Although individuals with 27–35 CAG repeats typically do not develop HD, their children are at risk. Individuals with 35–60 CAG repeats typically experience adult-onset HD. Individuals with more than 60 CAG repeats typically develop early-onset HD, experiencing HD symptoms before age 20. Individuals with a normal number of CAG repeats (<27) are not considered at risk for developing HD.

[0004] In addition to the presence of the expanded CAG repeat region, the HTT gene may further contain one or more disease-associated single nucleotide polymorphisms (SNPs).An exemplary disease-associated SNP is rs7685686, which has an A nucleotide instead of a G nucleotide at this position. Other exemplary disease-associated SNPs include, but are not limited to, rs362271, rs362272, rs362273, rs362307, rs362331, rs363099, rs2798296, rs1263309, rs762855, rs6446723, rs2298969, rs7691627, rs6844859, rs4690073, rs2024115, rs16843804, rs363064, rs363088, and rs4690072 (Carroll, et al., Mol Ther. 2011, 19:2178-2185; Skotte, et al., PLOS ONE 2014, 9:e107434).

[0005] Currently, there is a lack of acceptable options for the treatment of Huntington's disease. Accordingly, it is an object of the present invention to provide compounds, pharmaceutical compositions and methods of use for the treatment of HD. Summary of the Invention

[0006] Provided herein are compounds, pharmaceutical compositions, and methods of use for selectively reducing the amount or activity of HTT RNA containing SNP rs7685686, and in certain embodiments, for reducing the amount of mHTT protein encoded by HTT containing SNP rs7685686 in a cell or subject. In certain embodiments, the subject has HD. The compounds and pharmaceutical compositions provided herein selectively reduce the amount or activity of an HTT variant containing SNP rs7685686 compared to a non-target nucleic acid, such as wild-type HTT or BMPR1. In certain embodiments, a compound useful for selectively reducing the amount or activity of HTT RNA containing SNP rs7685686 is an oligomeric compound. In certain embodiments, a compound useful for selectively reducing the amount or activity of HTT RNA containing SNP rs7685686 compared to wild-type HTT or BMPR1 is an oligomeric compound. In certain embodiments, a compound useful for selectively reducing the amount or activity of HTT RNA containing SNP rs7685686 is a modified oligonucleotide. In certain embodiments, the compound useful for selectively reducing the amount or activity of HTT RNA comprising SNP rs7685686 compared to wild-type HTT or BMPR1 is a modified oligonucleotide. In certain embodiments, the compound useful for reducing the amount of mHTT protein encoded by HTT comprising SNP rs7685686 is an oligomeric compound. In certain embodiments, the compound useful for reducing the amount of mHTT protein encoded by HTT comprising SNP rs7685686 is a modified oligonucleotide.

[0007] Also provided is a method useful for improving at least one symptom or characteristic of HD.In certain embodiments, the symptom or characteristic comprises brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movement, seizures, tremors, anxiety, memory loss, or depression.In certain embodiments, improving one or more of these symptoms or characteristics results in the reduction or delay of brain atrophy, the reduction or delay of muscle atrophy, the delay of neurodegeneration, the reduction of uncontrolled movement, the reduction of seizures, the reduction of tremors, the reduction of anxiety, the improvement of memory, or the reduction of depression. DETAILED DESCRIPTION OF THE INVENTION

[0008] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not limiting. As used herein, the use of the singular includes the plural unless expressly stated otherwise. As used herein, the use of "or" means "and / or" unless expressly stated otherwise. Furthermore, the use of the term "including" and other forms such as "includes" and "comprises" is not limiting. Furthermore, terms such as "element" or "component" encompass both elements and components that contain a single unit and elements and components that contain multiple subunits, unless expressly stated otherwise.

[0009] The section headings used herein are for organizational purposes only and should not be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application (including, but not limited to, patents, patent applications, articles, books, and papers) are expressly incorporated by reference in their entirety, as well as portions of the documents discussed herein.

[0010] definition Unless specific definitions are provided, the nomenclature used in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, medicinal chemistry, and pharmaceutical chemistry described herein are those well known and commonly used in the art. Where permitted, all patents, applications, published applications, and other publications, and other materials referenced throughout the disclosure are incorporated herein by reference in their entirety.

[0011] Unless otherwise stated, the following terms have the following meanings:

[0012] As used herein, "2'-deoxynucleoside" refers to a nucleoside containing a 2'-H(H) deoxyribosyl sugar moiety. In certain embodiments, a 2'-deoxynucleoside is a 2'-β-D-deoxynucleoside, which contains a 2'-β-D-deoxyribosyl sugar moiety having the β-D ribosyl configuration found in naturally occurring deoxyribonucleic acid (DNA). In certain embodiments, a 2'-deoxynucleoside or a nucleoside containing an unmodified 2'-deoxyribosyl sugar moiety may contain a modified nucleobase or may contain an RNA nucleobase (uracil).

[0013] As used herein, "2'-MOE" refers to a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-MOE sugar moiety" refers to a sugar moiety having a 2'-OCH2CH2OCH3 group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, the 2'-MOE sugar moiety is in the β-D configuration. "MOE" refers to O-methoxyethyl.

[0014] As used herein, "2'-MOE nucleoside" or "2'-O(CH2)2OCH3 nucleoside" means a nucleoside that includes a 2'-MOE sugar moiety (or a 2'-OCH2CH2OCH3 ribosyl sugar moiety).

[0015] As used herein, "2'-OMe" refers to a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. "2'-O-methyl sugar moiety" refers to a sugar moiety having a 2'-OCH group in place of the 2'-OH group of a ribosyl sugar moiety. Unless otherwise specified, 2'-OMe has the stereochemical configuration of β-D ribosyl.

[0016] As used herein, "2'-OMe nucleoside" means a nucleoside that includes a 2'-OMe sugar moiety.

[0017] As used herein, "2'-F" refers to a 2'-fluoro group in place of the 2'-OH group of a furanosyl sugar moiety. A "2'-F sugar moiety" refers to a sugar moiety having a 2'-F group in place of the 2'-OH group of a furanosyl sugar moiety. Unless otherwise specified, the 2'-F sugar moiety is in the β-D-ribosyl configuration.

[0018] As used herein, "2'-F nucleoside" means a nucleoside that includes a 2'-F modified sugar moiety.

[0019] As used herein, "2'-substituted nucleoside" refers to a nucleoside that includes a 2'-substituted furanosyl sugar moiety. As used herein, "2'-substituted" with respect to the sugar moiety means that the sugar moiety includes at least one 2'-substituent other than H or OH.

[0020] As used herein, "5-methylcytosine" means a cytosine modified by being attached to a methyl group at position 5. 5-methylcytosine is a modified nucleobase.

[0021] As used herein, "abasic sugar moiety" means a sugar moiety that is not attached to a nucleobase. Such abasic sugar moieties are sometimes referred to in the art as "abasic nucleosides."

[0022] As used herein, "administration" or "administering" means providing a pharmaceutical agent or composition to a subject.

[0023] As used herein, "improve" in relation to treatment refers to the improvement of at least one symptom or characteristic compared to the same symptom or characteristic without treatment.In certain embodiments, improvement is a reduction in the severity or frequency of a symptom or characteristic, or a delay in the onset or progression of the severity or frequency of a symptom or characteristic.In certain embodiments, the symptom or characteristic is brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movement, seizures, tremors, anxiety, memory loss, or depression.The progression or severity of indicators can be determined by subjective or objective measures known to those skilled in the art.

[0024] As used herein, "antisense activity" refers to a detectable and / or measurable change resulting from hybridization of an antisense compound with its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount or expression of a target nucleic acid or a protein encoded by such a target nucleic acid compared to the target nucleic acid or target protein level in the absence of the antisense compound.

[0025] As used herein, "antisense agent" means an antisense compound and, optionally, one or more additional features, such as a sense compound.

[0026] As used herein, "antisense compound" means an antisense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0027] As used herein, "sense compound" means a sense oligonucleotide and, optionally, one or more additional features, such as a conjugate group.

[0028] As used herein, "antisense oligonucleotide" refers to an oligonucleotide (including the oligonucleotide portion of an antisense compound) that can hybridize to a target nucleic acid and have at least one antisense activity. Antisense oligonucleotides include, but are not limited to, antisense RNAi oligonucleotides and antisense RNase H oligonucleotides.

[0029] As used herein, "sense oligonucleotide" refers to an oligonucleotide that can hybridize with an antisense oligonucleotide, comprising the oligonucleotide portion of a sense compound. Sense oligonucleotides include, but are not limited to, sense RNAi oligonucleotides.

[0030] As used herein, "bicyclic nucleoside" or "BNA" means a nucleoside that includes a bicyclic sugar moiety.

[0031] As used herein, "bicyclic sugar" or "bicyclic sugar moiety" refers to a modified sugar moiety comprising two rings, the second ring being formed via a bridge connecting two atoms of the first ring, thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl sugar moiety. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl sugar moiety.

[0032] As used herein, "blunt" or "blunt-ended" in reference to an oligomeric duplex formed by two oligonucleotides means that there are no unpaired nucleotides at the ends (i.e., no overhanging nucleotides). One or both ends of a double-stranded RNAi agent can be blunt.

[0033] As used herein, "cell targeting moiety" means a conjugate moiety or a portion of a conjugate moiety that is capable of binding to a specific cell type or specific cell types.

[0034] As used herein, "cerebrospinal fluid" or "CSF" refers to the fluid that fills the space surrounding the brain and spinal cord. "Artificial cerebrospinal fluid" or "aCSF" refers to a prepared or manufactured fluid that has certain properties (e.g., osmolality, pH, and / or electrolytes) similar to cerebrospinal fluid and is biocompatible with CSF.

[0035] As used herein, "chiral enrichment" in reference to a population means that there are multiple molecules of the same molecular formula, but the number or percentage of molecules in the population containing a specific stereochemical configuration at a specific chiral center is greater than the number or percentage of molecules expected to contain the same specific stereochemical configuration at the same specific chiral center in the population if the specific chiral center were stereorandom as defined herein. A chiral enriched molecular population having multiple chiral centers within each molecule can contain one or more stereorandom chiral centers. In certain embodiments, the molecules are modified oligonucleotides. In certain embodiments, the molecules are oligomeric compounds comprising modified oligonucleotides. In certain embodiments, the chiral center is at the phosphorus atom of a phosphorothioate internucleoside linkage. In certain embodiments, the chiral center is at the phosphorus atom of a mesylphosphoramidate internucleoside linkage.

[0036] As used herein, "cleavable moiety" means a bond or group of atoms that is cleaved upon administration to a subject, e.g., a cell, a subject, or inside a human.

[0037] As used herein, "complementary" with respect to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide, or one or more portions thereof, and the nucleobases of another nucleic acid, or one or more portions thereof, can hydrogen bond with each other when the nucleobase sequence of the oligonucleotide and the nucleobase sequence of the other nucleic acid are aligned in opposite directions. As used herein, complementary nucleobases refer to nucleobases that can form hydrogen bonds with each other. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methylcytosine (C), and 5-methylcytosine (M). m The term "fully complementary" or "100% complementary" as used herein with respect to an oligonucleotide or a portion thereof means that the oligonucleotide or a portion thereof is complementary to another oligonucleotide or nucleic acid at each nucleobase of the shorter of the two oligonucleotides, or at each nucleoside if the oligonucleotides are the same length.

[0038] As used herein, "region of complementarity" with respect to an oligonucleotide refers to the stretch of nucleobases of an oligonucleotide that is complementary to a second oligonucleotide or target nucleic acid.

[0039] As used herein, "conjugate group" refers to a group of atoms directly attached to an oligonucleotide that confers at least one property to the resulting conjugated oligonucleotide. A conjugate group includes a conjugate moiety and a conjugate linker that attaches the conjugate group moiety to the oligonucleotide.

[0040] As used herein, "conjugate linker" means a single bond or a group of atoms containing at least one bond that connects a conjugate moiety to an oligonucleotide.

[0041] As used herein, "conjugate moiety" means a grouping of atoms that, when covalently attached to a molecule, modifies one or more properties of such molecule compared to the same molecule lacking the conjugate moiety, such properties including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0042] As used herein, "contiguous" in the context of oligonucleotides refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, "contiguous nucleobases" means nucleobases that are immediately adjacent to each other in a sequence.

[0043] As used herein, "constrained ethyl" or "cEt" or "cEt sugar moiety" means a β-D ribosyl bicyclic sugar moiety, wherein the second ring of the bicyclic sugar is formed via a bridge connecting the 4'-carbon and 2'-carbon of the β-D ribosyl sugar moiety, the bridge having the formula 4'-CH(CH3)-O-2', and the methyl group of the bridge is in the S configuration.

[0044] As used herein, "cEt nucleoside" means a nucleoside that includes a cEt sugar moiety.

[0045] As used herein, a "deoxy region" refers to a region of 5 to 12 contiguous nucleotides, wherein at least 70% of the nucleosides contain a 2'-deoxy sugar moiety. In certain embodiments, each nucleoside is selected from a 2'-β-D-deoxynucleoside, a bicyclic nucleoside, and a 2'-substituted nucleoside. In certain embodiments, the deoxy region supports RNase H activity. In certain embodiments, the deoxy region is the gap or an internal region of a gapmer.

[0046] As used herein, "diluent" refers to an ingredient in a composition that has no pharmacological activity but is pharmaceutically necessary or desirable. For example, the diluent in a composition to be injected can be a liquid such as aCSF, PBS, or saline.

[0047] As used herein, "double-stranded" with respect to a region or oligonucleotide refers to a duplex formed by complementary strands of nucleic acid (including, but not limited to, oligonucleotides) hybridized to each other. In certain embodiments, the two strands of a double-stranded region are separate molecules. In certain embodiments, the two strands are folded regions of the same molecule (e.g., a hairpin structure).

[0048] As used herein, "duplex" or "duplex region" means the structure formed by two oligonucleotides or portions thereof hybridized to one another.

[0049] As used herein, "gapmer" refers to a modified oligonucleotide comprising an internal region having multiple nucleosides that support RNase H cleavage, separated by external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleosides comprising the external regions. The internal region may be referred to as a "gap," and the external regions may be referred to as "wings" or "wing segments." In certain embodiments, the internal region is a deoxyribonucleotide region. The position of the internal region or gap refers to the order of the nucleosides in the internal region, counting from the 5'-end of the internal region. Unless otherwise specified, "gapmer" refers to a sugar motif. In certain embodiments, each nucleoside in the gap is a 2'-β-D-deoxynucleoside. In certain embodiments, the gap contains one 2'-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, with the remaining nucleosides in the gap being 2'-β-D-deoxynucleosides. As used herein, the term "MOE gapmer" refers to a gapmer having a gap comprising a 2'-β-D-deoxynucleoside and wings comprising 2'-MOE nucleosides. As used herein, the term "mixed-wing gapmer" refers to a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise specified, a gapmer may contain one or more modified internucleoside linkages and / or modified nucleobases, and such modifications need not follow the gapmer pattern of sugar modifications.

[0050] As used herein, a "hotspot region" refers to a range of nucleobases on a target nucleic acid that is suitable for reducing the amount or activity of the target nucleic acid through the action of an oligomeric agent, oligomeric compound, antisense compound, or antisense agent. A hotspot region includes at least one portion that is complementary to an active antisense oligonucleotide.

[0051] As used herein, "hybridization" refers to the annealing of oligonucleotides and / or nucleic acids. While not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding (which may be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonding) between complementary nucleic acid bases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, antisense compounds and nucleic acid targets. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, oligonucleotides and nucleic acid targets.

[0052] As used herein, "internucleoside linkage" refers to a covalent bond between consecutive nucleosides in an oligonucleotide. As used herein, "modified internucleoside linkage" refers to any internucleoside linkage other than a phosphodiester internucleoside linkage. A "phosphorothioate internucleoside linkage" or "PS internucleoside linkage" is a modified internucleoside linkage in which one of the non-bridging oxygen atoms of a phosphodiester internucleoside linkage is replaced with a sulfur atom.

[0053] As used herein, "inverted nucleoside" means a nucleotide having a 3' to 3' and / or 5' to 5' internucleoside linkage as shown herein.

[0054] As used herein, "inverted sugar moiety" means the sugar moiety of an inverted nucleoside or an abasic sugar moiety having a 3' to 3' and / or 5' to 5' internucleoside linkage.

[0055] As used herein, "linked nucleosides" are nucleosides joined in contiguous sequence (ie, there are no additional nucleosides between the linked nucleosides).

[0056] As used herein, "linker nucleoside" refers to a nucleoside that connects an oligonucleotide to a conjugate moiety, either directly or indirectly. The linker nucleoside is located within the conjugate linker of an oligomeric compound. Linker nucleosides are not considered part of the oligonucleotide moiety of the oligomeric compound, even if they are contiguous with the oligonucleotide.

[0057] As used herein, "mismatch" or "non-complementary" means that the nucleobases of a first nucleic acid sequence are not complementary to the corresponding nucleobases of a second nucleic acid sequence or target nucleic acid when the first and second nucleic acid sequences are aligned in opposite orientations.

[0058] As used herein, "motif" means a pattern of unmodified and / or modified sugar moieties, nucleobases, and / or internucleoside linkages in an oligonucleotide.

[0059] As used herein, "non-bicyclic modified sugar moiety" means a modified sugar moiety that includes a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

[0060] As used herein, "nucleobase" refers to an unmodified nucleobase or a modified nucleobase. As used herein, an "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a "modified nucleobase" is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one unmodified nucleobase. "5-methylcytosine" is a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0061] As used herein, "nucleobase sequence" means the order of consecutive nucleobases in a nucleic acid or oligonucleotide, independent of any sugar or internucleoside linkage modifications.

[0062] As used herein, the "nucleobase sequence" of a reference SEQ ID NO refers only to the nucleobase sequence provided in such SEQ ID NO, and therefore, unless otherwise specified, includes compounds in which each sugar moiety and each internucleoside linkage may be independently modified or unmodified, with or without the modifications indicated in the reference SEQ ID NO.

[0063] As used herein, "nucleoside" means a compound or fragment of a compound that comprises a nucleobase and a sugar moiety, each of which is independently unmodified or modified.

[0064] As used herein, "modified nucleoside" means a nucleoside comprising a modified nucleobase and / or a modified sugar moiety. "Linked nucleosides" are nucleosides joined in a contiguous sequence (i.e., there are no additional nucleosides between the linked nucleosides).

[0065] As used herein, "oligomeric agent" means an oligomeric compound and, optionally, one or more additional features, such as a second oligomeric compound. An oligomeric agent can be a single-stranded oligomeric compound or an oligomeric duplex formed by two complementary oligomeric compounds.

[0066] As used herein, "oligomeric compound" refers to an oligonucleotide and, optionally, one or more additional features, such as a conjugate group or a terminal group. An oligomeric compound may or may not be paired with a second oligomeric compound that is complementary to the first oligomeric compound. A "single-stranded oligomeric compound" is an unpaired oligomeric compound.

[0067] The term "oligomeric duplex" means a duplex formed by two oligomeric compounds having complementary nucleobase sequences. Each oligomeric compound of an oligomeric duplex may be referred to as a "duplex oligomeric compound."

[0068] As used herein, "oligonucleotide" means a polymer of linked nucleosides joined via internucleoside linkages, where each nucleoside and internucleoside linkage may be modified or unmodified. Unless otherwise specified, an oligonucleotide consists of 8 to 50 linked nucleosides.

[0069] As used herein, "modified oligonucleotide" refers to an oligonucleotide in which at least one nucleoside or internucleoside bond is modified.As used herein, "unmodified oligonucleotide" refers to an oligonucleotide that does not contain any nucleoside modification or internucleoside modification.An oligonucleotide may be paired with a second oligonucleotide that is complementary to the oligonucleotide, or may not be paired.A "single-stranded oligonucleotide" is an unpaired oligonucleotide.A "double-stranded oligonucleotide" is an oligonucleotide that is paired with a second oligonucleotide.

[0070] As used herein, "pharmaceutically acceptable carrier or diluent" means any substance suitable for use in administration to a subject. Certain such carriers enable the pharmaceutical composition to be formulated as, for example, tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and lozenges for oral ingestion by a subject. In certain embodiments, the pharmaceutically acceptable carrier or diluent is sterile water, sterile saline, sterile buffer solution, or sterile artificial cerebrospinal fluid.

[0071] As used herein, "pharmaceutically acceptable salt" refers to a physiologically and pharmaceutically acceptable salt of a compound that retains the desired biological activity of the parent compound and does not impart undesired toxicological effects thereto.

[0072] As used herein, "pharmaceutical composition" refers to a mixture of substances suitable for administration to a subject. For example, a pharmaceutical composition may comprise an oligomeric compound and a sterile aqueous solution. In certain embodiments, the pharmaceutical composition exhibits activity in a free uptake assay in certain cell lines.

[0073] As used herein, "prodrug" refers to an inactive or less active form of a compound that is metabolized to form an active or more active compound upon administration to a subject. In certain embodiments, a prodrug comprises a cell-targeting moiety and at least one active compound.

[0074] As used herein, "reducing or inhibiting the amount or activity" refers to a reduction or inhibition of transcriptional expression or activity relative to transcriptional expression or activity in an untreated or control sample, and does not necessarily indicate complete elimination of transcriptional expression or activity.

[0075] As used herein, "RNA" means RNA transcript, and includes pre-mRNA and mature mRNA, unless otherwise specified.

[0076] As used herein, "RNAi agent" refers to an antisense agent that acts at least in part through RISC or Ago2 to regulate a target nucleic acid and / or a protein encoded by the target nucleic acid. RNAi agents include, but are not limited to, double-stranded siRNA, single-stranded RNA (ssRNAi), and microRNA (including microRNA mimics). RNAi agents may include conjugate groups and / or terminal groups. In certain embodiments, RNAi agents regulate the amount, activity, and / or splicing of a target nucleic acid. The term RNAi agent does not include antisense agents that act primarily through RNase H.

[0077] As used herein, "RNase H agent" refers to an antisense agent that acts through RNase H to modulate a target nucleic acid and / or a protein encoded by a target nucleic acid. In certain embodiments, the RNase H agent is single-stranded. In certain embodiments, the RNase H agent is double-stranded. The RNase H agent may include a conjugate group and / or a terminal group. In certain embodiments, the RNase H agent modulates the amount and / or activity of a target nucleic acid. The term RNase H agent does not include antisense agents that act primarily through RISC / Ago2.

[0078] As used herein, "antisense RNase H oligonucleotide" means an oligonucleotide that includes a region complementary to a target sequence and that contains at least one chemical modification suitable for RNase H-mediated nucleic acid reduction.

[0079] As used herein, "antisense RNAi oligonucleotide" means an oligonucleotide that includes a region complementary to a target sequence and that contains at least one chemical modification suitable for RNAi-mediated nucleic acid reduction.

[0080] As used herein, "self-complementary" with respect to an oligonucleotide means an oligonucleotide that at least partially hybridizes with itself.

[0081] As used herein, "single-stranded" means a nucleic acid (including, but not limited to, an oligonucleotide) that is unpaired and not part of a duplex. A single-stranded compound can hybridize with a complementary nucleic acid to form a duplex, at which point it is no longer single-stranded.

[0082] As used herein, a "stabilized phosphate group" means a 5'-phosphate analog that is more metabolically stable than the 5'-phosphate that occurs naturally on DNA or RNA.

[0083] As used herein, "standard in vitro assay" means the assay described in Example 2, and reasonable variations thereof.

[0084] As used herein, "standard in vivo assay" means the assay described in any one of Examples 3-7 and 9, and reasonable variations thereof.

[0085] As used herein, "stereorandom" or "stereorandom chiral center" in the context of a population of molecules of the same molecular formula refers to a chiral center that is not controlled during synthesis or enriched after synthesis with respect to a specific absolute stereochemical configuration. The stereochemical configuration of a chiral center is random if the stereochemical configuration of the chiral center is the result of a synthetic method not designed to control the stereochemical configuration. For example, in a population of molecules containing stereorandom chiral centers, the number of molecules having the (S) configuration of the stereorandom chiral center may be the same as the number of molecules having the (R) configuration of the stereorandom chiral center ("racemic"). The stereochemical configuration of a chiral center is random if the stereochemical configuration of the chiral center is the result of a synthetic method not designed to control the stereochemical configuration. In certain embodiments, the stereorandom chiral center is at the phosphorus atom of a stereorandom phosphorothioate or mesyl phosphoramidate internucleoside linkage.

[0086] As used herein, "subject" means a human or non-human animal. In certain embodiments, the subject is a human.

[0087] In certain embodiments, "sugar moiety" refers to an unmodified sugar moiety or a modified sugar moiety. As used herein, "unmodified sugar moiety" refers to a 2'-OH(H)β-D-ribosyl sugar moiety found in RNA (an "unmodified RNA sugar moiety") or a 2'-H(H)β-D-deoxyribosyl sugar moiety found in DNA (an "unmodified DNA sugar moiety"). An unmodified sugar moiety has one hydrogen at each of the 1', 3', and 4' positions, an oxygen at the 3' position, and two hydrogens at the 5' position. As used herein, "modified sugar moiety" or "modified sugar" refers to a modified furanosyl sugar moiety or sugar surrogate.

[0088] As used herein, "sugar surrogate" refers to a modified sugar group having a group other than a furanosyl group that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide. Modified nucleosides containing sugar surrogates can be incorporated at one or more positions within an oligonucleotide, and such oligonucleotides can hybridize to complementary oligomeric compounds or target nucleic acids.

[0089] As used herein, "symptoms or characteristics" refers to physical characteristics or test results that indicate the presence or extent of a disease or disorder. In certain embodiments, symptoms are apparent to the subject themselves or to a medical professional examining or testing the subject. In certain embodiments, characteristics are revealed by invasive diagnostic testing, including, but not limited to, post-mortem examination. In certain embodiments, symptoms and characteristics include brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

[0090] As used herein, "target nucleic acid" and "target RNA" refer to a nucleic acid that an antisense compound is designed to affect. Target RNA refers to an RNA transcript, and unless otherwise specified, includes pre-mRNA and mature mRNA.

[0091] As used herein, "target region" means a portion of a target nucleic acid to which an oligomeric compound is designed to hybridize.

[0092] As used herein, "terminal group" means a chemical group or group of atoms covalently attached to the end of an oligonucleotide.

[0093] As used herein, "treatment" refers to improving a disease or condition in a subject by administering an oligomeric agent or oligomeric compound described herein. In certain embodiments, treating a subject improves symptoms compared to the same symptoms in the absence of treatment. In certain embodiments, treatment reduces the severity or frequency of symptoms, delays the onset of symptoms, slows the progression of symptoms, or slows the severity or frequency of symptoms.

[0094] As used herein, a "therapeutically effective amount" refers to an amount of a pharmaceutical agent or composition that confers a therapeutic benefit on a subject, e.g., administration of a therapeutically effective amount results in amelioration of disease symptoms.

[0095] Certain embodiments The present disclosure provides the following non-limiting numbered embodiments:

[0096] Embodiment 1. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 25): [ka] or a pharmaceutically acceptable salt thereof.

[0097] Embodiment 2. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 26): [ka] or a pharmaceutically acceptable salt thereof.

[0098] Embodiment 3. The modified oligonucleotide of embodiment 1 or embodiment 2, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0099] Embodiment 4. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 25): [ka]

[0100] Embodiment 5. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 26): [ka]

[0101] Embodiment 6. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: A es T ks T dz G dz T ds m C ds A ds T ds m C ds A ds m C es m C es A es G ko A es A ks A e (SEQ ID NO: 25), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.

[0102] Embodiment 7. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: A es T ks T ds G ds T ds m C ds A ds T ds m C ds A ds m C es m C ez A ez G kz A es A ks A e (SEQ ID NO: 26), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.

[0103] Embodiment 8. The oligomeric compound of embodiment 6 or embodiment 7, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

[0104] Embodiment 9. The oligomeric compound of embodiment 8, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

[0105] Embodiment 10. A population of modified oligonucleotides according to any one of embodiments 1 to 5, or a population of oligomeric compounds according to any one of embodiments 6 to 9, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

[0106] Embodiment 11. A population of modified oligonucleotides according to any one of embodiments 1-5, or a population of oligomeric compounds according to any one of embodiments 6-9, wherein the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotides are all stereorandom.

[0107] Embodiment 12. A pharmaceutical composition comprising a modified oligonucleotide according to any one of embodiments 1 to 5, an oligomeric compound according to any one of embodiments 6 to 9, a population of modified oligonucleotides according to embodiment 10 or 11, or a population of oligomeric compounds according to embodiment 10 or 11, and a pharmaceutically acceptable diluent.

[0108] Embodiment 13. The pharmaceutical composition of embodiment 12, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0109] Embodiment 14. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide of any one of embodiments 1-5, the oligomeric compound of any one of embodiments 6-9, the population of modified oligonucleotides of embodiment 10 or 11, or the population of oligomeric compounds of embodiment 10 or 11, and aCSF.

[0110] Embodiment 15. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists essentially of the modified oligonucleotide of any one of embodiments 1-5, the oligomeric compound of any one of embodiments 6-9, the population of modified oligonucleotides of embodiment 10 or 11, or the population of oligomeric compounds of embodiment 10 or 11, and PBS.

[0111] Embodiment 16. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists of a modified oligonucleotide of any one of embodiments 1-5, an oligomeric compound of any one of embodiments 6-9, a population of modified oligonucleotides of embodiment 10 or 11, or a population of oligomeric compounds of embodiment 10 or 11, and aCSF.

[0112] Embodiment 17. The pharmaceutical composition of embodiment 12, wherein the pharmaceutical composition consists of a modified oligonucleotide of any one of embodiments 1 to 5, an oligomeric compound of any one of embodiments 6 to 9, a population of modified oligonucleotides of embodiment 10 or 11, or a population of oligomeric compounds of embodiment 10 or 11, and PBS.

[0113] 18. An oligomeric compound comprising a modified oligonucleotide consisting of linked nucleosides of embodiment 12 to 30 and having nucleobases complementary to Huntingtin (HTT) SNP rs7685686, wherein at least one internucleoside linkage of said modified oligonucleotide is a mesylphosphoramidate internucleoside linkage.

[0114] 19. An oligomeric compound comprising a modified oligonucleotide consisting of the linked nucleosides of embodiments 12 to 30 and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 21, and 24, wherein the modified oligonucleotide is 5'-ssssssssssssoooss-3', 5'-ssssssssssssoosss-3', 5'-sssssssssssssooss- 3', 5'-ssssssssssssooss-3', 5'-sssssssssssssss-3', 5'-sssoossssssssss-3', 5'-sssoossssssssss-3' and 5'-ssssssssssssoss-3', wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0115] Embodiment 20. The oligomeric compound of embodiment 18, wherein said modified oligonucleotide comprises one or more internucleoside linkages selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

[0116] Embodiment 21. The modified oligonucleotide is 5'-ssssssssssszzzss-3', 5'-szzsssssssssosss-3', 5'-zsssssssssssssosss-3', 5'-zssssssssssssssszz-3', 5'-zsssssssssssssszz-3', 5'-sszzssssssssssssoss-3', 5'-zzssssssssssssoss-3', 5'-zsssssssssssssss-3', 5'-zsssssssssssssss-3', 5'-zsssssssssssssszz-3', 5'-zsssssssssssssszz-3', 5'-zsssssssssssssszz-3', 5'-ssss ssssssszzzss-3', 5'-ssssssssssszzss-3', 5'-sszzssssssssss-3', 5'-zzsssssssssssss-3', 5'-zsssssssss ssssz-3', 5'-sssssszzsssssss-3', 5'-ssszzsssssssss-3', 5'-sssssszssssssss-3', 5'-ssssszzssssssss-3 ', 5'-ssssszzszssssss-3', 5'-ssszsszsssssss-3', 5'-ssszszzsssssss-3', 5'-sszzsszssssssss-3', 5'-ss zzszzssssssss-3', 5'-ssszszszssssss-3', 5'-sszszszsssssss-3', 5'-ssssssssssszss-3', 5'-szzsssssss 21. The oligomeric compound of embodiment 18 or embodiment 20, comprising an internucleoside linkage motif selected from ssss-3', 5'-zssssssssssss-3' and 5'-zssssssssssssz-3', wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesylphosphoramidate internucleoside linkage.

[0117] Embodiment 22. The oligomeric compound of any one of embodiments 18 to 21, wherein at least one nucleoside of the modified oligonucleotide is a modified nucleoside.

[0118] Embodiment 23 The oligomeric compound of embodiment 22, wherein the modified nucleoside comprises a modified sugar moiety.

[0119] Embodiment 24 The oligomeric compound of embodiment 23, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

[0120] Embodiment 25. The oligomeric compound of embodiment 24, wherein the bicyclic sugar moiety comprises a 2'-4' bridge selected from -O-CH2- and -O-CH(CH3)-.

[0121] Embodiment 26 The oligomeric compound of any one of Embodiments 22-25, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

[0122] Embodiment 27. The oligomeric compound of embodiment 26, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

[0123] Embodiment 28 The oligomeric compound of any one of Embodiments 22 to 27, wherein the modified nucleoside comprises a sugar surrogate.

[0124] Embodiment 29. The oligomeric compound of embodiment 28, wherein the sugar surrogate is any one of morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

[0125] Embodiment 30. The modified oligonucleotide is 5'-kddddddddeeekekee-3', 5'-kdddddddddeekekee-3', 5'-eddddddddeeekekee-3', 5'-edddddddddeekekee-3', 5'-edddddddddddeekekee-3', 5'-kddddddddeeeeeeee-3', 5'-kdddddddddeeeeeee-3', 5'-eddddddddeeeeeeee-3', 5'-edddddddddeeeeeeeee-3', 5'-edddddddddeeeeeee-3', 5'-ekddddddddeeekeke-3', 5'-ekdddddddd dddeekeke-3', 5'-eedddddddddeekeke-3', 5'-eeddddddddeeekeke-3', 5'-ekddddddddeeeeee-3', 5'-ekdddddddeeeeeee-3', 5'-eedddddddddee eeee-3', 5'-eeddddddddeeeeeee-3', 5'-ekdddddddeeekek-3', 5'-ekdddddddeeeekek-3', 5'-eeddddddddeeekek-3', 5'-eedddddddeeeekek-3', 5 '-ekddddddddeeeeee-3', 5'-ekdddddddeeeeeee-3', 5'-eedddddddeeeeee-3', 5'-eeddddddeeeeeee-3', 5'-ekdddddddeeekek-3', 5'-ekdddddd deeeekek-3', 5'-ekdddddddeeekek-3', 5'-ekdddddddeeeekek-3', 5'-eeeeeeedddddddkke-3', 5'-eeeekkdddddddeee-3', 5'-eeeekkdddddddkke-3 28. The oligomeric compound of any one of embodiments 18-27, comprising a modified sugar motif selected from: 5'-eeeeeedddddddeee-3', 5'-ekddddddddeeekek-3', 5'-kdddddddddkeekk-3', 5'-edddddddddkeekk-3', 5'-kdddddddddeeeee-3', and 5'-edddddddddeeeee-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety.

[0126] 31. An oligomeric compound comprising a modified oligonucleotide consisting of linked nucleosides of embodiment 12 to 30 and having a nucleobase complementary to Huntingtin (HTT) SNP rs7685686, wherein said modified oligonucleotide comprises a modified sugar moiety selected from a 2'-OMe sugar moiety or a 2'-α-L-deoxyribosyl sugar moiety.

[0127] Embodiment 32. The oligomeric compound of embodiment 31, wherein the modified oligonucleotide comprises one or more modified sugar moieties selected from a cEt sugar moiety and a 2'-MOE sugar moiety.

[0128] Embodiment 33. The modified oligonucleotide is 5'-kydddddddeeekekee-3', 5'-kyddddddddeekekee-3', 5'-kdyddddddeeekekee-3', 5'-kdydddddddeekekee-3', 5'-ekyddddddddeekeke-3', 5'-ekydddddddeeekeke-3', 5'-ekdydddddddeekeke-3', 5'-ekdyddddddddeeekeke-3', 5'-ekydddddddeeekek-3', 5'-ekdyddddddeeekek-3', 5'-ekydddddddeeekek-3', 5'-ekdyddddddeeekek-3', 5'-kyddddddddkeekk-3', 5'-kdydddddddkeekk-3', 5'-kddd[aLd]ddddeeekekee-3', 5'-kddd[aLd] ddddeekekee-3', 5'-ekddd[aLd]dddddeekeke-3', 5'-ekddd[aLd]ddddeekeke-3', 5'-eeeekkddd[a Ld]dddkke-3', 5'-kddd[aLd]dddddkeekk-3', 5'-ekddd[aLd]ddddeeekek-3', and 5'-ekddd[aLd]dddee eekek-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, and each "[aLd]" represents a 2'-α-L-deoxyribosyl sugar moiety.

[0129] Embodiment 34. The oligomeric compound of any one of Embodiments 31 to 33, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

[0130] Embodiment 35 The oligomeric compound of embodiment 34, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

[0131] Embodiment 36 The oligomeric compound of embodiment 34 or embodiment 35, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

[0132] Embodiment 37. The oligomeric compound of any one of Embodiments 34-36, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

[0133] Embodiment 38. The oligomeric compound of any one of embodiments 34 to 37, wherein the modified oligonucleotide has an internucleoside linkage motif selected from 5'-sssssssssssoosss-3', 5'-ssssssssssssooss-3', 5'-sssssssssssooss-3', 5'-ssssssssssssss-3', 5'-ssssssssssssss-3', and 5'-ssssssssssssoss-3', wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0134] Embodiment 39. The oligomeric compound of any one of embodiments 18 to 38, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an HTT nucleic acid, and the HTT nucleic acid has the nucleobase sequence of SEQ ID NO: 1.

[0135] Embodiment 40. The oligomeric compound of any one of embodiments 18-39, wherein the modified oligonucleotide consists of 12 to 20, 12 to 25, 12 to 30, 13 to 20, 13 to 25, 13 to 30, 14 to 20, 14 to 25, 14 to 30, 15 to 20, 15 to 25, 15 to 30, 16 to 18, 16 to 20, 16 to 25, 16 to 30, 17 to 20, 17 to 25, 17 to 30, 18 to 20, 18 to 22, 18 to 25, 18 to 30, 19 to 20, 19 to 25, 19 to 30, 20 to 25, 20 to 30, 21 to 25, 21 to 30, 22 to 25, 22 to 30, 23 to 25, or 23 to 30 linked nucleosides.

[0136] Embodiment 41. The oligomeric compound of any one of Embodiments 18 to 40, wherein the modified oligonucleotide consists of 15 linked nucleosides.

[0137] Embodiment 42. The oligomeric compound of any one of embodiments 18 to 40, wherein the modified oligonucleotide consists of 16 linked nucleosides.

[0138] Embodiment 43. The oligomeric compound of any one of Embodiments 18 to 40, wherein the modified oligonucleotide consists of 17 linked nucleosides.

[0139] Embodiment 44. The oligomeric compound of any one of embodiments 18 to 30 and 39 to 43, wherein the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 21 and 24.

[0140] Embodiment 45. The oligomeric compound of any one of embodiments 31 to 43, wherein the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 19, 20, 21, 22, 23, and 24.

[0141] Embodiment 46 The oligomeric compound of any one of Embodiments 18 to 45, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

[0142] Embodiment 47. The oligomeric compound of embodiment 46, wherein the modified nucleobase is 5-methylcytosine.

[0143] Embodiment 48 The oligomeric compound of embodiment 46, wherein each cytosine is a 5-methylcytosine.

[0144] Embodiment 49. The oligomeric compound of any one of embodiments 18 to 48, wherein each nucleoside of the modified oligonucleotide is an unmodified adenine, an unmodified guanine, an unmodified thymine, an unmodified cytosine, or a 5-methylcytosine.

[0145] Embodiment 50. The oligomeric compound of any one of Embodiments 18 to 49, wherein the modified oligonucleotide comprises a deoxy region.

[0146] Embodiment 51. The oligomeric compound of embodiment 50, wherein each nucleoside of the deoxy region is a 2'-β-D-deoxynucleoside.

[0147] Embodiment 52. The oligomeric compound of embodiment 50 or embodiment 51, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

[0148] Embodiment 53 The oligomeric compound of any one of Embodiments 50-52, wherein each nucleoside immediately adjacent to the deoxy region comprises a modified sugar moiety.

[0149] Embodiment 54. The oligomeric compound according to any one of embodiments 50 to 53, wherein the deoxy region comprises a 5'-region consisting of 1 to 6 linked 5'-region nucleosides on the 5'-side and a 3'-region consisting of 1 to 8 linked 3'-region nucleosides on the 3'-side, wherein at least one nucleoside in the 5'-region comprises a modified sugar moiety, and at least one nucleoside in the 3'-region comprises a modified sugar moiety.

[0150] Embodiment 55. The oligomeric compound of embodiment 54, wherein each nucleoside of the 5'-region comprises a modified sugar moiety.

[0151] Embodiment 56 The oligomeric compound of embodiment 54 or embodiment 55, wherein each nucleoside of the 3'-region comprises a modified sugar moiety.

[0152] Embodiment 57. The oligomeric compound of any one of embodiments 18 to 56, consisting of the modified oligonucleotide.

[0153] Embodiment 58. The oligomeric compound of any one of Embodiments 18 to 56, wherein the oligomeric compound comprises a conjugate group.

[0154] Embodiment 59. The oligomeric compound of embodiment 58, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0155] Embodiment 60 The oligomeric compound of embodiment 59, wherein the conjugate linker is a phosphodiester linker.

[0156] Embodiment 61. The oligomeric compound of embodiment 59, wherein the conjugate linker consists of a single bond.

[0157] Embodiment 62 The oligomeric compound of any one of embodiments 59 to 61, wherein the conjugate linker is cleavable.

[0158] Embodiment 63. The oligomeric compound of any one of embodiments 59, 60, or 62, wherein the conjugate linker comprises one to three linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

[0159] Embodiment 64. The oligomeric compound of any one of embodiments 58 to 63, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

[0160] Embodiment 65. The oligomeric compound of any one of embodiments 58 to 63, wherein the conjugate group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.

[0161] Embodiment 66. The oligomeric compound of any one of Embodiments 18 to 58, wherein the oligomeric compound does not comprise a linker nucleoside.

[0162] Embodiment 67. The oligomeric compound of any one of embodiments 18 to 66, comprising a terminal group.

[0163] Embodiment 68. The oligomeric compound of embodiment 67, wherein the terminal group is an abasic sugar moiety.

[0164] Embodiment 69. The oligomeric compound of any one of Embodiments 18 to 68, wherein the oligomeric compound is an RNase H agent.

[0165] Embodiment 70. An oligomeric compound according to the following chemical notation: N 1 es T ks T dz G dz T ds m C ds A ds T ds m C ds A ds m C es m C es A es G ko A es A ks N 2 e (SEQ ID NO: 27), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, N 1 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 1 is absent, then the sugar and internucleoside linkage are also absent, N2 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 2 If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group.

[0166] Embodiment 71. An oligomeric compound according to the following chemical notation: N 1 es T ks T ds G ds T ds m C ds A ds T ds m C ds A ds m C es m C ez A ez G kz A es A ks N 2 e (SEQ ID NO: 28), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, N 1 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2= adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 2 If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group.

[0167] Embodiment 72.N 1 and N 2 and n is each independently an adenine nucleobase.

[0168] Embodiment 73.N 1 and N 2 and n is independently an unmodified adenine.

[0169] Embodiment 74.N 1 and N 2 and n is each independently a modified adenine.

[0170] Embodiment 75.N 1 and N 2 and 72 are each independently hypoxanthine.

[0171] Embodiment 76.N 1 and N 2 and n is an integer from 1 to 3. The oligomeric compound of embodiment 70 or 71, wherein each is independently an abasic sugar moiety.

[0172] Embodiment 77.N 1 and N 2and n is each independently a terminal group.

[0173] Embodiment 78.N 1 and N 2 and n is independently 0 or 1. The oligomeric compound of embodiment 70 or 71, wherein

[0174] Embodiment 79.N 1 is an adenine nucleobase, and N 2 79. The oligomeric compound of any one of embodiments 70-78, wherein is an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0175] Embodiment 80.N 1 is an adenine nucleobase, and N 2 80. The oligomeric compound of any one of embodiments 70-79, wherein is an unmodified adenine.

[0176] Embodiment 81.N 1 is an adenine nucleobase, and N 2 The oligomeric compound according to any one of embodiments 70-79, wherein is hypoxanthine.

[0177] Embodiment 82.N 1 is an adenine nucleobase, and N 2 80. The oligomeric compound of any one of embodiments 70-79, wherein is an abasic sugar moiety.

[0178] Embodiment 83.N 1 is an adenine nucleobase, and N 2 80. The oligomeric compound of any one of embodiments 70-79, wherein is a terminal group.

[0179] Embodiment 84.N 1 is an adenine nucleobase, and N 2 80. The oligomeric compound of any one of embodiments 70-79, wherein is absent.

[0180] Embodiment 85.N1 is an unmodified adenine, and N 2 80. The oligomeric compound of any one of embodiments 70-79, wherein is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0181] Embodiment 86.N 1 is an unmodified adenine, and N 2 86. The oligomeric compound of any one of embodiments 70-79 or 85, wherein is an adenine nucleobase.

[0182] Embodiment 87.N 1 is an unmodified adenine, and N 2 86. The oligomeric compound of any one of embodiments 70-79 or 85, wherein is an unmodified adenine.

[0183] Embodiment 88.N 1 is an unmodified adenine, and N 2 The oligomeric compound of any one of embodiments 70-79 or 85, wherein is hypoxanthine.

[0184] Embodiment 89.N 1 is an unmodified adenine, and N 2 86. The oligomeric compound of any one of embodiments 70-79 or 85, wherein is an abasic sugar moiety.

[0185] Embodiment 90.N 1 is an unmodified adenine, and N 2 The oligomeric compound of any one of embodiments 70-79 or 85, wherein is a terminal group.

[0186] Embodiment 91.N 1 is an unmodified adenine, and N 2 The oligomeric compound of any one of embodiments 70 to 79 or 85, wherein is absent.

[0187] Embodiment 92.N 1 is hypoxanthine, and N 279. The oligomeric compound of any one of embodiments 70-78, wherein is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0188] Embodiment 93.N 1 is hypoxanthine, and N 2 93. The oligomeric compound of any one of embodiments 70-78 or 92, wherein is an adenine nucleobase.

[0189] Embodiment 94.N 1 is hypoxanthine, and N 2 93. The oligomeric compound of any one of embodiments 70-78 or 92, wherein is an unmodified adenine.

[0190] Embodiment 95.N 1 is hypoxanthine, and N 2 The oligomeric compound of any one of embodiments 70-78 or 92, wherein is hypoxanthine.

[0191] Embodiment 96.N 1 is hypoxanthine, and N 2 93. The oligomeric compound of any one of embodiments 70-78 or 92, wherein is an abasic sugar moiety.

[0192] Embodiment 97.N 1 is hypoxanthine, and N 2 The oligomeric compound of any one of embodiments 70-78 or 92, wherein is a terminal group.

[0193] Embodiment 98.N 1 is hypoxanthine, and N 2 The oligomeric compound of any one of embodiments 70 to 78 or 92, wherein is absent.

[0194] Embodiment 99.N 1 is the abasic sugar moiety, and N 279. The oligomeric compound of any one of embodiments 70-78, wherein is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0195] Embodiment 100.N 1 is the terminal group, and N 2 79. The oligomeric compound of any one of embodiments 70-78, wherein is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0196] Embodiment 101.N 1 does not exist, and N 2 79. The oligomeric compound of any one of embodiments 70-78, wherein is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

[0197] Embodiment 102.N 1 does not exist, and N 2 79. The oligomeric compound of any one of embodiments 70-78, wherein is absent.

[0198] Embodiment 103. The oligomeric compound of embodiment 70 or 71, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

[0199] Embodiment 104. The oligomeric compound of embodiment 103, wherein the conjugate linker is a phosphodiester linker.

[0200] Embodiment 105. The oligomeric compound of embodiment 103, wherein the conjugate linker consists of a single bond.

[0201] Embodiment 106. The oligomeric compound of any one of embodiments 103 to 105, wherein the conjugate linker is cleavable.

[0202] Embodiment 107. The oligomeric compound of any one of embodiments 103, 104, or 106, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the oligomeric compound, or another linker nucleoside by a phosphodiester bond.

[0203] Embodiment 108. The oligomeric compound of any one of embodiments 70, 71, or 103-107, wherein the conjugate group is attached to the oligomeric compound at the 5'-end of the oligomeric compound.

[0204] Embodiment 109. The oligomeric compound of any one of embodiments 70, 71, or 103-107, wherein the conjugate group is attached to the oligomeric compound at the 3'-end of the oligomeric compound.

[0205] Embodiment 110. The oligomeric compound of any one of embodiments 70 to 109, wherein the oligomeric compound is a pharmaceutically acceptable salt.

[0206] Embodiment 111. The oligomeric compound of embodiment 110, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

[0207] Embodiment 112. The population of oligomeric compounds of any one of embodiments 18 to 111, wherein the phosphorothioate internucleoside linkages of said modified oligonucleotides are all stereorandom.

[0208] Embodiment 113. The population of oligomeric compounds of any one of embodiments 18 to 111, wherein the mesyl phosphoramidate internucleoside linkages of said modified oligonucleotides are all stereorandom.

[0209] Embodiment 114. A pharmaceutical composition comprising an oligomeric compound according to any one of embodiments 18 to 111, or a population of oligomeric compounds according to embodiment 112 or 113, and a pharmaceutically acceptable diluent.

[0210] Embodiment 115. The pharmaceutical composition of embodiment 114, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

[0211] Embodiment 116. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of the oligomeric compound of any one of embodiments 18 to 111, or a population of oligomeric compounds of embodiments 112 or 113, and aCSF.

[0212] Embodiment 117. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any one of embodiments 18 to 111, or a population of oligomeric compounds of embodiments 112 or 113, and PBS.

[0213] Embodiment 118. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists of an oligomeric compound of any one of embodiments 18 to 111, or a population of oligomeric compounds of embodiment 112 or 113, and aCSF.

[0214] Embodiment 119. The pharmaceutical composition of embodiment 115, wherein the pharmaceutical composition consists of an oligomeric compound of any one of embodiments 18 to 111, or a population of oligomeric compounds of embodiments 112 or 113, and PBS.

[0215] Embodiment 120. A method comprising administering to a subject a modified oligonucleotide according to any one of embodiments 1 to 5, an oligomeric compound according to any one of embodiments 6 to 9, or 18 to 111, a population of modified oligonucleotides according to embodiment 10 or 11, a population of oligomeric compounds according to any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition according to any one of embodiments 12 to 17 or 114 to 119.

[0216] Embodiment 121. The method of embodiment 120, wherein the subject has or is at risk of developing Huntington's disease.

[0217] Embodiment 122. A method of treating Huntington's disease, comprising administering to a subject having or at risk of developing Huntington's disease a therapeutically effective amount of a modified oligonucleotide of any one of embodiments 1-5, an oligomeric compound of any one of embodiments 6-9, or 18-111, a population of modified oligonucleotides of embodiment 10 or 11, a population of oligomeric compounds of any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition of any one of embodiments 12-17, or 114-119.

[0218] Embodiment 123. The method of embodiment 122, wherein at least one symptom or feature of Huntington's disease is ameliorated.

[0219] Embodiment 124. The method of embodiment 123, wherein the symptom or characteristic is brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

[0220] Embodiment 125. The method of embodiment 124, wherein administering a modified oligonucleotide of any one of embodiments 1 to 5, an oligomeric compound of any one of embodiments 6 to 9, or 18 to 111, a population of modified oligonucleotides of embodiment 10 or 11, a population of oligomeric compounds of any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition of any one of embodiments 12 to 17 or 114 to 119 reduces or delays the onset or progression of brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

[0221] Embodiment 126. The method of any one of embodiments 120 to 125, wherein the modified oligonucleotide of any one of embodiments 1 to 5, the oligomeric compound of any one of embodiments 6 to 9, or 18 to 111, the population of modified oligonucleotides of embodiment 10 or 11, the population of oligomeric compounds of any one of embodiments 10, 11, 112, or 113, or the pharmaceutical composition of any one of embodiments 12 to 17 or 114 to 119 is administered to the central nervous system or systemically.

[0222] Embodiment 127. The method of any one of embodiments 120 to 126, wherein the modified oligonucleotide of any one of embodiments 1 to 5, the oligomeric compound of any one of embodiments 6 to 9, or 18 to 111, the population of modified oligonucleotides of embodiment 10 or 11, the population of oligomeric compounds of any one of embodiments 10, 11, 112, or 113, or the pharmaceutical composition of any one of embodiments 12 to 17 or 114 to 119 is administered intraspinally.

[0223] Embodiment 128. The method of any one of embodiments 120 to 127, wherein the subject is a human.

[0224] Embodiment 129. A method of reducing expression of HTT in a cell, comprising contacting the cell with a modified oligonucleotide of any one of embodiments 1-5, an oligomeric compound of any one of embodiments 6-9, or 18-111, a population of modified oligonucleotides of embodiment 10 or 11, a population of oligomeric compounds of any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition of any one of embodiments 12-17 or 114-119.

[0225] Embodiment 130. The method of embodiment 129, wherein the cells are brain cells.

[0226] Embodiment 131. The method of embodiment 129, wherein the cell is a neuron or a glial cell.

[0227] Embodiment 132. The method of any one of embodiments 129 to 131, wherein the cells are human cells.

[0228] Embodiment 133. Use of a modified oligonucleotide according to any one of embodiments 1 to 5, an oligomeric compound according to any one of embodiments 6 to 9, or 18 to 111, a population of modified oligonucleotides according to embodiment 10 or 11, a population of oligomeric compounds according to any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition according to any one of embodiments 12 to 17 or 114 to 119, for the treatment of Huntington's disease.

[0229] Embodiment 134. Use of a modified oligonucleotide according to any one of embodiments 1 to 5, an oligomeric compound according to any one of embodiments 6 to 9, or 18 to 111, a population of modified oligonucleotides according to embodiment 10 or 11, a population of oligomeric compounds according to any one of embodiments 10, 11, 112, or 113, or a pharmaceutical composition according to any one of embodiments 12 to 17 or 114 to 119, for the manufacture of a medicament for the treatment of Huntington's disease.

[0230] I. Certain Oligonucleotides In certain embodiments, the present disclosure provides oligomeric compounds comprising oligonucleotides composed of linked nucleosides. The oligonucleotides can be unmodified oligonucleotides (RNA or DNA) or modified oligonucleotides. The modified oligonucleotides contain at least one modification relative to unmodified RNA or DNA. That is, the modified oligonucleotides contain at least one modified nucleoside (containing a modified sugar moiety and / or a modified nucleobase) and / or at least one modified internucleoside linkage. Specific modified nucleosides and modified internucleoside linkages suitable for use in modified oligonucleotides are described below.

[0231] A. Certain modified nucleosides Modified nucleosides comprise a modified sugar moiety or a modified nucleobase, or both a modified sugar moiety and a modified nucleobase. In certain embodiments, modified nucleosides comprising the following modified sugar moieties and / or the following modified nucleobases can be incorporated into an oligonucleotide:

[0232] 1. Certain sugar moieties In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety. In certain embodiments, the modified sugar moiety is a bicyclic or tricyclic sugar moiety. In certain embodiments, the modified sugar moiety is a sugar surrogate. Such sugar surrogates may contain one or more substitutions that correspond to the substitutions of other types of modified sugar moieties.

[0233] In certain embodiments, the modified sugar moiety is a non-bicyclic modified furanosyl sugar moiety comprising one or more acyclic substituents, including, but not limited to, substituents at the 2', 3', 4', and / or 5' positions. In certain embodiments, the furanosyl sugar moiety is a ribosyl sugar moiety. In certain embodiments, one or more of the acyclic substituents of the non-bicyclic modified sugar moiety is branched.

[0234] In certain embodiments, a non-bicyclic modified sugar moiety has a substituent at the 2'-position. Examples of suitable substituents at the 2'-position of the modified sugar chain include, but are not limited to, -F, -OCH ("OMe" or "O-methyl"), and -OCHCHOCH ("MOE"). In certain embodiments, the 2'-substituent is halo, allyl, amino, azido, SH, CN, OCN, CF, OCF, O-Ci-Ci. 10 Alkoxy, O-C1~C 10 Substituted alkoxy, O-C1-C 10 Alkyl, O-C1-C 10 Substituted alkyl, S-alkyl, N(R m )-alkyl, O-alkenyl, S-alkenyl, N(R m )-alkenyl, O-alkynyl, S-alkynyl, N(R m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, O(CH2)2SCH3, O(CH2)2ON(R m )(R n ) or OCH2C(=O)-N(R m )(R n ) wherein each R m and R n are independently H, an amino protecting group, or a substituted or unsubstituted C1-C 10 alkyl, -O(CH2)2ON(CH3)2 ("DMAOE"), or 2'-O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"). 2'-substituents are also described in Cook et al., US 6,531,584, Cook et al., US 5,859,221, and Cook et al., US 6,005,087.

[0235] Methods for synthesizing some of these 2'-substituents can be found, for example, in Cook et al., U.S. Pat. No. 6,531,584, and Cook et al., U.S. Pat. No. 5,859,221. Certain embodiments of these 2'-substituents can be further substituted with one or more substituents independently selected from hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0236] In certain embodiments, the 2'-substituted non-bicyclic modified nucleoside is selected from the group consisting of F, NH, N, OCF, OCH, O(CH)NH, CHCH=CH, OCHCH=CH, OCHCHOCH, O(CH)SCH, O(CH)ON(R m )(R n ), O(CH2)2O(CH2)2N(CH3)2, and N-substituted acetamides (OCH2C(=O)-N(R m )(R n )) wherein R m and R n each independently represents H, an amino protecting group, or a substituted or unsubstituted C1-C 10 It is alkyl.

[0237] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent selected from F, OCF3, OCH3, OCH2CHOCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, O(CH2)2ON(CH3)2 ("DMAOE"), O(CH2)2O(CH2)2N(CH3)2 ("DMAEOE"), and OCH2C(=O)-N(H)CH3 ("NMA").

[0238] In certain embodiments, 2'-substituted non-bicyclic modified nucleosides comprise a sugar moiety that includes a non-bridging 2'-substituent selected from F, OCH3, OCH2CH2OCH3, O(CH2)2SCH3, O(CH2)2ON(CH3)2, O(CH2)2O(CH2)2N(CH3)2, and OCH2C(=O)-N(H)CH3 ("NMA").

[0239] In certain embodiments, the 2'-substituted sugar moiety of the modified nucleoside comprises a 2'-substituent selected from F, OCH3, and OCH2CH2OCH3.

[0240] In certain embodiments, modified furanosyl sugar moieties and nucleosides incorporating such modified furanosyl sugar moieties are further defined by their isomeric configuration. For example, 2'-deoxyfuranosyl sugar moieties can have seven isomeric configurations in addition to the natural β-D-deoxyribosyl configuration. Such modified sugar moieties are described, for example, in WO 2020 / 072991. 2'-modified sugar moieties have an additional stereocenter at the 2'-position relative to the 2'-deoxyfuranosyl sugar moiety. Thus, a total of 16 isomeric configurations are possible for such sugar moieties. The modified furanosyl sugar moieties described herein are in the β-D-ribosyl isomeric configuration unless otherwise specified.

[0241] In certain embodiments, the non-bicyclic modified sugar moiety is a stereoisomer of DNA, such as a 2'-α-L-deoxyribosyl sugar moiety, [ka] .

[0242] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 4'-position. Examples of suitable substituents for the 4'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl, and those described in Manoharan et al., WO 2015 / 106128.

[0243] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 3'-position. Examples of suitable substituents for the 3'-position of the modified sugar moiety include, but are not limited to, alkoxy (e.g., methoxy), alkyl (e.g., methyl, ethyl).

[0244] In certain embodiments, the non-bicyclic modified sugar moiety has a substituent at the 5'-position. Examples of suitable substituents for the 5'-position of the modified sugar moiety include, but are not limited to, vinyl, alkoxy (e.g., methoxy), alkyl (e.g., methyl (R or S), ethyl).

[0245] In certain embodiments, the non-bicyclic modified sugar moiety comprises one or more non-bridging sugar substituents, such as, for example, a 2'-F-5'-methyl sugar moiety as described in Migawa et al., US2010 / 0190837, or an alternative 2'- and 5'-modified sugar moiety as described in Rajeev et al., US2013 / 0203836.

[0246] In natural nucleic acids, sugars are linked to each other from 3' to 5'. In certain embodiments, oligonucleotides contain one or more nucleosides or sugar moieties linked at alternative positions, such as the 2' position, or inverted 5' to 3'. For example, if the linkage is at the 2' position, the 2'-substituent may instead be at the 3' position.

[0247] Certain modified sugar moieties include a substituent that bridges two atoms of a furanosyl ring to form a second ring, resulting in a bicyclic sugar moiety. In certain embodiments, the bicyclic sugar moiety includes a bridge between the 4'-furanose ring atom and the 2'-furanose ring atom. Examples of such 4' to 2' bridged sugar substituents include 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2' ("LNA"), 4'-CH2-S-2', '-(CH2)2-O-2' ("ENA"), 4'-CH(CH3)-O-2' (when in the S configuration, referred to as "constrained ethyl" or "cEt"), 4'-CH2-O-CH2-2', 4'-CH2 -N(R)-2', 4'-CH(CHOCH)-O-2' ("constrained MOE" or "cMOE") and its analogs, 4'-C(CH)(CH)-O-2' and its analogs, 4'-CH-N(OCH)-2' and its analogs, 4'-CH-ON(CH)-2', 4'-CH-C(H)(CH), 4'-CH-C(=CH)-2' and its analogs), 4'-C(R a R b )-N(R)-O-2',4'-C(R a R b )-ON(R)-2', 4'-CH2-ON(R)-2', and 4'-CH2-N(R)-O-2', wherein each R, R a and R b are independently H, a protecting group, or C1-C 12 Representative U.S. patents that teach methods for the preparation of such bicyclic sugar moieties include, but are not limited to, Imanishi et al., U.S. Pat. No. 7,427,672; Swayze et al., U.S. Pat. No. 7,741,457; and Swayze et al., U.S. Pat. No. 8,022,193; Seth et al., U.S. Pat. No. 8,278,283; Prakash et al., U.S. Pat. No. 8,278,425; Seth et al., U.S. Pat. No. 8,278,426.

[0248] In certain embodiments, such a 4' to 2' bridge is -[C(R a )(R b )]n -, -[C(R a )(R b )] n -O-, -C(R a )=C(R b )-, -C(R a )=N-, -C(=NR a )-, -C(=O)-, -C(=S)-, -O-, -Si(R a )2-, -S(=O) x - and -N(R a )-, During the ceremony, x is 0, 1 or 2, n is 1, 2, 3, or 4; Each R a and R b are independently H, a protecting group, hydroxyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)-H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1), and each J1 and J2 is independently H, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C2-C 12 Alkenyl, substituted C2-C 12 Alkenyl, C2-C 12 Alkynyl, substituted C2-C 12 Alkynyl, C5-C 20 Aryl, substituted C5-C 20 Aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C 12Aminoalkyl, substituted C1-C 12 aminoalkyl, or a protecting group.

[0249] Additional bicyclic sugar moieties are known in the art, see, e.g., Wan, et al., J. Medicinal Chemistry, 2016, 59, 9645-9667; Wengel et al., US8,080,644; Ramasamy et al., US6,525,191; Seth et al., US7,547,684; and Seth et al., US7,666,854.

[0250] In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by their isomeric configuration. For example, LNA nucleosides (described herein) can be in the α-L or β-D configuration. [ka] α-L-methyleneoxy (4'-CH2-O-2') or α-L-LNA bicyclic nucleosides have been incorporated into oligonucleotides that exhibit antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). The addition of locked nucleic acids to siRNA has been shown to improve the stability of siRNA in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol. Canc. Ther. 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). In this specification, the general description of bicyclic nucleosides includes both isomeric configurations. In exemplary embodiments herein, where positions of particular bicyclic nucleosides (eg, LNA or cEt) are specified, they are in the β-D configuration unless otherwise specified.

[0251] In certain embodiments, the modified sugar moiety comprises one or more non-bridging sugar substituents and one or more bridging sugar substituents (eg, a 5'-substituted sugar and a 4'-2'-bridging sugar).

[0252] In certain embodiments, the modified sugar moiety is a sugar surrogate. In certain such embodiments, the oxygen atom of the sugar moiety is replaced with, for example, a sulfur, carbon, or nitrogen atom. In certain such embodiments, such modified sugar moieties also include bridging and / or non-bridging substituents as described herein. For example, certain sugar surrogates include a 4'-sulfur atom and substitutions at the 2'- and / or 5'-positions.

[0253] In certain embodiments, the sugar surrogate contains a ring other than five atoms. For example, in certain embodiments, the sugar surrogate contains a six-membered tetrahydropyran ("THP"). Such tetrahydropyrans may be further modified or substituted. Nucleosides containing such modified tetrahydropyrans include hexitol nucleic acid ("HNA"), anitol nucleic acid ("ANA"), mannitol nucleic acid ("MNA"), fluoroHNA, [ka] ("F-HNA", see e.g., Egli, et. al., J Am Chem (2011) 133(41):16642-16649, Swayze et al., US 8,088,904; and Swayze et al., US 8,440,803, F-HNA is also called F-THP or 3'-fluorotetrahydropyran), and nucleosides containing additional modified THP compounds having the formula: [ka] wherein, independently for each modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each independently an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, or one of T3 and T4 is an internucleoside linking group that links the modified THP nucleoside to the remainder of the oligonucleotide, and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5'- or 3'-terminal group; and q1, q2, q3, q4, q5, q6, and q7 are each independently H, C1-C6 alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl, and R1 and R2 are each independently selected from hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, and CN, where X is O, S, or NJ1, and each J1, J2, and J3 is independently H or C1-C6 alkyl.

[0254] In certain embodiments, modified THP nucleosides are provided wherein q1, q2, q3, q4, q5, q6, and q7 are each H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is other than H. In certain embodiments, at least one of q1, q2, q3, q4, q5, q6, and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of R1 and R2 is F. In certain embodiments, R1 is F and R2 is H, in certain embodiments, R1 is methoxy and R2 is H, and in certain embodiments, R1 is methoxyethoxy and R2 is H.

[0255] In certain embodiments, the sugar surrogate comprises a ring having five or more atoms and one or more heteroatoms. For example, nucleosides containing morpholino sugar moieties and their use in oligonucleotides have been reported. As used herein, the term "morpholino" refers to a sugar surrogate having the following structure: [ka] .

[0256] In certain embodiments, morpholinos can be modified, for example, by adding or altering various substituents to the morpholino structure. Such sugar surrogates are referred to herein as "modified morpholinos."

[0257] In certain embodiments, the sugar surrogate comprises an acyclic moiety. Examples of nucleosides and oligonucleotides containing such acyclic sugar surrogates include, but are not limited to, peptide nucleic acids ("PNAs"), acyclic butyl nucleic acids, and the nucleosides and oligonucleotides described in Manoharan et al., U.S. Pat. No. 10,913,767. Representative U.S. patents teaching the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082, 5,714,331, and 5,719,262.

[0258] In certain embodiments, the sugar surrogate is the "unlocked" sugar structure of a UNA (unlocked nucleic acid) nucleoside. A UNA is a nucleoside in which one of the bonds of the sugar moiety has been removed to form the unlocked sugar surrogate. Representative U.S. publications teaching the preparation of UNAs include, but are not limited to, U.S. Patent Publication No. 2011 / 0313020.

[0259] In certain embodiments, the sugar substitute is glycerol, found in GNA (glycol nucleic acid) nucleosides, as shown below: (S)-GNA [ka] , In the formula, Bx represents any nucleic acid base.

[0260] Many other bicyclic and tricyclic sugars and sugar surrogates are known in the art that can be used in modified nucleosides.

[0261] 2. Certain modified nucleobases In certain embodiments, modified oligonucleotides contain one or more nucleosides containing unmodified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides containing modified nucleobases. In certain embodiments, modified oligonucleotides contain one or more nucleosides that do not contain a nucleobase (referred to as abasic nucleosides). In certain embodiments, modified oligonucleotides contain one or more inosine nucleosides (i.e., nucleosides containing hypoxanthine nucleobases). An "unmodified nucleobase" is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). A modified nucleobase is an atomic group other than unmodified A, T, C, U, or G that can pair with at least one other nucleobase. 5-methylcytosine is an example of a modified nucleobase. A universal base is a modified nucleobase that can pair with any of the five unmodified nucleobases.

[0262] In certain embodiments, the modified adenine has the structure (I): [ka] In the formula, R 2A is H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 thioalkyl, or substituted C1-C6 thioalkyl, C1-C6 alkyloxy, or substituted C1-C6 alkyloxy, and R 6A is H,N(R a )(R b ), acetyl, formyl, or O-phenyl, and Y 7A is N and R 7A is absent or is C1-C6 alkyl, or Y 7A is C and R 7A is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8A is N and R 8A does not exist or Y 8Ais C and R 8A is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7A N, Y 8A C, R 8A H, R 2A H, R 6A The case where is NH2 (unmodified adenine) is excluded.

[0263] In certain embodiments, the modified guanine has the structure (II): [ka] In the formula, R 2G is N(R a )(R b ) and R 6G is oxo and R 1G is H or R 6G is selected from O—C1-C6 alkyl or S—C1-C6 alkyl, and R 1G does not exist, Y 7G is N and R 7A is absent or is C1-C6 alkyl, or Y 7G is C and R 7G is H, C1-C6 alkyl, or CN(R a )(R b ) and Y 8G is N and R 8G does not exist or Y 8G is C and R 8G is selected from H, halogen, OH, C1-C6 alkyl, or substituted C1-C6 alkyl; R a and R bare independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, formyl, or together form a 5- to 7-membered heterocycle, provided that Y 7G is N and Y 8G C, R 8G H, R 2G is NH2, R 6G The case where =O (unmodified guanosine) is excluded.

[0264] In certain embodiments, the modified thymine or uracil has the structure (III): [ka] wherein X is selected from O or S, and R 5U H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and when each X is O, R 5U is not H or CH3 (unmodified uracil and unmodified thymine, respectively).

[0265] In certain embodiments, the modified cytosine has the structure (IV): [ka] wherein X is selected from O or S, and R 4C is N(R a )(R b ) and R 5C H, OH, halogen, O-C1~C 12 Alkyl, O-C1-C 12 Substituted alkyl, C1-C 12 Alkyl, substituted C1-C 12 Alkyl, C1-C 12 Alkenyl, substituted C1-C 12 alkenyl, and R aand R b are independently selected from H, C1-C6 alkyl, substituted C1-C6 alkyl, C1-C6 alkenyl, substituted C1-C6 alkenyl, acetyl, and formyl, or together form a 5- to 7-membered heterocycle, provided that X is not O, R 4C is NH2, R 5C However, H (unmodified cytosine) is excluded.

[0266] In certain embodiments, the modified nucleobase is selected from 5-substituted pyrimidines, 6-azapyrimidines, alkyl- or alkynyl-substituted pyrimidines, alkyl-substituted purines, and N-2, N-6, and O-6 substituted purines. In certain embodiments, modified nucleobases include 5-methylcytosine, 2-aminopropyladenine, 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine, 6-N-methyladenine, 2-propyladenine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (—C≡C—CH3) uracil, 5-propynylcytosine, 6-azo uracil, 6-azo cytosine, 6-azo thymine, 5-ribosyluracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza, and others. 8-substituted purines, 5-halo (especially 5-bromo), 5-trifluoromethyl, 5-halouracil and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N-benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N-benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size-extended bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines such as 1,3-diazaphenoxazin-2-one, 1,3-diazaphenothiazin-2-one, 9-(2-aminoethoxy)-1,3-diazaphenoxazin-2-one (G-clamp). Modified nucleobases can also include those in which the purine or pyrimidine base is replaced with other heterocycles, such as 7-deazaadenine, 7-deazaguanosine, 2-aminopyridine, and 2-pyridone.Further nucleobases include those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, YS, Chapter 15, Antisense Research and Applications, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993, 273-288, and Chapters 6 and 15, Antisense Drug Technology, Crooke ST, Ed., CRC Press, 2008, 163-166 and 442-443.

[0267] Publications that teach the preparation of certain of the above-described modified nucleobases, as well as other modified nucleobases, include, but are not limited to, Rogers et al., US 5,134,066; Benner et al., US 5,432,272; Matteucci et al., US 5,502,177; Froehler et al., US 5,594,121; and Cook et al., US 5,681,941.

[0268] In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from the group consisting of A, G, C, T, U, and m C is selected.

[0269] In certain embodiments, each nucleobase of a modified oligonucleotide of the invention is selected from the group consisting of A, G, T, and m C (i.e., unmodified purines and 5-methylpyrimidines).

[0270] 3. Certain modified internucleoside linkages The natural internucleoside linkage in RNA and DNA is a 3'-5' phosphodiester linkage. In certain embodiments, the nucleosides of a modified oligonucleotide can be linked to each other using one or more modified internucleoside linkages. Two major classes of internucleoside linkage groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester linkages ("P=O") (also called unmodified or native linkages), phosphotriesters, methylphosphonates, phosphoramidates, phosphorothioates ("P=S"), and phosphodiesters containing phosphorodithioates ("HS-P=S"). Representative non-phosphorus-containing internucleoside linkage groups include, but are not limited to, methylenemethylimino (-CH-N(CH)-O-CH-), thiodiester, thionocarbamate (-OC(=O)(NH)-S-), siloxane (-O-SiH-O-), and N,N'-dimethylhydrazine (-CH-N(CH)-N(CH)-). Compared to natural phosphodiester internucleoside linkages, modified internucleoside linkages can be used to alter, typically increase, the nuclease resistance of oligonucleotides. In certain embodiments, internucleoside linkages having chiral atoms can be prepared as racemic mixtures or as separate enantiomers. Methods for preparing phosphorus-containing and non-phosphorus-containing internucleoside linkages are well known to those skilled in the art.

[0271] In certain embodiments, the modified internucleoside linkage is any of those described in WO2021 / 030778, which is incorporated herein by reference. In certain embodiments, the modified internucleoside linkage comprises the following formula: [ka] , wherein, independently, for each such internucleoside linkage group of the modified oligonucleotide: X is selected from O or S; R1 is selected from H, C1-C6 alkyl, and substituted C1-C6 alkyl; and T is selected from SO2R2, C(=O)R3 and P(=O)R4R5, wherein: R2 is selected from aryl, substituted aryl, heterocycle, substituted heterocycle, aromatic heterocycle, substituted aromatic heterocycle, diazole, substituted diazole, C1-C6 alkoxy, C1-C6 alkyl, C1-C6 alkenyl, C1-C6 alkynyl, substituted C1-C6 alkyl, substituted C1-C6 alkenyl, substituted C1-C6 alkynyl, and a conjugate group; R3 is selected from aryl, substituted aryl, CH3, N(CH3)2, OCH3, and a conjugate group; R4 is selected from OCH3, OH, C1-C6 alkyl, substituted C1-C6 alkyl, and a conjugate group; and R5 is selected from OCH3, OH, C1-C6 alkyl, and substituted C1-C6 alkyl.

[0272] In certain embodiments, the modified internucleoside linkage comprises a mesylphosphoramidate linking group having the formula: [ka] .

[0273] The mesyl phosphoramidate internucleoside linkage contains a chiral center. In certain embodiments, modified oligonucleotides contain (Rp) and / or (Sp) mesyl phosphoramidate, each represented by the following formula, where "B" represents a nucleobase: [ka] .

[0274] In certain embodiments, the phosphorothioate internucleoside linkages may contain chiral centers. The modified oligonucleotides each comprise one or more of the following formulae, where "B" represents a nucleobase: [ka] .

[0275] Representative internucleoside linkages having a chiral center include, but are not limited to, alkylphosphonates and phosphorothioates. Modified oligonucleotides containing internucleoside linkages having a chiral center can be prepared as a group of modified oligonucleotides containing stereorandom internucleoside linkages or as a group of modified oligonucleotides containing such internucleoside linkages of a specific stereochemical configuration. In certain embodiments, a group of modified oligonucleotides contains phosphorothioate internucleoside linkages, and all of the phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, a group of modified oligonucleotides contains mesyl phosphoramidate internucleoside linkages, and all of the mesyl phosphoramidate internucleoside linkages are stereorandom. Such modified oligonucleotides can be produced using a synthetic method that randomly selects the stereochemical configuration of each internucleoside linkage having a chiral center. Nevertheless, each individual internucleoside linkage having a chiral center in each individual oligonucleotide molecule has a defined stereochemistry. In certain embodiments, a population of modified oligonucleotides is enriched for modified oligonucleotides containing one or more specific phosphorothioate and / or mesyl phosphoramidate internucleoside linkages, each in a specific, independently selected stereochemical configuration. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 65% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 70% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 80% of the molecules in the population. In certain embodiments, a specific configuration of the phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 90% of the molecules in the population.In certain embodiments, a particular arrangement of phosphorothioate and / or mesyl phosphoramidate internucleoside linkages is present in at least 99% of the molecules in the population. Such chirally enriched populations of modified oligonucleotides can be produced using synthetic methods known in the art, such as those described in Oka et al., JACS 125, 8307 (2003), Wan et al. Nucleic Acids Res. 42, 13456 (2014), and WO 2017 / 015555. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate and / or mesyl phosphoramidate in the (Sp) configuration. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides having at least one designated phosphorothioate and / or mesyl phosphoramidate in the (Rp) configuration. Unless otherwise specified, the internucleoside linkages containing chiral centers of the modified oligonucleotides described herein may be stereorandom or may be of a specific stereochemical configuration.

[0276] Neutral internucleoside linkages include, but are not limited to, phosphotriester, methylphosphonate, MMI (3'-CH2-N(CH3)-O-5'), amide-3 (3'-CH2-C(=O)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=O)-5'), formacetal (3'-O-CH2-O-5'), methoxypropyl (MOP), and thioformacetal (3'-S-CH2-O-5'). Neutral internucleoside linkages further include nonionic linkages, including siloxanes (dialkylsiloxanes), carboxylate esters, carboxamides, sulfides, sulfonate esters, and amides (see, e.g., Carbohydrate Modifications in Antisense Research; YS Sanghvi and PD Cook, Eds. ACS Symposium Series 580; Chapters 3 and 4, 40-65). Neutral internucleoside linkages further include nonionic linkages containing mixed N, O, S, and CH moieties.

[0277] In certain embodiments, modified oligonucleotides comprise one or more inverted nucleosides, as shown below: [ka] , In the formula, each Bx independently represents any nucleobase.

[0278] In certain embodiments, the inverted nucleoside is terminal (i.e., the last nucleoside at one end of the oligonucleotide), so that only one internucleoside linkage is present. In certain embodiments, additional features (such as conjugate groups) can be attached to the inverted nucleoside. Such terminal inverted nucleosides can be attached to either or both ends of the oligonucleotide.

[0279] In certain embodiments, the nucleic acids can be linked in a 2' to 5' manner rather than the standard 3' to 5' manner. Such linkages are shown below: [ka] , In the formula, each Bx represents any nucleic acid base.

[0280] B. A specific motif In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified sugar moieties. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising modified nucleobases. In certain embodiments, modified oligonucleotides comprise one or more modified internucleoside linkages. In such embodiments, the modified sugar moieties, unmodified sugar moieties, and differentially modified nucleobases and / or internucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the sugar moieties, nucleobases, and internucleoside linkage patterns are each independent of one another. Thus, a modified oligonucleotide can be described by its sugar motif, nucleobase motif, and / or internucleoside linkage motif (as used herein, nucleobase motif describes modifications to the nucleobases independently of the sequence of the nucleobases).

[0281] 1. A specific glycomotif In certain embodiments, an oligonucleotide comprises one or more types of modified sugar and / or unmodified sugar moieties arranged in a defined pattern or sugar motif along the oligonucleotide or a region thereof. In certain instances, such sugar motifs include, but are not limited to, any of the sugar modifications described herein.

[0282] In certain embodiments, a modified oligonucleotide comprises a deoxy region. In certain embodiments, each nucleoside in the deoxy region is a 2'-β-D-deoxynucleoside. In certain embodiments, the deoxy region consists of 5 to 12 linked nucleosides. In certain embodiments, the deoxy region consists of 6, 7, 8, 9, 10, or 6 to 10 linked nucleosides. In certain embodiments, at least one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, exactly one nucleoside in the deoxy region comprises a modified sugar moiety. In certain embodiments, two or three nucleosides in the deoxy region comprise a modified sugar moiety.

[0283] In certain embodiments, the deoxy region is flanked on its 5'-side by a 5'-region consisting of linked 5'-region nucleosides and on its 3'-side by a 3'-region consisting of linked 3'-region nucleosides, wherein the 3'-most nucleoside of the 5'-region is a modified nucleoside and the 5'-most nucleoside of the 3'-region is a modified nucleoside. At least one nucleoside in the 5'-region contains a modified sugar moiety, and at least one nucleoside in the 3'-region contains a modified sugar moiety. The three regions (5'-region, deoxy region, and 3'-region) form a continuous sequence of nucleosides. In certain embodiments, the sugar moiety of the 3'-most nucleoside in the 5'-region and the sugar moiety of the 5'-most nucleoside in the 3'-region are different from the sugar moieties of adjacent nucleosides in the deoxy region, thus defining the boundaries between the 5'-region, the deoxy region, and the 3'-region. In certain embodiments, each nucleoside in the 5'-region and each nucleoside in the 3'-region comprises a modified sugar moiety. In certain embodiments, the nucleosides in the 5'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 5'-region comprise two or more different sugar modifications. In certain embodiments, the nucleosides in the 3'-region comprise the same sugar modification. In certain embodiments, the nucleosides in the 3'-region comprise two or more different sugar modifications.

[0284] In certain embodiments, the 5'-region and 3'-region of the modified oligonucleotide each comprise 1 to 8 nucleosides. In certain embodiments, the 5'-region comprises 1 to 7 nucleosides. In certain embodiments, the 5'-region comprises 1 to 6 nucleosides. In certain embodiments, the 5'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides. In certain embodiments, the 3'-region comprises 1 to 7 nucleosides. In certain embodiments, the 3'-region comprises 1 to 6 nucleosides. In certain embodiments, the 3'-region comprises 1, 2, 3, 4, 5, 6, 7, or 8 nucleosides.

[0285] In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif defined by two outer regions or "wings" and a central or internal region or "gap." The three regions of the gapmer motif (the 5'-wing, the gap, and the 3'-wing) form a continuous sequence of nucleosides, with at least some of the sugar moieties of the nucleosides in each wing being different from at least some of the sugar moieties of the nucleosides in the gap. In particular, at least the sugar moieties of the nucleosides in each wing closest to the gap (the 3'-most nucleoside of the 5'-wing and the 5'-most nucleoside of the 3'-wing) are different from the sugar moieties of the adjacent gap nucleosides, thus defining the boundary between the wing and the gap (i.e., the wing / gap junction). In certain embodiments, the sugar moieties within the gap are the same as each other. In certain embodiments, the gap contains one or more nucleosides having sugar moieties that differ from the sugar moieties of one or more other nucleosides within the gap. In certain embodiments, the sugar motifs of the two wings are the same as each other (symmetric gapmers). In certain embodiments, the sugar motif of the 5'-wing is different from the sugar motif of the 3'-wing (asymmetric gapmers).

[0286] In certain embodiments, a gapmer wing comprises 1 to 8 nucleosides. In certain embodiments, a gapmer wing comprises 1 to 6 nucleosides. In certain embodiments, each nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside in each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least two nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least three nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least four nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least five nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least six nucleosides in each wing of a gapmer comprise a modified sugar moiety. In certain embodiments, at least seven nucleosides in each wing of a gapmer comprise a modified sugar moiety.

[0287] In certain embodiments, the gapmer gap comprises 7 to 12 nucleosides. In certain embodiments, each nucleoside of the gapmer gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety.

[0288] In certain embodiments, the gapmer is a deoxygapmer. In certain embodiments, a nucleoside on the gap side of each wing / gap junction comprises a 2'-β-D-deoxyribosyl sugar moiety, and a nucleoside on the wing side of each wing / gap junction comprises a modified sugar moiety. In certain embodiments, each nucleoside of the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, each nucleoside of each wing of a gapmer comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a modified sugar moiety. In certain embodiments, at least one nucleoside of the gapmer gap comprises a 2'-OMe sugar moiety.

[0289] In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif. In such embodiments, each nucleoside of the fully modified portion of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, each nucleoside throughout the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, a modified oligonucleotide comprises or consists of a portion having a fully modified sugar motif, and each nucleoside within the fully modified portion comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified oligonucleotide comprises the same 2'-modification.

[0290] As used herein, the lengths (number of nucleosides) of the three regions of a gapmer can be represented using the notation [number of nucleosides in the 5'-wing] - [number of nucleosides in the gap] - [number of nucleosides in the 3'-wing]. Thus, a 3-10-3 gapmer consists of three linked nucleosides in each wing and 10 linked nucleosides in the gap. When a specific modification is followed by this nomenclature, the modification is in the sugar moiety of each wing, and the gap nucleoside contains a 2'-β-D-deoxyribosyl sugar moiety. Thus, a 5-10-5 MOE gapmer consists of five linked 2'-MOE nucleosides in the 5'-wing, 10 linked 2'-β-D-deoxynucleosides in the gap, and 5 linked 2'-MOE nucleosides in the 3'-wing. A 3-10-3 cEt gapmer consists of three linked cEt nucleosides in the 5'-wing, ten linked 2'-β-D-deoxynucleosides in the gap, and three linked cEt nucleosides in the 3'-wing. A 5-8-5 gapmer consists of five linked nucleosides containing modified sugar moieties in the 5'-wing, eight linked 2'-β-D-deoxynucleosides in the gap, and five linked nucleosides containing modified sugar moieties in the 3'-wing. A 5-8-5 mixed gapmer has at least two different modified sugar moieties in the 5'- and / or 3'-wings, two different modified sugar moieties in the gap region, or a combination thereof.

[0291] In certain embodiments, the modified oligonucleotides disclosed herein are modified by specific sugar modifications. In certain embodiments, the modified oligonucleotide is a 5-10-5 MOE gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 BNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-3 LNA gapmer. In certain embodiments, the modified oligonucleotide is a 3-10-4 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-3 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 4-10-4 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 5-10-5 cEt gapmer. In certain embodiments, the modified oligonucleotide is a 6-10-4 MOE gapmer.

[0292] In certain embodiments, the modified oligonucleotides disclosed herein are modified with two or more sugar modifications. In certain embodiments, the modified oligonucleotide is a 3-10-3 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 3-10-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 3-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 4-9-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 6-10-4 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a modified sugar moiety selected from a 2'-MOE sugar moiety and a 2'-cEt sugar moiety, and the gap nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety.

[0293] In certain embodiments, the modified oligonucleotides disclosed herein are modified with two or more sugar modifications within the gap region. In certain embodiments, the modified oligonucleotide is a mixed cEt / MOE gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-cEt or a 2'-MOE sugar moiety, and each nucleoside in the gap comprises a sugar moiety selected from a 2'-β-D-deoxyribosyl sugar moiety, a 2'-α-L-deoxyribosyl sugar moiety, and a 2'-OMe sugar moiety. In certain embodiments, the modified oligonucleotide is a mixed cEt / MOE gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-cEt or a 2'-MOE sugar moiety, and each nucleoside in the gap comprises a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 3-10-3 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-cEt sugar moiety and each nucleoside in the gap comprises a sugar moiety selected from a 2'-OMe sugar moiety or a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is a 5-10-5 mixed gapmer, wherein each nucleoside in the 5' and 3' wings comprises a 2'-MOE sugar moiety and each nucleoside in the gap comprises a sugar moiety selected from a 2'-β-D-deoxyxylosyl sugar moiety, a 2'-α-L-deoxyribosyl sugar moiety, and a 2'-β-D-deoxyribosyl sugar moiety.

[0294] In certain embodiments, the modified oligonucleotide is 5’-kddddddddeeekekee-3’, 5’-kdddddddddeekekee-3’, 5’-kddddddddeeeeeeee-3’, 5’-kdddddddddeeeeeee-3’, 5’-kddddddddeeekekee-3’, 5’-kdddddddddeekekee-3’, 5’-kydddddddeeekekee-3’, 5’-kyddddddddeekekee-3’, 5’-kdyddddddeeekekee-3’, 5’-kdydddddddeekekee-3’, 5’-eddddddddeeekekee-3’, 5’-edddddddddeekekee-3’, 5’-eddddddddeeeeeeee-3’, 5’-edddddddddeeeeeee-3’, 5’-eedddddddddeekeke-3’, 5’-eeddddddddeeekeke-3’, 5’-eedddddddddeeeeee-3’, 5’-eeddddddddeeeeeee-3’, 5’-ekdddddddddeeeeee-3’, 5’-ekddddddddeeekeke-3’, 5’-ekddddddddeeeeeee-3’, 5’-ekyddddddddeekeke-3’, 5’-ekydddddddeeekeke-3’, 5’-ekdydddddddeekeke-3’, 5’-ekdddddddddeekeke-3’, 5’-ekddddddddeeekeke-3’, 5’-ekdyddddddeeekeke-3’, 5’-ekdddddddddeekeke-3’, 5’-ekddddddddeeekeke-3’, 5’-ekdddddddddeekeke-3’, 5’-ekddddddddeeekeke-3’, 5’-ekddddddddeeekeke-3’, 5’-ekdddddddddeekeke-3’, 5’-ekddddddddeeekek-3’, 5’-ekdddddddeeeekek-3’, 5’-eeddddddddeeekek-3’, 5’-eedddddddeeeekek-3’, 5’-ekddddddddeeeeee-3’, 5’-ekdddddddeeeeeee-3’, 5’-ekydddddddeeekek-3’, 5’-eeddddddddeeeeee-3’5'-eeddddddeeeeeee-3', 5'-ekdydddddeeekek-3', 5'-ekdddddddeeekek-3', 5'-ekdddddddeeeekek-3', 5'-ekddddddde eekek-3', 5'-ekdddddddeeeekek-3', 5'-ekdddddddeeekek-3', 5'-ekddddddeeeekek-3', 5'-eeeeeeedddddddkke-3', 5'-eee ekkdddddddeee-3', 5'-eeeekkdddddddkke-3', 5'-eeeeeeeddddddddeee-3', 5'-eeeekkddddddddkke-3', 5'-ekdddddddeeekek-3 ', 5'-ekdddddddeeekek-3', 5'-kdddddddddkeekk-3', 5'-edddddddddkeekk-3', 5'-kdddddddddeeeee-3', 5'-kyddddddddkee kk-3', 5'-eddddddddeeeee-3', 5'-kdydddddddkeekk-3', 5'-kddddddddkeekk-3', 5'-eeeekkddd[aLd]dddkke-3', 5'-ekdd d[aLd]ddddeeekek-3', 5'-ekddd[aLd]dddeeeekek-3', 5'-kddd[aLd]dddddkeekk-3', 5'-kddd[aLd]ddddeeekekee-3', 5'-kdd and 5'-ekddd[aLd]dddddeekekee-3', 5'-ekddd[aLd]dddddeekeke-3', and 5'-ekddd[aLd]ddddeeekeke-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, and each "[aLd]" represents a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is 5'-kydddddddeeekekee-3', 5'-kyddddddddeekekee-3', 5'-kdyddddddeeekekee-3', 5'-kdydddddddeekekee-3', 5'-ekyddddddddeekekee-3',5'-ekydddddddeeekeke-3', 5'-ekdydddddddeekeke-3', 5'-ekdyddddddeeekeke-3', 5'-ekydddddddeeekek-3', 5'-ekdydddddeeekek-3', 5'-kydddd ddddkeekk-3', 5'-kdyddddddkeekk-3', 5'-kddd[aLd]ddddeeekekee-3', 5'-kddd[aLd]ddddeekekee-3', 5'-ekddd[aLd]dddddeekeke-3', 5'-ekddd[ and 5'-ekddd[aLd]dddeeeekek-3', wherein each "e" represents a 2'-MOE sugar moiety, each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, and each "[aLd]" represents a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, the modified oligonucleotide is 5'-kddddddddeeekekee-3', 5'-kdddddddddeekekee-3', 5'-eddddddddeeekekee-3', 5'-edddddddddeekekee-3', 5'-edddddddddeekekee-3', 5'-kddddddddeeeeeeeeee-3', 5'-kdddddddddeeeeeee-3', 5'-eddddddddeeeeeeee-3', 5'-edddddddddeeeeeeeee-3', 5'-ekddddddddeeekeke-3' ', 5'-ekddddddddeekeke-3', 5'-eedddddddddeekeke-3', 5'-eeddddddddeeekeke-3', 5'-ekddddddddeeeeee-3', 5'-ekdddddddeeeeeee- 3', 5'-eedddddddddeeeeee-3', 5'-eeddddddddeeeeeee-3', 5'-ekdddddddeeekek-3', 5'-ekdddddddeeeekek-3', 5'-eeddddddddeeekek-3',5'-eedddddddeeeekek-3', 5'-ekddddddddeeeeeeee-3', 5'-ekdddddddeeeeeee-3', 5'-eedddddddeeeeee-3', 5'-eeddddddeeeeeee-3', 5'-ekd dddddddeeekek-3', 5'-ekddddddeeeekek-3', 5'-ekdddddddeeekek-3', 5'-ekddddddeeeekek-3', 5'-eeeeeeedddddddkke-3', 5'-eeeekkdddd dddeee-3', 5'-eeeekkdddddddkke-3', 5'-eeeeeedddddddeee-3', 5'-ekddddddddeeekek-3', 5'-kdddddddddkeekk-3', 5'-edddddddddkeekk-3', 5'-kdddddddddeeeee-3', and 5'-edddddddddeeeee-3', wherein each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety.

[0295] 2. Certain nucleobase motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified nucleobases arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases is modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in the modified oligonucleotide are 5-methylcytosine. In certain embodiments, all cytosine nucleobases are 5-methylcytosine, and all other nucleobases in the modified oligonucleotide are unmodified nucleobases.

[0296] In certain embodiments, the modified oligonucleotide comprises a block of modified nucleobases. In certain such embodiments, the block is at the 3'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 3'-end of the oligonucleotide. In certain embodiments, the block is at the 5'-end of the oligonucleotide. In certain embodiments, the block is within 3 nucleosides of the 5'-end of the oligonucleotide.

[0297] In certain embodiments, an oligonucleotide having a gapmer motif comprises a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is located in the central gap of the oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of the nucleoside is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, the modified nucleobase is selected from 2-thiopyrimidine and 5-propynepyrimidine.

[0298] 3. Certain internucleoside linkage motifs In certain embodiments, an oligonucleotide comprises modified and / or unmodified internucleoside linkages arranged in a defined pattern or motif along the oligonucleotide or a region thereof. In certain embodiments, each internucleoside linkage group is a phosphodiester internucleoside linkage (P=O). In certain embodiments, each internucleoside linkage group of a modified oligonucleotide is a phosphorothioate internucleoside linkage (P=S). In certain embodiments, each internucleoside linkage of a modified oligonucleotide is independently selected from a phosphorothioate internucleoside linkage and a phosphodiester internucleoside linkage. In certain embodiments, each phosphorothioate internucleoside linkage is independently selected from stereorandom phosphorothioate, (Sp) phosphorothioate, and (Rp) phosphorothioate.

[0299] In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and all internucleoside linkages within the gap are modified. In certain embodiments, some or all of the internucleoside linkages of the wings are unmodified phosphodiester internucleoside linkages. In certain embodiments, the terminal internucleoside linkage is modified. In certain embodiments, the sugar motif of the modified oligonucleotide is a gapmer, and the internucleoside linkage motif comprises at least one phosphodiester internucleoside linkage in at least one wing, at least one phosphodiester linkage is not a terminal internucleoside linkage, and the remaining internucleoside linkages are phosphorothioate internucleoside linkages. In certain such embodiments, all phosphorothioate linkages are stereorandom. In certain embodiments, all phosphorothioate linkages of the wings are (Sp) phosphorothioate, and the gap comprises at least one Sp, Sp, or Rp motif. In certain embodiments, the population of modified oligonucleotides is enriched for modified oligonucleotides that contain such internucleoside linkage motifs.

[0300] In certain embodiments, the modified oligonucleotide has an internucleoside linkage motif that comprises one or more mesyl phosphoramidate linkage groups. In certain embodiments, one or more phosphorothioate internucleoside linkages or one or more phosphodiester internucleoside linkages of the internucleoside linkage motif herein are replaced with mesyl phosphoramidate linkage groups.

[0301] In certain embodiments, the modified oligonucleotide is 5'-sssssssssssoss-3', 5'-sssssssssssooss-3', 5'-sssoossssssssss-3', 5'-sssoossssssssss-3', 5'-sssssssssssoooss-3', 5'-ssssssssssssoosss-3', 5'-ssssssssssssooss-3', 5'-szzssssssssss-3', 5'-zsssssssssssss-3', 5'-zsssssssssss ssz-3', 5'-ssssssssssszss-3', 5'-ssssssssssssss-3', 5'-zzsssssssssssss-3', 5'-zsssssssssssssz-3', 5'-sssssszzsss ssss-3', 5'-zssssssssssssssz-3', 5'-ssszzsssssssss-3', 5'-sszzssssssssss-3', 5'-sssssszssssssss-3', 5'-ssssszzss ssssss-3', 5'-ssssszzszssssss-3', 5'-ssszsszssssssss-3', 5'-ssszszzsssssss-3', 5'-sszzsszssssssss-3', 5'-sszzszz ssssssss-3', 5'-ssszszszsssssss-3', 5'-sszszszssssssss-3', 5'-sssssssssszzss-3', 5'-ssssssssssszzzss-3', 5'-szzs and each "z" represents a mesylphosphoramidate internucleoside linkage.In certain embodiments, the modified oligonucleotide is 5'-ssssssssssszzzss-3', 5'-szzsssssssssosss-3', 5'-zsssssssssssssosss-3', 5'-zsssssssssssssszz-3', 5'-sszzssssssssssss-3', 5'-zzssssssssssssoss-3', 5'-zzssssssssssssoss-3', 5'-zssssssssssssszz -3', 5'-ssssssssssszzzss-3', 5'-ssssssssssszzss-3', 5'-sszzsssssssssss-3', 5'-zzsssssssssssss-3 ', 5'-zssssssssssssssz-3', 5'-sssssszzsssssss-3', 5'-ssszzsssssssss-3', 5'-sssssszssssssss-3', 5' -ssssszzssssssss-3', 5'-ssssszzszssssss-3', 5'-ssszsszssssssss-3', 5'-ssszszzsssssss-3', 5'-ss zzsszsssssss-3', 5'-sszzszzsssssss-3', 5'-ssszszszssssss-3', 5'-sszszszssssssss-3', 5'-ssssss and each "z" represents a mesylphosphoramidate internucleoside linkage. In certain embodiments, modified oligonucleotides have a 5'-sssssssssssoooss-3', 5'-sssssssssssoosss-3', 5'-ssssssssssssooss-3', 5'-ssssssssssssooss-3', 5'-ssssssssssssss-3', 5'-sssssssssssss-3', 5'-sssoosssssssss-3', or 5'-ssssssssssssoss-3' internucleoside linkage motif, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.In certain embodiments, modified oligonucleotides have an internucleoside linkage motif of 5'-sssssssssssoosss-3', 5'-sssssssssssooss-3', 5'-sssssssssssooss-3', 5'-ssssssssssssss-3', 5'-ssssssssssssss-3', or 5'-ssssssssssssoss-3', where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

[0302] C. A certain length The length of oligonucleotides can be increased or decreased without compromising activity. For example, Woolf et al. (Proc. Natl. Acad. Sci. USA 89:7305-7309, 1992) tested a series of oligonucleotides ranging from 13 to 25 nucleobases in length for their ability to induce target RNA cleavage in an oocyte injection model. Oligonucleotides 25 nucleobases long with 8 or 11 mismatched bases near the end of the oligonucleotide were able to induce specific cleavage of the target RNA, although to a lesser extent than oligonucleotides without mismatches. Similarly, target-specific cleavage was achieved using 13 nucleobase oligonucleotides containing 1 or 3 mismatches.

[0303] In certain embodiments, oligonucleotides (including modified oligonucleotides) can have a range of lengths. In certain embodiments, oligonucleotides consist of X and Y linked nucleosides, where X represents the minimum number of nucleosides in the range and Y represents the maximum number of nucleosides in the range. In certain embodiments, X and Y are each independently selected from 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, and 50, where X≦Y. For example, in certain embodiments, 12-13, 12-14, 12-15, 12-16, 12-17, 12-18, 12-19, 12-20, 12-21, 12-22, 12-23, 12-24, 12-25, 12-26, 12-27, 12-28, 12-29, 12-30, 13-14, 13-15, 13-16, 13-17, 13-18, 13-19, 13-20, 13-21, 13-22, 13-23, 13-24, 13-25, 13-26, 13-27, 13-28, 13-29, 13-30, 14-15, 14-16, 14-17, 14-18, 14-19, 14-20, 14-21, 14-22, 14-23, 14-24, 14-25, 14-26, 14-27, 14-28, 14-29, 14-30, 15-16, 15-17, 15-18, 15-19 9, 15-20, 15-21, 15-22, 15-23, 15-24, 15-25, 15-26, 15-27, 15-28, 15-29, 15-30, 16-17, 16-18, 16-19, 16-20, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17 ~21, 17~22, 17~23, 17~24, 17~25, 17~26, 17~27, 17~28, 17~29, 17~30, 18~19, 18~20, 18~21, 18~22, 18~23, 18~24, 18~25, 18~26, 18~27, 18~28, 18~29, 18~30, 19~20, 19~21, 19~22, 19~23, 19~24, 19~25, 19~26,19-27, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, It consists of 23-24, 23-25, 23-26, 23-27, 23-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleosides.

[0304] In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 16 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 17 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 18 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 19 linked nucleosides. In certain embodiments, oligonucleotides (including modified oligonucleotides) consist of 20 linked nucleosides.

[0305] D. Certain Modified Oligonucleotides In certain embodiments, the above-described modifications (sugar, nucleobase, internucleoside linkage) are incorporated into modified oligonucleotides. In certain embodiments, modified oligonucleotides are characterized by their modification motif and overall length. In certain embodiments, these parameters are independent of each other. Thus, unless otherwise specified, each internucleoside linkage of an oligonucleotide having a gapmer sugar motif may be modified or unmodified, and may or may not follow the gapmer modification pattern of sugar modification. For example, the internucleoside linkages within the wing regions of a sugar gapmer may be the same or different from each other and may be the same or different from the internucleoside linkages in the gap region of the sugar motif. Similarly, such sugar gapmer oligonucleotides may contain one or more modified nucleobases, regardless of the gapmer pattern of sugar modification. Unless otherwise specified, all modifications are independent of the nucleobase sequence.

[0306] E. Certain Populations of Modified Oligonucleotides A population of modified oligonucleotides, where all modified oligonucleotides in the population have the same molecular formula, can be a stereorandom population or a chiral enriched population. All chiral centers of all modified oligonucleotides are stereorandom within the stereorandom population. In a chiral enriched population, at least one specific chiral center is not stereorandom among the modified oligonucleotides in the population. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for β-D ribosyl sugar moieties, and all phosphorothioate internucleoside linkages are stereorandom. In certain embodiments, the modified oligonucleotides in a chiral enriched population are enriched for both β-D ribosyl sugar moieties and at least one specific phosphorothioate internucleoside linkage in a specific stereochemical configuration.

[0307] F. Nucleic Acid Sequence In certain embodiments, the oligonucleotide (or a portion thereof) has a nucleobase sequence that is complementary to a second oligonucleotide or a specified reference nucleic acid (or a portion thereof), such as a target nucleic acid. In certain embodiments, the nucleobase sequence of a region or the entire length of the oligonucleotide is at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% complementary to the second oligonucleotide or specified reference nucleic acid (or a portion thereof), such as the target nucleic acid.

[0308] II. Certain Oligomeric Compounds In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide and, optionally, one or more conjugate groups and / or terminal groups. The conjugate group consists of a conjugate moiety and a conjugate linker that connects the conjugate moiety to the oligonucleotide. The conjugate group can be attached to one or both termini of the oligonucleotide and / or any internal position. In certain embodiments, the conjugate group is attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, the conjugate group is attached to one or both termini of the oligonucleotide (such conjugate groups are also terminal groups). In certain embodiments, the conjugate group or terminal group is attached to the 3'-terminus and / or 5'-terminus of the oligonucleotide.

[0309] A. Certain conjugate groups In certain embodiments, the oligonucleotide is covalently attached to one or more conjugate groups, which modify one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.

[0310] In certain embodiments, one or more properties of a modified oligonucleotide can be altered by conjugating one or more carbohydrate moieties to the modified oligonucleotide. In certain embodiments, the carbohydrate moiety is attached to a modified subunit of the modified oligonucleotide. For example, the ribose sugar of one or more ribonucleotide subunits of the modified oligonucleotide can be replaced with another moiety, such as a non-carbohydrate (preferably cyclic) carrier attached to a carbohydrate ligand. A ribonucleotide subunit in which the ribose sugar of the subunit has been replaced in this manner is referred to herein as a modified sugar moiety, a ribose-replacement modified subunit (RRMS). The cyclic carrier can be a carbocyclic ring system, i.e., one or more ring atoms can be a heteroatom, such as nitrogen, oxygen, or sulfur. The cyclic carrier can be a monocyclic ring system or can contain two or more rings, such as fused rings. The cyclic carrier can be a fully saturated ring system or can contain one or more double bonds. In certain embodiments, the modified oligonucleotide is a gapmer.

[0311] In certain embodiments, the conjugate group confers a new property to the attached oligonucleotide (e.g., a fluorophore or reporter group that allows for detection of the oligonucleotide). Certain conjugate groups and moieties have been previously described, such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), thioethers such as hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), thiocholesterol (Oberhauser et al., Nucleic Acids Res., 1992, 20, 533-538), aliphatic chains such as dodecanediol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), phospholipids such as dihexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucleic Acids Res., 1990, 18, 3777-3783), polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane palmityl acetate moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), octadecylamine or hexylaminocarbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), tocopherol groups (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220, and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or GalNAc clusters (e.g., WO2014 / 179620).

[0312] In certain embodiments, the conjugate group consists of a lipid and a conjugated linker, hi certain embodiments, the conjugate group is a phosphate-linked lipid having the structure: [ka] .

[0313] 1. Conjugate moiety Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), antibodies, vitamin moieties, polyethylene glycol, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes.

[0314] In certain embodiments, the conjugate moiety comprises an active drug substance, such as aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folic acid, benzothiadiazide, chlorothiazide, diazepine, indomethacin, barbiturates, cephalosporins, sulfa drugs, antidiabetics, antibacterial agents, or antibiotics.

[0315] In certain embodiments, the conjugate moiety is selected from any of C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, C5 alkyl, C22 alkenyl, C20 alkenyl, C16 alkenyl, C10 alkenyl, C21 alkenyl, C19 alkenyl, C18 alkenyl, C17 alkenyl, C15 alkenyl, C14 alkenyl, C13 alkenyl, C12 alkenyl, C11 alkenyl, C9 alkenyl, C8 alkenyl, C7 alkenyl, C6 alkenyl, or C5 alkenyl.

[0316] In certain embodiments, the conjugate moiety is selected from any of a C22 alkyl, C20 alkyl, C16 alkyl, C10 alkyl, C21 alkyl, C19 alkyl, C18 alkyl, C17 alkyl, C15 alkyl, C14 alkyl, C13 alkyl, C12 alkyl, C11 alkyl, C9 alkyl, C8 alkyl, C7 alkyl, C6 alkyl, or C5 alkyl, wherein the alkyl chain has one or more unsaturated bonds.

[0317] 2. Conjugate Linker Conjugate moiety is linked to oligonucleotide via conjugate linker.In some oligomer compounds, conjugate linker is a single chemical bond (i.e., conjugate moiety is directly linked to oligonucleotide via single bond).In some oligomer compounds, conjugate linker comprises chain structure such as hydrocarbyl chain, or oligomer of repeating unit such as ethylene glycol, nucleoside or amino acid unit.

[0318] In certain embodiments, the conjugate linker comprises pyrrolidine.

[0319] In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amido, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amido, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amido groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

[0320] In certain embodiments, the conjugate linker (including the conjugate linkers described above) is a bifunctional linking moiety, known in the art to be useful for attaching a conjugate group to a compound, such as the oligonucleotides provided herein. Typically, a bifunctional linking moiety contains at least two functional groups. One of the functional groups is selected to bind to a specific site on the compound, and the other is selected to bind to a conjugate group. Examples of functional groups used in bifunctional linking moieties include, but are not limited to, electrophiles that react with nucleophilic groups and nucleophiles that react with electrophilic groups. In certain embodiments, the bifunctional linking moiety contains one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

[0321] Examples of conjugate linkers include, but are not limited to, pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include substituted or unsubstituted C1-C 10Alkyl, substituted or unsubstituted C2-C 10 Alkenyl, or substituted or unsubstituted C2-C 10 A non-limiting list of preferred substituents includes, but is not limited to, alkynyl, hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0322] In certain embodiments, a conjugate linker comprises 1 to 10 linker nucleosides. In certain embodiments, a conjugate linker comprises 2 to 5 linker nucleosides. In certain embodiments, a conjugate linker comprises exactly 3 linker nucleosides. In certain embodiments, a conjugate linker comprises a TCA motif. In certain embodiments, such linker nucleosides are modified nucleosides. In certain embodiments, such linker nucleosides comprise modified sugar moieties. In certain embodiments, linker nucleosides are unmodified. In certain embodiments, a linker nucleoside comprises an optionally protected heterocyclic base selected from a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine, and 2-N-isobutyrylguanine. Typically, it is desirable for the linker nucleosides to be cleaved from the oligomeric compound after reaching the target tissue. Thus, the linker nucleosides are typically linked to each other and to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such a cleavable bond is a phosphodiester bond.

[0323] As used herein, linker nucleosides are not considered part of the oligonucleotide. Thus, in embodiments where an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and / or a specified percent complementarity to a reference nucleic acid, and the oligomeric compound also comprises a conjugate group comprising a conjugate linker containing linker nucleosides, those linker nucleosides are not counted in the length of the oligonucleotide and are not used to determine the percent complementarity of the oligonucleotide to the reference nucleic acid. For example, an oligomeric compound may comprise (1) a modified oligonucleotide consisting of 8 to 30 nucleosides and (2) a conjugate group comprising 1 to 10 consecutive linker nucleosides from the modified oligonucleotide. The total number of consecutively linked nucleosides in such an oligomeric compound is greater than 30. Alternatively, an oligomeric compound may comprise a modified oligonucleotide consisting of 8 to 30 nucleosides and no conjugate group. The total number of consecutively linked nucleosides in such an oligomeric compound is 30 or less. Unless otherwise specified, a conjugate linker comprises 10 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 5 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 3 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 2 or fewer linker nucleosides. In certain embodiments, a conjugate linker comprises 1 or fewer linker nucleosides.

[0324] In certain embodiments, it is desirable that the conjugate group be cleaved from the oligonucleotide.For example, in certain situations, oligomeric compounds containing certain conjugate moieties are better taken up by certain cell types, but after the oligomeric compound is taken up, it is desirable to cleave the conjugate group to release the unconjugated or parent oligonucleotide.Therefore, certain conjugate linkers can contain one or more cleavable moieties.In certain embodiments, the cleavable moiety is a cleavable bond.In certain embodiments, the cleavable moiety is an atomic group that includes at least one cleavable bond.In certain embodiments, the cleavable moiety includes an atomic group that has one, two, three, four, or more than four cleavable bonds.In certain embodiments, the cleavable moiety is selectively cleaved within cells or intracellular compartments such as lysosomes.In certain embodiments, the cleavable moiety is selectively cleaved by endogenous enzymes such as nucleases.

[0325] In certain embodiments, the cleavable bond is selected from among amide, ester, ether, one or both esters of phosphodiester, phosphate ester, carbamate, or disulfide. In certain embodiments, the cleavable bond is one or both esters of phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate bond between the oligonucleotide and the conjugate moiety or conjugate group.

[0326] In certain embodiments, the cleavable moiety comprises or consists of one or more linker nucleosides. In certain such embodiments, one or more linker nucleosides are linked to each other and / or to the remainder of the oligomeric compound via a cleavable bond. In certain embodiments, such cleavable bond is an unmodified phosphodiester bond. In certain embodiments, the cleavable moiety is a 2'-deoxynucleoside linked to either the 3'- or 5'-terminal nucleoside of the oligonucleotide by a phosphate internucleoside bond and covalently linked to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate bond. In certain embodiments, the cleavable moiety is 2'-deoxyadenosine.

[0327] 3.Cell targeting part In certain embodiments, the conjugate group comprises a cell targeting moiety. In certain embodiments, the cell targeting moiety targets neurons. In certain embodiments, the cell targeting moiety targets neurotransmitter receptors. In certain embodiments, the cell targeting moiety targets neurotransmitter transporters. In certain embodiments, the cell targeting moiety targets GABA transporters. For example, see WO 2011 / 131693, WO 2014 / 064257.

[0328] In certain embodiments, the conjugate group comprises a cell-targeting moiety having affinity for transferrin receptor (TfR) (also referred to herein as TfR1 and CD71). In certain embodiments, the conjugate group described herein comprises an anti-TfR1 antibody or fragment thereof. In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the anti-TfR1 antibody or fragment thereof can be any known in the art, including but not limited to those described in WO1991 / 004753, WO2013 / 103800, WO2014 / 144060, WO2016 / 081643, WO2016 / 179257, WO2016 / 207240, WO2017 / 221883, WO2018 / 129384, WO2018 / 124121, WO2019 / 151539, WO2020 / 132584, WO2020 / 028864, US 7,208,174, US 9,034,329, and US 10,550,188. In certain embodiments, the fragment of the anti-TfR1 antibody is F(ab')2, Fab, Fab', Fv, or scFv.

[0329] In certain embodiments, the conjugate group comprises a protein or peptide capable of binding to TfR1. In certain embodiments, the protein or peptide capable of binding to TfR1 can be any known in the art, including but not limited to those described in WO2019 / 140050, WO2020 / 037150, WO2020 / 124032, and US 10,138,483.

[0330] In certain embodiments, the conjugate group comprises an aptamer capable of binding to TfR1. In certain embodiments, the aptamer capable of binding to TfR1 can be any known in the art, including, but not limited to, those described in WO2013 / 163303, WO2019 / 033051, and WO2020 / 245198.

[0331] B. Certain end groups In certain embodiments, the oligomeric compound comprises one or more terminal groups. In certain such embodiments, the oligomeric compound comprises a stabilized 5'-phosphate. Stabilized 5'-phosphates include, but are not limited to, 5'-phosphonates (including, but not limited to, 5'-vinylphosphonates). In certain embodiments, the terminal group comprises one or more abasic sugar moieties and / or inverted nucleosides. In certain embodiments, the terminal group comprises an inverted abasic sugar moiety. In certain embodiments, the inverted abasic sugar moiety can be further attached to a conjugate group. In certain embodiments, the terminal group comprises one or more 2'-linked nucleoside or sugar moieties. In certain embodiments, the 2'-linked group is an abasic sugar moiety. Such terminal abasic sugar moieties can be attached to either or both ends of the oligonucleotide.

[0332] III. Antisense Activity In certain embodiments, oligomeric compounds can hybridize with target nucleic acids and produce at least one antisense activity. In certain embodiments, oligomeric compounds form oligomeric duplexes with a second oligomeric compound containing a complementary nucleobase sequence. Such oligomeric compounds and oligomeric duplexes are antisense compounds. In certain embodiments, antisense compounds are considered to have antisense activity if they reduce or inhibit the amount or activity of the target nucleic acid by 50% or more in a standard in vitro assay. In certain embodiments, antisense compounds selectively act on one or more target nucleic acids. Such antisense compounds comprise nucleobase sequences that hybridize to one or more target nucleic acids to produce one or more desired antisense activities and do not hybridize to one or more non-target nucleic acids, or that hybridize to one or more non-target nucleic acids without producing significant undesired antisense activity.

[0333] In certain antisense activities, hybridization of an antisense compound with a target nucleic acid recruits a protein that cleaves the target nucleic acid. For example, certain antisense compounds result in RNase H-mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex does not need to be unmodified DNA. In certain embodiments, antisense compounds are described herein that have sufficient "DNA-likeness" to induce RNase H activity. In certain embodiments, the gapmer gap can be tolerated by one or more non-DNA-like nucleosides.

[0334] In certain antisense activity, antisense compound or part of antisense compound is loaded into RNA-induced silencing complex (RISC), and finally target nucleic acid is cut.For example, certain antisense compound causes target nucleic acid to be cut by Argonaute.The antisense compound that is loaded into RISC is RNAi agent.RNAi agent is double-stranded (siRNA or dsRNAi) or single-stranded (ssRNAi).

[0335] In certain embodiments, the hybridization of an antisense compound with a target nucleic acid does not result in the recruitment of a protein that cleaves the target nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid alters the splicing of the target nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid inhibits the binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain embodiments, the hybridization of an antisense compound with a target nucleic acid alters the translation of the target nucleic acid.

[0336] Antisense activity can be observed directly or indirectly, hi certain embodiments, observing or detecting antisense activity comprises observing or detecting a change in the amount of a target nucleic acid or a protein encoded by such a target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and / or a change in phenotype in a cell or subject.

[0337] IV. Certain Target Nucleic Acids In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid. In certain embodiments, the target nucleic acid is an endogenous RNA molecule. In certain embodiments, the target nucleic acid encodes a protein. In certain embodiments, the target nucleic acid is selected from mature mRNA and pre-mRNA comprising introns, exons, and untranslated regions. In certain embodiments, the target RNA is a mature mRNA. In certain embodiments, the target nucleic acid is a pre-mRNA. In certain embodiments, the target region is entirely within an intron. In certain embodiments, the target region spans an intron / exon junction. In certain embodiments, at least 50% of the target region is within an intron. In certain embodiments, the target nucleic acid is an RNA transcript of a retrogene. In certain embodiments, the target nucleic acid is a non-coding RNA. In certain embodiments, the target non-coding RNA is selected from a long non-coding RNA, a short non-coding RNA, or an intronic RNA molecule.

[0338] A. Complementarity / Mismatch and Double-Stranded Complementarity to Target Nucleic Acid In certain embodiments, the oligonucleotide is complementary to the target nucleic acid over the entire length of the oligonucleotide. In certain embodiments, the oligonucleotide is 99%, 95%, 90%, 85%, or 80% complementary to the target nucleic acid. In certain embodiments, the oligonucleotide is at least 80% complementary to the target nucleic acid over the entire length of the oligonucleotide, and includes a region that is 100% or fully complementary to the target nucleic acid. In certain embodiments, the length of the fully complementary region is 6 to 20, 10 to 18, or 18 to 20 nucleobases.

[0339] It is possible to introduce mismatched bases without losing activity. For example, Gautschi et al. (J. Natl. Cancer Inst. 93:463-471, March 2001) demonstrated that an oligonucleotide with 100% complementarity to bcl-2 mRNA and three mismatches to bcl-xL mRNA was capable of reducing the expression of both bcl-2 and bcl-xL in vitro and in vivo. Furthermore, this oligonucleotide demonstrated potent antitumor activity in vivo. Maher and Dolnick (Nucleic Acids Res. 16:3341-3358, 1988) tested a series of tandem 14 nucleobase oligonucleotides, as well as 28 nucleobase and 42 nucleobase oligonucleotides composed of sequences of two or three tandem oligonucleotides, for their ability to inhibit the translation of human DHFR in a rabbit reticulocyte assay. Each of the three 14 nucleobase oligonucleotides alone was able to inhibit translation, but to a lesser extent than the 28 or 42 nucleobase oligonucleotides.

[0340] In certain embodiments, oligonucleotide comprises one or more mismatched nucleobases with target nucleic acid.In certain embodiments, this mismatch reduces the antisense activity of target, but further reduces the activity of non-target.Therefore, in certain embodiments, the selectivity of oligonucleotide is improved.

[0341] In certain embodiments, the mismatch is specifically located within an oligonucleotide having a gapmer motif. In certain embodiments, the mismatch is located at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5'-end of the gap region. In certain embodiments, the mismatch is located at position 9, 8, 7, 6, 5, 4, 3, 2, or 1 from the 3'-end of the gap region. In certain embodiments, the mismatch is located at position 1, 2, 3, or 4 from the 5'-end of the wing region. In certain embodiments, the mismatch is located at position 4, 3, 2, or 1 from the 3'-end of the wing region.

[0342] B. HTT SNP rs7685686 In certain embodiments, the oligomeric compounds described herein comprise or consist of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is HTT comprising SNP rs7685686. In each of the above embodiments, the oligomeric compounds selectively target HTT nucleic acids comprising SNP rs7685686. In certain embodiments, the oligomeric compounds described herein selectively target HTT nucleic acids comprising SNP rs7685686 over non-target nucleic acids such as wild-type HTT or BMPR1. In certain embodiments, the selectivity difference of oligomeric compounds targeting HTT nucleic acids comprising SNP rs7685686 is at least 10-fold compared to wild-type HTT. In certain embodiments, the selectivity difference of oligomeric compounds targeting HTT nucleic acids comprising SNP rs7685686 is at least 10-fold compared to BMPR1. In certain embodiments, the HTT nucleic acid comprising SNP rs7685686 has the sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NT_006081.18, truncated from nucleotides 1566000 to 1768000). In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to SEQ ID NO: 1 selectively reduces the amount of HTT RNA comprising SNP rs7685686, and in certain embodiments, reduces the amount of mHTT protein. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide and a conjugate group. In certain embodiments, the amount of wild-type HTT nucleic acid is not reduced by the oligomeric compounds described herein. In certain embodiments, the amount of wild-type HTT protein is not reduced by the oligomeric compounds described herein. In certain embodiments, the amount of non-target nucleic acid, such as BMPR1, is not reduced by the oligomeric compounds described herein. In certain embodiments, the amount of BMPR1 RNA is not reduced by the oligomeric compounds described herein.

[0343] In certain embodiments, contacting a cell with an oligomeric compound described herein that is complementary to SEQ ID NO: 1 selectively reduces the amount of HTT RNA containing SNP rs7685686 in the cell. In certain embodiments, contacting a cell with an oligomeric compound complementary to SEQ ID NO: 1 reduces the amount of mHTT protein in the cell. In certain embodiments, the cell is in vitro. In certain embodiments, the cell is in a subject. In certain embodiments, the oligomeric compound comprises a modified oligonucleotide. In certain embodiments, contacting a subject's cell with an oligomeric compound complementary to SEQ ID NO: 1 ameliorates one or more symptoms or characteristics of Huntington's disease. In certain embodiments, the one or more symptoms or characteristics include brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

[0344] In certain embodiments, oligomeric compounds described herein that are complementary to SEQ ID NO: 1 are capable of reducing the amount of HTT RNA containing SNP rs7685686 in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, oligomeric compounds described herein that are complementary to SEQ ID NO: 1 are capable of reducing the amount of HTT RNA containing SNP rs7685686 in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds described herein complementary to SEQ ID NO: 1 are capable of reducing the amount of mHTT protein in vitro by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vitro assay. In certain embodiments, oligomeric compounds described herein complementary to SEQ ID NO: 1 are capable of reducing the amount of mHTT protein in vivo by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% when administered according to a standard in vivo assay. In certain embodiments, oligomeric compounds described herein that are complementary to SEQ ID NO: 1 are capable of reducing the amount of HTT RNA containing SNP rs7685686 in a subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.In certain embodiments, the oligomeric compounds described herein that are complementary to SEQ ID NO: 1 can reduce the amount of mHTT protein in a subject's cells by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%.

[0345] C. A specific target nucleic acid in a specific tissue In certain embodiments, the oligomeric compound comprises or consists of an oligonucleotide comprising a region complementary to a target nucleic acid, wherein the target nucleic acid is expressed in a pharmacologically relevant tissue. In certain embodiments, the pharmacologically relevant tissue is a cell or tissue comprising the central nervous system (CNS). Such tissue includes the brain and spinal cord. In certain embodiments, the pharmacologically relevant tissue includes the cortex, substantia nigra, striatum including the caudate nucleus and putamen, globus pallidus, thalamus, cerebellum, amygdala, midbrain, and brainstem. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell comprises a neuron and a glial cell. In certain embodiments, the glial cell comprises an astrocyte, a microglial cell, and an oligodendrocyte.

[0346] V. Certain Methods and Uses Certain embodiments provided herein relate to methods for reducing or inhibiting the expression or activity of an HTT nucleic acid comprising SNP rs7685686, which may be useful for treating, preventing, or ameliorating Huntington's disease in a subject. In certain embodiments, the method comprises administering to the subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an HTT nucleic acid region comprising SNP rs7685686. In certain embodiments, the modified oligonucleotide, oligomeric duplex, or antisense agent targets SNP rs7685686. In certain embodiments, the subject has or is at risk of developing Huntington's disease. In certain embodiments, the subject has Huntington's disease.

[0347] In certain embodiments, a method for treating Huntington's disease comprises administering to a subject an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an HTT nucleic acid region containing SNP rs7685686. In certain embodiments, the modified oligonucleotide, oligomeric duplex, or antisense agent targets SNP rs7685686. In certain embodiments, the subject has or is at risk of developing Huntington's disease. In certain embodiments, the subject has Huntington's disease. In certain embodiments, at least one symptom or characteristic of Huntington's disease is ameliorated. In certain embodiments, the at least one symptom or characteristic is brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

[0348] In certain embodiments, a method for reducing the expression of an HTT nucleic acid containing SNP rs7685686, e.g., an HTT RNA containing SNP rs7685686, or a method for reducing the expression of mHTT protein in a cell, comprises contacting the cell with an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to an HTT nucleic acid region containing SNP rs7685686. In certain embodiments, the modified oligonucleotide, oligomeric duplex, or antisense agent targets SNP rs7685686. In certain embodiments, the subject has or is at risk of developing Huntington's disease. In certain embodiments, the subject has Huntington's disease. In certain embodiments, the cell is a brain cell. In certain embodiments, the cell is a neuron. In certain embodiments, the cell is a glial cell, e.g., an astrocyte, a microglial cell, or an oligodendrocyte. In certain embodiments, the cell is a human cell.

[0349] In certain embodiments, the present invention relates to an oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent having a nucleobase sequence complementary to a region of an HTT nucleic acid comprising SNP rs7685686 for use in the treatment of Huntington's disease or for use in the manufacture of a medicament for the treatment of Huntington's disease.

[0350] In any of the methods or uses described herein, the oligomeric compound, modified oligonucleotide, oligomeric duplex, or antisense agent may be any of those described herein.

[0351] VI. Certain Pharmaceutical Compositions In certain embodiments, described herein are pharmaceutical compositions comprising one or more oligomeric compounds. In certain embodiments, the one or more oligomeric compounds each comprise a modified oligonucleotide. In certain embodiments, the pharmaceutical composition comprises a pharmaceutically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition comprises or consists of sterile saline and one or more oligomeric compounds. In certain embodiments, the sterile saline is pharmaceutical-grade saline. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and sterile water. In certain embodiments, the sterile water is pharmaceutical-grade water. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and phosphate-buffered saline (PBS). In certain embodiments, the sterile PBS is pharmaceutical-grade PBS. In certain embodiments, the pharmaceutical composition comprises or consists of one or more oligomeric compounds and artificial cerebrospinal fluid ("artificial CSF" or "aCSF"). In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical-grade.

[0352] In certain embodiments, the pharmaceutical composition comprises a modified oligonucleotide and artificial cerebrospinal fluid (aCSF). In certain embodiments, the pharmaceutical composition consists of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the pharmaceutical composition consists essentially of the modified oligonucleotide and artificial cerebrospinal fluid. In certain embodiments, the artificial cerebrospinal fluid is pharmaceutical grade.

[0353] In certain embodiments, the aCSF comprises sodium chloride, potassium chloride, sodium dihydrogen phosphate dihydrate, disodium phosphate anhydrous, calcium chloride dihydrate, and magnesium chloride hexahydrate. In certain embodiments, the pH of the aCSF solution is adjusted to about 7.1-7.3, or about 7.2, with an appropriate pH adjuster, e.g., an acid such as hydrochloric acid and an alkali such as sodium hydroxide.

[0354] In certain embodiments, pharmaceutical compositions comprise one or more oligomeric compounds and one or more excipients, hi certain embodiments, the excipients are selected from water, saline, alcohol, polyethylene glycol, gelatin, lactose, amylase, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, and polyvinylpyrrolidone.

[0355] In certain embodiments, the oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The formulation and method of pharmaceutical compositions depends on several criteria, including, but not limited to, the route of administration, the extent of the disease, or the dosage.

[0356] In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts of the oligomeric compounds, esters of the oligomeric compounds, or salts of such esters. In certain embodiments, pharmaceutical compositions comprising oligomeric compounds comprising one or more oligonucleotides can provide (directly or indirectly) biologically active metabolites or residues thereof when administered to a subject, including a human. Thus, for example, the present disclosure also relates to pharmaceutically acceptable salts of oligomeric compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. In certain embodiments, pharmaceutically acceptable salts include inorganic salts, such as monovalent or divalent inorganic salts. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium, potassium, calcium, magnesium salts, and the like. In certain embodiments, the prodrugs include one or more conjugate groups attached to the oligonucleotide, where the conjugate groups are cleaved by endogenous nucleases in the body.

[0357] In certain embodiments, the oligomeric compound is lyophilized and isolated as a sodium salt. In certain embodiments, the sodium salt of the oligomeric compound is mixed with a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent comprises sterile saline, sterile water, PBS, or aCSF. In certain embodiments, the sodium salt of the oligomeric compound is mixed with PBS. In certain embodiments, the sodium salt of the oligomeric compound is mixed with aCSF.

[0358] Lipid moieties have been used in nucleic acid therapy in a variety of ways. In certain such methods, nucleic acids, such as oligomeric compounds, are introduced into preformed liposomes or lipoplexes made from a mixture of cationic and neutral lipids. In certain methods, DNA complexes are formed with monocationic or polycationic lipids in the absence of neutral lipids. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to specific cells or tissues. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to adipose tissue. In certain embodiments, lipid moieties are selected to increase the distribution of pharmaceuticals to muscle tissue.

[0359] In certain embodiments, the pharmaceutical composition comprises a delivery system. Examples of delivery systems include, but are not limited to, liposomes and emulsions. Certain delivery systems are useful for preparing certain pharmaceutical compositions, including those containing hydrophobic compounds. In certain embodiments, certain organic solvents, such as dimethyl sulfoxide, are used.

[0360] In certain embodiments, the pharmaceutical composition comprises one or more tissue-specific delivery molecules designed to deliver one or more pharmaceutical agents of the present invention to a specific tissue or cell type. For example, in certain embodiments, the pharmaceutical composition comprises a liposome coated with a tissue-specific antibody.

[0361] In certain embodiments, the pharmaceutical composition includes a cosolvent system. Such a cosolvent system may include, for example, benzyl alcohol, a nonpolar surfactant, a water-miscible organic polymer, and an aqueous phase. In certain embodiments, such a cosolvent system is used for hydrophobic compounds. A non-limiting example of such a cosolvent system is the VPD cosolvent system, which is a solution of 3% w / v benzyl alcohol, 8% w / v of the nonpolar surfactant Polysorbate 80™, and 65% w / v polyethylene glycol 300 in absolute ethanol. The proportions of such a cosolvent system can be varied significantly without significantly altering the solubility or toxicity characteristics. Furthermore, the types of cosolvent components can be varied, for example, by substituting other surfactants for Polysorbate 80™, varying the proportion of polyethylene glycol, substituting other biocompatible polymers such as polyvinylpyrrolidone for polyethylene glycol, or substituting other sugars or polysaccharides for dextrose.

[0362] In certain embodiments, the pharmaceutical composition is prepared for oral administration. In certain embodiments, the pharmaceutical composition is prepared for buccal administration. In certain embodiments, the pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, intrathecal (IT), intracerebroventricular (ICV), etc.). In certain such embodiments, the pharmaceutical composition includes a carrier and is formulated in an aqueous solution such as water, or a physiologically compatible buffer such as Hank's solution, Ringer's solution, or physiological saline buffer. In certain embodiments, other ingredients (e.g., ingredients that enhance solubility or act as preservatives) are also included. In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, etc. Certain injectable pharmaceutical compositions are provided in unit dosage form, e.g., in ampoules or multi-dose containers. Certain injectable pharmaceutical compositions are suspensions, solutions, or emulsions in oily or aqueous vehicles and may contain formulatory agents such as suspending agents, stabilizers, and / or dispersing agents. Certain vehicles suitable for use in injectable pharmaceutical compositions include, but are not limited to, lipophilic solvents and fatty oils (such as sesame oil), synthetic fatty acid esters (such as ethyl oleate or triglycerides), and liposomes.

[0363] Under certain conditions, certain compounds disclosed herein behave as acids. Such compounds may be depicted or described in a protonated (free acid) form or in an ionized, cationic (salt) form; however, aqueous solutions of such compounds exist in equilibrium between these forms. For example, the phosphodiester bond of an oligonucleotide in aqueous solution exists in equilibrium between the free acid, anionic, and salt forms. Unless otherwise specified, the compounds described herein are intended to include all such forms. Furthermore, a particular oligonucleotide may have multiple such bonds, each in equilibrium. Thus, an oligonucleotide in solution may exist in a collection of various forms at multiple locations, all in equilibrium. The term "oligonucleotide" is intended to encompass all such forms. Drawn structures necessarily represent a single form. However, unless otherwise specified, such drawings are intended to encompass corresponding forms as well. Herein, when a structure representing the free acid of a compound is followed by the term "or a pharmaceutically acceptable salt thereof," all forms, whether fully or partially protonated, deprotonated, cationic, or associated with a combination of cations, are expressly included. In certain embodiments, one or more specific cations are identified. Cations include, but are not limited to, sodium, potassium, calcium, and magnesium. In certain embodiments, when a structure representing the free acid of a compound is followed by the term "or a pharmaceutically acceptable salt thereof," all forms that may be fully or partially protonated / deprotonated / associated with one or more cations selected from sodium, potassium, calcium, and magnesium are expressly included.

[0364] In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with sodium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in an aqueous solution with potassium. In certain embodiments, the modified oligonucleotide or oligomeric compound is in PBS. In certain embodiments, the modified oligonucleotide or oligomeric compound is in water. In certain embodiments, the pH of the solution is adjusted with NaOH and / or HCl to achieve the desired pH.

[0365] Certain specific dosage amounts are described herein. Dosage amounts can be in the form of dosage units. For clarity, the milligram dosage (or dosage unit) of a modified oligonucleotide or oligomeric compound refers to the mass of the free acid form of the modified oligonucleotide or oligomeric compound. As mentioned above, in aqueous solution, the free acid is in equilibrium with the anion and salt form. However, for the purpose of calculating dosage amounts, the modified oligonucleotide or oligomeric compound is assumed to exist as a solvent-free, sodium acetate-free, anhydrous, free acid.

[0366] In certain embodiments, when a modified oligonucleotide or oligomeric compound is in a sodium-containing solution (e.g., saline), the modified oligonucleotide or oligomeric compound may be partially or completely deprotonated and associated with sodium ions. However, the mass of the protons counts toward the dose weight, while the mass of the sodium ions does not. Thus, for example, a 10 mg dose or dosage unit of Compound No. 1625897 corresponds to 10 mg of fully protonated molecules weighing 10 mg. This corresponds to 10.59 mg of solvent-free, sodium acetate-free, anhydrous sodium-containing Compound No. 1625897.

[0367] In certain embodiments, when a modified oligonucleotide or oligomeric compound is present in a solution containing sodium, potassium, calcium, and magnesium (such as aCSF), the modified oligonucleotide or oligomeric compound may be partially or fully deprotonated and associated with sodium, potassium, calcium, and / or magnesium, but the mass of the protons is counted in the dose weight, and the mass of the sodium, potassium, calcium, and magnesium ions is not counted in the dose weight.

[0368] In certain embodiments, when an oligomeric compound includes a conjugate group, the mass of the conjugate group may be included in calculating the dosage of such an oligomeric compound. If the conjugate group also contains an acid, it is assumed that the conjugate group is also fully protonated for the purposes of calculating the dosage.

[0369] VII. Certain Oligomeric Compounds In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, or at least 17 consecutive nucleobases of any of SEQ ID NOS: 14, 15, and 18-24. In certain such embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the oligomeric compound comprises a conjugate group. In certain embodiments, the oligomeric compound does not comprise a conjugate group. In certain embodiments, the oligomeric compound comprises a terminal group. In certain embodiments, the oligomeric compound does not comprise a terminal group.

[0370] In certain embodiments, oligomeric compounds disclosed herein comprise modified oligonucleotides consisting of 12 to 30 linked nucleosides, wherein the nucleobase sequence of the modified oligonucleotide comprises at least 12, at least 13, at least 14, at least 15, at least 16, or 17 consecutive nucleobases of 5'-ATTGTCATCACCAGAAA-3' (SEQ ID NO: 14). In certain embodiments, the modified oligonucleotide comprises at least one modification selected from a modified sugar moiety and a modified internucleoside linkage. In certain embodiments, the modified sugar moiety is a non-bicyclic modified sugar moiety selected from a 2'-MOE sugar moiety, a 2'-OMe sugar moiety, a cEt sugar moiety, and a 2'-α-L-deoxyribosyl sugar moiety. In certain embodiments, the modified internucleoside linkage is selected from a phosphorothioate internucleoside linkage and a mesylphosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of the modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of modified oligonucleotide is modified nucleobase.In certain embodiments, oligomeric compound comprises conjugate group.In certain embodiments, oligomeric compound does not have conjugate group.In certain embodiments, oligomeric compound comprises terminal group.In certain embodiments, oligomeric compound does not have terminal group.

[0371] In certain embodiments, a modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 14. In certain embodiments, a modified oligonucleotide has a modified sugar motif of (5' to 3', a) ekddddddddeeekeke, where each "e" is a 2'-MOE sugar moiety, each "k" is a cEt sugar moiety, and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, a modified oligonucleotide comprises a modified internucleoside linkage selected from a phosphorothioate internucleoside linkage and a mesylphosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of a modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of a modified oligonucleotide is a 5-methylcytosine.

[0372] In certain embodiments, a modified oligonucleotide has a nucleobase sequence of SEQ ID NO: 14. In certain embodiments, a modified oligonucleotide has a modified sugar motif of (5' to 3', a) ekddddddddeeekeke, where each "e" is a 2'-MOE sugar moiety, each "k" is a cEt sugar moiety, and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, a modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') sszzsssssssssoss, where each "s" is a phosphorothioate internucleoside linkage, each "o" is a phosphodiester internucleoside linkage, and each "z" is a mesylphosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.

[0373] In certain embodiments, a modified oligonucleotide has the nucleobase sequence of SEQ ID NO: 14. In certain embodiments, a modified oligonucleotide has a modified sugar motif of (5' to 3', a) ekddddddddeeekeke, where each "e" is a 2'-MOE sugar moiety, each "k" is a cEt sugar moiety, and each "d" is a 2'-β-D-deoxyribosyl sugar moiety. In certain embodiments, a modified oligonucleotide has a modified internucleoside linkage motif of (5' to 3') sssssssssszzzss, where each "s" is a phosphorothioate internucleoside linkage and each "z" is a mesylphosphoramidate internucleoside linkage. In certain embodiments, each nucleobase of a modified oligonucleotide is an unmodified nucleobase. In certain embodiments, at least one nucleobase of a modified oligonucleotide is a modified nucleobase. In certain embodiments, at least one cytosine of the modified oligonucleotide is a modified cytosine. In certain embodiments, each cytosine of the modified oligonucleotide is a 5-methylcytosine.

[0374] In certain embodiments, the oligomeric compounds disclosed herein have the following chemical notation: N 1 es T ks T dz G dz T ds m C ds A ds T ds m C ds A ds m C es m C es A es G ko A es A ks N 2 e (SEQ ID NO: 27), wherein A = adenine nucleobase, mC=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, N 1 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 2 If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group. 1 and N 2 are each independently an adenine nucleobase. 1 and N 2 are each independently an unmodified adenine. 1 and N 2 are each independently a modified adenine. 1 and N 2 are each independently hypoxanthine. 1 and N 2 are each independently an abasic sugar moiety. 1 and N 2 are each independently a terminal group. 1 and N 2 are each independently absent. 1 is an adenine nucleobase, and N 2is an unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is an unmodified adenine. 1 is an adenine nucleobase, and N 2 is hypoxanthine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. 1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is an unmodified adenine, and N 2 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an unmodified adenine. 1 is an unmodified adenine, and N 2 is hypoxanthine. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an abasic sugar moiety. 1 is an unmodified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is an unmodified adenine, and N 2 is absent. In certain embodiments, N 1 is hypoxanthine, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2is an adenine nucleobase. In certain embodiments, N 1 is hypoxanthine, and N 2 is an unmodified adenine. 1 is hypoxanthine, and N 2 is hypoxanthine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 does not exist.

[0375] In certain embodiments, the oligomeric compounds disclosed herein have the following chemical notation: N 1 es T ks T ds G ds T ds m C ds A ds T ds m C ds A ds m C es m C ez Aez G kz A es A ks N 2 e (SEQ ID NO: 28), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, N 1 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 1 is absent, then the sugar and internucleoside linkage are also absent, N 2 = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent, N 2 If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group. 1 and N 2 are each independently an adenine nucleobase. 1 and N 2 are each independently an unmodified adenine. 1 and N 2 are each independently a modified adenine. 1 and N 2 are each independently hypoxanthine. 1 and N 2 are each independently an abasic sugar moiety. 1 and N 2are each independently a terminal group. 1 and N 2 are each independently absent. 1 is an adenine nucleobase, and N 2 is an unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is an adenine nucleobase, and N 2 is an unmodified adenine. 1 is an adenine nucleobase, and N 2 is hypoxanthine. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is an abasic sugar moiety. 1 is an adenine nucleobase, and N 2 is a terminal group. In certain embodiments, N 1 is an adenine nucleobase, and N 2 is absent. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is an unmodified adenine, and N 2 is an adenine nucleobase. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an unmodified adenine. 1 is an unmodified adenine, and N 2 is hypoxanthine. In certain embodiments, N 1 is an unmodified adenine, and N 2 is an abasic sugar moiety. 1 is an unmodified adenine, and N 2 is a terminal group. In certain embodiments, N 1 is an unmodified adenine, and N 2 is absent. In certain embodiments, N1 is hypoxanthine, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is hypoxanthine, and N 2 is an adenine nucleobase. In certain embodiments, N 1 is hypoxanthine, and N 2 is an unmodified adenine. 1 is hypoxanthine, and N 2 is hypoxanthine. In certain embodiments, N 1 is hypoxanthine, and N 2 is an abasic sugar moiety. 1 is hypoxanthine, and N 2 is a terminal group. In certain embodiments, N 1 is hypoxanthine, and N 2 is absent. In certain embodiments, N 1 is the abasic sugar moiety, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 is the terminal group, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent. 1 does not exist, and N 2 does not exist.

[0376] VIII. Certain Compositions 1. Compound No. 1625961 Compound No. 1625961 is characterized as a mixed cEt / MOE gapmer of linked nucleosides having the nucleobase sequence (5' to 3') of ATTGTCATCACCAGAAA (SEQ ID NO: 14), wherein nucleosides 1, 11-13, 15, and 17 (5' to 3') are each 2'-MOE nucleosides, nucleosides 2, 14, and 16 are each cEt nucleosides, and nucleosides 3-10 are each 2'-β-D-deoxynucleosides; The internucleoside linkages between nucleosides 3 and 4 and 4 and 5 are mesylphosphoramidate internucleoside linkages, the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 12 and 13, 13 and 14, 15 and 16, and 16 and 17 are phosphorothioate internucleoside linkages, the internucleoside linkage between nucleosides 14 and 15 is a phosphodiester internucleoside linkage, and each cytosine is a 5-methylcytosine.

[0377] Compound number 1625961 is represented by the following chemical notation: A es T ks T dz G dz T ds m C ds A ds T ds m C ds A ds m C es m C es A es G ko A es A ks A e (SEQ ID NO: 25), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage and the compound does not contain a conjugate group or a terminal group.

[0378] Compound number 1625961 has the following chemical structure: [ka] (SEQ ID NO: 25) (Structure 1), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of compound number 1625961 contain one or more cations selected from sodium, potassium, calcium, and magnesium.

[0379] The sodium salt of compound number 1625961 has the following chemical structure: [ka] (SEQ ID NO: 25) (Structure 2).

[0380] 2. Compound No. 1637229 Compound No. 1637229 is characterized as a mixed cEt / MOE gapmer of linked nucleosides having the nucleobase sequence (5' to 3') of ATTGTCATCACCAGAAA (SEQ ID NO: 14), wherein nucleosides 1, 11-13, 15, and 17 (5' to 3') are each 2'-MOE nucleosides, nucleosides 2, 14, and 16 are each cEt nucleosides, and nucleosides 3-10 are each 2'-β-D -deoxynucleosides, the internucleoside linkages between nucleosides 12 and 13, 13 and 14, and 14 and 15 are mesylphosphoramidate internucleoside linkages, the internucleoside linkages between nucleosides 1 and 2, 2 and 3, 3 and 4, 4 and 5, 5 and 6, 6 and 7, 7 and 8, 8 and 9, 9 and 10, 10 and 11, 11 and 12, 15 and 16, and 16 and 17 are phosphorothioate internucleoside linkages, and each cytosine is a 5-methylcytosine.

[0381] Compound number 1637229 is represented by the following chemical notation: A es T ks T ds G ds T ds m C ds A ds T ds m C ds A ds m C es m C ez A ez G kz A es A ks A e (SEQ ID NO: 26), wherein A = adenine nucleobase, m C=5-methylcytosine nucleobase, G = guanine nucleobase; T=thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2'-β-D-deoxyribosyl sugar moiety, s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and the compound does not contain a conjugate group or a terminal group.

[0382] Compound number 1637229 has the following chemical structure: [ka] (SEQ ID NO: 26) (Structure 3), or a pharmaceutically acceptable salt thereof. Pharmaceutically acceptable salts of Compound No. 1637229 contain one or more cations selected from sodium, potassium, calcium, and magnesium.

[0383] The sodium salt of compound number 1637229 has the following chemical structure: [ka] (SEQ ID NO: 26) (Structure 4).

[0384] IX. Certain Comparative Compositions In certain embodiments, Compound No. 623208 is a comparative compound and was previously described in WO 2014 / 121287. Compound No. 623208 consists of the nucleobase sequence (5' to 3'): TTGTCATCACCAGAA, and is designated herein as SEQ ID NO: 15. The sugar motif of Compound No. 623208 is (5' to 3'): kddddddddkeekk, where each "k" represents a cEt sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif of Compound No. 623208 is (5' to 3'): sssssssssssoss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 623208 is a 5-methylcytosine.

[0385] Compound No. 623236 is a comparative compound and was previously described in WO 2014 / 121287. Compound No. 623236 consists of the nucleobase sequence (5' to 3'): ATTGTCATCACCAGAAA, and is designated herein as SEQ ID NO: 14. The sugar motif of Compound No. 623236 is (5' to 3'): ekdddddddddeeekeke, where each "k" represents a cEt sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motif of compound No. 623236 is (5' to 3'): sssssssssssssooss, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase of compound No. 623236 is a 5-methylcytosine.

[0386] Compound No. 443139 is a comparative compound and was previously described in WO 2011 / 032045. Compound No. 443139 consists of the nucleobase sequence (5' to 3'): CTCAGTAACATTGACACCAC and is designated herein as SEQ ID NO: 16. The sugar motif of Compound No. 443139 is (5' to 3'): eeeeeddddddddddeeeee, where each "d" represents a 2'-β-D-deoxyribosyl sugar moiety and each "e" represents a 2'-MOE sugar moiety. The internucleoside linkage motif of Compound No. 443139 is (5' to 3'): sooosssssssssssooos, where each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage. Each cytosine nucleobase in compound number 443139 is a 5-methylcytosine.

[0387] In certain embodiments, the compounds described herein are superior to the compounds described in WO 2014 / 121287 and WO 2011 / 032045 because they exhibit one or more improved properties, such as tolerability, selectivity, and duration of action.

[0388] For example, Compound No. 1625961 and Compound No. 1637229 were each better tolerated in vivo compared to Compound No. 623208 in the assay shown in Example 4. In particular, rats treated with Compound No. 1625961 had a Functional Observation Battery (FOB) score of 2.33, while rats treated with Compound No. 1637229 had an FOB score of 3. In comparison, rats administered Compound No. 623208 had an FOB score range of 3.75 to 4. Thus, Compound No. 1625961 and Compound No. 1637229 were each shown to be better tolerated compared to Compound No. 623208 in this assay.

[0389] For example, Compound No. 1625961 and Compound No. 1637229 each demonstrated a longer duration of action in vivo compared to Compound No. 443139 in the assay described in Example 7. In particular, Compound No. 1625961 and Compound No. 1637229 reduced human HTT RNA in the cortex by 35% and 22%, respectively, at 141 days post-administration. In comparison, Compound No. 443139 reduced human HTT RNA in the cortex by 17% at 84 days post-administration. Thus, in this assay, Compound No. 1625961 and Compound No. 1637229 each demonstrated a longer duration of action compared to Compound No. 443139.

[0390] For example, Compound No. 1625961 and Compound No. 1637229 each exhibited greater selectivity for SNP rs7685686 over the HTT wild-type allele in vitro compared to Compound No. 623236 in the assay described in Example 9. In particular, Compound No. 1625961 and Compound No. 1637229 have selectivity values ​​of >73 and >46, respectively. In comparison, Compound No. 623236 has a selectivity value of greater than 43. Thus, in this assay, Compound No. 1625961 and Compound No. 1637229 are more selective for SNP rs7685686 over the HTT wild-type allele compared to Compound No. 623236.

[0391] Non-Limiting Disclosure and Incorporation by Reference Each of the references and patent publications mentioned herein is incorporated by reference in its entirety.

[0392] While certain compounds, compositions, and methods described herein are specifically described according to certain embodiments, the following examples are intended only to illustrate the compounds described herein and are not intended to limit the compounds. Each reference, GenBank accession number, ENSEMBL identifier, etc. cited in this application is incorporated herein by reference in its entirety.

[0393] Although the sequence listing accompanying this application identifies each nucleic acid sequence as "RNA" or "DNA" as appropriate, those of skill in the art will readily understand that the designation "RNA" or "DNA" to describe modified oligonucleotides is, in some cases, arbitrary. For example, an oligonucleotide containing a nucleoside having a 2'-OH sugar moiety and a thymine base can be described as a DNA with a modified sugar (2'-OH instead of a single 2'-H in DNA) or as an RNA with a modified base (thymine (5-methyluracil) instead of uracil in RNA), and certain nucleic acid compounds described herein contain one or more nucleosides containing a modified sugar moiety having 2'-substituent(s) that are neither OH nor H. Those of skill in the art will readily understand that labeling such nucleic acid compounds as "RNA" or "DNA" does not alter or limit the description of such nucleic acid compounds.

[0394] Herein, when a compound is described as "having the nucleobase sequence of a SEQ ID NO," only the nucleobase sequence is described. Thus, unless otherwise specified, the description of a compound referring to the nucleobase sequence of a SEQ ID NO does not limit the presence or absence of additional substituents such as sugar or internucleoside linkage modifications or conjugate groups. Furthermore, unless otherwise specified, the nucleobase of a compound "having the nucleobase sequence" of a SEQ ID NO includes compounds having modified forms of the specific nucleobases described herein.

[0395] As used herein, when a compound is described by chemical notation (subscripts and / or superscripts indicating chemical modifications) without reference to a specific compound number, it includes only each modification described, but may include additional substituents such as conjugate groups unless otherwise specified. For example, "A es T ko m C ez G ds C d " indicates a nucleotide sequence in which a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked via a phosphorothioate bond to a second nucleoside, which second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked via a phosphodiester bond to a third nucleoside, which third nucleoside comprises a 2'-MOE sugar moiety and a mesylphosphoramidate linkage (denoted by the subscript "o"). and a 5-methyl-modified cytosine nucleobase (denoted by the superscript "m") linked via a phosphorothioate linkage to a fourth nucleoside (denoted by the letter "z"), the fourth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety (denoted by the subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate linkage, and the fifth nucleoside comprising a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and which compounds may include additional substituents such as conjugate groups.

[0396] As used herein, when a particular compound (e.g., see Compound Number) is described by chemical notation (as in the Examples), each nucleobase, sugar, and internucleoside linkage of such particular compound is modified only as shown. Thus, in the context of describing a particular compound having a particular Compound Number, "A es T ko m C ez G ds C d" refers to a chemical notation in which a first nucleoside comprises a 2'-MOE sugar moiety (denoted by the subscript "e") and an unmodified adenine nucleobase (denoted by the subscript "s") linked via a phosphorothioate bond to a second nucleoside, which second nucleoside comprises a cEt sugar moiety (denoted by the subscript "k") and an unmodified thymine nucleobase (denoted by the subscript "o") linked via a phosphodiester bond to a third nucleoside, which third nucleoside comprises a 2'-MOE sugar moiety and a mesylphosphoramidate bond. and a 5-methyl-modified cytosine nucleobase (denoted by superscript "m") linked to a fourth nucleoside via a phosphorothioate bond (denoted by subscript "z"), wherein the fourth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety (denoted by subscript "d") and an unmodified guanine nucleobase linked to the fifth nucleoside by a phosphorothioate bond, and wherein the fifth nucleoside comprises a 2'-β-D-deoxyribosyl sugar moiety and an unmodified cytosine nucleobase, and wherein the compound does not include any additional substituents.

[0397] As used herein, sugar, internucleoside linkage, and nucleobase modifications may be indicated within the nucleotide or nucleobase sequence (e.g., in superscript or subscript, as described above) or may be indicated in text accompanying the sequence (e.g., in separate text displayed above or below in a table of compounds).

[0398] Where a particular compound is described herein by a depicted chemical structure, each nucleobase, sugar, and internucleoside linkage of such particular compound contains only the modifications shown in the depicted chemical structure. However, one of ordinary skill in the art will understand that the depicted compound may exist in equilibrium between tautomers and / or as a salt in equilibrium with a protonated or ionic form. The depicted structure is intended to capture all forms of such compounds.

[0399] While every effort has been made to accurately describe the compounds in the attached Sequence Listing, in the event of any discrepancy between the description in this specification and the description in the attached Sequence Listing, the description in this specification, and not the Sequence Listing, shall prevail.

[0400] The compounds described herein include variations in which one or more atoms are replaced with non-radioactive or radioactive isotopes of the indicated elements. For example, compounds containing hydrogen atoms as described herein include 1 Isotopic substitutions encompassed in the compounds herein include all possible deuterium substitutions for each H hydrogen atom. 1 Instead of H 2 H or 3 H, 12 Instead of C 13 C or 14 C. 14 Instead of N 15 N, 16 Instead of O 17 O or 18 O, and 32 Instead of S 33 S, 34 S, 35 S, or 36 These include, but are not limited to, S. In certain embodiments, non-radioactive isotope substitution can confer new properties to oligomeric compounds, making them useful as therapeutic or research tools. In certain embodiments, radioactive isotope substitution can make compounds suitable for research or diagnostic purposes, such as imaging. [Example]

[0401] The following examples illustrate certain specific embodiments of the present disclosure, but are not limiting thereof. Furthermore, where specific embodiments are provided, the inventors contemplate the general applicability of those specific embodiments.

[0402] Example 1: Design of modified oligonucleotides complementary to and selective for human HTT SNP rs7685686 Modified oligonucleotides complementary to human HTT RNA were designed.

[0403] The sugar motifs of modified oligonucleotides are shown in the "Sugar Motif (5' to 3')" column of the table below, where each "k" represents a cEt sugar moiety, each "y" represents a 2'-OMe sugar moiety, each "e" represents a 2'-MOE sugar moiety, each [aLd] represents a 2'-α-L-deoxyribosyl sugar moiety, and each "d" represents a 2'-β-D-deoxyribosyl sugar moiety. The internucleoside linkage motifs of modified oligonucleotides are shown in the "Internucleoside Linkage (5' to 3')" column of the table below, where each "s" represents a phosphorothioate internucleoside linkage, each "z" represents a mesylphosphoramidate internucleoside linkage, and each "o" represents a phosphodiester internucleoside linkage. Each cytosine residue is a 5-methylcytosine.

[0404] "Start site" indicates the 5'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. "Stop site" indicates the 3'-most nucleoside in the target nucleic acid sequence to which the modified oligonucleotide is complementary. Each modified oligonucleotide listed in the table below has the sequence set forth in SEQ ID NO: 1 (GenBank Accession No. NT_006081.18, truncated from nucleotide 1566000 to 1768000).

[0405] Compound No. 387916 was previously disclosed in WO / 2007 / 089611. Compound Nos. 623205, 623206, 623235, 623236, 623208, 623242, 623243, and 572772 were previously disclosed in WO / 2014 / 121287. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 2]

[0406] Example 2: In vitro effects of modified oligonucleotides on human HTT RNA Modified oligonucleotides designed to target SNP rs7685686 as previously described were tested for allele-specific activity in GM04022 fibroblasts.

[0407] GM04022 fibroblasts obtained from the NIGMS Human Gene and Cell Repository at the Coriell Institute for Medical Research were treated with modified oligonucleotides at concentrations of 15,000 nM, 3750 nM, 937 nM, 234 nM, and 58.6 nM by electroporation at a density of 35,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and HTT RNA levels were measured by quantitative real-time RT-PCR.

[0408] GM04022 fibroblasts are heterozygous for both G and A nucleotides at SNP rs7685686. The knockdown levels of both the A and G alleles correlated with the levels of the two alleles at the second mutation site (SNP rs362303) in GM04022 fibroblasts. Specifically, the G allele of SNP rs7685686 correlated with the A allele of SNP rs362303. The A allele of SNP rs7685686 correlated with the G allele of SNP rs362303. Therefore, the knockdown levels of both the A and G alleles of SNP rs7685686 were quantified based on the levels of the two alleles of SNP rs362303 using the C_2229297_10 assay (Thermo Fisher Scientific).

[0409] The C_2229297_10 assay uses two different fluorophores to simultaneously measure the levels of both alleles of SNP rs7685686 relative to the allele of SNP rs362303: 6-carboxyfluorescein (FAM) measures the level of the A allele of SNP rs362303 (corresponding to the G allele of SNP rs7685686), and VIC® measures the level of the G allele of SNP rs362303 (corresponding to the A allele of SNP rs7685686). HTT levels were normalized to total RNA or to human GAPDH expression levels measured by quantitative RT-PCR using human primer probe set RTS104 (forward sequence GAAGGTGAAGGTCGGAGTC (herein designated as SEQ ID NO:2), reverse sequence GAAGATGGTGATGGATTTC (herein designated as SEQ ID NO:3), probe sequence CAAGCTTCCCGTTCTCAGCC (herein designated as SEQ ID NO:4)). IC50 values ​​were calculated using GraphPad Prism. Furthermore, the above modified oligonucleotides cross-react with human BMPR1. The effect of the modified oligonucleotides on BMPR1 levels was measured using human primer probe set RTS2623 (forward sequence CACTGCCCCCTGTTGTCATA (herein designated as SEQ ID NO:5), reverse sequence GAGCAAAACCAGCCATCGA (herein designated as SEQ ID NO:6), probe sequence TCCGTTTTTTGATGGCAGCA (herein designated as SEQ ID NO:7)).

[0410] The selectivity of modified oligonucleotides for the A allele relative to the G allele of SNP rs7685686 was measured by dividing the IC50 measured with the FAM fluorophore by the IC50 measured with the VIC fluorophore. The selectivity of modified oligonucleotides for the A allele of SNP rs7685686 for BMPR1 was measured by dividing the IC50 measured with the RTS2623 fluorophore by the IC50 measured with the VIC fluorophore. [Table 3-1] [Table 3-2] [Table 3-3] [Table 4]

[0411] Example 3: Tolerance of modified oligonucleotides in wild-type mice, 3-hour study The modified oligonucleotides described above were tested in wild-type female C57BL / 6 mice to assess their tolerability. Wild-type female C57BL / 6 mice each received a single ICV injection of 700 μg of the modified oligonucleotide. Unless otherwise noted in the table below, each treatment group consisted of four mice. In each experiment, a group of four mice received PBS as a negative control. Each experiment is identified in a separate table below. Three hours after injection, mice were evaluated according to seven different criteria: (1) the mice were bright, alert, and responsive; (2) the mice were standing or curled up without stimulation; (3) the mice showed any movement without stimulation; (4) the mice moved forward after being lifted; (5) the mice showed any movement after being lifted; (6) the mice responded to a tail pinch; and (7) the mice were breathing regularly. For each of the seven criteria, mice were given a subscore of 0 if they met the criterion and a subscore of 1 if they did not (Functional Observation Battery score or FOB). After assessing all seven criteria, the scores for each mouse were summed and averaged within each treatment group. The results are shown in the table below. [Table 5] [Table 6] [Table 7] [Table 8]

[0412] Example 4: Tolerance of modified oligonucleotides in rats, 3-hour study The modified oligonucleotides described above were tested in rats to assess their tolerability. Sprague-Dawley rats each received a single intraspinal (IT) dose of 3 mg of modified oligonucleotide. Unless otherwise noted in the table below, each treatment group consisted of four to six rats. A group of four rats received PBS as a negative control. Each experiment is identified in a separate table below. Three hours after injection, movement of seven different body parts of each rat was assessed. The seven body parts were: (1) rat tail, (2) rat rear posture, (3) rat hind limbs, (4) rat hind paws, (5) rat front paws, (6) rat front posture, and (7) rat head. For each of the seven different body parts of each rat, a subscore of 0 was given if the body part was moving, and a subscore of 1 was given if the body part was paralyzed (Functional Observation Battery Score or FOB). For each of the seven criteria, a subscore of 0 was given if the rat met the criterion, and a subscore of 1 was given if the rat did not meet the criterion (Functional Observation Battery Score or FOB). After all seven criteria were assessed, the scores for each rat were summed and averaged within each treatment group, and the results are shown in the table below. [Table 9] [Table 10] [Table 11] [Table 12]

[0413] Example 5: Efficacy of modified oligonucleotides in BACHD mice expressing SNP rs7685686, 2 weeks Transgenic mice expressing human HTT containing SNP rs7685686 (The Jackson Laboratory, stock number: 008197) were used to test the activity of the modified oligonucleotides described above.

[0414] process HTT transgenic mice were divided into groups of 3. Each mouse received a single ICV bolus of modified oligonucleotide at the doses shown in the table below. A group of 4 mice received a single ICV bolus with PBS as a negative control.

[0415] RNA analysis Two weeks after treatment, mice were sacrificed, and RNA was extracted from the cortical brain tissue and spinal cord for RT-PCR analysis. The amount of HTT RNA was measured using human primer probe set RTS2617 (forward sequence CTCCGTCCGGTAGACATGCT (designated herein as SEQ ID NO: 8), reverse sequence GGAAATCAGAACCCTCAAAATGG (designated herein as SEQ ID NO: 9), probe sequence TGAGCACTGTTCAACTGTGGATATCGGGA (designated herein as SEQ ID NO: 10)). Results are presented as the percent of human HTT RNA relative to the amount of HTT in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using primer probe set m_cyclo24 (forward sequence TCGCCTGCTGCA (designated herein as SEQ ID NO: 11), reverse sequence ATCGGCCGTGATGTTCGA (designated herein as SEQ ID NO: 12), probe sequence CCATGGTCAACCCCACCGTGTTC (designated herein as SEQ ID NO: 13)).

[0416] The half-maximal effective dose (ED) of each modified oligonucleotide 50 ) was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). [Table 13-1] [Table 13-2]

[0417] Example 6: Efficacy of modified oligonucleotides in BACHD mice expressing SNP rs7685686, 4 weeks Transgenic mice expressing human HTT containing SNP rs7685686 (described above) were used to test the activity of the modified oligonucleotides described above.

[0418] process HTT transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of modified oligonucleotide at the dose shown in the table below. A group of four mice received a single ICV bolus with PBS as a negative control.

[0419] RNA analysis After 4 weeks of treatment, mice were sacrificed, RNA was extracted from cortical brain tissue and spinal cord, and HTT RNA levels were measured by RT-PCR analysis using human primer probe set RTS2617 (described above). Results are shown as the percentage of human HTT RNA relative to the amount of HTT in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using primer probe set m_cyclo24 (described above).

[0420] The half-maximal effective dose (ED) of each modified oligonucleotide 50 ) was calculated using GraphPad Prism 7 software (GraphPad Software, San Diego, CA). [Table 14]

[0421] Example 7: Duration of Action Study of Modified Oligonucleotides in BACHD Mice Containing SNP rs7685686, Single Dose The above modified oligonucleotides were tested in HTT transgenic mice (described above).

[0422] HTT transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 200 or 300 μg of modified oligonucleotide as shown in the table below. Groups of two to four mice received a single ICV bolus with PBS as a negative control.

[0423] Mice were sacrificed at various time points as shown in the table below, and RNA was extracted from cortical brain tissue, spinal cord, striatum, and hippocampus. HTT RNA levels were measured by RT-PCR analysis using human primer probe set RTS2617 (described above). Results are shown as the percentage of human HTT RNA relative to HTT levels in PBS-treated control animals and normalized to mouse cyclophilin A (% control). Mouse PPIA was amplified using primer probe set m_cyclo24 (described above).

[0424] Compound 443139 is a comparative compound and has been previously described in WO 2011 / 032045. [Table 15-1] [Table 15-2] [Table 15-3] [Table 16]

[0425] Example 8: Duration of Action Study of Selected Modified Oligonucleotides in BACHD Mice Containing SNP rs7685686, Single Dose Modified oligonucleotides, including the following compound numbers 1625961, 1637229, and 623236, have been tested in HTT transgenic mice (described above).

[0426] HTT transgenic mice were divided into groups of four. Each mouse received a single ICV bolus of 200 or 300 μg of modified oligonucleotide. Groups of two to four mice received a single ICV bolus with PBS as a negative control.

[0427] Mice were sacrificed at various time points, and RNA was extracted from the cortical brain tissue, spinal cord, striatum, and hippocampus. HTT RNA levels were measured by RT-PCR analysis using the human primer probe set RTS2617 (described above). Results are shown as the percentage of human HTT RNA relative to the amount of HTT in PBS-treated control animals and normalized to mouse PPIA (% control). Mouse PPIA was amplified using the primer probe set m_cyclo24 (described above).

[0428] Example 9: In vitro effects of modified oligonucleotides on human HTT RNA Modified oligonucleotides designed to target SNP rs7685686 as previously described were tested for allele-specific activity in GM04022 fibroblasts.

[0429] GM04022 fibroblasts (described above) were electroporated at a density of 35,000 per well with modified oligonucleotides in a 10-point dose response ranging from 0.005 to 20 µM. After a treatment period of approximately 24 h, total RNA was isolated from the cells and HTT RNA levels were measured by quantitative real-time RT-PCR.

[0430] The C_2229297_10 assay (described above) was used to measure the levels of the A allele of SNP rs362303 (corresponding to the G allele of SNP rs7685686) and the G allele of SNP rs362303 (corresponding to the A allele of SNP rs7685686). HTT levels were normalized to human GAPDH expression levels measured by quantitative RT-PCR using total RNA or human primer probe set RTS104 (described above). IC 50 Values ​​were calculated using GraphPad Prism (San Diego, CA).

[0431] Selectivity of modified oligonucleotides for the A allele versus the G allele of SNP rs7685686 was measured with FAM fluorophores using IC 50 IC values ​​measured with VIC phosphor 50 was determined by dividing by the value. [Table 17]

Claims

1. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 25): 【Chemistry 1】 or a pharmaceutically acceptable salt thereof.

2. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 26): 【Chemistry 2】 or a pharmaceutically acceptable salt thereof.

3. 3. The modified oligonucleotide of claim 1 or claim 2, which is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

4. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 25): 【Transformation 3】

5. A modified oligonucleotide according to the following chemical structure (SEQ ID NO: 26): 【Chemistry 4】

6. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: A ｅｓ T ｋｓ T ｄｚ G ｄｚ T ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ ｍ C ｅｓ ｍ C ｅｓ A ｅｓ G ｋｏ A ｅｓ A ｋｓ A ｅ (SEQ ID NO: 25), wherein: A = adenine nucleobase; ｍ C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.

7. An oligomeric compound comprising a modified oligonucleotide according to the following chemical notation: A ｅｓ T ｋｓ T ｄｓ G ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ ｍ C ｅｓ ｍ C ｅｚ A ｅｚ G ｋｚ A ｅｓ A ｋｓ A ｅ (SEQ ID NO: 26), wherein: A = adenine nucleobase; ｍ C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group or a terminal group.

8. 8. The oligomeric compound of claim 6 or claim 7, wherein the modified oligonucleotide is a pharmaceutically acceptable salt.

9. 9. The oligomeric compound of claim 8, wherein the modified oligonucleotide is a pharmaceutically acceptable salt comprising one or more cations selected from sodium, potassium, calcium, and magnesium.

10. A population of modified oligonucleotides according to any one of claims 1 to 5, or a population of oligomeric compounds according to any one of claims 6 to 9, wherein all of the phosphorothioate internucleoside linkages of the modified oligonucleotides are stereorandom.

11. A population of modified oligonucleotides according to any one of claims 1 to 5, or a population of oligomeric compounds according to any one of claims 6 to 9, wherein the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotides are all stereorandom.

12. A pharmaceutical composition comprising a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, a population of modified oligonucleotides according to claim 10 or 11, or a population of oligomeric compounds according to claim 10 or 11, and a pharmaceutically acceptable diluent.

13. 13. The pharmaceutical composition of claim 12, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

14. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, a population of modified oligonucleotides according to claim 10 or 11, or a population of oligomeric compounds according to claim 10 or 11, and aCSF.

15. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition consists essentially of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, a population of modified oligonucleotides according to claim 10 or 11, or a population of oligomeric compounds according to claim 10 or 11, and PBS.

16. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition consists of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, a population of modified oligonucleotides according to claim 10 or 11, or a population of oligomeric compounds according to claim 10 or 11, and aCSF.

17. The pharmaceutical composition of claim 12, wherein the pharmaceutical composition consists of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, a population of modified oligonucleotides according to claim 10 or 11, or a population of oligomeric compounds according to claim 10 or 11, and PBS.

18. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having nucleobases complementary to huntingtin (HTT) SNP rs7685686, wherein at least one internucleoside linkage of said modified oligonucleotide is a mesylphosphoramidate internucleoside linkage.

19. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase sequence comprising the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 21 and 24, wherein said modified oligonucleotide is 5'-sssssssssssoosss-3', 5'-ssssssssssssoosss-3', 5'-sssssssssssssoo ...sooss-3', 5'-ssssssssssssssooss-3', 5'-ssssssssssssssooss-3', 5'-ssssssssssssss 1. An oligomeric compound comprising an internucleoside linkage motif selected from 5'-ssssssssssssss-3', 5'-ssssssssssssss-3', 5'-sssoosssssssss-3', 5'-sssoosssssssss-3' and 5'-sssssssssssss-3', wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

20. 20. The oligomeric compound of claim 18, wherein the modified oligonucleotide comprises one or more internucleoside linkages selected from phosphorothioate internucleoside linkages and phosphodiester internucleoside linkages.

21. The modified oligonucleotides are 5'-sssssssssszzzzss-3', 5'-szzsssssssssssssss-3', 5'-zssssssssssssosss-3', 5'-zsssss sssssssszz-3', 5'-sszzssssssssssss-3', 5'-zzssssssssssssssssssss-3', 5'-zsssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssssss3'-3'-3'-sssssssss ssszzzss-3', 5'-ssssssssssssss-3', 5'-sszzssssssssss-3', 5'-zzsssssssssssss-3', 5'-zsssssssssssss sz-3', 5'-sssssszzsssssss-3', 5'-ssszzsssssssss-3', 5'-sssssssssssssss-3', 5'-ssssszzssssssss-3', 5'-ssssszzsszssssss-3', 5'-ssszsszssssssss-3', 5'- ssszszzssssssss-3', 5'-sszzsszssssssss-3', 5'-ssz zszzssssssss-3', 5'-ssszszszsssssss-3', 5'-sszszs zssssssss-3', 5'-sssssssssszss-3', 5'-szzsssssss 21. The oligomeric compound of claim 18 or claim 20, comprising an internucleoside linkage motif selected from 5'-ssss-3', 5'-zsssssssssssss-3' and 5'-zssssssssssssz-3', wherein each "s" represents a phosphorothioate internucleoside linkage, each "o" represents a phosphodiester internucleoside linkage, and each "z" represents a mesylphosphoramidate internucleoside linkage.

22. 22. The oligomeric compound of any one of claims 18 to 21, wherein at least one nucleoside of said modified oligonucleotide is a modified nucleoside.

23. 23. The oligomeric compound of claim 22, wherein the modified nucleoside comprises a modified sugar moiety.

24. 24. The oligomeric compound of claim 23, wherein the modified sugar moiety comprises a bicyclic sugar moiety.

25. The bicyclic sugar moiety is —O—CH ２ - and -O-CH(CH ３ 25. The oligomeric compound of claim 24, comprising a 2'-4' bridge selected from:

26. 26. The oligomeric compound of any one of claims 22 to 25, wherein the modified nucleoside comprises a non-bicyclic modified sugar moiety.

27. 27. The oligomeric compound of claim 26, wherein said non-bicyclic modified sugar moiety is a 2'-MOE sugar moiety or a 2'-OMe sugar moiety.

28. 28. The oligomeric compound of any one of claims 22 to 27, wherein the modified nucleoside comprises a sugar surrogate.

29. 29. The oligomeric compound of claim 28, wherein the sugar surrogate is one of morpholino, modified morpholino, glycol nucleic acid (GNA), 6-membered ring tetrahydropyran (THP), and F-hexitol nucleic acid (F-HNA).

30. The modified oligonucleotides may have the following structures: 5'-kdddddddddeekekee-3', 5'-kdddddddddddeekekee-3', 5'-eddddddddddeekekee-3', 5'-eddddddddddddeekekee-3', 5'-eddddddddddddeekekee-3', 5'-kdddddddddeeeeeeee-3', 5'-kdddddddddddeeeeeeeee-3', 5'-eddddddddddeeeeeeee-3', 5'-eddddddddddeeeeeeee-3', 5'-eddddddddddeeeeeeee-3', 5'-ekdddddddddddeekeke-3', 5'-ekdddddddddddeekeke-3', 5'-ekdddddddddddee keke-3', 5'-eeddddddddeeekeke-3', 5'-eeddddddddeeekeke-3', 5'-ekd dddddddeeeeeee-3', 5'-ekdddddddeeeeeee-3', 5'-eeddddddddeeeeeee -3', 5'-eeddddddddeeeeeee-3', 5'-ekdddddddeeekek-3', 5'-ekdddddd deeeeekek-3', 5'-eeddddddddeeekek-3', 5'-eeddddddeeeeekek-3', 5'-e kdddddddeeeeeee-3', 5'-ekdddddddeeeeeee-3', 5'-eeddddddddeeeeeee- 3', 5'-eeddddddeeeeeeeee-3', 5'-ekdddddddeeekek-3', 5'-ekddddddde eeekek-3', 5'-ekdddddddeeekek-3', 5'-ekdddddddeeeeekek-3', 5'-eee eeedddddddkke-3', 5'-eeeekkdddddddeee-3', 5'-eeeeekkdddddddkke-3' 28. The oligomeric compound of any one of claims 18-27, comprising a modified sugar motif selected from: 5'-eeeeeedddddddddeee-3', 5'-ekdddddddddddeeekek-3', 5'-kdddddddddddkeekk-3', 5'-eddddddddddddkeekk-3', 5'-kdddddddddddeeee-3', and 5'-eddddddddddddeeeee-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, and each "k" represents a cEt sugar moiety.

31. 1. An oligomeric compound comprising a modified oligonucleotide consisting of 12 to 30 linked nucleosides and having a nucleobase complementary to huntingtin (HTT) SNP rs7685686, wherein said modified oligonucleotide comprises a modified sugar moiety selected from a 2'-OMe sugar moiety or a 2'-α-L-deoxyribosyl sugar moiety.

32. 32. The oligomeric compound of claim 31, wherein the modified oligonucleotide comprises one or more modified sugar moieties selected from a cEt sugar moiety and a 2'-MOE sugar moiety.

33. The modified oligonucleotides include 5'-kydddddddddeeekekee-3', 5'-kyddddddddddeeekekee-3', 5'-kdyddddddddeeekekee-3', 5'-kdydddddddddeeekekee-3', 5'-ekydddddddddddeeekeke-3', 5'-ekydddddddddeeekeke-3', 5'-ekdydddd dddeekeke-3', 5'-ekdydddddeeekeke-3', 5'-ekydddddddeeekek-3', 5'-ekdydddddeeekek-3', 5' -kyddddddddkeekk-3', 5'-kdyddddddkeekk-3', 5'-kddd[aLd]ddddeekekee-3', 5'-kddd[aLd]ddd ddeekekee-3', 5'-ekddd [aLd] ddddeekeke-3', 5'-ekddd [aLd] dddeekeke-3', 5'-eeeeekkddd [aLd ]dddkke-3', 5'-kddd[aLd]ddddkeekk-3', 5'-ekddd[aLd]ddddeekek-3', and 5'-ekddd[aLd]dddeee 33. The oligomeric compound of claim 31 or claim 32, comprising a modified sugar motif selected from: ekek-3', wherein each "d" represents a 2'-β-D-deoxyribosyl sugar moiety, each "e" represents a 2'-MOE sugar moiety, each "k" represents a cEt sugar moiety, each "y" represents a 2'-O-methyl sugar moiety, and each "[aLd]" represents a 2'-α-L-deoxyribosyl sugar moiety.

34. 34. The oligomeric compound of any one of claims 31 to 33, wherein the modified oligonucleotide comprises at least one modified internucleoside linkage.

35. 35. The oligomeric compound of claim 34, wherein at least one internucleoside linkage is a phosphodiester internucleoside linkage.

36. 36. The oligomeric compound of claim 34 or claim 35, wherein at least one modified internucleoside linkage is a phosphorothioate internucleoside linkage.

37. 37. The oligomeric compound of any one of claims 34 to 36, wherein each internucleoside linkage is independently selected from a phosphodiester internucleoside linkage and a phosphorothioate internucleoside linkage.

38. 38. The oligomeric compound of any one of claims 34-37, wherein the modified oligonucleotide has an internucleoside linkage motif selected from 5'-ssssssssssoosss-3', 5'-ssssssssssssooss-3', 5'-ssssssssssssooss-3', 5'-ssssssssssssss-3', and 5'-ssssssssssssss-3', wherein each "s" represents a phosphorothioate internucleoside linkage and each "o" represents a phosphodiester internucleoside linkage.

39. 39. The oligomeric compound of any one of claims 18 to 38, wherein the nucleobase sequence of the modified oligonucleotide is at least 85%, at least 90%, at least 95%, or 100% complementary to an equal length portion of an HTT nucleic acid, wherein the HTT nucleic acid has the nucleobase sequence of SEQ ID NO:

1.

40. 40. The oligomeric compound of any one of claims 18-39, wherein the modified oligonucleotide consists of 12-20, 12-25, 12-30, 13-20, 13-25, 13-30, 14-20, 14-25, 14-30, 15-20, 15-25, 15-30, 16-18, 16-20, 16-25, 16-30, 17-20, 17-25, 17-30, 18-20, 18-22, 18-25, 18-30, 19-20, 19-25, 19-30, 20-25, 20-30, 21-25, 21-30, 22-25, 22-30, 23-25, or 23-30 linked nucleosides.

41. The oligomeric compound of any one of claims 18 to 40, wherein the modified oligonucleotide consists of 15 linked nucleosides.

42. The oligomeric compound of any one of claims 18 to 40, wherein the modified oligonucleotide consists of 16 linked nucleosides.

43. The oligomeric compound of any one of claims 18 to 40, wherein the modified oligonucleotide consists of 17 linked nucleosides.

44. 44. The oligomeric compound of any one of claims 18 to 30 and 39 to 43, wherein the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 21 and 24.

45. 44. The oligomeric compound of any one of claims 31 to 43, wherein the modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOs: 14, 15, 18, 19, 20, 21, 22, 23 and 24.

46. 46. ​​The oligomeric compound of any one of claims 18 to 45, wherein at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase.

47. 47. The oligomeric compound of claim 46, wherein said modified nucleobase is 5-methylcytosine.

48. 47. The oligomeric compound of claim 46, wherein each cytosine is a 5-methylcytosine.

49. 49. The oligomeric compound of any one of claims 18 to 48, wherein each nucleoside of said modified oligonucleotide is an unmodified adenine, an unmodified guanine, an unmodified thymine, an unmodified cytosine, or a 5-methylcytosine.

50. 50. The oligomeric compound of any one of claims 18 to 49, wherein the modified oligonucleotide comprises a deoxy region.

51. 51. The oligomeric compound of claim 50, wherein each nucleoside of said deoxy region is a 2'-β-D-deoxynucleoside.

52. 52. The oligomeric compound of claim 50 or claim 51, wherein the deoxy region consists of 6, 7, 8, 9, 10, or 6-10 linked nucleosides.

53. 53. The oligomeric compound of any one of claims 50-52, wherein each nucleoside immediately adjacent to the deoxy tract comprises a modified sugar moiety.

54. 54. The oligomeric compound of any one of claims 50 to 53, wherein the deoxy region comprises a 5'-region consisting of 1 to 6 linked 5'-region nucleosides on the 5'-side and a 3'-region consisting of 1 to 8 linked 3'-region nucleosides on the 3'-side, wherein at least one nucleoside in the 5'-region comprises a modified sugar moiety, and at least one nucleoside in the 3'-region comprises a modified sugar moiety.

55. 55. The oligomeric compound of claim 54, wherein each nucleoside of said 5'-region comprises a modified sugar moiety.

56. 56. The oligomeric compound of claim 54 or claim 55, wherein each nucleoside of said 3'-region comprises a modified sugar moiety.

57. 57. The oligomeric compound of any one of claims 18 to 56, consisting of said modified oligonucleotide.

58. 57. The oligomeric compound of any one of claims 18 to 56, wherein the oligomeric compound comprises a conjugate group.

59. 59. The oligomeric compound of claim 58, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

60. 60. The oligomeric compound of claim 59, wherein the conjugate linker is a phosphodiester linker.

61. 60. The oligomeric compound of claim 59, wherein said conjugate linker consists of a single bond.

62. 62. The oligomeric compound of any one of claims 59 to 61, wherein the conjugate linker is cleavable.

63. 63. The oligomeric compound of any one of claims 59, 60, or 62, wherein the conjugate linker comprises one to three linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the modified oligonucleotide, or another linker nucleoside by a phosphodiester bond.

64. 64. The oligomeric compound of any one of claims 58 to 63, wherein the conjugate group is attached to the modified oligonucleotide at the 5'-end of the modified oligonucleotide.

65. 64. The oligomeric compound of any one of claims 58 to 63, wherein the conjugate group is attached to the modified oligonucleotide at the 3'-end of the modified oligonucleotide.

66. 59. The oligomeric compound of any one of claims 18 to 58, wherein the oligomeric compound does not contain a linker nucleoside.

67. 67. The oligomeric compound of any one of claims 18 to 66, comprising a terminal group.

68. 68. The oligomeric compound of claim 67, wherein said terminal group is an abasic sugar moiety.

69. 69. The oligomeric compound of any one of claims 18 to 68, wherein the oligomeric compound is an RNase H agent.

70. An oligomeric compound having the following chemical notation: N １ ｅｓ T ｋｓ T ｄｚ G ｄｚ T ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ ｍ C ｅｓ ｍ C ｅｓ A ｅｓ G ｋｏ A ｅｓ A ｋｓ N ２ ｅ (SEQ ID NO: 27), wherein: A = adenine nucleobase; ｍ C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, N １ = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent; N １ is absent, then the sugar and internucleoside linkage are also absent, N ２ = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent; N ２ If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage; z = mesylphosphoramidate internucleoside linkage, and o = phosphodiester internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group.

71. An oligomeric compound having the following chemical notation: N １ ｅｓ T ｋｓ T ｄｓ G ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ T ｄｓ ｍ C ｄｓ A ｄｓ ｍ C ｅｓ ｍ C ｅｚ A ｅｚ G ｋｚ A ｅｓ A ｋｓ N ２ ｅ (SEQ ID NO: 28), wherein: A = adenine nucleobase; ｍ C=5-methylcytosine nucleobase, G = guanine nucleobase; T = thymine nucleobase, N １ = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent; N １ is absent, then the sugar and internucleoside linkage are also absent, N ２ = adenine nucleobase, modified adenine, hypoxanthine, abasic sugar moiety, terminal group, or absent; N ２ If is not present, then the sugar is also not present, e=2'-MOE sugar moiety, k=cEt sugar moiety, d=2′-β-D-deoxyribosyl sugar moiety; s = phosphorothioate internucleoside linkage, and z = mesylphosphoramidate internucleoside linkage, and The oligomeric compound optionally comprises a conjugate group.

72. N １ and N ２ is each independently an adenine nucleobase.

73. N １ and N ２ is each independently an unmodified adenine.

74. N １ and N ２ is each independently a modified adenine.

75. N １ and N ２ and each independently is hypoxanthine.

76. N １ and N ２ is each independently an abasic sugar moiety.

77. N １ and N ２ is each independently a terminal group.

78. N １ and N ２ 72. The oligomeric compound of claim 70 or 71, wherein each of

79. N １ is an adenine nucleobase, and N ２ is an unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

80. N １ is an adenine nucleobase, and N ２ 80. The oligomeric compound of any one of claims 70 to 79, wherein is an unmodified adenine.

81. N １ is an adenine nucleobase, and N ２ 80. The oligomeric compound of any one of claims 70 to 79, wherein is hypoxanthine.

82. N １ is an adenine nucleobase, and N ２ is an abasic sugar moiety.

83. N １ is an adenine nucleobase, and N ２ The oligomeric compound of any one of claims 70 to 79, wherein is a terminal group.

84. N １ is an adenine nucleobase, and N ２ The oligomeric compound of any one of claims 70 to 79, wherein is absent.

85. N １ is an unmodified adenine, and N ２ is an adenine nucleobase, an unmodified adenine, a hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

86. N １ is an unmodified adenine, and N ２ 86. The oligomeric compound of any one of claims 70-79 or 85, wherein is an adenine nucleobase.

87. N １ is an unmodified adenine, and N ２ 86. The oligomeric compound of any one of claims 70-79 or 85, wherein is an unmodified adenine.

88. N １ is an unmodified adenine, and N ２ 86. The oligomeric compound of any one of claims 70 to 79 or 85, wherein is hypoxanthine.

89. N １ is an unmodified adenine, and N ２ is an abasic sugar moiety.

90. N １ is an unmodified adenine, and N ２ The oligomeric compound of any one of claims 70 to 79 or 85, wherein is a terminal group.

91. N １ is an unmodified adenine, and N ２ The oligomeric compound of any one of claims 70 to 79 or 85, wherein is absent.

92. N １ is hypoxanthine, and N ２ is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

93. N １ is hypoxanthine, and N ２ is an adenine nucleobase.

94. N １ is hypoxanthine, and N ２ 93. The oligomeric compound of any one of claims 70-78 or 92, wherein is an unmodified adenine.

95. N １ is hypoxanthine, and N ２ 93. The oligomeric compound of any one of claims 70 to 78 or 92, wherein is hypoxanthine.

96. N １ is hypoxanthine, and N ２ is an abasic sugar moiety.

97. N １ is hypoxanthine, and N ２ The oligomeric compound of any one of claims 70 to 78 or 92, wherein is a terminal group.

98. N １ is hypoxanthine, and N ２ The oligomeric compound of any one of claims 70 to 78 or 92, wherein is absent.

99. N １ is an abasic sugar moiety, and N ２ is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

100. N １ is a terminal group, and N ２ is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

101. N １ does not exist, and N ２ is an adenine nucleobase, unmodified adenine, hypoxanthine, an abasic sugar moiety, a terminal group, or is absent.

102. N １ does not exist, and N ２ The oligomeric compound of any one of claims 70 to 78, wherein is absent.

103. 72. The oligomeric compound of claim 70 or 71, wherein the conjugate group comprises a conjugate moiety and a conjugate linker.

104. 104. The oligomeric compound of claim 103, wherein the conjugate linker is a phosphodiester linker.

105. 104. The oligomeric compound of claim 103, wherein the conjugate linker consists of a single bond.

106. The oligomeric compound of any one of claims 103 to 105, wherein the conjugate linker is cleavable.

107. 107. The oligomeric compound of any one of claims 103, 104 or 106, wherein the conjugate linker comprises 1 to 3 linker nucleosides, and at least one linker nucleoside is linked to the conjugate moiety, the oligomeric compound, or another linker nucleoside by a phosphodiester bond.

108. 108. The oligomeric compound of any one of claims 70, 71 or 103-107, wherein the conjugate group is attached to the oligomeric compound at the 5'-end of the oligomeric compound.

109. 108. The oligomeric compound of any one of claims 70, 71 or 103-107, wherein the conjugate group is attached to the oligomeric compound at the 3'-terminus of the oligomeric compound.

110. 110. The oligomeric compound of any one of claims 70 to 109, wherein the oligomeric compound is a pharmaceutically acceptable salt.

111. 111. The oligomeric compound of claim 110, wherein the pharmaceutically acceptable salt comprises one or more cations selected from sodium, potassium, calcium, and magnesium.

112. 112. The population of oligomeric compounds of any one of claims 18 to 111, wherein the phosphorothioate internucleoside linkages of the modified oligonucleotides are all stereorandom.

113. 112. The population of oligomeric compounds of any one of claims 18 to 111, wherein the mesyl phosphoramidate internucleoside linkages of the modified oligonucleotides are all stereorandom.

114. 114. A pharmaceutical composition comprising an oligomeric compound according to any one of claims 18 to 111, or a population of oligomeric compounds according to claim 112 or 113, and a pharmaceutically acceptable diluent.

115. 115. The pharmaceutical composition of claim 114, wherein the pharmaceutically acceptable diluent is artificial cerebrospinal fluid (aCSF) or phosphate buffered saline (PBS).

116. 116. The pharmaceutical composition of claim 115, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any one of claims 18 to 111, or a population of oligomeric compounds of claims 112 or 113, and aCSF.

117. 116. The pharmaceutical composition of claim 115, wherein the pharmaceutical composition consists essentially of an oligomeric compound of any one of claims 18 to 111, or a population of oligomeric compounds of claims 112 or 113, and PBS.

118. The pharmaceutical composition of claim 115, wherein the pharmaceutical composition consists of an oligomeric compound of any one of claims 18 to 111, or a population of oligomeric compounds of claims 112 or 113, and aCSF.

119. 116. The pharmaceutical composition of claim 115, wherein the pharmaceutical composition consists of an oligomeric compound of any one of claims 18 to 111, or a population of oligomeric compounds of claims 112 or 113, and PBS.

120. 13. A method comprising administering to a subject a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, or 18 to 111, a population of modified oligonucleotides according to claim 10 or 11, a population of oligomeric compounds according to any one of claims 10, 11, 112, or 113, or a pharmaceutical composition according to any one of claims 12 to 17 or 114 to 119.

121. 121. The method of claim 120, wherein the subject has or is at risk of developing Huntington's disease.

122. 13. A method of treating Huntington's disease, comprising administering to a subject having or at risk of developing Huntington's disease a therapeutically effective amount of a modified oligonucleotide of any one of claims 1-5, an oligomeric compound of any one of claims 6-9, or 18-111, a population of modified oligonucleotides of claim 10 or 11, a population of oligomeric compounds of any one of claims 10, 11, 112, or 113, or a pharmaceutical composition of any one of claims 12-17 or 114-119.

123. 123. The method of claim 122, wherein at least one symptom or feature of Huntington's disease is ameliorated.

124. 124. The method of claim 123, wherein the symptom or characteristic is brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression.

125. 125. The method of claim 124, wherein the onset or progression of brain atrophy, muscle atrophy, neurodegeneration, uncontrolled movements, seizures, tremors, anxiety, memory loss, or depression is reduced or delayed by administering a modified oligonucleotide of any one of claims 1 to 5, an oligomeric compound of any one of claims 6 to 9, or 18 to 111, a population of modified oligonucleotides of claim 10 or 11, a population of oligomeric compounds of any one of claims 10, 11, 112, or 113, or a pharmaceutical composition of any one of claims 12 to 17 or 114 to 119.

126. 126. The method of any one of claims 120 to 125, wherein the modified oligonucleotide of any one of claims 1 to 5, the oligomeric compound of any one of claims 6 to 9, or 18 to 111, the population of modified oligonucleotides of claim 10 or 11, the population of oligomeric compounds of any one of claims 10, 11, 112, or 113, or the pharmaceutical composition of any one of claims 12 to 17 or 114 to 119 is administered to the central nervous system or systemically.

127. 127. The method of any one of claims 120 to 126, wherein the modified oligonucleotide of any one of claims 1 to 5, the oligomeric compound of any one of claims 6 to 9, or 18 to 111, the population of modified oligonucleotides of claim 10 or 11, the population of oligomeric compounds of any one of claims 10, 11, 112, or 113, or the pharmaceutical composition of any one of claims 12 to 17 or 114 to 119 is administered intraspinally.

128. 128. The method of any one of claims 120 to 127, wherein the subject is a human.

129. 13. A method of reducing expression of HTT in a cell, comprising contacting the cell with a modified oligonucleotide of any one of claims 1-5, an oligomeric compound of any one of claims 6-9, or 18-111, a population of modified oligonucleotides of claim 10 or 11, a population of oligomeric compounds of any one of claims 10, 11, 112, or 113, or a pharmaceutical composition of any one of claims 12-17 or 114-119.

130. 130. The method of claim 129, wherein the cell is a brain cell.

131. 130. The method of claim 129, wherein the cell is a neuron or a glial cell.

132. 132. The method of any one of claims 129 to 131, wherein the cell is a human cell.

133. 120. Use of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9, or 18 to 111, a population of modified oligonucleotides according to claim 10 or 11, a population of oligomeric compounds according to any one of claims 10, 11, 112, or 113, or a pharmaceutical composition according to any one of claims 12 to 17 or 114 to 119, for the treatment of Huntington's disease.

134. 120. Use of a modified oligonucleotide according to any one of claims 1 to 5, an oligomeric compound according to any one of claims 6 to 9 or 18 to 111, a population of modified oligonucleotides according to claim 10 or 11, a population of oligomeric compounds according to any one of claims 10, 11, 112 or 113, or a pharmaceutical composition according to any one of claims 12 to 17 or 114 to 119, for the manufacture of a medicament for the treatment of Huntington's disease.

Images