Reversir molecules and methods of use thereof

Abstract

The present invention provides REVERSIR compounds that inhibit the RNAi interference activity of dsRNA agents that contain thermodestabilizing nucleotide modifications in the antisense strand, and methods for their use.

Description

[Technical Field]

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 63 / 444,375, filed February 9, 2023, the entire contents of which are incorporated herein by reference. [Background technology]

[0002] RNA interference (RNAi) is an evolutionarily conserved mechanism by which endogenous (microRNA) or exogenous (siRNA, shRNA) short non-coding RNAs downregulate gene expression of mRNA transcripts in a sequence-dependent manner. As a native pathway that utilizes efficient cellular catalytic machinery, RNAi can be used to achieve robust, durable, and specific silencing of target gene transcripts. In recent years, several RNAi-based drugs have been successfully validated in clinical studies, demonstrating efficacy at lower doses and less frequent administration (up to six months) compared to alternative gene silencing strategies. Novel delivery solutions and highly chemically modified siRNAs have improved efficacy, durability, and safety, thus significantly expanding the range of RNAi therapeutics, with four drugs ultimately approved and several others in clinical development. In the liver, infrequent delivery of metabolically stabilized siRNAs conjugated to N-galactosamine (GalNAc) results in potent gene silencing that persists for several months in humans with a favorable safety and tolerability profile. RNAi therapeutics could benefit from technologies that extend their duration of action, allowing for rapid reversal of silencing activity and providing tailored control of RNAi pharmacology, desired for personalized precision medicine.

[0003] However, in some cases, subject may respond poorly to the treatment of dsRNA agent or may receive too much dose.In such cases, the compound that reverses the iRNA silencing activity of dsRNA agent can be administered to at least partially reduce the RNAi activity of dsRNA agent.In other cases, the effect of dsRNA lasts for a long time, so waiting for its effect to gradually decrease by natural clearance is not an attractive option. Summary of the Invention [Problem to be solved by the invention]

[0004] Thus, there is a need in the art for compositions and methods that provide for RNAi pharmacology and, therefore, modulation of the therapeutic activity and / or side effects of siRNA-based therapeutics in vivo. [Means for solving the problem]

[0005] The present invention provides oligonucleotides (REVERSIRs) that inhibit the RNAi activity of double-stranded ribonucleic acid (dsRNA) agents that contain thermolabile nucleotides in the antisense strand. The present invention also provides methods for using such oligonucleotides to inhibit the RNAi activity of double-stranded ribonucleic acid (dsRNA) agents that contain thermolabile nucleotides in the antisense strand in a subject in need thereof, such as a subject that has received too high a dose of the dsRNA agent or a subject that is experiencing side effects from administration of the dsRNA agent.

[0006] The present invention is based, at least in part, on the discovery that the activity of REVERSIR, an oligonucleotide that reverses the iRNA silencing activity of dsRNA agents used to control and regulate RNAi pharmacology, is abolished when the antisense strand of the dsRNA agent previously shown to be inhibited by REVERSIR contains a thermolabile nucleotide.The present invention is also based, at least in part, on the discovery that REVERSIR inhibits the RNAi interference activity of dsRNA agents that contain a thermolabile nucleotide in the antisense strand of the dsRNA agent.

[0007] Thus, in one aspect, the invention provides a single-stranded oligonucleotide for inhibiting the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand, wherein the single-stranded oligonucleotide comprises a nucleotide sequence substantially complementary to the antisense strand of the dsRNA agent, the single-stranded oligonucleotide is 16-30 nucleotides in length, substantially all of the nucleotides of the single-stranded oligonucleotide comprise nucleotide modifications, and at least three of the nucleotide modifications are high-affinity nucleotide modifications.

[0008] In one embodiment, substantially all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a locked nucleic acid (LNA) modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

[0009] In another embodiment, all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a locked nucleic acid (LNA) modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA), a 2'-O-(2-methoxyethyl) (MOE) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

[0010] In one embodiment, at least four or five, eg, four, five, or six, of the nucleotide modifications can be high affinity nucleotide modifications.

[0011] In one embodiment, at least two of the high affinity nucleotide modifications are at positions 2 and 6; 2 and 5; 2 and 7; 2 and 8; 2 and 9; 2 and 14; 2 and 15; and / or 2 and 16, counting from the 3' end of the oligonucleotide.

[0012] In one embodiment, the high affinity nucleotide modifications are at positions 2, 6, 8, and 14; positions 2, 4, 5, 6, and 7; positions 2, 4, 6, 8, and 13; positions 2, 4, 6, 8, and 14; positions 2, 4, 6, 8, and 15; positions 2, 4, 6, 8, and 16; positions 2, 8, 10, and 14; positions 2, 4, 6, 8, and 14; or positions 2, 8, 12, and 14, counting from the 3' end of the oligonucleotide.

[0013] In one embodiment, at least one of the nucleotides comprising the high-affinity nucleotide modification base pairs with a nucleotide comprising a thermally destabilized nucleotide in the antisense strand of the dsRNA agent.

[0014] In one embodiment, the high affinity modification is a locked nucleic acid (LNA) modification.

[0015] In one embodiment, the high affinity modification is a constrained ethyl nucleic acid (cEtNA) modification.

[0016] In one embodiment, the high affinity modification is a bridged nucleic acid (BNA) modification.

[0017] The single-stranded oligonucleotide may further comprise at least 5, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, phosphorothioate internucleotide modifications.

[0018] In one embodiment, the single-stranded oligonucleotide is conjugated to at least one ligand.

[0019] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0020] In one embodiment, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branched linker.

[0021] In one embodiment, the ligand is

[0022] [ka] is.

[0023] In one embodiment, the ligand is conjugated to a nucleoside containing a deoxy sugar in a single-stranded oligonucleotide.

[0024] In one embodiment, the deoxy sugar is 2'-deoxyribose.

[0025] In one embodiment, the ligand is conjugated to the 3'-end of the single-stranded oligonucleotide.

[0026] In another aspect, the invention provides a single-stranded oligonucleotide for inhibiting the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand, the single-stranded oligonucleotide comprises a nucleotide sequence substantially complementary to the antisense strand of the dsRNA agent; The single-stranded oligonucleotide is 18 to 24 nucleotides in length, The single-stranded oligonucleotide contains at least five phosphorothioate internucleotide modifications and has the formula (I):

[0027] [ka]

[0028] wherein: B1, B2, and B3 each independently represent a nucleotide that includes a nucleotide modification independently selected from the group consisting of a 2'-deoxy, a 2'-ribo, a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkoxyalkyl modification, a 2'-substituted alkyl modification, and a 2'-halo modification; T1, T2, and T3 each independently represent a nucleotide containing a nucleotide modification selected from the group consisting of a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a cEt modification, or a different BNA modification, a 2'-deoxy-2'-fluoro, and a 2'-O-methyl modification; q 1 , q 3 and q 5 are each independently 3 to 12 nucleotides in length; q 2 , q 4 and q 6 are each independently 1 to 6 nucleotides in length; The single-stranded oligonucleotide is conjugated to at least one ligand.

[0029] In one embodiment, the single-stranded oligonucleotide comprises 5 to 15 phosphorothioate internucleotide modifications; 5 to 14 phosphorothioate internucleotide modifications; 5 to 13 phosphorothioate internucleotide modifications; 5 to 12 phosphorothioate internucleotide modifications; 5 to 11 phosphorothioate internucleotide modifications; 5 to 10 phosphorothioate internucleotide modifications; 5 to 9 phosphorothioate internucleotide modifications; 5 to 8 phosphorothioate nucleotide modifications; 5 to 7 phosphorothioate internucleotide modifications; or 5 to 6 phosphorothioate nucleotide modifications.

[0030] In one embodiment, the single-stranded oligonucleotide contains 6 to 14 phosphorothioate internucleotide modifications.

[0031] In one embodiment, the single-stranded oligonucleotide is 18-22 or 18-20 nucleotides in length.

[0032] In one embodiment, the single-stranded oligonucleotide is at least about 90% complementary to the entire length of the antisense strand of the dsRNA agent.

[0033] In one embodiment, the single-stranded oligonucleotide is 90% complementary to nucleotides 2-16 of the antisense strand of the dsRNA agent.

[0034] In one embodiment, the single-stranded oligonucleotide is perfectly complementary to the antisense strand of the dsRNA agent.

[0035] In one embodiment, the nucleotide sequence of the antisense strand of a dsRNA agent comprises the nucleotide sequence 5'-UGUACUCUCAUUGUGGAUGACGA-3'.

[0036] In one embodiment, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in a duplex; a destabilizing sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

[0037] In one embodiment, the nucleotide sequence of the antisense strand of the dsRNA agent comprises the nucleotide sequence 5'-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3'.

[0038] In one embodiment, the nucleotide sequence of the single stranded oligonucleotide is at least 90% identical to the entire nucleotide sequence of any one of the unmodified nucleotide sequences in Table 6.

[0039] In one embodiment, the ligand is an N-acetylgalactosamine (GalNAc) derivative.

[0040] In one embodiment, the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branched linker.

[0041] In one embodiment, the ligand is

[0042] [ka] is.

[0043] In one embodiment, the ligand is conjugated to a nucleoside containing a deoxy sugar in a single-stranded oligonucleotide.

[0044] In one embodiment, the deoxy sugar is 2'-deoxyribose.

[0045] In one embodiment, the ligand is conjugated to the 3'-end of the single-stranded oligonucleotide.

[0046] In one embodiment, the single stranded oligonucleotide comprises a modified nucleotide sequence that differs from any one of the modified nucleotide sequences in Table 6 by no more than four modified nucleotides.

[0047] The invention also provides cells and pharmaceutical compositions, e.g., cells and pharmaceutical compositions comprising a buffer (e.g., acetate, citrate, prolamate, carbonate, or phosphate, or any combination thereof) or unbuffered (e.g., saline or water) solution comprising a single-stranded oligonucleotide of the invention.

[0048] In one aspect, the present invention provides a method for ameliorating the side effects of a dsRNA agent that inhibits the expression of a target gene and comprises a thermolabile nucleotide modification in the antisense strand in a subject.The method comprises administering an effective amount of the single-stranded oligonucleotide or pharmaceutical composition of the present invention to the subject, thereby ameliorating the side effects of the dsRNA agent in the subject.

[0049] In one aspect, the present invention provides a method for inhibiting the RNAi inhibitory activity of a dsRNA agent that comprises a thermolabile nucleotide modification in the antisense strand.The method comprises contacting the dsRNA agent with the single-stranded oligonucleotide or pharmaceutical composition of the present invention, thereby inhibiting the RNAi inhibitory activity of the dsRNA agent that comprises a thermolabile nucleotide modification in the antisense strand.

[0050] In one embodiment, the dsRNA agent is present intracellularly.

[0051] In one embodiment, the cell is in a human subject.

[0052] In another aspect, the present invention provides a method for treating a subject in need thereof, comprising administering a therapeutically effective amount of the single-stranded oligonucleotide or pharmaceutical composition of the present invention to the subject, thereby treating the subject.

[0053] In one embodiment, the subject in need of treatment has previously been administered a double-stranded RNAi agent that inhibits expression of a target gene and that includes a thermodestabilizing nucleotide modification in the antisense strand.

[0054] In one embodiment, the target gene is angiotensinogen (AGT).

[0055] In one embodiment, the subject in need of treatment is suffering from hypotension.

[0056] In one embodiment, the subject in need of treatment is suffering from hyperkalemia.

[0057] In one embodiment, the subject in need of treatment is suffering from impaired renal function.

[0058] In one embodiment, the method further comprises administering to the subject an additional therapy or treatment selected from the group consisting of increased dietary water / salt, fludrocortisone / midodrine treatment, intravenous fluids, vasopressors, reduction or discontinuation of concomitant antihypertensive medications, a low potassium diet, thiazides / loop diuretics, oral potassium binders, calcium, glucose, insulin, and hemodialysis, or a combination thereof.

[0059] In one embodiment, the single stranded oligonucleotide or pharmaceutical composition is administered subcutaneously to the subject.

[0060] In one embodiment, the single stranded oligonucleotide or pharmaceutical composition is administered to the subject intravenously.

[0061] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 1:1, 2:1, or 3:1 relative to the dose of the dsRNA agent previously administered to the subject.

[0062] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is at about a 1:1 ratio to the dose of the dsRNA agent previously administered to the subject.

[0063] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is in a ratio of about 1:2 relative to the dose of dsRNA agent previously administered to the subject.

[0064] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is in a ratio of about 1:3 relative to the dose of dsRNA agent previously administered to the subject.

[0065] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is in a ratio of about 1:4 relative to the dose of dsRNA agent previously administered to the subject.

[0066] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 1:5 relative to the dose of dsRNA agent previously administered to the subject.

[0067] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 1:10 relative to the dose of dsRNA agent previously administered to the subject.

[0068] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 2:1 relative to the dose of the dsRNA agent previously administered to the subject.

[0069] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 3:1 relative to the dose of the dsRNA agent previously administered to the subject.

[0070] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 5:1 relative to the dose of dsRNA agent previously administered to the subject.

[0071] In one embodiment, the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 10:1 relative to the dose of dsRNA agent previously administered to the subject.

[0072] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject at 24 hour intervals.

[0073] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 24 hours apart.

[0074] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject 12 hours apart.

[0075] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 12 hours apart.

[0076] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject at 8 hour intervals.

[0077] In one embodiment, the dose of the single stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 8 hours apart. [Brief explanation of the drawings]

[0078] [Figure 1A] FIG. 1A is a graph showing inhibition of silencing by REVERSIR in mice of a dsRNA agent that targets TTR and is conjugated to a GalNAc ligand. [Figure 1B] FIG. 1B is a graph showing inhibition of silencing by REVERSIR in mice of a dsRNA agent that targets TTR and is conjugated to a GalNAc ligand. [Figure 1C]FIG. 1C is a graph showing that REVERSIR, previously shown to inhibit silencing of a dsRNA agent conjugated to a GalNAc ligand (the dsRNA agent of FIG. 1A and FIG. 1B), is unable to inhibit silencing in mice of a dsRNA agent that targets the same region of mRNA and contains the same nucleotide sequence and substantially the same nucleotide modification, except that it contains a heat-destabilizing nucleotide modification. [Figure 2] Figure 2 is a graph showing the effect of administering up to 100-fold higher doses of REVERSIR, a longer REVERSIR targeting a non-stabilized dsRNA, on its ability to inhibit silencing of a dsRNA agent containing a heat-labile nucleotide modification and conjugated to a GalNAc ligand in mice. The graph also shows successful re-administration of the GalNAc dsRNA agent 30 days after REVERSIR agent administration and upon recovery. Successful re-administration indicates resumption of RNAi pharmacology, with a profile similar to that of the control (no REVERSIR) group in mice. [Figure 3A] Figure 3A is a graph showing the effect of intravenous administration of 3 mg / kg REVERSIR formulated in LNP on the RNAi silencing activity of dsRNA agents containing heat-labile nucleotide modifications in the antisense strand in mice, and the effect of subcutaneous administration of 3 mg / kg GalNAc-conjugated REVERSIR on the RNAi silencing activity of dsRNA agents containing heat-labile nucleotide modifications in the antisense strand in mice. [Figure 3B] FIG. 3B is a graph depicting the effect of subcutaneous administration of 3 mg / kg GalNAc-conjugated REVERSIR on the RNAi silencing activity of dsRNA agents containing heat-destabilizing nucleotide modifications in the antisense strand in mice. [Figure 4A] FIG. 4A is a graph showing the in vitro effect of the indicated REVERSIRs on the RNAi silencing activity of AD-85481 when cells were transfected with the REVERSIRs. [Figure 4B]FIG. 4B is a graph depicting the in vitro effect of the indicated REVERSIRs on the RNAi silencing activity of AD-85481 as assessed by free uptake of the REVERSIRs into cells. [Figure 5] FIG. 5 is a table showing the in vitro activity of REVERSIRs A-515518, A-515556, A-515559, A-515586, and A-515589. [Figure 6A] FIG. 6A is a graph showing the effect of intravenous administration of the indicated REVERSIRs formulated in LNPs at 0.3 mg / kg on the RNAi silencing activity of AD-85481 in mice. [Figure 6B] FIG. 6B is a graph showing the effect of subcutaneous administration of 3 mg / kg of the indicated GalNAc-conjugated REVERSIRs on the RNAi silencing activity of AD-85481 in mice. [Figure 7A] Figure 7A shows the schematic representation of the modified nucleotide sequences of A-762636, A-762655, A-762680, A-762689, A-762722, and A-762645. [Figure 7B] Figure 7B is a graph showing human AGT mRNA levels in mice administered AAV encoding human AGT at the indicated time points after subcutaneous administration of a single 3 mg / kg dose of AD-85481 and a single 3 mg / kg dose of the indicated GalNAc-conjugated REVERSIR. [Figure 8A] FIG. 8A shows a schematic representation of the modified nucleotide sequences of A-762689, A-762722, and A-762645. [Figure 8B] Figure 8B is a graph showing human AGT mRNA levels in mice administered AAV encoding human AGT at the indicated time points after subcutaneous administration of a single 3 mg / kg dose of AD-85481 and a single 1 mg / kg or 3 mg / kg dose of the indicated REVERSIR. [Figure 9]FIG. 9 shows a schematic diagram of the study design for the evaluation of A-762722 and A-762645 in non-human primates, as well as the modified nucleotide sequences of A-762722 and A-762645. [Figure 10A] FIG. 10A is a graph showing the effect of subcutaneous administration of 1 mg / kg or 3 mg / kg of the indicated GalNAc-conjugated REVERSIRs on the RNAi silencing activity of AD-85481 in non-human primates. [Figure 10B] FIG. 10B is a graph showing the effect of intravenous administration of 0.3 mg / kg of the indicated REVERSIR formulated in LNP on the RNAi silencing activity of AD-85481 in non-human primates. [Figure 11A] Figure 11A shows the schematic representation of the modified nucleotide sequences of A-762645, A-809917, A-809918, A-809919, A-809920, A-809921, A-809922, A-809923, A-809924, and A-809925. [Figure 11B] Figure 11B is a graph showing human AGT mRNA levels in mice administered AAV encoding human AGT at the indicated time points after subcutaneous administration of a single 3 mg / kg dose of AD-85481 and a single 3 mg / kg dose of the indicated REVERSIR. [Figure 12A] FIG. 12A shows a schematic representation of the modified nucleotide sequences of A-762645, A809918, A-809925, A2423818, or A2423819. [Figure 12B] Figure 12B is a graph showing human AGT mRNA levels in mice administered AAV encoding human AGT at the indicated time points after subcutaneous administration of a single 3 mg / kg dose of AD-85481 and a single 3 mg / kg dose of the indicated REVERSIR. [Figure 12C]Figure 12C is a graph showing human AGT mRNA levels in mice administered AAV encoding human AGT at the indicated time points after subcutaneous administration of a single 3 mg / kg dose of AD-85481 and a single 3 mg / kg dose of the indicated REVERSIR. [Figure 13A] FIG. 13A is a graph showing the effect of subcutaneous administration of 3 mg / kg of the indicated REVERSIR on the RNAi silencing activity of AD-85481 in non-human primates. [Figure 13B] FIG. 13B is a graph showing the reversal effect of subcutaneous administration of 3 mg / kg of the indicated REVERSIR on the RNAi silencing activity of AD-85481 in non-human primates. [Figure 13C] FIG. 13C is a table showing the effect of subcutaneous administration of 3 mg / kg of the indicated REVERSIR on the RNAi silencing activity of AD-85481 in non-human primates. [Figure 14A] FIG. 14A is a graph showing the effect of the indicated REVERSIRs on IL-6, IL-8, Il1B, and TNF-alpha levels in a diluted human whole blood transfection assay (24 hour incubation). [Figure 14B] FIG. 14B is a graph depicting the effect of the indicated REVERSIRs on IL-8 and MCP-1 levels in a 6-hour human whole blood assay. [Figure 14C] FIG. 14C is a graph showing the effect of the indicated REVERSIRs on platelet and complete blood counts in non-human primates. [Figure 15A] FIG. 15A is a graph showing % AGT ​​remaining and AGT silencing reversal with various RVR / dsRNA ratios, GalNAc-conjugated formulations, and LNP formulations in non-human primates. [Figure 15B] FIG. 15B is a graph showing that REVERSIR A-762645 produced potent and sustained pharmacological effects following AD-85481 (dilebesiran) administration in non-human primates. [Figure 15C] FIG. 15C is a graph showing the % AGT ​​remaining after subcutaneous or intravenous delivery of REVERSIR as indicated for various dose levels. [Figure 16A] Figure 16A is a graph showing the % AGT ​​remaining normalized to pre-dose after subcutaneous administration of the indicated REVERSIR at various dose levels in a hAGT-AAV mouse model pretreated with 10 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was expressed in mouse hepatocytes by transduction with the liver-specific AAV8 virus. [Figure 16B] Figure 16B is a graph showing the percentage of AGT remaining after subcutaneous administration of REVERSIR in a hAGT-AAV mouse model pretreated with 3 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was expressed in mouse hepatocytes by transduction with the liver-specific AAV8 virus. [Figure 17] Figure 17 is a graph showing the % AGT ​​remaining after subcutaneous administration of REVERSIR A-762645 in a hAGT transgenic mouse model pretreated with 10 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was randomly inserted into multiple regions in the mouse genome (generated at the embryonic stem cell stage). [Figure 18] FIG. 18 is a graph showing the % AGT ​​remaining after subcutaneous administration of GalNAc-conjugated REVERSIR A-762645 in a PXB mouse model pretreated with 10 mg / kg AD-85481. [Figure 19A] FIG. 19A is a graph showing the % AGT ​​remaining after administration of varying ratios of REVERSIR to dsRNA in rats. [Figure 19B] FIG. 19B is a graph showing the % AGT ​​remaining after administration of varying AD-85481 dsRNA loads. [Figure 19C]FIG. 19C is a graph showing reversal of AGT knockdown by REVERSIR in an LNP formulation and REVERSIR with a GalNac ligand administered subcutaneously to rats. [Figure 19D] FIG. 19D is a graph showing the % AGT ​​remaining after bolus intravenous and subcutaneous administration of REVERSIR A-762645. [Figure 20] FIG. 20 schematically shows the modified nucleotide sequences of REVERSIRs A-3903617, A-3903618, A-3903619, A-3903620, A-3903621, A-3903622, A-3903623, A-3903624, A-3903625, A-3903626, A-3903627, A-3903628, A-3903629, A-3903630, and A-3903631. [Figure 21] 21 is a graph showing the % AGT ​​remaining after subcutaneous administration of the indicated GalNAc-conjugated REVERSIR in a hAGT-AAV mouse model pretreated with 3 mg / kg or 10 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was expressed in mouse hepatocytes by transduction with liver-specific AAV8 virus. [Figure 22] 22 is a graph showing the % AGT ​​remaining after subcutaneous administration of the indicated GalNAc-conjugated REVERSIR in a hAGT-AAV mouse model pretreated with 3 mg / kg or 10 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was expressed in mouse hepatocytes by transduction with liver-specific AAV8 virus. [Figure 23] 23 is a graph showing the % AGT ​​remaining after subcutaneous administration of the indicated GalNAc-conjugated REVERSIR in a hAGT-AAV mouse model pretreated with 3 mg / kg or 10 mg / kg AD-85481. In the hAGT-AAV mouse model, the human AGT gene was expressed in mouse hepatocytes by transduction with liver-specific AAV8 virus. DETAILED DESCRIPTION OF THE INVENTION

[0079] The present invention provides a single-stranded oligonucleotide (REVERSIR) that inhibits the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand.The present invention also provides a method of using such an oligonucleotide to inhibit the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand in a subject, for example, a subject in need thereof, for example, a subject that has received too high a dose of a dsRNA agent or has experienced side effects, such as off-target effects, due to the administration of a dsRNA agent.

[0080] The present invention is based, at least in part, on the discovery that the activity of REVERSIR, an oligonucleotide that reverses the iRNA silencing activity of dsRNA agents used to control and modulate RNAi pharmacology, is abolished when a thermodestabilizing nucleotide is included in the antisense strand of a dsRNA agent previously demonstrated to be inhibited by REVERSIR.

[0081] The present invention is also based, at least in part, on the identification of REVERSIRs that can inhibit the RNAi activity of a class of dsRNA agents that contain thermolabile nucleotides in the antisense strand. This new class of REVERSIRs is characterized by a combination of structural properties, such as length, phosphorothioate (PS) content, and specific placement of high-affinity nucleotide modifications, such as locked nucleic acid (LNA) modifications, on the thermolabile nucleotides in the antisense strand of the dsRNA agent.

[0082] The following detailed description discloses methods for making and using oligonucleotides that inhibit the RNAi activity of double-stranded ribonucleic acid (dsRNA) agents that contain thermolabile nucleotides in the antisense strand, as well as applications and methods for treating subjects in need thereof.

[0083] I. Definition In order that the present invention may be more readily understood, certain terms are first defined. Furthermore, it should be noted that whenever a value or range of values ​​for a parameter is described, it is intended that values ​​and ranges intermediate to the described values ​​are also part of the invention.

[0084] As used herein, the articles "a" and "an" are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element, e.g., a plurality of elements.

[0085] As used herein, the term "including" is used to mean, and is used interchangeably with, the phrase "including but not limited to."

[0086] As used herein, the term "or" is used to mean, and is used interchangeably with, the term "and / or," unless the context clearly indicates otherwise. For example, "the sense strand or the antisense strand" is understood as "the sense strand or the antisense strand, or the sense strand and the antisense strand."

[0087] As used herein, the term "about" is used to mean within a typical acceptable range in the art. For example, "about" can be understood as about 2 standard deviations from the mean. In certain embodiments, "about" means ±10%. In certain embodiments, "about" means ±5%. When preceded by a series of numerical values ​​or ranges, it is understood that "about" can modify each numerical value in the series or ranges.

[0088] The terms "at least," "greater than," or "or more than" before a number or series of numbers are understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that may be logically included, as is clear from the context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 19 nucleotides of a 21-nucleotide nucleic acid molecule" means that 19, 20, or 21 nucleotides have the specified property. When "at least" appears before a series of numbers or ranges, it is understood that "at least" can modify each number in the series or range.

[0089] As used herein, "less than" or "or less than" is understood as a phrase and a value adjacent to a logically lower value or integer, such that the logical value is zero from the context. For example, a duplex with an overhang of "2 nucleotides or less" has an overhang of 2, 1, or 0 nucleotides. When "less than" precedes a series of numbers or ranges, it is understood that "less than" can modify each number within the series or range. As used herein, a range includes both the upper and lower limits.

[0090] In the event of a conflict between the nucleotide sequence of the indicated target site for either the sense or antisense strand, the indicated sequence shall prevail.

[0091] In the event of a discrepancy between the sequence and the indicated site on the transcript or other sequence, the nucleotide sequence set forth herein takes precedence.

[0092] As used herein, the term "nucleoside" refers to a glycosylamine containing a nucleobase and a sugar. Nucleosides include, but are not limited to, naturally occurring nucleosides, abasic nucleosides, modified nucleosides, and nucleosides with mimetic base and / or sugar groups.

[0093] As used herein, the term "nucleotide" refers to a glycosomine comprising a nucleobase and a sugar having a phosphate group covalently attached to the sugar. Nucleotides can be modified with any of a variety of substituents.

[0094] As used herein, the term "nucleobase" refers to the base portion of a nucleoside or nucleotide. A nucleobase can include any atom or group of atoms that is capable of hydrogen bonding to a base of another nucleic acid.

[0095] As used herein, the term "heterocyclic base moiety" refers to a nucleobase that comprises a heterocycle.

[0096] As used herein, the term "oligomeric compound" refers to a polymeric structure that comprises two or more substructures and can hybridize to a region of a nucleic acid molecule. In certain embodiments, the oligomeric compound is an oligonucleoside. In certain embodiments, the oligomeric compound is an oligonucleotide. In certain embodiments, the oligomeric compound is an antisense compound. In certain embodiments, the oligomeric compound is a reverse ion compound. In certain embodiments, the oligomeric compound comprises a conjugate group.

[0097] As used herein, "oligonucleoside" refers to an oligonucleotide in which the internucleoside linkages do not contain a phosphorus atom.

[0098] As used herein, the term "oligonucleotide" refers to an oligomeric compound comprising multiple linked nucleosides. In certain embodiments, one or more nucleotides of the oligonucleotide are modified. In certain embodiments, the oligonucleotide comprises ribonucleic acid (RNA) or deoxyribonucleic acid (DNA). In certain embodiments, the oligonucleotide is composed of naturally occurring and / or non-naturally occurring nucleobases, sugars, and covalent internucleoside linkages, and may further comprise non-nucleic acid conjugates.

[0099] As used herein, the term "REVERSIR compound" or "REVERSIR" refers to a single-stranded oligomeric compound, such as a single-stranded oligonucleotide, that is complementary to and can hybridize (target) at least one strand of a dsRNA agent containing a thermolabile nucleotide in the antisense strand. Without limitation, REVERSIR compounds can not only block unintended target pharmacodynamic (PD) effects, but also block potential off-target activity that may occur with dsRNA agents, for example, conjugated or unconjugated dsRNA agents. REVERSIR binds to the asialoglycoprotein receptor (ASPGR) and is internalized into cells, where it irreversibly binds to the antisense strand of the dsRNA agent in a functional RISC complex. REVERSIR binding inhibits the recognition and cleavage of the mRNA target caused by the hybridization of the dsRNA agent.

[0100] As used herein, the term "REVERSIR activity" refers to any decrease in the strength and / or duration of any dsRNA activity resulting from hybridization of a REVERSIR compound to one of the strands of the dsRNA.

[0101] The REVERSIR compounds disclosed herein are particularly effective in reducing the activity of dsRNA that contains thermolabile nucleotides in the antisense strand.For example, the REVERSIR compounds disclosed herein can reduce the activity of dsRNA by at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 97%, or at least about 99%, or 100% reduction (i.e., compared to reference sample, deletion level), or any reduction of 20-100% or 50-100% within 24 hours to 7 days.The reference level can be the dsRNA activity in the absence of REVERSIR compounds.

[0102] In some embodiments, the REVERSIR compounds described herein can reduce the activity of a dsRNA by at least 5%, at least 10%, at least 15%, at least 20%, such as 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95% or more, and up to a complete reduction or inhibition of dsRNA activity, within less than 7 days (e.g., within 6, 5, 4, 3, 2, or 1 day) of administration or use of the REVERSIR compound.

[0103] In some embodiments, the REVERSIR compound can completely reduce dsRNA activity within 4 days of administration or use of the REVERSIR compound. A complete reduction in dsRNA activity means a reduction in dsRNA activity of at least 80% relative to reference levels.

[0104] The terms "iRNA," "RNAi agent," "iRNA agent," and "RNA interference agent," as used interchangeably herein, refer to agents that comprise RNA, as those terms are defined herein, and that mediate targeted cleavage of RNA transcripts via the RNA-induced silencing complex (RISC) pathway. iRNA induces sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). iRNA regulates, e.g., inhibits, the expression of a target mRNA sequence, for example, in a cell, e.g., a cell within a subject, such as a mammalian subject.

[0105] In certain embodiments, the "iRNA" for use in the compositions, uses, and methods of the present invention is double-stranded RNA, and is referred to herein as a "double-stranded RNA agent," a "double-stranded RNA (dsRNA) molecule," a "dsRNA agent," or a "dsRNA." The term "dsRNA" refers to a complex of ribonucleic acid molecules having a duplex structure comprising two antiparallel, substantially complementary nucleic acid strands, which are referred to as having "sense" and "antisense" orientations relative to the target RNA. In some embodiments of the present invention, the double-stranded RNA (dsRNA) induces the degradation of target RNA, for example, mRNA, through a post-transcriptional gene silencing mechanism, referred to herein as RNA interference or RNAi.

[0106] The term "antisense strand" or "guide strand" refers to the strand of an iRNA, e.g., a dsRNA, that includes a region that is substantially complementary to a target sequence.

[0107] As used herein, the term "sense strand" or "passenger strand" refers to the strand of an iRNA that includes a region that is substantially complementary to a region of the antisense strand, as defined herein.

[0108] The term "thermally destabilizing modification(s)" refers to the melting temperature (T m ) lower than T m For example, a thermodestabilizing modification can be a modification that results in a dsRNA having a T m can be decreased by 1-4° C., for example, 1° C., 2° C., 3° ​​C. or 4° C. The term "thermally destabilized nucleotide" refers to a nucleotide that includes one or more thermodestabilizing modifications.

[0109] Exemplary thermodestabilizing modifications include abasic modifications; mismatches with the opposing nucleotide in a duplex; and sugar modifications such as 2'-deoxy modifications or acyclic nucleotides, e.g., unlocked nucleic acids (UNAs) or glycol nucleic acids (GNAs), or 2'-5'-linked ribonucleotides ("3'-RNAs").

[0110] As used herein, the term "detecting dsRNA activity" or "measuring dsRNA activity" means that a test for detecting or measuring dsRNA activity is carried out in a specific sample and compared with that of a control sample. Such detection and / or measurement can include a value of zero. Therefore, even if the test for detecting dsRNA activity results in no dsRNA activity (zero dsRNA activity), the step of "detecting dsRNA activity" is still carried out.

[0111] As used herein, the term "control sample" refers to a sample that has not been contacted with an oligomeric compound.

[0112] As used herein, the term "motif" refers to a pattern of unmodified and modified nucleotides in an oligomeric compound.

[0113] As used herein, an "internucleoside linkage" refers to a covalent linkage between adjacent nucleosides.

[0114] As used herein, a "naturally occurring internucleoside linkage" refers to a 3' to 5' phosphodiester linkage.

[0115] As used herein, the term "chimeric oligomer" refers to an oligomeric compound having at least one sugar, nucleobase, or internucleoside linkage that is differentially modified when compared to at least one other sugar, nucleobase, or internucleoside linkage within the same oligomeric compound. The remaining sugars, nucleobases, and internucleoside linkages may be independently modified or unmodified, and may be the same or different.

[0116] As used herein, the term "chimeric oligonucleotide" refers to an oligonucleotide having at least one sugar, nucleobase, or internucleoside linkage that is differentially modified compared to at least one other sugar, nucleobase, or internucleoside linkage within the same oligonucleotide. The remaining sugars, nucleobases, and internucleoside linkages may be independently modified or unmodified, and may be the same or different.

[0117] As used herein, the term "mixed backbone oligomeric compound" refers to an oligomeric compound in which at least one internucleoside linkage of the oligomeric compound is different from at least one other internucleoside linkage of the oligomeric compound.

[0118] As used herein, the term "target protein" refers to a protein whose modulation is desired. For example, a target protein is angiotensinogen (AGT).

[0119] As used herein, the term "target gene" refers to a gene that encodes a target protein. For example, the target gene is angiotensinogen (AGT).

[0120] As used herein, the term "target nucleic acid" refers to any nucleic acid molecule whose expression or activity can be regulated by conjugated or non-conjugated dsRNA compounds.Target nucleic acid includes but is not limited to the RNA transcribed from the DNA encoding target protein (including but not limited to pre-mRNA, mRNA or its part), and also the cDNA and miRNA derived from such RNA.For example, target nucleic acid can be the cellular gene (or the mRNA transcribed from said gene) whose expression is related to a specific disorder or disease state, or the nucleic acid molecule derived from an infectious agent.

[0121] As used herein, the terms "targeted siRNA" and "targeted dsRNA" refer to compounds that are targeted by REVERSIR compounds.

[0122] As used herein, the term "targeting" or "targeted" refers to the association of the antisense strand of a dsRNA with a specific target nucleic acid molecule or a specific region of nucleotides within a target nucleic acid molecule.

[0123] As used herein, the term "nucleobase complementarity" refers to a nucleobase that can base pair with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to the nucleobase of an antisense compound that can base pair with the nucleobase of a target nucleic acid. For example, if the nucleobase at a specific position of an antisense compound can hydrogen bond with the nucleobase at a specific position of a target nucleic acid, the hydrogen bond position between the oligonucleotide and the target nucleic acid is considered to be complementary in this nucleobase pair.

[0124] As used herein, the term "non-complementary nucleobases" refers to a pair of nucleobases that do not form hydrogen bonds with each other or otherwise support hybridization.

[0125] As used herein, "complementary" refers to the ability of an oligomeric compound to hybridize to another oligomeric compound or nucleic acid through nucleobase complementarity. In certain embodiments, an oligomeric compound and its target are complementary to each other when a sufficient number of corresponding positions in each molecule are occupied by nucleobases that can bind to each other to allow stable association between the antisense compound and the target. Those skilled in the art will recognize that it is possible to include mismatches without eliminating the ability of the oligomeric compound to remain associated. Thus, the present specification describes oligomeric compounds that can contain up to about 20% mismatched nucleotides (i.e., nucleobases that are not complementary to the corresponding nucleotides of the target). Preferably, the oligomeric compound contains no more than about 15%, more preferably no more than about 10%, and most preferably no more than 5% mismatches. The remaining nucleotides are nucleobase-complementary or do not otherwise interfere with hybridization (e.g., universal bases). Those skilled in the art will recognize that the compounds provided herein are at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% complementary to the target nucleic acid.

[0126] The terms "complementary," "fully complementary," and "substantially complementary" herein can be used in reference to base matching between two oligonucleotides or polynucleotides, such as the antisense strand of a double-stranded RNA agent and a REVERSIR, as understood in the context of their use.

[0127] As used herein, "hybridization" refers to the pairing of complementary oligomeric compounds (e.g., the antisense strand of a dsRNA and its target nucleic acid, or a REVERSIR and its target dsRNA). Although not limited to a specific mechanism, the most common pairing mechanism involves hydrogen bonding between complementary nucleoside or nucleotide bases (nucleobases), which can be Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen bonds. For example, the natural base adenine is a nucleobase complementary to the natural nucleobases thymidine and uracil, and pairs through the formation of hydrogen bonds. The natural base guanine is a nucleobase complementary to the natural bases cytosine and 5-methylcytosine. Hybridization can occur under various circumstances.

[0128] As used herein, the term " specifically hybridize " refers to the ability of oligomeric compound to hybridize with one nucleic acid site with higher affinity than to hybridize with another nucleic acid site.In certain embodiments, the antisense strand of dsRNA specifically hybridizes with more than one target site.

[0129] As used herein, the term "modulation" refers to the impairment of function or activity compared with the level of function or activity before modulation.For example, modulation includes either increasing (stimulating or inducing) or decreasing (inhibiting or decreasing) the change of gene expression.As another example, the modulation of expression can include impairing the splice site selection of pre-mRNA processing.

[0130] As used herein, the term "expression" refers to all of the functions and processes by which a gene's coded information is converted into structures present and operating within a cell, including, but not limited to, the products of transcription and translation.

[0131] As used herein, " variant " refers to alternative RNA transcripts that can be produced from the same genomic region of DNA.Variant includes, but is not limited to, " pre-mRNA variant ", which is a transcript produced from the same genomic DNA, and differs from other transcripts produced from the same genomic DNA in either start position or stop position, and includes both intron and exon sequences.Variant also includes, but is not limited to, those with alternating splice junctions or alternating start and stop codons.

[0132] As used herein, "high affinity nucleotide modification" refers to a nucleotide that has at least one modified nucleobase, internucleoside linkage, or sugar moiety, compared to a naturally occurring nucleotide, such that the modification increases the affinity of an antisense compound that contains the high affinity modified nucleotide for its target nucleic acid. High affinity modifications include, but are not limited to, nucleotides that contain 2'-modified sugars.

[0133] As used herein, the term "2'-modified" or "2'-substituted" refers to a sugar containing a substituent at the 2' position other than H or OH. 2'-modified monomers include, but are not limited to, BNAs and monomers (e.g., nucleosides and nucleotides) containing a 2'-substituent, such as allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(Rm)(Rn), or O-CH2-C(=O)-N(Rm)(Rn), where each Rm and Rn is independently H or a substituted or unsubstituted C1-C 10 In certain embodiments, the oligomeric compound has the formula 2'-O(CH2) nIn certain embodiments, oligomeric compounds include 2'-modified monomers that do not have the formula 2'-OCH3, or alternatively, 2'-O(CH2)2OCH3.

[0134] As used herein, the term "locked nucleic acid" or "LNA" or "locked nucleoside" or "locked nucleotide" refers to a nucleoside or nucleotide in which the furanose portion of the nucleoside contains a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system. Locked nucleic acids are also called bicyclic nucleic acids (BNAs).

[0135] As used herein, unless otherwise specified, the term "methyleneoxy LNA" refers solely to β-D-methyleneoxy LNA.

[0136] As used herein, the term "MOE" refers to a 2'-O-methoxyethyl substituent.

[0137] As used herein, the term "pharmaceutically acceptable salt" refers to a salt of an active compound that retains the desired biological activity of the active compound and does not impart undesired toxicological effects.

[0138] As used herein, the term "cap structure" or "terminal cap moiety" refers to a chemical modification incorporated at either end of an antisense compound.

[0139] As used herein, the phrase "contacting a cell," e.g., contacting a REVERSIR with a cell, includes contacting a cell by any possible means. Contacting a cell includes contacting a cell in vitro or contacting a cell in vivo. Contacting can be direct or indirect. Thus, for example, a REVERSIR can be physically contacted with a cell by an individual performing the method, or the REVERSIR can be placed in a situation that allows or causes it to subsequently contact a cell.

[0140] Contacting the cells in vitro can be accomplished, for example, by incubating the cells with REVERSIR. Contacting the cells in vivo can be accomplished, for example, by injecting REVERSIR into or near the tissue where the cells are localized, or by injecting REVERSIR into another area, for example, the bloodstream or subcutaneous space, so that the agent subsequently reaches the tissue where the cells to be contacted are localized. A combination of in vitro and in vivo contacting methods is also possible. For example, cells can be contacted with REVERSIR in vitro and then implanted into a subject.

[0141] In certain embodiments, contacting a cell with a REVERSIR includes "introducing the REVERSIR into the cell" or "delivering the REVERSIR to the cell" by promoting or effecting uptake or absorption into the cell. Absorption or uptake of the REVERSIR can occur by unassisted diffusion or active cellular processes, or by auxiliary agents or devices. Introduction of the REVERSIR into the cell can occur in vitro or in vivo. For example, for in vivo introduction, the REVERSIR can be injected into a tissue site or administered systemically. Introduction into cells in vitro includes methods known in the art, such as electroporation and lipofection. Additional approaches are described herein below or known in the art.

[0142] The term "lipid nanoparticle" or "LNP" refers to a vesicle comprising a lipid layer encapsulating a pharmaceutically active molecule, such as a nucleic acid molecule, for example, an iRNA or a plasmid into which the iRNA is transcribed.LNPs are described, for example, in U.S. Patent Nos. 6,858,225, 6,815,432, 8,158,601, and 8,058,069, the entire contents of which are incorporated herein by reference.In some embodiments, one or more of the oligonucleotides (REVERSIR) that inhibit the RNAi activity of double-stranded ribonucleic acid (dsRNA) agents described herein are encapsulated in LNPs.

[0143] As used herein, a "therapeutically effective amount" is intended to include an amount of REVERSIR sufficient to effectively treat the disease (e.g., by reducing, ameliorating, or maintaining an existing disease or one or more symptoms of the disease) when administered to a subject. A "therapeutically effective amount" may vary depending on the REVERSIR, the method of administration of the REVERSIR, the disease and its severity, and the medical history, age, weight, family history, genetic makeup, type of prior or concurrent treatment (if any), and other individual characteristics of the subject being treated.

[0144] A "therapeutically effective amount" also includes that amount of REVERSIR that produces some desired effect at a reasonable benefit / risk ratio applicable to any treatment. The REVERSIR employed in the methods of the present invention can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0145] As used herein, "administering" means providing an RNAi agent and / or REVERSIR to an animal subject, such as a human, and includes, but is not limited to, administration by a medical professional and self-administration.

[0146] As used herein, the term "co-administration" means providing an RNAi agent and a REVERSIR to a subject, such as a human subject. In certain embodiments, the RNAi agent and the REVERSIR are administered together. In certain embodiments, the RNAi agent and the REVERSIR are administered separately. In certain embodiments, the RNAi agent and the REVERSIR are administered simultaneously. In certain embodiments, the RNAi agent and the REVERSIR are administered at different times. In certain embodiments, the RNAi agent and the REVERSIR are administered via the same route of administration. In certain embodiments, the RNAi agent and the REVERSIR are administered via different routes of administration. In certain embodiments, the RNAi agent and the REVERSIR are included in the same pharmaceutical formulation. In certain embodiments, the RNAi agent and the REVERSIR are present in separate formulations.

[0147] The phrase "pharmaceutically acceptable" is employed herein to refer to compounds, materials (including salts), compositions, or dosage forms that are suitable for use in contact with the tissues of human and animal subjects without excessive toxicity, irritation, allergic response, or other problem or complication, within the scope of sound medical judgment, commensurate with a reasonable benefit / risk ratio.

[0148] As used herein, the phrase "pharmaceutically acceptable" refers to a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, magnesium talc, calcium or zinc stearate, or stearic acid), or solvent encapsulating material, that is involved in the transport or transportation of the subject compound from one organ or part of the body to another. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not harmful to the subject being treated. Such carriers are known in the art. Pharmaceutically acceptable carriers include carriers for administration by injection.

[0149] As used herein, the term "in vitro" refers to events that occur not within an organism (e.g., an animal or plant) but in an artificial environment, e.g., in a test tube or reaction vessel, cell culture, etc. As used herein, the term "ex vivo" refers to cells removed from a living organism and cultured outside the body (e.g., in a test tube). As used herein, the term "in vivo" refers to events that occur within an organism (e.g., an animal, plant, and / or microorganism).

[0150] As used herein, a "subject" is an animal, e.g., a mammal, including a primate (e.g., a human, a non-human primate, e.g., a monkey and a chimpanzee), a non-primate (e.g., a cow, a pig, a horse, a goat, a rabbit, a sheep, a hamster, a guinea pig, a cat, a dog, a rat, or a mouse), or a bird, that expresses a universal target sequence either endogenously or heterologously. In an embodiment, the subject is a human. In some embodiments, the subject is a female human. In other embodiments, the subject is a male human. In one embodiment, the subject is an adult subject. In another embodiment, the subject is a pediatric subject.

[0151] In jurisdictions that prohibit the patenting of processes performed on the human body, the meaning of "administering" a composition to a human subject shall be limited to the formulation of a controlled substance that the human subject self-administers by any technique (e.g., orally, inhalation, topical application, injection, insertion, etc.). The broadest reasonable interpretation consistent with the statute or regulation defining patentable subject matter is intended. In jurisdictions that do not prohibit the patenting of processes performed on the human body, "administering" a composition includes both the process and the aforementioned activities performed on the human body.

[0152] As used herein, the term "parenteral administration" refers to administration by injection or infusion. Parenteral administration includes, but is not limited to, subcutaneous, intravenous, or intramuscular administration.

[0153] As used herein, the term "subcutaneous administration" refers to administration just below the skin. "Intravenous administration" means administration into a vein.

[0154] As used herein, the term "dose" refers to a specified amount of a pharmaceutical agent provided in one administration. In certain embodiments, a dose can be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, when subcutaneous administration is desired, the desired dose requires a volume that cannot be easily accommodated in a single injection. In such embodiments, two or more injections can be used to achieve the desired dose. In certain embodiments, a dose can be administered in two or more injections to minimize injection site reactions in individuals.

[0155] As used herein, the term "dosage unit" refers to the form in which the RNAi agent and / or REVERSIR is provided. In certain embodiments, the dosage unit is a vial containing a lyophilized RNAi agent and / or REVERSIR. In certain embodiments, the dosage unit is a vial containing a reconstituted RNAi agent and / or REVERSIR.

[0156] As used herein, the term "active pharmaceutical ingredient" refers to the substance in a pharmaceutical composition that provides a desired effect.

[0157] As used herein, the term "side effects" refers to physiological responses resulting from treatment other than the desired effect. In certain embodiments, side effects include, but are not limited to, injection site reactions, liver function test abnormalities, renal function abnormalities, hepatotoxicity, nephrotoxicity, central nervous system abnormalities, and myopathy. For example, an increase in serum aminotransferase levels may indicate liver toxicity or liver function abnormalities. For example, an increase in bilirubin may indicate liver toxicity or liver function abnormalities.

[0158] As used herein, the term "sample" includes similar fluid, cell, or tissue collections isolated from a subject, as well as fluids, cells, or tissues present within a subject. Examples of biological fluids include blood, serum and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, and the like. Tissue samples can include samples from tissues, organs, or localized regions. For example, samples can be obtained from specific organs, parts of organs, or fluids or cells within those organs. In certain embodiments, samples can be derived from the liver (e.g., the entire liver, or specific segments of the liver, or specific types of cells within the liver, such as hepatocytes). In some embodiments, a "sample from a subject" refers to urine obtained from a subject. A "sample from a subject" can refer to blood or blood-derived serum or plasma obtained from a subject.

[0159] As used herein, the term "alkyl" refers to a saturated straight-chain or branched hydrocarbon radical containing up to 24 carbon atoms. Examples of alkyl groups include, but are not limited to, methyl, ethyl, propyl, butyl, isopropyl, n-hexyl, octyl, decyl, dodecyl, and the like. Alkyl groups typically contain 1 to about 24 carbon atoms, more typically 1 to about 12 carbon atoms (C1-C12 alkyl), with 1 to about 6 carbon atoms being more preferred. As used herein, the term "lower alkyl" includes 1 to about 6 carbon atoms. As used herein, alkyl groups may optionally include one or more further substituents.

[0160] As used herein, the term "alkenyl" refers to a straight or branched hydrocarbon chain radical containing up to 24 carbon atoms and having at least one carbon-carbon double bond. Examples of alkenyl groups include, but are not limited to, ethenyl, propenyl, butenyl, 1-methyl-2-buten-1-yl, dienes such as 1,3-butadiene, and the like. Alkenyl groups typically contain from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms, with from 2 to about 6 carbon atoms being more preferred. Alkenyl groups as used herein may optionally contain one or more further substituents.

[0161] As used herein, the term "alkynyl" refers to a straight-chain or branched hydrocarbon radical containing up to 24 carbon atoms and having at least one carbon-carbon triple bond. Examples of alkynyl groups include, but are not limited to, ethynyl, 1-propynyl, 1-butynyl, and the like. Alkynyl groups typically contain from 2 to about 24 carbon atoms, more typically from 2 to about 12 carbon atoms, with from 2 to about 6 carbon atoms being more preferred. Alkynyl groups as used herein may optionally contain one or more further substituents.

[0162] As used herein, the term "aminoalkyl" refers to an amino-substituted alkyl radical. This term is intended to include C1-C12 alkyl groups with an amino substituent at any position, where the alkyl group attaches the aminoalkyl group to the parent molecule. The alkyl and / or amino portions of the aminoalkyl group can be further substituted with substituents.

[0163] As used herein, the term "aliphatic" refers to a straight-chain or branched hydrocarbon radical containing up to 24 carbon atoms, with the saturation between any two carbon atoms being a single, double, or triple bond. Aliphatic groups preferably contain from 1 to about 24 carbon atoms, more typically from 1 to about 12 carbon atoms, with from 1 to about 6 carbon atoms being more preferred. The straight or branched chain of the aliphatic group may be interrupted by one or more heteroatoms, including nitrogen, oxygen, sulfur, and phosphorus. Such heteroatom-interrupted aliphatic groups include, but are not limited to, polyalkoxy, e.g., polyalkylene glycols, polyamines, and polyimines. The aliphatic groups used herein may optionally contain additional substituents.

[0164] As used herein, the term "alicyclic" or "alicyclic" refers to a cyclic ring system in which the ring is aliphatic. The ring system can contain one or more rings, at least one of which is aliphatic. Preferred alicyclics include rings having from about 5 to about 9 carbon atoms in the ring. As used herein, alicyclics can optionally contain further substituents. As used herein, the term "alkoxy" refers to a radical formed between an alkyl group and an oxygen atom, where the oxygen atom is used to attach the alkoxy group to the parent molecule. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, n-pentoxy, neopentoxy, n-hexoxy, and the like. As used herein, alkoxy groups can optionally contain further substituents. As used herein, the terms "halo" and "halogen" refer to an atom selected from fluorine, chlorine, bromine, and iodine.

[0165] As used herein, the terms "aryl" and "aromatic" refer to a monocyclic or polycyclic carbocyclic ring system radical having one or more aromatic rings. Examples of aryl groups include, but are not limited to, phenyl, naphthyl, tetrahydronaphthyl, indanyl, idenyl, and the like. Preferred aryl ring systems have from about 5 to about 20 carbon atoms in one or more rings. Aryl groups as used herein may optionally include further substituents.

[0166] As used herein, the terms "aralkyl" and "arylalkyl" refer to a radical formed between an alkyl group and an aryl group, where the alkyl group is used to attach the aralkyl group to the parent molecule. Examples include, but are not limited to, benzyl, phenethyl, and the like. Aralkyl groups as used herein can optionally include additional substituents attached to the alkyl group, the aryl group, or both, which form the radical group.

[0167] As used herein, the term "heterocyclic radical" refers to a monocyclic or polycyclic radical ring system that contains at least one heteroatom and is unsaturated, partially saturated, or fully saturated, thereby including heteroaryl groups. Heterocycle is also meant to include fused ring systems, where one or more of the fused rings contain at least one heteroatom, and the other rings may contain one or more heteroatoms, or, where appropriate, no heteroatoms. Heterocyclic groups typically contain at least one atom selected from sulfur, nitrogen, or oxygen. Examples of heterocyclic groups include [1,3]dioxolane, pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, quinoxalinyl, pyridazinonyl, tetrahydrofuryl, and the like. As used herein, heterocyclic groups may optionally contain additional substituents. As used herein, the terms "heteroaryl" and "heteroaromatic" refer to radicals containing monocyclic or polycyclic aromatic rings, ring systems, or fused ring systems in which at least one of the rings is aromatic and contains one or more heteroatoms. Heteroaryl is also meant to include fused ring systems, including systems in which one or more fused rings contain no heteroatoms. Heteroaryl groups typically contain one ring atom selected from sulfur, nitrogen, or oxygen. Examples of heteroaryl groups include, but are not limited to, pyridinyl, pyrazinyl, pyrimidinyl, pyrrolyl, pyrazolyl, imidazolyl, thiazolyl, oxazolyl, isoxazolyl, thiadiazolyl, oxadiazolyl, thiophenyl, furanyl, quinolinyl, isoquinolinyl, benzimidazolyl, benzoxazolyl, quinoxalinyl, and the like. Heteroaryl radicals can be attached to a parent molecule directly or through a linking moiety such as an aliphatic group or a heteroatom. As used herein, heteroaryl groups can optionally contain additional substituents.

[0168] As used herein, the term "heteroarylalkyl" refers to a heteroaryl group, as defined above, having an alkyl radical that can attach the heteroarylalkyl group to a parent molecule. Examples include, but are not limited to, pyridinylmethyl, pyrimidinylethyl, naphthyridinylpropyl, and the like. As used herein, heteroarylalkyl groups can optionally include further substituents on either or both the heteroaryl or alkyl portions.

[0169] As used herein, the term "monocyclic or polycyclic structure" refers to all ring systems, whether monocyclic or polycyclic, with fused or linked rings, including monocyclic and mixed rings individually selected from aliphatic, alicyclic, aryl, heteroaryl, aralkyl, arylalkyl, heterocyclic, heteroaryl, heteroaromatic, and heteroarylalkyl. Such monocyclic and polycyclic structures can contain rings that are homogeneous or have various degrees of saturation, including fully saturated, partially saturated, or fully unsaturated. Each ring can contain ring atoms selected from C, N, O, and S, resulting in heterocyclic rings and rings containing only C ring atoms, which can exist in mixed motifs, such as benzimidazole, where one ring has only carbon ring atoms and the fused ring has two nitrogen atoms. The monocyclic or polycyclic structure can be further substituted with a substituent, such as phthalimide, which has two =O groups attached to one of the rings. In another embodiment, the monocyclic or polycyclic structure can be directly attached to the parent molecule through a ring atom, through a substituent, or through a bifunctional linking moiety.

[0170] As used herein, the term "acyl" refers to a radical formed by removal of a hydroxyl group from an organic acid and has the general formula -C(O)-X, where X is typically aliphatic, alicyclic, or aromatic. Examples include aliphatic carbonyls, aromatic carbonyls, aliphatic sulfonyls, aromatic sulfinyls, aliphatic sulfinyls, aromatic phosphates, aliphatic phosphates, and the like. As used herein, acyl groups can optionally include further substituents.

[0171] As used herein, the term "hydrocarbyl" includes groups containing C, O, and H. Included are straight-chain, branched, and cyclic groups of any degree of saturation. Such hydrocarbyl groups may contain one or more heteroatoms selected from N, O, and S, and may further be mono- or polysubstituted with one or more substituents.

[0172] As used herein, the terms "substituent" and "substituent group" include groups that are typically added to other groups or parent compounds to enhance a desired property or impart a desired effect. Substituents can be protected or unprotected and can be added to one available site or multiple available sites in the parent compound. Substituents can also be further substituted with other substituents and can be attached to the parent compound directly or through a linking group such as an alkyl group or hydrocarbyl group. Such groups include, but are not limited to, halogen, hydroxyl, alkyl, alkenyl, alkynyl, acyl (-C(O)Ra), carboxyl (-C(O)O-Ra), aliphatic groups, alicyclic groups, alkoxy, substituted oxo (-O-Ra), aryl, aralkyl, heterocycle, heteroaryl, heteroarylalkyl, amino (-NRbbRcc), imino (=NRbb), amido (-C(O)N-RbbRcc or -N(Rbb)C(O)Ra), azido (-N3), nitro (-NO2), cyano (-CN), carbamido (-OC(O)NRbbRcc or -OC(O)NRbbRcc). or -N(Rbb)C(O)ORaa), ureido (-N(Rbb)C(O)NRbbRcc), thioureido (-N(Rbb)C(S)NRbbRcc), guanidinyl (-N(Rbb)C(=O)NRbb)NRbbRcc), amidinyl (-C(=NRbb)-NRbbRcc or -N(Rbb)C(NRbb)Raa), thiol (-SRbb), sulfinyl (-S(O)Rbb), sulfonyl (-S(O)Rbb), sulfonamidyl (-S(O)NRbbRcc or -N(Rbb)S(O)Rbb), and conjugate groups. wherein each Ra, Rbb, and Rcc is independently H, an appropriately linked chemical functional group, or a further substituent, with a preferred list including, but not limited to, H, alkyl, alkenyl, alkynyl, aliphatic, alkoxy, acyl, aryl, aralkyl, heteroaryl, alicyclic, heterocyclic, and heteroarylalkyl.

[0173] II. REVERSIR COMPOUNDS OF THE INVENTION The present invention provides REVERSIR compounds that inhibit the RNAi inhibitory activity of dsRNA agents that contain thermodestabilizing nucleotide modifications in the antisense strand.

[0174] Generally, REVERSIR compounds of the invention are single-stranded oligonucleotides (oligomers) 16-30 nucleotides in length, e.g., 16-24, 18-22, or 18-20 nucleotides in length. The single-stranded oligonucleotides comprise a nucleotide sequence that is substantially complementary to the antisense strand of a dsRNA agent that contains a thermodestabilizing nucleotide modification. The nucleotide sequence of the oligonucleotide can be at least about 90%, e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to the entire nucleotide sequence of the antisense strand of the dsRNA agent.

[0175] In certain embodiments, REVERSIR compounds are oligomeric compounds that are chemically modified compared to naturally occurring oligomers such as DNA or RNA.

[0176] Thus, in certain embodiments, the REVERSIR compounds of the present invention comprise at least one modified nucleotide, ie, at least one modified monomer.

[0177] In other embodiments, substantially all of the nucleotides of the oligonucleotide are modified nucleotides, e.g., no more than 5, 4, 3, 2, or 1 of the nucleotides are unmodified nucleotides, e.g., substantially all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

[0178] In still other embodiments, all of the nucleotides of the oligonucleotide are modified nucleotides, e.g., all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

[0179] In certain such embodiments, the REVERSIR compounds of the invention comprise one or more high affinity modifications. In one embodiment, the REVERSIR compounds of the invention comprise four high affinity modifications. In one embodiment, the REVERSIR compounds of the invention comprise five high affinity modifications.

[0180] In certain embodiments, such high affinity modifications include modifications (e.g., nucleosides and nucleotides) that include 2'-modified sugars, including, but not limited to, BNAs and modifications (e.g., nucleosides and nucleotides) that include 2'-substituents, such as allyl, amino, azido, thio, O-allyl, O-C1-C 10 alkyl, -OCF3, O-(CH2)2-O-CH3, 2'-O(CH2)2SCH3, O-(CH2)2-ON(Rm)(Rn), or O-CH2-C(=O)-N(Rm)(Rn), where each Rm and Rn is independently H or a substituted or unsubstituted C1-C 10 The group is selected from those having the following structure:

[0181] In certain embodiments, REVERSIR compounds of the present invention comprise one or more β-D-methyleneoxy (4′-CH 2 —O-2′) LNA modifications.

[0182] In certain embodiments, REVERSIR compounds of the invention comprise one or more α-D-methyleneoxy (4′-CH 2 —O-2′) LNA modifications.

[0183] In certain embodiments, REVERSIR compounds of the invention contain one or more (S)-cEt modifications.

[0184] In certain embodiments, the REVERSIR compounds of the present invention are those in which the compound is 2'-O(CH2) n It contains one or more high affinity modifications, provided that it does not contain any nucleotides containing H (where n is 1-6).

[0185] In certain embodiments, REVERSIR compounds of the invention contain one or more high affinity modifications, provided that the compounds do not contain nucleotides containing 2'-OCH3 or 2'-O(CH2)2OCH3.

[0186] In certain embodiments, REVERSIR compounds of the invention include one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) high affinity modifications, provided that the compound does not include α-L-methyleneoxy (4′-CH2-O-2′) LNA.

[0187] In certain embodiments, REVERSIR compounds of the invention comprise one or more high affinity modifications, provided that the compounds do not comprise β-D-methyleneoxy(4′-CH 2 —O-2′) LNA.

[0188] In certain embodiments, REVERSIR compounds of the invention contain one or more high affinity modifications, provided that the compounds do not contain α-L-methyleneoxy(4'-CH2-O-2')LNA or β-D-methyleneoxy(4'-CH2-O-2')LNA.

[0189] In some embodiments, at least one of the nucleotides comprising the high-affinity nucleotide modification base pairs with a nucleotide comprising a thermally destabilized nucleotide in the antisense strand of the dsRNA agent.

[0190] In some embodiments, the REVERSIR compounds of the present invention comprise at least two high affinity nucleotide modifications, e.g., LNA. In some embodiments, the at least two high affinity nucleotide modifications, e.g., LNA, are located at positions 2 and 6, 2 and 5, 2 and 7, 2 and 8, 2 and 9, 2 and 14, 2 and 15, and / or 2 and 16, counting from the 3' end of the oligonucleotide.

[0191] In one embodiment, a REVERSIR compound of the invention comprises four high affinity modifications, e.g., four LNAs. In one embodiment, a REVERSIR compound of the invention comprises five high affinity modifications, e.g., five LNAs.

[0192] In certain embodiments, the high affinity nucleotide modifications, e.g., LNAs, are at positions 2, 6, 8, and 14; positions 2, 4, 5, 6, and 7; positions 2, 4, 6, 8, and 13; positions 2, 4, 6, 8, and 14; positions 2, 4, 6, 8, and 15; positions 2, 4, 6, 8, and 16; positions 2, 8, 10, and 14; positions 2, 4, 6, 8, and 14; or positions 2, 8, 12, and 14, counting from the 3' end of the oligonucleotide.

[0193] The naturally occurring base moiety of a nucleoside is typically a heterocyclic base. The two most common classes of such heterocyclic bases are purines and pyrimidines. For nucleosides containing a pentofuranosyl sugar, the phosphate group can be linked to the 2', 3', or 5' hydroxyl moiety of the sugar. When forming oligonucleotides, these phosphate groups covalently link adjacent nucleosides to each other to form a linear polymeric compound. Within oligonucleotides, the phosphate groups are commonly referred to as forming the internucleoside or internucleotide backbone of the oligonucleotide. The naturally occurring linkage or backbone of RNA and DNA is the 3' to 5' phosphodiester linkage.

[0194] In addition to "unmodified" or "natural" nucleobases, such as the purine nucleobases adenine (A) and guanine (G), and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U), many modified nucleobases or nucleobase mimics known to those skilled in the art are applicable to the compounds described herein. Unmodified or natural nucleobases can be modified or substituted to provide oligonucleotides with improved properties. For example, nuclease-resistant oligonucleotides can be prepared using these bases, or using synthetic and natural nucleobases (e.g., inosine, xanthine, hypoxanthine, nubularine, isoguanisine, or tubercidin) with any one of the oligomer modifications described herein. Alternatively, substituted or modified analogs of any of the above bases and "universal bases" can also be employed. When a natural base is replaced with an unnatural base and / or a universal base, the nucleotide is referred to herein as comprising a modified nucleobase and / or a nucleobase modification. Modified nucleobases and / or nucleobase modifications also include conjugated moieties, such as natural bases, unnatural bases, and universal bases, including the ligands described herein. Preferred conjugation moieties for conjugation with nucleobases include cationic amino groups, which can be conjugated to the nucleobase via a linker having a suitable alkyl, alkenyl, or amide bond.

[0195] The REVERSIR compounds described herein can also include modifications or substitutions of nucleobases (often simply referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Exemplary modified nucleobases include, but are not limited to, other synthetic and natural nucleobases, such as inosine, xanthine, hypoxanthine, nubularine, isoguanisine, tubercidin, 2-(halo)adenine, 2-(alkyl)adenine, 2-(propyl)adenine, 2-(amino)adenine, 2-(aminoalkyl)adenine, 2-(aminopropyl)adenine, 2-(methylthio)-N 6 -(Isopentenyl)adenine, 6-(Alkyl)adenine, 6-(Methyl)adenine, 7-(Deaza)adenine, 8-(Alkenyl)adenine, 8-(Alkyl)adenine, 8-(Alkynyl)adenine, 8-(Amino)adenine, 8-(Halo)adenine, 8-(Hydroxyl)adenine, 8-(Thioalkyl)adenine, 8-(Thiol)adenine, N 6 -(Isopentyl)adenine, N 6 -(methyl)adenine, N 6 ,N 6 -(Dimethyl)adenine, 2-(alkyl)guanine, 2-(propyl)guanine, 6-(alkyl)guanine, 6-(methyl)guanine, 7-(alkyl)guanine, 7-(methyl)guanine, 7-(deaza)guanine, 8-(alkyl)guanine, 8-(alkenyl)guanine, 8-(alkynyl)guanine, 8-(amino)guanine, 8-(halo)guanine, 8-(hydroxyl)guanine, 8-(thioalkyl)guanine cytosine, 8-(thiol)guanine, N-(methyl)guanine, 2-(thio)cytosine, 3-(deaza)-5-(aza)cytosine, 3-(alkyl)cytosine, 3-(methyl)cytosine, 5-(alkyl)cytosine, 5-(alkynyl)cytosine, 5-(halo)cytosine, 5-(methyl)cytosine, 5-(propynyl)cytosine, 5-(trifluoromethyl)cytosine, 6-(azo)cytosine, N 4-(Acetyl)cytosine, 3-(3-amino-3-carboxypropyl)uracil, 2-(thio)uracil, 5-(methyl)-2-(thio)uracil, 5-(methylaminomethyl)-2-(thio)uracil, 4-(thio)uracil, 5-(methyl)-4-(thio)uracil, 5-(methylaminomethyl)-4-(thio)uracil, 5-(methyl)-2,4-(dithio)uracil, 5-(methylaminomethyl)-2,4-(dithio)uracil, 5-(2-aminopropyl)uracil, 5-(alkyl)uracil, 5-(alkynyl)uracil, 5-(allylamino)uracil, 5-(aminoallyl)uracil , 5-(aminoalkyl)uracil, 5-(guanidiniumalkyl)uracil, 5-(1,3-diazole-1-alkyl)uracil, 5-(cyanoalkyl)uracil, 5-(dialkylaminoalkyl)uracil, 5-(dimethylaminoalkyl)uracil, 5-(halo)uracil, 5-(methoxy)uracil, uracil-5-oxyacetic acid, 5-(methoxycarbonylmethyl)-2-(thio)uracil, 5-(methoxycarbonylmethyl)uracil, 5-(propynyl)uracil, 5-(propynyl)uracil, 5-(trifluoromethyl)uracil, 6-(azo)uracil, dihydrouracil, N 3-(methyl)uracil, 5-uracil (i.e., pseudouracil), 2-(thio)pseudouracil, 4-(thio)pseudouracil, 2,4-(dithio)pseudouracil, 5-(alkyl)pseudouracil, 5-(methyl)pseudouracil, 5-(alkyl)-2-(thio)pseudouracil, 5-(methyl)-2-(thio)pseudouracil, 5-(alkyl)-4-(thio)pseudouracil, 5-(methyl)-4-(thio)pseudouracil, 5-(alkyl)-2,4-(dithio)pseudouracil Pseudouracil, 5-(methyl)-2,4-(dithio)pseudouracil, 1-substituted pseudouracil, 1-substituted 2(thio)-pseudouracil, 1-substituted 4-(thio)pseudouracil, 1-substituted 2,4-(dithio)pseudouracil, 1-(aminocarbonylethylenyl)-pseudouracil, 1-(aminocarbonylethylenyl)-2(thio)-pseudouracil, 1-(aminocarbonylethylenyl)-4-(thio)pseudouracil, 1-(aminocarbonylethylenyl)-2,4-(dithio)pseudouracil Douracil, 1-(aminoalkylaminocarbonylethylenyl)-pseudouracil, 1-(aminoalkylaminocarbonylethylenyl)-2(thio)-pseudouracil, 1-(aminoalkylaminocarbonylethylenyl)-4-(thio)pseudouracil, 1-(aminoalkylaminocarbonylethylenyl)-2,4-(dithio)pseudouracil, 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 1 ,3-(diaza)-2-(oxo)-phenthiazin-1-yl, 1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-substituted 1,3-(diaza)-2-(oxo)-phenthiazin-1-yl, 7-substituted 1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(aminoalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl, 7-(aminoalkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl, 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl, 7-(guanidiniumalkylhydroxy)-1,3-(diaza)-2-(oxo)-phenoxazin-1-yl alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenoxazin-1-yl, 7-(guanidinium alkylhydroxy)-1,3-(diaza)-2-(oxo)-phenthiazin-1-yl, 7-(guanidinium alkylhydroxy)-1-(aza)-2-(thio)-3-(aza)-phenthiazin-1-yl, 1,3,5-(triaza)-2,6-(dioxa)-naphthalene, inosine, xanthine, hypoxanthine, nubularine, tubercidin, isoguanisine, inosinyl, 2-aza-inosinyl, 7-deaza- Inosinyl, Nitroimidazolyl, Nitropyrazolyl, Nitrobenzimidazolyl, Nitroindazolyl, Aminoindolyl, Pyrrolopyrimidinyl, 3-(Methyl)isocarbostyril, 5-(Methyl)isocarbostyril, 3-(Methyl)-7-(Propynyl)isocarbostyril, 7-(Aza)indolyl, 6-(Methyl)-7-(Aza)indolyl, Imidizopyridinyl, 9-(Methyl)-Imidizopyridinyl, Pyrrolopyridinyl, Isocarbostyril, 7-(Propynyl)isocarbostyril, Propynyl-7-(Aza)indolyl , 2,4,5-(trimethyl)phenyl, 4-(methyl)indolyl, 4,6-(dimethyl)indolyl, phenyl, naphthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, difluorotolyl, 4-(fluoro)-6-(methyl)benzimidazole, 4-(methyl)benzimidazole, 6-(azo)thymine, 2-pyridinone, 5-nitroindole, 3-nitropyrrole, 6-(aza)pyrimidine, 2-(amino)purine, 2,6-(diamino)purine, 5-substituted pyrimidines, N, 2 -substituted purines, N6 -substituted purines, O 6 -substituted purines, substituted 1,2,4-triazoles, pyrrolo-pyrimidin-2-one-3-yl, 6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-substituted-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, para-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin Examples of suitable bases include pyridin-2-one-3-yl, ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, bis-ortho-(aminoalkylhydroxy)-6-phenyl-pyrrolo-pyrimidin-2-one-3-yl, pyridopyrimidin-3-yl, 2-oxo-7-amino-pyridopyrimidin-3-yl, 2-oxo-pyridopyrimidin-3-yl, or any of their O- or N-alkylated derivatives. Alternatively, substituted or modified analogs of any of the above bases and "universal bases" can be employed.

[0196] As used herein, a universal nucleobase is any nucleobase that can base pair with all four naturally occurring nucleobases without substantially affecting the melting behavior, recognition by intracellular enzymes, or activity of an oligonucleotide duplex. Some exemplary universal nucleobases include, but are not limited to, 2,4-difluorotoluene, nitropyrrolyl, nitroindolyl, 8-aza-7-deazaadenine, 4-fluoro-6-methylbenzimidazole, 4-methylbenzimidazole, 3-methylisocarbostyril, 5-methylisocarbostyril, 3-methyl-7-propynylisocarbostyril, 7-azaindolyl, 6-methyl-7-azaindolyl, imidizopyridinyl, 9-methyl-imidizopyridinyl, pyrrolopyridinyl, isocarbostyril, 7-propynylisocarbostyril, propynyl-7-azaindolyl, 2,4,5-trimethylphenyl, 4-methylinolyl, 4,6-dimethylindolyl, phenyl, naphthalenyl, anthracenyl, phenanthracenyl, pyrenyl, stilbenyl, tetracenyl, pentacenyl, and structural derivatives thereof (e.g., Loakes, 2001, Nucleic Acids Research, 29, 2437-2447).

[0197] No. 3,687,808; those disclosed in International Application No. PCT / US09 / 038425, filed March 26, 2009; those disclosed in Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, JI, ed. John Wiley & Sons, 1990; those disclosed in English et al., Angewandte Chemie, International Edition, 1991, 30, 613; those disclosed in Modified Nucleosides in Biochemistry, Biotechnology and Medicine, Herdewijin, P. Ed. Wiley-VCH, 2008; and those disclosed in Sanghvi, YS, Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Eds., CRC Press, 1993. The contents of all of the above are incorporated herein by reference.

[0198] In certain embodiments, modified nucleobase is the nucleobase that has a structure that is substantially similar to that of parent nucleobase, such as 7-deazapurine, 5-methylcytosine or G-clamp.In certain embodiments, nucleobase mimics include more complex structures, such as tricyclic phenoxazine nucleobase mimics.The method for preparing the above-mentioned modified nucleobase is well known to those skilled in the art.

[0199] In some embodiments, the REVERSIR compounds of the present invention are:

[0200] [ka] (n is 0, 1, 2, 3, 4, 5, or 6) and at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) G-clamp nucleobase selected from:

[0201] The REVERSIR compounds provided herein can comprise one or more monomers, including nucleosides or nucleotides with modified sugar moieties.For example, the furanosyl sugar ring of a nucleoside can be modified in many ways, including but not limited to, adding a substituent, or bridging two non-genetic ring atoms to form a locked nucleic acid or bicyclic nucleic acid.In certain embodiments, the compound comprises one or more monomers that are LNA.

[0202] In some embodiments of the locked nucleic acid, the 2' position of the flunaosyl is -[C(R1)(R2)] n -, -[C(R1)(R2)] n -O-, -[C(R1)(R2)] n -N(R1)-, -[C(R1)(R2)] n -N(R1)-O-, -[C(R1R2)] n -ON(R1)-, -C(R1)=C(R2)-O-, -C(R1)=N-, -C(R1)=NO-, -C(=NR1)-, -C(=NR1)- O-, -C(=O)-, -C(=O)O-, -C(=S)-, -C(=S)O-, -C(=S)S-, -O-, -Si(R1)2-, -S(=O) x - and -N(R1)-; During the ceremony, x is 0, 1 or 2; n is 1, 2, 3 or 4; each R and R is independently H, a protecting group, hydroxyl, C-C alkyl, substituted C-C alkyl, C-C alkenyl, substituted C-C alkenyl, C-C alkynyl, substituted C-C alkynyl, C-C aryl, substituted C-C aryl, heterocyclic radical, substituted heterocyclic radical, heteroaryl, substituted heteroaryl, C-C alicyclic radical, substituted C-C alicyclic radical, halogen, OJ, NJJ, SJ, N, COOJ, acyl (C(=O)-H)), substituted acyl, CN, sulfonyl (S(=O)-J), or sulfoxyl (S(=O)-J); Each J1 and J2 is independently H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)-H), substituted acyl, heterocyclic radical, substituted heterocyclic radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl, or a protecting group.

[0203] In one embodiment, each of the linkers of the LNA compound is independently -[C(R1)(R2)]n-, -[C(R1)(R2)]nO-, -C(R1R2)-N(R1)-O-, or -C(R1R2)-ON(R1)-. In another embodiment, each of the linkers is independently 4'-CH2-2', 4'-(CH2)2-2', 4'-(CH2)3-2', 4'-CH2-O-2', 4'-(CH2)2-O-2', 4'-CH2-ON(R1)-2', and 4'-CH2-N(R1)-O-2'-, where each R1 is independently H, a protecting group, or C1-C12 alkyl.

[0204] Certain LNAs have been prepared and disclosed in the patent and scientific literature (Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; International Publication No. WO94 / 14226; International Publication No. WO2005 / 021570; Singh et al., J. Org. Chem., 1998, 63, 10035-10039); Examples of issued U.S. patents and published applications disclosing LNAs include, for example, U.S. Patent Nos. 7,053,207; 6,268,490; 6,770,748; 6,794,499; 7,034,133; and 6,525,191; and U.S. Patent Application Publication Nos. 2004-0171570; 2004-0219565; 2004-0014959; 2003-0207841; 2004-0143114; and 2003-0082807.

[0205] Also provided herein are LNAs in which the 2'-hydroxyl group of the ribosyl sugar ring is linked to the 4' carbon atom of the sugar ring, thereby forming a methyleneoxy (4'-CH2-O-2') linkage to form a bicyclic sugar moiety (reviewed in Elayadi et al., Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; see also U.S. Pat. Nos. 6,268,490 and 6,670,461). The linkage can be a methylene (-CH2-) group bridging the 2' oxygen atom and the 4' carbon atom, in which case the term methyleneoxy(4'-CH2-O-2')LNA is used for the bicyclic moiety; if there is an ethylene group at this position, the term ethyleneoxy(4'-CH2CH2-O-2')LNA is used (Singh et al., Chem. Commun., 1998, 4, 455-456; Morita et al., Bioorganic Medicinal Chemistry, 2003, 11, 2211-2226). Methyleneoxy(4'-CH2-O-2')LNA and other bicyclic sugar analogs exhibit very high duplex thermal stability with complementary DNA and RNA (Tm = +3 to +10°C), stability against 3'-exonuclease degradation, and good solubility. Potent, non-toxic antisense oligonucleotides, including BNAs, have been described (Wahlestedt et al., Proc. Natl. Acad. Sci. USA, 2000, 97, 5633-5638).

[0206] A similarly investigated isomer of methyleneoxy(4'-CH2-O-2')LNA is alpha-L-methyleneoxy(4'-CH2-O-2')LNA, which has been shown to have superior stability against 3'-exonucleases. Alpha-L-methyleneoxy(4'-CH2-O-2')LNA has been incorporated into antisense gapmers and chimeras that have demonstrated potent antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).

[0207] The synthesis and preparation of methyleneoxy (4'-CH2-O-2') LNA monomers adenine, cytosine, guanine, 5-methyl-cytosine, thymine and uracil, and their oligomerization and nucleic acid recognition properties have been described (Koshkin et al., Tetrahedron, 1998, 54, 3607-3630).BNA and its preparation are also described in International Publication Nos. WO98 / 39352 and WO99 / 14226.

[0208] Analogs of methyleneoxy (4'-CH2-O-2') LNA, phosphorothioate-methyleneoxy (4'-CH2-O-2') LNA and 2'-thio-LNA have also been prepared (Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222). The preparation of locked nucleoside analogs containing oligodeoxyribonucleotide duplexes as substrates for nucleic acid polymerases has also been described (Wengel et al., WO 99 / 14226). Furthermore, the synthesis of 2'-amino-LNA, a novel conformationally restricted high-affinity oligonucleotide analog, has been described in the art (Singh et al., J. Org. Chem., 1998, 63, 10035-10039). Additionally, 2'-amino- and 2'-methylamino-LNAs have been prepared and the thermal stability of duplexes with complementary RNA and DNA strands has been previously reported.

[0209] Modified sugar moieties are well known and can be used to change, typically increase, the affinity of antisense compounds for their targets and / or increase nuclease resistance. A representative list of preferred modified sugars includes, but is not limited to, bicyclic modified sugars, such as methyleneoxy (4'-CH2-O-2') LNA and ethyleneoxy (4'-(CH2)2-O-2'-bridged) ENA; substituted sugars, particularly 2'-substituted sugars with 2'-F, 2'-OCH3, or 2'-O(CH2)2-OCH3 substituents; and 4'-thio modified sugars. Sugars can also be substituted, particularly with sugar mimetic groups. Methods for preparing modified sugars are well known to those skilled in the art. Some representative patents and publications that teach the preparation of such modified sugars include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427 Nos. 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; 5,792,747; 5,700,920; 6,531,584; and 6,600,032; and International Publication No. WO 2005 / 121371.

[0210] Examples of modifications of the "oxy"-2' hydroxyl group include alkoxy or aryloxy (OR, e.g., R = H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); polyethylene glycol (PEG), O(CH2CHO) n CH2CH2OR, n = 1-50; "locked" nucleic acids (LNAs) in which the furanose portion of the nucleoside contains a bridge connecting two carbon atoms on the furanose ring, thereby forming a bicyclic ring system; O-AMINE or O-(CH2) nAMINE (n=1-10, AMINE=NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, ethylenediamine or polyamino); and O-CH2CH2(NCH2CH2NMe2)2.

[0211] "Deoxy" modifications include hydrogen (i.e., deoxyribose sugars particularly associated with single-stranded overhangs); halo (e.g., fluoro); amino (e.g., NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid); NH(CHCHNH) n These include CH2CH2-AMINE (AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino); -NHC(O)R (R = alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar); cyano; mercapto; alkyl-thio-alkyl; thioalkoxy; thioalkyl; alkyl; cycloalkyl; aryl; alkenyl, and alkynyl, which may be optionally substituted, for example, with an amino functionality.

[0212] Other suitable 2'-modifications, such as modified MOEs, are described in US Patent Application Publication No. 20130130378, the contents of which are incorporated herein by reference.

[0213] Modifications at the 2' position may be in the arabinose configuration. The term "arabinose configuration" refers to placing the substituent on C2' of the ribose in the same configuration as the 2'-OH is in arabinose.

[0214] A sugar can contain two different modifications, e.g., gem modifications, at the same carbon of the sugar. The sugar group can also contain one or more carbons with the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, a REVERSIR compound can contain one or more monomers containing, for example, arabinose as the sugar. The monomer can have an alpha linkage at the 1'-position of the sugar, e.g., an alpha-nucleoside. The monomer can also have the opposite configuration at the 4'-position, e.g., the C5' and H4' or the substituents replacing them are interchanged. When the C5' and H4' or the substituents replacing them are interchanged, the sugar is said to be modified at the 4'-position.

[0215] The REVERSIR compounds of the present invention can also contain abasic sugars, i.e., sugars that lack a nucleobase at C-1' or have other chemical groups in place of a nucleobase at C1'. See, for example, U.S. Pat. No. 5,998,203, the contents of which are incorporated herein in their entirety. These abasic sugars can also further contain modifications to one or more of the constituent sugar atoms. The REVERSIR compounds can also contain one or more sugars that are L-isomers, e.g., L-nucleosides. Modifications to the sugar group can also include substitution of the 4'-O with sulfur, an optionally substituted nitrogen, or a CH2 group. In some embodiments, the linkage between C1' and the nucleobase is in the α-configuration.

[0216] Sugar modifications can also include acyclic nucleotides in which the C-C bond between the ribose carbons (e.g., C1'-C2', C2'-C3', C3'-C4', C4'-O4', C1'-O4') is absent and / or at least one of the ribose carbons or oxygens (e.g., C1', C2', C3', C4', or O4'), independently or in combination, is absent from the nucleotide. In some embodiments, the acyclic nucleotide is

[0217] [ka] wherein B is a modified or unmodified nucleobase, R and R are independently H, halogen, OR, or alkyl; and R is H, alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar.

[0218] In some embodiments, the sugar modification is selected from the group consisting of 2'-H, 2'-O-Me (2'-O-methyl), 2'-O-MOE (2'-O-methoxyethyl), 2'-F, 2'-O-[2-(methylamino)-2-oxoethyl] (2'-O-NMA), 2'-S-methyl, 2'-O-CH2-(4'-C) (LNA), 2'-O-CH2CH2-(4'-C) (ENA), 2'-O-aminopropyl (2'-O-AP), 2'-O-dimethylaminoethyl (2'-O-DMAOE), 2'-O-dimethylaminopropyl (2'-O-DMAP), 2'-O-dimethylaminoethyloxyethyl (2'-O-DMAEOE), and gem 2'-OMe / 2'F with the 2'-O-Me in the arabinose configuration.

[0219] It should be understood that when a particular nucleotide is linked to the next nucleotide through its 2'-position, the sugar modifications described herein can be located at the 3'-position of the sugar for that particular nucleotide, for example, the nucleotide linked through its 2'-position. The 3'-position modification can be in a xylose configuration. The term "xylose configuration" refers to placing a substituent on the C3' of the ribose in the same configuration as the 3'-OH of the xylose sugar.

[0220] The hydrogen attached to C4' and / or C1' can be replaced with a straight or branched chain optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, and the backbone of the alkyl, alkenyl, and alkynyl can include one or more of O, S, S(O), SO2, N(R'), C(O), N(R')C(O)O, OC(O)N(R'), CH(Z'), a phosphorus-containing linkage, optionally substituted aryl, optionally substituted heteroaryl, optionally substituted heterocycle, or optionally substituted cycloalkyl, wherein R' is hydrogen, acyl, or an optionally substituted aliphatic, and Z' is OR 11 , C.O.R. 11 , CO2R 11 ,

[0221] [ka] NR 21 R 31 ,CONR 21 R 31 , CON(H)NR 21 R 31 , ONR 21 R 31 , CON(H)N=CR 41 R 51 , N(R 21 )C(=NR 31 )NR 21 R 31 , N(R 21 )C(O)NR 21 R 31 , N(R 21 )C(S)NR 21 R 31 , OC(O)NR 21 R 31 , SC(O)NR 21 R 31 , N(R 21 )C(S)OR 11 , N(R 21 )C(O)OR 11 , N(R 21 )C(O)SR 11 , N(R 21 )N=CR 41 R 51 , ON=CR 41 R51 , SO2R 11 , SOR 11 , S.R. 11 and a substituted or unsubstituted heterocycle; R for each occurrence 21 and R 31 are independently hydrogen, acyl, unsubstituted or substituted aliphatic, aryl, heteroaryl, heterocyclic, OR 11 , C.O.R. 11 , CO2R 11 , or NR 11 R 11 ' or R 21 and R 31 together with the atoms to which they are attached form a heterocyclic ring; R 41 and R 51 is, for each occurrence, independently selected from hydrogen, acyl, unsubstituted or substituted aliphatic, aryl, heteroaryl, heterocyclic, OR 11 , C.O.R. 11 , or CO2R 11 , or NR 11 R 11 ' and ;R 11 and R 11 is independently hydrogen, aliphatic, substituted aliphatic, aryl, heteroaryl, or heterocyclic. In some embodiments, the hydrogen attached to C4' of the 5'-terminal nucleotide is substituted.

[0222] In some embodiments, C4' and C5' together form an optionally substituted heterocycle, preferably containing at least one -PX(Y)-, where X is H, OH, OM, SH, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkylthio, optionally substituted alkylamino, or optionally substituted dialkylamino, M is, independently for each occurrence, an alkyl metal or transition metal with a total charge of +1; Y is O, S, or NR', and R' is hydrogen or optionally substituted aliphatic. Preferably, this modification is at the 5' end of the oligonucleotide.

[0223] In certain embodiments, the LNA has the formula:

[0224] [ka] and a bicyclic nucleotide having the formula: Bx is a heterocyclic base moiety; T1 is H or a hydroxyl protecting group; T2 is H, a hydroxyl protecting group or a reactive phosphorus group; Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, or substituted amido.

[0225] In one embodiment, each of the substituents is independently mono- or polysubstituted with an appropriately protected substituent independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein each J1, J2 and J3 is independently H or C1-C6 alkyl, and X is O, S or NJ1.

[0226] In certain such embodiments, each of the substituents is independently mono- or polysubstituted with a substituent independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(=X)J1, and NJ3C(=X)NJ1J2, and each J1, J2, and J3 is independently H, C1-C6 alkyl, or substituted C1-C6 alkyl, and X is O or NJ1.

[0227] In certain embodiments, the Z group is C-C alkyl substituted with one or more X, where each X is independently OJ, NJJ, SJ, N, OC(=X)J, OC(=X)NJJ, NJC(=X)NJJ, or CN; each J, J, and J is independently H or C-C alkyl, where X is O, S, or NJ. In another embodiment, the Z group is C-C alkyl substituted with one or more X, where each X is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO-), substituted alkoxy, or azido.

[0228] In certain embodiments, the Z group is -CH2Xx, where Xx is OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, or CN; each J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O, S, or NJ1. In another embodiment, the Z group is -CH2Xx, where Xx is halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO-), or azido.

[0229] In certain such embodiments, the Z group has the (R)-configuration:

[0230] [ka] is.

[0231] In certain such embodiments, the Z group is in the (S)-configuration:

[0232] [ka] is.

[0233] In certain embodiments, each T1 and T2 is a hydroxyl protecting group. A preferred list of hydroxyl protecting groups includes benzyl, benzoyl, 2,6-dichlorobenzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl, mesylate, tosylate, dimethoxytrityl (DMT), 9-phenylxanthin-9-yl (Pixyl) and 9-(p-methoxyphenyl)xanthin-9-yl (MOX). In certain embodiments, T1 is a hydroxyl protecting group selected from acetyl, benzyl, t-butyldimethylsilyl, t-butyldiphenylsilyl and dimethoxytrityl, and a more preferred hydroxyl protecting group is T1 is 4,4'-dimethoxytrityl.

[0234] In certain embodiments, T2 is a reactive phosphorus group, and preferred reactive phosphorus groups include diisopropylcyanoethoxyphosphoramidite and H-phosphonate. In certain embodiments, T1 is 4,4'-dimethoxytrityl and T2 is diisopropylcyanoethoxyphosphoramidite.

[0235] In certain embodiments, the REVERSIR compound has the formula:

[0236] [ka] or the expression:

[0237] [ka] or the expression:

[0238] [ka] and having at least one monomer of the formula: Bx is a heterocyclic base moiety; T3 is H, a hydroxyl protecting group attached to a nucleoside, nucleotide, oligonucleoside, oligonucleotide, monomeric subunit, or oligomeric compound, a linked conjugate group, or an internucleoside linking group; T4 is H, a hydroxyl protecting group attached to a nucleoside, nucleotide, oligonucleoside, oligonucleotide, monomeric subunit, or oligomeric compound, a linked conjugate group, or an internucleoside linking group; at least one of T3 and T4 is an internucleoside linking group attached to a nucleoside, nucleotide, oligonucleoside, oligonucleotide, monomeric subunit, or oligomeric compound; Z is C1-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, substituted C1-C6 alkyl, substituted C2-C6 alkenyl, substituted C2-C6 alkynyl, acyl, substituted acyl, or substituted amido.

[0239] In one embodiment, each of the substituents is independently mono- or polysubstituted with an appropriately protected substituent independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2 and CN, wherein each J1, J2 and J3 is independently H or C1-C6 alkyl, and X is O, S or NJ1.

[0240] In one embodiment, each of the substituents is independently mono- or polysubstituted with substituents independently selected from halogen, oxo, hydroxyl, OJ1, NJ1J2, SJ1, N3, OC(=X)J1, and NJ3C(=X)NJ1J2, wherein each J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O or NJ1.

[0241] In certain such embodiments, at least one Z is C-C alkyl or substituted C-C alkyl. In certain embodiments, each Z is independently C-C alkyl or substituted C-C alkyl. In certain embodiments, at least one Z is C-C alkyl. In certain embodiments, each Z is independently C-C alkyl. In certain embodiments, at least one Z is methyl. In certain embodiments, each Z is methyl. In certain embodiments, at least one Z is ethyl. In certain embodiments, each Z is ethyl. In certain embodiments, at least one Z is substituted C-C alkyl. In certain embodiments, each Z is independently substituted C-C alkyl. In certain embodiments, at least one Z is substituted methyl. In certain embodiments, each Z is substituted methyl. In certain embodiments, at least one Z is substituted ethyl. In certain embodiments, each Z is substituted ethyl.

[0242] In certain embodiments, at least one substituent is C-C alkoxy (e.g., at least one Z is C-C alkyl substituted with one or more C-C alkoxy). In other embodiments, each substituent is independently C-C alkoxy (e.g., each Z is independently C-C alkyl substituted with one or more C-C alkoxy).

[0243] In certain embodiments, at least one C1-C6 alkoxy substituent is CHO- (e.g., at least one Z is CHOCH-). In other embodiments, each C1-C6 alkoxy substituent is CHO- (e.g., each Z is CHOCH-).

[0244] In certain embodiments, at least one substituent is halogen (e.g., at least one Z is C-C alkyl substituted with one or more halogens). In certain embodiments, each substituent is independently halogen (e.g., each Z is independently C-C alkyl substituted with one or more halogens). In certain embodiments, at least one halogen substituent is fluoro (e.g., at least one Z is CHFCH-, CHFCH-, or CFCH-). In certain embodiments, each halo substituent is fluoro (e.g., each Z is independently CHFCH-, CHFCH-, or CFCH-).

[0245] In certain embodiments, at least one substituent is hydroxyl (e.g., at least one Z is C-C alkyl substituted with one or more hydroxyl). In certain embodiments, each substituent is independently hydroxyl (e.g., each Z is independently C-C alkyl substituted with one or more hydroxyl). In certain embodiments, at least one Z is HOCH2-. In other embodiments, each Z is HOCH2-.

[0246] In certain embodiments, at least one Z is CH3-, CH3CH2-, CHOCH3-, CH2F-, or HOCH2-. In certain embodiments, each Z is independently CH3-, CH3CH2-, CHOCH3-, CH2F-, or HOCH2-.

[0247] In certain embodiments, at least one Z group is C-C alkyl substituted with one or more X, where each X is independently OJ, NJJ, SJ, N, OC(=X)J, OC(=X)NJJ, NJC(=X)NJJ, or CN; each J, J, and J is independently H or C-C alkyl, where X is O, S, or NJ. In another embodiment, at least one Z group is C-C alkyl substituted with one or more X, where each X is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO-), or azido.

[0248] In certain embodiments, each Z group is independently C-C alkyl substituted with one or more X, where each X is independently OJ, NJJ, SJ, N, OC(=X)J, OC(=X)NJJ, NJC(=X)NJJ, or CN; each J, J, and J is independently H or C-C alkyl, where X is O, S, or NJ. In another embodiment, each Z group is independently C-C alkyl substituted with one or more X, where each X is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO—), or azido.

[0249] In certain embodiments, at least one Z group is -CH2Xx, where Xx is OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, or CN; each J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O, S, or NJ1. In certain embodiments, at least one Z group is -CH2Xx, where Xx is halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO-), or azido.

[0250] In certain embodiments, each Z group is independently -CH2Xx, and each Xx is independently OJ1, NJ1J2, SJ1, N3, OC(=X)J1, OC(=X)NJ1J2, NJ3C(=X)NJ1J2, or CN; each J1, J2, and J3 is independently H or C1-C6 alkyl, and X is O, S, or NJ1. In another embodiment, each Z group is independently -CH2Xx, and each Xx is independently halo (e.g., fluoro), hydroxyl, alkoxy (e.g., CHO-), or azido.

[0251] In certain embodiments, at least one Z is CH3-. In other embodiments, each Z is CH3.

[0252] In certain embodiments, the Z group of at least one monomer has the formula:

[0253] [ka] or the expression:

[0254] [ka] or the expression:

[0255] [ka] It is an (R)-configuration represented by the formula:

[0256] In certain embodiments, the Z group of each monomer of the formula is in the (R)-configuration.

[0257] In certain embodiments, the Z group of at least one monomer has the formula:

[0258] [ka] or the expression:

[0259] [ka] or the expression:

[0260] [ka] This is the (S)-configuration, represented by

[0261] In certain embodiments, the Z group of each monomer of the formula is in the (S)-configuration.

[0262] In certain embodiments, T3 is H or a hydroxyl protecting group. In certain embodiments, T4 is H or a hydroxyl protecting group. In further embodiments, T3 is an internucleoside linking group attached to a nucleoside, nucleotide, or monomeric subunit. In certain embodiments, T4 is an internucleoside linking group attached to a nucleoside, nucleotide, or monomeric subunit. In certain embodiments, T3 is an internucleoside linking group attached to an oligonucleoside or oligonucleotide. In certain embodiments, T4 is an internucleoside linking group attached to an oligonucleoside or oligonucleotide. In certain embodiments, T3 is an internucleoside linking group attached to an oligomeric compound. In certain embodiments, T4 is an internucleoside linking group attached to an oligomeric compound. In certain embodiments, at least one of T3 and T4 comprises an internucleoside linking group selected from phosphodiester or phosphorothioate.

[0263] In certain embodiments, the REVERSIR compound has the formula:

[0264] [ka] or the expression:

[0265] [ka] or the expression:

[0266] [ka] and at least one region of at least two consecutive monomers of

[0267] In certain such embodiments, the LNA may include, but is not limited to, the following:

[0268] [ka] (A) α-L-methyleneoxy (4'-CH2-O-2') LNA, (B) β-D-methyleneoxy (4'-CH2-O-2') LNA, (C) ethyleneoxy (4'-(CH2)2-O-2') LNA, (D) aminooxy (4'-CH2-ON(R)-2') LNA, and (E) oxyamino (4'-CH2-N(R)-O-2') LNA, as shown in

[0269] In certain embodiments, REVERSIR compounds of the invention comprise at least two regions of at least two consecutive monomers of the above formula. In certain embodiments, the compounds comprise gapped oligomeric compounds. In certain embodiments, REVERSIR compounds of the invention comprise at least one region of about 8 to about 14 consecutive β-D-2'-deoxyribofuranosyl nucleosides. In certain embodiments, the compounds comprise at least one region of about 9 to about 12 consecutive β-D-2'-deoxyribofuranosyl nucleosides.

[0270] In certain embodiments, the REVERSIR compound has at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) of the formula:

[0271] [ka] wherein Bx is a heterocyclic base moiety.

[0272] In some embodiments, the REVERSIR compounds of the present invention are:

[0273] [ka] wherein B is A-001 to A-026, and n is 0 to 6 (e.g., 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) nucleotides selected from the following:

[0274] In certain embodiments, the monomer comprises a sugar mimetic. In certain such embodiments, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, while maintaining the nucleobase for hybridization to a selected target. Representative examples of sugar mimetics include, but are not limited to, cyclohexenyl or morpholino. Representative examples of mimetics of sugar-internucleoside linkage combinations include, but are not limited to, peptide nucleic acids (PNAs) linked by uncharged achiral bonds and morpholino groups. In some examples, a mimetic is used in place of the nucleobase. Representative nucleobase mimetics are well known in the art and include, but are not limited to, tricyclic phenoxazine analogs and universal bases (Berger et al., Nuc Acid Res. 2000, 28:2911-14, incorporated herein by reference). Methods for synthesizing sugar, nucleoside, nucleotide, and nucleobase analogs are well known to those skilled in the art.

[0275] In certain embodiments, the REVERSIR compounds of the present invention comprise at least one monomer that is an LNA and at least one G-clamp nucleobase. For example, the REVERSIR compounds can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more monomers that are LNA and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more monomers that are G-clamp nucleobases.

[0276] In some embodiments, REVERSIR compounds of the invention comprise at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more) peptide nucleic acid monomers. In certain embodiments, REVERSIR compounds comprise at least one monomer that is an LNA and at least one monomer that is a PNA. For example, REVERSIR compounds can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more monomers that are LNA and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more monomers that are PNA.

[0277] In certain embodiments, the REVERSIR compounds of the present invention comprise at least one PNA monomer and at least one G-clamp nucleobase. For example, the REVERSIR compounds can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more PNA monomers and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more G-clamp nucleobases.

[0278] In certain embodiments, the REVERSIR compound of the present invention comprises at least one LNA monomer, at least one PNA monomer, and at least one G-clamp nucleobase.For example, the REVERSIR compound may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more LNA monomers; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more PNA monomers, and 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more G-clamp nucleobases.

[0279] Described herein are linking groups that link monomers (including, but not limited to, modified and unmodified nucleosides and nucleotides) together to form oligomeric compounds, i.e., REVERSIR compounds, including oligonucleotides. Such linking groups are also referred to as intersugar linkages. Two major classes of linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing linking groups include, but are not limited to, phosphodiesters (P=O), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (P=S). Representative non-phosphorus-containing linking groups include, but are not limited to, methylenemethylimino (-CH2-N(CH3)-O-CH2-), thiodiester (-OC(O)-S-), thionocarbamate (-OC(O)(NH)-S-); siloxane (-O-Si(H)2-O-); and N,N'-dimethylhydrazine (-CH2-N(CH3)-N(CH3)-). Oligomeric compounds with non-phosphorus-containing linking groups are called oligonucleosides. Modified linkages can be used to alter, typically increase, the nuclease resistance of oligomeric compounds compared to native phosphodiester linkages. In certain embodiments, linkages with chiral atoms can prepare racemic mixtures as separate enantiomers. Representative chiral linkages include, but are not limited to, alkylphosphonates and phosphorothioates. Methods for preparing phosphorus-containing and non-phosphorus-containing linkages are well known to those skilled in the art.

[0280] The phosphate group of the linking group can be modified by replacing one of the oxygen atoms with a different substituent. One result of this modification can increase the resistance of the oligonucleotide to nucleolytic degradation. Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. In some embodiments, one of the non-bridging phosphate oxygen atoms in the linkage can be replaced with any of the following: S, Se, BR3 (R is hydrogen, alkyl, aryl), C (i.e., alkyl group, aryl group, etc.), H, NR2 (R is hydrogen, optionally substituted alkyl, aryl), or OR (R is optionally substituted alkyl or aryl). The phosphorus atom of an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygen atoms with one of the above atoms or groups of atoms makes the phosphorus atom chiral; in other words, the phosphorus atom in a phosphate group modified in this manner is a stereogenic center. The stereoisomeric phosphorus atom can have either the "R" configuration (herein Rp) or the "S" configuration (herein Sp).

[0281] In phosphorodithioate, both non-bridging oxygens are replaced with sulfur.The phosphorus center of phosphorodithioate is achiral, which prevents the formation of diastereomers of oligonucleotides.Therefore, without wishing to be bound by theory, the modification of both non-bridging oxygens to remove chiral center, for example, phosphorodithioate formation, may be desirable in that it cannot produce diastereomeric mixtures.Therefore, each non-bridging oxygen can be independently O, S, Se, B, C, H, N, or OR (R is alkyl or aryl).

[0282] Phosphate linkers can also be modified by substituting the bridging oxygen (i.e., the oxygen connecting the phosphate to the sugar of the monomer) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Substitution can occur at either or both of the linking oxygens. When the bridging oxygen is the 3'-oxygen of the nucleoside, substitution with carbon is preferred. When the bridging oxygen is the 5'-oxygen of the nucleoside, substitution with nitrogen is preferred.

[0283] Modified phosphate linkages in which at least one of the oxygens linked to the phosphate is replaced, or the phosphate group is replaced with a non-phosphorus group, are also referred to as "non-phosphodiester interglycan linkages" or "non-phosphodiester linkers."

[0284] In certain embodiments, the phosphate group can be replaced by a non-phosphorus-containing linker, such as a dephosphorylated linker. Dephosphorylated linkers are also referred to herein as non-phosphodiester linkers. Without wishing to be bound by theory, it is believed that because charged phosphodiester groups are the reaction center in nucleic acid degradation, substitution with a neutral structural mimic confers enhanced nuclease stability. Again, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce a modification in which a charged phosphate group is replaced with a neutral moiety.

[0285] Examples of moieties that can replace the phosphate group include, but are not limited to, amide (e.g., amide-3 (3'-CH2-C(=O)-N(H)-5') and amide-4 (3'-CH2-N(H)-C(=O)-5')), hydroxylamino, siloxane (dialkylsiloxane), carboxamide, carbonate, carboxymethyl, carbamate, carboxylate ester, thioether, ethylene oxide linker, sulfide, sulfonate, sulfonamide, sulfonate ester, thioformacetal (3'-S-CH2-O-5'), formate (3'-O-CH2-O-5'), oxime, methyleneimino, methylketone ... Examples of linkages include carbonylamino, methylenemethylimino (MMI, 3'-CH2-N(CH3)-O-5'), methylenehydrazo, methylenedimethylhydrazo, methyleneoxymethylimino, ether (C3'-O-C5'), thioether (C3'-S-C5'), thioacetamide (C3'-N(H)-C(=O)-CH2-S-C5', C3'-O-P(O)-O-S-S-C5', C3'-CH2-NH-NH-C5', 3'-NHP(O)(OCH3)-O-5' and 3'-NHP(O)(OCH3)-O-5', as well as nonionic linkages containing mixed N, O, S and CH2 moieties. For example, Carbohydrate See Modifications in Antisense Research; YS Sanghvi and PD Cook Eds. ACS Symposium Series 580; Chapters 3 and 4, (pp. 40-65). Preferred embodiments include methylenemethylimino (MMI), methylenecarbonylamino, amide, carbamate, and ethylene oxide linkers.

[0286] Those skilled in the art are well aware that in certain instances, substitution of a non-bridging oxygen can lead to enhanced cleavage of the inter-sugar linkage by the adjacent 2'-OH; therefore, in many instances, modification of a non-bridging oxygen can require modification of the 2'-OH, e.g., a modification that does not involve cleavage of the adjacent inter-sugar linkage, e.g., arabinose sugars, 2'-O-alkyl, 2'-F, LNA, and ENA.

[0287] Preferred non-phosphodiester intersugar linkages include phosphorothioates, phosphorothioates with at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more enantiomeric excess of the Sp isomer, phosphorothioates in at least 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more enantiomeric excess of the Rp isomer, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, alkyl-phosphonates (e.g., methylphosphonate), selenophosphates, phosphoramidates (e.g., N-alkylphosphoramidites), and borane phosphonates.

[0288] In some embodiments, REVERSIR compounds of the invention contain at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more and up to and including all) modified or non-phosphodiester linkage. In one embodiment, REVERSIR compounds of the invention contain at least one (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more and up to and including all) phosphorothioate linkage.

[0289] In some embodiments, REVERSIR compounds of the invention comprise at least five phosphorothioate internucleotide modifications. In other embodiments, REVERSIR compounds of the invention comprise 5 to 15 phosphorothioate internucleotide modifications; 5 to 14 phosphorothioate internucleotide modifications; 5 to 13 phosphorothioate internucleotide modifications; 5 to 12 phosphorothioate internucleotide modifications; 5 to 11 phosphorothioate internucleotide modifications; 5 to 10 phosphorothioate internucleotide modifications; 5 to 9 phosphorothioate internucleotide modifications; 5 to 8 phosphorothioate internucleotide modifications; 5 to 7 phosphorothioate internucleotide modifications; or 5 to 6 phosphorothioate internucleotide modifications. In yet other embodiments, REVERSIR compounds of the invention comprise 6 to 14 phosphorothioate internucleotide modifications.

[0290] In some embodiments, all internucleotide linkages in a REVERSIR compound are phosphorothioate (PS) internucleotide linkages. In certain embodiments, a REVERSIR compound contains at least one phosphorothioate (PS) internucleotide linkage, but not all internucleotide linkages in the REVERSIR compound are phosphorothioate linkages. In other words, in some embodiments, less than 100% (e.g., 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40% or less) of the internucleotide linkages are phosphorothioate linkages.

[0291] In some embodiments, the REVERSIR compound comprises at least one phosphorothioate internucleotide linkage and at least one internucleoside or internucleotide linkage that is not phosphorothioate. For example, the REVERSIR compound comprises at least one phosphorothioate internucleotide linkage and at least one phosphodiester internucleotide linkage. In some embodiments, the non-phosphorothioate internucleotide linkage is between the terminal and penultimate nucleotide.

[0292] In some embodiments, the internucleotide linkage between the 3'-terminal nucleobase of the REVERSIR compound and the remainder of the REVERSIR compound is a phosphodiester linkage, hi some embodiments, all internucleotide linkages in the REVERSIR compound, except for the internucleotide linkage between the 3'-terminal nucleotide of the REVERSIR compound and the remainder of the REVERSIR compound, are phosphorothioate.

[0293] REVERSIR compounds can also be constructed in which the phosphate linker and sugar are replaced with nuclease-resistant nucleosides, nucleotides, or nucleotide surrogates. Without wishing to be bound by theory, it is believed that the absence of a repeatedly charged backbone reduces binding to proteins that recognize polyanions (e.g., nucleases). Again, without wishing to be bound by theory, in some embodiments, it may be desirable to introduce modifications in which the bases are tethered by a neutral surrogate backbone. Examples include morpholino, cyclobutyl, pyrrolidine, peptide nucleic acid (PNA), aminoethylglycyl PNA (aegPNA), and backbone-extended pyrrolidine PNA (bepPNA) nucleoside surrogates. A preferred surrogate is a PNA surrogate.

[0294] The REVERSIR compounds described herein contain one or more asymmetric centers and can therefore give rise to enantiomers, diastereomers, and other stereoisomeric configurations that can be defined in terms of absolute stereochemistry as (R) or (S), such as sugar anomers, or as (D) or (L), such as amino acids. Included in the antisense compounds provided herein are all such possible isomers, as well as their racemic and optically pure forms.

[0295] The termini of the REVERSIR compounds of the present invention can be modified. Such modifications can be at one or both termini. For example, the 3' and / or 5' termini of an oligonucleotide can be conjugated with a labeling moiety, such as a fluorescent dye (e.g., pyrene, TAMRA, fluorescein, Cy3, or Cy5 dye) or other functional molecular entities, such as protecting groups (e.g., sulfur-, silicon-, boron-, or ester-based). The functional molecular entities can be attached to the sugar via a phosphate group and / or a linker. The terminal atom of the linker can be connected to or replace the linking atom of the phosphate group or the C-3' or C-5' O, N, S, or C group of the sugar. Alternatively, the linker can be connected to or replace the terminal atom of a nucleotide surrogate (e.g., PNA).

[0296] When a linker / phosphate-functional molecular entity-linker / phosphate array is interposed between the two strands of a double-stranded oligomeric compound, the array can take the place of the hairpin loop of a hairpin-type compound.

[0297] Terminal modifications useful for modulating activity include modifying the 5'-end of the compound with phosphate or phosphate analogs. In certain embodiments, the 5'-end of the compound is phosphorylated or contains a phosphate analog. Exemplary 5'-phosphate modifications include those compatible with RISC-mediated gene silencing. Modifications of the 5'-end may also be useful for stimulating or inhibiting the immune system of a subject. In some embodiments, the 5'-end of the compound is modified

[0298] [ka] wherein W, X, and Y are each independently selected from the group consisting of O, OR (R is hydrogen, alkyl, aryl), S, Se, BR (R is hydrogen, alkyl, aryl), BH—, C (i.e., alkyl, aryl, etc.), H, NR (R is hydrogen, alkyl, aryl), or OR (R is hydrogen, alkyl, or aryl); A and Z are each independently for each occurrence absent, O, S, CH, NR (R is hydrogen, alkyl, aryl), or optionally substituted alkylene, where the alkylene backbone can include one or more of O, S, SS, and NR (R is hydrogen, alkyl, aryl) internally and / or terminally; and n is 0-2. In some embodiments, n is 1 or 2. It is understood that A replaces the oxygen linked to the 5′ carbon of the sugar. When n is 0, W and Y, together with the P to which they are attached, can form an optionally substituted 5- to 8-membered heterocycle, where W and Y are each independently O, S, NR', or alkylene. Preferably, the heterocycle is substituted with aryl or heteroaryl. In some embodiments, one or both hydrogens on the C5' of the 5'-terminal nucleotide are substituted with halogen, e.g., F.

[0299] Exemplary 5'-modifications include, but are not limited to, 5'-monophosphate ((HO)2(O)PO-5'); 5'-diphosphate ((HO)2(O)POP(HO)(O)-O-5'); 5'-triphosphate ((HO)2(O)PO-(HO)(O)PO-(HO)(O)-O-5'); 5'-monothiophosphate (phosphorothioate; (HO)2(S)PO-5'); 5'-monodithiophosphate (phosphorothioate; (HO)2(S)PO-5'); Phosphates (phosphorodithioates; (HO)(HS)(S)PO-5'), 5'-phosphorothiolates ((HO)2(O)PS-5'); 5'-alpha-thiotriphosphate; 5'-beta-thiotriphosphate; 5'-gamma-thiotriphosphate; 5'-phosphoramidites ((HO)2(O)P-NH-5', (HO)(NH2)(O)PO-5'). Other 5'-modifications include 5'-alkylphosphonates (R(OH)(O)PO-5', R = alkyl, e.g., methyl, ethyl, isopropyl, propyl, etc.), 5'-alkyl ether phosphonates (R(OH)(O)PO-5', R = alkyl ether, e.g., methoxymethyl (CHOMe), ethoxymethyl, etc.). Other exemplary 5'-modifications include, where Z is at least once optionally substituted alkyl, for example: ((HO)2(X)PO[-(CH2) a -OP(X)(OH)-O] b -5', ((HO)2(X)PO[-(CH2) a -P(X)(OH)-O] b -5', ((HO)2(X)P-[-(CH2) a -OP(X)(OH)-O] b -5'; Dialkyl-terminated phosphate esters and phosphate mimetics: HO[-(CH2) a -OP(X)(OH)-O] b -5', H2N[-(CH2) a -OP(X)(OH)-O] b -5', H[-(CH2) a -OP(X)(OH)-O] b -5', Me2N[-(CH2) a -OP(X)(OH)-O] b-5', HO[-(CH2) a -P(X)(OH)-O] b -5', H2N[-(CH2) a -P(X)(OH)-O] b -5', H[-(CH2) a -P(X)(OH)-O] b -5', Me2N[-(CH2) a -P(X)(OH)-O] b -5', (wherein a and b are each independently 1 to 10). In other embodiments, oxygen and / or sulfur are replaced with BH3, BH3 - and / or Se substitution.

[0300] Terminal modifications can also be useful for monitoring distribution; in such cases, preferred groups added include fluorophores, such as fluorescein, or Alexa dyes, such as Alexa 488. Terminal modifications can also be useful for enhancing uptake; modifications useful for this purpose include targeting ligands. Terminal modifications can also be useful for crosslinking an oligonucleotide to another moiety; modifications useful for this purpose include mitomycin C, psoralen, and their derivatives.

[0301] In certain embodiments, the REVERSIR compounds of the present invention are chimeric oligomeric compounds, i.e., chimeric oligonucleotides. In certain such embodiments, the chimeric oligonucleotides comprise differently modified nucleotides. In certain embodiments, the chimeric oligonucleotides are mixed-backbone antisense oligonucleotides.

[0302] Generally, chimeric oligomeric compounds have modified nucleosides that can be in isolated positions or grouped together in regions that define a particular motif. Any combination of modifying and / or mimetic groups can comprise the chimeric oligomeric compounds described herein.

[0303] In certain embodiments, chimeric oligomeric compounds typically contain at least one region modified to confer increased resistance to nuclease degradation, increased cellular uptake, and / or increased binding affinity for the target nucleic acid. In certain embodiments, an additional region of the oligomeric compound may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids.

[0304] In certain embodiments, the chimeric oligomeric compound is a gapmer. In certain such embodiments, the mixed backbone oligomeric compound has one type of internucleotide linkage in one or both wings and a different type of internucleoside linkage in the gap. In certain such embodiments, the mixed backbone oligonucleotide has phosphodiester linkages in the wings and phosphorothioate linkages in the gap. In certain embodiments in which the internucleotide linkages of the wings are different from those of the gap, the internucleotide linkages bridging the wing and the gap are the same as the internucleotide linkages of the wing. In certain embodiments in which the internucleotide linkages of the wing are different from those of the gap, the internucleotide linkages bridging the wing and the gap are the same as the internucleotide linkages of the gap.

[0305] In certain embodiments, the present invention provides REVERSIR compounds of any of a variety of lengths. In certain embodiments, the present invention provides compounds consisting of 16-30 nucleotides, e.g., 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. For example, in certain embodiments, the present invention provides compounds consisting of 16-17, 16-18, 16-19, 16-25, 16-21, 16-22, 16-23, 16-24, 16-25, 16-26, 16-27, 16-28, 16-29, 16-30, 17-18, 17-19, 17-20, 17-21, 17-22, 17-23, 17-24, 17-25, 17-26, 17-27, 17-28 , 17-29, 17-30, 18-19, 18-20, 18-21, 18-22, 18-23, 18-24, 18-25, 18-26, 18-27, 18-28, 18-29, 18-30, 19-20, 19-21, 19-22, 19-23, 19-24, 19-25, 19-26, 19-29, 19-28, 19-29, 19-30, 20-21, 20-22, 20-23, 20-24, 20-25, 20-26, 20-27, 20-28, 20-29, 20-30, 21-22, 21-23, 21-24, 21-25, 21-26, 21-27, 21-28, 21-29, 21-30, 22-23, 22-24, 22-25, 22-26, 22-27, 22-28, 22-29, 22-30, 23-24, 23-25, 23-26, 23-27, 2 Compounds are provided that include 3-28, 23-29, 23-30, 24-25, 24-26, 24-27, 24-28, 24-29, 24-30, 25-26, 25-27, 25-28, 25-29, 25-30, 26-27, 26-28, 26-29, 26-30, 27-28, 27-29, 27-30, 28-29, 28-30, or 29-30 linked nucleotides.

[0306] As described above, REVERSIR compounds can be of any length. For example, in some embodiments, REVERSIR compounds are modified oligonucleotides consisting of 16 to 30 nucleotides. For example, REVERSIR compounds can consist of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 linked nucleobases. In some embodiments, REVERSIR compounds consist of 16 to 24, 16 to 22, or 18 to 20 linked nucleobases.

[0307] As discussed herein, REVERSIR compounds are oligonucleotides, e.g., modified oligonucleotides, that are substantially complementary to the antisense strand of a dsRNA agent that includes a thermodestabilizing nucleotide modification in the antisense strand. Now, without wishing to be bound by theory, REVERSIR compounds that are substantially complementary to the seed region of the antisense strand of a dsRNA (i.e., positions 2-8 or 2-9 of the 5'-end of the antisense strand) are particularly effective in reducing dsRNA activity. Thus, in many embodiments, REVERSIR compounds are substantially complementary to nucleotides 2-8, 2-9, 2-10, 2-11, 2-12, 2-13, 2-14, 2-15, or 2-16 of the antisense strand of a dsRNA agent described herein. Substantially complementary in this context means at least 90%, preferably at least 95% complementary, and more preferably perfect complementary.

[0308] A. Modified REVERSIR Compounds Containing the Motif of the Invention The present invention also includes oligomeric compounds, 18-24 nucleotides in length, that contain a nucleotide sequence substantially complementary to the antisense strand of a dsRNA agent. Such oligomeric compounds generally contain at least five phosphorothioate internucleotide modifications and have the formula (I):

[0309] [ka] wherein: B1, B2, and B3 each independently represent a nucleotide that includes a nucleotide modification independently selected from the group consisting of a 2'-deoxy, a 2'-ribo, a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkoxyalkyl modification, a 2'-substituted alkyl modification, and a 2'-halo modification; T1, T2, and T3 each independently represent a nucleotide containing a nucleotide modification selected from the group consisting of a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a cEt modification, or a different BNA modification, a 2'-deoxy-2'-fluoro, and a 2'-O-methyl modification; q 1 , q 3 and q 5 are each independently 3 to 12 nucleotides in length; q 2 , q 4 and q 6 are each independently 1 to 6 nucleotides in length.

[0310] In other embodiments, the present invention provides oligomeric compounds that are chimeric oligomeric compounds, i.e., chimeric REVERSIR compounds. A "chimeric" oligomeric compound or "chimera," in the context of the present invention, is an oligomeric compound that contains two or more chemically distinct regions, each consisting of at least one monomeric unit, i.e., in the case of oligonucleotides, a modified or unmodified nucleotide. Chimeric oligomeric compounds can be described as having a specific motif. In some embodiments, motifs include, but are not limited to, alternating motifs, gap motifs, hemimeric motifs, uniformly fully modified motifs, and positionally modified motifs. As used herein, the phrase "chemically distinct region" refers to an oligomeric region that differs from other regions by having a modification that is not present elsewhere in the oligomeric compound, or by not having a modification that is present elsewhere in the oligomeric compound. An oligomeric compound can contain two or more chemically distinct regions. As used herein, a region that does not contain a modification is also considered chemically distinct.

[0311] Chemically distinct regions can be repeated within an oligomeric compound. Thus, the pattern of chemically distinct regions in an oligomeric compound can be realized such that a first chemically distinct region is followed by one or more second chemically distinct regions. This sequence of chemically distinct regions can be repeated one or more times. Preferably, this sequence is repeated more than once. Both strands of a double-stranded oligomeric compound can contain these sequences. Each chemically distinct region can actually contain only one monomer, e.g., nucleotide. In some embodiments, each chemically distinct region contains 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, or 18 monomers, e.g., nucleotides.

[0312] In some embodiments, alternating nucleotides contain the same modification, for example, all odd-numbered nucleotides in a strand have the same modification and / or all even-numbered nucleotides in a strand have the same modification as in the first strand. In some embodiments, all odd-numbered nucleotides in an oligomeric compound have the same modification and all even-numbered nucleotides have a modification that is not present in the odd-numbered nucleotides, or vice versa.

[0313] In some embodiments, the oligonucleotide comprises two chemically distinct regions, each region being 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.

[0314] In other embodiments, the oligomeric compound comprises three chemically distinct regions. The middle region is approximately 5-15 (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15) nucleotides in length, and each flanking or wing region is independently 1-10 (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) nucleotides in length. The regions can all have different modifications, or the wing regions can be similarly modified to each other. In some embodiments, the wing regions are equal in length, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length.

[0315] As used herein, the term "alternating motif" refers to an oligomeric compound comprising a continuous sequence of linked monomeric subunits, where the monomeric subunits have two different types of sugar groups that alternate for essentially the entire sequence of the oligomeric compound. Oligomeric compounds having an alternating motif can be described by the formula: 5'-A(-LBLA)n(-LB)nn-3', where A and B are monomeric subunits with different sugar groups, each L is an internucleoside linking group, n is from about 4 to about 12, and nn is 0 or 1. This allows for the creation of oligomeric compounds with alternating lengths of from about 9 to about 26 monomeric subunits. This length range is not meant to be limiting, as longer and shorter oligomeric compounds are also applicable to the present invention. In one embodiment, one of A and B is a 2'-modified nucleoside provided herein.

[0316] As used herein, "type of modification" when referring to a "type" of nucleoside or nucleoside refers to the modification of the nucleoside and includes modified and unmodified nucleosides. Thus, unless otherwise specified, a "nucleoside having a first type of modification" can be an unmodified nucleoside.

[0317] As used herein, a "type region" refers to a portion of an oligomeric compound in which the nucleosides and internucleoside linkages within the region all contain the same type of modification; any adjacent nucleosides and / or internucleoside linkages contain at least one different type of modification. As used herein, the term "uniformly fully modified motif" refers to an oligonucleotide comprising a continuous sequence of linked monomer subunits, each having the same type of sugar group. In one embodiment, a uniformly fully modified motif comprises a continuous sequence of nucleosides of the present invention. In one embodiment, one or both of the 3'-end and 5'-end of the continuous sequence of nucleosides provided herein comprises a terminal group, such as one or more unmodified nucleosides.

[0318] As used herein, the term "hemimeric motif" refers to an oligomeric compound having a short, consecutive sequence of monomeric subunits with one type of sugar group located at the 5' or 3' end, with the remainder of the monomeric subunits having a different type of sugar group. Generally, a hemimer is an oligomeric compound of uniform sugar groups, further comprising a short region (1, 2, 3, 4, or about 5 monomeric subunits) with uniform but different sugar groups located at either the 3' or 5' end of the oligomeric compound. In one embodiment, a hemimeric motif comprises a consecutive sequence of about 10 to about 28 monomeric subunits of one type, with 1 to 5 or 2 to about 5 monomeric subunits of a second type located at one of the termini. In one embodiment, a hemimer is a consecutive sequence of about 8 to about 20 β-D-2'-deoxyribonucleosides, with 1 to 12 consecutive nucleosides of the invention located at one of the termini. In one embodiment, a hemimer is a sequence of about 8 to about 20 contiguous β-D-2'-deoxyribonucleosides having 1 to 5 contiguous nucleosides of the invention at one of its termini. In one embodiment, a hemimer is a sequence of about 12 to about 18 contiguous β-D-2'-deoxyribonucleosides having 1 to 3 contiguous nucleosides of the invention at one of its termini. In one embodiment, a hemimer is a sequence of about 10 to about 14 contiguous β-D-2'-deoxyribonucleosides having 1 to 3 contiguous nucleosides of the invention at one of its termini.

[0319] As used herein, the term "blockmir motif" refers to an oligonucleotide containing an otherwise contiguous sequence of monomer subunits in which the sugar groups of each monomer subunit are the same, except for interrupted internal blocks of consecutive monomer subunits with different types of sugar groups. Blockmirs overlap somewhat in definition with gapmers, but typically, in blockmirs, only the monomer subunits within the blocks have non-naturally occurring sugar groups, while in gapmers, only the monomer subunits in the outer regions have non-naturally occurring sugar groups, with the remainder of the monomer subunits in the blockmir or gapmer being β-D-2'-deoxyribonucleosides or β-D-ribonucleosides. In one embodiment, provided herein are blockmir oligonucleotides in which all of the monomer subunits contain non-naturally occurring sugar groups.

[0320] As used herein, the term "positionally modified motif" refers to an otherwise contiguous sequence of monomer subunits having one type of sugar group interrupted by two or more regions of one to about five consecutive monomer subunits having a different type of sugar group. Each of the two or more regions of one to about five consecutive monomer subunits is independently uniformly modified with respect to the type of sugar group. In one embodiment, each of the two or more regions has the same type of sugar group. In one embodiment, each of the two or more regions has a different type of sugar group. In one embodiment, a positionally modified oligonucleotide is provided that comprises a sequence of 8 to 20 β-D-2'-deoxyribonucleosides and further comprises two or three regions of two to about five consecutive nucleosides of the invention. Positionally modified oligonucleotides are distinguished from gapped motifs, hemimer motifs, blockmer motifs, and alternating motifs because the pattern of region substitution defined by any positional motif does not fit the definition provided herein for one of these other motifs. The term positionally modified oligomeric compound encompasses many different specific substitution patterns.

[0321] As used herein, the term "gapmer" or "gapped oligomeric compound" refers to an oligomeric compound having two exterior regions, or wings, and an interior region, or gap. The three regions form a continuous sequence of monomer subunits in which the sugar groups in the exterior regions are different from those in the interior region and the sugar groups of each monomer subunit within a particular region are the same. If the sugar groups in the exterior regions are the same, the gapmer is a symmetric gapmer; if the sugar groups used in the 5'-exterior region are different from those used in the 3'-exterior region, the gapmer is an asymmetric gapmer. In one embodiment, the exterior regions are small (each independently 1, 2, 3, 4, or about 5 monomer subunits), and the monomer subunits comprise non-naturally occurring sugar groups, including β-D-2'-deoxyribonucleosides, while the interior region comprises 6 to 18 unmodified nucleosides. In one embodiment, the exterior regions each independently comprise 1 to about 5 monomer subunits with non-naturally occurring sugar groups, and the interior region comprises 6 to 18 unmodified nucleosides. The internal region or gap generally comprises β-D-2′-deoxyribonucleosides and may contain non-naturally occurring sugar groups.

[0322] In one embodiment, a gapped oligomeric compound comprises an internal region of β-D-2'-deoxyribonucleosides, where one of the external regions comprises a nucleoside of the invention. In one embodiment, a gapped oligonucleotide comprises an internal region of β-D-2'-deoxyribonucleosides, where both external regions comprise a nucleoside of the invention. In one embodiment, a gapped oligonucleotide comprises an internal region of β-D-2'-deoxyribonucleosides, where both external regions comprise a nucleoside of the invention. In one embodiment, a gapped oligonucleotide is provided herein, where all of the monomer subunits comprise a non-naturally occurring sugar group. In one embodiment, a gapped oligonucleotide is provided, where the 5'-terminus comprises one or two nucleosides of the invention, the 3'-terminus comprises two or three nucleosides of the invention, and an internal region of 10 to 16 β-D-2'-deoxyribonucleosides. In one embodiment, a gapped oligonucleotide is provided that comprises one nucleoside of the invention at the 5'-terminus, two nucleosides of the invention at the 3'-terminus, and an internal region of 10 to 16 β-D-2'-deoxyribonucleosides. In one embodiment, a gapped oligonucleotide is provided that comprises two nucleosides of the invention at the 5'-terminus, two nucleosides of the invention at the 3'-terminus, and an internal region of 10 to 14 β-D-2'-deoxyribonucleosides. In one embodiment, a gapped oligonucleotide is provided that is about 10 to about 21 monomer subunits in length. In one embodiment, a gapped oligonucleotide is provided that is about 12 to about 16 monomer subunits in length. In one embodiment, a gapped oligonucleotide is provided that is about 12 to about 14 monomer subunits in length.

[0323] In certain embodiments, the 5'-terminal monomer of an oligomeric compound of the present invention comprises a phosphorus moiety at the 5'-terminus. In certain embodiments, the 5'-terminal monomer comprises a 2'-modification. In certain such embodiments, the 2'-modification of the 5'-terminal monomer is a cationic modification. In certain embodiments, the 5'-terminal monomer comprises a 5'-modification. In certain embodiments, the 5'-terminal monomer comprises a 2'-modification and a 5'-modification. In certain embodiments, the 5'-terminal monomer is a 5'-stabilizing nucleoside. In certain embodiments, the modification of the 5'-terminal monomer stabilizes the 5'-phosphate. In certain embodiments, oligomeric compounds comprising a modification of the 5'-terminal monomer are exonuclease resistant. In certain embodiments, oligomeric compounds comprising a modification of the 5'-terminal monomer have improved reversible properties. In certain such embodiments, oligomeric compounds comprising a modification of the 5'-terminal monomer have improved association with a dsRNA strand.

[0324] In certain embodiments, the 5'-terminal monomer is attached to the remainder of the oligomeric compound with a modified linkage, hi certain such embodiments, the 5'-terminal monomer is attached to the remainder of the oligomeric compound by a phosphorothioate linkage.

[0325] In certain embodiments, the oligomeric compounds of the present invention comprise one or more regions of alternating modifications. In certain embodiments, the oligomeric compounds comprise one or more regions of alternating nucleoside modifications. In certain embodiments, the oligomeric compounds comprise one or more regions of alternating linkage modifications. In certain embodiments, the oligomeric compounds comprise one or more regions of alternating nucleoside and linkage modifications.

[0326] In certain embodiments, the oligomeric compounds of the present invention comprise one or more regions of alternating 2'-F modified nucleosides and 2'-O-Me modified nucleosides. In certain such embodiments, such regions of alternating 2'F modified nucleosides and 2'O-Me modified nucleosides also comprise alternating linkages. In certain such embodiments, the linkage at the 3' end of the 2'-F modified nucleoside is a phosphorothioate linkage. In certain such embodiments, the linkage at the 3' end of the 2'O-Me nucleoside is a phosphodiester linkage.

[0327] In certain embodiments, such alternating regions include (2'-F)-(PS)-(2'-OMe)-(PO) is.

[0328] In certain embodiments, oligomeric compounds contain 2, 3, 4, 5, 6, 7, 8, 9, 10, or 11 such alternating regions. Such regions can be contiguous or interrupted by different modified nucleosides or linkages.

[0329] In certain embodiments, one or more alternating regions in an alternating motif comprises more than one single nucleoside of one type. For example, oligomeric compounds of the invention may comprise the following nucleoside motif: ABA; ABBA; AABA; AABBAA; ABBABB; AABAAB; ABBABAABB; ABABAA; AABABAB; ABABAA; ABBAABBABABAA; BABBAABBABABAA; or ABABBAABBABABAA; wherein A is a first type of nucleoside and B is a second type of nucleoside. In certain embodiments, A and B are each selected from 2'-F, 2'-OMe, LNA, DNA, and MOE.

[0330] In certain embodiments, A is DNA. In certain embodiments, B is DNA. In some embodiments, A is 4'-CHO-2'-LNA. In certain embodiments, B is 4'-CHO-2'-LNA. In certain embodiments, A is DNA and B is 4'-CHO-2'-LNA. In certain embodiments, A is 4'-CHO-2'-LNA and B is DNA.

[0331] In certain embodiments, A is 2'-OMe. In certain embodiments, B is 2'-OMe. In certain embodiments, A is 2'-OMe and B is 4'-CHO-2'-LNA. In certain embodiments, A is 4'-CHO-2'-LNA and B is 2'-OMe. In certain embodiments, A is 2'-OMe and B is DNA. In certain embodiments, A is DNA and B is 2'-OMe.

[0332] In certain embodiments, A is (S)-cEt. In some embodiments, B is (S)-cEt. In particular embodiments, A is 2'-OMe and B is (S)-cEt. In particular embodiments, A is (S)-cEt and B is 2'-OMe. In particular embodiments, A is DNA and B is (S)-cEt. In particular embodiments, A is (S)-cEt and B is DNA.

[0333] In certain embodiments, A is 2'-F. In certain embodiments, B is 2'-F. In certain embodiments, A is 2'-F and B is 4'-CHO-2'-LNA. In certain embodiments, A is 4'-CHO-2'-LNA and B is 2'-F. In certain embodiments, A is 2'-F and B is (S)-cEt. In certain embodiments, A is (S)-cEt and B is 2'-F. In certain embodiments, A is 2'-F and B is DNA. In certain embodiments, A is DNA and B is 2'-F. In certain embodiments, A is 2'-OMe and B is 2'-F. In certain embodiments, A is DNA and B is 2'-OMe. In certain embodiments, A is 2'-OMe and B is DNA.

[0334] In certain embodiments, oligomeric compounds having such alternating motifs also include a 5'-terminal nucleoside that includes a phosphate-stabilizing modification. In certain embodiments, oligomeric compounds having such alternating motifs also include a 5'-terminal nucleoside that includes a 2'-cationic modification. In certain embodiments, oligomeric compounds having such alternating motifs also include a 5'-terminal modification.

[0335] In certain embodiments, oligomeric compounds of the invention comprise a region having a 2-2-3 motif. Such a region may contain the following motif: 5'-(E) w- (A) 2- (B) x- (A) 2- (C) y- (A) 3- (D) z wherein A is a first type of modified nucleoside; B, C, D, and E are nucleosides with different modifications than A, but B, C, D, and E can have the same or different modifications from each other; w and z are 0 to 15; x and y are 1 to 15.

[0336] In certain embodiments, A is a 2'-OMe modified nucleoside. In certain embodiments, B, C, D, and E are all 2'-F modified nucleosides. In certain embodiments, A is a 2'-OMe modified nucleoside and B, C, D, and E are all 2'-F modified nucleosides.

[0337] In certain embodiments, all of the linkages in the 2-2-3 motif are modified linkages. In certain embodiments, all of the linkages are phosphorothioate linkages. In certain embodiments, the linkage at the 3' end of each first type modification is a phosphodiester.

[0338] In certain embodiments, Z is 0. In such embodiments, the region of three nucleosides of the first type is at the 3'-end of the oligonucleotide. In certain embodiments, such region is at the 3'-end of the oligomeric compound, and no additional group is attached to the 3'-end of the region of three nucleosides of the first type. In certain embodiments, an oligomeric compound comprising an oligonucleotide in which Z is 0 can include a terminal group attached to the 3'-terminal nucleoside. Such a terminal group can include an additional nucleoside. Such an additional nucleoside is typically a non-hybridizing nucleoside.

[0339] In certain embodiments, Z is 1 to 3. In certain embodiments, Z is 2, and in certain embodiments, the nucleoside of Z is a 2'-MOE nucleoside. In certain embodiments, Z represents a non-hybridizing nucleoside. To avoid confusion, it should be noted that such a non-hybridizing nucleoside may also be described as a 3'-terminal group with Z=0.

[0340] It should be understood that certain of the above motifs and modifications can be combined.Since a motif may only contain a few nucleosides, certain oligomeric compounds may contain two or more motifs.By way of non-limiting example, in certain embodiments, oligomeric compounds may have two or more nucleotide motifs selected from LNA, phosphorothioate linkage, 2'-OMe, and conjugate ligand(s).

[0341] Oligomeric compounds having any of the various nucleoside motifs described herein can also have any linkage motif. For example, in an oligomeric compound, the first 1, 2, 3, 4, or 5 intersugar linkages at the 5'-end can be modified, and the first 4, 5, 6, 7, or 8 intersugar linkages at the 3'-end can be modified. The central region of such modified oligomeric compounds can have intersugar linkages based on any of the other motifs described herein, such as uniform, alternating, hemimer, gapmer, etc. In some embodiments, the oligomeric compound contains a phosphorothioate linkage between the first and second monomers at the 5'-end, alternating phosphorothioate / phosphodiester linkages in the central region, and 6, 7, or 8 phosphorothioate linkages at the 3'-end.

[0342] It should be noted that the length of the region defined by the nucleoside motif and the length of the region defined by the linkage motif need not be the same.

[0343] In some embodiments, the single stranded oligomeric compound comprises the following motif: (a) 5′-phosphorothioate or 5′-phosphorodithioate; (b) cationic modifications of 5'-terminal nucleotides 1 and 2, said cationic modifications being at the C5 position of pyrimidines and at C2, C6, C8, exocyclic N2 or exocyclic N6 of purines; (c) at least one G-clamp nucleotide among the first two terminal nucleotides of the 5' end and any other nucleotide having a cationic modification, wherein the cationic modification is at the C5 position of a pyrimidine or at the C2, C6, C8, exocyclic N2 or exocyclic N6 position of a purine; (d) at least one 2'-F modified nucleotide containing a base modification of the nucleobase; (e) at least one gem-2'-O-methyl / 2'-F modified nucleotide comprising a nucleobase modification, preferably a modified nucleotide in which the methyl substituent is in the up configuration, e.g., the arabinose configuration; (f) a 3'-terminal 5'-PuPu-3' dinucleotide, wherein both nucleotides contain a modified MOE at the 2'-position as described in U.S. Patent Application Publication No. 20130130378, the contents of which are incorporated herein by reference in their entirety; (g) a 5'-terminal 5'-PuPu-3' dinucleotide, wherein both nucleotides contain a modified MOE at the 2'-position as described in U.S. Patent Application Publication No. 20130130378; (h) a 5'-terminal nucleotide having a modified MOE at the 2'-position as described in U.S. Patent Application Publication No. 20130130378; (i) a 5'-terminal nucleotide with a 3'-F modification; (j) a 5'-terminal nucleotide containing a 4'-substituent; (k) a 5′-terminal nucleotide containing an O4′ modification; (l) a 3'-terminal nucleotide containing a 4'-substitution; and (m) Combinations of these It includes at least one of the following:

[0344] The above examples are provided solely to illustrate how the described motifs may be used in combination and are not intended to limit the invention to the specific combinations or the specific modifications used in illustrating the combinations. Moreover, specific examples herein are intended to encompass more general embodiments. All examples throughout this specification are intended to be interpreted in this general manner.

[0345] It should also be noted that the length of the oligomeric compound can be easily manipulated by lengthening or shortening one or more of the described regions without disrupting the motif.

[0346] In some embodiments, the oligomeric compounds are comprised of two or more chemically distinct regions and have the structures described in International Application No. PCT / US09 / 038433, filed March 26, 2009, the contents of which are incorporated herein in their entirety.

[0347] III. Ligands of the Invention In certain embodiments, oligomeric compounds are modified by the covalent attachment of one or more conjugate groups. Generally, conjugate groups modify one or more properties of the attached oligomeric compounds, including but not limited to pharmacodynamics, pharmacokinetics, binding, absorption, cellular distribution, cellular uptake, charge, and clearance. Conjugate groups are routinely used in chemical technology and are linked to parent compounds, such as oligomeric compounds, directly or via any linking moiety or linking group. Preferred conjugate groups include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, thioethers, polyethers, cholesterol, thiocholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, and dyes.

[0348] Preferred conjugate groups applicable to the present invention include lipid moieties such as cholesterol moieties (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553); cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053); thioethers, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY Acad. Sci., 1992, 660, 306; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765); thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533); aliphatic chains, e.g., dodecanediol or undecyl residues (Aison-Behmoaras et al., EMBO J., 1991, 10, 111; Kabanov et al., FEBS Lett., 1990, 259, 327; Svinarchuk et al., Biochimie, 1993, 75, 49); phospholipids, such as di-hexadecyl-rac-glycerol or triethylammonium-1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651; Shea et al., Nucl. Acids Res., 1990, 18, 3777); polyamine or polyethylene glycol chains (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969); adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651); a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229); or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923).

[0349] Generally, a wide variety of entities, e.g., ligands, can be coupled to the oligomeric compounds described herein. Ligands can include naturally occurring or recombinant or synthetic molecules. Exemplary ligands include, but are not limited to, polylysine (PLL), poly-L-aspartic acid, poly-L-glutamic acid, styrene-maleic anhydride copolymer, poly(L-lactide-co-glycolide) copolymer, divinyl ether-maleic anhydride copolymer, N-(2-hydroxypropyl) methacrylamide copolymer (HMPA), polyethylene glycol (PEG, e.g., PEG-2K, PEG-5K, PEG-10K, PEG-12K, PEG-15K, PEG-20K, PEG-40K), MPEG, [MPEG]2, polyvinyl alcohol (PVA), polyurethane, poly(2-ethylacrylic acid), N-isopropylacrylamide polymer, polyphosphazine, polyethyleneimine, cationic groups, spermine, spermidine, polyamines, pseudopeptide polyamines, peptidomimetic polyamines, dendrimeric polyamines, arginine, amidine, protamine, cationic lipids, cationic porphyrins, quaternary salts of polyamines, thiazolinone ... Examples of suitable antibodies include thrombin time-dependent agonists, ... isin C), porphyrins (e.g., TPPC4, texaphyrin, sapphyrin), polycyclic aromatic hydrocarbons (e.g., phenazine, dihydrophenazine), artificial endonucleases (e.g., EDTA), lipophilic molecules (e.g., steroids, bile acids, cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleoyl)lithocholic acid, O3-(oleoyl)cholinic acid, dimethoxytrityl, or phenoxazine), peptides (e.g., alpha helical peptides, amphipathic peptides, RGD peptides, cell penetrating peptides, endosomolytic / fusogenic peptides), alkylating agents, phosphate, amino, mercapto, polyamino, alkyl, substituted alkyl, radiolabeled markers, enzymes, haptens (e.g., biotin), transport / absorption enhancers (e.g., naproxen, aspirin, vitamin E, folic acid), synthetic ribonucleases (e.g., imidazole, bis-imidazole, histamine, imidazole clusters, acridine-imidazole conjugates, Eu3+ complexes of tetraazamacrocycles), dinitrophenyl, HRP, AP, antibodies, hormones and hormone receptors, lectins, carbohydrates, polyvalent carbohydrates, vitamins (e.g., vitamin A, vitamin E, vitamin K, vitamin B, e.g., folic acid, B12, riboflavin, biotin, pyridoxal, etc.), vitamin coenzymes, lipopolysaccharides, p38 These include activators of MAP kinase, activators of NF-κB, taxon, vincristine, vinblastine, cytochalasin, nocodazole, japlakinolide, latrunculin A, phalloidin, swinholide A, indanocine, myoservin, tumor necrosis factor alpha (TNF alpha), interleukin-1 beta, gamma interferon, natural or recombinant low-density lipoprotein (LDL), natural or recombinant high-density lipoprotein (HDL), and cell-penetrating agents (e.g., helical cell-penetrating agents).

[0350] Exemplary cationic groups include, but are not limited to, protonated amino groups derived from, for example, O-AMINE (AMINE = NH; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino); aminoalkoxy, for example, O(CH) nAMINE, (e.g., AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, polyamino); amino (e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or amino acid); and NH(CH2CH2NH) n Examples include CH2CH2-AMINE (AMINE = NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino).

[0351] As used herein, the term "targeting ligand" refers to any molecule that provides enhanced affinity to a selected target, such as a cell, cell type, tissue, organ, body region, or compartment, such as a cell, tissue, or organ compartment. Some exemplary targeting ligands include, but are not limited to, antibodies, antigens, folate, receptor ligands, carbohydrates, aptamers, integrin receptor ligands, chemokine receptor ligands, transferrin, biotin, serotonin receptor ligands, PSMA, endothelin, GCPII, somatostatin, LDL, and HDL ligands.

[0352] Carbohydrate-based targeting ligands include, but are not limited to, D-galactose, multivalent galactose, N-acetyl-D-galactose (GalNAc), multivalent GalNAc, such as GalNAc2 and GalNAc3; D-mannose, multivalent mannose, multivalent lactose, N-acetyl-galactosamine, N-acetyl-glucosamine, multivalent fucose, glycosylated polyamino acid and lectin.The term multivalent indicates the presence of multiple monosaccharide units.These monosaccharide subunits can be linked to each other through glycosidic linkage or linked to scaffolding molecules.

[0353] As used herein, the terms "PK-modulating ligand" and "PK modulator" refer to molecules that can modulate the pharmacokinetics of the compositions of the present invention. Some exemplary PK modulators include, but are not limited to, lipophilic molecules, bile acids, sterols, phospholipid analogs, peptides, protein binders, vitamins, fatty acids, phenoxazines, aspirin, naproxen, ibuprofen, suprofen, ketoprofen, (S)-(+)-pranoprofen, carprofen, PEG, biotin, and transthyretin-binding ligands (e.g., tetraimidothyroacetic acid, 2,4,6-triiodophenol, and flufenamic acid). Oligomeric compounds containing multiple phosphorothioate intersugar linkages are also known to bind to serum proteins. Therefore, short oligomeric compounds, e.g., oligonucleotides containing about 5-30 nucleotides (e.g., 5-25 nucleotides, preferably 5-20 nucleotides, e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides) and containing multiple phosphorothioate linkages in the backbone, are also applicable as ligands (e.g., PK-modulating ligands) in the present invention. PK-modulating oligonucleotides can contain at least 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or more phosphorothioate and / or phosphorodithioate linkages. In some embodiments, all internucleotide linkages in a PK-modulating oligonucleotide are phosphorothioate and / or phosphorodithioate linkages. In addition, aptamers that bind to serum components (e.g., serum proteins) can also be used as PK-regulating ligands in the present invention. Binding to serum components (e.g., serum proteins) can be predicted from albumin binding assays such as those described in Oravcova, et al., Journal of Chromatography B (1996), 677: 1-27.

[0354] When there are two or more ligands, the ligands may all have the same properties, or all have different properties, or some ligands may have the same properties and other ligands have different properties.For example, the ligand may have targeting properties, endosomal activity, or PK regulating properties.In a preferred embodiment, all the ligands have different properties.As used herein, when the ligand is bound to multiple oligomer chains, the binding point of the oligomer compound may be an atom of the ligand itself or an atom on the carrier molecule to which the ligand itself is bound.

[0355] Ligands can be coupled to oligomeric compounds at various locations, such as the 3' end, the 5' end, and / or internal positions. When two or more ligands are present, the ligands can be present at opposite ends of the oligomeric compound. In preferred embodiments, the ligands are attached to the oligomeric compound via an intervening tether / linker. The ligand or tethered ligand can be present on a monomer when the monomer is incorporated into a growing chain. In some embodiments, a ligand can be incorporated via coupling to a "precursor" monomer after the monomer is incorporated into the growing chain. For example, a monomer, such as a monomer having an amino-terminated tether (i.e., no associated ligand), e.g., monomer-linker-NH, can be incorporated into a growing oligomeric compound chain. In a subsequent operation, i.e., after the precursor monomer is incorporated into the chain, a ligand having an electrophilic group, e.g., a pentafluorophenyl ester or aldehyde group, can be subsequently attached to the precursor monomer by coupling the electrophilic group of the ligand with the terminal nucleophilic group of the precursor monomer's tether.

[0356] In another example, one can incorporate a monomer bearing a chemical group suitable for participating in a click chemistry reaction, e.g., an azide- or alkyne-terminated tether / linker. In a subsequent operation, i.e., after the precursor monomer is incorporated into the chain, a ligand bearing a complementary chemical group, e.g., an alkyne or azide, can be attached to the precursor monomer by coupling the alkyne and azide to each other.

[0357] In some embodiments, the ligand can be conjugated to the nucleobase, sugar moiety, or internucleoside linkage of the oligomeric compound.Conjugation to the purine nucleobase or its derivative can occur at any position, including the inner and outer ring atoms.In some embodiments, the 2, 6, 7, or 8 position of the purine nucleobase is bonded to the conjugate moiety.Conjugation to the pyrimidine nucleobase or its derivative can also occur at any position.In some embodiments, the 2, 5, and 6 positions of the pyrimidine nucleobase can be replaced with the conjugate moiety.When the ligand is conjugated to the nucleobase, the preferred position is one that does not interfere with hybridization, i.e., does not interfere with the hydrogen bond interaction required for base pairing.

[0358] Conjugation to the sugar moiety of a nucleoside can occur at any carbon atom. Exemplary carbon atoms of the sugar moiety that can be attached to the conjugate moiety include the 2', 3', and 5' carbon atoms. The 1' position can also be attached to a conjugate moiety such as an abasic residue. The internucleoside linkage can also have a conjugate site. In the case of phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, etc.), the conjugate moiety can be attached directly to the phosphorus atom or to an O, N, or S atom attached to the phosphorus atom. In the case of amine- or amide-containing internucleoside linkages (e.g., PNA), the conjugate moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom.

[0359] In some embodiments, the REVERSIR compound is conjugated to a ligand.

[0360] Although useful for delivering REVERSIR compounds to desired sites of action, the ligand conjugated with REVERSIR compounds may adversely affect the ability of REVERSIR compounds to reduce dsRNA activity.Therefore, in some embodiments, the link between the ligand and the REVERSIR compound can be designed to be cleaved after the REVERSIR compound reaches the desired site of action.This can be achieved in many ways.For example, the linker connecting the REVERSIR compound and the ligand can be a cleavable linker.

[0361] In some embodiments, the nucleoside conjugated to the ligand comprises a deoxy sugar, eg, a 2'-deoxy sugar.

[0362] In some embodiments of the various aspects disclosed herein, the ligand is attached to a nucleoside at the 3'-end of the REVERSIR compound. In some embodiments, the ligand-conjugated nucleotide is attached to the remainder of the REVERSIR compound via a cleavable internucleotide linkage. In some embodiments, the cleavable internucleotide linkage is a phosphodiester internucleotide linkage.

[0363] In some embodiments, the ligand-conjugated nucleotide comprises a deoxy sugar and is linked to the remainder of the REVERSIR compound via a cleavable internucleotide linkage, which in some further embodiments is a phosphodiester linkage.

[0364] In some embodiments, the ligand-conjugated nucleotide comprises a deoxy sugar and is linked to the remainder of the REVERSIR compound via an internucleotide linkage that is not a phosphodiester linkage.

[0365] In some embodiments, the ligand is conjugated to a nucleotide at the 3'-end of the REVERSIR compound.

[0366] In some embodiments, the ligand is conjugated at the 5'-end of the REVERSIR compound. In some embodiments, a first ligand is conjugated at the 5'-end of the REVERSIR compound and a second ligand is conjugated to the first ligand.

[0367] There are many methods for preparing conjugates of oligomeric compounds. Generally, oligomeric compounds are attached to conjugate moieties by contacting a reactive group (e.g., OH, SH, amine, carboxyl, aldehyde, etc.) on the oligomeric compound with a reactive group on the conjugate moiety. In some embodiments, one reactive group is electrophilic and the other reactive group is nucleophilic.

[0368] For example, the electrophilic group can be a carbonyl-containing functionality, and the nucleophilic group can be an amine or thiol. Methods for conjugation of nucleic acids and related oligomeric compounds, whether or not they have a linking group, are well described in the literature, for example, Manoharan in Antisense Research and Applications, Crooke and LeBleu, eds., CRC Press, Boca Raton, Fla., 1993, Chapter 17, which is incorporated herein by reference in its entirety.

[0369] Representative United States patents that teach the preparation of oligomeric compounds, e.g., conjugates of oligonucleotides, include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717; 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,41 No. 4,077; No. 5,486,603; No. 5,512,439; No. 5,578,718; No. 5,608,046; No. 5,608,046; No. 4,587,044; No. 4,605,735; No. 4,667,025; No. 4,762,779; No. 4,789,737 ; Same No. 4,824,941; Same No. 4,835,263; Same No. 4,876,335; Same No. 4,904,582; Same No. 4,958,0 No. 13; No. 5,082,830; No. 5,112,963; No. 5,214,136; No. 5,082,830; No. 5,11 2,963; 5,149,782; 5,214,136; 5,245,022; 5,254,469; No. 5,258,506; No. 5,262,536; No. 5,272,250; No. 5,292,873; No. 5,317,098 ; Same No. 5,371,241, 5,391,723; Same No. 5,416,203, 5,451,463; Same No. 5,510,475; Same No. No. 5,512,667; No. 5,514,785; No. 5,565,552; No. 5,567,810; No. 5,574,142 ; Same No. 5,585,481; Same No. 5,587,371; Same No. 5,595,726; Same No. 5,597,696; Same No. 5,599,9 No. 23; No. 5,599,928; No. 5,672,662; No. 5,688,941; No. 5,714,166; No. 6,15 No. 3,737; No. 6,172,208; No. 6,300,319; No. 6,335,434; No. 6,335,437; No. 6 , 395,437; 6,444,806; 6,486,308; 6,525,031; 6,528,631;No. 6,559,279, the contents of which are incorporated herein by reference in their entireties.

[0370] In certain embodiments, the oligomeric compounds described herein, including but not limited to REVERSIR compounds, have the structure shown below:

[0371] [ka] and a ligand having the formula: L G is, independently for each occurrence, a ligand, e.g., a carbohydrate, e.g., a monosaccharide, disaccharide, trisaccharide, tetrasaccharide, polysaccharide; Z', Z'', Z''' and Z'''' are each independently O or S for each occurrence.

[0372] In certain embodiments, the oligomeric compounds described herein, including but not limited to REVERSIR compounds, have Formula (II), (III), (IV) or (V):

[0373] [ka] wherein: q 2A , q 2B , q 3A , q 3B , q4 A , q 4B , q 5A , q 5B and q 5C represents independently 0 to 20 for each occurrence, and the repeat units are identical or different; Q and Q′ are, independently for each occurrence, absent or −(P 7 -Q 7 -R 7 ) p -T 7 -or-T 7 -Q 7 -T 7’ -BT 8’ -Q8 -T 8 and; p 2A , p 2B , p 3A , p 3B , p 4A , p 4B , p 5A , p 5B , p 5C , p 7 , t 2A , t 2B , t 3A , t 3B , t 4A , t 4B , t 4A , t 5B , T 5C , T 7 , T 7’ , T 8 and T 8’ is each independently for each occurrence absent or CO, NH, O, S, OC(O), NHC(O), CH, CHNH, or CHO; B is -CH2-N(B L )-CH 2- and; B L -T B -Q B -T B’ -R x and; Q 2A , Q 2B , Q 3A , Q 3B , Q 4A , Q 4B , Q 5A , Q 5B , Q 5C , Q 7 , Q 8 and Q B is, independently for each occurrence, absent, alkylene, or substituted alkylene, and one or more methylenes are selected from O, S, S(O), SO, N(R N ), C(R')=C(R'), C≡C or C(O); T B and T B’are each independently for each occurrence absent or CO, NH, O, S, OC(O), OC(O)O, NHC(O), NHC(O)NH, NHC(O)O, CH, CHNH, or CHO; R x are lipophilic (e.g., cholesterol, cholic acid, adamantaneacetic acid, 1-pyrenebutyric acid, dihydrotestosterone, 1,3-bis-O(hexadecyl)glycerol, geranyloxyhexyl group, hexadecylglycerol, borneol, menthol, 1,3-propanediol, heptadecyl group, palmitic acid, myristic acid, O3-(oleyl)lithocholic acid, O3-(oleyl)cholinic acid, dimethoxytrityl, or phenylalanine. enoxazine), vitamins (e.g., folic acid, vitamin A, vitamin E, biotin, pyridoxal), peptides, carbohydrates (e.g., monosaccharides, disaccharides, trisaccharides, tetrasaccharides, oligosaccharides, polysaccharides), endosomolytic components, steroids (e.g., uvaol, hesigenin, diosgenin), terpenes (e.g., triterpenes, e.g., sarsasapogenin, friedelin, epifriedelanol-derivatized lithocholic acid), or cationic lipids; R 1 , R 2 , R 2A , R 2B , R 3A , R 3B , R 4A , R 4B , R 5A , R 5B , R 5C , R 7 are each independently for each occurrence absent or NH, O, S, CH, C(O)O, C(O)NH, NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CO,

[0374] [ka] or heterocyclyl; L 1 , L 2A , L 2B , L 3A , L 3B, L 4A , L 4B , L 5A , L 5B and L 5C is each independently for each occurrence a carbohydrate, e.g., a monosaccharide, a disaccharide, a trisaccharide, a tetrasaccharide, an oligosaccharide, and a polysaccharide; R' and R'' are each independently H, C 1 -C6 alkyl, OH, SH, or N(R N )2; R N are each independently H, methyl, ethyl, propyl, isopropyl, butyl, or benzyl; R a is H or an amino acid side chain; Z', Z'', Z''' and Z'''' are each independently for each occurrence O or S; p, independently for each occurrence, represents 0 to 20.

[0375] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0376] [ka] The ligands include:

[0377] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0378] [ka] The ligands include:

[0379] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0380] [ka] The ligands include:

[0381] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0382] [ka] The ligands include:

[0383] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0384] [ka] The ligands include:

[0385] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0386] [ka] The ligands include:

[0387] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0388] [ka] The ligands include:

[0389] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0390] [ka] The ligands include:

[0391] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0392] [ka] The ligands include:

[0393] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0394] [ka] The ligands include:

[0395] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0396] [ka] The ligands include:

[0397] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0398] [ka] The monomers include:

[0399] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0400] [ka] The ligands include:

[0401] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0402] [ka] The monomers include:

[0403] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0404] [ka] The monomers include:

[0405] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0406] [ka] The monomers include:

[0407] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0408] [ka] The monomers include:

[0409] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the following structure:

[0410] [ka] The monomers include:

[0411] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0412] [ka] The monomers include:

[0413] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0414] [ka]

[0415] The ligands include:

[0416] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0417] [ka] The ligands include:

[0418] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0419] [ka] The ligands include:

[0420] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0421] [ka] The ligands include:

[0422] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0423] [ka] The ligands include:

[0424] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0425] [ka] The ligands include:

[0426] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0427] [ka] The ligands include:

[0428] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0429] [ka] The ligands include:

[0430] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0431] [ka] The ligands include:

[0432] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0433] [ka] The monomers include:

[0434] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0435] [ka] The monomers include:

[0436] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0437] [ka] The monomers include:

[0438] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0439] [ka] The monomers include:

[0440] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0441] [ka] The monomers include:

[0442] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0443] [ka] The monomers include:

[0444] In some embodiments, L 2A and L 2B are both different.

[0445] In some preferred embodiments, L 3A and L 3B are both the same.

[0446] In some embodiments, L 3A and L 3B are both different.

[0447] In some preferred embodiments, L 4A and L 4B are both the same.

[0448] In some embodiments, L 4A and L 4B are both different.

[0449] In some preferred embodiments, L 5A , L 5B and L 5C All of the are the same.

[0450] In some embodiments, L 5A , L 5B and L 5C Two of them are the same.

[0451] In some embodiments, L 5A and L 5B is the same.

[0452] In some embodiments, L 5A and L 5C is the same.

[0453] In some embodiments, L 5B and L 5C is the same.

[0454] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0455] [ka]

[0456] The monomers include:

[0457] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0458] [ka] The monomers include:

[0459] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0460] [ka] The monomers include:

[0461] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0462] [ka] wherein Y is O or S, and n is 3 to 6.

[0463] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0464] [ka] wherein Y is O or S, and n is 3 to 6.

[0465] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0466] [ka] The monomers include:

[0467] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0468] [ka] wherein X is O or S.

[0469] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, are

[0470] [ka] TIFF2026506607000072.tif81125.

[0471] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0472] [ka]

[0473] where R is OH or NHCOOH.

[0474] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0475] [ka] where R is OH or NHCOOH.

[0476] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0477] [ka] wherein R is O or S.

[0478] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0479] [ka] where R is OH or NHCOOH.

[0480] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0481] [ka] The monomers include:

[0482] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0483] [ka] where R is OH or NHCOOH.

[0484] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0485] [ka] where R is OH or NHCOOH.

[0486] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0487] [ka] where R is OH or NHCOOH.

[0488] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0489] [ka] wherein R is OH or NHCOOH.

[0490] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0491] [ka] The monomers include:

[0492] In the above monomers, X and Y are each independently for each occurrence H, a protecting group, a phosphate group, a phosphodiester group, an activated phosphate group, an activated phosphite group, a phosphoramidite, a solid support, a -P(Z')(Z'')O-nucleoside, a -P(Z')(Z'')O-oligonucleotide, a lipid, a PEG, a steroid, a polymer, a nucleotide, a nucleoside, or an oligonucleotide; and Z' and Z'' are each independently for each occurrence O or S.

[0493] In certain embodiments, the REVERSIR compound has the structure:

[0494] [ka] The ligand is conjugated to

[0495] In certain embodiments, the conjugated dsRNA has the structure:

[0496] [ka] The ligands include:

[0497] In certain embodiments, the REVERSIR compound has the structure:

[0498] [ka] The monomers include:

[0499] The synthesis of the above ligands and monomers is described, for example, in US Pat. No. 8,106,022, the contents of which are incorporated herein by reference in their entirety.

[0500] In certain embodiments, the oligomeric compounds described herein, including but not limited to, REVERSIR compounds, have the structure:

[0501] [ka] The ligand has the structure:

[0502] In certain embodiments, the oligomeric compounds described herein, including but not limited to REVERSIR compounds, comprise ligands from those described in U.S. Pat. No. 9,181,549 to Prakash et al., the entire contents of which are incorporated herein by reference.

[0503] Linking groups or bifunctional linking moieties, such as those known in the art, are applicable to the compounds provided herein. Linking groups are useful, for example, for attaching chemical functional groups, conjugate groups, reporter groups, and other groups to selective sites in parent compounds, such as oligomeric compounds. Generally, bifunctional linking moieties comprise a hydrocarbyl moiety having two functional groups. One of the functional groups is selected to bind to a parent molecule or compound of interest, and the other is selected to bind to essentially any selected group, such as a chemical functional group or conjugate group. In some embodiments, the linker comprises a chain structure or an oligomer of repeating units, such as ethylene glycol or amino acid units. Examples of functional groups routinely used in bifunctional linking moieties include, but are not limited to, electrophilic groups for reacting with nucleophilic groups and nucleophilic groups for reacting with electrophilic groups. In some embodiments, bifunctional linking moieties include amino, hydroxyl, carboxylic acid, thiol, unsaturation (e.g., double or triple bonds), and the like. Some non-limiting examples of bifunctional linking moieties include 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (SMCC), and 6-aminohexanoic acid (AHEX or AHA). Other linking groups include, but are not limited to, substituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl, or substituted or unsubstituted C2-C10 alkynyl, with a non-limiting list of preferred substituents including hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

[0504] In certain embodiments, the ligand is conjugated to the oligomeric compound via a linker.

[0505] As used herein, the term "linker" means an organic moiety that connects two parts of a compound. A linker is typically a direct bond or an atom such as oxygen or sulfur, NR 1, C(O), C(O)NH, SO, SO2, SO2NH, or substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl, alkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, and alkylaryl, alkenylaryl, alkynylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl, alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl, alkylheterocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl, alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl, alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylheteroaryl, and the like, wherein one or more methylenes are selected from O, S, S(O), SO, N(R 1 )2, which can be interrupted or terminated by C(O), a cleavable linking group, a substituted or unsubstituted aryl, a substituted or unsubstituted heteroaryl, a substituted or unsubstituted heterocycle; R 1 is hydrogen, acyl, aliphatic or substituted aliphatic.

[0506] In one embodiment, the linker is -[(P-Q''-R) q -X-(P'-Q''-R')q’ ] q’’ -T-, P, R, T, P', R' and T are each independently for each occurrence absent or CO, NH, O, S, OC(O), NHC(O), CH, CHNH, CHO; NHCH(R a )C(O), -C(O)-CH(R a )-NH-, CH=NO,

[0507] [ka] or heterocyclyl; Q" and Q"' are each independently for each occurrence absent or -(CH2) n -, -C(R 1 )(R 2 )(CH2) n -, -(CH2) n C(R 1 )(R 2 )-, -(CH2CH2O) m CH2CH2- or -(CH2CH2O) m CH2CH2NH-; X is absent or a cleavable linking group; R a is H or an amino acid side chain; R 1 and R 2 is, independently for each occurrence, H, CH, OH, SH, or N(R N )2; R N is independently for each occurrence H, methyl, ethyl, propyl, isopropyl, butyl, or benzyl; q, q', and q'' are each independently 0 to 20 for each occurrence, and the repeat units can be the same or different; n is, independently for each occurrence, 1 to 20; m is, independently for each occurrence, from 0 to 50.

[0508] In some embodiments, the linker comprises at least one cleavable linking group.

[0509] In some embodiments, the linker is a branched linker. The branch point of the branched linker can be at least trivalent, but can also be a tetravalent, pentavalent, or hexavalent atom or group exhibiting such polyvalency. In some embodiments, the branch point is -N, -N(Q)-C, -OC, -SC, -SS-C, -C(O)N(Q)-C, -OC(O)N(Q)-C, -N(Q)C(O)-C, or -N(Q)C(O)OC; Q is, independently for each occurrence, H or optionally substituted alkyl. In some embodiments, the branch point is glycerol or a derivative thereof.

[0510] A cleavable linking group is one that is sufficiently stable outside a cell but is cleaved once inside a target cell to release the two moieties held together by the linker. In preferred embodiments, the cleavable linking group is cleaved at least 10 times faster, and preferably at least 100 times faster, in the target cell or under first reference conditions (which can, for example, be selected to mimic or represent intracellular conditions) or under second reference conditions (which can, for example, be selected to mimic or represent conditions found in blood or serum) than in the subject's blood or serum.

[0511] Cleavable linking groups are susceptible to cleavage agents, such as pH, redox potential, or the presence of decomposing molecules.Generally, cleavage agents are more abundant, or found at higher levels or activity in cells than in serum or blood.Examples of such decomposing agents include redox agents that are selective for specific substrates, or redox agents that do not have substrate specificity, such as oxidative or reductive enzymes, or reducing agents present in cells, such as mercaptans, which can decompose redox-cleavable linking groups by reduction; esterases; amidases; endosomes or agents that can create an acidic environment, such as those that produce a pH of 5 or higher; for example, general acids, peptidases (which can be substrate-specific) and proteases, and enzymes that can act as phosphatases, thereby hydrolyzing or decomposing acid-cleavable linking groups.

[0512] Linker can contain a cleavable linking group that can be cleaved by a specific enzyme.The type of cleavable linking group incorporated into linker can depend on the cell to be targeted.For example, liver targeting ligand can be linked to cationic lipid through a linker that contains an ester group.Hepatocytes are rich in esterase, and therefore linker is cleaved more efficiently in hepatocytes than in cell types that are not rich in esterase.Other cell types that are rich in esterase include lung, renal cortex, and testicular cells.

[0513] Linkers containing peptide bonds can be used to target cell types rich in peptidases, such as hepatocytes and synoviocytes.

[0514] In some embodiments, the cleavable linking group is cleaved at least 1.25, 1.5, 1.75, 2, 3, 4, 5, 10, 25, 50, or 100 times faster inside a cell (or under in vitro conditions selected to mimic intracellular conditions) compared to blood or serum (or under in vitro conditions selected to mimic extracellular conditions). In some embodiments, the cleavable linking group is cleaved less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% faster in blood (or under in vitro conditions selected to mimic extracellular conditions) compared to inside a cell (or under in vitro conditions selected to mimic intracellular conditions).

[0515] Exemplary cleavable linking groups include, but are not limited to, redox cleavable linking groups (e.g., -SS- and -C(R)2)-SS-, where R is H or C1-C6 alkyl and at least one R is C1-C6 alkyl, such as CH3 or CH2CH3; phosphate-based cleavable linking groups (e.g., -OP(O)(OR)-O-, -OP(S)(OR)-O-, -OP(S)(SR)-O-, -SP(O)(OR)-O-, -OP(O)(OR)-S-, -SP(O)(OR)-S-, -OP(S)(ORk)-S-, -SP(S)(OR)-O-, -OP(O)(R)-O-, -OP(S) (R)-O-, -SP(O)(R)-O-, -SP(S)(R)-O-, -SP(O)(R)-S-, -OP(S)(R)-S-, -OP(O)(OH)-O-, -OP(S)(OH)-O-, -OP(S)(SH)-O-, -SP(O)(OH)-O-, -OP(O)(OH)-S-, -SP(O)(OH)-S-, -OP(S)(OH)-S-, -SP(S)(OH)-O-, -OP(O)(H)-O-, -OP(S)(H)-O-, -SP(O)(H)-O-, -SP(S)(H)-O-, -SP(O)(H)-S-, and -OP(S)(H)-S-, wherein R is an optionally substituted straight or branched C-C 10alkyl); acid cleavable linking groups (e.g., hydrazones, esters, esters of amino acids, -C=NN- and -OC(O)-); ester-based cleavable linking groups (e.g., -C(O)O-); peptide-based cleavable linking groups (e.g., linking groups that are cleaved by enzymes such as intracellular peptidases and proteases, e.g., -NHCHR A C(O)NHCHR B C(O)-, where R A and R B are the R groups of two adjacent amino acids. Peptide-based cleavable linkers include two or more amino acids. In some embodiments, the peptide-based cleavable linker includes an amino acid sequence that is a substrate for a peptidase or protease found in cells.

[0516] In some embodiments, the acid-cleavable linking group is cleavable in an acidic environment at a pH of about 6.5 or less (e.g., about 6.0, about 5.5, about 5.0 or less) or by an agent such as an enzyme that can act as a general acid.

[0517] In some embodiments, the linker is (N) n (where N is independently a modified or unmodified nucleotide, and n is 1 to 23). In some embodiments, n is 1 to 10, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, the oligonucleotide linker is selected from the group consisting of GNRA, (G)4, (U)4, and (dT). (4 ), wherein N is a modified or unmodified nucleotide, and R is a modified or unmodified purine nucleotide. Some of the nucleotides in the linker may participate in base pairing interactions with other nucleotides in the linker. Those skilled in the art will understand that any chemical modification or modification of the oligonucleotides described herein can be used in the oligonucleotide linker. In certain embodiments, the linker is dA.

[0518] IV. SYNTHESIS, PURIFICATION AND ANALYSIS OF REVERSIRS OF THE INVENTION Oligomerization of modified and unmodified nucleosides and nucleotides can be carried out routinely according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA (Scaringe, Methods (2001), 23, 206-217; Gait et al., Applications of Chemically Synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36; Gallo et al., Tetrahedron (2001), 57, 5707-5713).

[0519] The oligomeric compounds provided herein can be easily and routinely prepared by the well-known technique of solid phase synthesis.Devices for such synthesis are commercially available from several vendors, including, for example, Applied Biosystems (Foster City, Calif.).Any other means for such synthesis known in the art can additionally or alternatively be employed.It is well known to use similar techniques to prepare oligonucleotides such as phosphorothioates and alkylated derivatives.The present invention is not limited by the method of synthesizing antisense compounds.

[0520] Methods for purifying and analyzing oligomeric compounds are known to those skilled in the art. Analytical methods include capillary electrophoresis (CE), electrospray mass spectrometry, and the like. Such synthesis and analysis methods can be performed in multi-well plates. The method of the present invention is not limited by the method of purifying the oligomers.

[0521] The oligomeric compounds of the present invention can be prepared using solution-phase or solid-phase organic synthesis, or enzymatically by methods known in the art. Organic synthesis offers the advantage of easily preparing oligomeric chains containing unnatural or modified nucleotides. Other means for such synthesis known in the art can additionally or alternatively be employed. It is also known to use similar techniques to prepare other oligomeric compounds, such as those containing phosphorothioates, phosphorodithioates, and alkylated derivatives of intersugar linkages. The double-stranded oligomeric compounds of the present invention can be prepared using a two-step approach. First, the individual strands of the double-stranded molecule are prepared separately. Then, the component strands are annealed.

[0522] Regardless of the synthesis method, the oligomeric compound can be prepared in a solution suitable for formulation (e.g., aqueous and / or organic solution). For example, the oligomeric preparation can be precipitated, redissolved in pure double-distilled water, and lyophilized. The dried oligomeric compound can then be resuspended in a solution appropriate for the intended formulation process.

[0523] Teachings regarding the synthesis of certain modified oligomeric compounds can be found in the following U.S. patents or pending applications: U.S. Pat. Nos. 5,138,045 and 5,218,105 relate to polyamine-conjugated oligonucleotides; U.S. Pat. No. 5,212,295 relates to monomers for preparing oligonucleotides with chiral phosphorus linkages; U.S. Pat. Nos. 5,378,825 and 5,541,307 relate to oligonucleotides with modified backbones; U.S. Pat. No. 5,386,023 relates to oligonucleotides with backbone modifications. No. 5,457,191 relates to modified nucleobases based on 3-deazapurine ring systems and methods for their synthesis; U.S. Pat. No. 5,459,255 relates to modified nucleobases based on N-2 substituted purines; U.S. Pat. No. 5,521,302 relates to a process for preparing oligonucleotides with chiral phosphorus linkages; U.S. Pat. No. 5,539,082 relates to peptide nucleic acids; U.S. Pat. No. 5,554,746 relates to oligonucleotides with beta-lactam backbones. U.S. Patent No. 5,571,902 relates to methods and materials for synthesizing oligonucleotides; U.S. Patent No. 5,578,718 relates to nucleosides having alkylthio groups, which can be used as linkers to other moieties attached at any of various positions on the nucleoside; U.S. Patent Nos. 5,587,361 and 5,599,797 relate to oligonucleotides having phosphorothioate linkages of high chiral purity; U.S. Patent No. 5,506,351 relates to 2'-O-alkylguanosine and 2,6 - relates to processes for preparing related compounds, including diaminopurine compounds; U.S. Patent No. 5,587,469 relates to oligonucleotides having N-2 substituted purines; U.S. Patent No. 5,587,470 relates to oligonucleotides having 3-deazapurines; U.S. Patent Nos. 5,223,166 and 5,608,040 both relate to conjugated 4'-desmethyl nucleoside analogs; U.S. Patent Nos. 5,602,240 and 5,610,289 relate to backbone-modified oligonucleotide analogs;U.S. Patent Nos. 6,262,241 and 5,459,255 relate, inter alia, to methods for synthesizing 2'-fluorooligonucleotides;

[0524] V. Pharmaceutical Compositions of the Invention The oligomeric compounds can be mixed with pharmaceutically acceptable active and / or inactive substances to prepare pharmaceutical compositions or formulations. The composition and method for formulating a pharmaceutical composition depends on many criteria, including, but not limited to, the route of administration, the extent of the disease, or the dose to be administered.

[0525] Oligomeric compounds, including REVERSIR compounds, can be utilized in pharmaceutical compositions by combining such oligomeric compounds with a suitable pharmaceutically acceptable diluent or carrier. Pharmaceutically acceptable diluents include phosphate buffered saline (PBS). PBS is a suitable diluent for use in parenterally delivered compositions. Thus, in one embodiment, the method described herein employs a pharmaceutical composition comprising a REVERSIR compound and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS.

[0526] Pharmaceutical compositions comprising oligomeric compounds include any pharmaceutically acceptable salts, esters, or salts of such esters.In certain embodiments, pharmaceutical compositions comprising oligomeric compounds include one or more oligonucleotides that can provide (directly or indirectly) biologically active metabolites or their residues when administered to animals, including humans.Therefore, for example, the present disclosure also relates to pharmaceutically acceptable salts of antisense compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents.Suitable pharmaceutically acceptable salts include, but are not limited to, sodium salts and potassium salts.

[0527] Prodrugs can involve the incorporation of additional nucleosides at one or both termini of the oligomeric compound that are cleaved by endogenous nucleases in vivo to form the active oligomeric compound.

[0528] The pharmaceutical composition of the present invention can be administered in many ways, depending on whether local or systemic treatment is desired and the area to be treated.Administration can be topical administration (for example, by transdermal patch), pulmonary administration, for example, by inhalation of powder or aerosol, including by nebulizer, or by pneumoperitoneum; intratracheal administration, intranasal administration, epidermal and transdermal administration, oral administration or parenteral administration.Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; subcutaneous, for example, via implanted device; or intracranial, for example, intracerebral parenchyma, intrathecal or intraventricular administration.

[0529] The oligomeric compounds can be delivered in a manner that targets a particular tissue, such as the liver (eg, hepatocytes of the liver).

[0530] Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids, and powders. Conventional pharmaceutical carriers, aqueous, powder, or oily bases, thickeners, and the like may be necessary or desirable. Coated condoms, gloves, and the like are also useful. Suitable topical formulations include iRNAs featured in the present invention mixed with topical delivery agents such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents, and surfactants. Suitable lipids and liposomes include neutral (e.g., dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidylcholine DMPC, distearoylphosphatidylcholine), anionic (e.g., dimyristoylphosphatidylglycerol DMPG), and cationic (e.g., dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidylethanolamine DOTMA). The iRNAs featured in the present invention can be encapsulated within liposomes or complexed with liposomes, particularly cationic liposomes. Alternatively, the iRNA can be complexed with lipids, particularly cationic lipids. Suitable fatty acids and esters include, but are not limited to, arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitine, acylcholine, or C 1-20 These include alkyl esters (e.g., isopropyl myristate IPM), monoglycerides, diglycerides, or pharmaceutically acceptable salts thereof. Topical formulations are described in detail in U.S. Patent No. 6,747,014, which is incorporated herein by reference.

[0531] In addition to microemulsions, many other organized surfactant structures have been studied and used in drug formulation. These include single-phase structures, micelles, bilayers, and vesicles. Vesicles such as liposomes have attracted great interest from the perspective of drug delivery due to their specificity and long duration of action. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in a spherical bilayer(s).

[0532] Liposomes are unilamellar or multilamellar vesicles with a membrane formed from a lipophilic substance and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes have the advantage of being able to fuse with the cell wall. Non-cationic liposomes cannot fuse efficiently with the cell wall, but are taken up by macrophages in vivo.

[0533] Additional advantages of liposomes include: liposomes derived from natural phospholipids are biocompatible and biodegradable; liposomes can entrap a wide range of water- and lipid-soluble drugs; and liposomes can protect drugs encapsulated in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Important considerations in the preparation of liposome formulations are the surface charge of the lipids, vesicle size and the water capacity of the liposomes.

[0534] Liposomes are useful for transporting and delivering active ingredients to the site of action. Because liposome membranes are structurally similar to biological membranes, when liposomes are applied to tissues, they begin to combine with cell membranes, and as the combination of liposomes with cells progresses, the contents of the liposomes are released into the cells where the active agent can act.

[0535] Liposomal formulations have been the focus of extensive research as a delivery mode for many drugs. For topical administration, liposomes have proven to offer several advantages over other formulations. These advantages include reduced side effects associated with high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to deliver a wide variety of drugs, both hydrophilic and hydrophobic, to the skin.

[0536] There have been several reports on the ability of liposomes to deliver drugs, including polymeric DNA, to the skin. Compounds such as analgesics, antibodies, hormones, and polymeric DNA have been administered to the skin. Many applications have resulted in targeting of the upper epidermis.

[0537] There are two major classifications of liposomes. Cationic liposomes are positively charged liposomes that interact with negatively charged DNA molecules to form stable complexes. The positively charged DNA / liposome complex binds to the negatively charged cell surface and is internalized into endosomes. Due to the acidic pH inside the endosome, the liposomes rupture, releasing their contents into the cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0538] pH-sensitive or negatively charged liposomes entrap DNA rather than complexing with it. Because both DNA and lipids are similarly charged, repulsion occurs rather than complex formation. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cultured cell monolayers. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0539] One major type of liposome composition contains phospholipids other than naturally occurring phosphatidylcholine. For example, neutral liposome compositions can be formed from dimyristoylphosphatidylcholine (DMPC) or dipalmitoylphosphatidylcholine (DPPC). Anionic liposome compositions are generally formed from dimyristoylphosphatidylglycerol, and anionic fusogenic liposomes are primarily formed from dioleoylphosphatidylethanolamine (DOPE). Another type of liposome composition is formed from phosphatidylcholine (PC), such as soybean PC and egg PC. Another type is formed from a mixture of phospholipids and / or phosphatidylcholine and / or cholesterol.

[0540] Several studies have evaluated the topical delivery of liposomal drug formulations to the skin. Application of interferon-containing liposomes to the skin of guinea pigs resulted in a reduction in cutaneous herpes sores, whereas delivery of interferon by other means (e.g., as a solution or emulsion) was ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Furthermore, additional studies have tested the efficacy of interferon administered as part of a liposomal formulation versus administration of interferon using an aqueous system, concluding that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0541] Nonionic liposomal systems have also been investigated to determine their usefulness in skin drug delivery, particularly systems containing nonionic surfactants and cholesterol. Nonionic liposomal formulations containing Novasome™ I (glyceryl dilaurate / cholesterol / polyoxyethylene-10-stearyl ether) and Novasome™ II (glyceryl distearate / cholesterol / polyoxyethylene-10-stearyl ether) were used to deliver cyclosporine A to the dermis of mouse skin. The results showed that such nonionic liposomal systems were effective in promoting the deposition of cyclosporine A into different layers of the skin (Hu et al. STP Pharma. Sci., 1994, 4, 6, 466).

[0542] Liposomes also include "sterically stabilized" liposomes, which term, as used herein, refers to liposomes that contain one or more specialized lipids that, when incorporated into the liposome, result in enhanced circulation longevity compared to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes include those in which the vesicle-forming lipid portion of the liposome is (A) monosialoganglioside G M1 or (B) are derivatized with one or more hydrophilic polymers, such as polyethylene glycol (PEG) moieties. Without wishing to be bound by any particular theory, it is believed in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes results from reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0543] Various liposomes containing one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. NY Acad. Sci., 1987, 507, 64) report the use of monosialoganglioside G to improve the blood half-life of liposomes. M1 reported the ability of (1) sphingomyelin, and (2) ganglioside G. M1 or liposomes containing galactocerebroside sulfate. U.S. Patent No. 5,543,155 (Webb et al.) discloses liposomes containing sphingomyelin. International Publication No. WO 97 / 13499 (Lim et al.) discloses liposomes containing 1,2-sn-dimyristoylphosphatidylcholine.

[0544] Many liposomes containing lipids derivatized with one or more hydrophilic polymers, and methods for their preparation, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) describe the preparation of liposomes containing a nonionic detergent 2C containing a PEG moiety. 1215G(FEBS Lett., 1984, 167, 79) describe liposomes containing PEG- or PEG-stearate-derivatized phosphatidylethanolamine (PE) as a hydrophilic coating of polystyrene particles. Synthetic phospholipids modified by the attachment of carboxyl groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) describe experiments showing that liposomes containing phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate significantly increase their blood circulation half-life. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended these observations to other PEG-derivatized phospholipids, such as DSPE-PEG, formed from a combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes with covalently bound PEG moieties on their outer surface are described in European Patent No. 0445131B1 and International Publication No. WO90 / 04384 to Fisher et al. Liposomal compositions containing 1-20 mole % PEG-derivatized PE and methods for their use are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. 0496813B1). Liposomes containing many other lipid-polymer conjugates are disclosed in International Publication No. WO91 / 05545 and U.S. Patent No. 5,225,212 (both by Martih et al.) and International Publication No. WO94 / 20073 (by Zalipsky et al.). Liposomes containing PEG-modified ceramide lipids are described in International Publication No. WO96 / 10391 (by Choi et al.). U.S. Patent No. 5,540,935 (by Miyazaki et al.) and U.S. Patent No. 5,556,948 (by Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on the surface.

[0545] Many liposomes containing nucleic acid are known in the art.International Publication No. WO96 / 40062 by Thierry et al. discloses a method for encapsulating high molecular weight nucleic acid into liposome.US Patent No. 5,264,221 by Tagawa et al. discloses protein-bound liposome, and claims that the contents of such liposome can contain dsRNA.US Patent No. 5,665,710 by Rahman et al. describes a specific method for encapsulating oligodeoxynucleotide into liposome.International Publication No. WO97 / 04787 by Love et al. discloses liposomes containing dsRNA that target raf gene.

[0546] Transfersomes, yet another type of liposome, are highly deformable lipid aggregates that are attractive candidates for drug delivery vehicles. Transfersomes can be described as lipid droplets that are so highly deformable that they can easily penetrate pores smaller than the droplets themselves. Transfersomes are adaptable to their environment, e.g., they self-optimize (adapt to the shape of skin pores), self-repair, frequently reach their target without fragmentation, and are often self-loading. To create transfersomes, a surface-edge active agent, usually a surfactant, can be added to standard liposome compositions. Transfersomes have been used to deliver serum albumin to the skin. Transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0547] Liposomal compositions can be prepared by a variety of methods known in the art. See, for example, U.S. Patent Nos. 4,235,871; 4,737,323; 4,897,355 and 5,171,678; International Application Publication Nos. WO96 / 14057 and WO96 / 37194; Felgner, PL et al., Proc. Natl. Acad. Sci., USA (1987) 8:7413-7417; Bangham, et al., M. Mol. Biol. (1965) 23:238; Olson, et al., Biochim. Biophys. Acta (1979) 557:9; Szoka, et al., Proc. Natl. Acad. Sci. (1978) 75: 4194; Mayhew, et al., Biochim. Biophys. Acta (1984) 775:169, Kim, et al. Biochim. Biophys. Acta (1983) 728:339, and Fukunaga, et al. Endocrinol. (1984) 115:757.

[0548] Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way to classify and rank the properties of natural and synthetic surfactants is by using the hydrophilic / lipophilic balance (HLB). The nature of the hydrophilic group (also known as "head") provides the most useful means for classifying the various surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0549] If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants are widely used in pharmaceuticals and cosmetics and can be used over a wide range of pH values. Their HLB values ​​generally range from 2 to approximately 18, depending on their structure. Nonionic surfactants include nonionic esters, such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers, such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated / propoxylated block polymers, are also included in this class. Polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0550] If the surfactant molecule has a negative charge when dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactates, acyl amides of amino acids, sulfate esters such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyltaurates, sulfosuccinates, and phosphates. The most important anionic surfactants are alkyl sulfates and soaps.

[0551] If the surfactant molecule carries a positive charge when dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The most commonly used members of this class are quaternary ammonium salts.

[0552] If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines, and phosphatides.

[0553] The use of surfactants in drug products, formulations and emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, NY, 1988, p. 285).

[0554] A. Lipid particles In some embodiments, REVERSIR can be fully encapsulated in a lipid formulation, such as an LNP or other nucleic acid-lipid particle. The REVERSIR encapsulated in the lipid formulation can be unconjugated or conjugated to a ligand (i.e., a conjugated REVERSIR).

[0555] As used herein, the term "LNP" refers to stable nucleic acid-lipid particles. LNPs contain cationic lipids, non-cationic lipids, and lipids that prevent particle aggregation (e.g., PEG-lipid conjugates). LNPs exhibit extended circulatory life after intravenous (iv) injection and accumulate at distal sites (e.g., sites physically distant from the administration site), making them extremely useful for systemic applications. LNPs include "pSPLPs," which contain encapsulated condensing agent-nucleic acid complexes, as described in PCT Application Publication No. WO 00 / 03683. The particles of the present invention typically have an average diameter of about 50 nm to about 150 nm, more typically about 60 nm to about 130 nm, more typically about 70 nm to about 110 nm, and most typically about 70 nm to about 90 nm, and are substantially nontoxic. Furthermore, the nucleic acid present in the nucleic acid-lipid particles of the present invention is resistant to degradation by nucleases in aqueous solution. Nucleic acid-lipid particles and methods for their preparation are disclosed, for example, in U.S. Patent Nos. 5,976,567; 5,981,501; 6,534,484; 6,586,410; 6,815,432; U.S. Patent Application Publication No. 2010 / 0324120; and PCT Application Publication No. WO 96 / 40964.

[0556] In some embodiments, the lipid to drug ratio (mass / mass ratio) (e.g., lipid to REVERSIR ratio) is in the range of about 1:1 to about 50:1, about 1:1 to about 25:1, about 3:1 to about 15:1, about 4:1 to about 10:1, about 5:1 to about 9:1, or about 6:1 to about 9:1. Ranges intermediate to the above ranges are also contemplated as part of the invention.

[0557] Examples of cationic lipids include N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), N,N-distearyl-N,N-dimethylammonium bromide (DDAB), N-(1-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTAP), N-(1-(2,3-dioleyloxy)propyl)-N,N,N-trimethylammonium chloride (DOTMA), N,N-dimethyl-2,3-dioleyloxy)propylamine (DODMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLinDMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (DLenDMA), 1,2-dilinoleylcarbamoyl 1,2-Dilinoleyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-Dilinoleyloxy-3-(dimethylamino)acetoxypropane (DLin-DAC), 1,2-Dilinoleyloxy-3-morpholinopropane (DLin-MA), 1,2-Dilinoleoyl-3-dimethylaminopropane (DLin-DAP), 1,2-Dilinoleoylthio-3-dimethylaminopropane (DLin-S-DMA), 1-Linoleoyl-2-linoleoyloxy-3-dimethylaminopropane (DLin-2-DMAP), 1,2-Dilinoleoyloxy-3-trimethylaminopropane chloride salt (DLin-TMA.Cl), 1,2-Dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP.Cl), 1,2-dilinoleyloxy-3-(N-methylpiperazino)propane (DLin-MPZ), or 3-(N,N-dilinoleylamino)-1,2-propanediol (DLinAP), 3-(N,N-dioleylamino)-1,2-propanediol (DOAP), 1,2-dilinoleyloxy-3-(2-N,N-dimethylamino)ethoxypropane (DLin-EG-DMA), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (D LinDMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA) or their analogs, (3aR,5s,6aS)-N,N-dimethyl-2,2-di((9Z,12Z)-octadecane-9,12-dienyl)tetrahydro-3aH-cyclopenta[d][1,3]dioxol-5-amine (ALN100), (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl The cationic lipid may be 4-(dimethylamino)butanoate (MC3), 1,1'-(2-(4-(2-((bis(2-hydroxydodecyl)amino)ethyl)(2-hydroxydodecyl)amino)ethyl)piperazin-1-yl)ethylazanediyl)didodecan-2-ol, or a mixture thereof. The cationic lipid may comprise about 20 mol% to about 50 mol% or about 40 mol% of the total lipid present in the particle.

[0558] In some embodiments, the compound 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane can be used to prepare lipid-REVERSIR nanoparticles. The synthesis of 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane is described in International Application No. PCT / US2009 / 061897 (published as International Publication No. WO / 2010 / 048536), which is incorporated herein by reference.

[0559] In some embodiments, the lipid-REVERSIR particles comprise 40% 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane:10% DSPC:40% cholesterol:10% PEG-C-DOMG (mol percent), have a particle size of 63.0±20 nm, and a REVERSIR / lipid ratio of 0.027.

[0560] Ionizable / non-cationic lipids can be anionic or neutral lipids, including but not limited to distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoyl-phosphatidylethanolamine (DOPE), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleylphosphatidylethanolamine (POPE). Non-cationic lipids include, for example, dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-L-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoyl-phosphatidylethanolamine (DSPE), 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearoyl-2-oleoyl-phosphatidylethanolamine (SOPE), cholesterol, or mixtures thereof. When cholesterol is included, the non-cationic lipid can be about 5 mol% to about 90 mol%, about 10 mol%, or about 58 mol% of the total lipid present in the particle.

[0561] The conjugated lipid that inhibits particle aggregation can be, for example, a polyethylene glycol (PEG)-lipid, including, but not limited to, PEG-diacylglycerol (DAG), PEG-dialkyloxypropyl (DAA), PEG-phospholipid, PEG-ceramide (Cer), or a mixture thereof. PEG-DAA conjugates can be, for example, PEG-dilauryloxypropyl (C12 ), PEG-dimyristyloxypropyl (C 14 ), PEG-dipalmityloxypropyl (C 16 ), or PEG-distearyloxypropyl (C 18 The conjugated lipid that prevents particle aggregation can be from 0 mol % to about 20 mol % or about 2 mol % of the total lipid present in the particle.

[0562] In some embodiments, the nucleic acid-lipid particles further comprise cholesterol, for example, from about 10 mol % to about 60 mol % or about 48 mol % of the total lipid present in the particle.

[0563] Additional exemplary lipid-REVERSIR formulations are set forth in the table below.

[0564] [Table 1-1] [Table 1-2] [Table 1-3]

[0565] Formulations containing DLinDMA (1,2-dilinolenyloxy-N,N-dimethylaminopropane) are described in International Publication No. WO2009 / 127060, filed April 15, 2009, which is incorporated herein by reference.

[0566] Formulations containing XTC are described, for example, in U.S. Provisional Application No. 61 / 148,366, filed January 29, 2009; U.S. Provisional Application No. 61 / 156,851, filed March 2, 2009; U.S. Provisional Application No. 61 / 228,373, filed June 24, 2009; U.S. Provisional Application No. 61 / 239,686, filed September 3, 2009; and International Application No. PCT / US2010 / 022614, filed January 29, 2010, which are incorporated herein by reference.

[0567] Formulations containing MC3 are described, for example, in US Patent Publication No. 2010 / 0324120, filed June 10, 2010, the entire contents of which are incorporated herein by reference.

[0568] Formulations containing biodegradable lipids are described, for example, in PCT Publication Nos. WO2011 / 153493, filed June 3, 2011, and WO / 2013 / 086354, filed December 7, 2012, the entire contents of which are incorporated herein by reference.

[0569] Formulations containing (13Z,16Z)-N,N-dimethyl-3-nonyldocosa-13,16-dien-1-amine are described, for example, in PCT Publication No. WO / 2012 / 040184, filed September 20, 2011, the entire contents of which are incorporated herein by reference.

[0570] The oligomeric compounds of the present invention can be prepared and formulated as micelles.As used herein, "micelle" refers to a specific type of molecular assembly in which amphiphilic molecules are arranged in a spherical structure, with all hydrophobic portions of the molecules facing inward, and hydrophilic portions remaining in contact with the surrounding aqueous phase.If the environment is hydrophobic, the opposite arrangement exists.

[0571] In some embodiments, the formulation comprises micelles formed from the oligonucleotides of the present invention and at least one amphiphilic carrier, the micelles preferably having an average diameter of less than about 100 nm. More preferred embodiments provide micelles having an average diameter of less than about 50 nm, and even more preferred embodiments provide micelles having an average diameter of less than about 30 nm, or even less than about 20 nm.

[0572] The micelle formulation contains an aqueous solution of the oligonucleotide composition, an alkali metal C8-C 22They can be prepared by mixing an alkyl sulfate and an amphiphilic carrier. The amphiphilic carrier can be added simultaneously with or after the addition of the alkali metal alkyl sulfate. Micelles can be formed by mixing virtually any components, but intensive mixing is required to provide smaller micelles.

[0573] The oligomeric compounds of the present invention can be prepared and formulated as emulsions. As used herein, an "emulsion" is a heterogeneous system of one liquid dispersed in another liquid in the form of droplets.

[0574] Emulsions are often biphasic systems containing two immiscible liquid phases intimately mixed and dispersed with each other. Generally, emulsions can be either water-in-oil (w / o) or oil-in-water (o / w). When the aqueous phase is finely divided and dispersed as minute droplets into the bulk oil phase, the resulting composition is called a water-in-oil (w / o) emulsion. Alternatively, when the oil phase is finely divided and dispersed as minute droplets into the bulk aqueous phase, the resulting composition is called a water-in-oil (o / w) emulsion. Emulsions may contain additional components in addition to the dispersed phase; the active agent may be present as a solution in either the aqueous or oil phase, or as a separate phase. Pharmaceutical excipients, such as emulsifiers, stabilizers, dyes, and antioxidants, may also be present in emulsions as needed. Pharmaceutical emulsions can also be multiple emulsions, consisting of more than one phase, as in the case of oil-in-water-in-oil (o / w / o) emulsions and water-in-oil-in-water (w / o / w) emulsions. Such complex formulations often offer certain advantages over simple binary emulsions. Multiple emulsions in which individual oil droplets of an o / w emulsion encase small water droplets constitute a w / o / w emulsion. Similarly, a system of oil droplets encased in globules of water stabilized by an oily continuous phase provides an o / w / o emulsion.

[0575] Emulsions are characterized by little or no thermodynamic stability. In most cases, the dispersed or discontinuous phase of an emulsion is well dispersed in the external or continuous phase, and is maintained in this form by emulsifiers or the viscosity of the formulation. Either phase of an emulsion can be semi-solid or solid, as in the case of emulsion-type ointment bases and creams. Other means of stabilizing emulsions include the use of emulsifiers, which can be incorporated into either phase of the emulsion. Emulsifiers can be broadly divided into four categories: synthetic surfactants, naturally occurring emulsifiers, absorbent bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0576] Synthetic surfactants, also known as surface active agents, find wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, NY, 1988, volume 1, p. 199). Surfactants are typically amphiphilic, containing hydrophilic and hydrophobic moieties. The ratio of hydrophilic to hydrophobic properties of a surfactant is called the hydrophilic / lipophilic balance (HLB), and is a valuable tool for classifying and selecting surfactants in the preparation of formulations. Surfactants can be divided into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 285).

[0577] Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin, and acacia. Absorbent bases have hydrophilic properties, such as anhydrous lanolin and hydrophilic petrolatum, which absorb water to form water-in-oil emulsions while maintaining a semisolid consistency. Finely divided solids have also been used as excellent emulsifiers, especially in combination with surfactants and in viscous preparations. These include polar inorganic solids such as heavy metal hydroxides, non-swelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate, and colloidal magnesium aluminum silicate, pigments, and non-polar solids such as carbon or glyceryl tristearate.

[0578] A wide variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives, and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199).

[0579] Hydrophilic colloids, or hydrocolloids, include naturally occurring gums and synthetic polymers, such as polysaccharides (e.g., acacia, agar, alginate, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (e.g., carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (e.g., carbomer, cellulose ethers, and carboxyvinyl polymers), which disperse or swell in water to form colloidal solutions and stabilize emulsions by forming strong interfacial films around the dispersed phase droplets and increasing the viscosity of the external phase.

[0580] Because emulsions contain many components that can support microbial growth, such as carbohydrates, proteins, sterols, and phosphatides, these formulations often contain preservatives. Preservatives commonly used in emulsion formulations include methylparaben, propylparaben, quaternary ammonium salts, benzalkonium chloride, p-hydroxybenzoic acid esters, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration. Antioxidants used can be free radical scavengers such as tocopherol, alkyl gallates, butylhydroxyanisole, and butylhydroxytoluene; reducing agents such as ascorbic acid and sodium metabisulfite; and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0581] In some embodiments, the composition is formulated as microemulsion.As used herein, " microemulsion " refers to the system of water, oil and amphiphilic substance, which is a single optically isotropic and thermodynamically stable liquid solution.Microemulsion also includes the dispersion of two immiscible liquids, which is thermodynamically stable and isotropically transparent, and is stabilized by the interfacial film of surface-active molecules.

[0582] A microemulsion can be defined as a system of water, oil, and an amphiphile that is a single, optically isotropic, thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245). Typically, microemulsions are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, typically a medium-chain alcohol, to form a transparent system. Thus, a microemulsion can also be described as a thermodynamically stable, isotropically transparent dispersion of two immiscible liquids, stabilized by an interfacial film of surfactant molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions are typically prepared by combining three to five components, including oil, water, surfactant, cosurfactant, and electrolyte. Whether a microemulsion is water-in-oil (w / o) or oil-in-water (o / w) depends on the properties of the oil and surfactant used, as well as the structure and geometric packing of the polar head and hydrocarbon tail of the surfactant molecule (Schott, in *Remington's Pharmaceutical Sciences*, *Mack Publishing Co.*, Easton, Pa., 1985, p. 271).

[0583] The phenomenological approach using phase diagrams has been extensively studied, providing those skilled in the art with comprehensive knowledge of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that form spontaneously.

[0584] Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, nonionic surfactants, Brij 96, polyoxyethylene oleyl ether, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), and decaglycerol decaoleate (DAO750), either alone or in combination with cosurfactants. Cosurfactants, typically short-chain alcohols such as ethanol, 1-propanol, and 1-butanol, increase interfacial fluidity by penetrating the surfactant film, resulting in the formation of disordered films due to the creation of voids between surfactant molecules. However, microemulsions can also be prepared without using co-surfactants, and alcohol-free self-emulsifying microemulsion systems are known in the art.The aqueous phase can typically be, but is not limited to, water, aqueous solution of drug, glycerol, PEG300, PEG400, polyglycerol, propylene glycol, and ethylene glycol derivatives.The oil phase can include, but is not limited to, materials such as Captex300, Captex355, Capmul MCM, fatty acid esters, medium-chain (C8-C12) mono-, di-, and triglycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C10 glycerides, vegetable oils, and silicone oils.

[0585] Microemulsions have been of particular interest for their potential to solubilize drugs and enhance their absorption. Lipid-based microemulsions (both o / w and w / o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions offer advantages such as improved drug solubilization, drug protection from enzymatic hydrolysis, potential enhancement of drug absorption through surfactant-induced changes in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical efficacy, and reduced toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Microemulsions often form spontaneously when their components are combined at ambient temperature. This can be particularly advantageous when formulating heat-sensitive drugs, peptides, or dsRNA. Microemulsions are also effective for transdermal delivery of active ingredients in both cosmetic and pharmaceutical applications. The microemulsion compositions and formulations of the present invention are expected to enhance systemic absorption of dsRNA and nucleic acids from the gastrointestinal tract and improve local cellular uptake of dsRNA and nucleic acids.

[0586] The microemulsions of the present invention can also contain additional ingredients and additives, such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers, to improve formulation properties and enhance the absorption of the dsRNA and nucleic acids of the present invention.The penetration enhancers used in the microemulsions of the present invention can be classified into one of five major categories: surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92).Each of these classes has been discussed above.

[0587] The application of emulsion formulations via dermatological, oral, and parenteral routes, as well as their manufacturing methods, have been reviewed in the literature, see, for example, Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 245; and Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger, and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, NY, volume 1, p. 335, the contents of which are incorporated herein by reference in their entirety.

[0588] The oligomeric compounds of the present invention can be prepared and formulated as lipid particles, for example, the formulated lipid particles (FLiP) comprise (a) the oligonucleotides of the present invention conjugated to a lipophilic substance, and (b) at least one lipid component, such as emulsion, liposome, isolated lipoprotein, reconstituted lipoprotein or phospholipid, wherein the conjugated oligonucleotides are aggregated, mixed or associated.The stoichiometry of the oligonucleotide and lipid component can be 1:1.Alternatively, the stoichiometry can be 1:many, many:1 or many:many, where many is 2 or more.

[0589] FLiP can comprise one or several lipid-binding proteins that are aggregated, mixed or associated with triacylglycerol, phospholipid, glycerol, and oligonucleotide via lipophilic linker molecule.Surprisingly, it has been found that by combining said one or several lipid-binding proteins with said lipid, FLiP shows affinity to liver, intestine, kidney, steroidogenic organ, heart, lung and / or muscle tissue.Therefore, these FLiP can function as a carrier of oligonucleotide to these tissues.For example, lipid-conjugated oligonucleotide, for example cholesterol-conjugated oligonucleotide, binds to HDL and LDL lipoprotein particles, and mediates cellular uptake when binding to their respective receptors, thus directing the delivery of oligonucleotide to liver, intestine, kidney and steroidogenic organ.See Wolfrum et al.Nature Biotech.(2007), 25:1145-1157.

[0590] FLiPs can be lipid particles containing 15-25% triacylglycerol, about 0.5-2% phospholipids, 1-3% glycerol, and one or several lipid-binding proteins. FLiPs can be lipid particles having about 15-25% triacylglycerol, about 1-2% phospholipids, about 2-3% glycerol, and one or several lipid-binding proteins. In some embodiments, the lipid particles contain about 20% triacylglycerol, about 1.2% phospholipids, and about 2.25% glycerol, and one or several lipid-binding proteins.

[0591] Another lipid component suitable for FLiP is lipoprotein, for example, isolated lipoprotein or more preferably reconstituted lipoprotein.Exemplary lipoprotein includes chylomicron, VLDL (very low density lipoprotein), IDL (intermediate density lipoprotein), LDL (low density lipoprotein) and HDL (high density lipoprotein).The method for producing reconstituted lipoprotein is known in the art, for example, see A. Jones, Experimental Lung Res.6, 255-270 (1984), U.S. Patent No. 4,643,988 and U.S. Patent No. 5,128,318, PCT Application Publication No. WO87 / 02062, Canadian Patent No. 2,138,925. Other methods for producing reconstituted lipoproteins, particularly apolipoproteins AI, A-II, A-IV, apoC, and apoE, are described in A. Jonas, Methods in Enzymology 128, 553-582 (1986) and G. Franceschini et al. J. Biol. Chem., 260(30), 16321-25 (1985).

[0592] One preferred lipid component for FLiP is Intralipid. Intralipid® is the trade name for the first safe lipid emulsion for human use. Intralipid® 20% (20% intravenous lipid emulsion) consists of 20% soybean oil, 1.2% egg yolk phospholipids, 2.25% glycerin, and water for injection. It is further within the scope of the present invention that other suitable oils, such as safflower oil, are useful in preparing the lipid component of FLiP.

[0593] FLiPs can range in size from about 20 to 50 nm or about 30 to 50 nm, e.g., about 35 nm or about 40 nm. In some embodiments, FLiPs have a particle size of at least about 100 nm. FLiPs, whether characterized as liposome-based or emulsion-based, can alternatively be about 100 to 150 nm, e.g., about 110 nm, about 120 nm, about 130 nm, or about 140 nm. Multiple FLiPs can also be aggregated and delivered together, thus resulting in a size greater than 100 nm.

[0594] The process for producing lipid particles includes (a) mixing a lipid component with one or several lipophilic (e.g., cholesterol)-conjugated oligonucleotides, which may be chemically modified; and (b) fractionating the mixture. In some embodiments, the process includes an additional step of selecting a fraction having a particle size of 30-50 nm, preferably about 40 nm.

[0595] Some exemplary lipid particle formulations applicable to the present invention are described in US Patent Application No. 12 / 412,206 (filed March 26, 2009), the contents of which are incorporated herein by reference in their entirety.

[0596] In some embodiments, oligomeric compounds may be formulated into yeast cell wall particles ("YCWP"). Yeast cell wall particles comprise an extracted yeast cell wall exterior and a core, the core containing a payload (e.g., an oligonucleotide). The exterior of the particle comprises yeast glucan (e.g., beta-glucan, beta-1,3-glucan, beta-1,6-glucan), yeast mannan, or a combination thereof. Yeast cell wall particles are typically spherical particles with a diameter of about 1-4 μm.

[0597] The preparation of yeast cell wall particles is known in the art and is described, for example, in U.S. Patent Nos. 4,992,540; 5,082,936; 5,028,703; 5,032,401; 5,322,841; 5,401,727; 5,504,079; 5,607,677; 5,741,495; The application of yeast cell-like particles for drug delivery is described in, for example, U.S. Patent Nos. 5,830,463; 5,968,811; 6,444,448; and 6,476,003, U.S. Patent Application Publication Nos. 2003 / 0216346 and 2004 / 0014715, and International Application Publication No. WO2002 / 12348, the contents of which are incorporated herein by reference in their entirety.The application of yeast cell-like particles for drug delivery is described in, for example, U.S. Patent Nos. 5,032,401; 5,607,677; 5,741,495; and 5,830,463, and U.S. Patent Application Publication Nos. 2005 / 0281781 and 2008 / 0044438, the contents of which are incorporated herein by reference in their entirety. US Patent Application Publication No. 2009 / 0226528, the contents of which are incorporated herein by reference, describes the formulation of nucleic acids with yeast cell wall particles for delivery of oligonucleotides to cells.

[0598] Exemplary formulations for oligomeric compounds are described in U.S. Patent Nos. 4,897,355; 4,394,448; 4,235,871; 4,231,877; 4,224,179; 4,753,788; 4,673,567; 4,247,411; 4,814,270; 5,567,434; 5,552,157; ​​5,565,213; 5,738,868; 5,795,587; 5,922,859; Nos. 6,077,663; 7,906,484; and 8,642,076; PCT Publication No. WO2009 / 132131 and U.S. Patent Publication Nos. 2006 / 0240093, 2007 / 0135372, 2011 / 0117125, 2009 / 0291131, 2012 / 0316220, 2009 / 0163705, and 2013 / 0129785, the contents of which are incorporated herein by reference in their entireties. Behr (1994) Bioconjugate Chem. 5:382-389, and Lewis et al. (1996) PNAS 93:3176-3181) also describe formulations for oligonucleotides applicable to the present invention, the contents of which are incorporated herein by reference in their entireties.

[0599] VI. dsRNA Targeted by REVERSIR The present invention provides REVERSIR™, which inhibits the activity of dsRNA agents that contain thermodestabilizing nucleotide modifications in the antisense strand.

[0600] In specific embodiments, the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in a duplex; a destabilizing sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

[0601] In some embodiments, the thermally destabilizing nucleotide modification is an abasic modification. In some embodiments, the thermally destabilizing nucleotide modification is a mismatch with the opposing nucleotide in a duplex. In some embodiments, the thermally destabilizing nucleotide modification is a destabilizing sugar modification. In some embodiments, the thermally destabilizing nucleotide modification is a 2'-deoxy modification. In some embodiments, the thermally destabilizing nucleotide modification is an acyclic nucleotide. In some embodiments, the thermally destabilizing nucleotide modification is an unlocked nucleic acid (UNA). In some embodiments, the thermally destabilizing nucleotide modification is a glycerol nucleic acid (GNA).

[0602] In some embodiments, the dsRNA agent includes at least 1, at least 2, at least 3, at least 5, or at least 10 thermally destabilizing nucleotide modifications described herein.

[0603] As discussed above, the term " dsRNA " refers to the agent that mediates the target cleavage of RNA transcripts.These agents associate with the cytoplasmic multiprotein complex known as RNAi-induced silencing complex (RISC).The agent that is effective in inducing RNA interference is also referred to herein as siRNA, RNAi agent, or iRNA agent, or dsRNA agent.

[0604] As used herein, the terms "dsRNA activity," "siRNA activity," and "RNAi activity" refer to gene silencing or RNAi interference by an adsRNA agent.

[0605] As used herein, " gene silencing " by RNA interference molecules refers to the mRNA level of target gene in cells that is reduced by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to 100%, and any integer between the mRNA level found in cells that do not contain miRNA or RNA interference molecules.In a preferred embodiment, mRNA level is reduced by at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 99%, up to 100%, and any integer between 5% and 100%.

[0606] As used herein, the term "modulate gene expression" means that the expression of a gene encoding one or more proteins or protein subunits, or the level of an RNA molecule or equivalent RNA molecule, is up-regulated or down-regulated, such that the expression, level, or activity is greater or less than that observed in the absence of the modulator. For example, the term "modulate" can mean "inhibit," although the use of the term "modulate" is not limited to this definition.

[0607] As used herein, gene expression modulation occurs when the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, differs by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, or more from the expression observed in the absence of dsRNA, e.g., an RNAi agent. This percentage and / or fold difference can be calculated, for example, relative to a control or non-control. [Expression with dsRNA - Expression without dsRNA] Difference %=----------------------------------- Expression without dsRNA

[0608] As used herein, the terms "inhibit," "downregulate," or "reduce" in reference to gene expression means that the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits, is reduced below that observed in the absence of a modulator. Gene expression is downregulated when the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits, is reduced by at least 10% compared to a corresponding non-modulator control, preferably by at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 99%, or most preferably 100% (i.e., no gene expression).

[0609] As used herein, the terms "increase" or "up-regulate" in reference to gene expression means that the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits, is increased above that observed in the absence of a modulator. Gene expression is up-regulated when the expression of a gene, or the level of an RNA molecule or equivalent RNA molecule encoding one or more proteins or protein subunits, or the activity of one or more proteins or protein subunits, is increased by at least 10%, preferably at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98%, 100%, 1.1-fold, 1.25-fold, 1.5-fold, 1.75-fold, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 50-fold, 100-fold or more compared to a corresponding non-modulator control.

[0610] As used herein, the term "increased" or "increase" generally refers to an increase by a statistically significant amount; for the avoidance of doubt, "increased" means an increase of at least 10% compared to a reference level, for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to a reference level, or any increase between 10 and 100%, including 100%, or at least about a 2-fold, or at least about 3-fold, or at least about 4-fold, or about 5-fold, or at least about 10-fold increase compared to a reference level, or any increase from 2-fold to 10-fold or more compared to a reference level.

[0611] The term "decreased" or "reduced" as used herein generally refers to a statistically significant decrease.However, for the avoidance of doubt, "decreased" refers to a decrease of at least 10% compared to the reference level, for example, a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% compared to the reference level, or a decrease of 100% (i.e., a level that is absent compared to the reference sample), or any decrease between 10% and 100%.

[0612] The dsRNA agent targeted by one or more REVERSIR of the present invention comprises two complementary RNA strands that hybridize to form a duplex structure under the conditions in which the dsRNA is used.One strand of the dsRNA (antisense strand) comprises a region of complementarity that is substantially complementary, generally completely complementary, to the universal target sequence.The target sequence can be derived from the sequence of the mRNA formed during the expression of the universal target sequence.The other strand (sense strand) comprises a region that is complementary to the antisense strand, and when combined under appropriate conditions, the two strands hybridize to form a duplex structure.

[0613] Generally, the duplex structure is 15-30 base pairs in length, e.g., 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-22, 19-23, 19-24, 19-25, 19-26, 19-27, 19-28, 19-29, 19-30, 19-31, 19-32, 19-33, 19-34, 19-35, 19-36, 19-37, 19-38, 19-39, 19-40, 19-41, 19-42, 19-43, 19-44, 19-45, 19-46, 19-47, 19-48, 19-49, 19-50, 19-51, 19-52, 19-53, 19-54, 19-55, 19-56, 19-57, 19-58, 19-59, 19-60, 19-61, 19-62, 19-63, 19-64, 19-65, 19-6 9, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs in length. In certain embodiments, the duplex structure is 18 to 25 base pairs in length, e.g., 18 to 25, 18 to 24, 18 to 23, 18 to 22, 18 to 21, 18 to 20, 19 to 25, 19 to 24, 19 to 23, 19 to 22, 19 to 21, 19 to 20, 20 to 25, 20 to 24, 20 to 23, 20 to 22, 20 to 21, 21 to 25, 21 to 24, 21 to 23, 21 to 22, 22 to 25, 22 to 24, 22 to 23, 23 to 25, 23 to 24, or 24 to 25 base pairs in length, e.g., 19 to 21 base pairs in length. Ranges and lengths intermediate to the above ranges and lengths are also contemplated as part of this disclosure.

[0614] Similarly, the region of complementarity to the target sequence may be, for example, 15-30 nucleotides in length, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27 , 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length, e.g., 19-23 nucleotides in length or 21-23 nucleotides in length. Ranges and lengths intermediate to the above ranges and lengths are also contemplated as part of this disclosure.

[0615] In some embodiments, the duplex structure is 19-30 base pairs in length. Similarly, the region of complementarity to the target sequence is 19-30 nucleotides in length.

[0616] In some embodiments, the dsRNA is about 19 to about 23 nucleotides in length, or about 25 to about 30 nucleotides in length. Generally, the dsRNA is long enough to function as a substrate for the Dicer enzyme. For example, it is well known in the art that dsRNAs longer than about 21 to 23 nucleotides in length function as Dicer substrates. Furthermore, as those skilled in the art will recognize, the region of an RNA targeted for cleavage is often a portion of a larger RNA molecule, often an mRNA molecule. Where relevant, a "portion" of an mRNA target is a contiguous sequence of the mRNA target long enough to be a substrate for RNAi-directed cleavage (i.e., cleavage via the RISC pathway).

[0617] Those skilled in the art will also recognize that the duplex region is the primary functional portion of a dsRNA, e.g., a duplex region of about 19 to about 30 base pairs, e.g., about 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 base pairs. Thus, in one embodiment, an RNA molecule or complex of RNA molecules having a duplex region greater than 30 base pairs that targets a desired RNA for cleavage, e.g., to the extent that it is processed into a functional duplex of 15-30 base pairs, is a dsRNA. Thus, those skilled in the art will recognize that, in one embodiment, an miRNA is a dsRNA. In another embodiment, the dsRNA is not a naturally occurring miRNA. In another embodiment, an iRNA agent useful for targeting the expression of a universal target sequence is not generated in a target cell by cleavage of a larger dsRNA.

[0618] The dsRNA described herein can further include one or more single-stranded nucleotide overhangs, for example, 1 to 4, 2 to 4, 1 to 3, 2 to 3, 1, 2, 3, or 4 nucleotides. dsRNAs with at least one nucleotide overhang can have superior inhibitory properties compared to their blunt-ended counterparts. The nucleotide overhangs can comprise or consist of nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The overhang(s) can be present on the sense strand, the antisense strand, or any combination thereof. Furthermore, the overhang nucleotide(s) can be present at the 5'-end, 3'-end, or both ends of the antisense or sense strand of the dsRNA.

[0619] dsRNA can be synthesized by standard methods known in the art.Double-stranded RNAi compounds of the present invention can be prepared by two-step procedure.First, prepare each strand of double-stranded RNA molecules separately.Then, anneal the constituent strands.The individual strands of dsRNA compounds can be prepared by liquid phase or solid phase organic synthesis, or both.Organic synthesis has the advantage that it can easily prepare the oligonucleotide chain containing unnatural or modified nucleotides.Similarly, single-stranded oligonucleotides of the present invention can be prepared by liquid phase or solid phase organic synthesis, or both.

[0620] In some embodiments, the dsRNA of the present invention comprises at least two nucleotide sequences, sense and antisense sequences.In this embodiment, one of the two sequences is complementary to the other of the two sequences, and one of the sequences is substantially complementary to the sequence of the mRNA produced in the expression of the universal target sequence.

[0621] In certain embodiments, the substantially complementary sequences of the dsRNA are contained on separate oligonucleotides, while in other embodiments, the substantially complementary sequences of the dsRNA are contained on a single oligonucleotide.

[0622] In some embodiments, the dsRNA agent inhibits expression of angiotensinogen (AGT), and the dsRNA agent includes a sense strand and an antisense strand that form a double-stranded region.

[0623] In some embodiments, the nucleotide sequence of the antisense strand of the dsRNA agent comprises a nucleotide sequence that includes at least 19, at least 20, at least 21, or at least 22 contiguous nucleotides of the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO: 9. In some embodiments, the nucleotide sequence of the sense strand of the dsRNA agent comprises a nucleotide sequence that includes at least 19, at least 20, at least 21, or at least 22 contiguous nucleotides of the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO: 10.

[0624] In some embodiments, the antisense strand of a dsRNA agent comprises the nucleotide sequence of SEQ ID NO:9, UGUACUCUCAUUGUGGAUGACGA.

[0625] In some embodiments, the sense strand of a dsRNA agent comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO:10.

[0626] In some embodiments, the antisense strand of the dsRNA agent comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO:9, and the sense strand of the dsRNA agent comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO:10.

[0627] In some embodiments, the antisense strand of the dsRNA agent comprises the nucleotide sequence UGUACUCUCAUUGUGGAUGACGA of SEQ ID NO:9, and the sense strand of the dsRNA agent comprises the nucleotide sequence GUCAUCCACAAUGAGAGUACA of SEQ ID NO:10.

[0628] In some embodiments, the dsRNA agent is AD-85481, also known as Zilebesilan®.

[0629] AD-85481 comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises the nucleotide sequence 5'-gsuscaucCfaCfAfAfugagaguaca-3' and the antisense strand comprises the nucleotide sequence 5'-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3', where a, g, c, and u are 2'-O-methyl (2'-OMe) A, G, C, and U, respectively; Af, Gf, Cf, and Uf are 2'-fluoro A, G, C, and U, respectively; s is a phosphorothioate linkage; and (Tgn) is a thymidine-glycol nucleic acid (GNA) S-isomer; and the 3'-end of the sense strand is conjugated to a ligand as shown in the following schematic diagram.

[0630] [ka] wherein X is O.

[0631] Furthermore, pharmaceutically acceptable salt forms of dsRNA agents include any pharmaceutically acceptable salt, for example, a sodium salt of a dsRNA agent. In some embodiments, a pharmaceutically acceptable salt of a dsRNA has the following structure:

[0632] [ka]

[0633] Additional dsRNA agents targeted by one or more REVERSIRs of the invention are described in International PCT Application Publication Nos. WO2015 / 179724 and WO2019 / 222166, the entire contents of each of which are incorporated herein by reference.

[0634] Those skilled in the art are well aware that dsRNAs with duplex structures of approximately 20-23 base pairs, for example, 21 base pairs, are praised as being particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, other researchers have found that shorter or longer RNA duplex structures can also be effective (Chu and Rana (2007) RNA 14:1714-1719; Kim et al. (2005) Nat Biotech 23:222-226). In the above embodiment, the dsRNA described herein may comprise at least one strand with a minimum length of 21 nucleotides. It can be reasonably expected that shorter duplexes, with only a few nucleotides removed from one or both ends, may also be similarly effective compared to the above dsRNAs. Thus, dsRNAs having a sequence of at least 19, 20, or more contiguous nucleotides that differ in their ability to inhibit expression of a universal target sequence by no more than about 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA containing the entire sequence are contemplated as being within the scope of the present invention.

[0635] In addition, the RNA identifies a site(s) in the universal target sequence transcript that is susceptible to RISC-mediated cleavage. Thus, the present invention further features iRNAs that target within one of these sites. As used herein, an iRNA is said to target within a specific site of an RNA transcript if the iRNA promotes cleavage of the transcript anywhere within that specific site. Such iRNAs generally contain at least about 19 consecutive nucleotides linked to an additional nucleotide sequence removed from the region contiguous with the selected sequence in the universal target sequence.

[0636] In certain embodiments, the universal iRNA of the present invention, for example, dsRNA, is unmodified, for example, does not contain chemical modifications or conjugations known in the art and described herein.In other embodiments, the universal iRNA of the present invention, for example, dsRNA, is chemically modified to enhance stability or other beneficial properties.In certain embodiments of the present invention, substantially all of the nucleotides of the universal iRNA of the present invention are modified, that is, there are 5, 4, 3, 2, or 1 or less unmodified nucleotides in the chain of the iRNA.In other embodiments of the present invention, all of the nucleotides of the universal iRNA are modified.

[0637] Nucleic acids featured in the present invention can be synthesized or modified by methods established in the art, such as those described in "Current protocols in nucleic acid chemistry," Beaucage, S.L. et al. (Eds.), John Wiley & Sons, Inc., New York, NY, USA, incorporated herein by reference. Modifications include, for example, terminal modifications, such as 5'-end modifications (phosphorylation, conjugation, inverted ligation) or 3'-end modifications (conjugation, DNA nucleotides, inverted ligation, etc.); base modifications, such as substitution with stabilizing bases, destabilizing bases, or bases that expand the repertoire of base-pairing partners, base removal (abasic nucleotides), or conjugated bases; sugar modifications (e.g., at the 2'- or 4'-position) or sugar substitutions; or backbone modifications, including modification or substitution of phosphodiester linkages. Specific examples of iRNA compounds useful in the embodiments described herein include, but are not limited to, RNAs containing modified backbones or RNAs that do not contain natural internucleoside linkages. The RNA with modified backbone particularly includes that which does not have phosphorus atom in backbone.For the purpose of this specification or as sometimes referred to in the art, the modified RNA that does not have phosphorus atom in internucleoside backbone can also be considered as oligonucleoside.In some embodiments, modified iRNA has phosphorus atom in its internucleoside backbone.

[0638] Modified RNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates such as 3'-alkylene phosphonates and chiral phosphonates, phosphoramidates such as 3'-aminophosphoramidates and aminoalkylphosphoramidates, thionophosphoramidites, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates with normal 3'-5' linkages, their 2'-5' linked analogs, and those with reverse polarity, in which adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Also included are various salts, mixed salts, and free acid forms. In some embodiments of the present invention, the dsRNA agent of the present invention is in the form of a free acid. In other embodiments of the present invention, the dsRNA agent of the present invention is in the form of a salt. In one embodiment, the dsRNA agent of the present invention is in the form of a sodium salt. In certain embodiments, when the dsRNA agent of the present invention is in the form of sodium salt, sodium ion exists in the agent as the counterion of substantially all phosphodiester and / or phosphorothioate groups present in the agent.The agent in which substantially all phosphodiester and / or phosphorothioate linkages have sodium counterion comprises 5, 4, 3, 2 or 1 or less phosphodiester and / or phosphorothioate linkages that do not have sodium counterion.In some embodiments, when the dsRNA agent of the present invention is in the form of sodium salt, sodium ion exists in the agent as the counterion of all phosphodiester and / or phosphorothioate groups present in the agent.

[0639] Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Patent Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; No. 5,321,131; No. 5,399,676; No. 5,405,939; No. 5,453,496; No. 5,455,233; No. 5,466,677; No. 5,476, No. 925; No. 5,519,126; No. 5,536,821; No. 5,541,316; No. 5,550,111; No. 5,563,253; No. 5,571,799; No. 5 , 587,361; 5,625,050; 6,028,188; 6,124,445; 6,160,109; 6,169,170; 6,172,20 No. 9; No. 6,239,265; No. 6,277,603; No. 6,326,199; No. 6,346,614; No. 6,444,423; No. 6,531,590; No. 6, Nos. 534,639; 6,608,035; 6,683,167; 6,858,715; 6,867,294; 6,878,805; 7,015,315; 7,041,816; 7,273,933; 7,321,029; and U.S. Patent No. RE39464, the entire contents of each of which are incorporated herein by reference.

[0640] Modified RNA backbones that do not contain phosphorus atoms have backbones formed by short alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short heteroatom or heterocyclic internucleoside linkages. These include those with morpholino linkages (formed in part from the sugar portion of the nucleoside), siloxane backbones, sulfide, sulfoxide, and sulfone backbones, formacetyl and thioformacetyl backbones, methyleneformacetyl and thioformacetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and others with mixed N, O, S, and CH component moieties.

[0641] Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Patent Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; Nos. 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and 5,677,439, the entire contents of each of which are incorporated herein by reference.

[0642] Suitable RNA mimics are contemplated for use in the iRNAs provided herein, in which both the sugar and internucleoside linkages, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an RNA mimic that has been shown to have excellent hybridization properties, is called peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of RNA is replaced with an amide-containing backbone, particularly an aminoethylglycine backbone. The nucleobases are retained and are linked directly or indirectly to the aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Patent Nos. 5,539,082; 5,714,331; and 5,719,262, the entire contents of each of which are incorporated herein by reference. Additional PNA compounds suitable for use in the iRNA of the present invention are described, for example, in Nielsen et al., Science, 1991, 254, 1497-1500.

[0643] Some embodiments featured herein include RNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, particularly the -CH-NH-CH-, -CH-N(CH)-O-CH- (known as the methylene (methylimino) or MMI backbone) of the above-referenced U.S. Pat. No. 5,489,677, -CH-ON(CH)-CH-, -CH-N(CH)-N(CH)-CH-, and -N(CH)-CH- of the above-referenced U.S. Pat. No. 5,602,240. In some embodiments, the RNAs featured herein have the morpholino backbone structure of the above-referenced U.S. Pat. No. 5,034,506. The native phosphodiester backbone can be represented as OP(O)(OH)-OCH-.

[0644] Modified RNAs can also contain one or more substituted sugar moieties. The iRNAs, e.g., dsRNAs, provided herein, can contain any of the following at the 2'-position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S-, or N-alkynyl; or O-alkyl-O-alkyl, where alkyl, alkenyl, and alkynyl are substituted or unsubstituted C1-C6. 10 Alkyl or C2-C 10 It can be alkenyl and alkynyl. Exemplary suitable modifications include O[(CH) n O] m CH3, O(CH2). n OCH3, O(CH2) n NH2, O(CH2) n CH3, O(CH2) n ONH2, and O(CH2) n ON[(CH2) n CH3]2, where n and m are from 1 to about 10. In other embodiments, the dsRNA has at the 2' position one of the following: C1 to C 10The modified iRNA may be one of the following: lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH, OCN, Cl, Br, CN, CF, OCF, SOCH, SOCH, ONO, NO, N, NH, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, RNA cleaving group, reporter group, intercalator, group for improving the pharmacokinetic properties of iRNA, or group for improving the pharmacodynamic properties of iRNA, and other substituents with similar properties. In some embodiments, the modification comprises 2'-methoxyethoxy (2'-O-CHCHOCH, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504), i.e., an alkoxy-alkoxy group. Another exemplary modification is the 2'-dimethylaminooxyethoxy, i.e., O(CH2)2ON(CH3)2 group (also known as 2'-DMAOE, as described in the Examples herein below), and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2-O-CH2-N(CH3)2. Further exemplary modifications include 5'-Me-2'-F nucleotides, 5'-Me-2'-OMe nucleotides, 5'-Me-2'-deoxynucleotides (both R and S isomers in these three families); 2'-alkoxyalkyl; and 2'-NMA (N-methylacetamide).

[0645] Other modifications include 2'-methoxy (2'-OCH), 2'-aminopropoxy (2'-OCHCHNH), and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the RNA of an iRNA, particularly the 3' position of the sugar on the 3'-terminal nucleotide, or the 3' position of the sugar in a 2'-5'-linked dsRNA, and the 5' position of the 5'-terminal nucleotide. iRNAs can also have sugar mimetics, such as cyclobutyl moieties, in place of the pentofuranosyl sugar. Representative United States patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Patent Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567, Nos. 5,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, portions of which are commonly owned with the present application. The entire contents of each of the foregoing are incorporated herein by reference.

[0646] Universal iRNAs may also contain modifications or substitutions of nucleobases (often simply referred to in the art as "bases"). As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). Modified nucleobases include other synthetic and natural nucleobases, such as deoxythymidine (dT), 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyluracil and cytosine, 6-azouracil, and the like. These include 8-amino, 8-thiazolinone, 8-isopropyl methyl ether ...Additional nucleobases include those disclosed in U.S. Patent No. 3,687,808, those disclosed in Biochemistry, Biotechnology and Medicine, Herdewijn, P. ed. Wiley-VCH, 2008, those disclosed in The Concise Encyclopedia of Polymer Science and Engineering, pages 858-859, Kroschwitz, J. L. ed. John Wiley & Sons, 1990, those disclosed in Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed in Sanghvi, Y S., Chapter 15, dsRNA Research and Applications, pages 289-302, Crooke, ST and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds featured in the present invention. These include 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6, and O-6 substituted purines, such as 2-aminopropyladenine, 5-propynyluracil, and 5-propynylcytosine. 5-Methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6 to 1.2°C (Anghvi, YS, Crooke, ST, and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278), and are an exemplary base substitution, especially when combined with a 2'-O-methoxyethyl sugar modification.

[0647] Representative United States patents that teach the preparation of the above-mentioned specific modified nucleobases, as well as other modified nucleobases, include, but are not limited to, the above-mentioned U.S. Patent Nos. 3,687,808; 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594, Nos. 121; 5,596,091; 5,614,617; 5,681,941; 5,750,692; 6,015,886; 6,147,200; 6,166,197; 6,222,025; 6,235,887; 6,380,368; 6,528,640; 6,639,062; 6,617,438; 7,045,610; 7,427,672, and 7,495,088, the entire contents of each of which are incorporated herein by reference.

[0648] In some embodiments, the RNAi agents of the present disclosure may also be modified to include one or more bicyclic sugar moieties. A "bicyclic sugar" is a furanosyl ring modified by a ring formed by a bridge between two carbons, whether adjacent or non-adjacent. A "bicyclic nucleoside" ("BNA") is a nucleoside having a sugar moiety containing a ring formed by a bridge between two carbons, whether adjacent or non-adjacent, of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4'-carbon and 2'-carbon of the sugar ring, optionally through a 2'-acyclic oxygen atom. Thus, in some embodiments, the agents of the present invention may include one or more locked nucleic acids (LNAs). A locked nucleic acid is a nucleotide having a modified ribose moiety in which the ribose moiety contains an extra bridge connecting the 2' and 4' carbons. In other words, an LNA is a nucleotide containing a bicyclic sugar moiety containing a 4'-CH2-O-2' bridge. This structure effectively "locks" the ribose in a 3'-endo conformation. The addition of a locked nucleic acid to dsRNA has been shown to increase the stability of dsRNA in serum and reduce off-target effects (Elmen, J. et al., (2005) Nucleic Acids Research 33(1):439-447; Mook, OR. et al., (2007) Mol Canc Ther 6(3):833-843; Grunweller, A. et al., (2003) Nucleic Acids Research 31(12):3185-3193). Examples of bicyclic nucleosides for use in the polynucleotide of the present invention include, but are not limited to, nucleosides comprising a bridge between the 4' and 2' ribosyl ring atoms. In certain embodiments, the antisense polynucleotide agent of the present invention comprises one or more bicyclic nucleosides comprising a 4' to 2' bridge.

[0649] Locked nucleosides have the structure (stereochemistry omitted):

[0650] [ka] where B is a nucleobase or modified nucleobase, and L is a linking group connecting the 2'-carbon to the 4'-carbon of the ribose ring. Examples of such 4' to 2' bridged bicyclic nucleosides include, but are not limited to, 4'-(CH2)-O-2' (LNA); 4'-(CH2)-S-2'; 4'-(CH2)2-O-2' (ENA); 4'-CH(CH3)-O-2' (also referred to as "constrained ethyl" or "cEt") and 4'-CH(CHOCH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 7,399,845); 4'-C(CH 3) (CH3)-O-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,283); 4'-CH2-N(OCH3)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,425); 4'-CH2-ON(CH3)-2' (see, e.g., U.S. Patent Application Publication No. 2004 / 0171570); 4'-CH2-N(R)-O-2' (where R is H, C1-C12 alkyl, or a nitrogen protecting group) (see, e.g., U.S. Pat. No. 7,427,672); 4'-CH2-C(H)(CH3)-2' (see, e.g., Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4'-CH2-C(=CH2)-2' (and analogs thereof; see, e.g., U.S. Pat. No. 8,278,426), the entire contents of each of the foregoing being incorporated herein by reference.

[0651] Additional representative United States patents and publications that teach the preparation of locked nucleic acid nucleotides include, but are not limited to, U.S. Patent Nos. 6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 6,998,484; 7,053,207; 7,034,133; 7,084,125; 7,399 ,845; 7,427,672; 7,569,686; 7,741,457; 8,022,193; 8,030,467; 8,278,425; 8,278,426; 8,278,283; U.S. Patent Application Publication No. 2008 / 0039618; and U.S. Patent Application Publication No. 2009 / 0012281, the entire contents of each of which are incorporated herein by reference.

[0652] Any of the foregoing bicyclic nucleosides can be prepared with one or more stereochemical sugar configurations, including, for example, α-L-ribofuranose and β-D-ribofuranose (see International Publication No. WO 99 / 14226).

[0653] The iRNA of the present invention can also be modified to contain one or more constrained ethyl nucleotides. As used herein, a "constrained ethyl nucleotide" or "cEt" is a locked nucleic acid containing a bicyclic sugar moiety containing a 4'-CH(CH3)-O-2' bridge (i.e., L in the preceding structure). In one embodiment, the constrained ethyl nucleotide is in the S conformation, referred to herein as an "S-cEt."

[0654] The iRNA of the present invention may also contain one or more "conformationally restricted nucleotides" ("CRNs"). CRNs are nucleotide analogs with a linker connecting the C2' and C4' carbons of ribose or the C3 and C5' carbons of ribose. The CRNs lock the ribose ring into a stable conformation, increasing hybridization affinity to mRNA. The linker is long enough to position the oxygen at an optimal position for stability and affinity, thereby reducing puckering of the ribose ring.

[0655] Representative publications that teach the preparation of the above-mentioned specific CRNs include, but are not limited to, U.S. Patent Publication No. 2013 / 0190383; and PCT Application Publication No. WO2013 / 036868, the entire contents of each of which are incorporated herein by reference.

[0656] In some embodiments, the dsRNA of the present invention comprises one or more modifications that are UNA (unlocked nucleic acid) nucleotides. UNA is an unlocked acyclic nucleic acid, and one of the sugar bonds is removed to form an unlocked "sugar" residue. In one example, UNA also comprises a monomer in which the bond between C1'-C4' (i.e., the covalent carbon-oxygen-carbon bond between C1' and C4' carbon) is removed. In another example, the C2'-C3' bond of sugar (i.e., the covalent carbon-carbon bond between C2' and C3' carbon) is removed (see Nuc. Acids Symp. Series, 52, 133-134 (2008) and Fluiter et al., Mol. Biosyst., 2009, 10, 1039, which are incorporated herein by reference).

[0657] Representative U.S. publications that teach the preparation of UNAs include, but are not limited to, U.S. Patent No. 8,314,227; and U.S. Patent Application Publication Nos. 2013 / 0096289; 2013 / 0011922; and 2011 / 0313020, the entire contents of each of which are incorporated herein by reference.

[0658] In certain embodiments, the compositions and methods of the present disclosure include vinyl phosphonate (VP) modifications of the RNAi agents described herein. In an exemplary embodiment, the 5' vinyl phosphonate modified nucleotides of the present disclosure have the following structure:

[0659] [ka] and wherein X is O or S; R is hydrogen, hydroxy, fluoro, or C 1-20 alkoxy (e.g., methoxy or n-hexadecyloxy); R 5’ is =C(H)-P(O)(OH)2, and the C5' carbon and R 5’ the double bond between is in the E or Z orientation (e.g., E orientation); B is a nucleobase or modified nucleobase, optionally B is adenine, guanine, cytosine, thymine, or uracil.

[0660] The vinyl phosphonate of the present disclosure can be attached to either the antisense strand or the sense strand of the dsRNA of the present disclosure. In certain embodiments, the vinyl phosphonate of the present disclosure is attached to the antisense strand of the dsRNA, optionally at the 5' end of the antisense strand of the dsRNA.

[0661] Vinyl phosphonate modifications are also contemplated in the compositions and methods of the present disclosure. Exemplary vinyl phosphonate structures include the preceding structure, where R5' is =C(H)-O-P(O)(OH)2, and the double bond between the C5' carbon and R5' is in the E or Z orientation (e.g., E orientation).

[0662] Potentially stabilizing modifications to the ends of RNA molecules include N-(acetylaminocaproyl)-4-hydroxyprolinol (Hyp-C6-NHAc), N-caproyl-4-hydroxyprolinol (Hyp-C6), N-acetyl-4-hydroxyprolinol (Hyp-NHAc), thymidine-2'-O-deoxythymidine (ether), N-(aminocaproyl)-4-hydroxyprolinol (Hyp-C6-amino), 2-docosanoyl-uridine-3'-phosphate, inverted dT (idT), inverted dA (idA), inverted abasic 2'-deoxyribonucleotides (iAb), and the like. Disclosure of this modification can be found in International Publication No. WO 2011 / 005861.

[0663] In one example, the 3' or 5' end of the oligonucleotide is linked to an inverted 2'-deoxy modified ribonucleotide, such as inverted dT (idT), inverted dA (idA), or inverted abasic 2'-deoxyribonucleotide (iAb). In one particular example, the inverted 2'-deoxy modified ribonucleotide is linked to the 3'-end of the oligonucleotide, such as the 3'-end of the sense strand described herein, and the linkage is via a 3'-3' phosphodiester linkage or a 3'-phosphorothioate linkage.

[0664] In another example, the 3'-end of the sense strand is linked to an inverted abasic ribonucleotide (iAb) via a 3'-3'-phosphorothioate linkage. In another example, the 3'-end of the sense strand is linked to an inverted dA (idA) via a 3'-3'-phosphorothioate linkage.

[0665] In one particular example, an inverted 2'-deoxy modified ribonucleotide is linked to the 3'-end of an oligonucleotide, such as the 3'-end of the sense strand described herein, and the linkage is via a 3'-3' phosphodiester linkage or a 3'-phosphorothioate linkage.

[0666] In another example, the 3'-terminal nucleotide of the sense strand is an inverted dA (idA) and is linked to the preceding nucleotide via a 3'-3'-linkage (eg, a 3'-phosphorothioate linkage).

[0667] Other modifications of the nucleotides of the iRNAs of the invention include 5' phosphates or 5' phosphate mimetics, such as 5'-terminal phosphates or phosphate mimetics on the antisense strand of the iRNA. Suitable phosphate mimetics are disclosed, for example, in U.S. Patent Publication No. 2012 / 0157511, t...

Claims

1. 1. A single-stranded oligonucleotide for inhibiting the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand, comprising: the single-stranded oligonucleotide comprises a nucleotide sequence substantially complementary to the antisense strand of the dsRNA agent; the single-stranded oligonucleotide is 16-30 nucleotides in length; substantially all of the nucleotides of the single-stranded oligonucleotide comprise a nucleotide modification; A single-stranded oligonucleotide, wherein at least three of the nucleotide modifications are high-affinity nucleotide modifications.

2. 2. The single-stranded oligonucleotide of claim 1, wherein substantially all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a locked nucleic acid (LNA) modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

3. 3. The single-stranded oligonucleotide of claim 1, wherein all of the nucleotides comprise a nucleotide modification selected from the group consisting of a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkyl modification, a 2'-halo modification, a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a bridged nucleic acid (2',4'-BNA), a 2'-O-ethyl (cEt), and a 2'-O-methyl modification.

4. The single-stranded oligonucleotide of any one of claims 1 to 3, wherein at least four of the nucleotide modifications are high-affinity nucleotide modifications.

5. The single-stranded oligonucleotide of any one of claims 1 to 4, wherein at least five of the nucleotide modifications are high-affinity nucleotide modifications.

6. 6. The single-stranded oligonucleotide of any one of claims 1 to 5, wherein at least two of the high-affinity nucleotide modifications are at positions 2 and 6; 2 and 5; 2 and 7; 2 and 8; 2 and 9; 2 and 14; 2 and 15; and / or 2 and 16, counting from the 3' end of the oligonucleotide.

7. 7. The single-stranded oligonucleotide of claim 6, wherein the high-affinity nucleotide modifications are at positions 2, 6, 8, and 14; 2, 4, 5, 6, and 7; 2, 4, 6, 8, and 13; 2, 4, 6, 8, and 14; 2, 4, 6, 8, and 15; 2, 4, 6, 8, and 16; 2, 8, 10, and 14; 2, 4, 6, 8, and 14; or 2, 8, 12, and 14, counting from the 3' end of the oligonucleotide.

8. 8. The single-stranded oligonucleotide of any one of claims 1-7, wherein at least one of the nucleotides comprising the high-affinity nucleotide modification base pairs with a nucleotide comprising a thermally destabilized nucleotide in the antisense strand of the dsRNA agent.

9. 9. The single-stranded oligonucleotide of claim 8, wherein the high-affinity modification is selected from the group consisting of a locked nucleic acid (LNA) modification, a constrained ethyl nucleic acid (cEtNA) modification, and a bridged nucleic acid (BNA) modification.

10. 10. The single-stranded oligonucleotide of any one of claims 1 to 9, further comprising at least five phosphorothioate internucleotide modifications.

11. The single-stranded oligonucleotide according to any one of claims 1 to 10, wherein the single-stranded oligonucleotide is conjugated to at least one ligand.

12. The single-stranded oligonucleotide of claim 11, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

13. 12. The single-stranded oligonucleotide of claim 11, wherein the ligand is one or more GalNAc derivatives attached via a monovalent, divalent, or trivalent branched linker.

14. The ligand is 【Chemistry 1】 The single-stranded oligonucleotide of claim 13, wherein

15. The single-stranded oligonucleotide of any one of claims 11 to 13, wherein the ligand is conjugated to a nucleoside containing a deoxy sugar in the single-stranded oligonucleotide.

16. 16. The single-stranded oligonucleotide of claim 15, wherein the deoxy sugar is 2'-deoxyribose.

17. The single-stranded oligonucleotide of any one of claims 11 to 16, wherein the ligand is conjugated to the 3'-end of the single-stranded oligonucleotide.

18. 1. A single-stranded oligonucleotide for inhibiting the RNAi activity of a double-stranded ribonucleic acid (dsRNA) agent that contains a thermolabile nucleotide in the antisense strand, comprising: the single-stranded oligonucleotide comprises a nucleotide sequence substantially complementary to the antisense strand of the dsRNA agent; the single-stranded oligonucleotide is 18-24 nucleotides in length; The single-stranded oligonucleotide comprises at least five phosphorothioate internucleotide modifications and has the formula (I): 【Chemistry 2】 [During the ceremony, B1, B2, and B3 each independently represent a nucleotide that includes a nucleotide modification independently selected from the group consisting of a 2'-deoxy, a 2'-ribo, a 2'-O-alkyl modification, a 2'-substituted alkoxy modification, a 2'-substituted alkoxyalkyl modification, a 2'-substituted alkyl modification, and a 2'-halo modification; T1, T2, and T3 each independently represent a nucleotide comprising a nucleotide modification selected from the group consisting of a deoxynucleotide modification, a D-methyleneoxy (4'-CH2-O-2') locked nucleic acid (LNA) modification, a 2'-O-(2-methoxyethyl) (MOE) modification, a bridged nucleic acid (2',4'-BNA) modification, a 2'-O-ethyl (cEt) modification, a 2'-deoxy-2'-fluoro, and a 2'-O-methyl modification; q １ , q ３ and q ５ are each independently 3 to 12 nucleotides in length; q ２ , q ４ and q ６ are each independently 1 to 6 nucleotides in length; The single-stranded oligonucleotide is conjugated to at least one ligand. A single-stranded oligonucleotide represented by the formula:

19. 19. The single-stranded oligonucleotide of any one of claims 1 to 18, wherein the single-stranded oligonucleotide comprises 5 to 15 phosphorothioate internucleotide modifications; 5 to 14 phosphorothioate internucleotide modifications; 5 to 13 phosphorothioate internucleotide modifications; 5 to 12 phosphorothioate internucleotide modifications; 5 to 11 phosphorothioate internucleotide modifications; 5 to 10 phosphorothioate internucleotide modifications; 5 to 9 phosphorothioate internucleotide modifications; 5 to 8 phosphorothioate internucleotide modifications; 5 to 7 phosphorothioate internucleotide modifications; or 5 to 6 phosphorothioate internucleotide modifications.

20. 20. The single-stranded oligonucleotide of claim 19, wherein the single-stranded oligonucleotide comprises 6 to 14 phosphorothioate internucleotide modifications.

21. 21. The single-stranded oligonucleotide of any one of claims 1 to 20, which is 18 to 22 or 18 to 20 nucleotides in length.

22. 22. The single stranded oligonucleotide of any one of claims 1-21, wherein the single stranded oligonucleotide is at least about 90% complementary to the entire length of the antisense strand of the dsRNA agent.

23. 23. The single stranded oligonucleotide of any one of claims 1-22, wherein the single stranded oligonucleotide is 90% complementary to nucleotides 2-16 of the antisense strand of the dsRNA agent.

24. 24. The single stranded oligonucleotide of any one of claims 1 to 23, wherein the single stranded oligonucleotide is perfectly complementary to the antisense strand of the dsRNA agent.

25. 25. The single-stranded oligonucleotide of any one of claims 1 to 24, wherein the nucleotide sequence of the antisense strand of the dsRNA agent comprises the nucleotide sequence 5'-UGUACUCUCAUUGUGGAUGACGA-3' of SEQ ID NO:

9.

26. 26. The single-stranded oligonucleotide of any one of claims 1 to 25, wherein the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in a duplex; a destabilizing sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA).

27. the nucleotide sequence of the antisense strand of the dsRNA agent comprises the nucleotide sequence of SEQ ID NO: 11, 5'-usGfsuac(Tgn)cucauugUfgGfaugacsgsa-3', where a, c, g, and u are 2'-O-methyladenosine-3'-phosphate, 2'-O-methylcytidine-3'-phosphate, 2'-O-methylguanosine-3'-phosphate, and 2'-O-methyluridine-3'-phosphate, respectively; Af, Cf, 27. The single-stranded oligonucleotide of claim 26, wherein Gf and Uf are 2'-O-fluoroadenosine-3'-phosphate, 2'-O-fluorocytidine-3'-phosphate, 2'-O-fluoroguanosine-3'-phosphate, and 2'-O-fluorouridine-3'-phosphate, respectively; dT is deoxy-thymine; s is a phosphorothioate linkage; and (Tgn) is a thymidine-glycol nucleic acid (GNA) S-isomer.

28. 28. The single-stranded oligonucleotide of any one of claims 1 to 27, wherein the nucleotide sequence of the single-stranded oligonucleotide is at least 90% identical to the entire nucleotide sequence of any one of the unmodified nucleotide sequences of Table 6.

29. The single-stranded oligonucleotide according to any one of claims 12 to 28, wherein the ligand is an N-acetylgalactosamine (GalNAc) derivative.

30. 30. The single-stranded oligonucleotide according to any one of claims 12 to 29, wherein the ligand is one or more GalNAc derivatives attached via a monovalent, divalent or trivalent branched linker.

31. The ligand is 【Transformation 3】 31. The single-stranded oligonucleotide of claim 30, wherein:

32. 32. The single-stranded oligonucleotide of any one of claims 18 to 31, wherein the ligand is conjugated to a nucleoside comprising a deoxy sugar in the single-stranded oligonucleotide.

33. 33. The single-stranded oligonucleotide of claim 32, wherein the deoxy sugar is 2'-deoxyribose.

34. The single-stranded oligonucleotide of any one of claims 18 to 33, wherein the ligand is conjugated to the 3'-end of the single-stranded oligonucleotide.

35. 35. The single-stranded oligonucleotide of any one of claims 1 to 34, comprising a modified nucleotide sequence that differs by no more than four modified nucleotides from any one of the modified nucleotide sequences of Table 6.

36. A pharmaceutical composition comprising the single-stranded oligonucleotide of any one of claims 1 to 35.

37. 37. The pharmaceutical composition of claim 36, wherein the single-stranded oligonucleotide is in an unbuffered solution.

38. 38. The pharmaceutical composition of claim 37, wherein the unbuffered solution is saline or water.

39. 37. The pharmaceutical composition of claim 36, wherein the single-stranded oligonucleotide is in a buffer solution.

40. 40. The pharmaceutical composition of claim 39, wherein the buffer comprises acetate, citrate, prolamine, carbonate, phosphate, or any combination thereof.

41. An isolated cell comprising the single-stranded oligonucleotide of any one of claims 1 to 35 or the pharmaceutical composition of any one of claims 36 to 40.

42. 1. A method of inhibiting the RNAi inhibitory activity of a dsRNA agent that contains a thermodestabilizing nucleotide modification in the antisense strand, comprising:

41. A method comprising the step of contacting a dsRNA agent with the single-stranded oligonucleotide of any one of claims 1-35 or the pharmaceutical composition of any one of claims 36-40, thereby inhibiting the RNAi inhibitory activity of a dsRNA agent that comprises a thermodestabilizing nucleotide modification in the antisense strand.

43. 43. The method of claim 42, wherein the dsRNA agent is present intracellularly.

44. 44. The method of claim 43, wherein the cell is in a human subject.

45. 1. A method for treating a subject in need thereof, comprising: A method comprising the step of administering to a subject a therapeutically effective amount of the single-stranded oligonucleotide according to any one of claims 1 to 35 or the pharmaceutical composition according to any one of claims 36 to 40, thereby treating the subject.

46. 46. ​​The method of claim 45, wherein the subject in need of treatment has previously been administered a double-stranded RNAi agent that inhibits expression of the target gene and that comprises a thermodestabilizing nucleotide modification in the antisense strand.

47. 47. The method of claim 46, wherein the target gene is angiotensinogen (AGT).

48. 48. The method of claim 47, wherein the subject in need of treatment is suffering from hypotension.

49. 48. The method of claim 47, wherein the subject in need thereof is suffering from hyperkalemia.

50. 48. The method of claim 47, wherein the subject in need of treatment is suffering from impaired renal function.

51. 51. The method of any one of claims 45-50, further comprising administering to the subject an additional treatment or therapeutic agent selected from the group consisting of increased water / salt in the diet, fludrocortisone / midodrine treatment, intravenous fluids, vasopressors, reduction or discontinuation of concomitant antihypertensive medications, low potassium diet, thiazides / loop diuretics, oral potassium binders, calcium, glucose, insulin, and hemodialysis, or a combination thereof.

52. The method of any one of claims 45 to 51, wherein the single-stranded oligonucleotide or pharmaceutical composition is administered subcutaneously to the subject.

53. The method of any one of claims 45 to 51, wherein the single-stranded oligonucleotide or pharmaceutical composition is administered intravenously to the subject.

54. 54. The method of any one of claims 45-53, wherein the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 1:1, 2:1, or 3:1 relative to the dose of dsRNA agent previously administered to the subject.

55. 1. A method of inhibiting expression of a target gene and ameliorating a side effect of a dsRNA agent comprising a thermolabile nucleotide modification in the antisense strand in a subject, the method comprising:

41. A method comprising the step of administering to a subject an effective amount of the single-stranded oligonucleotide of any one of claims 1-35 or the pharmaceutical composition of any one of claims 36-40, thereby ameliorating a side effect of a dsRNA agent in the subject.

56. 56. The method of claim 55, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is in about a 1:1 ratio to the dose of the dsRNA agent previously administered to the subject.

57. 57. The method of claim 55 or 56, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is in a ratio of about 2:1 relative to the dose of the dsRNA agent previously administered to the subject.

58. 58. The method of any one of claims 55-57, wherein the dose of single stranded oligonucleotide or pharmaceutical composition is at a ratio of about 3:1 relative to the dose of dsRNA agent previously administered to the subject.

59. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject at 24 hour intervals.

60. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 24 hours apart.

61. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject at 12 hour intervals.

62. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 12 hours apart.

63. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into three doses and administered to the subject at 8 hour intervals.

64. 59. The method of any one of claims 55 to 58, wherein the dose of the single-stranded oligonucleotide or pharmaceutical composition is divided into two doses and administered to the subject 8 hours apart.

65. The method of any one of claims 55 to 64, wherein the single-stranded oligonucleotide or pharmaceutical composition is administered subcutaneously to the subject.

66. The method of any one of claims 55 to 64, wherein the single-stranded oligonucleotide or pharmaceutical composition is administered intravenously to the subject.

67. A kit comprising a single-stranded oligonucleotide according to any one of claims 1 to 35 or a pharmaceutical composition according to any one of claims 36 to 40, and instructions for use, and, where appropriate, means for administering the single-stranded oligonucleotide or pharmaceutical composition.

68. 68. The kit of Claim 67, further comprising a double-stranded RNAi agent that inhibits expression of a target gene and that comprises a thermolabilizing nucleotide modification in the antisense strand, and optionally, a means for administering the double-stranded RNA agent.

Images