Combinations for treating Parkinson's disease and other primary and secondary parkinsonian disorders
Administering antihyperlipidemic agents and CSF-1R antagonists enhances the engraftment and efficacy of DA neurons, addressing the limitations of existing methods in treating Parkinson's disease and other parkinsonian disorders.
Patent Information
- Application Number
- JP2025546675
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- Priority Date
- 2023-02-27
- Filing Date
- 2024-02-26
- Publication Date
- 2026-02-27
AI Technical Summary
Existing methods for generating midbrain dopaminergic (DA) neurons from pluripotent cells have limited therapeutic effects for treating Parkinson's disease and other parkinsonian disorders, and there is a need for improved cell populations and methods to enhance the efficacy of cell therapy.
Administering antihyperlipidemic agents and CSF-1R antagonists to patients before, during, or after cell therapy to improve the engraftment and efficacy of administered cells, particularly DA neurons, by enhancing viability, proliferation, migration, innervation, and differentiation.
Improves the therapeutic efficacy of cell therapy by increasing the engraftment and functionality of DA neurons, thereby aiding in the treatment of Parkinson's disease and other parkinsonian disorders.
Smart Images

Figure 2026506930000005 
Figure 2026506930000006 
Figure 2026506930000007
Abstract
Description
[Technical Field]
[0001] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No. 63 / 487,171, entitled "COMBINATIONS FOR TREATMENT OF PARKINSON'S DISEASE AND OTHER PRIMARY AND SECONDARY PARKINSONIAN DISORDERS," filed February 27, 2023, the entire contents of which are incorporated herein by reference.
[0002] The present invention relates to novel methods for treating patients with Parkinson's disease and other primary and secondary parkinsonian disorders, as well as the Parkinson-plus diseases of multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, and dementia with Lewy bodies. [Background technology]
[0003] Microglia Microglia, the only immune cells found in the brain, comprise approximately 10% of the brain's cellular composition and perform essential functions in maintaining brain homeostasis, such as phagocytic waste removal, injury repair, and proper neuronal network maintenance. However, excessive microglial activation induces inflammation, producing reactive oxygen species (ROS) and proinflammatory cytokines such as TNF-α and IL-β. Chronic inflammation contributes to neuronal stress and neurodegeneration.
[0004] Differentiation into lineage-specific cell populations Cell populations that maintain the ability to differentiate into multiple dedicated cell types are useful for generating multiple lineage-specific differentiated cell populations. These cell populations that maintain the ability to further differentiate into dedicated cells contain pluripotent cells. Pluripotent cells can be derived from embryonic and / or non-embryonic stem cells.
[0005] It is contemplated that these lineage-specific differentiated cell populations will find use in cell replacement therapy for patients suffering from diseases that result in the loss of function of a defined cell population. In addition to their direct therapeutic value, lineage-specific differentiated cells are also valuable research tools for a variety of purposes, including in vitro screening assays to identify, confirm, and test functional specificity or to test for the delivery of therapeutic molecules to treat cell lineage-specific diseases.
[0006] Traditionally, embryonic stem cells (ESCs), somitic stem cells, and induced pluripotent stem cells (iPSCs) have been used as therapeutic agents and model systems for neurodegenerative diseases. Research and technological development related to the directed differentiation of embryonic stem cells and somitic stem cells has occurred in the field of central nervous system (CNS) diseases such as Huntington's disease (HD), Alzheimer's disease (AD), Parkinson's disease (PD), and multiple sclerosis (MS). However, to date, only limited therapeutic effects have been demonstrated.
[0007] Thus, there is a need for compositions and methods for obtaining cell populations that can be used both in research and as therapeutic agents to treat diseases when loss of a specific cell population causes a patient to lose a particular function.
[0008] In the case of Parkinson's disease, for example, the loss of midbrain dopaminergic (DA) neurons leads to the onset of symptoms. Therefore, there is a need for a method for generating DA neurons from pluripotent cells so that the pluripotent cells can be used both in therapy and in disease models to identify new therapeutic agents for treating other primary and secondary parkinsonian disorders, including, but not limited to, Parkinson's disease and idiopathic Parkinson's disease; Parkinson's plus diseases such as multiple system atrophy, progressive supranuclear palsy, corticobasal degeneration, and dementia with Lewy bodies, vascular parkinsonism, and drug-induced parkinsonism; and non-idiopathic parkinsonian disorders, including, but not limited to, Parkinson's disease due to mutations in the Parkinson gene and other familial and genetic factors.
[0009] Various efforts have been made to generate midbrain DA neurons from pluripotent cells. For example, methodologies for generating midbrain DA neurons from pluripotent cells typically require the combined use of a BMP signaling inhibitor, LDN-193189 (which inhibits ALK 1 / 2 / 3 / 6 and blocks SMAD 1 / 5 / 8), and a TGF-β signaling inhibitor, SB-431542 (which inhibits ALK 4 / 5 / 7 and blocks SMAD 2 / 3), as described in U.S. Pat. No. 10,280,398, the entire contents of which are incorporated herein by reference. Because these methods utilize a combination of two inhibitors of Small Mothers Against Decapetaplegic (SMAD) signaling, these methods are commonly referred to as "dual SMAD inhibition" or "dual SMADi."
[0010] One method for generating DA neurons using dual SMAD inhibition involves inducing a plurality of multipotent stem cells into at least one inhibitor of TGFβ / Activin-Nodal signaling, at least one inhibitor of bone morphogenetic protein (BMP) signaling, and at least two activators of sonic hedgehog (SHH) signaling, e.g., parmorphamine and SHH. The method includes differentiating pluripotent stem cells, comprising exposing the cells to C25II and at least one inhibitor of glycogen synthase kinase 3p (GSK3P) signaling that activates Wingless (Wnt) signaling, wherein exposing the cells to at least one inhibitor of TGFβ / Activin-Nodal signaling and at least one inhibitor of BMP signaling begins on day 0, and the cells are exposed to at least one inhibitor of GSK3P signaling from day 3 to day 11 of the initial exposure of the cells to at least one inhibitor of TGFβ / Activin-Nodal signaling and at least one inhibitor of BMP signaling in an amount effective to generate a cell population comprising at least about 10% differentiated cells that express both Forkhead box protein A2 (FOXA2) and LIM homeobox transcription factor 1 alpha (LMX1 A).
[0011] Additionally, U.S. Pat. No. 10,858,625, the entire contents of which are incorporated herein by reference, describes another method for generating DA neurons using dual SMAD technology, which comprises contacting a plurality of multipotent stem cells with at least one inhibitor of TGFβ / Activin-Nodal signaling, and contacting the cells with at least one activator of Sonic hedgehog (SHH) signaling and at least one activator of Wingless (Wnt) signaling to induce the expression of Forkhead box protein A2 (FOXA2) and LI. obtaining a population of differentiated cells that express M homeobox transcription factor 1 alpha (LMX1A), wherein the concentration of at least one activator of Wnt signaling is increased during contact with the cells, where i) the increase in concentration begins between about 2 days and about 6 days after initial contact of the at least one activator of Wnt signaling with the cells, and ii) the concentration of the at least one activator of Wnt signaling is increased by about 250% to about 1800% of the initial concentration of the at least one activator of Wnt signaling contacted with the cells.
[0012] Additionally, U.S. Pat. No. 10,273,452, the entire contents of which are incorporated herein by reference, discloses another method for generating DA neurons using dual SMAD technology, the method comprising: contacting a plurality of starting cells selected from the group consisting of pluripotent stem cells, pluripotent cells, and combinations thereof with an inhibitor of Small Mothers Against Decapentaplegic (SMAD) protein signaling ("SMAD inhibitor"); contacting the cells with a bone morphogenetic protein (BMP); and contacting the cells with a compound selected from the group consisting of BRL-54443, parthenolide, phenanthroline, and combinations thereof, wherein the cells are contacted with the SMAD inhibitor and the BMP in amounts effective to induce detectable expression of SIX1 and Pax6 in the plurality of cells.
[0013] A method for obtaining an enriched population of midbrain dopaminergic (DA) neurons is described in U.S. Patent No. 10,828,335, the entire contents of which are incorporated herein by reference. Generally, the method includes the steps of (a) obtaining a population of pluripotent cells; (b) culturing the population of cells in a medium containing a BMP signaling inhibitor; a TGFβ signaling inhibitor; an activator of sonic hedgehog (SHH) signaling; and an activator of Wnt signaling, a MEK inhibitor, optionally without FGF8; and (c) transferring the population of cells to a suspension culture medium containing a BMP signaling inhibitor; an activator of SHH signaling; and an activator of Wnt signaling, optionally without FGF8. (d) forming cell aggregates containing FGF8, (e) dissociating the cell aggregates and seeding the dissociated cells in culture to provide a neural lineage cell population; (f) further differentiating the neural lineage cell population in a maturation medium containing a neural maturation factor to generate a cell population comprising midbrain neuron cells; and (g) using a screenable or selectable transgenic marker under the control of a pan-neural promoter expressed by cells of the cell population to provide an enriched population of midbrain DA neurons.
[0014] A method for preparing multipotent stem cells for neural differentiation is described in U.S. Patent No. 9,487,752, which is incorporated herein by reference in its entirety. Generally, the method includes: a) culturing a population of human multipotent stem cells in a medium containing transforming growth factor β (TGFβ) and basic fibroblast growth factor (bFGF), which maintains cellular pluripotency; b) priming the multipotent stem cells in an adhesion medium and in a serum-free medium essentially free of exogenously added TGFβ and bFGF, and in the absence of mouse feeder cells, prior to aggregate formation, where the priming is carried out for at least one day and the levels of TGFβ and bFGF are gradually reduced; c) forming aggregates from the cells of step b) in a suspension medium; and d) further differentiating the aggregates into a cell population containing neural cells, thereby generating human neural cells. Others have used mono-SMAD inhibition (mono-SMADi) to generate midbrain DA neurons from pluripotent cells. See, e.g., U.S. Patent No. 10,590,383, incorporated herein by reference in its entirety. Generally, the method includes culturing human pluripotent cells in the presence of the following signaling modulators: (a) a single inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling, (b) at least one activator of Sonic Hedgehog (SHH) signaling, and (c) at least one activator of Wingless (Wnt) signaling, and culturing the cells in the presence of the modulators for a period of time sufficient to provide a cell composition comprising FOXA2+ / LMX1+ cells, wherein the culturing does not include culturing the human pluripotent cells in the presence of a second inhibitor of Small Mothers Against Decapentaplegic (SMAD) signaling. [Prior art documents] [Patent documents]
[0015] [Patent Document 1] U.S. Patent No. 10,280,398 [Patent Document 2] U.S. Patent No. 10,858,625 [Patent Document 3] U.S. Patent No. 10,273,452 [Patent Document 4] U.S. Patent No. 10,828,335 [Patent Document 5] U.S. Patent No. 9,487,752 [Patent Document 6] U.S. Patent No. 10,590,383 [Brief explanation of the drawings]
[0016] [Figure 1] 1 is a flowchart of an exemplary method of processing disclosed herein.
[0017] [Figure 2] Formulas (I) and (II) are reproduced from U.S. Patent Publication No. 20170081326A1.
[0018] [Figure 3] Table 1 is reproduced from U.S. Patent Publication No. 20170081326A1. Summary of the Invention
[0019] method Methods of treating patients to improve engraftment of administered cells Methods of pre-treating a patient to improve engraftment of administered cells are disclosed. Methods of pre-treating a patient to improve engraftment of administered progenitor cells are disclosed. Methods of pre-treating a patient to improve engraftment of administered DA neurons are disclosed.
[0020] In some embodiments, methods are provided for improving the efficacy of progenitor cell therapy in a mammal by administering to the mammal an antihyperlipidemic agent and / or a CSF-1R antagonist, hi some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is administered in combination with the cell therapy, resulting in improved efficacy of the cell therapy.
[0021] Administration of an antihyperlipidemic drug or a CSF-1R antagonist to a patient Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of an antihyperlipidemic agent or a CSF-1R antagonist to the patient. Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of an antihyperlipidemic agent to the patient. Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of fenofibrate to the patient. Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of fenofibrate to the patient. Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of a CSF-1R antagonist to the patient. Disclosed are methods for pretreating a patient to improve cell engraftment by administering a therapeutically effective amount of pexidartinib, also known as PLX3397, to the patient. Disclosed are methods of pretreating a patient to enhance cell engraftment by administering a therapeutically effective amount of PLX5622 to the patient. Administration of an antihyperlipidemic agent or CSF-1R antagonist can occur before, during, or after administration of cells to the patient for engraftment. In some embodiments, the engrafted cells are stem cells, progenitor cells, or progenitor cells. In some embodiments, the engrafted cells are DA neurons.
[0022] Administration of an antihyperlipidemic agent and a CSF-1R antagonist to a patient Disclosed are methods for pretreating a patient to improve cell engraftment by administering to the patient therapeutically effective amounts of an antihyperlipidemic drug and a CSF-1R antagonist. Disclosed are methods for pretreating a patient to improve cell engraftment by administering to the patient therapeutically effective amounts of fenofibrate and a CSF-1R antagonist. Disclosed are methods for pretreating a patient to improve cell engraftment by administering to the patient therapeutically effective amounts of fenofibrate and a CSF-1R antagonist. Disclosed are methods for pretreating a patient to improve cell engraftment by administering to the patient therapeutically effective amounts of fenofibrate and pexidartinib. Disclosed are methods for pretreating a patient to improve cell engraftment by administering to the patient therapeutically effective amounts of fenofibrate and pexidartinib. The administration of the antihyperlipidemic agent and CSF-1R antagonist can occur before, during, and after administration of cells to the patient for engraftment. In some embodiments, the engrafted cells are progenitor cells. In some embodiments, the engrafted cells are DA neurons.
[0023] Administration of an antihyperlipidemic agent and a CSF-1R antagonist to a patient prior to administration of cell therapy In one embodiment, a method includes identifying a mammal having dysfunctional tissue, providing the mammal with an antihyperlipidemic agent and / or a CSF-1R antagonist, and administering one or more cells to the tissue after administering the antihyperlipidemic agent and / or CSF-1R antagonist to the mammal, wherein the antihyperlipidemic agent and / or CSF-1R antagonist improves one or more of viability, engraftment, proliferation, migration, innervation, or differentiation of the administered cells, thereby improving the efficacy of the cell therapy. In some embodiments, the administered cells are progenitor cells. In some embodiments, the administered cells are DA neurons.
[0024] Administration of an antihyperlipidemic agent and a CSF-1R antagonist to a patient during administration of cell therapy In one embodiment, a method includes identifying a mammal having dysfunctional tissue, administering one or more cells to the tissue, and simultaneously providing the mammal with an antihyperlipidemic agent and / or a CSF-1R antagonist, wherein the antihyperlipidemic agent and / or CSF-1R antagonist improves one or more of viability, engraftment, proliferation, migration, innervation, or differentiation of the administered cells, thereby improving the efficacy of the cell therapy. In some embodiments, the administered cells are progenitor cells. In some embodiments, the administered cells are DA neurons.
[0025] Administration of an antihyperlipidemic agent and a CSF-1R antagonist to a patient after administration of cell therapy In one embodiment, a method includes identifying a mammal having dysfunctional tissue, administering one or more cells to the tissue, and then providing an antihyperlipidemic drug and / or a CSF-1R antagonist to the mammal after administration of the cells, wherein the antihyperlipidemic drug and / or CSF-1R antagonist improves one or more of viability, engraftment, proliferation, migration, innervation, or differentiation of the administered cells, thereby improving the efficacy of the cell therapy. In some embodiments, the administered cells are progenitor cells. In some embodiments, the administered cells are DA neurons.
[0026] Administration of an antihyperlipidemic agent and a CSF-1R antagonist to a patient before, during, and after administration of cell therapy In one embodiment, a method includes identifying a mammal having dysfunctional tissue, administering one or more cells to the tissue, and providing the mammal with an antihyperlipidemic agent and / or a CSF-1R antagonist before, during, and after administration of the cells, wherein the antihyperlipidemic agent and / or CSF-1R antagonist improves one or more of viability, engraftment, proliferation, migration, innervation, or differentiation of the administered cells, thereby improving the efficacy of progenitor cell therapy. In some embodiments, the administered cells are progenitor cells. In some embodiments, the administered cells are DA neurons. All combinations of providing the mammal with an antihyperlipidemic agent and / or a CSF-1R antagonist before and after (but not during) administration of the cells, or before and during (but not after) administration of the cells, or during and after (but not before) administration of the cells are contemplated.
[0027] Implantation of treated cells Treating stem cells in vitro with antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, the stem cells are treated with an antihyperlipidemic agent and / or a CSF-1R antagonist to differentiate into DA neurons, and the DA neurons are then implanted into the brain of a patient, in some embodiments, at risk for, exhibiting symptoms of, and / or diagnosed with Parkinson's disease.
[0028] The implanted cells help repair damage to the brain or spinal cord or nerve(s), and recovery or prognosis is improved in patients who receive the progenitor cells compared to patients who do not receive such implantation. In some embodiments, treating the stem cells with an antihyperlipidemic agent and / or a CSF-1R antagonist is performed in vitro one or more times prior to implantation.
[0029] In some embodiments, after implantation, the engraftment site or recipient site, including some other part of the brain or other neural tissue, e.g., the cortex or spinal cord, is directly treated with an antihyperlipidemic agent and / or a CSF-1R antagonist.
[0030] Treating progenitor cells in vitro with antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, the cells that differentiate into progenitor cells are treated with an antihyperlipidemic drug and / or a CSF-1R antagonist, and once differentiated into DA neurons, the DA neurons are implanted or transplanted into the brain of the patient.
[0031] In some embodiments, progenitor cells are treated with an antihyperlipidemic drug and / or a CSF-1R antagonist and implanted or transplanted into the brain of a patient. In some embodiments, the patient is at risk for, exhibits symptoms of, and / or has been diagnosed with Parkinson's disease or other Parkinson's disorder. The implanted cells help repair damage to the spinal cord or nerve(s), and recovery or prognosis is improved in patients who receive the progenitor cells compared to patients who do not receive such implantation. In some embodiments, treating the progenitor cells with an antihyperlipidemic drug and / or a CSF-1R antagonist is performed in vitro one or more times prior to implantation. In some embodiments, the transplanted cells produce dopamine and treat Parkinson's disease in the patient, or reduce and / or delay the onset of Parkinson's disease symptoms.
[0032] Treating progenitor cells in vivo with antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, the progenitor cells are treated with an antihyperlipidemic drug and / or CSF-1R antagonist after delivery to the target tissue (e.g., in vivo). In some embodiments, this approach improves the overall efficacy of the treatment because there is a limited time lag between exposure of the cells to the antihyperlipidemic drug and / or CSF-1R antagonist and the target tissue receiving the beneficial effect. In some embodiments, a combination of antihyperlipidemic drug and / or CSF-1R antagonist treatments is used. For example, in some embodiments, the cells are treated with the antihyperlipidemic drug and / or CSF-1R antagonist before, during, after administration, or a combination thereof. In some embodiments, treatment with the antihyperlipidemic drug and / or CSF-1R antagonist is performed one or more times in vitro before implantation and / or one or more times after implantation.
[0033] composition DA neuron population Disclosed are one or more DA neuronal cells comprising, consisting essentially of, or consisting of an antihyperlipidemic drug or a CSF-1R antagonist. DA neuronal cells comprising, consisting essentially of, or consisting of an antihyperlipidemic drug. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate. DA neuronal cells comprising, consisting essentially of, or consisting of a CSF-1R antagonist. DA neuronal cells comprising, consisting essentially of, or consisting of pexidartinib.
[0034] Provided herein are one or more DA neuronal cells comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and a CSF-1R antagonist. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate and a CSF-1R antagonist. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate and a CSF-1R antagonist. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate and pexidartinib. DA neuronal cells comprising, consisting essentially of, or consisting of fenofibrate and pexidartinib.
[0035] For each of the above compositions, the composition can be administered to a subject identified as likely to have a nervous system disorder, such as Parkinson's disease or other primary and secondary parkinsonian disorders. DETAILED DESCRIPTION OF THE INVENTION
[0036] Throughout this disclosure, various publications, patents, and published patent specifications are referenced by specific citation. The disclosures of these publications, patents, and published patent specifications are hereby incorporated by reference into this disclosure in order to more fully describe the state of the art to which this disclosure pertains.
[0037] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry, and immunology, which are within the skill of the art. Such techniques are described more fully in the literature, for example in the following publications: For example, Sambrook and Russell eds. MOLECULAR CLONING: A LABORATORY MANUAL, 3rd edition (2001); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (FM Ausubel et al. eds. (2007)) series; METHODS IN ENZYMOLOGY (Academic Press, Inc., NY) series; PCR 1:A PRACTICAL APPROACH (M. MacPherson et al. IRE Press at Oxford University Press(1991)); PCR 2:A PRACTICAL APPROACH (MJ MacPherson, BD Hames and GR Taylor eds.(1995));ANTIBODIES, A LABORATORY MANUAL (Harlow and Lane eds.(1999));CULTURE OF ANIMAL CELLS: A MANUAL OF BASIC TECHNIQUE(RI Freshney 5th edition (2005)); OLIGONUCLEOTIDE SYNTHESIS (M.J. Gait ed. (1984)); Mullis et al. U.S. Pat. No. 4,683,195; NUCLEIC ACID HYBRIDIZATION (B.D. Hames & S.J. Higgins eds. (1984)); NUCLEIC ACID HYBRIDIZATION (M.L.M. Anderson (1999)); TRANSCRIPTION AND TRANSLATION (B.D. Hames & S.J. Higgins eds. (1984)); IMMOBILIZED CELLS AND ENZYMES (IRL Press (1986)); B.Perbal, A PRACTICAL GUIDE TO MOLECULAR CLONING (1984); GENE TRANSFER VECTORS FOR MAMMALIAN CELLS (JH Miller and MP Calos eds. (1987) Cold Spring Harbor Laboratory); GENE TRANSFER AND EXPRESSION IN MAMMALIAN CELLS (SC Makrides ed. (2003)) IMMUNOCHEMICAL METHODS IN CELL AND MOLECULAR BIOLOGY (Mayer and Walker, eds., Academic Press, London (1987)); WEIR'S HANDBOOK OF EXPERIMENTAL IMMUNOLOGY (LA Herzenberg et al. eds (1996)). .
[0038] General Considerations for Parkinson's Disease and Other Primary and Secondary Parkinsonian Disorders Injury and / or disease can result in loss of function or cell death in tissues afflicted by or indirectly affected by the injury or disease. For example, age-related degeneration of tissues can result in loss of function of neurons in the eye, loss of touch, decreased control of muscle movement, and memory impairment, among many other possible effects. Non-neural tissues are also subject to injury or disease. For example, heart tissue can be damaged after an adverse myocardial event such as a myocardial infarction. Blood cells can be damaged by chemotherapy or radiation therapy. Liver cells can be damaged by toxins or metabolic waste products. All of these diseases and / or injuries, among others, are candidates for cell therapy.
[0039] Cell therapy, which introduces new cells into tissue to treat disease, offers a potential method for repairing diseased tissue or replacing diseased tissue with healthy tissue. In some embodiments described herein, antihyperlipidemic agents and / or CSF-1R antagonists are used to enhance the effects of cell therapy. As described in more detail below, antihyperlipidemic agents and / or CSF-1R antagonists are used in some embodiments (either by contacting the transplanted cells or by pre-treating the recipient of the transplanted cells) to improve the viability of the transplanted cells. In some embodiments, improved viability is manifested as a more robust population of cells for transplant into a subject in need of cell therapy. In some embodiments, the use of antihyperlipidemic agents and / or CSF-1R antagonists (either by contacting the transplanted cells or by pre-treating the recipient of the transplanted cells) results in transplanted cells that are more highly stabilized, have improved survival after transplantation, and increased engraftment. In some embodiments, the use of an antihyperlipidemic agent and / or a CSF-1R antagonist (either by contacting the transplanted cells or by pre-treating the recipient of the transplanted cells) enhances endogenous stem cell activation and differentiation. In some embodiments, the antihyperlipidemic agent and / or a CSF-1R antagonist is used to treat harvested stem cells (or cultured stem cells) prior to administration to an individual in need of therapy. In some embodiments, DA neurons are administered to a patient containing a transplanted area, followed by administration of an antihyperlipidemic agent and / or a CSF-1R antagonist. In some embodiments, the cells are administered without prior exposure to the antihyperlipidemic agent and / or a CSF-1R antagonist (e.g., the cells are not exposed until after administration). In some embodiments, the target tissue / brain region is pre-treated with an antihyperlipidemic drug and / or a CSF-1R antagonist prior to administration of the cells (either treated with an antihyperlipidemic drug and / or a CSF-1R antagonist, or not treated with antihyperlipidemic drug and / or a CSF-1R antagonist cells).In some embodiments, the antilipidemic agent and / or CSF-1R antagonist is administered 10 days prior to administering the cells (either treated with the antilipidemic agent and / or CSF-1R antagonist or not treated with the antilipidemic agent and / or CSF-1R antagonist cells). In some embodiments, the period prior to cell administration is 15, 20, 30, 40, 50, or 60 days. In some embodiments, the antilipidemic agent and / or CSF-1R antagonist is administered prior to administering the cells (either treated with the antilipidemic agent and / or CSF-1R antagonist or not treated with the antilipidemic agent and / or CSF-1R antagonist cells), and then the antilipidemic agent and / or CSF-1R antagonist is re-administered for a period of days after cell administration. In some cases, the antihyperlipidemic agent and / or CSF-1R antagonist is administered for 10 days, 15 days, 20 days, 30 days, 2 months, 3 months, 4 months, 5 months, or 6 months. In some embodiments, only the antihyperlipidemic agent, such as fenofibrate, is re-administered after cell administration. In some embodiments, the cells are treated with the antihyperlipidemic agent and / or CSF-1R antagonist and then incubated for a period of time before administration. For example, the incubation period, in some embodiments, ranges from 1 minute or more to about 48 hours. In some embodiments, the incubation period ranges from about 1 to about 5 minutes, about 5 to about 10 minutes, about 10 to about 15 minutes, about 15 to about 20 minutes, about 20 to about 30 minutes, about 30 to about 40 minutes, about 40 to about 50 minutes, about 50 to about 60 minutes, and overlapping ranges thereof. In some embodiments, the waiting period after administration is 1 to 4 hours, 4 to 8 hours, 8 to 12 hours, 12 to 16 hours, 16 to 20 hours, 20 to 24 hours, and overlapping ranges thereof. In some embodiments, longer or shorter incubation periods are used. In some embodiments, the cells are administered to the target tissue simultaneously with administration of the antihyperlipidemic drug and / or CSF-1R antagonist. In some embodiments, the cells are administered to a subject, and after a period of time, the antihyperlipidemic drug and / or CSF-1R antagonist is then administered to the patient and / or directly to the target tissue.For example, in some embodiments, the waiting period after administration ranges from at least 1 minute to about 48 hours. In some embodiments, the waiting period after administration ranges from about 1 to about 5 minutes, about 5 to about 10 minutes, about 10 to about 15 minutes, about 15 to about 20 minutes, about 20 to about 30 minutes, about 30 to about 40 minutes, about 40 to about 50 minutes, about 50 to about 60 minutes, and overlapping ranges thereof. In some embodiments, the waiting period after administration ranges from 1 to 4 hours, 4 to 8 hours, 8 to 12 hours, 12 to 16 hours, 16 to 20 hours, 20 to 24 hours, and overlapping ranges thereof. In some embodiments, longer or shorter incubation periods are used. In some embodiments, administering an antihyperlipidemic agent and / or a CSF-1R antagonist together with the DA neurons enhances the efficacy of the implanted cells, advantageously providing improved therapy for a variety of clinical applications.
[0040] definition As used herein, certain terms may have the following defined meanings: As used in this specification and claims, the singular forms "a," "an," and "the" include singular and plural referents unless the context clearly dictates otherwise. For example, the term "a cell" includes a singular cell and plural cells, including mixtures thereof.
[0041] As used herein, the term "about" refers to ±10%.
[0042] As used herein, the term "comprising" is intended to mean that the composition, method includes the recited elements, but does not exclude others. When used to define compositions and methods, "consisting essentially of" is intended to mean excluding other elements of any substantial significance to the composition or method. "Consisting of" is intended to mean excluding more than trace elements of other components relative to the claimed compositions and substantial method steps. Embodiments defined by each of these transitional phrases are within the scope of this disclosure. Thus, it is intended that methods and compositions may include additional steps and components (comprising), or alternatively, may include insignificant steps and compositions (consisting essentially of), or alternatively, may include only the recited method steps or compositions (consisting of).
[0043] The words "comprises," "comprising," "includes," "including," "having," and combinations thereof mean "including but not limited to."
[0044] The term "consisting of" means "including and limited to."
[0045] The term "consisting essentially of" means that a composition, method, or structure may include additional components, steps, and / or moieties, but only if the additional components, steps, and / or moieties do not materially alter the basic and novel characteristics of the claimed composition, method, or structure.
[0046] "Formula (I) or (II), or a pharmaceutically acceptable salt, solvate, tautomer, isomer, or deuterated analog of Formula (I) or (II)" means Formula (I) or (II) as set forth in U.S. Patent Publication No. 20170081326A1, wherein, with respect to Formula I, R is cyano; halo; or (C-C) alkyl optionally substituted with 1 to 3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy; X, if present, is halo; and with respect to Formula II, R is cyano; halo; or (C-C) alkyl optionally substituted with 1 to 3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy; X is halo, if present; 1 is cyano; halo; or (C1-C3) alkyl optionally substituted with 1 to 3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy.
[0047] As used herein, the term "neurodegeneration" should be given its conventional meaning and should refer to the process of cell destruction resulting from a primary destructive event, such as stroke or trauma, as well as secondary delayed and progressive destructive mechanisms initiated by the cell due to the occurrence of the primary destructive event. Primary destructive events include disease processes or physical injury or neurotoxin exposure or seizures, including stroke, but also other diseases and conditions, such as multiple sclerosis, amyotrophic lateral sclerosis, heat stroke, epilepsy, Alzheimer's disease, Parkinson's disease, Huntington's disease, dopaminergic dysfunction, dementia caused by other causes, such as AIDS, cerebral ischemia, including focal cerebral ischemia, disruptive or compressive damage in the CNS, including disruptive or compressive damage to the brain, spinal cord, nerves, or retina, or any other acute injury or seizure that produces neurodegeneration. Secondary destructive mechanisms include any mechanism that results in the production and release of neurotoxic molecules, including apoptosis, depletion of cellular energy stores due to changes in mitochondrial membrane permeability, release of excess glutamate or failure to reuptake, reperfusion injury, and cytokine activity and inflammation. Both primary and secondary mechanisms can contribute to the formation of a "zone of danger" for neurons, where neurons within the zone at least temporarily survive the primary destructive event but are at risk of death due to a process of delayed effects.
[0048] As used herein, the term "neuroprotection" should be given its conventional meaning and should also refer to a therapeutic strategy to delay or prevent otherwise irreversible neuronal loss due to neurodegeneration following a primary destructive event, whether the neurodegenerative loss is a disease mechanism associated with the primary destructive event or a secondary destructive mechanism.
[0049] As used herein, the term "composition" has its broadest reasonable meaning, including, but not limited to, a composition comprising, consisting of, or consisting essentially of a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist. In some embodiments, the composition further comprises DA neurons.
[0050] As used herein, the term "combination therapy," as used herein, has its broadest reasonable meaning, including, but not limited to, a process in which a patient is treated with a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist, and DA neurons are delivered to a target tissue in the patient.
[0051] As used herein, the term "cognitive function" is to be given its conventional meaning and also refers to cognitive and cognition or mental processes or functions, including those related to perception, thinking, learning, perception, memory (including immediate, recent, or remote memory), and judgment. Symptoms of cognitive loss can also include changes in a patient's personality, mood, and behavior. Diseases or conditions that affect cognitive function include Alzheimer's disease, dementia, AIDS or HIV infection, Creutzfeldt-Jakob disease, head trauma (single-event trauma and prolonged trauma such as multiple concussions or other trauma that may result from athletic injury), Lewy body disease, Pick's disease, Parkinson's disease, dementia with Lewy bodies, frontotemporal dementia (FTD), Huntington's disease, drug or alcohol abuse, brain tumor, hydrocephalus, kidney or liver disease, stroke, depression, and other psychiatric disorders that cause disruption of cognitive function, and neurodegeneration.
[0052] "DA neurons" or "DA neurons" are midbrain-fate cells that express FOXA2+, LMX1A+, and TH+.
[0053] As used herein, the term "differentiation" refers to the process by which an undifferentiated embryonic cell acquires the characteristics of a differentiated cell, such as a specific type of neuron, brain cell, heart, liver, or muscle cell. Differentiation is usually controlled by the interaction of the cell's genes with the physical and chemical conditions outside the cell through signaling pathways involving proteins embedded in the cell surface.
[0054] As used herein, the term "cell differentiation" refers to the pathway by which less differentiated cells (i.e., stem cells) develop or mature to have more specific morphology and function (e.g., iPSCs develop from neural crest progenitor cells, to cells of neuronal lineage, to floor plate midbrain progenitor cells, and then to midbrain-fate FOXA2 / LMX1A+ dopamine (DA) neurons).
[0055] The terms "derived from," "established from," or "differentiated from," as used with reference to any cell disclosed herein, refer to cells obtained (e.g., isolated, purified, etc.) from a parent cell, tissue (such as a dissociated embryo), or fluid within a cell line using any method, including, but not limited to, single-cell isolation, in vivo culture, treatment, and / or mutagenesis. Cells can be derived from other cells using, for example, chemical treatment; radiation; contact with (treatment with), for example, a virus, transfection with a DNA / RNA sequence, morphogens, etc., and induction of de novo protein expression by selection (such as by continuous culture) of any cell type contained within the cultured parent cell. Derived cells can be selected from a mixed population based on response to growth factors, cytokines, selection for progression to cytokine treatment, adhesion, lack of adhesion, sorting procedures, etc.
[0056] As used herein, the term "directed differentiation" refers to the manipulation of stem cell culture conditions to induce differentiation into specific (e.g., desired) cell types, such as floor-plate mesencephalic progenitor cells and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons. In one embodiment, the term "directed differentiation," with reference to cells, refers to the use of small molecules, growth factor proteins, and other growth conditions to promote the transition of cells from a pluripotent state to a more mature or differentiated cell fate (e.g., central nervous system cells, neural cells, floor-plate mesencephalic progenitor cells, and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons, etc.). In a preferred embodiment, directed differentiation is initiated on day 0 by contacting cells with LDN / SB. Cells undergoing directed differentiation as described herein result in the formation of non-default cell types, floor-plate mesencephalic progenitor cells and mesencephalic-fate FOXA2 / LMX1A+ dopamine (DA) neurons.
[0057] As used herein, the term "differentiation" has its broadest meaning, including, but not limited to, the process by which undifferentiated multipotent stem cells progress through one or more metaphase cell divisions, potentially ultimately producing one or more differentiated cell types. Thus, differentiation includes the process by which progenitor cells, e.g., undifferentiated cell types that progress to fully differentiated forms but which may or may not be true stem cells, progress through metaphase cell divisions to ultimately differentiated cell types. Differentiation encompasses the process by which multipotent stem cells are induced to differentiate into DA neurons. Differentiation encompasses the process by which multipotent stem cells are induced to differentiate into cell types, including those of the central nervous system, either in vivo or in vitro.
[0058] The term "embryonic stem (ES) cells" refers to pluripotent stem cells derived from an early embryo. The phrase "embryonic stem cells" refers to embryonic cells that can differentiate into all three germ layers (i.e., endoderm, ectoderm, and mesoderm) or remain undifferentiated. The phrase "embryonic stem cells" includes cells obtained from embryonic tissue formed after conception (e.g., blastocysts) and before implantation of the embryo (i.e., preimplantation blastocysts); expanded blastocyst cells (EBCs) obtained from postimplantation / postvesicular stage blastocysts (see WO2006 / 040763); and embryonic (EG) cells obtained from fetal reproductive tissue at any time during pregnancy, preferably before 10 weeks of pregnancy.
[0059] As used herein, the term "engraftment" should be given its conventional meaning and should also refer to the process (or result of that process) by which cells are incorporated into another group of cells or another tissue. For example, in some embodiments, exogenously administered cells implant into (e.g., become part of) the host's neural network. Engraftment may or may not occur with migration, depending on the embodiment. Similarly, engraftment may or may not be associated with increased viability (e.g., engraftment is not a requirement for maintaining or increasing cell viability), depending on the embodiment.
[0060] As used herein, the terms "growth chamber" and "cell culture chamber" are used interchangeably and should be construed very broadly to refer to any container or vessel suitable for culturing cells, including, but not limited to, dishes, culture dishes (single or multi-well), bioreactors, incubators, and the like.
[0061] The term "induced pluripotent stem cells," commonly abbreviated as "iPS cells" or "iPSCs," refers to a type of multipotent stem cell artificially prepared from non-pluripotent cells, usually adult somatic cells, or terminally differentiated cells, such as fibroblasts, hematopoietic cells, muscle cells, neurons, and epidermal cells, by introducing or contacting them with reprogramming factors. Induced pluripotent stem cells are conferred pluripotency (i.e., they can differentiate into all three germ cell germ layers: endoderm, ectoderm, and mesoderm). According to some embodiments, induced pluripotent stem cells are formed by inducing expression of Oct-4.
[0062] As used herein, the term "migration" should be given its conventional meaning and should also refer to the movement of stem cells (either endogenous or exogenous) from their initial site (e.g., an endogenous storage site or an administration site) to a second site (e.g., a final location within a target tissue). In some embodiments, migration occurs based on changes in fluid flow or pressure in the environment surrounding the cells. In some embodiments, chemoattractants or chemorepellents induce cell migration.
[0063] The terms "neuron" or "neuronal cell" or "neuronal cell type" or "neuronal lineage" can include any neuronal lineage cell and, unless otherwise specified, can be interpreted to refer to a cell at any stage of neuronal ontogeny without any limitation. For example, neurons can include all cell types derived from a common primitive domain of neurons, such as neuronal progenitor cells, mature neurons, and astrocytes.
[0064] As used herein, the term "neural lineage cells" refers to cells that contribute to the nervous system (both central and peripheral) or neural crest cell fate during development or in adults. The nervous system includes the brain, spinal cord, and peripheral nervous system. Neural crest cell fate includes the skull, nerve trunks, vagus nerves, sacrum, and heart, which give rise to mesectoderm, cranial cartilage, skull, thymus, teeth, melanocytes, iris pigment cells, cranial ganglia, dorsal root ganglia, sympathetic / parasympathetic ganglia, endocrine gland cells, enteric nervous system, and parts of the heart.
[0065] The term "Parkinsonism" refers to a group of disorders all related to insufficient dopamine in the basal ganglia, the part of the brain that controls movement. Symptoms include tremor, bradykinesia (very slow movements), flexed posture, postural instability, and rigidity. A diagnosis of Parkinsonism requires the presence of at least two of these symptoms, one of which must be tremor or bradykinesia. The most common form of Parkinsonism, aside from a very small number of diagnoses, is idiopathic, or classic, Parkinson's disease (PD), and a total of approximately 15% of patients may have one of the Parkinson-plus syndromes (PPS). Also known as atypical Parkinsonism, these syndromes include corticobasal degeneration, dementia with Lewy bodies, multiple system atrophy, and progressive supranuclear palsy. Generally, Parkinson's disease involves the dysfunction and death of key nerve cells in the brain, primarily in an area of the brain called the substantia nigra. Many of these important nerve cells produce dopamine, and when these neurons die, the amount of dopamine produced by synthesis in the brain decreases, causing the person to lose normal motor control. The intestines also contain dopamine cells that degenerate in Parkinson's disease patients, which may be an important causative factor in the gastrointestinal symptoms that are part of the disease. The set of symptoms experienced by individuals varies from person to person. The main motor signs of Parkinson's disease include tremors in the hands, arms, legs, jaw, and face; bradykinesia or slow movements; rigidity or stiffness of the limbs and trunk; and postural instability or loss of balance and coordination.
[0066] The term "prior art preparation" refers to any pharmaceutical composition described in WO2014145051A1, US Patent Publication No. 20170081326A1, and US Patent No. 10,717,735.
[0067] The terms "pluripotent" or "pluripotent" refer to stem or undifferentiated cells that have the ability to differentiate into cells that make up one or more tissues or organs, for example, any of the three germ layers: endoderm (stomach lining, gastrointestinal tract, lungs), mesoderm (muscle, bone, blood, urogenital tract), or ectoderm (epidermal tissue and nervous system).
[0068] As used herein, the term "progenitor cell" has its broadest meaning reasonably, including, but not limited to, a pluripotent or lineage-committed progenitor cell; a "stem cell" or "mesenchymal stem cell (MSC)" that is optionally capable of either regenerating its cell lineage by endless mitosis or generating progeny cells that differentiate into any of a variety of cells (e.g., cells of the central nervous system, including neural cells such as astrocytes, oligodendrocytes, and neurons; cardiac cells; hematopoietic cells, etc.).
[0069] As used herein, the term "progenitor cell" has its broadest meaning reasonably, including, but not limited to, a lineage-uncommitted precursor cell that is generated by mitosis of a stem cell and ultimately differentiates into a neural cell (or other cell type within the lineage of the stem cell, e.g., a cardiac progenitor cell that differentiates into a cardiomyocyte). Unlike the stem cells from which they are derived, progenitor cells are generally considered incapable of infinite mitosis and ultimately differentiate into a cell type within their lineage (e.g., neural cell to neural cell, cardiac cell to cardiac cell, etc.).
[0070] As used herein, the term "proliferation" should be given its conventional meaning and refer to the process (e.g., mitosis) by which one or more stem cells (endogenous or exogenous) divide, expanding the stem cell population. In some embodiments, proliferation is measured by simple total cell count. In other embodiments, proliferation is monitored by expression of certain proteins (e.g., proliferating cell nuclear antigen, PCNA) or by monitoring cell entry into the cell cycle.
[0071] As used herein, the term "motor function," as used herein, should be given its conventional meaning and should also refer to bodily functions associated with muscle movement, primarily conscious muscle movement, including motor coordination, the performance of simple and complex motor acts, and the like.
[0072] As used herein, the term "nervous system function," as used herein, should be given its conventional meaning and should also refer to both cognitive and motor function.
[0073] As used herein, the terms "cognitive enhancement" and "motor enhancement," as used herein, should be given their conventional meaning and should also refer to the improvement or increase of cognitive function and motor function, respectively.
[0074] As used herein, the term "neurological enhancement," as used herein, should be given its conventional meaning and should also include both cognitive enhancement and motor enhancement.
[0075] As used herein, the term "neuroprotectively effective," as used herein, should be given its conventional meaning and should also refer to the amount of DA neurons and hypolipidemic agent and / or CSF-1R antagonist to achieve the goal of preventing, avoiding, reducing, or eliminating neurodegeneration, which should result in cognitive and / or motor enhancement.
[0076] As used herein, the term "effective in improving nervous system function," as used herein, should be given its conventional meaning and should also refer to the amount of DA neurons and antihyperlipidemic agent and / or CSF-1R antagonist to achieve neuroprotection, motor and / or cognitive enhancement, and / or improved cell viability, proliferation, differentiation, or increased efficacy of cell therapy.
[0077] As used herein, "pharmaceutically acceptable salts thereof" includes acid addition or base salts.
[0078] As used herein, a "pharmaceutically acceptable carrier" includes any material that, when combined with a composition disclosed herein, preserves the biological activity of the composition, e.g., its ability to treat disease-associated inflammation or affect various mechanisms associated with disease, and is non-reactive with the subject's immune system. Examples include, but are not limited to, any of the standard pharmaceutical carriers, such as phosphate-buffered saline, water, emulsions such as oil / water emulsions, and various types of wetting agents. Compositions containing such carriers are formulated by well-known conventional methods (see, e.g., Remington's Pharmaceutical Sciences, Chapter 43, 14th Ed., Mack Publishing Co., Easton, Pa.).
[0079] As used herein, the term "Small Mothers Against Decapentaplegic" or "Small Mothers Against Decapentaplegic" or "SMAD" refers to signaling molecules.
[0080] As used herein, the term "stem cell" refers to a cell that has the ability to divide indefinitely in culture and give rise to differentiated cells. Stem cells can be obtained from animals and patients, including humans; for example, human stem cells refer to stem cells that are human. Stem cells can be obtained from a variety of sources, including embryonic and non-embryonic cells, e.g., umbilical cord cells, cells from children, and cells from adults. Adult stem cells generally refer to cells that were not originally obtained from a fetus, i.e., cells from an infant, cells from a dissected umbilical cord, cells from a dissected placenta, cells from children, cells from adults, etc.
[0081] The terms "subject," "individual," or "patient" are used interchangeably herein and refer to a vertebrate, preferably a mammal, more preferably a human. Mammals include, but are not limited to, mice, rats, rabbits, monkeys, cows, sheep, pigs, dogs, cats, farm animals, sport animals, pets, horses, and primates, particularly humans.
[0082] The terms or phrases "transplantation," "cell exchange," "administering," or "engrafting" are used interchangeably herein to refer to the introduction of cells disclosed herein into a target tissue. As noted, the cells can be derived from the recipient or from an allogeneic, semi-allogeneic, or xenogeneic donor.
[0083] As used herein, the term "therapeutic agent" means an agent that has a therapeutic effect, for example, in alleviating or treating a neurodegenerative disease or injury.
[0084] As used herein, the term "viability" should be given its conventional meaning and should also refer to the ability of a cell to become a stem cell or a resident cell, or to survive disease, trauma, or other insult that impairs the normal functionality of the cell. In some embodiments, viability is measured by examining the size of a particular population of cells, while in some embodiments, specific chemical, biological, or analytical tests are performed to assess the viability of the cells. In some embodiments, viability is also examined by function, and increased function may be associated with increased viability.
[0085] By "therapeutically effective amount" is meant a dosage that produces the desired effect of administration, preferably such effect being one that improves the effectiveness of the cell therapy.
[0086] "MiR-155-3p biased or miR-155-5p biased" means that a cell population is miR-155-3p or miR-155-5p biased, e.g., (1) such cells express more miR-155-3p relative to miR-155-5p, or (2) such cells express more miR-155-3p / miR-155-5p relative to natural cells.
[0087] Throughout this application, various embodiments may be presented in a range format. The description in range format should be understood merely for convenience and simplicity and should not be construed as an inflexible limitation on the scope of the present disclosure. Accordingly, the description of a range should be construed as including all specifically disclosed subranges and individual numerical values within that range. For example, a description of a range such as 1 to 6 should be construed as including specifically disclosed subranges such as 1 to 3, 1 to 4, 1 to 5, 2 to 4, 2 to 6, 3 to 6, etc., as well as individual numerical values within that range, e.g., 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
[0088] Whenever a range of numerical values is given herein, the range is meant to include any recited numbers (fractional or integer) within the given range. The phrases "ranging between" a first given number and "ranging from" a first given number to a second given number are used interchangeably herein and are meant to include the first and second given numbers and all fractional and integer numbers therebetween.
[0089] Numerical designations, e.g., pH, temperature, time, concentration, and molecular weight, including ranges, are all approximations that vary (+) or (-) in increments of 0.1. Although not always explicitly stated, it should be understood that all numerical designations are preceded by the term "about." The term "about" includes not only the exact value "X," but also small increments of "X," such as "X+0.1," or "X-0.1." It should also be understood, although not always explicitly stated, that the reagents described herein are merely exemplary and that equivalents of such are known in the art.
[0090] Unless otherwise defined, all technical and / or scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those disclosed herein can be used in the practice or testing of the embodiments described herein, exemplary methods and / or materials are described below. In case of conflict, the patent specification, including definitions, will control. Additionally, the materials, methods, and examples are illustrative only and are not necessarily intended to be limiting.
[0091] Before describing at least one embodiment in detail, it is to be understood that the disclosure is not necessarily limited in its application to the details set forth in the following description or illustrated by way of example, as the disclosure is capable of other embodiments or of being practiced or carried out in various ways.
[0092] Antihyperlipidemic drugs Antihyperlipidemic drugs, also known as antidyslipidemic drugs, that can be used with the methods and compositions described herein include bile acid sequestrants, fenofibrate derivatives, HMG-CoA reductase inhibitors, and nicotinic acid compounds. Antihyperlipidemic drugs reduce the amount of cholesterol and fat in the blood through a variety of mechanisms. For example, bile acid sequestrants bind to bile acids in the intestine, preventing them from being reabsorbed into the blood. The liver then produces more bile to replace the bile already lost. Because the body requires cholesterol to produce bile, the liver uses cholesterol from the blood, thereby reducing the amount of LDL cholesterol circulating in the blood.
[0093] Fenofibrate derivatives that can be used in the disclosed combinations include, but are not limited to, clifofibrate, pirifibrate, ciprofibrate, bezafibrate, clinofibrate, lonifibrate, theofibrate, clofibrate, etofibrate, gemfibrozil, and fenofibrate. HMG-CoA reductase inhibitors, also known as statins, include cerivastatin, fluvastatin, atorvastatin, lovastatin, pravastatin, and simvastatin, or pharmaceutically acceptable salt forms thereof. Niacin is an example of a nicotinic acid compound that can be used with the disclosed methods. Lipase inhibitors such as orlistat are also useful. The use of these agents is described in more detail in U.S. Patent Publication No. 2002 / 0198202-A1, the entire contents of which are incorporated herein by reference.
[0094] Clifofibrate is commercially available from Wyeth-Ayerst Pharmaceuticals in 500 mg ATROMID-S® capsules, with a recommended daily dose of approximately 2 g administered in divided doses. Gemfibrozoil is available from Parke-Davis in 600 mg LOPID® tablets, with a recommended adult dose of approximately 1200 mg / day administered in two divided doses 30 minutes before breakfast and dinner. Fenofibrate is available from Abbott Laboratories Inc. in 67 mg, 134 mg, and 200 mg TRICOR® tablets, with a recommended starting dose of 67 mg to 200 mg / day, with a maximum daily dose of 200 mg / day.
[0095] In some embodiments, two or more hypolipidemic drugs are administered to the patient to promote cell viability, engraftment, proliferation, migration, or differentiation of the administered DA neurons.
[0096] Surprisingly, applicants discovered that only fenofibrate, but not its major metabolite fenofibric acid, is active. Specifically, chlorofibrate and benzafibrate fail to upregulate PGC-1a, a novel target and mechanism of action associated with dopaminergic cells and Parkinson's disease.
[0097] CSF-1R antagonists CSF-1R antagonists that can be used in the disclosed combinations include, but are not limited to, axitinib (AG 013736), dasatinib (BMS 354825), erlotinib, gefitinib, flavopiridol, imatinib mesylate, lapatinib, motesanib diphosphate (AMG 706), nilotinib (AMN107), seliciclib, sorafenib, sunitinib malate, AEE-788, BMS-599626, UCN-01 (7-hydroxystaurosporine), vemurafenib, dabrafenib, selumetinib, LGX818, BGB-283, pexidartinib (PLX3397), PLX5622, and vatalanib. In some embodiments, CSF-1R antagonists that can be used in the disclosed combinations are pexidartinib (PLX3397) and PLX5622.
[0098] In some embodiments, two or more CSF-1R antagonists are administered to a patient to promote cell viability, engraftment, proliferation, migration, innervation, or differentiation of the administered DA neurons.
[0099] Possible mechanism of action Fenofibrate The following sections discuss theories and possible mechanisms of action as they are apparent to the inventors for certain embodiments described herein. The claims of this application should not be interpreted depending on the accuracy, relevance, or specific examples of any of these theories or possible mechanisms of action. Therefore, the claims of this application should be interpreted without being bound by any theory or specific mechanism.
[0100] Fenofibrate promotes effective mitochondrial function, promotes anti-inflammation, and provides overall neuroprotection. Fenofibrate can restore the ability of PGC1-alpha to restore mitochondrial biogenesis and promote effective mitophagy. Fenofibrate has been used to treat traumatic brain injury, AD, and PD animal models. Generally, fenofibrate is used to modify disease progression. In contrast, fenofibrate is used here to promote cell engraftment. The literature does not describe co-administration of DA neurons with fenofibrate (before, simultaneously with, and / or after engraftment) to promote the survival of DA neuron progenitors after engraftment.
[0101] Furthermore, although fenofibrate has been shown to have anti-inflammatory effects, it has not been shown to affect the survival of stem cells or DA neuronal progenitors after engraftment.
[0102] Fenofibrate is predicted to be converted to its active metabolite, fenofibric acid, after administration. Fenofibric acid ligates the receptor PPAR-alpha and switches on numerous genes that promote anti-inflammatory effects. In fact, the FDA has approved fenofibrate as a prodrug that ligates PPAR-alpha and reduces triglycerides when metabolized to fenofibric acid. Surprisingly, applicants have discovered that fenofibrate is active in dopaminergic stem cells and in the brain environment in which it is placed. Thus, applicants have discovered a novel mechanism of action for fenofibrate that is directly related to promoting mitochondrial homeostasis in engrafted dopaminergic progenitors (DA neurons).
[0103] Aspects and embodiments of the methods disclosed herein can be further understood by reference to the following numbered paragraphs:
[0104] Paragraph 1. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of an antihyperlipidemic agent.
[0105] Paragraph 2. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate.
[0106] Paragraph 2a. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate, and not including chlorofibrate or benzafibrate.
[0107] Paragraph 2b. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate, and not including chlorofibrate, benzafibrate, and / or fenofibric acid.
[0108] Paragraph 3. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate.
[0109] Paragraph 4. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of an antihyperlipidemic agent.
[0110] Paragraph 5. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate.
[0111] Paragraph 6. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate.
[0112] Paragraph 7. The composition of any of the preceding paragraphs, wherein said composition does not comprise any of the prior art preparations.
[0113] Paragraph 8. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one pharmaceutically acceptable carrier.
[0114] Paragraph 9. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one additional therapeutic agent.
[0115] Paragraph 10. The composition of any of the preceding paragraphs, wherein said composition further comprises a CSF-1R antagonist.
[0116] Paragraph 11. The composition of any of the preceding paragraphs, wherein said composition further comprises DA neurons.
[0117] Paragraph 12. The composition of any of the preceding paragraphs, wherein said composition further comprises DA neurons and stem cells.
[0118] Paragraph 13. The composition of any of the preceding paragraphs, wherein said composition further comprises cells for administration.
[0119] Paragraph 14. A kit comprising the composition of any of the preceding paragraphs.
[0120] Paragraph 13. A composition according to any of the preceding paragraphs, comprising a pharmaceutically acceptable salt according to Paragraphs 1-13.
[0121] Pexidartinib Pexidartinib, or PLX3397, has been shown to inhibit microglial survival and rapidly deplete microglial populations in healthy brains, suggesting its potential use in resetting the microglial imbalance that occurs in inflamed brains. This also suggests that none of the microglia regenerated after pexidartinib administration are polarized. Therefore, it is anticipated that pre- or co-administration of pexidartinib can promote an in vivo environment, and administration after neuronal engraftment can then influence the degree, sequence, and specificity of microgliogenesis after engraftment.
[0122] In some embodiments, the patient's exposure to pexidartinib is shorter than their exposure to fenofibrate.
[0123] In some embodiments, the patient's exposure to fenofibrate is shorter than their exposure to pexidartinib.
[0124] The literature does not describe the co-administration of DA neurons / pexidartinib (before, simultaneously with, and after engraftment) to promote survival of DA neuron progenitors after engraftment.
[0125] Aspects and embodiments of the methods disclosed herein can be further understood by reference to the following numbered paragraphs:
[0126] Paragraph 1. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of a CSF-1R antagonist.
[0127] Paragraph 2. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of pexidartinib.
[0128] Paragraph 2a. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of pexidartinib, and not including chlorofibrate or benzafibrate.
[0129] Paragraph 2b. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of pexidartinib, the composition being free of chlorofibrate, benzafibrate, and / or fenofibric acid.
[0130] Paragraph 3. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of a CSF-1R antagonist.
[0131] Paragraph 4. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of pexidartinib.
[0132] Paragraph 5. The composition of any of the preceding paragraphs, wherein said composition does not comprise any of the prior art preparations.
[0133] Paragraph 6. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one pharmaceutically acceptable carrier.
[0134] Paragraph 7. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one additional therapeutic agent.
[0135] Paragraph 8. The composition of any of the preceding paragraphs, wherein the composition further comprises an antihyperlipidemic agent.
[0136] Paragraph 9. The composition of any of the preceding paragraphs, wherein said composition further comprises DA neurons.
[0137] Paragraph 10. The composition of any of the preceding paragraphs, wherein said composition further comprises DA neurons and stem cells.
[0138] Paragraph 11. The composition of any of the preceding paragraphs, wherein said composition further comprises cells for administration.
[0139] Paragraph 12. A kit comprising the composition of any of the preceding paragraphs.
[0140] Paragraph 13. A composition according to any of the preceding paragraphs, comprising a pharmaceutically acceptable salt according to Paragraphs 1-12.
[0141] Cell Therapy Targets Neurodegenerative diseases As mentioned above, cell therapy can be used to treat a wide variety of disorders. For example, Parkinson's disease is a chronic, progressive neurodegenerative disease or movement disorder that affects up to one million people in the United States. Parkinson's disease affects nervous system function by impairing a subject's motor abilities and causing dementia. The pathology of Parkinson's disease includes a decreased formation and action of dopamine, which is produced by dopaminergic neurons in the brain. Research into the causes and potential treatments of Parkinson's disease has focused on compensating for the decreased formation and action of dopamine caused by the disease.
[0142] Alzheimer's disease is another neurological disorder that affects many individuals worldwide. Cellular therapy may help slow or compensate for the loss of function experienced by Alzheimer's patients by replacing diseased neurons.
[0143] Neurodegenerative diseases include, but are not limited to, (1) trauma, (2) stroke, (3) nonspecific anoxia (i.e., anoxia due to drowning, asphyxiation, etc.), (4) Alzheimer's disease, Parkinson's disease and other primary and secondary parkinsonian disorders, as well as neurodegenerative diseases such as amyotrophic lateral sclerosis (ALS), primary lateral sclerosis (PLS), pseudobulbar palsy, and progressive bulbar palsy, and (5) mental retardation syndromes associated with progressive neurodegeneration (e.g., cerebral palsy). These conditions are well known in the art and can be diagnosed by the treating physician.
[0144] damage Apart from degenerative disorders, acute damage to nervous tissue can result in loss of neuronal function. For example, traumatic brain injury can result in cell damage or death through both primary and secondary mechanisms (discussed further below). Head injuries, whether direct impact to the head or brain swelling due to indirect impact, can also generally result in decreased neuronal function. Furthermore, spinal cord injury is one of the most commonly recognized forms of acute injury to nervous tissue. Cell therapy in this area of neurological disorders aims to restore function (full or partial) to organs or limbs that have lost function due to injury. Even the most mild clinical improvement can have a significant impact in terms of the recovery of activities an individual can perform and quality of life.
[0145] Disclosed are methods of treating or improving nervous system function in a patient in need of such treatment, involving delivering a nervous system function-enhancing or neuroprotective amount of DA neurons to a target region of the patient's brain in combination with treating the patient with an antihyperlipidemic agent and / or a CSF-1R antagonist. In some embodiments, the target region of the patient's brain comprises an area exhibiting neurodegeneration. In other embodiments, the target region comprises a portion of the brain that does not exhibit neurodegeneration.
[0146] According to some embodiments, there is provided a method for improving nervous system function in a subject, the method comprising delivering to the patient an antihyperlipidemic agent and / or a CSF-1R antagonist in an amount effective to improve the nervous system, and delivering DA neurons to at least one region of the subject's brain sufficient to cause the improvement in nervous system function.
[0147] In some embodiments, a method of treating a patient having nervous system function affected by Parkinson's disease is provided. The method includes providing a patient having impaired nervous system function affected by Parkinson's disease. The method further includes delivering an antihyperlipidemic agent and / or a CSF-1R antagonist to the patient orally (or, e.g., bucally, systemically, nasally, or by injection) and delivering DA neurons directly to at least a portion of the patient's brain sufficient to reduce the severity of Parkinson's disease symptoms in the patient.
[0148] In some embodiments, a method for preventing Parkinson's disease in a patient is provided. The method includes providing a patient with a predisposition to Parkinson's disease. The method further includes delivering DA neurons to at least one portion of the patient's brain sufficient to reduce the patient's likelihood of developing Parkinson's disease. In some embodiments, the patient is orally treated with an antihyperlipidemic agent and / or a CSF-1R antagonist before, during, and / or after delivery of the DA neurons.
[0149] Non-neurological disorders Many other diseases affecting various tissues are key targets for cell therapy. In some embodiments, liver injury or cancer is treated with cell therapy to replace lost or dysfunctional cells. In some embodiments, diabetic patients are treated with pancreatic progenitor cells (or other stem cells differentiated to a pancreatic identity) to recapitulate the loss of insulin secretion.
[0150] Cell therapy also plays a major role in the treatment of cardiac injury. Myocardial infarction and stroke often result in substantial loss of function in portions of the myocardium. Cardiac muscle is generally characterized as containing a population of terminally differentiated cells with limited self-renewal capacity. Therefore, cell therapy for treating cardiac tissue injury shows great potential for advancement in aiding functional recovery in post-infarction or post-stroke patients.
[0151] As mentioned above, cancer is a particularly interesting area from the perspective of cell therapy in that standard therapeutic modalities for treating the disease induce damage to host tissues. Ultimately, the goal is to kill cancerous cells and, to a lesser extent, host cells that result in the patient's death. Thus, overcoming these treatment-induced side effects with cell therapy may increase the chances of survival for cancer patients.
[0152] Methods for treating a patient with a disorder involving an inflammatory component are provided by administering to the patient a therapeutically effective amount of DA neurons and at least one antihyperlipidemic agent and / or at least one CSF-1R antagonist. Such disorders include, but are not limited to, (1) asthma; (2) autoimmune diseases; (3) allergies; and (4) arthritis. In some embodiments, the disorder involving an inflammatory component can include inflammation associated with diseases such as Alzheimer's disease, Parkinson's disease, ALS, atherosclerosis, diabetes (type 1 or type 2), arthritis, multiple sclerosis, sepsis, septic shock, endotoxemia, multiple organ failure, or organ damage such as liver injury.
[0153] In some embodiments, a method is provided for treating injury or degeneration in non-neural tissue, e.g., skeletal muscle, the method comprising delivering an effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to an in vitro culture containing progenitor cells, wherein the progenitor cells are muscle, liver, pancreas, heart, blood, or bone progenitor cells.
[0154] As discussed more fully below, the use of antihyperlipidemic drugs and / or CSF-1R antagonists in combination with cell therapy (either by contacting the transplanted cells or by pre-treating the recipient of the transplanted cells) is believed to improve the efficacy of the cell therapy and provide a more pronounced therapeutic effect. Furthermore, in some embodiments, contacting stem, progenitor, or progenitor cells with antihyperlipidemic drugs and / or CSF-1R antagonists is believed to positively affect the stem, progenitor, or progenitor cells in a manner that makes them more suitable for use in cell therapy. Furthermore, in some embodiments, the use of antihyperlipidemic agents and / or CSF-1R antagonists (either by contacting the transplanted cells or by pre-treating the recipient of the transplanted cells) is believed to not only improve the efficacy of exogenously administered stem cells used in cell therapy, but also to positively influence endogenous stem and / or progenitor cells (e.g., resident neural progenitors or resident cardiac progenitors) such that the combination of the administered cells with endogenous cells results in a synergistically improved therapeutic effect.
[0155] As discussed herein, numerous other diseases are treated with the appropriate stem, precursor, or progenitor cells in combination with an antihyperlipidemic agent and / or a CSF-1R antagonist.
[0156] method It has been determined that administering DA neurons in combination with the administration of antihyperlipidemic drugs and / or CSF-1R antagonists can promote neuronal survival in vitro and in vivo. The composition (in which a patient is treated with an antihyperlipidemic drug or CSF-1R antagonist and DA neurons are delivered to the patient's target tissue via oral, buccal, systemic, nasal, or injectable administration) is believed to rescue neurons that typically shrink, die, or collapse after traumatic brain injury or as a result of chronic neurodegenerative diseases. Furthermore, the combination therapy is expected to have utility as a modulator of inflammation. The combination therapy (in which a patient is treated with DA neurons in combination with the administration of antihyperlipidemic drugs and / or CSF-1R antagonists) also promotes neuronal survival.
[0157] The combination therapy promotes neuronal survival and inhibits aspects of the immune response to cerebral cortical injury, particularly the emergence and infiltration of macrophages and microglia at the injury site. Therefore, the combination therapy can be used to treat disorders involving acute neurodegeneration (stroke and traumatic brain injury), as well as some chronic neurodegenerative diseases, including Parkinson's disease and Alzheimer's disease. In the latter application, the composition is thought to inhibit both neuronal death and the brain's immune response to degenerative elements, which should slow the progression of these disorders and the accompanying decline in behavioral performance. Therefore, the combination therapy can be used to treat disorders associated with inflammation.
[0158] Some embodiments described herein provide methods for improving nervous system function in a subject. In some embodiments, the methods include orally delivering a nervous system-enhancing amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to a patient and delivering DA neurons to at least one region of the subject's brain.
[0159] In some embodiments, the damaged portion of the brain (or other tissue) can include the entire brain (or tissue), or a portion thereof (e.g., less than 0.1%, less than 0.5%, less than 1%, less than 5%, less than 10%, less than 15%, less than 25%, less than 50%, or less than 75% of the target area).
[0160] Patient treatment Disease prevention Disclosed is a method of preventing or reducing the severity of neurodegeneration in a subject, the method comprising delivering DA neurons to at least one region of the subject's brain and administering to the subject an antihyperlipidemic agent and / or a CSF-1R antagonist sufficient to prevent or reduce the severity or reduce the occurrence of neurodegeneration in the subject.
[0161] In some embodiments, the method treats a subject suffering from Parkinson's disease or other primary and secondary parkinsonian disorders, including but not limited to, idiopathic Parkinson's disease, vascular parkinsonism, drug-induced parkinsonism, and non-idiopathic parkinsonian disorders, including but not limited to, Parkinson's disease due to mutations in the Parkinson gene and other familial and genetic causes of the disease. The method includes delivering DA neurons to at least one target region of the subject's brain and administering to the subject an antihyperlipidemic drug and / or a CSF-IR antagonist sufficient to prevent, reduce the severity of, or reduce the incidence of Parkinson's disease or other primary and secondary parkinsonian disorders in the subject.
[0162] In some embodiments, the target region of the brain may be the entire brain or a specific region of the brain, including, but not limited to, a region associated with a particular cognitive or motor function, a region exhibiting neurodegeneration, the cortex, and / or a region affected by trauma. The subject may have cognitive or motor dysfunction, such as from neurodegeneration, or the subject may be healthy, i.e., not have significant neurodegeneration.
[0163] The target region can be an area of the brain affected by disease or trauma that has been identified, such as by using standard medical imaging techniques, can be a part of the brain known to control a particular function or process, or can be any compartment of the brain, including but not limited to the cortex, cerebellum, and other brain regions.
[0164] The patient can be treated with an antihyperlipidemic drug for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 60 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons. The patient can be treated with fenofibrate for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons.
[0165] The stem cells, progenitor cell population, progenitor cell population, or DA neuron population can be contacted with the antihyperlipidemic agent for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons. The stem cells, progenitor cell population, progenitor cell population, or DA neuron population can be contacted with fenofibrate for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons.
[0166] The patient can be treated with a CSF-IR antagonist for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons. The patient can be treated with pexidartinib for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons.
[0167] The stem cells, progenitor cell population, progenitor cell population, or DA neuron population can be contacted with a CSF-IR antagonist for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons. The stem cells, progenitor cell population, progenitor cell population, or DA neuron population can be contacted with pexidartinib for 1 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 15 days, 30 days, 45 days, 75 days, 100 days, 150 days, 200 days, or 365 days prior to administration of the DA neurons.
[0168] In some embodiments, the patient is treated with the antihyperlipidemic agent for a longer period than the CSF-1R antagonist. In some embodiments, the patient is treated with fenofibrate for a longer period than pexidartinib. In some embodiments, the patient is treated with the CSF-1R antagonist for a longer period than the antihyperlipidemic agent. In some embodiments, the patient is treated with pexidartinib for a longer period than fenofibrate. In some embodiments, the patient is treated with the CSF-1R antagonist for the same period as the antihyperlipidemic agent. In some embodiments, the patient is treated with pexidartinib for the same period as the antihyperlipidemic agent.
[0169] In some embodiments, the stem, progenitor, or progenitor cells are exposed to the antilipidemia drug for a longer period of time than the CSF-1R antagonist. In some embodiments, the stem, progenitor, or progenitor cells are exposed to fenofibrate for a longer period of time than pexidartinib. In some embodiments, the stem, progenitor, or progenitor cells are exposed to the CSF-1R antagonist for a longer period of time than the antilipidemia drug. In some embodiments, the stem, progenitor, or progenitor cells are exposed to pexidartinib for a longer period of time than fenofibrate. In some embodiments, the stem, progenitor, or progenitor cells are exposed to the CSF-1R antagonist for the same period of time as the antilipidemia drug. In some embodiments, the stem, progenitor, or progenitor cells are exposed to pexidartinib for the same period of time as the antilipidemia drug.
[0170] In some embodiments, the stem cells are selected from the group including hematopoietic stem cells, endothelial stem cells, neural stem cells, bone marrow stem cells, including bone marrow mesenchymal stem cells and bone marrow stromal stem cells, and fetal stem cells.
[0171] The length of time for treatment with the antihyperlipidemic agent and / or CSF-1R antagonist and the frequency of treatment sessions will depend on several factors, including the patient's functional recovery and the results of imaging analysis. In some cases where the disease is degenerative (e.g., Alzheimer's disease) or where treatment is given to a generally healthy patient, treatment can be continued indefinitely at selected intervals.
[0172] During treatment, the antihyperlipidemic drug and / or CSF-1R antagonist can be provided continuously or intermittently. During treatment, the antihyperlipidemic drug can be provided continuously and the CSF-1R antagonist can be provided intermittently. During treatment, the CSF-1R antagonist can be provided continuously and the antihyperlipidemic drug CSF-1R antagonist can be provided intermittently. During treatment, the antihyperlipidemic drug and CSF-1R antagonist can be provided intermittently. During treatment, the antihyperlipidemic drug and / or CSF-1R antagonist can be provided continuously. As used herein, treatment refers to preparing a patient to receive transplanted cells during and / or after cell transplantation.
[0173] Promotion of graft formation Another aspect of the present disclosure includes a method of improving the long-term repopulation capacity of a cell population transplant in a recipient. The method includes the steps of: a) treating the recipient with at least one antihyperlipidemic agent and / or at least one CSF-1R antagonist; and b) administering to the recipient a therapeutically effective amount of at least one cell population. In some embodiments, the cell population comprises neural cells. In some embodiments, the cell population comprises DA neurons. In some embodiments, the cell population comprises DA neurons and stem cells. In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist improve one or more of the viability, engraftment, proliferation, migration, innervation, or differentiation of the administered cells.
[0174] Treatment with an antihyperlipidemic agent and / or a CSF-1R antagonist before, during, and after the administration step Methods for improving the efficacy of one or more implanted DA neuron populations are disclosed.
[0175] In one embodiment, the method comprises treating the recipient with a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist prior to administering the cell population. In one embodiment, the method comprises treating the recipient with a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist during administration of the cell population. In one embodiment, the method comprises treating the recipient with a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist after administering the cell population. In one embodiment, the method comprises treating the recipient with a therapeutically effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist before, during, and after administration of the cell population. In some embodiments, the cell population comprises DA neurons.
[0176] In another aspect, a method is provided for treating a patient having a neurodegenerative disease by administering to the patient a therapeutically effective amount of DA neurons and a therapeutically effective amount of at least one antihyperlipidemic agent and / or at least one CSF-1R antagonist before, during, and / or after administration of the DA neurons.
[0177] Administration of antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 10 mg / day to 1000 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 50 mg / day to 500 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 60 mg / day to 200 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 500 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 200 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 100 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate or pexidartinib is 50 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate is about 10 mg to about 200 mg. In some embodiments, the therapeutically effective amount of fenofibrate is about 10 mg to about 200 mg in the form of an immediate-release tablet. In some embodiments, the therapeutically effective amount of fenofibrate is about 10 mg to about 200 mg of fenofibrate in the form of a single matrix tablet. In some embodiments, fenofibrate or pexidartinib is administered at a sub-therapeutic dose. In some embodiments, fenofibrate or pexidartinib is administered at a therapeutic dose.
[0178] In some embodiments, the therapeutically effective amount of fenofibrate is 10 mg / day to 1000 mg / day, and the therapeutically effective amount of pexidartinib is 10 mg / day to 1000 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate is 10 mg / day to 1000 mg / day, and the therapeutically effective amount of pexidartinib is 10 mg / day to 50 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate is 10 mg / day to 1000 mg / day, and the therapeutically effective amount of pexidartinib is 50 mg / day to 1000 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate is 10 mg / day to 50 mg / day, and the therapeutically effective amount of pexidartinib is 10 mg / day to 1000 mg / day. In some embodiments, the therapeutically effective amount of fenofibrate is 500 mg / day to 1000 mg / day and the therapeutically effective amount of pexidartinib is 10 mg / day to 1000 mg / day.
[0179] In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is administered both in vitro and in vivo. When administered in vitro, the antihyperlipidemic agent and / or CSF-1R antagonist contacts cells to be transplanted. When administered in vivo, the antihyperlipidemic agent and / or CSF-1R antagonist contacts transplanted cells, endogenous cells, or both.
[0180] In some embodiments, current modes of administration of the antihyperlipidemic agent and / or CSF-1R antagonist (e.g., daily administration, twice daily administration, either in vitro, in vivo, or both) are used. Many varying patterns of administration of the antihyperlipidemic agent and / or CSF-1R antagonist can be used based on the specific disease or injury and the cell type being used in the cell therapy.
[0181] In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered continuously. In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered intermittently, i.e., administered for a first period of time, stopped, and then administered for a second period of time. In some embodiments, the antihyperlipidemic agent is administered continuously and the CSF-1R antagonist is delivered intermittently. In some embodiments, the CSF-1R antagonist is administered continuously and the antihyperlipidemic agent is delivered intermittently.
[0182] Aspects and embodiments of the methods disclosed herein can be further understood by reference to the following numbered paragraphs:
[0183] Paragraph 1. A method of enhancing cell therapy, comprising administering to a patient a therapeutically effective amount of fenofibrate.
[0184] Paragraph 2. A method of improving cell therapy, comprising administering to a patient a therapeutically effective amount of at least one antihyperlipidemic agent.
[0185] Paragraph 3. A method of improving cell therapy, comprising administering to a patient a therapeutically effective amount of pexidartinib.
[0186] Paragraph 4. A method of improving cell therapy, comprising administering to a patient a therapeutically effective amount of at least one CSF-1R antagonist.
[0187] Paragraph 5. The method of any of the preceding paragraphs, wherein the administration occurs before cell therapy, during cell therapy, after cell therapy, and combinations thereof.
[0188] Paragraph 6. A method of improving cell therapy comprising administering to a patient a therapeutically effective amount of fenofibrate, and / or pexidartinib, but not chlorofibrate, benzafibrate, and / or fenofibric acid.
[0189] Implantation site The implantation site is selected so that the implanted cells will regenerate the damaged tissue, for example, by directly growing the damaged or degenerating tissue or by supporting the growth or proliferation of endogenous cells.
[0190] In some embodiments, the target region of the brain (implantation site) may be the entire brain or a specific region of the brain, including, but not limited to, an area associated with a particular cognitive or motor function, an area exhibiting neurodegeneration, the cortex, and / or an area affected by trauma. The subject may have cognitive or motor dysfunction, such as from neurodegeneration, or the subject may be normal.
[0191] Cell delivery Stem cells can be delivered by a number of routes, including direct injection, catheter-based approaches, intravascular administration, stereotactic guided delivery, and the like.
[0192] In some embodiments, improved engraftment caused by treating a patient with an antihyperlipidemic agent or a CSF-1R antagonist is manifested as increased viability of the transplanted cells. In some embodiments, increased viability is advantageous because the cells reside in disease-affected tissue and, therefore, can exhibit one or more post-cell death signals. In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist improves the viability of transplanted cells by increasing the cells' resistance to apoptotic factors. In some embodiments, anti-apoptotic pathways are upregulated in the transplanted cells. While not the only factor to consider, in some embodiments, improved cell viability is particularly important, as replacement of damaged or diseased cells is most effective when the replacement cells have a high chance of survival.
[0193] In some embodiments, increased proliferation results in a substantially larger population of stem cells that can functionally replace (partially or completely) damaged or diseased cells in the host. For example, in some embodiments, administering a small population of neural progenitor cells to an individual with Parkinson's disease (e.g., by stereotactic delivery of the cells to a targeted region of the brain) and co-administering an antihyperlipidemic drug and / or a CSF-1R antagonist induces proliferation of neural progenitor cells to an extent that compensates for the aphasia or loss of motor control associated with Parkinson's disease. In some embodiments, treating a patient with an antihyperlipidemic drug and / or a CSF-1R antagonist can increase proliferation of endogenous stem cells and enhance the effects of the exogenously delivered cells. In some embodiments, the dose of the antihyperlipidemic agent and / or CSF-1R antagonist is individualized to produce a desired proliferative growth curve (e.g., decreasing the frequency and / or intensity of the antihyperlipidemic agent and / or CSF-1R antagonist over time to reduce the proliferative stimulus), thus avoiding uncontrolled proliferation of either endogenous cells or the administered cells (or other cells receiving the antihyperlipidemic agent and / or CSF-1R antagonist).
[0194] In some embodiments, treating a patient with an antihyperlipidemic drug and / or a CSF-1R antagonist improves the migration of transplanted cells. In some embodiments, chemoattractant signals present in the target tissue guide the migration (internally or externally) of cells to a desired location. In some embodiments, the antihyperlipidemic drug and / or CSF-1R antagonist enhances the response of transplanted cells to such signals, thereby allowing the cells to more rapidly relocate to the desired location. Once relocated to the desired location, in some embodiments, the additional effect of the antihyperlipidemic drug and / or CSF-1R antagonist described herein allows the cells to more quickly or efficiently provide a therapeutic benefit (e.g., provide a function lost due to injury or disease). In some embodiments, chemorepulsive signals move transplanted cells away from undesired locations. In some embodiments, a combination of chemoattractant and chemorepulsive signals work in concert to direct transplanted cells to the desired location. In some embodiments, the chemoattractant and / or chemorepulsive signals are also administered exogenously. In some such embodiments, a series of injections of the chemoattractant compound are preformed into the target tissue to generate a signal gradient to which the administered cells respond. After administration, the cells migrate along this gradient, thereby remaining in the desired location.
[0195] In some embodiments, the engraftment of transplanted cells is improved by administering a lipid-lowering drug and / or a CSF-1R antagonist to the patient. As discussed above, this can be particularly advantageous in certain therapeutic applications, such as cell therapy directed at target tissues that experience shear flow, contraction, or other forces that may expel cells. For example, in some embodiments, the lipid-lowering drug and / or CSF-1R antagonist and DA neurons are administered, resulting in improved engraftment (compared to progenitor cells alone). This is particularly advantageous because blood flow through the brain can wash administered cells away from the target organ. Furthermore, the constant contraction of microglia can expel administered cells. Therefore, increased engraftment of administered cells increases the efficacy of the therapy by retaining a greater number of cells at the target site.
[0196] Cell Function In some embodiments, stem cell function is improved by administering an antihyperlipidemic agent and / or a CSF-1R antagonist to the patient. In some embodiments, the function of administered progenitor cells (or endogenous stem cells) is improved by treating the patient (before, concurrently with, and after engraftment) with an antihyperlipidemic agent and / or a CSF-1R antagonist. For example, an antihyperlipidemic agent and / or a CSF-1R antagonist can promote increased firing of neurons (derived from neural progenitors). Similarly, in some embodiments, increased neurotransmitter release results. In some embodiments, changes in cell biology (e.g., increased or decreased axonal transport) occur that are beneficial to neuronal function.
[0197] In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist positively affects the administered cells, which are themselves improved by one or more of the methods described herein. In some embodiments, the effect of the antihyperlipidemic agent and / or CSF-1R antagonist on the transplanted cells results in a cascade of beneficial effects on cells of damaged or diseased host tissue. For example, in some embodiments, treating a patient with an antihyperlipidemic agent and / or CSF-1R antagonist (before, concurrently with, and after engraftment) induces the release of post-survival paracrine factors (e.g., growth factors, immunosuppressive molecules) from progenitor cells, thereby improving the survival of damaged or diseased host tissue. Thus, in some embodiments, the characteristics of progenitor cells are improved, thereby improving cell therapy. In some embodiments, progenitor cells treated with an antihyperlipidemic drug and / or a CSF-1R antagonist become a source of signals that improve damaged or diseased host tissue (e.g., the cells are a vehicle for a beneficial effect rather than directly producing the effect).
[0198] In some embodiments, progenitor cells are responsive to the in vivo environment into which they are transplanted. For example, tissue injury or disease is often associated with various signaling cascades that ultimately determine the outcome of a subset of cells (or the entire tissue). In some embodiments, the administered cells detect injury, disease, and / or inflammatory signals in the target tissue and then respond to the environment of the injury, disease, and / or inflammatory signals in the target tissue. In some embodiments, certain characteristics of the administered cells (as described above) favorably shift the balance for the administered cells and / or cells of the host tissue, such as contraction with antihyperlipidemic drugs and / or CSF-1R antagonists before or after delivery. For example, MSCs respond to the pro-inflammatory environment in damaged tissues by releasing anti-inflammatory cytokines, altering T cell function, and / or altering monocyte maturation. Thus, MSCs can be particularly beneficial in allogeneic transplant tissues. Also, in some embodiments, other progenitor cell types have similar environmental responsive characteristics. Such cells, capable of responding to local signals, generate counteracting local and / or paracrine signals, effectively altering the local environment in a beneficial manner (e.g., pro-survival or regeneration of function), and are used in some embodiments. In some embodiments, a combination of these mechanisms is provided. As discussed, such cells are particularly advantageous in allogeneic transplants, although in some embodiments, they are used in autologous cell transplants. Pluripotent cells as used herein can be autologous, syngeneic, or allogeneic related (matched siblings or haploidentical family members), or derived from an unrelated, fully mismatched source.
[0199] In some embodiments, a method of treating injury or disease in the central nervous system in a mammal or human is provided, comprising delivering an effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to an in vitro culture containing stem cells (e.g., stem cells, induced pluripotent cells, genetically modified adult cells, adult cells, etc.) and implanting the cells into the central nervous system of the mammal or human.
[0200] In some embodiments, treatment of a patient involves implanting progenitor cells into the patient's central nervous system ("CNS"). After implantation, the progenitor cells differentiate to form one or more cell types of the central nervous system. The implanted cells can serve any of a variety of purposes, including replacing cells or tissues that have been irreparably damaged; repairing portions of the CNS; or improving production of important CNS neurochemicals, such as dopamine, seratonin, endogenous opioid peptides, and the like. The implantation of progenitor cells can be performed alone or in combination with methods of improving nervous system function, as described herein. For example, the progenitor cells can be treated with a single therapeutic agent or multiple therapeutic agents in combination with an antihyperlipidemic agent and / or a CSF-1R antagonist before, during, after, or a combination thereof. For example, the additional agent may be selected from the group consisting of a pharmaceutical compound, a cytokine, a growth factor, a neurotransmitter, a hormone, a trophic factor, a transcription factor, a monoclonal antibody, a polyclonal antibody, or a signal transduction molecule, hi some embodiments, a single agent, or a combination of agents, may have a stimulatory or mobilizing effect on progenitor cells.
[0201] Antihyperlipidemic and / or CSF-1R Antagonist Treatment Protocol In certain embodiments, the patient is treated by identifying multiple (e.g., at least about 10) treatment sites within the patient's brain or other target tissue, administering at least one of multiple cells (stem cells, precursor cells, progenitor cells, DA neurons, or a combination thereof) to each of the treatment sites, and administering to the patient (before, during, after, or a combination thereof) an antihyperlipidemic agent and / or a CSF-1R antagonist. In some embodiments, the cells are treated with the antihyperlipidemic agent and / or CSF-1R antagonist before administration to the patient. In some embodiments, the cells are treated with the antihyperlipidemic agent and / or CSF-1R antagonist before implantation and one or more times after implantation.
[0202] In some embodiments, a single treatment site is treated with cells. In some embodiments, the treatment site is selected from the group consisting of heart, lung, liver, pancreas, kidney, spleen, intestine, bone, bone marrow, teeth / gums, skeletal or smooth muscle, skin, or a combination thereof. Each of the treatment sites can be treated with stem cells, precursor cells, progenitor cells, or DA neurons.
[0203] Figure 1 is a flowchart of an exemplary method disclosed herein. As shown in Figure 1, the general method involves differentiating (110) stem cells (101) into a progenitor cell population (102) and transplanting (103) the differentiated cell population. At each step, there are optional steps indicated by dashed lines. The stem cells can be contacted with an antilipidemic drug and / or a CSF-1R antagonist (104), the differentiated cells can be contacted with an antilipidemic drug and / or a CSF-1R antagonist (105), the DA neurons can be contacted with an antilipidemic drug and / or a CSF-1R antagonist (106), the transplanted DA neurons can be contacted with an antilipidemic drug and / or a CSF-1R antagonist (108), or a combination thereof. Administration of the cells can occur prior to treating the patient with the antihyperlipidemic drug and / or CSF-1R antagonist (e.g., before 107), while treating the patient with the antihyperlipidemic drug and / or CSF-1R antagonist (e.g., before 108), after treating the patient with the antihyperlipidemic drug and / or CSF-1R antagonist (e.g., before 109), or combinations thereof. In some embodiments, treating the patient with the antihyperlipidemic drug and / or CSF-1R antagonist and / or cell delivery occurs multiple times during a treatment regimen. As noted above, although not shown in FIG. 1, in some embodiments, similar methods are used to treat other tissues.
[0204] In some embodiments, treatment can be terminated after a certain treatment period, while in other embodiments, treatment can be repeated for at least 2 treatment periods, at least 5 treatment periods, at least 10 treatment periods, at least 50 treatment periods, or at least 100 treatment periods. In some embodiments, treatment can be terminated after a certain treatment period, while in other embodiments, treatment can be repeated for at least 10 treatment periods. The time between subsequent treatment periods is preferably at least about 5 minutes, at least about 1-2 days, at least about 1 week, at least about 2 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 6 months, or at least about 1 year. The length of treatment time and frequency of treatment periods can depend on several factors, including the patient's functional recovery and the results of the patient's imaging analysis. In certain embodiments, one or more treatment parameters can be adjusted in response to feedback signals from a patient monitoring device (e.g., magnetic resonance imaging). As used herein, treatment refers to combination therapy.
[0205] In addition to combining cell therapy with treatment of patients with antihyperlipidemic drugs and / or CSF-1R antagonists, certain embodiments combine other types of treatments for improved therapeutic effects. Treatment can include administering cells to a target region of the brain and simultaneously applying an electromagnetic field to the brain. A similar approach can be used to treat other target tissues. In such embodiments, the electromagnetic field has an effective electric field strength, as described in U.S. Pat. No. 6,042,531 (issued to Holcomb), which is incorporated herein by reference in its entirety. In certain embodiments, the electromagnetic field comprises a magnetic field, while in other embodiments, the electromagnetic field comprises a radiofrequency (RF) magnetic field. As another example, treatment can include administering DA cells to a target region of the patient's brain and simultaneously applying an effective amount of ultrasound energy to the brain. Such systems can include ultrasound treatment systems, such as those described in U.S. Pat. No. 5,054,470 (issued to Fry et al.), which is incorporated herein by reference in its entirety.
[0206] Investigating the efficacy of antihyperlipidemic drugs and / or CSF-1R antagonists, and cell therapy Depending on the disease or injury being treated by administering an antihyperlipidemic agent and / or a CSF-1R antagonist to a patient in combination with cell therapy, various endpoints can be used to assess the effectiveness of the therapy. For example, a nervous system function scale can be used to quantify or otherwise characterize the effectiveness of various embodiments described herein. A nervous system function scale typically uses a number of levels or points, with each point corresponding to an aspect of the patient's condition. The number of points a patient receives can be used to quantify the patient's condition, and improvement in the patient's condition can be represented by a change in the number of points. One example of a nervous system function scale used as a clinical tool for diagnosing and measuring the severity of Parkinson's disease is the Unified Parkinson's Disease Rating Scale (UPDRS), which includes various sections assessed by interview and clinical observation. In certain embodiments, two or more of the nervous system function scales can be used in combination with each other to provide a measure of effectiveness over a longer period of time (e.g., three months).
[0207] In certain embodiments described herein, a patient exhibiting symptoms of Parkinson's disease is treated by administering an antihyperlipidemic drug and / or a CSF-1R antagonist to the patient and administering DA neurons to the patient's brain, which is expected to produce a mean difference of at least 2% between the treatment group and the placebo group in at least one nervous system function scale (e.g., UPDRS), analyzed dichotomously or in any other manner. In certain other embodiments, a mean difference of at least 4%, at least 6%, or at least 10% is produced between the treatment group and the placebo group in at least one nervous system function scale, analyzed dichotomously or in any other manner. In certain embodiments, treatment by administering an antihyperlipidemic drug and / or a CSF-1R antagonist to the patient and administering DA neurons to the patient's brain produces a change in the patient's condition. In certain such embodiments, the change in the patient's condition corresponds to a change in the number of points indicating the patient's condition. In certain such embodiments, treatment produces a one point change, a two point change, a three point change, or a four or more point change on a nervous system function scale.
[0208] Aspects and embodiments of the methods disclosed herein can be further understood by reference to the following numbered paragraphs:
[0209] Paragraph 1. A method for improving the suitability of cells for use in neuronal cell therapy, comprising:
[0210] delivering an antihyperlipidemic agent and / or a CSF-1R antagonist to a mammal;
[0211] delivering cells to said mammal; A method comprising:
[0212] Paragraph 2. The method of any of the preceding paragraphs, wherein the cell is a DA neuron.
[0213] Paragraph 3. The method of any of the preceding paragraphs, wherein the cells are derived from a group of stem cell sources including adult stem cells, embryonic stem cells, placenta-derived stem cells, bone marrow-derived stem cells, mesenchymal stem cells, adipose stem cells, and induced pluripotent stem cells.
[0214] Paragraph 4. The method of any of the preceding paragraphs, wherein the cells are for use in cell therapy to treat a neurological disease or injury.
[0215] Paragraph 5. The method of Paragraph 4, wherein the neurological disease or injury is selected from the group consisting of Parkinson's disease, Alzheimer's disease, Huntington's disease, dopaminergic dysfunction, depression, stroke, head trauma, neurodegeneration, and dementia.
[0216] Paragraph 6. The method of any of the preceding paragraphs, wherein delivering the antihyperlipidemic agent and / or CSF-1R antagonist to the mammal occurs before, during, and after the administering step.
[0217] Paragraph 7. The method of any of the preceding paragraphs, wherein the cells are treated with an antihyperlipidemic agent and / or a CSF-1R antagonist prior to the administering step.
[0218] Paragraph 8. The method of Paragraph 3, wherein said stem cells are treated with an antihyperlipidemic agent and / or a CSF-1R antagonist prior to differentiation into stem cells.
[0219] Paragraph 9. The method of any of the preceding paragraphs, wherein the cells are administered to a defective tissue.
[0220] Paragraph 10. The method of any of the preceding paragraphs, wherein the cells are administered to healthy tissue.
[0221] Paragraph 11. The method of any of the preceding paragraphs, wherein the cells are stem cells, precursor cells, or progenitor cells.
[0222] Paragraph 12. The method of any of the preceding paragraphs, wherein the cells are neural, brain, heart, liver, bone, or muscle progenitor cells.
[0223] Paragraph 13. The method of any of the preceding paragraphs, wherein delivering the antihyperlipidemic agent and / or the CSF-1R antagonist to the mammal occurs before the administering step.
[0224] Paragraph 14. The method of any of the preceding paragraphs, wherein delivering an antihyperlipidemic agent and / or a CSF-1R antagonist to the mammal occurs during the administering step.
[0225] Paragraph 15. The method of any of the preceding paragraphs, wherein delivering the antihyperlipidemic agent and / or the CSF-1R antagonist to the mammal occurs after the administering step.
[0226] Paragraph 16. The method of any of the preceding paragraphs, wherein the cells include stem cells, precursor cells, and progenitor cells.
[0227] Paragraph 17. The method of any of the preceding paragraphs, wherein the cells include stem and progenitor cells.
[0228] Paragraph 18. The method of any of the preceding paragraphs, wherein the cells include stem cells and DA neurons.
[0229] Paragraph 19. The method of any of the preceding paragraphs, wherein the cells are treated with an antihyperlipidemic agent and / or a CSF-1R antagonist after the administering step.
[0230] Paragraph 20. The method of any of the preceding paragraphs, wherein the cells are treated with the antihyperlipidemic agent for a first period of time and with the CSF-1R antagonist for a second period of time, the first period of time being shorter than the second period of time.
[0231] Paragraph 21. The method of any of the preceding paragraphs, wherein the cells are treated with an antihyperlipidemic agent for a first period of time and with a CSF-1R antagonist for a second period of time, the first period of time being longer than the second period of time.
[0232] Paragraph 22. The method of any of the preceding paragraphs, wherein the cells are not treated with chlorofibrate, benzafibrate, and / or fenofibric acid.
[0233] Cell differentiation method In some embodiments, treating patients with Parkinson's disease and other primary and secondary parkinsonian disorders involves implanting progenitor cells into the patient's brain. As discussed herein, the patient can be pre-treated with an antihyperlipidemic drug and / or a CSF-1R antagonist, or can be treated after implantation, or can be treated during transplantation, or a combination thereof. After implantation, the progenitor cells differentiate to form one or more brain cell types. In some embodiments, the cells functionally replace damaged brain cells in the patient, thereby restoring brain function (partially or fully). In some embodiments, the progenitor cells are seeded and expanded in vitro in cell culture while exposed to an antihyperlipidemic drug and / or a CSF-1R antagonist before, during, after differentiation from stem cells, or a combination thereof.
[0234] In some embodiments, the DA neurons and the antihyperlipidemic drug and / or CSF-1R antagonist are selected for delivery to the cells by applying them directly to the cell culture medium in vitro, without transport through intervening body tissues. The concentration of the antihyperlipidemic drug and / or CSF-1R antagonist is generally below that used for patient treatment. In some embodiments, the treated cells are transplanted after treatment. In other embodiments, at least some of the treated cells remain in culture to maintain the cell line for subsequent use. In some embodiments, the concentration of the antihyperlipidemic drug for in vitro culture is about 0.2 μM to about 4 μM, about 0.2 μM to about 8 μM, about 0.2 μM to about 16 μM, about 0.2 μM to about 50 μM, about 0.2 μM to about 100 μM, or any range variable thereof. In some embodiments, the concentration of the CSF-1R antagonist agent for in vitro culture is about 0.2 μM to about 4 μM, about 0.2 μM to about 8 μM, about 0.2 μM to about 16 μM, about 0.2 μM to about 50 μM, about 0.2 μM to about 100 μM, or any range variable thereof. In some embodiments, the concentration of fenofibrate for in vitro culture is about 0.2 μM to about 4 μM, about 0.2 μM to about 8 μM, about 0.2 μM to about 16 μM, about 0.2 μM to about 50 μM, about 0.2 μM to about 100 μM, or any range variable thereof. In some embodiments, the concentration of the pexidartinib agent for in vitro culture is about 0.2 μM to about 4 μM, about 0.2 μM to about 8 μM, about 0.2 μM to about 16 μM, about 0.2 μM to about 50 μM, about 0.2 μM to about 100 μM, or any range variable thereof. In some embodiments, the concentration of pexidartinib for in vitro culture is less than the concentration of fenofibrate. In some embodiments, the concentration of fenofibrate for in vitro culture is less than the concentration of pexidartinib. In some embodiments, the concentrations of fenofibrate and pexidartinib are the same. In some embodiments, the exposure of cells (stem cells, progenitor cells, or progenitor cells) to pexidartinib is longer than the exposure to fenofibrate.In some embodiments, the exposure of the cells (stem, progenitor, or progenitor cells) to fenofibrate is longer than the exposure to pexidartinib, hi some embodiments, the exposure of the cells (stem, progenitor, or progenitor cells) to fenofibrate is the same as the exposure to pexidartinib.
[0235] After in vitro treatment of the cells with an antihyperlipidemic agent and / or a CSF-1R antagonist, the cells are transplanted or implanted into a recipient site in a patient. In some embodiments, treatment prior to transplantation or implantation includes culturing sufficient cells for implantation. The recipient site can be an injured, diseased, or defective site, or can be an area of relatively healthy tissue. In some embodiments, the recipient site and / or the area surrounding such a site is treated with DA neurons and an antihyperlipidemic agent and / or a CSF-1R antagonist according to the methods described above before and / or after implantation to improve the rate at which the implanted cells integrate with surrounding cells at the recipient site.
[0236] Disclosed are methods of improving the efficacy of one or more cell populations by contacting the cells with an antihyperlipidemic drug and / or a CSF-1R antagonist.
[0237] Disclosed are methods for improving the engraftment efficiency of one or more DA neuronal populations by contacting the DA neuronal cells with an antihyperlipidemic agent and / or a CSF-1R antagonist. In some embodiments, the DA neuronal cells are derived from one of a variety of stem cell sources, including adult stem cells, embryonic stem cells, placenta-derived stem cells, bone marrow-derived stem cells, mesenchymal stem cells, adipose stem cells, and induced pluripotent stem cells. In some embodiments, the DA neuronal cells are derived from neural stem cells. In other embodiments, the DA neuronal cells are differentiated in vivo after administration to a cell therapy subject. In some embodiments, the in vitro differentiation is not complete (e.g., the cells are not terminally differentiated), but the lineage remains.
[0238] In some embodiments, the administered cells are autologous to the recipient. In other embodiments, the administered cells are allogeneic to the recipient. In some embodiments, the administered DA neurons are autologous to the recipient. In other embodiments, the administered DA neurons are allogeneic to the recipient. In one embodiment, mesenchymal stem cells are used in allogeneic transplants due to the cells' ability to regulate immune responses in the target tissue. In one embodiment, the DA neurons have altered T cell or antigen-presenting cell function, thereby reducing immune rejection of the transplanted cells. In one embodiment, the DA neurons also reduce fibrosis in the target tissue.
[0239] In some embodiments, the DA neurons are for use in cell therapy to treat neurological diseases or injuries. For example, in some embodiments, the dysfunctional tissue is neural tissue that has become dysfunctional due to a degenerative neurological disease. In some embodiments, the DA neurons are administered to a subject to treat Parkinson's disease or other primary and secondary parkinsonian disorders. In some embodiments, other degenerative diseases, such as dopaminergic dysfunction, Alzheimer's disease, amyotrophic lateral sclerosis, Huntington's disease, and / or dementia, are treated. In some embodiments, the dysfunctional neural function is the result of damage to neurons.
[0240] In one embodiment, DA neurons are used to treat damage caused by stroke, hi one embodiment, physical trauma such as cerebral ischemia (including focal cerebral ischemia), traumatic brain injury, and / or disruptive or compressive damage in the CNS, including disruptive or compressive damage to the brain, spinal cord, nerves, or retina.
[0241] As is well known in the art, modified or unmodified pluripotent cells can be differentiated to become midbrain DA neurons. In some embodiments, the midbrain DA neuron cell population differentiated from modified or unmodified pluripotent cells comprises three cell populations: A9 dopamine neurons, astrocytes, and vascular leptomeningeal cells (VLMCs). In some embodiments, the pluripotent cells are differentiated using the mono-SMAD or dual-SMAD methods disclosed herein. In some embodiments, the pluripotent cells are differentiated using mono-SMAD, dual-SMAD, or other approaches. In some embodiments, after the unmodified pluripotent cells have differentiated into unmodified midbrain DA neurons, the unmodified midbrain DA neurons are incubated with an antihyperlipidemic drug and / or a CSF-1R antagonist. In some embodiments, after the modified pluripotent cells have differentiated into modified midbrain DA neurons, the modified midbrain DA neurons are incubated with an antihyperlipidemic drug and / or a CSF-1R antagonist.
[0242] Treatment of stem cells with antihyperlipidemic drugs and / or CSF-1R antagonists In one embodiment, the method further comprises the step of applying an antihyperlipidemic agent and / or a CSF-1R antagonist to the stem cells prior to differentiation.
[0243] In some embodiments, a method of treating central nervous system injury or disease in a mammal or human is provided, comprising delivering an effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to an in vitro culture containing stem cells, differentiating the treated stem cells into DA neurons, and implanting the DA neurons into the central nervous system of the mammal or human.
[0244] Treatment of differentiated cells with antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, a method of treating injury or disease in the central nervous system in a mammal or human is provided, comprising delivering an effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to an in vitro culture containing stem cells, differentiating the treated stem cells into DA neurons while providing the effective amount of the antihyperlipidemic agent and / or CSF-1R antagonist to the differentiating cells, and implanting the DA neurons into the central nervous system of the mammal or human.
[0245] Treatment of progenitor cells with antihyperlipidemic drugs and / or CSF-1R antagonists In some embodiments, a method of treating central nervous system injury or disease in a mammal or human is provided, comprising delivering an effective amount of an antihyperlipidemic agent and / or a CSF-1R antagonist to an in vitro culture containing progenitor cells and implanting the treated cells into the central nervous system of the mammal or human.
[0246] Methods of treating patients with progenitor cells contacted with an antihyperlipidemic drug and / or a CSF-1R antagonist In some embodiments, methods of treating the central nervous system of a patient are provided. The methods include identifying a patient exhibiting symptoms of damage to the central nervous system. The method further includes contacting an in vitro culture containing the cells with an antihyperlipidemic agent and / or a CSF-1R antagonist. The method further includes implanting the treated cells into the central nervous system of the patient. In some embodiments, the cells are stem cells. In some embodiments, the cells are progenitor cells. In some embodiments, the cells are DA neurons.
[0247] In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered to the DA neuron in vitro, while in some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered to the DA neuron in vivo (e.g., after administering the cells to a subject).
[0248] In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered orally to a patient and delivered to DA neurons in vitro. In some embodiments, the antihyperlipidemic agent and / or CSF-1R antagonist is delivered orally to a patient and delivered to DA neurons in vitro and in vivo.
[0249] Treatment method Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with an antihyperlipidemic agent and / or a CSF-1R antagonist.
[0250]
[0001] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with an antihyperlipidemic drug or a CSF-1R antagonist.
[0002] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with an antihyperlipidemic drug.
[0003] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate.
[0004] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate. Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with a CSF-1R antagonist.Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with pexidartinib.
[0251] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with an antihyperlipidemic drug and a CSF-1R antagonist. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate and a CSF-1R antagonist. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate and a CSF-1R antagonist. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate and pexidartinib.Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons in combination with treating the subject with fenofibrate and pexidartinib.
[0252] In one embodiment, a method of engrafting cells in vivo for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons; ii) an antihyperlipidemic drug or a CSF-1R antagonist; and iii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of engrafting cells in vivo for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons; ii) and an antihyperlipidemic drug and a CSF-1R antagonist; and iii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons; ii) and fenofibrate and pexidartinib; and iii) a subject exhibiting at least one neurological symptom; b) treating the subject with an antihyperlipidemic drug or a CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuron function. In one embodiment, the neurological symptom is selected from the group consisting of tremor, bradykinesia (very slow movements), flexed posture, postural instability, and rigidity. In one embodiment, the subject exhibits a decline in the neurological symptom. In one embodiment, the population of midbrain dopamine (DA) neurons is derived from a cell population selected from the group including primates and humans. In one embodiment, the human cells are derived from a patient with symptoms of Parkinson's disease (PD).
[0253] Treatment with recombinant DA neurons Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising genetically modified DA neurons. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising genetically modified DA neurons in combination with an antihyperlipidemic agent and a CSF-1R antagonist.
[0254]
[0001] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with an antihyperlipidemic drug or a CSF-1R antagonist.
[0002] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with an antihyperlipidemic drug. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased in combination with fenofibrate.Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased in combination with fenofibrate.
[0014] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with a CSF-1R antagonist.
[0015] Provided are methods for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with pexidartinib.
[0255]
[0001] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with an antihyperlipidemic drug and a CSF-1R antagonist.
[0002] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with fenofibrate and a CSF-1R antagonist.
[0001] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with fenofibrate and a CSF-1R antagonist.
[0002] Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising DA neurons that are miR-155-3p-biased or miR-155-5p-biased, in combination with fenofibrate and pexidartinib. Provided is a method for treating a brain disease or disorder in a subject in need thereof, the method comprising administering to the subject a therapeutically effective amount of an isolated cell population comprising miR-155-3p-biased or miR-155-5p-biased DA neurons in combination with fenofibrate and pexidartinib.
[0256] In some embodiments, the isolated population of miR-155-3p-biased or miR-155-5p-biased cells are A9 dopamine neurons. In some embodiments, the isolated population of miR-155-3p-biased or miR-155-5p-biased cells are astrocytes. In some embodiments, the isolated population of miR-155-3p-biased or miR-155-5p-biased cells are VLMCs.
[0257] In one embodiment, a method of engrafting cells in vivo for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-5p is expressed more than miR-155-3p; ii) an antihyperlipidemic drug or a CSF-1R antagonist; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-5p is expressed more than miR-155-3p; ii) an antihyperlipidemic drug and a CSF-1R antagonist; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-5p is expressed more than miR-155-3p; ii) fenofibrate and pexidartinib; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with an antihyperlipidemic drug or a CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function.
[0258] In one embodiment, a method of engrafting cells in vivo for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-3p is expressed more than miR-155-5p; ii) an antihyperlipidemic drug or a CSF-1R antagonist; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of engrafting cells in vivo for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-3p is expressed more than miR-155-5p; ii) an antihyperlipidemic drug and a CSF-1R antagonist; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with the antihyperlipidemic drug or the CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function. In one embodiment, a method of in vivo cell engraftment for therapeutic treatment is provided, comprising: a) providing i) a population of midbrain dopamine (DA) neurons in which miR-155-3p is expressed more than miR-155-5p; ii) fenofibrate and pexidartinib; and ii) a subject exhibiting at least one neurological symptom; b) treating the subject with an antihyperlipidemic drug or a CSF-1R antagonist; and c) transplanting the midbrain dopamine (DA) neurons into the subject under conditions that allow in vivo engraftment and confer dopamine (DA) neuronal function.
[0259] In one aspect, disclosed are in vitro cell populations having unique molecular profiles in that the microRNA (miR or miRNA) and / or miRNA profile of the cell populations comprises more miR-155-3p compared to miR-155-5p, or more modified miR-155-3p compared to unmodified miR-155-3p, or more miR-155-5p compared to miR-155-3p, or more modified miR-155-5p compared to unmodified miR-155-5p. In one aspect, the in vitro cell composition comprises, alternatively consists essentially of, or additionally consists of 1 fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 fold or more, 10 fold or more, 11 fold or more, 12 fold or more, 13 fold or more, 14 fold or more, 15 fold or more, 16 fold or more, 20 fold or more, 30 fold or more, 40 fold or more, 50 fold or more, 50 fold or more, 70 fold or more, 80 fold or more, 90 fold or more, 95 fold or more, or 99 fold or more more miR-155-3p than miR-155-5p. In one aspect, the in vitro cell composition comprises, alternatively consists essentially of, or additionally consists of 1 fold or more, 2 fold or more, 3 fold or more, 4 fold or more, 5 fold or more, 6 fold or more, 7 fold or more, 8 fold or more, 9 fold or more, 10 fold or more, 11 fold or more, 12 fold or more, 13 fold or more, 14 fold or more, 15 fold or more, 16 fold or more, 20 fold or more, 30 fold or more, 40 fold or more, 50 fold or more, 50 fold or more, 70 fold or more, 80 fold or more, 90 fold or more, 95 fold or more, or 99 fold or more more miR-155-5p than miR-155-3p.
[0260] In a further embodiment, the cell population of the above-described composition is identified by a microRNA (miR) profile by a lack of upregulation of miR-155-5p relative to miR-155-3p. In a further embodiment, the cell population of the above-described composition is identified by a microRNA (miR) profile by a lack of upregulation of miR-155-3p relative to miR-155-5p.
[0261] The combination therapy is useful for implementing one or more of the following methods in a subject in need thereof: a) inhibiting the progression of Parkinson's disease or a related disorder, b) preventing Parkinson's disease or a related disorder, or c) treating Parkinson's disease or a related disorder. The method comprises, or alternatively consists essentially of, or additionally consists of, administering to the subject an effective amount of an antihyperlipidemic agent or a CSF-1R antagonist described above together with a therapeutically effective amount of DA neurons.
[0262] Therapy and patient health can be monitored by measuring the level of inflammatory response during and after therapy.
[0263] Also provided herein are isolated or purified cell populations isolated from bodily fluids (e.g., urine, saliva, lymph, breast milk, serum, and / or plasma) of disease-free subjects or differentiated from iPSCs. In one aspect, the cell populations have a unique molecular profile in that the microRNA (miR) profile within the cell population comprises upregulation of miR-155-3p, or upregulation of miR-155-3p relative to miR-155-5p, or upregulation of miR-155-3p relative to wild-type.
[0264] Also provided herein are isolated or purified cell populations isolated from bodily fluids (e.g., urine, saliva, lymph, breast milk, serum, and / or plasma) of disease-free subjects or differentiated from iPSCs. In one aspect, the cell populations have a unique molecular profile in that the microRNA (miR) profile within the cell population comprises upregulation of miR-155-5p, or upregulation of miR-155-5p relative to miR-155-3p, or upregulation of miR-155-5p relative to wild-type.
[0265] composition Non-recombinant DA neuronal population Provided herein are purified or isolated cell populations and a therapeutically effective amount of an antihyperlipidemic agent or a CSF-1R antagonist. Provided herein are purified or isolated cell populations and a therapeutically effective amount of an antihyperlipidemic agent. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate. Provided herein are purified or isolated cell populations and a therapeutically effective amount of a CSF-1R antagonist. Provided herein are purified or isolated cell populations and a therapeutically effective amount of pexidartinib. In some embodiments, the purified or isolated cell population comprises, consists essentially of, or consists of DA neurons. In some embodiments, the purified or isolated cell population is differentiated from pluripotent cells.
[0266] Provided herein are purified or isolated cell populations and a therapeutically effective amount of an antihyperlipidemic agent and a CSF-1R antagonist. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate and a CSF-1R antagonist. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate and a CSF-1R antagonist. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate and pexidartinib. Provided herein are purified or isolated cell populations and a therapeutically effective amount of fenofibrate and pexidartinib. In some embodiments, the purified or isolated cell populations comprise, consist essentially of, or consist of DA neurons. In some embodiments, the purified or isolated cell populations are differentiated from pluripotent cells.
[0267] Paragraph 1. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of an antihyperlipidemic agent and DA neurons.
[0268] Paragraph 2. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate and DA neurons.
[0269] Paragraph 3. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate and DA neurons.
[0270] Paragraph 4. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of an antihyperlipidemic drug and DA neurons.
[0271] Paragraph 5. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate and DA neurons.
[0272] Paragraph 6. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate and DA neurons.
[0273] Paragraph 7. The composition of any of the preceding paragraphs, wherein the composition does not include any of the formulas and compounds of WO2014145051A1, U.S. Patent Publication No. 20170081326A1, and U.S. Patent No. 10,717,735.
[0274] Paragraph 8. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one pharmaceutically acceptable carrier.
[0275] Paragraph 9. The composition of any of the preceding paragraphs, wherein said composition further comprises at least one additional therapeutic agent.
[0276] Paragraph 10. The composition of any of the preceding paragraphs, wherein said composition further comprises a CSF-1R antagonist.
[0277] Paragraph 11. A kit comprising the composition of any of the preceding paragraphs.
[0278] Paragraph 12. A composition according to any of the preceding paragraphs, comprising a pharmaceutically acceptable salt according to Paragraphs 1-10.
[0279] Paragraph 13. The composition of any of the preceding paragraphs, wherein the DA neurons are genetically modified.
[0280] Paragraph 14. The composition of any of the preceding paragraphs, wherein the DA neuronal cells are miR-155-3p biased or miR-155-5p biased.
[0281] Paragraph 15. A composition for improving cell therapy in a subject, the composition comprising a therapeutically effective amount of fenofibrate and DA neurons, the composition being free of chlorofibrate, benzafibrate, and / or fenofibric acid.
[0282] Recombinant DA neuronal population Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of an antihyperlipidemic agent or a CSF-1R antagonist. Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of an antihyperlipidemic agent. Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of fenofibrate. Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of fenofibrate. Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of a CSF-1R antagonist. Provided herein are a purified or isolated genetically modified cell population and a therapeutically effective amount of pexidartinib. In some embodiments, the purified or isolated genetically modified cell population comprises, consists essentially of, or consists of DA neurons. In some embodiments, the purified or isolated genetically modified cell population is differentiated from pluripotent cells.
[0283] Provided herein are purified or isolated recombinant cell populations and therapeutically effective amounts of an antihyperlipidemic agent and a CSF-1R antagonist. Provided herein are purified or isolated recombinant cell populations and therapeutically effective amounts of fenofibrate and a CSF-1R antagonist. Provided herein are purified or isolated recombinant cell populations and therapeutically effective amounts of fenofibrate and a CSF-1R antagonist. Provided herein are purified or isolated recombinant cell populations and therapeutically effective amounts of fenofibrate and pexidartinib. Provided herein are purified or isolated recombinant cell populations and therapeutically effective amounts of fenofibrate and pexidartinib. In some embodiments, the purified or isolated recombinant cell populations comprise, consist essentially of, or consist of DA neurons. In some embodiments, the purified or isolated genetically engineered cell population is differentiated from pluripotent cells. In some embodiments, a DA neuron having a modified premiR-155. In some embodiments, a DA neuron having a modified pre-miR-155 having SEQ ID NO: 6. In some embodiments, a DA neuron having a modified pre-miR-155 having SEQ ID NO: 7. In some embodiments, a DA neuron having a modified pre-miR-155 stem loop having SEQ ID NO: 8. In some embodiments, a DA neuron having a modified pre-miR-155 having SEQ ID NO: 6 and SEQ ID NO: 7. In some embodiments, a DA neuron having a pre-miR-155 stem loop having SEQ ID NO: 6, SEQ ID NO: 7; and SEQ ID NO: 8. In some embodiments, a DA neuron having a modified pre-miR-155 having SEQ ID NO: 6 and a pre-miR-155 stem loop having SEQ ID NO: 8. In some embodiments, a DA neuron having a modified pre-miR-155 having SEQ ID NO: 7 and a pre-miR-155 stem loop having SEQ ID NO: 8. SEQ ID NOs: 6-8 can be used to generate miR-155-3p-biased or miR-155-5p-biased DA neurons.In some embodiments, a DA neuron has a modified pre-miR-155 having SEQ ID NO:7 and a pre-miR-155 stem-loop having SEQ ID NO:8. SEQ ID NOs:6-8 can be used to generate DA neurons that are miR-155-3p biased or miR-155-5p unbiased. In some embodiments, DA neurons with modified pre-miR-155 favor miR-155-3p strand selection. In some embodiments, DA neurons with modified pre-miR-155 favor miR-155-5p strand selection. In some embodiments, DA neurons with modified pre-miR-155 decrease miR-155-5p strand selection. In some embodiments, DA neurons with modified pre-miR-155 decrease miR-155-5p strand selection. In some embodiments, DA neurons with modified pre-miR-155, which favors miR-155-3p strand selection and reduces miR-155-5p strand selection.
[0284] In certain embodiments, pre-miRNA-155 sequences are disclosed, and pre-miRNA-155 incorporated into DA neurons has an anti-inflammatory effect in a human subject. In certain embodiments, pre-miRNA-155 sequences are disclosed, and pre-miRNA-155 incorporated into DA neurons has a pro-inflammatory effect in a human subject.
[0285] These compositions are useful in the treatment of diseases such as nervous system diseases and related disorders.
[0286] In some embodiments described herein, the cell populations are differentiated using a mono-SMAD or dual-SMAD method.
[0287] Sequence number SEQ ID NO: 1: Human hsa-miR-15 5-5p MIMAT0000646
[0288] UUAAUGCUAAUCGUGAUAGGGGUU
[0289] SEQ ID NO: 2: Mouse miR-15 5-5p MIMAT0000646
[0290] UUAAUGCUAAUUGUGAUAGGGGUU
[0291] SEQ ID NO: 3: Human hsa-miR-155-3p MIMAT0004658
[0292] CUCCUACAUAUUAGCAUUAACA
[0293] SEQ ID NO: 4: Mouse-miR-155-3p MIMAT0004658
[0294] CUCCUACCUGUUAGCAUUAACA
[0295] SEQ ID NO: 5: hsa-miR-155 stem loop MI0000681
[0296] CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG
[0297] SEQ ID NO: 6: modified hsa-miR-155-5p
[0298] GGAAUGCUAAUCGUGAUAGGGGUU
[0299] SEQ ID NO: 7: modified hsa-miR-155-3p
[0300] UUCCUACAUAUUAGCAUUAACA
[0301] SEQ ID NO: 8: Modified hsa-miR-155 stem loop
[0302] CUGUUAAUGCUAAUCGUGAUAGGGAUUUUUGCCUCCAACUGAUUCCUACAUAUUAGCAUUAACAG
[0303] SEQ ID NO: 9: miR-155-3p isomiR
[0304] 3'-ACC**UACGAUUAUACAUCCUC
[0305] SEQ ID NO: 10: miR-155-3p isomiR
[0306] 3'-*CAAUUACGAUUAUACAUCCU*
[0307] SEQ ID NO: 11: miR-155-3p isomiR
[0308] 3'-ACAAUUACGAUUAUACAUCCU*
[0309] SEQ ID NO: 12: miR-155-3p isomiR
[0310] 3'-***ACUACGAUUAUACAUCCUC
[0311] SEQ ID NO: 13: miR-155-3p isomiR
[0312] 3'-**AAUUACGAUUAUACAUCCU*
[0313] SEQ ID NO: 14: miR-155-3p isomiR
[0314] 3'-***AUUACGAUUAUACAUCCUC
[0315] SEQ ID NO: 15: miR-155-3p isomiR
[0316] 3'-******ACGAUUAUACAUCCUCA
[0317] SEQ ID NO: 16: miR-155-3p isomiR
[0318] 3'-******ACGAUUAUACAUCCUCAG
[0319] SEQ ID NO: 17: miR-155-3p isomiR
[0320] 3'-*CAA*UACGAUUAUACAUCCUC
[0321] SEQ ID NO: 18: miR-155-3p isomiR
[0322] 3'-***AUUACGAUUAUACAUCCUC A
[0323] SEQ ID NO: 19: miR-155-3p isomiR
[0324] 3'-***CUUACGAUUAUACAUCCUC
[0325] SEQ ID NO: 20: miR-15 5-3p isomiR
[0326] 3'-ACAAUUACGAUUAUACAU****
[0327] SEQ ID NO: 21: miR-155-3p isomiR
[0328] 3'-****UUACGAUUAUACAUCCUC
[0329] All *'s in the sequence listing represent deletions.
[0330] DA neuron population In some embodiments, the DA neuronal cell populations described herein comprise three distinct cell populations: (1) A9 dopamine neurons, (2) astrocytes, and (3) vascular leptomeningeal cells (VLMCs).
[0331] Disclosed is a neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and an antihyperlipidemic drug or a CSF-1R antagonist.A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and an antihyperlipidemic drug.A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate.A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate.A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and a CSF-1R antagonist. A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and pexidartinib.
[0332] The neural cell population comprises, consists essentially of, or consists of A9 dopamine neurons, astrocytes, or VLMCs, and an antihyperlipidemic drug and a CSF-1R antagonist. The neural cell population comprises, consists essentially of, or consists of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate and a CSF-1R antagonist. The neural cell population comprises, consists essentially of, or consists of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate and a CSF-1R antagonist. The neural cell population comprises, consists essentially of, or consists of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate and a CSF-1R antagonist. The neural cell population comprises, consists essentially of, or consists of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate and pexidartinib. A neural cell population comprising, consisting essentially of, or consisting of A9 dopamine neurons, astrocytes, or VLMCs, and fenofibrate and pexidartinib.
[0333] Pharmaceutical Composition The present disclosure also provides pharmaceutical compositions comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of an antihyperlipidemic agent or a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of an antihyperlipidemic agent.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of pexidartinib. In some embodiments, the cells differentiated from the pluripotent cells are recombinant DA neurons. In some embodiments, the cells differentiated from the pluripotent cells are non-recombinant DA neurons.
[0334] A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of an antihyperlipidemic agent and a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate and a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate and a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate and a CSF-1R antagonist.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate and pexidartinib.A pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of a pharmaceutically acceptable carrier and an effective amount of fenofibrate and pexidartinib. In some embodiments, the cells differentiated from the pluripotent cells are recombinant DA neurons. In some embodiments, the cells differentiated from the pluripotent cells are non-recombinant DA neurons.
[0335] The compositions can be administered orally, parenterally (e.g., intramuscularly, intraperitoneally, intravenously, ICV, intracisternal injection or infusion, subcutaneous injection, or engraftment), by inhalation spray, nasally, vaginally, rectally, sublingually, urethrally (e.g., urethral suppository), or topically (e.g., gel, ointment, cream, aerosol, etc.), and can be formulated alone or in a suitable unit dosage form containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, excipients, and vehicles appropriate for each administration route. Non-limiting examples of carriers include phosphate-buffered saline (PBS), saline, or a biocompatible matrix material. The compositions can contain protease inhibitors, glycerol, and / or dimethyl sulfoxide (DMSO).
[0336] The pharmaceutical compositions can be conveniently presented in unit dosage form and can be prepared by any of the methods well known in the art of pharmacy. In the pharmaceutical composition, the active compound is contained in an amount sufficient to produce the desired therapeutic effect. For example, the pharmaceutical compositions (antihyperlipidemic agents or CSF-1R antagonists) of the present disclosure can be in a form suitable for virtually any mode of administration, including, for example, topical, ocular, oral, buccal, systemic, nasal, injectable, transdermal, rectal, and vaginal, or in a form suitable for administration by inhalation or inhalation.
[0337] Systemic formulations include those designed for administration by injection (e.g., subcutaneous, intravenous, intramuscular, intrathecal, or intraperitoneal injection), as well as those designed for transdermal, transmucosal, oral, or pulmonary administration.
[0338] The compositions are generally used in an amount effective to achieve the intended result, for example, an amount effective to treat or prevent the particular condition being treated. Compounds can be administered therapeutically to achieve a therapeutic effect, or prophylactically to achieve a prophylactic effect. A therapeutic effect refers to the eradication or amelioration of the underlying disorder being treated and / or the eradication or amelioration of one or more symptoms associated with the underlying disorder, such that the patient reports an improvement in feeling or condition, although the patient may still be affected by the underlying disorder. A therapeutic effect also includes halting or slowing the progression of the disease, regardless of whether an improvement is achieved.
[0339] The amount of compound administered will depend on various factors, including, for example, the specific condition being treated, the method of administration, the severity of the condition being treated, the age and weight of the patient, and the bioavailability of the particular active compound. Determining an effective dose is well within the capabilities of one of ordinary skill in the art. As known to those skilled in the art, the preferred dose of the compounds of the present disclosure will also depend on the age, weight, general health, and severity of the condition being treated of the individual. When administered by inhalation, the dose may also need to be individualized to the individual's gender and / or lung capacity. The dose and frequency of administration of the composition will also depend on whether the composition is formulated to treat an acute episode of the condition or for the prophylactic treatment of the disorder. A skilled practitioner will be able to determine the optimal dose for a particular individual.
[0340] For prophylactic administration, the compound can be administered to patients who are at risk of developing one of the above-mentioned conditions.For example, if a patient is allergic to a particular drug, the compound can be administered before the drug is administered to avoid or reduce the allergic reaction to the drug.Alternatively, prophylactic administration can be applied to prevent the onset of symptoms in patients who have been diagnosed with the underlying disorder.
[0341] Effective doses can be initially estimated from in vitro assays. For example, initial doses for use in animals can be formulated to achieve therapeutic concentrations and / or doses of miR-155-3p-biased or miR-155-5p-biased cell compositions as measured in in vitro assays. Calculation of doses to achieve such effective doses for other animal models or human patients is well within the capabilities of one of ordinary skill in the art. For guidance, the reader is referred to Fingi & Woodbury, "General Principles," in: Goodman and Gilman's The Pharmaceutical Basis of Therapeutics, Chapter 1, pp. 1-446, latest edition (Pergamagon Press), and the references cited therein.
[0342] The initial dose can also be estimated from in vivo data, such as animal models. Animal models useful for testing the efficacy of compounds for treating or preventing the various diseases mentioned above are well known in the art. Those skilled in the art can routinely adapt such information to determine appropriate doses for human administration.
[0343] Doses typically range from about 0.0001 or 0.001 or 0.01 mg / kg / day to about 1000 mg / kg / day, but can be higher or lower depending on, among other factors, the activity of the composition, bioavailability, method of administration, and various factors discussed above. Doses and intervals can be individually adjusted to provide local and / or systemic concentrations of the cell population sufficient to maintain therapeutic or prophylactic effect. For example, compositions can be administered once per week, several times per week (e.g., every other day), once per day, or multiple times per day, depending, among other things, on the method of administration, the specific indication being treated, and the judgment of the prescribing physician. One of skill in the art will be able to optimize an effective local dose without undue experimentation.
[0344] Preferably, the compound(s) provide therapeutic or prophylactic benefit without causing substantial toxicity. Compound toxicity can be measured using standard pharmaceutical procedures. The dose ratio between toxicity and therapeutic (or prophylactic) benefit is the therapeutic index. Compositions that exhibit a high therapeutic index are preferred.
[0345] Aspects and embodiments of the methods disclosed herein can be further understood by reference to the following numbered paragraphs:
[0346] Paragraph 1: A method for improving cell engraftment in a mammal, the method comprising treating the mammal with an antihyperlipidemic agent.
[0347] Paragraph 2: A method for improving cell engraftment in a mammal, the method comprising treating the mammal with fenofibrate.
[0348] Paragraph 3: A method for improving cell engraftment in a mammal, the method comprising treating the mammal with fenofibrate.
[0349] Paragraph 4: A method of improving cell engraftment in a mammal, the method comprising treating the mammal with a CSF-1R antagonist.
[0350] Paragraph 5: A method for improving cell engraftment in a mammal, the method comprising treating the mammal with pexidartinib.
[0351] Paragraph 6: A method for improving cell engraftment in a mammal, the method comprising treating said mammal with an antihyperlipidemic agent and a CSF-1R antagonist.
[0352] Paragraph 7: A method of improving cell engraftment in a mammal, comprising treating said mammal with fenofibrate and a CSF-1R antagonist.
[0353] Paragraph 8: A method of improving cell engraftment in a mammal, comprising treating said mammal with fenofibrate and a CSF-1R antagonist.
[0354] Paragraph 9: A method of improving cell engraftment in a mammal, comprising treating said mammal with fenofibrate and pexidartinib.
[0355] Paragraph 10: A method of improving cell engraftment in a mammal, comprising treating said mammal with fenofibrate and pexidartinib.
[0356] Paragraph 11: The method of any of the preceding paragraphs, further comprising administering viable cells to the patient.
[0357] Paragraph 12: The method of any of the preceding paragraphs, further comprising administering to the patient living DA neurons.
[0358] Paragraph 13: The method according to Paragraph 12, wherein the DA neuronal cells are contacted with an antihyperlipidemic drug and / or a CSF-1R antagonist before engraftment.
[0359] Paragraph 14: The method of any of the preceding paragraphs, further comprising administering to the patient implanted DA neurons and implanted pluripotent cells.
[0360] Paragraph 15: The method of any of the preceding paragraphs, further comprising administering viable cells to the patient, wherein said cells are administered to healthy tissue.
[0361] Paragraph 16: The method of any of Paragraphs 1 to 15, further comprising administering viable cells to the patient, wherein the cells are administered to non-healthy tissue.
[0362] Paragraph 17: The method of any of the preceding paragraphs, further comprising administering viable cells to the patient, wherein said cells are administered to the brain of the mammal.
[0363] Paragraph 18: A method for improving cell engraftment in a mammal, comprising treating the mammal with fenofibrate and pexidartinib, but not with chlorofibrate, benzafibrate, and / or fenofibric acid.
[0364] Pharmaceutical composition + non-recombinant cells The present disclosure also provides pharmaceutical compositions comprising, consisting essentially of, or further consisting of a purified or isolated DA neuron population and an antihyperlipidemic drug and / or a CSF-1R antagonist. In one aspect, the pharmaceutical composition comprises, alternatively consists essentially of, or further consists of a pharmaceutically acceptable carrier and an effective amount of a DA neuron population and an antihyperlipidemic drug and / or a CSF-1R antagonist.
[0365] Pharmaceutical composition + recombinant cells The present disclosure also provides pharmaceutical compositions comprising, consisting essentially of, or further consisting of purified or isolated miR-155-3p-biased or miR-155-5p-biased DA cell populations and an antihyperlipidemic drug and / or a CSF-1R antagonist. In one embodiment, the pharmaceutical composition comprises, alternatively, consists essentially of, or further consists of a pharmaceutically acceptable carrier and an effective amount of the miR-155-3p-biased or miR-155-5p-biased DA cell populations and an antihyperlipidemic drug and / or a CSF-1R antagonist.
[0366] Non-limiting examples of carriers include phosphate buffered saline (PBS), saline, or a biocompatible matrix material such as a collagen matrix. The composition may contain a protease inhibitor, glycerol, and / or dimethyl sulfoxide (DMSO). Pharmaceutically acceptable carriers include one or more of a biocompatible matrix or a liquid carrier. The pharmaceutical compositions of the present disclosure can be formulated for freeze-drying or lyophilization using methods well known in the art.
[0367] The pharmaceutical composition is intended for in vitro and in vivo use and may comprise a miR-155-3p-biased DA cell population or a miR-155-5p-biased DA cell population at a concentration of about 1 mg / mL to about 10 mg / mL, or alternatively, about 1 to about 8 mg / mL, or alternatively, about 2 to about 8 mg / mL, or alternatively, about 2 to about 5 mg / mL, or about 2 to 4 mg / mL, or alternatively, 3 mg / mL to 20 mg / mL. In the methods provided herein, an effective amount of a miR-155-3p-biased DA cell population or a miR-155-5p-biased DA cell population is administered that, when administered to a subject, causes an efficacy of at least about 5%, or alternatively at least about 10%, or alternatively at least about 20%, or alternatively at least about 30%, or alternatively at least about 40%, or alternatively at least about 50%, or alternatively at least about 60%, or alternatively at least about 70%, or alternatively at least about 80%, or alternatively at least about 85%, or alternatively at least about 90%, or alternatively at least about 95%, or alternatively at least about 99% compared to a control that does not receive the composition. Comparative efficacy can be measured by suitable in vitro or in vivo methods known in the art and briefly exemplified herein.
[0368] In one aspect, the composition is a pharmaceutical formulation for use in the therapeutic methods of the present disclosure and for treating an appropriate or related disease. Although the examples are written for the treatment of PD, the principles can be applied to other conditions, including nervous system disorders.
[0369] In a further aspect, the present disclosure provides a pharmaceutical composition comprising, alternatively consisting essentially of, or further consisting of, an isolated or purified miR-155-3p-biased or miR-155-5p-biased DA cell population at a concentration such that the composition comprises at least 75%, or alternatively at least 80%, or alternatively at least 85%, or alternatively at least 90%, or alternatively at least 95%, or alternatively at least 97%, or alternatively at least 98%, or alternatively at least 99% of the cells in the total composition, and an antihyperlipidemic agent and / or a CSF-IR antagonist.
[0370] A cell population can be selected such that greater than about 50% (alternatively, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or even greater than about 95%) of the cells express at least one, at least two, at least three, at least four, or at least five DA neuron markers, including, but not limited to, FOXA2, LMX1A, NURR1, TH, OTX2, Tujl, TTF3, PITX3, ASCL, EBF-1, EBF-3, TTR, DAT, Kir3.2 / GIRK2, CD 142, DC SMI, CD63, and CD99.
[0371] Isolated cell populations obtained according to the methods described herein are typically non-homogeneous, although homogeneous cell populations are also contemplated.
[0372] According to certain embodiments, the cell population is genetically engineered to express an exogenous miRNA or a polynucleotide agent capable of downregulating the miRNA. In some embodiments, the recombinant miRNA comprises SEQ ID NO: 6, 7, or 8. In some embodiments, the recombinant miRNA comprises recombinant miR-155-3p or miR-155-5p in the pluripotent cell population.
[0373] A cell population can be selected such that greater than about 50% (alternatively, greater than about 60%, greater than about 70%, greater than about 80%, greater than about 90%, or even greater than about 95%) of the cells harbor a recombinant miRNA, such as miR-155-3p or miR-155-5p.
[0374] Isolation of specific subpopulations of cells can be performed using techniques known in the art, including fluorescence activated cell sorting and / or magnetic separation of cells.
[0375] The cell population can contain DA neurons or DA neuron phenotypes, including cell size, cell shape, organelle size, and organelle number. These structural phenotypes can be analyzed using microscopic techniques (e.g., scanning electron microscopy). To aid in the analysis, antibodies or dyes can be used to highlight characteristic traits.
[0376] In some embodiments, the present disclosure provides compositions comprising, consisting of, or consisting essentially of at least one antihyperlipidemic agent and / or at least one CSF-1R antagonist and one or more other therapeutic agents, including, but not limited to, adozelesin, altretamine, bendamustine, bizelesin, busulfan, carboplatin, carboquone, carmofur, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, estramustine, etoglucide, fotemustine, hepsulfam, ifosfamide, improsulfan, irofulven, lomustine, mannosulfan, mechlorethamine, melphalan, mitoxanthin, thiazolinone ... Alkylating agents, including but not limited to, bronitrile, nedaplatin, nimustine, oxaliplatin, piposulfan, prednimustine, procarbazine, ranimustine, satraplatin, semustine, streptozocin, temozolomide, thiotepa, treosulfan, triaziquone, triethylenemelamine, triplatin tetranitrate, trofosfamide, and umamustine; Antibiotics, including but not limited to elsamitrucin, epirubicin, idarubicin, menogaril, mitomycin, neocarzinostatin, pentostatin, pirarubicin, plicamycin, valrubicin, and zorubicin; aminopterin, azacitidine, azathioprine, capecitabine, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fludarabine, 5-fluorouracil, gemcitabine, hydroxyurea, mercaptopurine, methotrexate antimetabolites, including but not limited to, cefotaxime, nelarabine, pemetrexed, raltitrexed, tegafur-uracil, thioguanine, trimethoprim, trimetrexate, and vidarabine; immunotherapies, including but not limited to alemtuzumab, bevacizumab, cetuximab, galiximab, gemtuzumab, panitumumab, pertuzumab, rituximab, brentuximab, tositumomab, trastuzumab, 90Y ibritumomab tiuxetan, ipilimumab, tremelimumab, and anti-CTLA-4 antibodies;antibody therapy; hormones or hormone antagonists, including but not limited to, anastrozole, androgens, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin, idoxifene, letrozole, leuprolide, magestrol, raloxifene, tamoxifen, and toremifene; 287, taxanes, including larotaxel, ortataxel, paclitaxel, DHA-paclitaxel, and tesetaxel; retinoids, including but not limited to alitretinoin, bexarotene, fenretinide, isotretinoin, and tretinoin; alkaloids, including but not limited to demecolcine, homoharringtonine, vinblastine, vincristine, vindesine, vinflunine, and vinorelbine; and steroids, including but not limited to AE-941 (GW786034, Neovastat), ABT- antiangiogenic agents, including but not limited to amsacrine, belotecan, edotecarin, etoposide, etoposide phosphate, exatecan, irinotecan (activated metabolite SN-38 (also 7-ethyl-10-hydroxy-camptothecin)), lucanthone, mitoxantrone, pixantrone, rubitecan, teniposide, topotecan, and 9-aminocamptothecin; kinase inhibitors, including but not limited to, dasatinib (BMS 354825), erlotinib, gefitinib, flavopiridol, imatinib mesylate, lapatinib, motesanib diphosphate (AMG 706), nilotinib (AMN107), seliciclib, sorafenib, sunitinib malate, AEE-788, BMS-599626, UCN-01 (7-hydroxystaurosporine), vemurafenib, dabrafenib, selumetinib, LGX818, BGB-283, and vatalanib; targeted signal transduction inhibitors, including but not limited to, bortezomib, geldanamycin, and rapamycin; imiquimod, interferon-α,and interleukin-2; and biological response modifiers, including, but not limited to, 3-AP (3-amino-2-carboxaldehyde thiosemicarbazone), altrasentan, aminoglutethimide, anagrelide, asparaginase, bryostatin, cilengitide, elesclomol, eribulin mesylate (E5389), ixabepilone, lonidamine, masoprocol, mitoguanazone, oblimersen, sulindac, testolactone, tiazofurin, mT Selected from other chemotherapies including OR inhibitors (e.g., sirolimus, temsirolimus, everolimus, deforolimus), PI3K inhibitors (e.g., BEZ235, GDC-0941, XL147, XL765, BMK120), Cdk4 inhibitors (e.g., PD-332991), Akt inhibitors, Hsp90 inhibitors (e.g., geldanamycin, radicicol, tanespimycin), farnesyltransferase inhibitors (e.g., tipifarnib), and aromatase inhibitors (anastrozole, letrozole, exemestane). In one embodiment, a method of treating cancer involves administering to a subject an effective amount of a composition comprising any one or more compounds of Formula (I) or (II); or a pharmaceutically acceptable salt, solvate, tautomer, isomer, or deuterated analogue of Formula (I) or (II); or any of the compounds set forth in Table I, in combination with a chemotherapeutic agent selected from capecitabine, 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide, vinblastine, bevacizumab, cetuximab, interferon-α, interleukin-2, or erlotinib. In another embodiment, the chemotherapeutic agent is a Mek inhibitor. Exemplary Mek inhibitors include, but are not limited to, AS703026, AZD6244 (selumetinib), AZD8330, BIX 02188, CI-1040 (PD184352), GSK1120212 (JTP-74057), PD0325901, PD318088, PD98059, RDEA119 (BAY 869766), TAK-733, and U0126-EtOH.The chemotherapeutic agent is a tyrosine kinase inhibitor. Exemplary tyrosine kinase inhibitors include AEE788, AG-1478 (tyrphostin AG-1478), AG-490, apatinib (YN968D1), AV-412, AV-951 (tivozanib), axitinib, AZD8931, BIBF1120 (valgatef), BIBW2992 (afatinib), BMS794833, BMS-599626, brivanib (BMS-540215), brivanib alanine (BMS-5 82664), cediranib (AZD2171), chrysophanic acid (chrysophanol), crenolanib (CP-868569), CUDC-101, CYC116, dovitinib dinitrate (TKI258 dinitrate), E7080, erlotinib hydrochloride (Tarceva, CP-358774, OSI-774, NSC-718781), foretinib (GSK1363089, XL880), gefitinib (ZD-1839 or Iressa), imatinib (Gleevec), imatinib mesylate, KI8751, KRN 633, lapatinib (Tykerb), linifanib (ABT-869), masitinib (Macivet, AB 1010), MGCD-265, motesanib (AMG-706), MP-470, mubritinib (TAK 165), neratinib (HKI-272), NVP-BHG712, OSI-420 (desmethylerlotinib, CP-473420), OSI-930, pazopanib HCl, PD-153035 HCl, PD173074, pelitinib (EKB-569), PF299804, ponatinib (AP24534), PP121, RAF265 (CHIR-265), Raf265 derivatives, regorafenib (BAY 73-4506), sorafenib tosylate (Nexavar), sunitinib malate (Sutent), telatinib (BAY 57-9352), TSU-68 (SU6668), vandetanib (Zactima), vatalanib dihydrochloride (PTK787), WZ3146, WZ4002, WZ8040, quizartinib, cabozantinib, XL647, EGFR siRNA, FLT4 siRNA, KDR siRNA, metformin, and other antidiabetic drugs, as well as DPP4 inhibitors (sitagliptin, vildagliptin, saxagliptin, dutogliptin, gemigliptin,In another embodiment, the agent is an EGFR inhibitor. Exemplary EGFR inhibitors include, but are not limited to, AEE-788, AP-26113, BIBW-2992 (Tovok), CI-1033, GW-572016, Iressa, LY2874455, RO-5323441, Tarceva (erlotinib, OSI-774), CUDC-101, and WZ4002. In another embodiment, the therapeutic agent for the combination is a c-Fms and / or c-Kit inhibitor, as described in U.S. Patent Application Publication Nos. 2009 / 0076046 and 2011 / 0112127, which are incorporated by reference in their entireties for all purposes. In one embodiment, a method of treating cancer involves administering to a subject an effective amount of a composition comprising any one or more compounds described herein in combination with a chemotherapeutic agent selected from capecitabine, 5-fluorouracil, carboplatin, dacarbazine, gefitinib, oxaliplatin, paclitaxel, SN-38, temozolomide, vinblastine, bevacizumab, cetuximab, interferon-α, interleukin-2, or erlotinib. In some embodiments, the present disclosure provides a composition comprising, consisting of, or consisting essentially of an antihyperlipidemic agent and / or a CSF-1R antagonist, one or more other therapeutic agents, and DA neurons.
[0377] Disclosed are DA neuronal populations comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist, wherein the DA neuronal population is a genetically modified cell population. Disclosed are DA neuronal populations comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist, wherein the level of miR-155-3p (5'CUCCUACAUAUUAGCAUUAACA3') (SEQ ID NO: 3) or a variant thereof is increased or decreased compared to the wild-type. Disclosed are DA neuronal populations comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist, wherein the level of miR-155-5p (5'GGAAUGCUAAUCGUGAUAGGGGUU3') (SEQ ID NO: 6) or a variant thereof is increased or decreased compared to the wild-type. A DA neuronal population comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist, wherein the level of miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') (SEQ ID NO: 1) or a variant thereof is increased or decreased compared to miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3') (SEQ ID NO: 7). A DA neuronal population comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist, wherein the level of miR-155-3p (5'UUCCUACAUAUUAGCAUUAACA3') (SEQ ID NO: 7) or a variant thereof is increased or decreased compared to miR-155-5p (5'UUAAUGCUAAUCGUGAUAGGGGUU3') (SEQ ID NO: 1).
[0378] Disclosed are compositions comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist and an in vitro cell population, wherein a majority of the cells are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-5p-modified midbrain dopamine (DA) neurons. Disclosed are compositions comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist and an in vitro cell population, wherein a majority of the cells are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-5p-modified or miR-155-3p-modified midbrain dopamine (DA) neurons. Disclosed are compositions comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist and an in vitro cell population, wherein a majority of the cells are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-3p-biased midbrain dopamine (DA) neurons. Disclosed are compositions comprising, consisting essentially of, or consisting of an antihyperlipidemic drug and / or a CSF-1R antagonist and an in vitro cell population, wherein a majority of the cells are tyrosine hydroxylase (TH), forkhead box protein A2 (FOXA2), LIM homeobox transcription factor 1, alpha (LMX1A), floor plate miR-155-5p-biased midbrain dopamine (DA) neurons.
[0379] Isolation of pluripotent cells Embryonic stem cells in some embodiments can be obtained using well-known cell culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from in vivo pre-implanted human embryos or in vitro fertilized (IVF) embryos. Alternatively, single-cell human embryos can be expanded to the blastocyst stage. For isolation from human ES cells, the zona pellucida is removed from the blastocyst, and the inner cell mass (ICM) is isolated by immunosurgery, in which trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting. The ICM is then plated in tissue culture flasks containing an appropriate medium to allow proliferation. After 9-15 days, the expanded ICM is dissociated into clumps by either mechanical dissociation or enzymatic digestion, and the cells are then replated in fresh tissue culture medium. Colonies exhibiting undifferentiated morphology are individually selected with a micropipette, mechanically dissociated into clumps, and replated. The resulting ES cells are then routinely divided every 4 to 7 days. For further details regarding methods for preparing human ES cells, see U.S. Patent No. 5,843,780 (Thomson et al.); Science 282:1145, 1998; Curr. Top. Dev. Biol. 38:133, 1998; Proc. Natl. Acad. Sci. USA 92:7844, 1995; Bongso et al., Hum Reprod 4:706, 30 1989; and Gardner et al., Fertil. Steril. 69:84, 1998.
[0380] It will be appreciated that commercially available stem cells can also be used. Human ES cells are available for purchase from the NIH Human Embryonic Stem Cell Registry (www.escr.nih.gov). Non-limiting examples of commercially available embryonic stem cells are BGO1, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, and TE32.
[0381] Furthermore, ES cells have been used in mouse (Mills and Bradley, 2001), golden hamster (Doetschman et al., 1988, Dev Biol. 127:224-7), rat (lannaccone et al., 1994, Dev Biol. 163:288-92), rabbit (Giles et al. 1993, Mol Reprod Dev. 36:130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36:424-33), and several livestock species (Notarianni et al., 1991, J Reprod Fertil Suppl. 43:255-60; Wheeler 1994, Reprod Fertil Dev. 6:563-8; Mitalipova et al. al., 2001, Cloning. 3:59-67), as well as from other species, including non-human primate species (rhesus monkeys and marmosets) (Thomson et al., 1995, Proc Natl Acad Sci USA. 92:7844-8; Thomson et al., 1996, Biol Reprod. 55:254-9).
[0382] Induced pluripotent stem cells (iPS) (embryonic-like stem cells) can be generated from somatic cells, such as fibroblasts, hepatocytes, and gastric epithelial cells, by genetic manipulation of the somatic cells, e.g., by retroviral transduction of transcription factors such as Oct-3 / 4, Sox2, c-Myc, and KLF4 into the somatic cells (Yamanaka S, Cell Stem Cell. 2007, 1(1):3 9-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 February 14. (Epub ahead of print); IH Park, Zhao R, West JA, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008; 451:141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human (Fibroblasts by defined factors. Cell 2007;131:861-872). Other embryonic-like stem cells can be generated by nuclear transfer into oocytes, fusion with embryonic stem cells, or, once the recipient cell has stopped mitosis, nuclear transfer into a zygote.
[0383] As used herein, pluripotent cells (hES or iPSC) can be autologous, syngeneic, or allogeneic related (matched siblings or haploidentical family members), or derived from an unrelated, fully mismatched source.
[0384] Pluripotent cell culture Pluripotent cell culture can be carried out in any medium known in the art that supports pluripotent cells. Methods for preparing and culturing pluripotent stem cells, such as ES cells, can be found in standard textbooks and reviews in cell biology, tissue culture, and embryology, including teratocarcinoma and embryonic stem cells: Guide to Techniques in Mouse Development (1993); Embryonic Stem Cell Differentiation in Vitro (1993); Properties and Uses of Embryonic Stem Cells: Prospects for Application to Human Biology and Gene Therapy (1998) (all of which are incorporated herein by reference). Standard methods used in tissue culture are described in Animal Cell Culture (1987); Gene Transfer Vectors for Mammalian Cells (1987); and Current Protocols in Molecular Biology and Short Protocols in Molecular Biology (1987 & 1995).
[0385] As described above, cultured pluripotent cells can be engineered. The cultured recombinant pluripotent cells contain at least one recombinant miRNA, such as pre-mir155-5p or pre-mir155-3p. The cultured recombinant pluripotent cells contain at least one recombinant miRNA, such as pre-mir155-5p or pre-mir155-3p, to induce differentiation into miR-155-3p-biased or miR-155-5p-biased DA neurons. The cultured recombinant pluripotent cells contain at least one recombinant miRNA, such as pre-mir155-5p or pre-mir155-3p, to induce differentiation into miR-155-3p-biased and / or miR-155-5p-unbiased DA neurons.
[0386] Differentiation method Another aspect of the present disclosure relates to cultures of recombinant or non-recombinant midbrain dopaminergic (DA) neurons generated from pluripotent cells and an antihyperlipidemic drug and / or a CSF-1R antagonist by the mono-SMAD or dual-SMAD method described above. The culture medium can further be contained in a container means. The neurons can be contained in a pharmaceutical product, such as a pharmaceutical product formulated for injection into a host being treated with an antihyperlipidemic drug and / or a CSF-1R antagonist.
[0387] The differentiation state of the pluripotent cells may be monitored during or after the differentiation step. Cell differentiation can be measured upon examination of cell or tissue-specific markers known to indicate differentiation.
[0388] The following are markers that can be used to confirm differentiation into DA neurons: FOXA2 or LMX1. Additional markers include TH, thodenticle homeobox 2 (OTX2), nuclear receptor-related 1 protein (NURR1), neuron-specific class III beta-tubulin (Tujl), TTF3, paired-like homeodomain 3 (PITX3), achaete-scute complex (ASCL), early B-cell factor 1 (EBF-1), early B-cell factor 3 (EBF-3), transthyretin (TTR), synapsin, dopamine transporter (DAT), G-protein-coupled inwardly rectifying potassium channel (Kir3.2 / GIRK2), CD142, DCSM1, CD63, and CD99.
[0389] Tissue / cell-specific markers can be detected using immunological techniques well known in the art (Thomson JA et al., (1998). Science 282:1145-7). Examples include, but are not limited to, flow cytometry for membrane-bound markers, immunohistochemistry for extracellular and intracellular markers, and enzyme immunoassays for secreted molecular markers.
[0390] It will be appreciated that the cells obtained according to the methods described herein can be enriched for particular cell types, e.g., progenitor or mature cell types. Thus, for example, differentiation times can be selected to obtain early progenitor or late mature cell types.
[0391] We disclose a method for using microRNAs to differentiate pluripotent cells into neural progenitor cells and DA neurons ex vivo.
[0392] Numerous methods for differentiating pluripotent cells into DA neurons are known in the art, including genetic modification and / or culture in a medium that promotes differentiation to that fate. The medium typically contains at least one activator of Sonic Hedgehog (SHH) signaling and at least one activator of Wingless (Wnt) signaling. Typically, differentiation is performed in serum-free medium or serum substitutes.
[0393] The present disclosure relates to the field of stem cell biology, particularly the lineage-specific differentiation of pluripotent or multipotent stem cells, which may include, but are not limited to, non-embryonic induced pluripotent stem cells (iPSCs), as well as human embryonic stem cells (hESCs), somitic stem cells, stem cells derived from patients with disease, or any other cells capable of lineage-specific differentiation. Specifically described are methods for directing the lineage-specific differentiation of hESCs and / or iPSCs into floor-plate mesencephalic progenitor cells, and then further into a larger population of mesencephalic-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons using novel culture conditions. The mesencephalic-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons generated using the methods disclosed herein are further contemplated for a variety of uses, including, but not limited to, use in in vitro drug discovery assays, neurological research, and therapeutics for reversing or treating disorders resulting from the lack of dopamine neurons in patients. Additionally, compositions and methods are provided for differentiating midbrain-fate FOXA2+LMX1A+TH+ dopamine (DA) neurons from human pluripotent stem cells for use in modeling disease, particularly Parkinson's disease.
[0394] As mentioned above, differentiation of multipotent stem cells into DA neurons is known to those skilled in the art. See U.S. Patent Nos. 10,280,398 and 10,590,383. Table 1 below is a single illustrative example of differentiation of multipotent stem cells into DA neurons. Table 1 below reproduces Table 6, Condition 9 of U.S. Patent No. 10,590,383. The cell population at day 17 yields FoxA2+ / Lmxl+ DA progenitor cells. When iPSC cells are recombined as described herein, the cell population at day 17 yields FoxA2+ / Lmxl+ recombinant DA progenitor cells. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4]
[0395] In some embodiments, DA neurons generated from differentiation of iPSCs comprise three distinct cell populations: A9 dopamine neurons, astrocytes, and vascular leptomeningeal cells (VLMCs). In some embodiments, the A9 dopamine neurons are biased for miR-155-3p. In some embodiments, the A9 dopamine neurons are biased for miR-155-5p. In some embodiments, the A9 dopamine neurons are not biased for miR-155-5p. In some embodiments, the astrocytes are biased for miR-155-3p. In some embodiments, the astrocytes are biased for miR-155-5p. In some embodiments, the astrocytes are not biased for miR-155-5p. In some embodiments, the VLMCs are biased for miR-155-3p. In some embodiments, the VLMCs are biased for miR-155-5p. In some embodiments, the VLMCs are not biased for miR-155-5p.
[0396] In some embodiments, the A9 dopamine neurons are biased for miR-155-3p and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the A9 dopamine neurons are biased for miR-155-5p and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the A9 dopamine neurons are unbiased for miR-155-5p and isolated from astrocytes and vascular leptomeningeal cells. In some embodiments, the astrocytes are biased for miR-155-3p and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, the astrocytes are biased for miR-155-5p and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, the astrocytes are unbiased for miR-155-5p and isolated from A9 dopamine neurons and vascular leptomeningeal cells. In some embodiments, the VLMCs are miR-155-3p biased and isolated from A9 dopamine neurons and astrocytes. In some embodiments, the VLMCs are miR-155-5p biased and isolated from A9 dopamine neurons and astrocytes. In some embodiments, the VLMCs are miR-155-5p unbiased and isolated from A9 dopamine neurons and astrocytes.
[0397] In some embodiments, DA neurons generated from differentiation of iPSCs are further differentiated by adding an antihyperlipidemic drug or a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are further differentiated by adding an antihyperlipidemic drug. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate. DA neurons generated from differentiation of iPSCs are further differentiated by adding a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are further differentiated by adding pexidartinib.
[0398] In some embodiments, DA neurons generated from differentiation of iPSCs are further differentiated by adding an antihyperlipidemic drug and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate and pexidartinib. DA neurons generated from differentiation of iPSCs are further differentiated by adding fenofibrate and pexidartinib.
[0399] In some embodiments, DA neurons generated from differentiation of iPSCs are incubated with an antilipidemic drug or a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with an antilipidemic drug. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate. DA neurons generated from differentiation of iPSCs are incubated with a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with pexidartinib.
[0400] In some embodiments, DA neurons generated from differentiation of iPSCs are incubated with an antihyperlipidemic drug and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate and a CSF-1R antagonist. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate and pexidartinib. DA neurons generated from differentiation of iPSCs are incubated with fenofibrate and pexidartinib.
[0401] Further enrichment for specific cell types can be achieved using cell sorting techniques, such as FACS and magnetic sorting.
[0402] Furthermore, cell differentiation can also be followed by specific reporters tagged with GFP or RFP, which show an increase in fluorescence upon differentiation.
[0403] Isolation of specific subpopulations of cells Isolation of specific subpopulations of cells can be performed using techniques known in the art, including fluorescence activated cell sorting and / or magnetic separation of cells.
[0404] Treatment method A method for treating Parkinson's disease or other Parkinsonian disorders in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and an antihyperlipidemic drug or a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and an antihyperlipidemic drug. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and a CSF-1R antagonist.A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron and pexidartinib.
[0405] A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron, an antihyperlipidemic drug, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of a DA neuron, fenofibrate, and pexidartinib. Disclosed is a method for treating Parkinson's disease in a subject in need thereof, the method comprising administering to the subject in need thereof therapeutic amounts of DA neurons, fenofibrate, and pexidartinib.
[0406] A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of a DA neuron and an antihyperlipidemic drug or a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of a DA neuron and an antihyperlipidemic drug. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of a DA neuron and fenofibrate. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of a DA neuron and fenofibrate. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of DA neurons and a CSF-1R antagonist.A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof a therapeutic amount of DA neurons and pexidartinib.
[0407] A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons, an antihyperlipidemic drug, and a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons, fenofibrate, and a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons, fenofibrate, and a CSF-1R antagonist. Disclosed is a method for rescuing or increasing dopamine neuron survival in a subject in need thereof, the method comprising administering to a subject in need thereof therapeutic amounts of DA neurons, fenofibrate, and pexidartinib.Disclosed is a method for rescuing or increasing dopamine neuron survival in a subject in need thereof, the method comprising administering to a subject in need thereof therapeutic amounts of DA neurons, fenofibrate, and pexidartinib.
[0408] Modified treatment with recombinant DA neurons Therapeutic doses of miR-155-3p-biased DA neurons and antihyperlipidemic drugs and / or CSF-1R antagonists. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased and an antihyperlipidemic drug and / or a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased and an antihyperlipidemic drug. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-3p is biased and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-3p is biased and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-3p is biased and pexidartinib.
[0409] A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased, an antihyperlipidemic drug, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased, fenofibrate, and pexidartinib.A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-3p is biased, fenofibrate, and pexidartinib.
[0410] Therapeutic doses of miR-155-5p biased DA neurons and antihyperlipidemic drugs or CSF-1R antagonists. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased and an antihyperlipidemic drug or a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased and an antihyperlipidemic drug. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-5p is biased and fenofibrate. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-3p is biased and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject a therapeutic amount of DA neurons in which miR-155-5p is biased and pexidartinib.
[0411] A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased, an antihyperlipidemic drug, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased, fenofibrate, and a CSF-1R antagonist. A method for treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased, fenofibrate, and a CSF-1R antagonist. A method of treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased, fenofibrate, and pexidartinib.A method of treating Parkinson's disease in a subject in need thereof is disclosed, comprising administering to the subject therapeutic amounts of DA neurons in which miR-155-5p is biased, fenofibrate, and pexidartinib.
[0412] DA neurons with recombinant MIR-155 and a therapeutic amount of an antihyperlipidemic drug or a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof therapeutic amounts of DA neurons having recombinant MIR-155 and an antihyperlipidemic drug or a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof therapeutic amounts of DA neurons having recombinant MIR-155 and an antihyperlipidemic drug. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need thereof therapeutic amounts of DA neurons having recombinant MIR-155 and fenofibrate. Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to the subject in need thereof therapeutic amounts of DA neurons bearing recombinant MIR-155 and fenofibrate. Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to the subject in need thereof therapeutic amounts of DA neurons bearing recombinant MIR-155 and a CSF-1R antagonist. Disclosed are methods for rescuing or increasing dopamine neuron survival in a subject in need thereof, comprising administering to the subject in need thereof therapeutic amounts of DA neurons bearing recombinant MIR-155 and pexidartinib.
[0413] A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons bearing recombinant MIR-155, an antihyperlipidemic drug, and a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons bearing recombinant MIR-155, fenofibrate, and a CSF-1R antagonist. A method for rescuing or increasing dopamine neuron survival in a subject in need thereof is disclosed, comprising administering to the subject in need therapeutic amounts of DA neurons bearing recombinant MIR-155, fenofibrate, and a CSF-1R antagonist. Disclosed is a method for rescuing or increasing dopamine neuron survival in a subject in need thereof, the method comprising administering to a subject in need thereof therapeutic amounts of DA neurons bearing recombinant MIR-155, fenofibrate, and pexidartinib.Disclosed is a method for rescuing or increasing dopamine neuron survival in a subject in need thereof, the method comprising administering to a subject in need thereof therapeutic amounts of DA neurons bearing recombinant MIR-155, fenofibrate, and pexidartinib.
[0414] The compositions are useful for preparing a medicament for, and / or practicing a method for, one or more of: a) inhibiting progression of, b) preventing, or c) treating a disease, e.g., a nervous system disease or related disorder.
[0415] In one embodiment, the composition is useful for preparing a medicament for, and / or practicing a method for, one or more of: a) inhibiting progression of, b) preventing, or c) treating Parkinson's disease or a related disorder in a subject in need thereof, the method comprising, or alternatively consisting essentially of, or additionally consisting of, administering to the subject an effective amount of the above-described pharmaceutical composition comprising miR-155-3p-biased DA neurons or miR-155-5p-biased DA neurons.
[0416] As described, the cells are administered in an effective amount. For example, an effective amount includes about 1 to about 1,000 mg / kg, or alternatively, about 1 to about 500 mg / kg, or alternatively, about 5 to about 500 mg / kg, or alternatively, about 10 to about 100 mg / kg, or alternatively, about 5 mg / kg to about 100 mg / kg, or alternatively, about 10 mg / kg to about 80 mg / kg, or alternatively, about 10 mg / kg to about 50 mg / kg, or alternatively, about 5 mg / kg to about 50 mg / kg, or alternatively, greater than 5 mg / kg, or alternatively greater than about 10 mg / kg, or alternatively greater than about 15 mg / kg, or alternatively greater than about 20 mg / kg, or alternatively greater than 25 mg / kg, or alternatively greater than 30 mg / kg, each measured per kg of body weight of the subject. An effective amount, in one embodiment, is a per dose or daily amount, or alternatively, a total amount over the course of treatment.
[0417] transplant The disclosed administered cells can be administered to the treated individual using a variety of transplantation approaches, the nature of which depends on the site of implantation.
[0418] The disclosed administered cells can be systemically injected into the blood circulation, intrathecally administered, or engrafted into the central nervous system, spinal cord, or ventricular lumen, or subdurally onto the surface of the host brain. Criteria for successful transplantation include (i) viability of the implant; (ii) retention of the graft at the transplant site; and (iii) minimal pathological reaction at the transplant site. Methods for transplanting various neural tissues, such as embryonic brain tissue, into the host brain are described in "Neural Grafting in the Mammalian CNS," Bjorklund and Stenevi, eds. (1985); Freed et al., 2001; Olanow et al., 2003). These procedures include intraparenchymal, i.e., transplantation within the host brain (as opposed to extracerebral or extraparenchymal, transplantation), achieved by injection or attachment of the tissue within the brain parenchyma at the time of transplantation.
[0419] Intraparenchymal transplantation can be performed using two approaches: (i) injection of cells into the host brain parenchyma, or (ii) surgical preparation of a cavity to expose the host brain parenchyma and then attachment of the graft within the cavity.
[0420] Both methods result in parenchymal attachment of the graft to the host brain tissue at the time of engraftment, and both promote anatomical integration of the graft with the host brain tissue, which is important if the graft is to become an integral part of the host brain and survive for the lifespan of the host.
[0421] Alternatively, grafts can be placed in a chamber, e.g., the ventricle, or subdurally, on the surface of the host brain, separated from the host brain parenchyma by the intervening pia mater or arachnoid mater and pia mater. Ventricular engraftment can be achieved by injecting donor cells or by growing cells on a matrix, such as 3% collagen, to form a solid tissue plug that can later be implanted into the chamber to prevent dislocation of the graft. For dural engraftment, cells can be injected around the brain surface after creating a slit in the dura. Injection into selected regions of the host brain can be achieved by drilling a hole through the dura to allow insertion of a microsyringe needle. The microsyringe is preferably fixed in a stereotaxic frame, and three-dimensional stereotaxic coordinates are selected to position the needle at the desired location in the brain or spinal cord. Cells can also be introduced into the putamen, basal ganglia, hippocampal cortex, striatum, substantia nigra, or caudate regions of the brain, and the spinal cord.
[0422] The disclosed administered cells can also be transplanted into healthy regions of tissue. The administered cells can also be transplanted into healthy regions of tissue. In some cases, the exact location of the damaged tissue region may be unknown, and cells may accidentally implant into a healthy region. In other cases, it may be preferable to administer cells to a healthy region to avoid any further damage to that region. In all cases, it is preferable for the cells to migrate into the damaged region after transplantation.
[0423] For transplantation, the disclosed cell suspension is prepared in a syringe and administered to an anesthetized transplant recipient. This procedure can be used to perform multiple injections. For transplantation, the disclosed cell suspension is prepared in a syringe and administered to an anesthetized transplant recipient. This procedure can be used to perform multiple injections.
[0424] In this way, the cell suspension procedure allows cells to be engrafted at any desired location within the brain or spinal cord, is relatively non-traumatic, and allows multiple engraftments at several different sites, or at the same site simultaneously, using the same cell suspension, resulting in a mixture of cells from different anatomical regions.
[0425] Multiple grafts can consist of a mixture of cell types and / or transgenes inserted into the cells. Preferably, approximately 10 to approximately 10 cells are introduced per graft. Cells can be administered concomitantly, such as in combination, intrathecally and intravenously at different locations to maximize the chances of targeting the affected area.
[0426] For implantation into the lumen, which may be preferred for spinal cord engraftment, tissue is removed from an area near the exterior of the central nervous system (CNS) to form a graft lumen, for example, by removing the bone overlying the brain and sequestering with a material such as Gelfoam, as described by Stenevi et al. (Brain Res. 114:1-20, 1976). The lumen can be created using suction. The graft is then placed into the lumen. Two or more graft tissues can be placed into the same lumen using injection of cells or solid tissue implants. The implantation site is preferably determined by the CNS disorder being treated. Demyelinating MS lesions are distributed across multiple locations throughout the CNS, and effective treatment of MS may depend more on the ability of cells to migrate to the appropriate target site.
[0427] Nasal administration of the disclosed administered cells is also contemplated.
[0428] The use of pluripotent cells or differentiated pluripotent cells may also be indicated for treating traumatic injuries to the nervous system, including spinal cord injury, as they are needed to provide survival factors that induce neurogenesis and minimize injury to damaged neurons, and also for treating stroke caused by hemorrhage or thrombosis or embolism.
[0429] Because non-autologous cells can induce an immune response when administered to the body, several approaches have been developed to reduce the likelihood of rejection of non-autologous cells. Furthermore, diseases such as multiple sclerosis are inflammatory, exacerbating the problem of immune responses. These include either administering cells to a dedicated site, or alternatively providing anti-inflammatory treatments that may be shown to control the onset of autoimmune disease by suppressing the recipient's immune system, and / or encapsulating non-autologous / semi-autologous cells in a semi-permeable membrane for immunoisolation prior to transplantation.
[0430] As mentioned herein above, the inventors also propose the use of umbilical cord and placenta-derived pluripotent cells, which express MHC II molecules at very low levels and therefore limit the immune response.
[0431] To confirm the feasibility of using neonatal pluripotent cells isolated from umbilical cord I placenta for the treatment of neurological disorders, the following experiments can be performed: 1. Differentiated pluripotent cells (to various neural cells or neural progenitor cells) can function as stimulators in one-way mixed lymphocyte cultures with allogeneic T cell and proliferative responses, compared to T cell responses to allogeneic lymphocytes isolated from the same donor, which can be assessed by 3H-thymidine incorporation to document hyporesponsiveness. 2. Differentiated pluripotent cells can be added to / co-cultured with one-way mixed lymphocyte culture medium and cell culture medium containing T cell mitogens (phytohemagglutinin and concanavalin A) to confirm their immunosuppressive effect on T cell-mediated proliferative responses. 3. Umbilical cord and placental cells cultured from Brown Norway rats (non-recombinant, differentiated) can be enriched for pluripotent cells, and these cells can be injected into Lewis rats with induced experimental autoimmune encephalomyelitis (EAE). Alternatively, umbilical cord and placental cells cultured from BALB / c mice, (BALB / cxC57BL / 6)F1, or xenogeneic cells from Brown Norway rats (non-recombinant, differentiated) can be enriched for pluripotent cells, and these cells can be injected into C57BL / 6 or SJL / j recipients with induced experimental autoimmune encephalomyelitis (EAE). Clinical effects on paralysis can be investigated, and the therapeutic efficacy of xenogeneic, fully MHC-mismatched, or haploidentical pluripotent cells can be evaluated. Such experiments can provide a basis for treating patients with genetic diseases or genetically predisposed disorders with haploidentical pluripotent cells from family members. 4. Pluripotent cells cultured from umbilical cord and placenta can be transfected with GFP- or RFP-tagged pre-miRs, allowing us to track the migration and persistence of these cells in the brains of EAE-induced C57BL / 6 recipients. The clinical efficacy of labeled MHC-mismatched pluripotent cells can be assessed by monitoring signs of disease, paralysis, and histopathology. The migration and localization of such cells can also be monitored using fluorescent cells from genetically transduced GFP (green) or Red2 (red) donors.
[0432] As mentioned, the present disclosure also contemplates encapsulation techniques to minimize immune response.
[0433] Encapsulation Technology Encapsulation techniques are generally classified as microencapsulation, which involves small spherical vesicles, and macroencapsulation, which involves larger flat sheet and hollow fiber membranes (Uludag, H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000;42:29-64).
[0434] Methods for preparing microcapsules are known in the art and include, for example, those disclosed by Lu MZ, et al., Cell encapsulation with alginate and alpha phenoxycinnamylidene-acetylated poly(allylamine). Biotechnol Bioeng. 2000, 70:479-83; Chang T M and Prakash S. Procedures for microencapsulation of enzymes, cells and genetically engineered microorganisms. Mol. Biotechnol. 2001, 17:249-60; and Lu MZ, et al., A novel cell encapsulation method using photosensitive poly(allylamine alpha-cyanocinnamylideneacetate). J. Microencapsul. 2000, 17:245-51.
[0435] For example, microcapsules have been prepared by complexing modified collagen with a per-polymer shell of 2-hydroxyethylmethylacrylate (HEMA), methacrylic acid (MAA), and methylmethacrylate (MMA), resulting in a capsule thickness of 2-5 μm. Such microcapsules can be further encapsulated with an additional 2-5 μm prepolymer shell to impart a negatively charged, smooth surface and minimize the absorption of plasma proteins (Chia, SM et al. Multilayered microcapsules for cell encapsulation Biomaterials. 2002 23:849-56).
[0436] Other microcapsules are based on alginate, marine polysaccharides (Sambanis, A. Encapsulated islets in diabetes treatment. Diabetes Technol. Then 2003, 5:665-8), or their derivatives. For example, microcapsules can be prepared by polyelectrolyte complexation of the polyanionic sodium alginate and sodium cellulose sulfate with the polycation poly(methylene-co-guanidine) in the presence of calcium chloride.
[0437] It is understood that cell encapsulation improves when smaller capsules are used. Thus, quality control, mechanical stability, diffusivity, and in vitro activity of encapsulated cells improved when capsule sizes were reduced from 1 mm to 400 μm (Canaple L. et al., Improving cell encapsulation through size control. J Biomater Sci Polym Ed. 2002;13:78396). Furthermore, nanoporous biocapsules with well-controlled pore sizes down to 7 nm, tailored surface chemistry, and precise microarchitecture were found to successfully immunoisolate the microenvironment for cells (Williams D. Small is beautiful: microparticle and nanoparticle technology in medical devices. Med Device Technol. 1999,10:6-9; Desai, T.A. Microfabrication technology for pancreatic cell encapsulation. Expert Opin Biol Ther. 2002,2:633-46).
[0438] immunosuppressants Examples of immunosuppressants include, but are not limited to, methotrexate, cyclophosphamide, cyclosporine, cyclosporine A, chloroquine, hydroxychloroquine, sulfasalazine (sulfasalazopyrin), gold salts, D-penicillamine, leflunomide, azathioprine, anakinra, infliximab (REMICADE™), etanercept, TNFα blockers, biologic agents that target inflammatory cytokines, and nonsteroidal anti-inflammatory drugs (NSAIDs). Examples of NSAIDs include, but are not limited to, acetylsalicylic acid, choline magnesium salicylate, diflunisal, magnesium salicylate, salsalate, sodium salicylate, diclofenac, etodolac, fenoprofen, flurbiprofen, indomethacin, ketoprofen, ketorolac, meclofenamate, naproxen, nabumetone, phenylbutazone, piroxicam, sulindac, tolmetin, acetaminophen, ibuprofen, Cox-2 inhibitors, and tramadol.
[0439] In any of the methods described herein, the cells can be administered either per se or, preferably, as part of a pharmaceutical composition that further comprises a pharmaceutically acceptable carrier.
[0440] Techniques for formulation and administration of pharmaceutical agents can be found in "Remington's Pharmaceutical Sciences," Mack Publishing Co., Easton, Pa., latest edition, which is incorporated herein by reference.
[0441] Administration Suitable routes of administration include the blood circulation (intravenous or intraarterial), the spinal fluid, or directly into the tissue or organ of interest. Thus, for example, cells can be administered directly to the brain.
[0442] For any preparation used in the methods disclosed herein, the therapeutically effective amount, or dose, can be estimated initially from in vitro and cell culture assays. The dose is preferably formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
[0443] The toxicity and therapeutic efficacy of the active ingredients described herein can be measured in vitro, in cell culture, or in experimental animals using standard pharmaceutical procedures. For example, animal models of demyelinating diseases include shiverer (shi / shi MBP-deficient) mice, MD rats (PLP-deficient), Jimpy mice (PLP-mutant), dog shaking pups (PLP-mutant), twitcher mice (galactosylceramidase-deficient, as in human Krabbe disease), and trembler mice (PMP-22-deficient). Virus-induced demyelination models include the use of Theiler's virus and mouse hepatitis virus. Autoimmune EAE is a potential model for multiple sclerosis.
[0444] The data obtained from these in vitro and cell culture assays and animal studies can be used to formulate a wide range of dosages for use in humans. Dosages may vary depending on the dosage form used and the route of administration utilized. The exact formulation, route of administration, and dosage can be selected by the individual physician in light of the patient's condition (see, for example, Fingl et al., 1975, "The Pharmacological Basis of Therapeutics," Ch. 1, p. 1). For example, multiple sclerosis patients can be symptomatically monitored for improvement in motor function, indicating a positive response to treatment.
[0445] For injection, the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological saline buffer.
[0446] Dosage and interval can be individually adjusted to the level of the active ingredient sufficient to effectively treat brain disease / disorder.The dosage required to achieve the desired effect will depend on individual characteristics and administration route.Detection assay can be used to measure plasma concentration.
[0447] Depending on the severity and responsiveness of the condition to be treated, the dosage can be single or multiple administrations, with the course of treatment lasting from several days to several weeks, or until a reduction in symptoms is achieved.
[0448] The amount of the composition administered will, of course, be dependent on the individual being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc. The dosage and timing of administration will be responsive to careful and ongoing monitoring of the individual's changing condition. For example, a patient being treated for multiple sclerosis would be administered a quantity of cells sufficient to alleviate the symptoms of the disease, based on the indications being monitored.
[0449] The administered cells can be administered simultaneously with therapeutic agents useful in the treatment of neurodegenerative diseases, such as gangliosides; antibiotics, neurotransmitters, neurohormones, toxins, neurite outgrowth molecules; and antimetabolites and precursors of neurotransmitter molecules, such as L-DOPA.
[0450] negative limitation The composition or combination therapy does not include any of the compositions described in U.S. Patent Publication No. 20170081326A1 For each of the above-described compounds and combination therapies, the compositions or combination therapies may be those of formula (I) and (II) (reproduced in Figure 2), as described in U.S. Patent Publication No. 20170081326A1, as well as pharmaceutically acceptable salts, solvates, tautomers, isomers, and deuterated analogs of formula (I) and (II), where, with respect to formula I, R is cyano; halo; or (C-C) alkyl optionally substituted with 1 to 3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy; X, when present, is halo; and with respect to formula II, R is cyano; halo; or (C-C) alkyl optionally substituted with 1 to 3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy; and X is halo, if present; 1is cyano; halo; or (C1-C3) alkyl optionally substituted with 1-3 substituents independently selected from the group consisting of halo, methyl, ethyl, methoxy, and ethoxy. Specifically, U.S. Patent Publication No. 20170081326A1 discloses that compounds in the disclosure may contain R as defined therein that provide desirable PK properties. 1 Formulas I and II are described as novel compounds because they contain a di(pyridin-2-yl)methylene moiety that requires substitution. It would not be obvious to one skilled in the art to remove / exclude Formula I and / or Formula II from the compositions and combination therapies described herein in order to deem PK properties desirable.
[0451] For each of the compounds and combination therapies described above, it is contemplated that the composition or combination therapy does not include any of the compounds set forth in Table I of U.S. Patent Publication No. 20170081326A1 (reproduced in FIG. 3).
[0452] For each of the above-mentioned compounds, and combination therapies, it is contemplated that the compositions or combination therapies do not include any of the compositions described in U.S. Patent Publication No. 20170081326A1.
[0453] The composition or combination therapy does not include any of the compositions described in WO2014145051A1 For each of the above-mentioned compounds and combination therapies, the composition or combination therapy is not considered to include any heterocyclic compounds of formula (I) described in WO2014145051A1. For each of the above-mentioned compounds and combination therapies, the composition or combination therapy is not considered to include any heterocyclic compounds of formula (I), (I'), (II), (III), (IV), (V), (Va), and (Vb), as well as any of the formulas and subformulas described in WO2014145051A1, as well as any compounds claimed in and listed anywhere described therein, as well as pharmaceutically acceptable salts, solvates, tautomers, and isomers thereof, and pharmaceutical compositions described in WO2014145051A1.
[0454] For each of the above compounds, and combination therapies, it is contemplated that the compositions or combination therapies do not include any of the pharmaceutical compositions described in WO2014145051A1 and U.S. Patent Publication No. 20170081326A1.
[0455] The compositions or combination therapies do not include any of the compositions described in U.S. Pat. No. 10,717,735. For each of the compounds and combination therapies described above, the compositions or combination therapies are not considered to include any of the combination therapies described in U.S. Patent No. 10,717,735. For each of the compounds and combination therapies described above, the compositions or combination therapies are not considered to include the free acid amorphous form of Compound I, or pharmaceutically acceptable salts, solvates, tautomers, isomers, or modified analogs of Compound I, as described in U.S. Patent No. 10,717,735.
[0456] For each of the above-mentioned compounds and combination therapies, it is contemplated that the compositions or combination therapies do not include any of the pharmaceutical compositions described in WO2014145051A1, U.S. Patent Publication No. 20170081326A1, and U.S. Patent No. 10,717,735.
[0457] kit Kits are provided to facilitate administration of DA neurons.
[0458] The kit may further comprise suitable packaging and / or instructions for use of the composition and / or administration of the administered cells. The kit may also comprise a means for delivering at least one composition, and a syringe for injection.
[0459] Additionally, the kits can contain compositions and reagents for preparing recombinant and non-recombinant DA neuron compositions for administration. The kits can contain devices for administering or dispensing the compositions, including, but not limited to, syringes, pipettes, or transdermal patches.
[0460] The kits can include other therapeutic compounds for use with the compounds described herein, and thus the methods disclosed herein can include other suitable therapeutic compounds or agents. These compounds can be provided separately from or mixed with the recombinant or non-recombinant DA neuron compositions of the present disclosure. These compounds can be provided separately from or mixed with the non-recombinant DA neuron compositions of the present disclosure. The kits can include suitable instructions for preparing and administering the recombinant or non-recombinant DA neuron compositions, side effects of the compositions, and any other relevant information. The instructions can be in any suitable format, including, but not limited to, printed writing, videotape, computer-readable disk, or optical disc.
[0461] Kits can also be provided that contain a sufficient dose of the compound or composition to provide effective treatment to an individual for an extended period of time, for example, 1 week, 2 weeks, 3 weeks, 4 weeks, 6 weeks, or 8 weeks or longer.
[0462] A kit comprising compounds required for engineering pre-miR-155 or pre-miR-155 DA neurons, and an antilipidemic agent and / or a CSF-1R antagonist. A kit comprising compounds required for differentiating pluripotent cells into miR-155-5p or miR-155-3p DA neurons, and an antilipidemic agent and / or a CSF-1R antagonist. A kit comprising compounds required for differentiating pluripotent cells into miR-155-5p-biased or miR-155-3p-biased DA A9 dopamine neurons, astrocytes, vascular leptomeningeal cells (VLMCs), and an antilipidemic agent and / or a CSF-1R antagonist.
[0463] Also provided are kits for one or more of a) inhibiting the progression of Parkinson's disease or a related disorder, b) preventing Parkinson's disease or a related disorder, or c) treating Parkinson's disease or a related disorder in a subject in need thereof, comprising an effective amount of the isolated or purified cell population and / or the above-described pharmaceutical composition and / or reagent and / or instructions for use.
[0464] The following examples are intended to illustrate, but not limit, the disclosure herein. For example, although the examples describe the isolation, purification, and use of exosome compositions to treat fibrosis or liver disease or related disorders, the methods and compositions can be modified for the treatment of other nervous system diseases described herein. [Example]
[0465] Prophetic Example Example 1 Neuronal survival is enhanced by antihyperlipidemic drugs and / or CSF-1R antagonists DA neurons are exposed to antihyperlipidemic drugs and / or CSF-1R antagonists, which are expected to promote neuronal survival and inhibit the emergence and differentiation of monocyte derivatives (macrophages / microglia) in vitro and in vivo, including after systemic administration.
[0466] Example 2 Antihyperlipidemic drugs and / or CSF-1R antagonists are expected to protect neurons subjected to stress in vitro. Varying concentrations of an antihyperlipidemic drug (fenofibrate) and / or a CSF-1R antagonist (pexidartinib) are tested in a stress test consisting of a medium change followed by serum deprivation. When used at concentrations of 0.1 and 0.01 μM (10-100 picomolar), fenofibrate and / or pexidartinib are expected to rescue DA neurons. DA neuron survival is measured either by counting the number of surviving, attached DA neurons or by colorimetric measurement after application of an electron-coupling reagent that responds to chemical reactions in normal cellular respiration. Depending on the length of serum deprivation and the starting concentration of cells, the number of neurons protected in culture is estimated to be 3-10-fold.
[0467] Example 3 Fenofibrate and pexidartinib protect cortical neurons after cortical stab wound in rats Using a dissection knife (blade = 1 × 2 mm), stab wounds were made in the rostral cortical region of the exposed cerebral cortex (with the dura mater intact) of three rats. The wounds usually produce a prominent local inflammatory response, destruction of the functional layer of the cortex, and significant atrophy and degeneration of neurons. The main immune cells involved in the inflammatory response are macrophages and microglia. 20 minutes after wounding, subcutaneous injection of fenofibrate and pexidartinib (0.4 mg / kg, bilaterally into the shoulder skin) and DA neurons is expected to result in significant anatomical sparing of the parenchyma around the wound and a more limited inflammatory response.
[0468] Example 4 Microglial activation is inhibited by fenofibrate, pexidartinib, and DA neurons Microglial cells are purified from neonatal rats according to established procedures and grown in vitro for an additional 72–96 hours, after which 90–98% of the cells are found to be ED-1+. ED-1 is a specific marker for rat microglia. Contaminating cells are expected to be GFAF+ (suggesting astrocytes) or unresponsive. TNFα immunoreactivity is expected to be low to moderate in these cultures. However, when cells are activated with 100 nM retinoic acid in vitro on days 1 and 2 and examined on days 3 or 4, ED-1-positive microglial cells exhibit a rounded morphology with small or blunted processes, suggesting that the cells have transformed into amoeboid microglia (sometimes called brain macrophages; Milligan et al., 1991a;b). TNFα immunoreactivity is higher in these cultures. These same morphological changes have been described in several studies of in vitro microglial activation (e.g., Siao and Tsirka, 2002; Bothatschek, 2001). When microglia are treated with 1 nM fenofibrate and pexidartinib and DA neurons during the RA activation period (30 min after RA treatment), cells in the treated cultures are expected to become smaller on average due to intrinsic processes, suggesting that transformation to an activated amoeboid morphology is inhibited. Similarly, TNFα immunostaining in the cells is expected to decrease.
[0469] Example 5 Fenofibrate, pexidartinib, and DA neurons protect neurons and inhibit inflammation Animals, Surgery, and Histology: Lesion studies were performed in 15 Long Evans hooded rats weighing 225–275 g. Twelve of these rats were deeply anesthetized with ketamine / xylazine and placed in a stereotaxic holder. A 4 × 2 mm (anteroposterior × medial-lateral) cranial opening was created on the right side, starting just posterior to the coronal suture and centered at +2.5 mm medial-lateral to the bregma. A dissecting knife was penetrated 1 mm deep through the dura and cortex in the center of this cranial opening. The cranial defect was filled with bone wax, the skin was sutured closed, and the animal was placed on a heating pad. After 20 minutes, 0.4 cc of a solution containing 100 μg of the 20 peptide (approximately 0.4 mg / kg, 6 rats) or DMEM vehicle (6 rats) was injected under the skin of the shoulder near the midline. Four days later, rats were perfused, and brains were processed for histology and immunohistochemistry as previously described. The rats were sacrificed without surgery or treatment. Alternate coronal sections of the brains were stained with cresyl violet acetate and immunostained for the neuron-specific tubulin isotype III (Covance Research Products) or the mononuclear cell marker ED-1 (Serotec) with TUJ1 antibody. Secondary antibodies were FITC- or rhodamine-conjugated (Jackson Immunolabs). Four regions (dorsal and ventral periphery of the wound) in two sections per lesion were counted blindly by the experimenter, and the density of ED-1+ amoeboid microglia in the parenchymal scar around the lesion was calculated.
[0470] In rats injected with fenofibrate and / or pexidartinib and DA neurons, both the destruction of the cerebral cortex and the accumulation of inflammatory cells in the parenchyma are expected to be inhibited.
Claims
1. 1. A method for promoting mitochondrial homeostasis in engrafted dopaminergic progenitors, comprising administering to a human in need thereof an effective amount of a composition comprising at least one antihyperlipidemic agent.
2. 10. The method of claim 1, wherein the at least one antihyperlipidemic agent is fenofibrate.
3. 10. The method of claim 1, wherein the at least one antihyperlipidemic agent is administered in a subtherapeutic amount.
4. 10. The method of claim 1, wherein the at least one antihyperlipidemic agent is administered in a therapeutic amount.
5. 10. The method of claim 1, wherein the effective amount is 20 to 200 mg / day.
6. 10. The method of claim 1, wherein the administration is parenteral, subcutaneous, intramuscular, intravenous, intra-articular, intracapsular, intrachondral, intracavitary, intraosseous, intrapelvic, intraperitoneal, intraspinal, intrasynovial, oral, buccal, sublingual, nasal, and transdermal.
7. 10. The method of claim 1, further comprising administering at least one CSF-1R antagonist.
8. 10. The method of claim 1, further comprising administering pexidartinib.
9. 10. The method of claim 1, further comprising administering at least one cell population selected from the group comprising stem cells, progenitor cells, progenitor cells, DA neurons, neurons, brain cells, cardiac cells, liver cells, muscle cells, or a combination thereof.
10. 10. The method of claim 1, wherein the composition does not comprise Formula (I) or Formula (II), or a pharmaceutically acceptable salt, solvate, tautomer, isomer, or deuterated analogue of Formula (I) or (II).
11. 10. The method of claim 1, wherein the at least one antihyperlipidemic agent is administered before, during, or after engraftment of the dopaminergic progenitors.
12. 12. The method of claim 11, wherein the at least one antihyperlipidemic agent is administered at least 10 days prior to engraftment of the dopaminergic progenitors.
13. 10. The method of claim 1, wherein the dopaminergic progenitors are contacted with an antihyperlipidemic drug prior to engraftment.
14. The method of claim 1 , wherein the dopaminergic progenitors are genetically modified.
15. 2. The method of claim 1, wherein the dopaminergic progenitors are genetically modified to have a bias for miR-155-3p or a bias for miR-155-5p.
16. 1. A method for reducing symptoms of an inflammatory condition in an animal, comprising: A method comprising administering to said animal a composition comprising an effective amount of at least one antihyperlipidemic agent, wherein said at least one antihyperlipidemic agent enhances engraftment of progenitor cells.
17. 17. The method of claim 16, further comprising administering at least one other therapeutic agent.
18. The at least one other therapeutic agent may be i) adozelesin, altretamine, bizelesin, busulfan, carboplatin, carboquone, carmustine, chlorambucil, cisplatin, cyclophosphamide, dacarbazine, estramustine, fotemustine, hepsulfam, ifosfamide, estramustine, irofulven, lomustine, mechlorethamine, melphalan, oxaliplatin, piposulfan, semustine, streptozocin, tetanus ... ii) an alkylating agent selected from mozolomide, thiotepa, and treosulfan; ii) an antibiotic selected from bleomycin, dactinomycin, daunorubicin, doxorubicin, epirubicin, idarubicin, menogaril, mitomycin, mitoxantrone, neocarzinostatin, pentostatin, and plicamycin; iii) an antibiotic selected from azacitidine, capecitabine, cladribine, clofarabine, cytarabine, decitabine, floxuridine, fluoxetine ... antimetabolites selected from the group consisting of darabine, 5-fluorouracil, ftorafur, gemcitabine, hydroxyurea, mercaptopurine, methotrexate, nelarabine, pemetrexed, raltitrexed, thioguanine, and trimetrexate; iv) alemtuzumab, bevacizumab, cetuximab, galiximab, gemtuzumab, nivolumab, panitumumab, pembrolizumab, pertuzumab, rituximab, tositumomab, and trastuzumab and 90Y-ibritumomab tiuxetan; v) a hormone or hormone antagonist selected from the group consisting of anastrozole, androgen, buserelin, diethylstilbestrol, exemestane, flutamide, fulvestrant, goserelin, idoxifene, letrozole, leuprolide, megestrol, raloxifene, tamoxifen, and toremifene; vi) a taxane selected from DI-927, docetaxel, TPI 287, paclitaxel, and DHA-paclitaxel; vii) a retinoid selected from alitretinoin, bexarotene, fenretinide, isotretinoin, and tretinoin; viii) an alkaloid selected from etoposide, homoharringtonine, teniposide, vinblastine, vincristine, vindesine, and vinorelbine;ix) antiangiogenic agents selected from AE-941 (GW786034, Neovastat), ABT-510, 2-methoxyestradiol, lenalidomide, and thalidomide; x) topoisomerase inhibitors selected from amsacrine, edotecarin, exatecan, irinotecan, SN-38 (7-ethyl-10-hydroxy-camptothecin), rubitecan, topotecan, and 9-aminocamptothecin; xi) erlotinib, gefitinib, flavopiridol, imatinib mesylate, lapatinib, sorafenib, sunitinib malate, AEE-788, AG-013736, AMG xii) kinase inhibitors selected from bortezomib, geldanamycin, and rapamycin; xiii) biological response modifiers selected from imiquimod, interferon alpha, and interleukin-2; xiv) IDO inhibitors; and xv) 3-AP (3-amino-2-carboxaldehyde thiosemicarbazone), altrasentan, aminoglutethimide, anagrelide, asparaginase, bromide, thiazolinone ...
17. The method of claim 16, wherein the chemotherapeutic agent is selected from liostatin, cilengitide, elesclomol, eribulin mesylate (E5389), ixabepilone, lonidamine, masoprocol, mitoguanazone, oblimersen, sulindac, testolactone, tiazofurin, an mTOR inhibitor, a PI3K inhibitor, a Cdk inhibitor, an Akt inhibitor, an Hsp90 inhibitor, a farnesyltransferase inhibitor, or an aromatase inhibitor (anastrozole, letrozole, exemestane); xvi) a Mek inhibitor; xvii) a tyrosine kinase inhibitor; xviii) a c-kit mutant inhibitor; xix) an EGFR inhibitor; or xx) an epigenetic modulator.
19. The inflammatory conditions include inflammatory pelvic disease, urethritis, sunburn, sinusitis, pneumonia, encephalitis, meningitis, myocarditis, nephritis, osteomyelitis, myositis, hepatitis, gastritis, enteritis, dermatitis, gingivitis, appendicitis, pancreatitis, cholecystitis, agammaglobulinemia, psoriasis, allergies, Crohn's disease, irritable bowel syndrome, ulcerative colitis, Sjogren's disease, tissue graft rejection, hyperacute rejection of transplanted organs, asthma, allergic rhinitis, chronic obstructive pulmonary disease (COPD), autoimmune polyglandular disease (also known as autoimmune polyglandular syndrome), autoimmune alopecia, pernicious anemia, glomerulonephritis, dermatomyositis, multiple sclerosis, scleroderma, vasculitis, autoimmune hemolytic and thrombocytopenic states, Goodpasture's syndrome, atelectasis, and the like.
17. The method of claim 16, wherein the disease is selected from the group consisting of rheumatoid arthritis, Addison's disease, Parkinson's disease, Alzheimer's disease, type 1 diabetes, type 2 diabetes, septic shock, systemic lupus erythematosus (SLE), rheumatoid arthritis, psoriatic arthritis, juvenile arthritis, osteoarthritis, chronic idiopathic thrombocytopenic purpura, Waldenstrom's macroglobulinemia, myasthenia gravis, Hashimoto's thyroiditis, atopic dermatitis, degenerative joint disease, vitiligo, autoimmune hypopituitarism, Guillain-Barré syndrome, Behcet's disease, scleracierma, mycosis fungoides, acute inflammatory responses (such as acute respiratory distress syndrome and ischemia / reperfusion injury), and Graves' disease.
20. 1. A method for reducing symptoms of Parkinson's disease or other primary and secondary parkinsonian disorders in an animal, comprising: administering DA neurons to the animal; administering to said animal a composition comprising an effective amount of at least one antihyperlipidemic agent; wherein the at least one antihyperlipidemic agent improves engraftment of the DA neurons.
Citation Information
Patent Citations
US10,273,452
US10,280,398
US10,590,383
US10,828,335
US10,858,625