Method for generating regulatory T cells (TREGs) using genome engineering

Abstract

Methods, polynucleotides, and compositions for generating engineered Treg cells are provided. The methods, polynucleotides, and compositions enable the reprogramming of hematopoietic cells into Treg cells by constitutive or controlled expression of FOXP3 in engineered cells, so that engineered Treg cells can suppress the activation and proliferation of responder T cells.

Description

Technical Field

[0001] (Cross - reference to Related Applications and Incorporation by Reference) This PCT application claims the benefit of priority of U.S. Provisional Patent Application No. 63 / 491,481, filed on March 21, 2023, the entire disclosure of which is incorporated herein by reference.

[0002] (Reference to Electronically Submitted Sequence Listing) The content of the XML - formatted electronically - submitted ST.26 sequence listing (name: 5064_002PC01_SequenceListing_ST26.xml, size: 39,719 bytes, and creation date: March 18, 2023) filed using this application is incorporated herein by reference in its entirety.

[0003] This disclosure relates to regulatory T cells. Some aspects of this disclosure are directed to polynucleotide sequences comprising a bidirectional promoter operably linked to a FOXP3 exon and a selectable marker protein.

Background Art

[0004] Regulatory T cells are a subset of T cells that act to limit the scope and reactivity of other T - cell subsets. They play an important role in protecting against target damage during infection and function to protect against abnormal reactions targeting healthy tissues. Due to their low abundance, regulatory T cells have been difficult to produce. Retroviral vectors delivering the forkhead box protein 3 (FOXP3) complementary DNA (cDNA) expression cassette have been used to confer Treg - like properties on conventional T cells in humans and mice. However, the stability of the Treg phenotype depends on promoter strength and maintenance of high FOXP3 expression, randomly integrates vectors, resulting in heterogeneous cell products, and variable numbers of viral integration sites are scattered non - specifically throughout the genome, sometimes resulting in gene silencing.

[0005] Therefore, there is a need for methods and polynucleotide constructs that provide stable, high-level FOXP3 expression in target cells for the production of Treg cells. SUMMARY OF THE INVENTION

[0006] Methods, polynucleotides, and compositions are provided for generating regulatory T cells by gene editing to manipulate and reprogram normal T cells into a regulatory phenotype that can persist in vivo in increased numbers. The methods and materials provide a FOXP3 donor construct for editing of the genomic FOXP3 locus, and the FOXP3 gene is modified to include the FOXP3 donor construct. The FOXP3 donor construct includes a selectable marker protein and a heterologous bidirectional promoter that drives expression of FOXP3 in gene-edited cells. Advantageously, the methods and materials increase the number of regulatory T cells without requiring large-scale cell amplification, because such amplification can lead to depletion of T cells. Further, by placing the FOXP3 gene under the control of a heterologous promoter, it is no longer regulated by the cellular mechanisms that prevent normal T cells from becoming regulatory T cells. The methods and materials described herein can be used to treat autoimmunity and to prevent and / or treat rejection associated with allogeneic and xenogeneic transplantation.

[0007] In some aspects, a method of making a polynucleotide for expression of FOXP3 is provided, the method comprising: (i) providing a first nucleotide sequence, the first nucleotide sequence comprising a coding strand and a target locus, the coding strand comprising a target locus including one or more regulatory elements and the FOXP3 gene, an intron sequence of the FOXP3 gene; (ii) providing a second nucleic acid sequence; (iii) providing a nuclease; and (iv) performing a gene editing process on the first nucleotide sequence to edit the intron sequence and insert the second nucleic acid into the target locus, the insertion of the second nucleic acid resulting in expression of FOXP3.

[0008] In some embodiments, the completion of the editing process results in a knock-in process for the insertion of a second nucleotide sequence at the target locus, the second nucleotide sequence comprising a heterologous promoter operably ligated to a polynucleotide containing at least one FOXP3 exon or a portion thereof.

[0009] In some embodiments, the second nucleotide sequence further comprises a polynucleotide encoding a selectable marker protein. In some embodiments, the selectable marker protein is a cell surface protein. In some embodiments, the selectable marker protein is a truncated low-affinity nerve growth factor receptor protein.

[0010] In some embodiments, the heterologous promoter is a bidirectional promoter that controls the transcription in opposite directions of a polynucleotide containing at least one FOXP3 exon or a portion thereof, and a polynucleotide encoding a selectable marker protein.

[0011] In some embodiments, the second nucleotide sequence comprises exons 1, 2, and 3 of FOXP3, and the target locus is located in the intron between exons 2 and 3 of the FOXP3 gene in the first nucleotide sequence. In some embodiments, the second nucleotide sequence comprises exons 1, 2, 3, and 4 of FOXP3, and the target locus is located in the intron between exons 3 and 4 of the FOXP3 gene in the first nucleotide sequence.

[0012] In some embodiments, the nuclease is Cas9, a zinc finger nuclease, a TALEN, a modified meganuclease, or a restriction endonuclease.

[0013] Polynucleotides for FOXP3 expression produced by the methods described herein are further provided. In some embodiments, the polynucleotide comprises a coding strand operably ligated to a polynucleotide encoding a selectable marker protein, and including a heterologous promoter located between the intron regulatory T cell (Treg) specific demethylation region (TSDR) of the FOXP3 gene and the exons of the FOXP3 gene.

[0014] In some embodiments, the heterologous promoter of the polynucleotide is located between the TSDR of the FOXP3 gene and the first exon of the FOXP3 gene.

[0015] In some embodiments, the heterologous promoter is bidirectional, promoting the transcription of a polynucleotide encoding a selectable marker protein in the direction of the TSDR and the transcription of the first exon of the FOXP3 gene in the opposite direction.

[0016] In some embodiments, the polynucleotide selectable marker protein is a cell surface protein. In some embodiments, the polynucleotide selectable marker protein is a truncated low-affinity nerve growth factor receptor protein.

[0017] A system is also provided comprising a polynucleotide containing a selectable marker protein and a bidirectional heterologous promoter operably ligated to a polynucleotide encoding at least the first exon of the FOXP3 gene, and a nuclease.

[0018] In some embodiments, the polynucleotides of the system further include 5' and 3' arms, each homologous to a portion of the intron sequence of the FOXP3 gene.

[0019] In some embodiments, the 5' and 3' arms of the polynucleotide are homologous to a portion of the intron located between the second and third exons of the FOXP3 gene, and the polynucleotide comprises the first, second, and third FOXP3 exons.

[0020] In some embodiments, the 5' and 3' arms of the polynucleotide are homologous to a portion of the intron located between the third and fourth exons of the FOXP3 gene, and the polynucleotide comprises the first, second, third, and fourth FOXP3 exons.

[0021] In some embodiments, the nuclease of the system is Cas9, zinc finger nuclease, TALEN nuclease, manipulated meganuclease, or restriction endonuclease.

[0022] In some embodiments, the selectable marker protein of the system is a cell surface protein. In some embodiments, the cell surface protein of the system is a truncated low-affinity nerve growth factor receptor protein.

[0023] Further methods for inducing FOXP3 expression in cells are provided, the methods comprising administering the systems described herein. In some embodiments, the methods further comprise culturing cells and measuring the cell surface expression of cleaved low affinity nerve growth factor receptors on the cells, the expression level of cleaved low affinity nerve growth factor receptors indicating the level of FOXP3 expression in the cells.

[0024] A method is also provided for suppressing T cell activation using engineered regulatory T cells, the method comprising inducing FOXP3 expression in T cells using the method described herein to prepare engineered regulatory T cells, and co-incubating the engineered regulatory T cells with unengineered T cells and xenograft cells, thereby suppressing the activation of unengineered T cells by xenograft cells.

[0025] The methods provided herein can be used to suppress the immune response in subjects receiving non-HLA-matched (i.e., mismatched) donor cells. For example, engineered regulatory T cells prepared according to the methods described herein can be administered to a subject before, concurrently with, or after administration of non-HLA-matched donor cells. Using the methods described herein, the subject's donor cell-responsive T cells are engineered to express FOXP3 and, upon administration to the subject, inhibit T cell activation by mismatched donor cells.

[0026] For example, a method is provided for suppressing T cell activation using engineered regulatory T cells, the method comprising contacting T cells with mismatched donor cells, isolating donor cell-responsive T cells, preparing engineered donor cell-responsive T cells by inducing FOXP3 expression in the donor cell-responsive T cells using the method described herein, co-incubating the engineered donor cell-responsive T cells with unengineered T cells and mismatched donor cells, thereby suppressing the activation of unengineered T cells by the mismatched donor cells.

[0027] In some embodiments, the manipulated regulatory T cells are human cells. In some embodiments, the mismatched donor cells are human cells.

[0028] A vector is further provided comprising a polynucleotide containing a bidirectional heterologous promoter operably ligated to a polynucleotide encoding a selectable marker protein, and further operably ligated to a polynucleotide containing at least the first exon of the FOXP3 gene.

[0029] In some embodiments, the vector's polynucleotides further comprise 5' and 3' arms, each homologous to a portion of the intron and / or exon sequences of the FOXP3 gene.

[0030] In some embodiments, the selectable marker protein of the vector is a cell surface protein. In some embodiments, the cell surface protein is a truncated low-affinity nerve growth factor receptor protein.

[0031] Cells containing the polynucleotides described herein are also provided.

[0032] Furthermore, a system described herein, a vector described herein, or a composition comprising cells and a delivery vehicle described herein is provided.

[0033] In some embodiments, the delivery vehicle of the composition is a viral vector or a lipid.

[0034] In some embodiments, the lipids of the composition are contained within a lipid vehicle.

[0035] In some embodiments, the viral vector of the composition is selected from the group consisting of adeno-associated viruses, adenoviruses, retroviruses, orthomyxoviruses, paramyxoviruses, papovaviruses, picornaviruses, lentiviruses, herpes simplex viruses, vaccinia viruses, poxviruses, and alphaviruses.

[0036] Furthermore, pharmaceutical compositions comprising a system, a vector, or cells described herein, and a pharmaceutically acceptable carrier or excipient are also provided.

[0037] Further methods are provided for inducing, regulating, or enhancing the expression of the FOXP3 gene in a subject, the methods comprising (a) administering the system described herein to the subject.

[0038] A method is provided for controlling inflammation in a subject requiring it, comprising operably binding a heterologous promoter to the FOXP3 gene or a portion thereof, and conversely, operably binding the heterologous promoter to a polynucleotide encoding a selectable marker protein, wherein the heterologous promoter promotes transcription of the FOXP3 gene or a portion thereof and the polynucleotide of the selectable marker protein, and the expression of the FOXP3 gene controls inflammation in the subject.

[0039] In some embodiments, the method further comprises administering a therapeutically effective amount of the vector described herein, the cells described herein, the composition described herein, or the pharmaceutical composition described herein to a target.

[0040] A method for producing genetically engineered cells is further provided, comprising: providing a cell comprising a first nucleic acid containing at least one target locus; providing a Cas9 protein or a second nucleic acid encoding a Cas9 protein; introducing the Cas9 protein or the second nucleic acid into the cell; introducing a third nucleic acid encoding at least one CRISPR guide sequence configured to hybridize to at least one target locus; and introducing a fourth nucleic acid into the cell comprising a nucleic acid sequence encoding a selectable marker protein and a bidirectional xenopromoter operably ligated to at least one exon of the FOXP3 gene, wherein the Cas9 protein and CRISPR guide sequence induce the introduction of the fourth nucleic acid into the first nucleic acid at at least one target locus, thereby genetically engineering the cell.

[0041] In some embodiments, the target locus of this method is an intron of the FOXP3 gene.

[0042] In some embodiments, the selectable marker protein used in this method is a cell surface protein. In some embodiments, the cell surface protein used in this method is a truncated nerve growth factor receptor protein.

[0043] Furthermore, a method is provided for reducing xenotransplant rejection in patients, the method comprising administering to a patient a therapeutically effective amount of cells prepared according to the method described herein, either before or simultaneously with the implantation of a xenotransplant, the administered cells reducing xenotransplant rejection.

[0044] Furthermore, a method is provided for increasing immune tolerance to xenotransplantation in a patient, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method described herein, either before or at the same time as xenotransplantation, the administered cells increasing immune tolerance to xenotransplantation.

[0045] A method for reducing allogeneic transplant rejection in a patient is further provided, comprising administering to the patient a therapeutically effective amount of cells prepared according to the method described herein, either before or simultaneously with the transplantation of an allogeneic transplant, wherein the administered cells reduce allogeneic transplant rejection.

[0046] Furthermore, a method is provided for increasing immune tolerance to allogeneic transplantation in a patient, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method described herein, either before or simultaneously with the transplantation of an allogeneic transplant, the administered cells increasing immune tolerance to allogeneic transplantation. [Brief explanation of the drawing]

[0047] [Figure 1] Figure 1 shows schematic diagrams of the normal human FOXP3 gene (top), the normal human FOXP3 gene, the FOXP3 donor construct, and the nuclease (oval symbol) (center), as well as a schematic diagram of the final edited human FOXP3 gene (bottom). "Selectable genes" are indicated later to show their transcription in the opposite direction to the FOXP3 gene. [Figure 2]Figure 2 shows schematic diagrams of a FOXP3 donor construct including the human ubiquitin C promoter, LNGFR marker gene, and adjacent FOXP3 gene region (top), as well as a schematic diagram of a FOXP3 donor construct including the PGK promoter, delta LNGFR marker gene, and adjacent FOXP3 homology arm (bottom). [Figure 3] Figure 3A shows a schematic diagram of gene-edited Treg cell generation from activated CD4+ cells using FOXP3 donor construct expression and AAV6 for Cas9 RNP electroporation. Figure 3B shows flow cytometry scans of FOXP3 treated only with simulated AAV donor, FOXP3 treated only with CRISPR / Cas9, and FOXP3 targeting CD4+ cells treated with both CRISPR / Cas9 and AAV donor constructs, with FOXP3 expression on the y-axis and selectable gene expression on the x-axis. [Figure 4] Figure 4A shows a schematic diagram of the generation of gene-edited Treg cells from activated CD4+ cells using FOXP3 donor construct expression and AAV6 for Cas9 RNP electroporation, followed by a 1-week culture of the edited cells before assaying for edited cell markers. Figure 4B shows a flow cytometry scan identifying edited Treg cells expressing FOXP3 and selectable markers. [Figure 5] Figure 5A shows cell proliferation flow cytometry scans of unstimulated and respondeder T cells co-cultured with Tregs stimulated with T cell stimulating reagents (anti-CD3, anti-CD28, anti-CD2) and manipulated with different Treg-to-T responder cell ratios. Figure 5B shows histograms of replication indices of unstimulated and stimulated responder T cells after co-culture with Tregs manipulated with different Treg-to-T responder cell ratios. [Figure 6]Figure 6A shows graphs of the mean fluorescence intensity of CD154 and CD49d expression on unstimulated and stimulated responder T cells co-cultured with Tregs manipulated with different Treg-to-responder T cell ratios. Figure 6B shows graphs of the mean fluorescence intensity of CD45RA and CCR7 expression on unstimulated and stimulated responder T cells co-cultured with manipulated Tregs with different Treg-to-responder T cell ratios. Figure 6C shows graphs of the mean fluorescence intensity of PD-1 and CD25 expression on unstimulated and stimulated responder T cells co-cultured with Tregs manipulated with different Treg-to-responder T cell ratios. [Figure 7] Figure 7A shows the levels of cytokine IL-2 in the supernatant of unstimulated and stimulated responder T cells co-cultured with Tregs manipulated with different Treg-to-responder T cell ratios. Figure 7B shows the levels of cytokine IL-10 in the supernatant of unsynthesized and stimulated responder T cells co-cultured with Tregs manipulated with different Treg-to-responder T cell ratios. Figure 7C shows the levels of cytokine IL-4 in the supernatant of unstimulated and stimulated responder T cells co-cultured with Tregs manipulated with different Treg-to-responder T cell ratios. [Figure 8] Figure 8A shows cell proliferation flow cytometry scans of stimulated and unstimulated responder T cells and responder T cells in porcine cells, followed by co-culture with Tregs manipulated with different Treg-to-T responder cell ratios. Figure 8B shows histograms of T cell activation in stimulated and unstimulated responder T cells and responder T cells in porcine cells, followed by co-culture with Tregs manipulated with different Treg-to-T responder cell ratios. Figure 8C shows histograms of IFN-γ expression in stimulated and unstimulated responder T cells and responder T cells in porcine cells, followed by co-culture with Tregs manipulated with different Treg-to-T responder cell ratios. [Figure 9]Figure 9 shows cell proliferation flow cytometry scans of unstimulated and unstimulated responder T cells stimulated with mismatched human donor cells (primary human lung endothelial cells) in the absence and presence of bulk-engineered Tregs, and in the presence of directional Tregs at different Treg-to-T responder cell ratios. [Figure 10] Figure 10A shows a histogram of T cell activation in responder T cells stimulated with mismatched human donor cells, followed by culture in the absence of Tregs, in the presence of bulk Tregs, or in the presence of allogeneic donor-specific Tregs. Figure 10B shows a histogram of the percentage of maximum activation in responder T cells stimulated with mismatched human donor cells, followed by culture in the presence of bulk Tregs or allogeneic donor-specific Tregs. [Modes for carrying out the invention]

[0048] Methods, polynucleotides, and compositions are provided for generating regulatory T cells by gene editing to manipulate and reprogram normal T cells into a regulatory phenotype that can be sustained in the body in increased numbers. The methods and compositions provided improve upon other methods by increasing the number of regulatory T cells without requiring large-scale cell amplification, which can lead to T cell depletion. The methods, polynucleotides, and compositions described herein can be used to treat autoimmunity and prevent and / or treat rejection associated with allograft and xenograft. In some embodiments, Treg cells are generated using targeted high-efficiency gene editing to introduce a potent promoter to the endogenous FOXP3 locus by HDR, thereby stably expressing large amounts of FOXP3 in the target cells. In some embodiments, the target cells are CD4+ T cells. In some embodiments, the target cells are NK T cells. In some embodiments, the target cells are hematopoietic stem cells and progenitor cells. Advantageously, the resulting gene-edited Treg cells closely reflect purified peripheral blood Treg cells and exhibit phenotypic and cytokine profiles that demonstrate immunosuppression in vitro and in vivo.

[0049] In some embodiments, the methods, polynucleotides, and compositions involve the use of a targeted nuclease (e.g., CRISPR / Cas, Tal-like effector nuclease (TALEN), zinc finger nuclease (ZFN)) to induce a double-strand DNA break within an intron of the FoxP3 gene downstream of a Treg-specific demethylation region (TSDR). In some embodiments, the double-strand DNA break is induced downstream of a second exon within FoxP3. A “donor DNA” template utilizing a cell repair mechanism is cultured at the break site using a DNA sequence homologous to a sequence adjacent to the double-strand break site, thereby inserting a sequence of synthetic DNA into that site.

[0050] definition As used herein, the term “and / or” should be taken as a specific disclosure of each of two specific features or components having or not having the other. Accordingly, as used herein in phrases such as “A and / or B,” the term “and / or” is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Similarly, as used in phrases such as “A, B, and / or C,” the term “and / or” is intended to include each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0051] Naturally, other similar embodiments are also provided where any embodiment is described herein with the word "includes" and / or with respect to the term "essentially includes".

[0052] The terms “about” or “approximately” applied to the value of one or more subjects, unless otherwise stated or evident from the context, refer to a value that is similar to the stated reference value and falls within the range of 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) the stated reference value (except where such a number exceeds 100%, which is a possible value). Where the terms “approximately” or “about” are applied herein to a particular value, values ​​without the terms “approximately” or “about” are also disclosed herein.

[0053] As described herein, unless otherwise indicated, any concentration range, percentage range, ratio range, or integer range should be understood to include any integer value within the listed range, and, where appropriate, fractions thereof (such as one-tenth and one-hundredth of an integer).

[0054] The terms "ug" and "uM" are used herein interchangeably with "μg" and "μM," respectively.

[0055] Units, prefixes, and symbols are shown in the form permitted by the Systeme International de Unites (SI). Numerical ranges include the numerical values ​​that define the range. The headings provided herein are not limitations on the various aspects of this disclosure that may be found by referring to this specification as a whole. Thus, the terms defined immediately below are more fully defined by referring to this specification as a whole.

[0056] The term "nucleic acid" is a phosphate polymer form of ribonucleoside (including adenosine, guanosine, uridine, or cytidine, "RNA molecule," or mRNA) or deoxyribonucleoside (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine, "DNA molecule," or any phosphoester analog thereof, such as phosphorothioates and thioesters, and is either a single-stranded form or a double-stranded helix. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The terms nucleic acid molecule, and more specifically, DNA molecule or RNA molecule, refer only to the primary and secondary structures of the molecule and are not limited to any specific tertiary form. Therefore, this term includes, in particular, linear or circular DNA molecules (e.g., restriction fragments), plasmids, superhelical DNA, and double-stranded DNA found in chromosomes. When considering the structure of a particular double-stranded DNA molecule, the sequence may be described herein in accordance with the usual convention of giving only the sequence in the 5'-3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA). A “recombinant DNA molecule” is a DNA molecule that has undergone molecular biological manipulation. Examples of DNA include, but are not limited to, cDNA, genomic DNA, DNA plasmids, synthetic DNA, and semi-synthetic DNA. A “nucleic acid composition” of this disclosure comprises one or more nucleic acids as described herein. RNA can be obtained, for example, in cells, by transcription of DNA sequences. In eukaryotic cells, transcription typically takes place in the nucleus or mitochondria. In vivo, transcription of DNA usually results in immature RNA that must be processed into messenger RNA (mRNA). For example, the processing of immature RNA in eukaryotes involves various different post-transcriptional modifications, such as splicing, 5'-capping, polyadenylation, and export from the nucleus or mitochondria. The sum of these processes is also called RNA maturation.Mature mRNA typically provides a nucleotide sequence that can be translated into the amino acid sequence of a specific peptide, protein, or protein antigen. Typically, mature mRNA contains a 5' cap, optionally a 5' UTR, an open reading frame, optionally a 3' UTR, and a poly(A) sequence.

[0057] As used herein, the term "mRNA" refers to single-stranded RNA that encodes an amino acid sequence of one or more polypeptide chains.

[0058] As used herein, the term “antisense” refers to nucleic acids that are sufficiently complementary to all or part of a gene, primary transcript, or processed mRNA in order to interfere with the expression of an endogenous gene. A “complementary” polynucleotide is a polynucleotide that can base-pair according to the standard Watson-Crick complementarity rules. Specifically, purines pair with pyrimidines to form combinations such as guanine paired with cytosine (G:C) and adenine paired with thymine (A:T) in the case of DNA, or adenine paired with uracil (A:U) in the case of RNA. Naturally, two polynucleotides can hybridize to each other even if they are not perfectly complementary to one another, provided that each has at least one region that is substantially complementary to the other.

[0059] The terms "antisense strand" and "guide strand" refer to a strand of dsRNA, such as shRNA, that contains a region substantially complementary to the target sequence, such as mRNA. The antisense strand has a sequence that is sufficiently complementary to the desired target mRNA sequence and induces sufficient complementarity to trigger target-specific silencing, such as the disruption of the desired target mRNA by an RNAi mechanism or process.

[0060] As used herein, the terms “sense strand” and “passenger strand” refer to strands of dsRNA, e.g., shRNA, that include a region substantially complementary to the antisense strand region, as the terms are defined herein. The antisense and sense strands of dsRNA, e.g., shRNA, are hybridized to form a double-stranded structure.

[0061] As used herein, the terms "5'" or "5-prime" refer to the 5' end of a nucleic acid or nucleic acid sequence, and as used herein, the terms "3'" or "3-prime" refer to the 3' end of a nucleic acid or nucleic acid sequence.

[0062] As used herein, the terms “multicistronic mRNA” or “multicistronic mRNA vector” refer to mRNA having two or more open reading frames. In this context, an open reading frame is a sequence of codons that can be translated into polypeptides or proteins.

[0063] As used herein, the term “5'-cap” refers to an entity, typically a modified nucleotide entity that caps the 5' end of mature mRNA. The 5'-cap can typically be formed by a modified nucleotide, particularly a derivative of a guanine nucleotide. In some embodiments, the 5'-cap is ligated to the 5' end via a 5'-5'-triphosphate bond. The 5'-cap may be methylated, e.g., m7GpppN, where N is the terminal 5' nucleotide of the nucleic acid supporting the 5'-cap, typically the 5' end of RNA. The naturally occurring 5'-cap is m7GpppN.

[0064] As used herein, the term “poly(A) sequence” is also called “poly(A) tail” or “3'-poly(A) tail” and is typically understood to be a sequence of adenine nucleotides, e.g., up to about 400 adenine nucleotides. The poly(A) sequence may be located at the 3' end of mRNA. In some embodiments, the poly(A) sequence may be located in mRNA or in any other nucleic acid molecule, for example, in a vector, for example, in a vector that serves as a template for the production of RNA, preferably in mRNA, for example, by transcription of the vector. In some embodiments, the poly(A) sequence is located in the 3' UTR of mRNA as defined herein.

[0065] As used herein, the term “3' untranslated region” (3'UTR) refers to the 3'UTR sequence, which is part of the mRNA and located between the protein-coding region (i.e., the open reading frame) and the 3' end of the mRNA molecule. If a 3'-terminal poly(A) sequence ("poly(A) tail") is added to the RNA (e.g., by polyadenylation), the term 3'UTR may refer to that portion of the molecule located between the protein-coding region and the 3'-terminal poly(A) sequence. In some embodiments, the 3'UTR may also include a poly(A) sequence (e.g., a poly(A) sequence not located very far 3' on the RNA molecule). The 3'UTR of mRNA is not translated into an amino acid sequence. The 3'UTR sequence is commonly encoded by a gene that is transcribed into its respective mRNA during the gene expression process. The genomic sequence is first transcribed into pre-mRNA containing any introns. The pre-mRNA is then further processed into mature mRNA during the maturation process. This maturation process includes a 5' capping step, a step of splicing pre-mature mRNA to excise any introns, and modifications of the 3' end, such as polyadenylation of the 3' end of the pre-mature mRNA and any endonuclease or exonuclease cleavage. In some embodiments, the 3'UTR corresponds to a sequence of mature mRNA located 3' to the stop codon of the protein-coding region (e.g., immediately 3' to the stop codon of the protein-coding region) and extending to the 3' end of the RNA molecule or 5' to the nucleotide immediately 5' to the 3'-terminal poly(A) sequence (e.g., immediately 5' to the 3' end or immediately 5' to the nucleotide immediately 5' to the 3'-terminal poly(A) sequence). As used herein, the term “corresponding” means that the 3'UTR sequence may be an RNA sequence such as the mRNA sequence used to define the 3'UTR sequence, or a DNA sequence that corresponds to such an RNA sequence. In some embodiments, the term “3'UTR of a gene” refers to the 3'UTR of the mature mRNA derived from that gene, i.e., the sequence corresponding to the mRNA obtained by transcription of the gene and maturation of the pre-mRNA. The term “3'UTR of a gene” encompasses both the DNA and RNA sequences of the 3'UTR.In some embodiments, the 3'UTR is derived from a gene associated with the 3'UTR of a gene selected from the group consisting of an enhanced hemimesis mRNA (i.e., a stable mRNA), such as an albumin gene, an α-globin gene, a β-globin gene, a tyrosine hydroxylase gene, a lipoxygenase gene, and a collagen alpha gene such as the collagen alpha 1(I) gene.

[0066] The 5'UTR is typically understood to be a specific portion of messenger RNA (mRNA). It is located at 5' of the open reading frame of the mRNA. In some embodiments, the 5'UTR begins at the transcription start site and ends one nucleotide before the start codon of the open reading frame. The 5'UTR may contain elements for controlling gene expression, also called regulatory elements. Such regulatory elements may be, for example, a ribosome binding site or a 5'-terminal oligopyrimidine tract. The 5'UTR can be post-transcriptionally modified, for example, by the addition of a 5' cap. In some embodiments, the 5'UTR corresponds to a sequence of mature mRNA located between the 5' cap and the start codon. In some embodiments, the 5'UTR corresponds to a sequence extending from a nucleotide located at 3' to the 5' cap (e.g., from a nucleotide immediately near 3' to the 5' cap) to a nucleotide located 5' to the start codon of the protein-coding region (e.g., to a nucleotide immediately 5' of the start codon of the protein-coding region). The nucleotide located immediately 3' from the 5' cap of mature mRNA typically corresponds to the transcription start site. The term “corresponding” means that the 5'UTR sequence can be any RNA sequence, such as the mRNA sequence used to define the 5'UTR sequence, or a DNA sequence that corresponds to such an RNA sequence. In some embodiments, the term “5'UTR of a gene” refers to the sequence that corresponds to the 5'UTR of the mature mRNA derived from that gene.

[0067] As used herein, the terms “derived from” or “derivative” refer to a particular molecule or component isolated from or produced using information from a particular molecule (e.g., nucleic acid sequences). For example, a polynucleotide sequence derived from another polynucleotide sequence may contain polynucleotide sequences identical or substantially similar to the polynucleotide sequence from which it derives. In the case of polynucleotides, the species from which they derive can be obtained, for example, by natural mutagenesis, artificially directed mutagenesis, or artificially random mutagenesis. Mutagenesis used to induce polynucleotides can be intentionally directed, intentionally random, or a mixture of both. Mutagenesis of a polynucleotide to produce a different polynucleotide from a first polynucleotide can be a random event (e.g., caused by polymerase infidelity), and the identification of the polynucleotide from which it derives can be done by appropriate screening methods known in the art.In some embodiments, the polynucleotide sequence derived from the first polynucleotide sequence is at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, The derived polynucleotide sequence has sequence identity to each first polynucleotide sequence of at least approximately 77%, at least approximately 78%, at least approximately 79%, at least approximately 80%, at least approximately 81%, at least approximately 82%, at least approximately 83%, at least approximately 84%, at least approximately 85%, at least approximately 86%, at least approximately 87%, at least approximately 88%, at least approximately 89%, at least approximately 90%, at least approximately 91%, at least approximately 92%, at least approximately 93%, at least approximately 94%, at least approximately 95%, at least approximately 96%, at least approximately 97%, at least approximately 98%, at least approximately 99%, or at least 100%, and the derived polynucleotide sequence retains the biological activity of the original polynucleotide. The derived polynucleotide may not necessarily be physically derived from the target nucleotide sequence, but may be produced in any manner including, but not limited to, chemosynthesis, replication, reverse transcription, or transcription, based on information provided by the sequence of bases in the region from which the polynucleotide is derived. Thus, this can represent either the sense orientation or antisense orientation of the original polynucleotide.

[0068] As used herein, the terms “transfect” or “transfection” refer to the transport of nucleic acids from the external environment to the internal cellular environment of a cell, particularly with reference to the cytoplasm and / or cell nucleus. While not bound by any particular theory, it should be understood that nucleic acids can be delivered to a cell either after being encapsulated within or attached to one or more cationic polymer / nucleic acid complexes, or after being accompanied by them. A specific example of transfection is the delivery of nucleic acids to the cell nucleus. Examples of nucleic acids include DNA and RNA, as well as their synthetic congeners. These nucleic acids include missense, antisense, and nonsense nucleotides, as well as protein-producing nucleotides, on and off regulatory nucleotides, and regulatory nucleotides that control protein, peptide, and nucleic acid production. In particular, but not limited to, they may be genomic DNA, cDNA, mRNA, tRNA, rRNA, hybrid sequences, or synthetic or semi-synthetic sequences, and of natural or artificial origin. Furthermore, nucleic acids may vary in size, ranging from oligonucleotides to chromosomes. These nucleic acids may be of human, animal, plant, bacterial, viral, or synthetic origin. They can be obtained by any technique known to those skilled in the art.

[0069] As used herein, the term "knock-in process" refers to a process of introducing one polynucleotide into another polynucleotide (the original polynucleotide), the resulting polynucleotide containing all or part of the introduced polynucleotide and the original polynucleotide. Nucleases and methodologies for knocking genes are known in the art and can be used in combination with the methods and systems of the present invention.

[0070] "Percent (%) sequence identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence after the sequences have been aligned and gaps introduced as necessary to achieve maximum percentage sequence identity. Alignment for the purpose of determining the percentage of nucleic acid or amino acid sequence identity can be achieved in various ways within the capabilities of a person skilled in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. A person skilled in the art can determine appropriate parameters for aligning the sequences, including any algorithm necessary to achieve maximum alignment over the entire length of the sequences being compared. For example, a percentage sequence identity value can be generated using the sequence comparison computer program BLAST.

[0071] "Level" means the level or activity of a protein, or protein-coding mRNA, compared to a reference, as is optional. The reference may be any useful reference as defined herein. A decrease or increase in the level of a protein means a decrease or increase in the level of a protein compared to a reference. The level of a protein may be expressed as mass / volume (e.g., g / dL, mg / mL, μg / mL, ng / mL) or as a percentage of the total protein or mRNA in the sample.

[0072] "Reference" means any useful reference used to compare levels or activity of a protein or mRNA. A reference may be any sample, standard, standard curve, or level used for comparison purposes. A reference may be a normal reference sample or reference standard or level. A "reference sample" includes, for example, a control and a predetermined negative control value such as, for example, untreated cells or cells not modified according to the methods described herein, a normal control, or a previous sample taken from the same subject, a sample from a normal healthy subject such as, for example, normal cells or normal tissue, a sample (e.g., cells or tissue from a subject without disease), a sample from a subject diagnosed with disease, a sample from a subject that has not yet been treated but has not been treated by the methods described herein, or a purified protein (e.g., a selectable marker protein described herein at a known normal concentration).

[0073] When used herein to describe nucleic acid molecules, the term “recombinant” means polynucleotides of genomic, cDNA, viral, semi-synthetic, or synthetic origin, and which, by their origin or manipulation, are not related to all or some of the polynucleotides associated in nature. When used in relation to proteins or polypeptides, the term “recombinant” means polypeptides produced by the expression of recombinant polynucleotides. Generally, the gene of interest is cloned and then expressed in transformed cells, as further described below. The cells express the exogenous gene to produce a protein under expression conditions.

[0074] Terms such as “recombinant cells,” “cells,” “cell lines,” and “cell cultures,” as well as other terms referring to microorganisms or higher eukaryotic cell lines cultured as single-cell entities, refer to cells that can or have been used as recipients of recombinant vectors or other transplant DNA, including the original offspring of the transfected original cells.

[0075] As used herein, the term “host cell” refers to cells that can be genetically engineered using the FOXP3 donor constructs described herein, including T cells, NK T cells, and hematopoietic stem cells and progenitor cells (HSPCs).

[0076] "Operatively linked" refers to the arrangement of elements such that the components described in this way are configured to perform their normal function. Thus, a given promoter operably linked to a coding sequence can result in the expression of the coding sequence, provided the appropriate enzyme is present. Expression is intended to involve the transcription of mRNA from a DNA or RNA template, and may further involve the translation of a protein from the mRNA template. A promoter does not need to be contiguous with the coding sequence, insofar as it functions to direct its expression. Therefore, for example, an intervening untranslated but transcribed sequence can exist between the promoter sequence and the coding sequence, and the promoter sequence can still be considered "operably linked" to the coding sequence.

[0077] As used herein, the term “promoter” refers to a DNA sequence that can control the expression of a coding sequence or functional RNA. In some embodiments, the coding sequence is located 3' to the promoter sequence. A promoter may be entirely derived from a native gene, or it may consist of different elements derived from different promoters found in nature, or it may include a synthetic DNA segment. It is understood by those skilled in the art that different promoters can induce gene expression in different tissues or cell types, or at different developmental stages, or in response to different environmental or physiological conditions. Promoters that express a gene in most cell types are generally called constitutive promoters. Promoters that express a gene in a specific cell type are generally called cell-specific promoters or tissue-specific promoters. Promoters that express a gene at a specific stage of development or cell differentiation are generally called “development-specific promoters” or “cell differentiation-specific promoters.” Promoters that induce and express a gene after exposure or treatment of cells with drugs, biomolecules, chemicals, ligands, light, etc., that induce the promoter are generally called “inducible promoters” or “regulatory promoters.” In most cases, the precise boundaries of regulatory sequences are not fully defined, so it is further recognized that DNA fragments of different lengths can have the same promoter activity.

[0078] The term "bidirectional promoter" refers to a constitutive, regulated, tissue-specific, or ubiquitous promoter that promotes transcription in two opposite directions.

[0079] As used herein, the term “adjustable promoter” refers to any promoter whose activity is influenced by a cis or trans activator (e.g., an inducible promoter such as an external signal or drug).

[0080] As used herein, the term “constitutive promoter” refers to any promoter that induces RNA production in a human CMV immediate early enhancer / promoter region that promotes constitutive expression of cloned DNA insertions in many or all tissue / cell types, e.g., mammalian cells.

[0081] As used herein, the term “enhancer” refers to a cis-acting element that stimulates or inhibits the transcription of an adjacent gene. An enhancer that inhibits transcription is also called a “silencer.” Enhancers can function in either orientation, at distances of up to several kilobase pairs (kb) from the coding sequence and from downstream locations of the transcription region (for example, they may be associated with the coding sequence).

[0082] The terms “transcriptional regulatory protein,” “transcriptional regulatory factor,” and “transcription factor” are used interchangeably herein and refer to nuclear proteins that bind to DNA response elements and thereby transcriptionally regulate the expression of the associated genes. Transcriptional regulatory proteins generally bind directly to DNA response elements, but in some cases, binding to DNA may be indirect, by binding to another protein that binds to or binds to the DNA response element.

[0083] As used herein, the term “terminal signal sequence” refers to any genetic element that causes RNA polymerase to terminate transcription, such as a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region required for endonuclease cleavage of an RNA transcript, followed by a polyadenylation consensus sequence AATAAA. The polyadenylation signal sequence provides a “poly-A site,” i.e., a site on the RNA transcript to which an adenine residue is added by post-transcriptional polyadenylation.

[0084] As used herein, the terms “internal ribosome entry site” or “IRES” refer to elements that facilitate direct internal ribosome entry into the start codon (such as ATG) of a cistron (protein-coding region), thereby resulting in cap-independent translation of the gene. See, for example, Jackson RJ et al., Trends Biochem Sci 15(12):477-83 (199) and Jackson RJ and Kaminski, A. RNA 1(10):985-1000 (1995). As used herein, translational regulation of an IRES means that translation is associated with the IRES and proceeds cap-independently.

[0085] As used herein, the terms “self-processing cleavage site” or “self-processing cleavage sequence” refer to post-translational or co-translational processing cleavage sites or sequences. Such “self-processing cleavage” sites or sequences refer to DNA or amino acid sequences exemplified herein by 2A sites, sequences or domains, or 2A-like sites, sequences or domains. The term “self-processing peptide” is defined herein as a peptide expression product of a DNA sequence encoding a self-processing cleavage site or sequence, which, at translation, mediates rapid intramolecular (cis) cleavage of the protein or polypeptide containing the self-processing cleavage site to obtain individual mature protein or polypeptide products.

[0086] As used herein, the term “additional proteolytic cleavage site” refers to a sequence incorporated into the expression construct of the present disclosure adjacent to a self-processing cleavage site, such as a 2A or 2A-like sequence, which provides a means for removing additional amino acids remaining after cleavage by the self-processing cleavage site. Exemplary “additional proteolytic cleavage sites” are described herein and include, but are not limited to, furin cleavage sites having the consensus sequence RCK(R)R (SEQ ID NO: 17). Such furin cleavage sites may be cleaved by furin and other serine proteases in the protein secretion pathway, or other endogenous subtilisin-like proteases. In some embodiments, other exemplary “additional proteolytic cleavage sites” may be used, for example, as described in Lie et al., Sci Rep 7, 2193 (2017).

[0087] As used herein, the terms “coding sequence” or “coding” a particular molecule (e.g., a protein, e.g., FOXP3 protein or a selectable marker protein) refer to a nucleic acid that is transcribed (in the case of DNA) or translated (in the case of mRNA) into a polypeptide in vitro or in vivo, when operably ligated to an appropriate control sequence such as a promoter. The boundaries of a coding sequence are determined by a start codon at the 5' (amino) terminus and a translation termination codon at the 3' (carboxy) terminus. Coding sequences may include, but are not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic DNA sequences. The transcription termination sequence is typically located on the 3' side of the coding sequence.

[0088] As used herein, the term “vector” is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it is ligated, or an entity containing such a nucleic acid molecule capable of transporting another nucleic acid. In some embodiments, a vector is a “plasmid,” which refers to a round double-stranded DNA loop to which additional DNA segments can be ligated. In some embodiments, a vector is a viral vector, to which additional DNA segments can be ligated into a viral genome. In some embodiments, such vectors include, but are not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, lentivirus vectors, poxvirus vectors, baculovirus vectors, herpesvirus vectors, monkey virus 40 (SV40), cytomegalovirus (CMV), mouse mammary cancer virus (MMTV), and Moloney's mouse leukemia virus. Certain vectors, or polynucleotides that are part of a vector, can autonomously replicate in the host cell to which they are introduced (e.g., bacterial vectors with bacterial origins of replication, and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) may be integrated into the host cell's genome upon introduction into the host cell, thereby replicating with the host genome. Furthermore, certain vectors can direct the expression of genes to which they are functionally linked. Such vectors are referred to herein as “recombinant expression vectors” (or simply “expression vectors”). Generally, expression vectors of utility in recombinant DNA technology are often in the form of plasmids. Hereinafter, since plasmids are the most commonly used form of vectors, “plasmids” and “vectors” may be used interchangeably depending on the context. However, other forms of expression vectors, such as viral vectors (e.g., replication-deficient retroviruses, poxviruses, herpesviruses, baculoviruses, adenoviruses, and adeno-associated viruses), are also disclosed herein and may perform equivalent functions.

[0089] As used herein, the terms “adeno-associated virus vector” or “AAV vector” refer to any vector containing or derived from adeno-associated vector components and suitable for infecting mammalian cells, preferably human cells. The term AAV vector typically refers to an AAV-type virus particle or virion containing a payload. AAV vectors may be derived from various serotypes, including combinations of “pseudotype” AAV, or from various genomes (e.g., single-stranded or self-complementary). Furthermore, AAV vectors may be replication-defective and / or targeted. As used herein, the term “adeno-associated virus” (AAV) includes, but is not limited to, AAV1, AAV2, AAV3 (including types 3A and 3B), AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh8, AAVrh10, AAVrh74, snake AAV, bird AAV, cattle AAV, dog AAV, horse AAV, sheep AAV, goat AAV, shrimp AAV, their AAV serotypes, and the AAV serotypes and lineages disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33:375 (2004)), and any other AAVs that are currently known or have been discovered later. See, for example, FIELDS et al. VIROLOGY, Vol. 2, Chapter 69 (4th edition, Lippincott-Raven Publishers). In some embodiments, “AAV vector” includes derivatives of known AAV vectors. In some embodiments, “AAV vector” includes modified or artificial AAV vectors. The terms “AAV genome” and “AAV vector” can be used interchangeably. In some embodiments, the AAV vector is modified compared to the wild-type AAV serotype sequence.

[0090] As used herein, “AAV particle” is an AAV virus comprising an AAV vector having at least one payload region (e.g., a polynucleotide encoding a therapeutic protein or peptide) and at least one inverted terminal repeat (ITR) region. In some embodiments, the terms “AAV vector of the Disclosure” or “AAV vector” refer to, for example, an AAV vector comprising a polynucleotide encoding a FOXP3 protein and / or a selectable marker protein encapsulated in an AAV particle.

[0091] As used herein, “gene therapy composition” is a composition comprising a polynucleotide or a polynucleotide-containing vector, wherein the polynucleotide or vector comprises, for example, a FOXP3 donor construct and a polynucleotide that optionally expresses a nuclease.

[0092] As used herein, the phrase “bring cells into contact” (e.g., bringing cells into contact with an AAV vector, AAV capsid, or gene therapy composition of this disclosure) includes direct or indirect contact with cells. In some embodiments, bringing cells into contact with an AAV vector, AAV capsid, or gene therapy composition includes bringing cells into contact with a gene therapy composition, AAV vector, or AAV capsid in vitro, or bringing cells into contact with an AAV vector, AAV capsid, or gene therapy composition in vivo. Thus, for example, an AAV vector, AAV capsid, or gene therapy composition may be physically brought into contact with cells by an individual performing the method, or alternatively, an AAV vector, AAV capsid, or gene therapy composition may be placed in a situation that allows or causes subsequent contact with cells.

[0093] In some embodiments, in vitro contact of cells can be performed, for example, by incubating cells with an AAV vector. In some embodiments, in vivo contact of cells can be performed, for example, by injecting the AAV vector, AAV capsid, or gene therapy composition of this disclosure into or near the tissue where the cells are located (e.g., bone marrow, thymus), or by injecting the AAV vector, AAV capsid, or gene therapy composition into another area, for example, the bloodstream or subcutaneous space, so that the drug subsequently reaches the tissue where the contacting cells are located. For example, an AAV vector may be encapsulated and / or bound to a ligand that directs the AAV vector to a site of interest. Combinations of in vitro and in vivo contact methods are also possible. For example, cells may be contacted in vitro with an AAV vector, AAV capsid, or gene therapy composition and then transplanted into a subject.

[0094] In some embodiments, contacting cells with the polynucleotides, expression cassettes, vectors, rAAV particles, nuclease proteins, or compositions of the Disclosure includes introducing AAV vectors, AAV capsids, nuclease proteins, or gene therapy compositions into cells (directly or indirectly) by promoting or achieving uptake or absorption into cells. The introduction of AAV vectors, AAV capsids, nuclease proteins, or gene therapy compositions into cells may be in vitro and / or in vivo. For example, in vivo introduction, the AAV vector, AAV capsid, nuclease protein, or gene therapy composition may be injected into a specific tissue site (e.g., a site where a therapeutic effect is desired) or administered systemically (e.g., an AAV vector targeting a site where a therapeutic effect is desired). In vitro introduction into cells includes methods known in the Art, such as electroporation and lipofection.

[0095] As used herein, the term “in vitro” refers to events occurring in an artificial environment, such as a test tube or reaction vessel, a cell culture, or a petri dish, rather than within a living organism (e.g., an animal, plant, or microorganism).

[0096] As used herein, the term "in vivo" refers to events occurring within a living organism (for example, an animal or its cells or tissues).

[0097] As used herein, the term “mutation” refers to any change in the structure of a gene that results in a variant form (also called a “mutant”) that can be transmitted to subsequent generations. Mutations within a gene can be caused by alterations of a single base in DNA, or by deletions, insertions, or rearrangements of larger sections of a gene or chromosome.

[0098] As used herein, the term “modification” refers to a change in the state or structure of the molecule in this disclosure. Molecules can be modified in many ways, including chemically, structurally, and functionally. In some embodiments, the modification is relative to the reference wild-type molecule.

[0099] As used herein, the term “synthesis” means being produced, prepared, and / or manufactured by human hands. The synthesis of the polynucleotides or polypeptides or other molecules of this disclosure may be chemical or enzymatic.

[0100] As used herein, the term “polypeptide” is intended to encompass both the singular “polypeptide” and plural “polypeptides,” including any chain or more chains of two or more amino acids. Therefore, as used herein, “peptide,” “peptide subunit,” “protein,” “amino acid chain,” “amino acid sequence,” or any other term used to refer to a chain of two or more amino acids are included in the definition of “polypeptide,” even though each of these terms may have a more specific meaning. The term “polypeptide” can be used in place of or interchangeably with any of these terms. The term further includes polypeptides that have undergone post-translational or post-synthetic modifications, e.g., palmitoyl group conjugate, glycosylation, acetylation, phosphorylation, amidation, derivatization with known protecting / blocking groups, proteolytic cleavage, or modification with non-natural amino acids. As used herein, the term “peptide” encompasses full-length peptides and their fragments, variants, or derivatives. “Peptides” disclosed herein may be part of a fusion polypeptide containing additional components, such as an albumin domain, to increase half-life. The peptides described herein may also be derivatized in different ways. The peptides described herein may include modifications, for example, that involve the conjugation of a palmitoyl group.

[0101] As used herein, the term “homology-directed repair” (HDR) refers to intracellular mechanisms for repairing double-strand and single-strand DNA breaks. Homology-directed repair includes homologous recombination (HR) and single-strand annealing (SSA) (Lieber. 2010 Annu. Rev. Biochem. 79:181-211). The most common form of HDR is called homologous recombination (HR), which has the longest sequence homology requirement between donor and acceptor DNA. Other forms of HDR include single-strand annealing (SSA) and break-induced replication, which require shorter sequence homology compared to HR. Homology-directed repair (single-strand breaks) in a niche can occur via a different mechanism than HDR in double-strand breaks (Davis and Maizels, PNAS (0027-8424), 111 (10), p. E924-E932).

[0102] As used herein, the term “nuclease” refers to an enzyme having catalytic activity for DNA cleavage. In some embodiments, a nuclease can facilitate homologous recombination between a FOXP3 construct disclosed herein and a gene, such as the FOXP3 gene. In some embodiments, the construct integrated into the host cell genome contains homologous regions adjacent to sequences targeted by a nuclease, such as a CRISPR / Cas nuclease.

[0103] As used herein, the term “administration” means the administration of a composition of this disclosure (e.g., an AAV vector, AAV capsid, or gene therapy composition disclosed herein) to a subject or system. Administration to a subject (e.g., a human) may be by any suitable route, including but not limited to periorbital, posterior bulb, and / or intramuscular injection.

[0104] As used herein, the term “inverted terminal repeat” (or “ITR”) refers to a single-stranded sequence of nucleotides followed by a reverse complementary strand. The intervening nucleotide sequence between the initial sequence and the reverse complementary strand may be of any length, including zero.

[0105] As used herein, the term "Trelogen" means a substance that can suppress or downmodulate an adaptive or innate immune response.

[0106] As used herein, the term “biological specimen” refers to any specimen obtained from an organism, and includes clinical specimens. Types of “biological specimens” include, but are not limited to, tissue obtained by surgical excision, tissue obtained by biopsy, cells in culture, cell supernatant, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, microneedle aspiration, lymph node aspiration, cystic aspiration, paracentesis specimens, thoracentesis specimens, etc. In some embodiments, a biological specimen includes hematopoietic cells. In some embodiments, a biological specimen includes hematopoietic progenitor cells or stem cells. In some embodiments, a biological specimen includes T cells or NK T cells.

[0107] As used herein, the terms “obtained” or “to obtain” refer to the physical extraction or isolation of a biological sample from a subject (e.g., including hematopoietic stem cells and progenitor cells (HSPCs), lymphocyte progenitor cells, peripheral blood mononuclear cells (PBMCs), CD4+ T lymphocytes, or NK T cells). For example, a biological sample includes hematopoietic cells isolated from a subject (and thus obtained), and the same person or entity isolates HSPCs, CD4+ T lymphocytes, NK T cells, etc., from the sample and produces FOXP3-modified T cells (genes edited with CRISPR / Cas9 and FOXP3 homologous donor vectors) from the original, unmodified cells in the sample. If a biological sample is “extracted” or “isolated” from a first party or entity and subsequently transferred to a second party (e.g., by delivery, mail, etc.), the sample is obtained (and isolated by the first party) and subsequently obtained (but isolated) by the second party. Therefore, in some embodiments, the acquisition step does not include the step of isolating the biological sample. In some embodiments, the acquisition step includes the step of isolating the biological sample (e.g., pre-treatment biological sample, post-treatment biological sample, etc.). Methods and protocols for isolating various biological samples (e.g., blood samples, biopsy samples, aspirates, etc.) are known to those skilled in the art, and the biological sample may be isolated using any convenient method.

[0108] The term "substantially purified" generally refers to the isolation of components from a sample (e.g., cells or a substance), resulting in the components comprising a large proportion of the sample in which they exist. Typically, in a sample, substantially purified components comprise at least 70%, preferably at least 80-85%, and more preferably at least 90-99% of the sample.

[0109] As used herein, terms such as “treatment,” “to treat,” and “to cure” generally refer to obtaining a desired pharmacological and / or physiological effect. The effect may be prophylactic in that it completely or partially prevents the disease or its symptoms, and / or therapeutic in that it partially or completely stabilizes or cures the disease and / or adverse effects resulting from the disease. The term “treatment” encompasses any treatment of a disease in mammals, in particular humans, and includes (a) a step of preventing the development of the disease and / or one or more symptoms in a subject that may be predisposed to the disease or symptoms but has not yet been diagnosed with it; (b) inhibiting the disease and / or one or more symptoms, i.e., halting the development of the ability; or (c) alleviating one or more of the symptoms of the disease, i.e., causing regression of the disease and / or one or more symptoms. Those requiring treatment include those who are already ill, as well as those for which prevention is desirable (e.g., those with increased susceptibility to autoimmune diseases). In some embodiments, prevention of an outcome is achieved through prophylactic measures. As used herein, “preventive” refers to a therapeutic or set of actions used to prevent the onset of a disease or condition, or to prevent or delay one or more symptoms associated with a disease or condition. As used herein, “prevention” refers to measures taken to maintain health, to prevent or delay the onset of a disease or condition, or to prevent or delay one or more symptoms associated with a disease or condition.

[0110] Therapeutic treatment is treatment in which the subject has the disease prior to administration, while prophylactic treatment is treatment in which the subject has not had the disease prior to administration. In some embodiments, the subject is likely to develop the disease or is suspected to have developed the disease prior to treatment. In some embodiments, the subject is suspected to be at increased risk of developing the disease.

[0111] As used herein, the term “pharmaceutically acceptable excipient or carrier” means an excipient that may be optionally included in the compositions of this disclosure and does not cause significant toxic effects to a patient.

[0112] The term "pharmaceutically acceptable salt" includes, but is not limited to, amino acid salts, salts prepared with inorganic acids (e.g., chlorides, sulfates, phosphates, diphosphates, bromides, and nitrates), or salts prepared from any of the corresponding inorganic acid forms mentioned above (e.g., hydrochlorides), or salts prepared with organic acids (e.g., malates, maleates, fumarates, tartrates, succinates, ethyl succinates, citrates, acetates, lactates, methanesulfons, benzoates, ascorbic acid, para-toluenesulfonates, palmates, salicylates, and stearates, estrates, gluceptates, and lactobionates).

[0113] As used herein, the term “effective amount” for a composition comprising FOXP3-modified HSPCs or FOXP3-modified T cells or NK T cells (e.g., cells edited with CRISPR / Cas9 and FOXP3 homologous donor vectors) means an amount sufficient to safely influence a beneficial or desired outcome, such as suppressing the activation and proliferation of effector T cells and increasing immune tolerance. An effective amount may be administered in one or more doses, applications, or dosages.

[0114] As used herein, the term "therapeutically effective dose" or "amount" of a composition comprising FOXP3-engineered HSPCs or FOXP3-engineered T cells or NKT cells refers to an amount that, when administered as described herein, results in a positive therapeutic response such as improvement in recovery from inflammatory conditions such as autoimmune symptoms, allergies, graft-versus-host disease, and transplant rejection. Improved recovery can include reduction of inflammation, pain, or autoimmune-induced tissue damage, or better graft tolerance and long-term survival of transplanted cells, tissues, or organs. Further, a therapeutically effective dose or amount can compensate for functional (e.g., IPEX syndrome) or quantitative Treg deficiencies and reduce the need for immunosuppressive or anti-inflammatory drugs. The exact amount required will vary depending on the species, age, and general condition of the subject, the severity of the condition being treated, the particular agent or agents used, the mode of administration, and the like. The appropriate "effective" amount in any individual case can be determined by one of ordinary skill in the art using routine experimentation based on the information provided herein. For example, an effective unit dose can be about 1×10 5 cells / kg, about 2×10 5 cells / kg, about 3×10 5 cells / kg, about 4×10 5 cells / kg, about 5×10 5 cells / kg, about 6×10 5 cells / kg, about 7×10 5 cells / kg, about 8×10 5 cells / kg, about 9×10 5 cells / kg, about 1×10 6 cells / kg, about 2×10 6 cells / kg, about 3×10 6 cells / kg, about 4×10 6 cells / kg, about 5×10 6 cells / kg, about 6×10 6 cells / kg, about 7×10 6 cells / kg, about 8×10 6 cells / kg, about 9×10 6 cells / kg, about 1×10 7 cells / kg, about 2×10 7 cells / kg, about 3×10 7 cells / kg, about 4×10 7cells / kg, approximately 5×10 7 cells / kg, approximately 6×10 7 cells / kg, approximately 7×10 7 cells / kg, approximately 8×10 7 cells / kg, approximately 9×10 7 cells / kg, approximately 1×10 8 cells / kg, approximately 2×10 8 cells / kg, approximately 3×10 8 cells / kg, approximately 4×10 8 cells / kg, approximately 5×10 8 cells / kg, approximately 6×10 8 cells / kg, approximately 7×10 8 cells / kg, approximately 8×10 8 cells / kg, approximately 9×10 8 cells / kg, approximately 1×10 9 cells / kg, approximately 2×10 9 cells / kg, approximately 3×10 9 cells / kg, approximately 4×10 9 cells / kg, approximately 5×10 9 cells / kg, approximately 6×10 9 cells / kg, approximately 7×10 9 cells / kg, approximately 8×10 9 cells / kg, approximately 9×10 9 cells / kg, approximately 1×10 10 cells / kg, or the area enclosed by either of these numbers, or approximately 1 × 10⁻⁶ 5 cells / kg ~ approx. 1×10 10 cells / kg, or approximately 1 × 10⁶ 5 cells / kg ~ approx. 1×10 6 cells / kg, approximately 2×10 6 cells / kg ~ approx. 1×10 7 cells / kg, approximately 2×10 7 cells / kg ~ approx. 1×10 8 cells / kg, approximately 2×10 8 cells / kg ~ approx. 1×10 9 cells / kg, approximately 2×10 9 cells / kg ~ approx. 1×10 10 Cells / kg or more may be acceptable.

[0115] As used herein, the terms “recipient,” “individual,” “subject,” “host,” and “patient” are interchangeable and refer to humans, livestock, or any mammalian subject for which diagnosis, treatment, or therapy is desired, such as dogs, horses, cats, cattle, sheep, goats, pigs, zoo animals, sports animals, or pet animals.

[0116] As used herein, the term “unit dosage form” refers to a physically distinct unit suitable as a unit dose for human and non-human subjects, each unit containing a predetermined amount of the agent calculated in an amount sufficient to produce the desired effect in relation to a pharmaceutically acceptable diluent, carrier, or vehicle. The specifications of unit dosage forms for use in this disclosure depend on the specific compound employed, the effect to be achieved, the pharmacodynamics related to each compound in the host, and so on.

[0117] Nuclease In some embodiments, the FOXP3 donor construct, which is integrated into the genome of a host cell (e.g., a T cell), contains homologous regions adjacent to sequences (e.g., recognition sites) targeted by nucleases, such as CRISPR / Cas nucleases.

[0118] The size of the recognition site of a homologous recombination-mediated nuclease may vary depending on the nuclease, and may be, for example, at least about 4, at least about 6, at least about 8, at least about 10, at least about 12, at least about 14, at least about 16, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 nucleotides long, or about 4 The recognition sites include approximately 50 nucleotides, 4 to 40 nucleotides, 4 to 36 nucleotides, 4 to 32 nucleotides, 4 to 28 nucleotides, 4 to 24 nucleotides, 4 to 20 nucleotides, 4 to 16 nucleotides, 4 to 12 nucleotides, 4 to 10 nucleotides, 4 to 8 nucleotides, 4 to 6 nucleotides, or approximately 6 to 40 nucleotides, 6 to 36 nucleotides, 6 to 32 nucleotides, 6 to 28 nucleotides, 6 to 24 nucleotides, 6 to 20 nucleotides, 6 to 16 nucleotides, 6 to 12 nucleotides, 6 to 10 nucleotides, or approximately 6 to 8 nucleotides.

[0119] In one embodiment, each monomer of the nuclease recognizes a recognition site of at least 9 nucleotides. In other embodiments, the recognition site is approximately 9–12 nucleotides long, approximately 12–15 nucleotides long, approximately 15–18 nucleotides long, or approximately 18–21 nucleotides long, and any combination of these subranges (e.g., 9–18 nucleotides). The recognition site may be palindromic, i.e., a sequence on one strand reads the same on the opposite direction on the complementary strand. A given nuclease is recognized as being able to bind to the recognition site and cleave at or near the binding site. Cleavage by the nuclease may occur at nucleotide positions immediately opposite each other, resulting in a blunt-end cleavage, or in other cases, the cleavage site may be shifted, resulting in a single-stranded overhang, also called a "sticky end," which may be either a 5' overhang or a 3' overhang.

[0120] Any nuclease that induces a nick or double-strand break at a desired recognition site can be used in the methods and compositions disclosed herein. Natural nucleases can be used insofar as they induce a nick or double-strand break at or near the desired recognition site. Alternatively, modified or engineered nucleases can be used. Engineered nucleases include those derived from their natural form that have been modified to specifically recognize and induce a nick or double-strand break at a desired recognition site. Nuclease modifications may be as few as one amino acid in the nuclease protein or one nucleotide in the nucleic acid encoding the nuclease. In some embodiments, the engineered nuclease induces a nick or double-strand break at a recognition site that is not the sequence that would have been recognized by the unengineered nuclease. The production of single-strand or double-strand breaks in DNA may be referred to herein as "nick" or "break" of the DNA, respectively.

[0121] In certain aspects of this disclosure, homologous recombination is initiated by a CRISPR / Cas system, a TALEN system, a ZFN system, a meganuclease, or a restricted endonuclease.

[0122] In some embodiments, the nuclease is introduced into the cell by any means known in the art. For example, in the case of the CRISPR / Cas system, a ribonucleoprotein (RNP) containing transactivated CRISPR RNA and Cas9 protein complexed with CRISPR RNA (tracrRNA: crRNA-Cas9) can be directly introduced into the cell. Alternatively, polynucleotides encoding Cas9, tracrRNA, and crRNA can be introduced into the cell. When expressed from polynucleotides, CRISPR RNA and Cas9 may be expressed from different promoters.

[0123] Active variants and fragments of nucleases (i.e., engineered nucleases) are also provided. Such active variants may contain at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more sequence identity with the natural nuclease, and the active variants retain the ability to cleave at a desired recognition site and thus retain nick or double-strand break-inducing activity. For example, any of the nucleases described herein may be modified from a natural endonuclease sequence and designed to recognize and induce nicks or double-strand breaks at a recognition site not recognized by the natural nuclease. Thus, in some embodiments, the engineered nuclease has specificity to induce nicks or double-strand breaks at a recognition site different from the corresponding natural nuclease recognition site. Assays for nick or double-strand disruption-inducing activity are well-known and commonly measure the overall activity and specificity of endonucleases on DNA substrates containing the recognition site.

[0124] When a nuclease is supplied to a cell through the introduction of a polynucleotide encoding the nuclease, such polynucleotides can be codon-optimized for expression in that cell. In some embodiments, a polynucleotide encoding a nuclease can be modified to substitute codons that are more frequently used in the target cell compared to the native polynucleotide sequence encoding the nuclease. For example, a polynucleotide encoding a nuclease can be modified to substitute codons that are more frequently used in a given prokaryotic or eukaryotic cell, including bacterial cells, yeast cells, human cells, or any other host cell of interest, compared to the native polynucleotide sequence.

[0125] CRISPR / CAS In some embodiments, the nucleases used in the various methods and compositions disclosed herein may include a CRISPR / Cas system. Such a system may, for example, utilize a Cas9 nuclease, which in some examples is codon-optimized for the desired cell type in which it is expressed. Such a system may also employ a guide RNA (gRNA) comprising two distinct molecules. An exemplary two-molecule gRNA comprises a crRNA-like molecule ('Clustered regularly Interspaced Short Palindromic Repeats (CRISPR)RNA', or "targeter-RNA", or "crRNA", or "crRNA repeater") and a corresponding tracrRNA-like molecule ('trans-activating CRISPR RNA', or "activator-RNA", or "tracrRNA", or "scaffold").

[0126] crRNA contains both the DNA targeting segment (single-stranded) of gRNA and the nucleotide extension that forms half of the double-stranded RNA (dsRNA) double helix of the protein-binding segment of gRNA. The corresponding tracrRNA (activator-RNA) contains the nucleotide segment that forms the other half of the dsRNA double helix of the protein-binding segment of gRNA. Thus, the nucleotide segment of crRNA is complementary to the nucleotide segment of tracrRNA and hybridizes to form the dsRNA double helix of the protein-binding domain of gRNA. Therefore, it can be said that each crRNA has a corresponding tracrRNA. crRNA further provides a single-stranded DNA targeting segment. Thus, gRNA contains the sequence that hybridizes to the target sequence and the tracrRNA. The target sequence is upstream of the protospacer-adjacent motif (PAM) sequence. Therefore, crRNA and tracrRNA hybridize (as a corresponding pair) to form gRNA. When used for intracellular modification, the precise sequence and / or length of a given crRNA or tracrRNA molecule may be designed to be specific to the species in which the RNA molecule is used. gRNA is also referred to herein as a CRISPR guide sequence.

[0127] Alternatively, the system may further employ a fusion crRNA-tracrRNA construct that functions with Cas9 (i.e., a single transcript containing intervening nucleotides that selectively link the crRNA and tracrRNA). This single RNA is often called a single guide RNA or sgRNA. Within the sgRNA, the crRNA portion is identified as the “target sequence” for a given recognition site, and the tracrRNA is often called the “scaffold.” Briefly, a short DNA fragment containing the target sequence can be inserted into a guide RNA expression plasmid. The gRNA expression plasmid may contain the target sequence (in some embodiments, about 20 nucleotides), the morphology of the tracrRNA sequence (scaffold), and a suitable promoter that is active in the cell.

[0128] Next, gRNA expression cassettes and Cas9 expression cassettes are introduced into the cells. See, for example, Mali P et al. (2013) Science 2013 Feb. 15; 339(6121):823-6, Jinek M et al. Science 2012, published online June 28, 2012, 337(6096):816-21, Hwang WY et al. Nat Biotechnol 2013 March; 31(3):227-9; Jiang W et al. Nat Biotechnol 2013 March, 31(3):233-9, and Cong L et al. Science 2013 Feb. 15; 339(6121):819-23. Each of these is incorporated herein by reference. See also various commercially available kits, and international publications such as International Publication Nos. 2013 / 176772A1, International Publication Nos. 2014 / 065596A1, International Publication Nos. 2014 / 089290A1, International Publication Nos. 2014 / 093622A2, International Publication Nos. 2014 / 099750A2, and International Publication Nos. 2013142578A1, each of which is incorporated herein by reference.

[0129] In some embodiments, alternative Cas proteins may be used. For example, Cas12 or Cas13 proteins may be used. In some embodiments, the Cas9 nuclease may be provided in the form of a protein. In some embodiments, the Cas9 protein may be provided in the form of a gRNA-ribonucleoprotein (RNP) complex. In other embodiments, the Cas9 nuclease may be provided in the form of a protein-coding nucleic acid. The nucleic acid encoding the Cas9 nuclease may be RNA (e.g., messenger RNA (mRNA)) or DNA. In some embodiments, the gRNA may be provided to cells in the form of RNA. In other embodiments, the gRNA may be provided to cells in the form of RNA-coding DNA. In some embodiments, the gRNA may be provided in the form of separate crRNA and tracrRNA molecules, or separate DNA molecules encoding crRNA and tracrRNA, respectively. In some embodiments, the gRNA is referred to as a CRISPR guide sequence and is provided in the form of RNA. In some embodiments, the CRISPR guide sequence is provided in the form of RNA-coding DNA. In some embodiments, the CRISPR guide sequence may be provided in the form of separate crRNA and tracrRNA molecules.

[0130] In some embodiments, the Cas protein is a type I Cas protein (see, for example, Xu et al., Environmental Microbiology 23: 542-558, 2021). In one embodiment, the Cas protein is a type II Cas protein. In one embodiment, the type II Cas protein is Cas9. In one embodiment, the type II Cas, for example Cas9, is a human codon-optimized Cas9.

[0131] In certain embodiments, Cas proteins are “nickases” capable of generating single-strand breaks (i.e., “nicks”) at a target site without cleaving both strands of double-stranded DNA (dsDNA). Cas9, for example, comprises two nuclease domains involved in cleaving opposing DNA strands: a RuvC-like nuclease domain and an HNH-like nuclease domain. Mutations in either of these domains can generate nickases. Examples of nickase-generating mutations can be found, for example, in International Publication 2013 / 176772A1 and International Publication 2013 / 142578A1, each incorporated herein by reference.

[0132] In certain embodiments, two distinct Cas proteins (e.g., nickases) specific to target sites on each strand of dsDNA can generate an overhang sequence on another nucleic acid, or an overhang sequence complementary to a distinct region on the same nucleic acid. The overhang ends produced by contacting the nucleic acid with two nickases specific to target sites on both strands of dsDNA may be either 5' or 3' overhang ends. For example, a first nickase may generate a single-strand break on the first strand of dsDNA, while a second nickase may generate a single-strand break on the second strand of dsDNA so that an overhang sequence is produced. The target sites of each nickase that produce a single-strand break may be selected such that the resulting overhang end sequence is complementary to an overhang end sequence on a different nucleic acid molecule. Complementary overhang ends of two different nucleic acid molecules can be annealed by the methods disclosed herein. In some embodiments, the target sites of nickase on the first chain are different from the target sites of nickase on the second chain.

[0133] TALEN In some embodiments, the nucleases used in the various methods and compositions disclosed herein may include TALENs. Thus, in one embodiment, the nuclease is a transcription activator-like effector nuclease (TALEN). TAL effector nucleases are a class of sequence-specific nucleases that can be used to produce double-strand breaks at specific target sequences in the genomes of prokaryotes or eukaryotes or cells. TAL effector nucleases are produced by fusing a native or engineered transcription activator-like (TAL) effector or a functional portion thereof to the catalytic domain of an endonuclease, such as FokI.

[0134] The unique modular TAL effector DNA-binding domains allow for the design of proteins with potentially arbitrary given DNA recognition specificity. Therefore, the DNA-binding domains of TAL effector nucleases can be engineered to recognize specific DNA target sites and thus can be used to create double-strand breaks at desired target sequences. See International Publication No. 2010 / 079430, Morbitzer et al. (2010) PNAS 10.1073 / pnas.1013133107, Scholze & Boch (2010) Virulence 1:428-432, Christian et al. Genetics (2010) 186:757-761, Li et al. (2010) Nuc. Acids Res. (2010) doi:10.1093 / nar / gkq704, and Miller et al. (2011) Nature Biotechnology 29:143-148. All of these are incorporated herein by reference.

[0135] Examples of suitable TAL nucleases and methods for preparing suitable TALENs are disclosed, for example, in U.S. Patent Applications Nos. 2011 / 0239315 A1, 2011 / 0269234 A1, 2011 / 0145940 A1, 2003 / 0232410 A1, 2005 / 0208489 A1, 2005 / 0026157 A1, 2005 / 0064474 A1, 2006 / 0188987 A1, and 2006 / 0063231 A1 (each incorporated herein by reference).

[0136] In various embodiments, the TAL effector nuclease is engineered, for example, to cleave a target nucleic acid sequence or its vicinity at a genomic locus of interest, where the target nucleic acid sequence is the sequence or its vicinity that is modified by the targeting vector. Suitable TAL nucleases for use in the various methods and compositions provided herein include those designed to bind to or near the target nucleic acid sequence modified by the targeting vector described herein.

[0137] In one embodiment, each monomer of TALEN contains 12 to 25 TAL repeat sequences, each TAL repeat sequence binding to a 1 bp subsite. In one embodiment, the nuclease is a chimeric protein containing a TAL repeat-based DNA-binding domain operably linked to an independent nuclease. In one embodiment, the independent nuclease is a FokI endonuclease. In one embodiment, the nuclease contains a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, each of which is operably linked to a FokI nuclease, and the first and second TAL repeat-based DNA-binding domains recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a cleavage site of approximately 6 bp to approximately 40 bp, causing the FokI nuclease to dimerize and perform a double-strand break at the target sequence.

[0138] In one embodiment, the nuclease comprises a first TAL repeat-based DNA-binding domain and a second TAL repeat-based DNA-binding domain, each of which is operably ligated to a FokI nuclease, and the first and second TAL repeat-based DNA-binding domains recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a 5 bp or 6 bp cleavage site, causing the FokI nuclease to dimerize and perform a double-strand break.

[0139] Zinc finger nuclease (ZFN) In some embodiments, the nucleases used in the various methods and compositions disclosed herein may comprise a zinc finger nuclease (ZFN) system. In one embodiment, each monomer of the ZFN comprises three or more zinc finger-based DNA-binding domains, each zinc finger-based DNA-binding domain binding to a 3 bp subsite. In other embodiments, the ZFN is a chimeric protein comprising zinc finger-based DNA-binding domains operably linked to an independent nuclease. In one embodiment, the independent endonuclease is a FokI endonuclease. In one embodiment, the nuclease comprises a first ZFN and a second ZFN, each of which is operably linked to a FokI nuclease, and the first and second ZFNs recognize two consecutive target DNA sequences on each strand of a target DNA sequence separated by a cleavage site of about 6 bp to about 40 bp or a cleavage site of about 5 bp to about 6 bp, and the FokI nuclease dimerizes to perform a double-strand break. See, for example, U.S. Patent Publication No. 20060246567, U.S. Patent Publication No. 20080182332, U.S. Patent Publication No. 20020081614, U.S. Patent Publication No. 20030021776, International Publication No. 2002 / 057308A2, U.S. Patent Publication No. 20130123484, U.S. Patent Publication No. 20100291048, and International Publication No. 2011 / 017293A2, each incorporated herein by reference.

[0140] Meganuclease In some embodiments, the nucleases used in the various methods and compositions disclosed herein may include meganuclease systems. Meganucleases are classified into four families based on conserved sequence motifs, namely the "LAGLIDADG," "GIY-YIG," "HNH," and "His-Cys box" families. These motifs are involved in the coordination of metal ions and the hydrolysis of phosphodiester bonds.

[0141] In some aspects, meganucleases are homing endonucleases (HEases) notably for their long recognition sites and tolerance to several sequence polymorphisms in their DNA substrates. Meganuclease domains, structures, and functions are publicly known; see, for example, Guhan and Muniyappa (2003) Crit Rev Biochem Mol Biol 38:199-248, Lucas et al., (2001) Nucleic Acids Res 29:960-9, Jurica and Stoddard, (1999) Cell Mol Life Sci 55:1304-26, Stoddard, (2006) Q Rev Biophys 38:49-95, and Moure et al., (2002) Nat Struct Biol 9:764.

[0142] In some embodiments, natural variants and / or manipulated derivative meganucleases are used. Methods for modifying dynamics, cofactor interactions, expression, optimal conditions, and / or recognition site specificity, and activity screening are known, e.g., Epinat et al., (2003) Nucleic Acids Res 31:2952-62, Chevalier et al., (2002) Mol Cell 10:895-905, Gimble et al., (2003) Mol Biol 334:993-1008, Seligman et al., (2002) Nucleic Acids Res 30:3870-9, Sussman et al., (2004) J Mol Biol 342:31-41, Rosen et al., (2006) Nucleic Acids Res 34:4791-800, Chames et al., (2005) Nucleic Acids Res 33:e178, Smith See et al., (2006) Nucleic Acids Res 34:e149, Gruen et al., (2002) Nucleic Acids Res 30:e29, Chen and Zhao, (2005) Nucleic Acids Res 33:e154, WO2005105989, WO2003078619, WO2006097854, WO2006097853, WO2006097784, and WO2004031346.

[0143] Any meganuclease can be used herein, including, but not limited to, I-SceI, I-SceII, I-SceIII, I-SceIV, I-SceV, I-SecVI, I-SceVII, I-CeuI, I-CeuAIIP, I-CreI, I-CrepsbIP, I-CrepsbIIP, I-CrepsbIIIP, I-CrepsbIVP, I-TliI, I-PpoI, PI-PspI, F-SceI, F-SceII, F-SuvI, F-TevI, F-TevII, I-AmaI, I-AniI, I-ChuI, I-CmoeI, I-CpaI, I-CpaII, I-CsmI, I-CvuI, I-CvuAIP, I-DdiI, I-DdiII, I-DirI I-DmoI, I-HmuI, I-HmuII, I-HsNIP, I-LlaI, I-MsoI, I-NaaI, I-NanI, I-NcIIP, I-NgrIP, I-NitI, I-NjaI, I-NspIIIP, I-PakI, I-PboIP, I-PcuIP, I-PcuAI, I-PcuVI, I-PgrIP, I-PobIP, I-PorIIP, I-PbpIP, I-SpBetaIP, I-ScaI, I-SexIP I-SneIP, I-SpomI, I-SpomCP, I-SpomIP, I-SpomIIP, I-SquIP, I-Ssp6803I, I-SthPhiJP, I-SthPhiST3P, I-SthPhiSTe3bP, I-TdeIP, I-TevI, I-TevII, I-TevIII, I-UarAP, I-UarHGPAIP, I-UarHGPA13P, I-VinIP, I-ZbiIP, PI-MtuI, PI-MtuHIP, PI-MtuHIIP, PI-PfuI, PI-PfuII, PI-PkoI, PI-PkoII, PI-Rma43812IP, PI-SpBetaIP, PI-SceI, PI-TfuI, PI-TfuII, PI-ThyI, PI-TliI, PI-TliII, or any active variant or fragment thereof.

[0144] In some embodiments, the meganuclease recognizes a double-stranded DNA sequence of 12–40 base pairs. In some embodiments, the meganuclease recognizes a perfectly matched target sequence in one of the heterologous polynucleotides described herein. In some embodiments, the meganuclease is a homing nuclease. In some embodiments, the homing nuclease is a member of the "LAGLIDADG" family of homing nucleases. In some embodiments, the homing nuclease is selected from I-SceI, I-CreI, and I-Dmol.

[0145] Restricted Endonuclease In some embodiments, the nucleases used in homologous recombination in the various methods and compositions disclosed herein may include restriction endonucleases, including type I, type II, type III, and type IV endonucleases. Type I and type III restriction endonucleases recognize specific recognition sites, but typically cleave at variable positions from the nuclease binding site, and can be several hundred base pairs away from the cleavage site (recognition site). In the type II system, restriction activity is independent of any methylase activity, and cleavage typically occurs at a specific site within or near the binding site. Most type II enzymes cleave palindromic sequences, but type IIa enzymes recognize non-palindromic recognition sites and cleave outside the recognition site, type IIb enzymes cleave twice at both sites outside the recognition site, and type IIs enzymes recognize asymmetric recognition sites and cleave at a delimiting distance of about 1 to 20 nucleotides from the recognition site. Type IV restriction enzymes target methylated DNA. Restriction enzymes are further described and classified in, for example, the REBASE database (web page rebase.neb.com, Roberts et al., (2003) Nucleic Acids Res 31:418-20), Roberts et al., (2003) Nucleic Acids Res 31:1805-12, and Belfort et al., (2002), Mobile DNA II, pp. 761-783, Eds. Craigie et al. (ASM Press, Washington, DC).

[0146] Polynucleotides In some embodiments, a polynucleotide comprising a gene editing system for editing the FOXP3 gene is provided. The gene editing system comprises a nuclease such as a zinc finger nuclease (ZFN), a transcription activator-like effector nuclease (TALEN), a CRISPR / Cas system, a dimeric CRISPR RNA guide Fok1 nuclease, a meganuclease, or a restriction endonuclease, the nuclease being introduced into cells, such as T cells, NK T cells, or HSPCs, together with a FOXP3 donor polynucleotide construct.

[0147] In some embodiments, the polynucleotide encodes a TAL effector nuclease that has been engineered to bind to and cleave a target nucleic acid sequence, for example, in a FOXP3 intron or exon.

[0148] In some embodiments, the polynucleotide encodes a zinc finger nuclease or a transcription activator-like effector nuclease (TALEN). The zinc finger nuclease or TALEN binds to specific sequences upstream and / or downstream of introns or exons of the FOXP3 gene via a DNA-binding polypeptide (see, for example, Carlson et al. (2012), Targeting DNA with fingers and TALENs, Molecular Therapy-Nucleic Acids 1, e3).

[0149] In some embodiments, the polynucleotide encodes a Cas9 nuclease and guide RNA that binds to an intron or exon of the FOXP3 gene (see, for example, Mail et al. (2013), RNA-guided human genome engineering via Cas9, Science 339(6121), pages 823-826; Cong et al. (2013), Multiplex genome engineering using CRISPR / Cas systems, Science 339(6121), pages 819-823; and Tsai et al. (2014), Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing, Nature Biotechnology 32, pp. 569-576).

[0150] In some embodiments, the crRNA target sequence is ATCCACCGTTGAGAGCTGGG (SEQ ID NO: 1). This target sequence is located within the FOXP3 gene and spans a target cleavage site (nucleotide 7160-1741 reverse orientation) within intron 3 at the exon 4 splice site, thereby reducing the potential for adverse mutations resulting from cleavage at the SEQ ID NO: 1 target sequence without subsequent donor construct insertion. The region containing the SEQ ID NO: 1 target sequence is removed from innate regulatory mechanisms for inhibiting FOXP3 expression (e.g., mechanisms relying on modifications to the DNA nucleotides themselves). Furthermore, the SEQ ID NO: 1 target sequence is a unique sequence that does not have closely related sequences in the human genome that reduce the risk of adverse effects at other sites in the human genome. Following this strategy, additional crRNA target sequences within the FOXP3 gene can be generated and used in the manner described herein.

[0151] In some embodiments, the polynucleotide donor construct comprises a polynucleotide containing a portion of the FOXP3 intron and / or a portion of the FOXP3 exon, or alternatively, the entire FOXP3 gene, as well as the nucleic acid of the promoter. In some embodiments, the polynucleotide further comprises a polynucleotide encoding a selectable marker. In some embodiments, the polynucleotide containing a portion of the FOXP3 intron and / or a portion of the FOXP3 exon or the entire FOXP3 gene, as well as the nucleic acid of the polynucleotide encoding a selectable marker, is located at both ends of a bidirectional promoter and is under the control of the bidirectional promoter.

[0152] In some embodiments, the polynucleotide donor construct comprises a polynucleotide including a portion of FOXP3 exon 3 nucleic acid, a portion of FOXP3 intron 3, a nucleic acid encoding a marker gene, a promoter, and the nucleic acids of at least exons 1 and 2 of the FOXP3 gene, as well as a portion of FOXP3 intron 4. In some embodiments, the promoter of the donor construct is bidirectional, and the marker gene is oriented to be operably ligated to the bidirectional promoter. In some embodiments, the marker gene and the first FOXP3 exon are operably ligated to the bidirectional promoter so that their transcription proceeds in opposite directions.

[0153] In some embodiments, the polynucleotide donor construct comprises a polynucleotide including a portion of FOXP3 exon 3 nucleic acid, a portion of FOXP3 intron 3, a nucleic acid encoding a marker gene, a bidirectional promoter, the nucleic acids of exon 1, exon 2, and exon 3 of the FOXP3 gene, and a portion of FOXP3 intron 4.

[0154] In some embodiments, the polynucleotide donor construct comprises a nucleic acid of a portion of FOXP3 exon 3, a portion of FOXP3 intron 3, a nucleic acid encoding a marker gene, a bidirectional promoter, and a polynucleotide comprising the nucleic acid of exon 1, exon 2, exon 3, and exon 4 of the FOXP3 gene, as well as a portion of FOXP3 intron 4.

[0155] In some embodiments, the FOXP3 donor construct is replaced by homologous recombination (HR) with sections of genomic FOXP3 introns and / or exons, or portions thereof.

[0156] In some embodiments, homologous recombination and insertion of a donor construct in the target sequence of Sequence ID No. 1, by insertion of a donor construct consisting of a portion of FOXP3 exon 3, a portion of FOXP3 intron 3, nucleic acid encoding a marker gene, a bidirectional promoter, nucleic acids of exon 1, exon 2, and exon 3, nucleic acid of FOXP3 gene exon 4, and a portion of FOXP3 intron 4, the cell genome contains a modified FOXP3 gene including exons 1-12 under the control of an exogenous promoter. In some embodiments, exons 1-12 of the manipulated FOXP3 gene are operably ligated to the promoter without any intervening coding sequences, such as marker gene sequences.

[0157] In some embodiments, the site of exchange is predetermined by the homology arms of the FOXP3 donor construct. In some embodiments, the FOXP3 donor construct includes a FOXP3 homology arm at its 5' end and a FOXP3 homology arm at its 3' end. In some embodiments, the homology arms of the FOXP3 construct are homologous to the nucleic acid sequences on either side of a double-strand break induced by the nuclease described herein, thereby allowing hybridization and homologous recombination after the nuclease induces the double-strand break. As a result of homologous recombination of the FOXP3 donor construct with the genomic FOXP3 site, the FOXP3 gene is permanently modified to include the FOXP3 donor construct.

[0158] In some embodiments, if protospacer-adjacent motifs (PAMs) and CRISPR target sites are present in the FOXP3 donor constructs described herein, these sites can be removed by mutating the PAM sequence to prevent Cas9-mediated cleavage of the FOXP3 donor construct. For example, in one donor construct described herein, the PAM sequence present in the FOXP3 portion of the FOXP3 donor construct is disrupted by a silent mutation (G7135A) at the terminal nucleotide of the Cas9, NGG-invariant PAM, thereby preventing Cas9-mediated cleavage within each FOXP3 donor construct.

[0159] In some embodiments, the FOXP3 donor construct includes a bidirectional promoter located between the FOXP3 intron and / or exon sequences of the FOXP3 donor construct and a polynucleotide encoding a selectable marker gene.

[0160] In some embodiments, a selectable marker gene is any gene that can distinguish non-FOXP3 donor construct-modified cells from non-FOXP3 donor construct-modified cells. For example, a selectable marker gene may be a gene whose encoded protein is not present on cells targeted by the FOXP3 donor construct. In some embodiments, a selectable marker gene may be a gene whose encoded protein is present on cells targeted by the FOXP3 donor construct in very small amounts, such as undetectable by cell surface protein labeling assays.

[0161] For example, in some embodiments, the cells manipulated with the FOXP3 donor construct are T cells, NK T cells, or HSPCs, and the selectable marker gene is a neuron-specific protein. In some embodiments, the cells manipulated with the FOXP3 donor construct are hematopoietic stem cells, and the selectable marker gene is a protein expressed only in non-hematopoietic stem cells. These examples are, in principle, illustrative of selectable marker genes and should not be understood as being limited to illustrative disclosures. Those skilled in the art can readily devise selectable marker genes for other manipulated cell types based on their technical knowledge of cell type expression patterns.

[0162] In some embodiments, the manipulated cells are T cells, and the selectable marker gene encodes a truncated neuron growth factor receptor protein (e.g., low affinity NGFR, LNFGR).

[0163] In some embodiments, the FOXP3 donor construct polynucleotide is packaged in an adeno-associated virus vector (AAV) and / or encoded by plasmid DNA and / or packaged in a lentiviral vector and / or packaged in a protein-capped adenovirus vector (AdV). AAV vectors, lentiviral vectors, and AdV vectors have proven successful in gene transfer practice due to their lack of genotoxic side effects.

[0164] In certain aspects of this disclosure, a CRISPR gene editing system is used to generate FOXP3-expressing cells. CRISPR-based genome editing methods offer advantages over conventional lentiviral methods of gene addition. These advantages include, but are not limited to, targeted introduction of a selective promoter in the endogenous FOXP3 gene and regulated or constitutive expression of FOXP3 in gene-edited cells.

[0165] In some embodiments, the FOXP3 homologous donor vector contains a CRISPR / Cas9 polynucleotide comprising a CRISPR / Cas9 system that cleaves the endogenous FOXP3 gene at a target site of sgRNA. After cleavage, the FOXP3 homologous donor vector then replaces part or all of the endogenous copy of the FOXP3 gene with a desired FOXP3 polynucleotide donor construct contained within the FOXP3 homologous polynucleotide donor vector using homology-directed repair in hematopoietic cells, thereby converting the cells into gene-edited cells. For example, a nucleic acid coding portion, or a FOXP3 transcription factor, can be inserted into a FOXP3 homologous donor vector to generate a vector in which the endogenous copy of FOXP3 can be replaced with a FOXP3 gene containing a selectable marker gene inserted between the Treg-specific demethylation region (TSDR) and the second exon of FOXP3, or between the second and third exons of FOXP3, or between the third and fourth exons of FOXP3, or FOXP3 It is expressed between the fourth and fifth exons, or between the fifth and sixth exons of FOXP3, or between the sixth and seventh exons of FOXP3, or between the seventh and eighth exons of FOXP3, or between the eighth and ninth exons of FOXP3, or between the ninth and tenth exons of FOXP3, or between the tenth to eleventh exons of FOXP3, or between the eleventh and twelfth exons of FOXP3.

[0166] In some embodiments, the recombinant FOXP3 homologous donor vector comprises a) a 5' homology arm, b) a polynucleotide encoding a portion of FOXP3 or all of FOXP3 or a variant thereof, c) optionally a polyadenylated sequence, d) a polynucleotide encoding a selectable marker, e) at least one promoter operably ligated to a polynucleotide encoding a portion of FOXP3 or all of FOXP3 or a variant thereof, and the polynucleotide encoding a cell surface marker, and f) a 3' homology arm.

[0167] In some embodiments, the FOXP3 homologous donor vector comprises two or more promoters, one promoter operably ligated to a polynucleotide encoding part or all of FOXP3 or a variant thereof, and the other promoter operably ligated to a polynucleotide encoding a selectable marker.

[0168] In some embodiments, the FOXP3 homologous donor vector comprises a single promoter, which is bidirectional and promotes the transcription of polynucleotides encoding part or all of FOXP3 or its variant, and polynucleotides encoding a selectable marker.

[0169] In some embodiments, the bidirectional promoters include: elongation factor 1 alpha (EF1α)-cytomegalovirus (CMV) enhancer / actin promoter, EF1α-phosphoglycerate kinase (PGK) enhancer / PGK minimal promoter, EF1α-PGK enhancer / 2×PGK minimal promoter, EF1α-PGK enhancer / 4×PGK minimal promoter, EF1α-CMV enhancer / 2×EF1α promoter, EF1α-PGK enhancer / 2×EF1α promoter, EF1α-PGK enhancer / 4×EF1α promoter, PGK minimal promoter-PGK enhancer / 4PGK minimal promoter, and beta-actin. Selected from the following: -beta-globin (AG)-CMV enhancer / 2×actin promoter, AG-CMV enhancer / 4×actin promoter, actin promoter-CMV enhancer / PGK enhancer / 2×CMV enhancer / actin promoter, actin promoter-CMV enhancer / PGK enhancer / 4×CMV enhancer / actin promoter, actin promoter-CMV enhancer / 2×PGK enhancer / 2×CMV enhancer / 2×actin promoter, or actin promoter-CMV enhancer / 3×PGK enhancer / 2×CMV enhancer / 3×actin promoter.

[0170] In some embodiments, the bidirectional promoter is a ubiquitin promoter. In some embodiments, the bidirectional promoter is a ubiquitin C promoter. In some embodiments, the bidirectional promoter is a human ubiquitin C promoter. In some embodiments, the ubiquitin C promoter contains the minimum CMV promoter element.

[0171] In some embodiments, the bidirectional promoter is a PGK promoter. In some embodiments, the bidirectional promoter is a human PGK promoter. In some embodiments, the human PGK promoter includes a minimal CMV promoter element.

[0172] In some embodiments, a bidirectional promoter is a constitutive promoter. In some embodiments, a bidirectional promoter is a regulatory promoter. In some embodiments, a bidirectional promoter is a tissue-specific promoter. In some embodiments, a bidirectional promoter is a ubiquitous promoter.

[0173] In some embodiments, the bidirectional promoter is a regulated promoter containing multiple tet operator sequences (tetO) of the Escherichia coli Tn10 tetracycline-resistant operon adjacent to two minimal promoters. In some embodiments, each minimal promoter contains the sequence positions -53 to +75 of the human cytomegalovirus IE promoter (hCMV IE promoter). In some embodiments, the regulated promoter contains 1 to 10 tet operators. In some embodiments, the regulated promoter contains 7 tet operators. In some embodiments, the cell containing the regulated promoter further contains a fusion between a Tet repressor (TetR) and herpes simplex virus protein 16 (VP16), named reverse transcription activator (rTA). In the absence of tetracycline, tTA binds to tet operators and activates transcription from the minimal promoter, but in the presence of tetracycline, its association and consequently its transcriptional activation are prevented.

[0174] In some embodiments, cells containing a modulopromoter further include a fusion between a Tet repressor (TetR) and herpes simplex virus protein 16 (VP16), named transcription activator (TA). In the absence of tetracycline, TA does not bind to the tet operator, and transcription from the minimal promoter does not occur. In the presence of tetracycline, its association and consequently its transcriptional activation are induced, thereby allowing the modulopromoter to promote transcription in opposite directions of the polynucleotides operably linked to each minimal promoter.

[0175] In some embodiments, a regulated promoter is located upstream of the first exon of FOXP3, and the first FOXP3 exon is operably ligated to one of the minimal promoters of the regulated promoter. In some embodiments, a minimal promoter located opposite the tet operator, compared to the minimal promoter operably ligated to the first exon of FOXP3, is operably ligated to a polynucleotide sequence encoding a selectable gene. Thus, in some embodiments, when the tet operator binds to tetracycline, the first minimal promoter promotes transcription of the first FOXP3 exon, while the second minimal promoter promotes transcription of the polynucleotide encoding a selectable gene in the opposite direction.

[0176] In some embodiments, a first minimal promoter promotes the transcription of a first FOXP3 exon, while a second minimal promoter promotes the transcription of a polynucleotide encoding a gene that is selectable in the opposite direction in the absence of tetracycline, and transcription from both minimal promoters is stopped when the tet operator binds to tetracycline.

[0177] In some embodiments, the minimal promoter located adjacent to the tet operator is a separate promoter. For example, in some embodiments, one minimal promoter is the hCMV IE promoter and the second minimal promoter is the 5' long-term repeat of mouse mammary cancer virus (MMTV) (5'LTR MMTV promoter, e.g., Hoffman et al. PNAS 93: 5185-90, 1997). In some embodiments, one minimal promoter is the hCMV IE promoter and the second minimal promoter is the human immunodeficiency virus type 1 (HIV-1) promoter (HIV-1 promoter, e.g., Baron et al. Nucl. Acids Res. 23: 3605-06, 1995 and Baron et al., Journal of Molecular and Genetic Medicine 2(1): 107-18, 2006). In some embodiments, one minimal promoter is the 5'LTR MMTV promoter and the second minimal promoter is the minimal HIV-1 promoter. In some embodiments, the tunable bidirectional promoters are the bidirectional PtetA and PtetR promoters disclosed in Nguyen et al., Mol. Imaging Biol. 24: 82-92, 2022.

[0178] It should be noted that any minimal promoter may be used in the polynucleotide constructs of this disclosure, as long as it promotes transcription in opposite directions. It should be further noted that any inducible system may be used in this disclosure, as long as the inducible element is located between two promoters that promote transcription in opposite directions.

[0179] In some embodiments, the polynucleotides of this disclosure include recombinant FOXP3 homologous donor vector constructs.

[0180] In some embodiments, the recombinant FOXP3 homologous donor vector comprises a portion or all of the nucleotide sequence of SEQ ID NO: 1, or a sequence having at least about 80-100% sequence identity with the nucleotide sequence of SEQ ID NO: 1, and includes any percentage of sequence identity within this range, such as 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99%, in which case the recombinant FOXP3 homologous donor vector can generate Treg-like cells by transfection of CD4+ T lymphocytes.

[0181] In the embodiments described herein, the FOXP3 donor construct of this disclosure is inserted "downstream" of the TSDR with respect to its "upstream" position in exons 2–12 of the FOXP3 gene. This means that the FOXP3 donor construct is inserted anywhere between the TSDR and exons 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the FOXP3 gene.

[0182] In some embodiments, the 5' homology arm includes the nucleic acid sequence of a FOXP3 exon or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of a FOXP3 intron or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of a FOXP3 T cell-specific demethylation region (TSDR). In some embodiments, the 5' homology arm includes the nucleic acid sequence of a portion of FOXP3 intron 1 located between the TSDR and exon 2 of the FOXP3 gene.

[0183] In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 exon 2 or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 intron 2 or a portion thereof, where intron 2 is located between exon 2 and exon 3 of the FOXP3 gene.

[0184] In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 exon 3 or a portion thereof. In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP intron 3 or a portion thereof, where intron 3 is located between exon 3 and exon 4 of the FOXP3 gene.

[0185] In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 exon 4 or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 intron 4, which is located between exon 4 and exon 5 of the FOXP3 gene.

[0186] In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 exon 5 or a portion thereof. In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 intron 5, which is located between exon 5 and exon 6 of the FOXP3 gene.

[0187] In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 exon 6 or a portion thereof. In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 intron 6, which is located between exon 6 and exon 7 of the FOXP3 gene.

[0188] In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 exon 7 or a portion thereof. In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 intron 7, which is located between exon 7 and exon 8 of the FOXP3 gene.

[0189] In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 exon 8 or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 intron 8, which is located between exon 8 and exon 9 of the FOXP3 gene.

[0190] In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 exon 9 or a portion thereof. In some embodiments, the 5' homology arm comprises the nucleic acid sequence of FOXP3 intron 9, which is located between exon 9 and exon 10 of the FOXP3 gene.

[0191] In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 exon 10 or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 intron 10, which is located between exon 10 and exon 11 of the FOXP3 gene.

[0192] In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 exon 11 or a portion thereof. In some embodiments, the 5' homology arm includes the nucleic acid sequence of FOXP3 intron 11, which is located between exon 11 and exon 12 of the FOXP3 gene.

[0193] In some embodiments, the 3' homology arm includes the nucleic acid sequence of the FOXP3 exon or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of the FOXP3 intron or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of the FOXP3 exon 2 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of a portion of the FOXP3 intron 1, the portion of intron 1 located between the TSDR and exon 2 of the FOXP3 gene.

[0194] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 3 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 2, which is located between exon 2 and exon 3 of the FOXP3 gene.

[0195] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 4 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 3, which is located between exon 3 and exon 4 of the FOXP3 gene.

[0196] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 5 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 4, which is located between exon 4 and exon 5 of the FOXP3 gene.

[0197] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 6 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 5, which is located between exon 5 and exon 6 of the FOXP3 gene.

[0198] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 7 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 6, which is located between exon 6 and exon 7 of the FOXP3 gene.

[0199] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 8 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 7, which is located between exon 7 and exon 8 of the FOXP3 gene.

[0200] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 9 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 8, which is located between exon 8 and exon 9 of the FOXP3 gene.

[0201] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 10 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 9, which is located between exon 9 and exon 10 of the FOXP3 gene.

[0202] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 11 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 10, which is located between exon 10 and exon 11 of the FOXP3 gene.

[0203] In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 exon 12 or a portion thereof. In some embodiments, the 3' homology arm includes the nucleic acid sequence of FOXP3 intron 11, which is located between exon 11 and exon 12 of the FOXP3 gene.

[0204] In some embodiments, the FOXP3 nucleic acid and protein sequences may originate from any source. Numerous FOXP3 nucleic acid and protein sequences are publicly known. Representative examples of human FOXP3 sequences are presented in NCBI entry NG_007392, and additional representative sequences, including various isoforms of the FOXP3 transcription factor, are listed in the National Center for Biotechnology Information (NCBI) database, and these sequences are incorporated herein by reference (see, for example, NCBI entries: acceptance numbers NM_001114377 and NM_014009). Any of these sequences or their variants, including sequences having at least approximately 80–100% sequence identity with the sequence, including any percentage identity within this range, for example, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity, can be used to construct a FOXP3 homologous donor construct, in which the expressed variant FOXP3 retains biological activity, including transcription factor activity and the ability to convert CD4+ T lymphocytes, and includes introducing NK T cells, or HSPCs, into engineered FOXP3 T cells.

[0205] In some embodiments, the selectable markers are cell surface marker genes for in vitro selection and in vivo tracking of cells transduced with the FOXP3 donor vector.

[0206] In some embodiments, the selectable marker gene is selected from polynucleotides encoding B cell surface proteins or neuron cell surface proteins.

[0207] In some embodiments, the B cell surface protein is the CD19, CD22, or CD123 protein. In some embodiments, the selectable marker is a polynucleotide encoding the cleaved CD19, CD22, or CD123 protein, and the cleaved CD19, CD22, or CD123 protein lacks an intracellular signaling domain.

[0208] In some embodiments, the neuronal cell surface proteins are olfactory receptors. In some embodiments, the olfactory receptors are olfactory receptor 2M5, olfactory receptor 2A25, olfactory receptor 6C74, olfactory receptor 14I1, olfactory receptor 5H15, olfactory receptor 6C68, olfactory receptor 5K3, olfactory receptor 6C6, olfactory receptor 51F1, olfactory receptor 2T8, olfactory receptor 4C46, olfactory receptor 5H14, olfactory receptor 5H1, olfactory receptor 6C75, olfactory receptor 5B21, olfactory receptor 2AG2, olfactory receptor 6C76, olfactory receptor 5K4, olfactory receptor 4C45, olfactory receptor 2AT4, or olfactory receptor 7C2.

[0209] In some embodiments, the selectable genes are truncated nerve growth factor receptor genes, as described by Fehse et al. Human Gene Therapy 8(15): 1815-24, 2008.

[0210] In some embodiments, the cell surface marker is the low-affinity nerve growth factor receptor (LNGFR). In some embodiments, the LNGFR lacks intracellular signaling components and is referred to herein as the low-affinity cleaved NGFR. In some embodiments, the LNGFR contains a wild-type LNGFR extracellular domain containing four TNFR cysteine-rich NGFR domains and a serine / threonine-rich stalk. In some embodiments, the LNGFR contains only four TNFR cysteine-rich domains. In some embodiments, the LNGFR contains a mutated long LNGFR construct containing four TNFR cysteine-rich domains and a stalk, but the fourth domain is largely deleted to avoid NGF signaling (Yan H, Chao MV. Disruption of cysteine-rich repeats of the p75 nerve growth factor receptor results in loss of ligand binding. J Biol Chem (1991) 266(18):12099-104). In some embodiments, the LNGFR comprises a mutant short LNGFR containing only four TNFR cysteine-rich domains having a variant of the fourth domain.

[0211] In some embodiments, the FOXP3 donor construct includes a polynucleotide encoding a therapeutic protein. In some embodiments, the polynucleotide encoding the therapeutic protein is under the control of a bidirectional promoter. In some embodiments, the polynucleotide encoding the therapeutic protein is under the control of a separate promoter.

[0212] In some embodiments, a therapeutic protein is a protein that can treat an autoimmune disorder or condition. In some embodiments, a therapeutic protein is a protein that can prevent or improve an autoimmune disease or symptom. In some embodiments, a therapeutic protein is a protein that can treat allograft rejection. In some embodiments, a therapeutic protein is a protein that can prevent or improve allograft rejection. In some embodiments, a therapeutic protein is a protein that can treat xenograft rejection. In some embodiments, a therapeutic protein is a protein that can prevent or improve xenograft rejection.

[0213] In some embodiments, the therapeutic protein is a cytokine. In some embodiments, the cytokine is an inhibitory cytokine. In some embodiments, the inhibitory cytokine is interleukin-10, interleukin-35, or TGF-β. In some embodiments, the therapeutic protein is granzyme B. In some embodiments, the therapeutic protein is indoleamine-2,3-dioxygenase. In some embodiments, the protein is an anti-IL-2 antibody or a fragment thereof. In some embodiments, the therapeutic protein is an autoantigen involved in the development and / or maintenance of an autoimmune disease or disorder. In some embodiments, the therapeutic protein is an antigen involved in the development and / or maintenance of allograft rejection. In some embodiments, the therapeutic protein is an antigen involved in the development and / or maintenance of xenograft rejection.

[0214] In some embodiments, the polynucleotide encoding the cell surface marker includes a polyadenylation (polyA) site. In some embodiments, polyA is SV40 polyA.

[0215] The polynucleotides disclosed herein may further comprise one or more inverted end repeats (ITRs). In some embodiments, the polynucleotide comprises a first ITR and a second ITR. In some embodiments, the polynucleotide comprises a first ITR, e.g., a 5' ITR, and a second ITR, e.g., a 3' ITR. Typically, ITRs are involved in the replication and rescue or removal of parvovirus (e.g., adeno-associated virus (AAV)) DNA from prokaryotic cell plasmids (Samulski et al., 1983, 1987; Senapathy et al., 1984; Gottlieb and Muzyczka, 1988). Furthermore, ITRs appear to be the minimal sequences necessary for AAV proviral integration and the packaging of AAV DNA into virions (McLaughlin et al., 1988; Samulski et al., 1989). These elements are essential for the efficient proliferation of parvovirus genomes. In some embodiments, the ITR folds into a hairpin T-shaped structure. In some embodiments, the ITR folds into a non-T-shaped hairpin structure, such as a U-shaped hairpin structure.

[0216] In some embodiments, the ITRs useful to this disclosure include ITRs derived from AAV genomes. In certain embodiments, the ITR is an ITR from an AAV genome selected from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, and any combination thereof. In some embodiments, the ITR is an ITR from an AAV2 genome. In some embodiments, the ITR is a synthetic sequence genetically engineered to include ITRs derived from one or more AAV genomes at its 5' and 3' ends.

[0217] In some embodiments, the ITR does not originate from the AAV genome. In some embodiments, the ITR is a non-AAV ITR. In some embodiments, the ITR is a non-AAV genome ITR of a Parvoviridae origin, selected from the group consisting of, but not limited to, bocavirus, dependovirus, erythrovirus, amdovirus, parvovirus, densovirus, iteravirus, contravirus, abeparvovirus, copyparvovirus, protoparvovirus, tetraparvovirus, ambidensovirus, brevidensovirus, hepandensovirus, penstildensovirus, and any combination thereof. In certain embodiments, the ITR originates from erythrovirus parvovirus B19 (human virus). In some embodiments, the ITR originates from a Muscovyduck parvovirus (MDPV) strain. In certain embodiments, the MDPV strain, e.g., MDPV strain FZ91-30, is attenuated. In some embodiments, the MDPV strain is pathogenic, e.g., MDPV strain YY. In some embodiments, the ITR is derived from porcine parvovirus, e.g., porcine parvovirus U44978. In some embodiments, the ITR is derived from mouse microvirus, e.g., mouse microvirus U34256. In some embodiments, the ITR is derived from canine parvovirus, e.g., canine parvovirus M19296. In some embodiments, the ITR is derived from mink enteritis virus, e.g., mink enteritis virus D00765. In some embodiments, the ITR is derived from dependent parvovirus. In certain embodiments, the dependent parvovirus is a dependent goose parvovirus (GPV) strain. In some embodiments, the GPV strain, e.g., GPV strain 82-0321V, is attenuated. In some embodiments, the GPV strain is pathogenic, e.g., a GPV strain.

[0218] The polynucleotides disclosed herein may also include mammalian origins of replication (e.g., Epstein-Barr virus origins) to maintain the vector outside the chromosome and produce multiple copies of the vector within the cell.

[0219] In some embodiments, the 3'UTR poly(A) tail sequence is the 3'UTR SV40 poly(A) tail sequence (SEQ ID NO: XX), the 3'UTR bovine growth hormone (bGH) poly(A) tail sequence (SEQ ID NO: XX), the 3'UTR actin poly(A) tail sequence, the 3'UTR hemoglobin poly(A) tail, the LTR poly(A) tail, the human growth hormone (hGH) poly(A) tail, or the human β-globin poly(A) tail, or any combination thereof.

[0220] In some aspects of this disclosure, a TALEN gene editing system is used to generate FOXP3-expressing cells. TALEN-based genome editing methods offer the advantages of targeted introduction of a selective promoter in the endogenous FOXP3 gene and regulated or constitutive expression of FOXP3 in gene-edited cells.

[0221] In some aspects of this disclosure, a zinc finger nuclease gene editing system is used to generate FOXP3-expressing cells.

[0222] In certain aspects of this disclosure, a meganuclease gene editing system is used to generate FOXP3-expressing cells.

[0223] In some aspects of this disclosure, a restriction endonuclease gene editing system is used to generate FOXP3-expressing cells.

[0224] Polynucleotide delivery The polynucleotides described above can be delivered using a viral vector. In some embodiments, the polynucleotides are provided within the viral vector. In some embodiments, the viral vector containing the polynucleotides described herein includes an additional DNA segment which is part of the genome of the viral vector used and helps generate viral particles for the delivery of the polynucleotides described herein. In some embodiments, the viral vector includes, but is not limited to, adenovirus vectors, adeno-associated virus (AAV) vectors, retrovirus vectors, lentivirus vectors, poxvirus vectors, baculovirus vectors, herpesvirus vectors, monkey virus 40 (SV40), cytomegalovirus (CMV), mouse mammary cancer virus (MMTV), and Moloney's mouse leukemia virus.

[0225] In some embodiments, the polynucleotides described herein are delivered to cells using nonviral delivery methods. In some embodiments, nonviral delivery includes plasmid electroporation. In some embodiments, nonviral delivery includes lipids. In some embodiments, the lipids are lipid vesicles. In some embodiments, the lipid vesicles are micelles, liposomes, lipid nanoparticles, or extracellular vesicles. In some embodiments, the polynucleotides described herein are delivered to cells using electroporation. In some embodiments, the proteins described herein are delivered to cells using electroporation. In some embodiments, the polynucleotides described herein are delivered to cells using lipid vesicles. In some embodiments, the proteins described herein are delivered to cells using lipid vesicles.

[0226] In some embodiments, two or more delivery methods are used together or sequentially to deliver the polynucleotides and / or proteins described herein to cells. For example, in some embodiments, polynucleotides containing the FOXP3 donor construct may be delivered to cells in a viral vector, and nuclease proteins may be delivered using lipid vesicles or electroporation. In some embodiments, polynucleotides containing the FOXP3 donor construct may be delivered using plasmids and electroporation, and plasmids or lipid vesicles and nucleases may be delivered using viral vectors, lipid vesicles, or electroporation and plasmids or nuclease proteins.

[0227] composition This disclosure provides a pharmaceutical composition comprising the polynucleotides of this disclosure and at least one pharmaceutically acceptable excipient.

[0228] In some embodiments, the Disclosure provides a gene therapy composition comprising the polynucleotides of the Disclosure and at least one pharmaceutically acceptable excipient.

[0229] In some embodiments, the composition comprises a FOXP3 donor polynucleotide construct, vector, or nuclease described herein in a physiologically acceptable carrier, excipient, or stabilizer. The acceptable carrier, excipient, or stabilizer is non-toxic to the recipient at the dose and concentration employed.

[0230] The carrier may be a diluent, adjuvant, excipient, or vehicle to which the FOXP3 donor construct, vector, or nuclease is administered. Such pharmaceutical carriers may be sterile liquids such as water and oil, including those of petroleum, animal, plant, or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, glycerol polyethylene glycol ricinoleate, etc. Water or aqueous saline solution and aqueous solutions of dextrose and glycerol may be used as carriers, particularly for injectable solutions. Liquid compositions for parenteral administration may be formulated for administration by injection or continuous infusion. Routes of administration by injection or infusion include intravesical, intratumoral, intravenous, intraperitoneal, intramuscular, subarachnoid, and subcutaneous. Depending on the route of administration (e.g., intravenous, subcutaneous, intra-articular, etc.), the active compound may be coated with a material to protect it from acids and other natural state effects that may inactivate the compound. For example, pharmaceutical compositions may be formulated for parenteral administration, e.g., intravenous. Compositions used for in vivo administration can be sterilized. This can be easily achieved, for example, by filtration through a sterile filtration membrane. The pharmaceutical compositions described herein are one embodiment for use as pharmaceuticals.

[0231] In some embodiments, the compositions of this disclosure include adjuvants such as preservatives, humectants, emulsifiers, and dispersants. The presence of microorganisms can be avoided by the sterilization procedures described above, or by the inclusion of various antimicrobial and antifungal agents, such as parabens, chlorobutanol, phenol, and sorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride in the composition. Furthermore, long-term absorption of injectable pharmaceutical forms can be achieved by the inclusion of absorption-delaying agents such as aluminum monostearate and gelatin.

[0232] Method for producing polynucleotides A method is provided for producing polynucleotides for the expression of FOXP3. In some embodiments, the method comprises providing a first nucleotide sequence comprising a coding strand and a target locus, wherein the coding strand comprises one or more regulatory elements and the FOXP3 gene, and the target locus comprises an intron sequence of the FOXP3 gene. In some embodiments, the method further comprises providing a second nucleic acid sequence. In some embodiments, the method further comprises providing a nuclease. In some embodiments, the method further comprises performing a gene editing process on the first nucleotide sequence to edit the intron sequence and insert the second nucleic acid into the target locus. In some embodiments, the insertion of the second nucleic acid results in the expression of FOXP3.

[0233] In some embodiments, the target locus is a genomic locus. In some embodiments, the second nucleotide sequence includes a heterologous promoter operably ligated to a polynucleotide containing at least one FOXP3 exon or a portion thereof. In some embodiments, the second nucleotide sequence further includes a polynucleotide encoding a selectable marker protein.

[0234] In some embodiments, the heterologous promoter is a bidirectional promoter. In some embodiments, when a second nucleic acid is inserted into the target locus, the promoter controls the transcription of a polynucleotide containing at least one FOXP3 exon or a portion thereof, and a polynucleotide encoding a selectable marker protein. In some embodiments, when a second nucleic acid is inserted into the target locus, the bidirectional promoter promotes the transcription of a polynucleotide containing at least one FOXP3 exon or a portion thereof in the direction of an additional exon of the FOXP3 gene, and the polynucleotide encodes a selectable marker protein in the opposite direction, for example, in the direction of the TSDR site.

[0235] In some embodiments, the promoter is a heterologous promoter. In some embodiments, the heterologous promoter is a bidirectional promoter that controls the reverse transcription of a polynucleotide containing at least one FOXP3 exon or a portion thereof, and a polynucleotide encoding a selectable marker protein.

[0236] In some embodiments, the selectable marker protein is a cell surface protein. In some embodiments, the selectable marker protein is a truncated low-affinity nerve growth factor receptor protein.

[0237] In some embodiments, the second nucleotide sequence comprises exons 1, 2, and 3 of FOXP3, and the target locus is located in the intron between exons 2 and 3 of the FOXP3 gene in the first nucleotide sequence.

[0238] In some embodiments, the second nucleotide sequence comprises exons 1, 2, 3, and 4 of FOXP3, and the target locus is located in the intron between exon 3 and exon 4 of the FOXP3 gene of the first nucleotide sequence.

[0239] How to use This disclosure also provides a method for stimulating T-cell suppressor function or inhibiting an immune response in a subject, the method comprising administering an effective amount of cells containing the FOXP3 donor construct disclosed herein to the subject. Furthermore, a method is provided for suppressing responder T cell activation by non-human cells, such as porcine cells, in a subject containing non-human cells, the method comprising administering an effective amount of cells containing the FOXP3 donor construct disclosed herein to the subject. A method is further provided for suppressing responder T cell activation by mismatched human donor cells in a subject containing mismatched human donor cells, the method comprising administering an effective amount of cells containing the FOXP3 donor construct disclosed herein to the subject.

[0240] This disclosure also provides a method for generating cells for therapy, comprising inserting a FOXP3 donor construct into cells, comprising inserting the FOXP3 donor construct into cells, comprising inserting the FOXP3 donor construct into cells, wherein the insertion of the FOXP3 donor construct activates the expression of the FOXP3 gene. In some embodiments, the cells receiving the FOXP3 donor construct are T cells, NK T cells, or HSPCs. This disclosure provides a method for generating a persistent population of genetically engineered cells in a subject, the method comprising administering to the subject cells genetically engineered to express the FOXP3 donor construct polynucleotide disclosed herein. In some embodiments, the method comprises culturing the cells under appropriate conditions. In some embodiments, the method comprises expanding the cells under appropriate conditions before administering the cells to the subject.

[0241] In some embodiments, polynucleotides containing the FOXP3 donor construct are used to transduce hematopoietic cells. In some embodiments, the hematopoietic cells are hematopoietic stem cells. In some embodiments, the hematopoietic cells are hematopoietic progenitor cells. In some embodiments, the hematopoietic cells are NK T cells. In some embodiments, the hematopoietic cells are lymphocytes. In some embodiments, the lymphocytes are T lymphocytes. In some embodiments, the T lymphocytes are CD4+ T lymphocytes. In some embodiments, the T lymphocytes are Treg cells.

[0242] In some embodiments, hematopoietic cells are optionally purified before or after gene editing by any method known in the art, including but not limited to density gradient centrifugation (e.g., Ficoll Hypaque, percoll, iodoxanol, and sodium metrizoate), immunoselection using immunomagnetic beads or immunoaffinity columns (positive or negative selection for surface markers), or fluorescence-activated cell sorting (FACS). For example, CD4+ T lymphocytes, CD34+ HSPCs, or NK T cells may be isolated from apheresis products by immunomagnetic cell selection, cultured in the presence of IL-2 and IL-7, then transfected or transduced with a FOXP3 homologous donor vector, followed by immunoselection for a cell surface marker (e.g., LNGFR) expressed by the recombinant FOXP3 homologous donor vector, allowing the gene-edited cells to be separated from non-gene-edited cells.

[0243] In some embodiments, hematopoietic cells are hematopoietic stem cells, obtained from bone marrow, or from the subject's peripheral blood or umbilical cord blood. In some embodiments, bone marrow is aspirated from the posterior iliac crest while the donor is under either local or general anesthesia. Additional bone marrow can be obtained from the anterior iliac crest. In some embodiments, 1 × 10⁶ per kilogram 8 ~2×10 8 A dose of bone marrow mononuclear cells is considered the desirable dose for establishing engraftment in autologous and / or allogeneic bone marrow transplantation. In some embodiments, the bone marrow is initially stimulated with granulocyte colony-stimulating factor (G-CSF; filgrastim [Neupogen]) to increase the number of stem cells.

[0244] In some embodiments, the target stem cells are recruited from the bone marrow into the peripheral blood by administration of cytokines such as G-CSF or GM-CSF, and peripheral blood progenitor cells are collected by apheresis. In some embodiments, a dose of G-CSF used for recruitment can be given at approximately 10 μg / kg / day to approximately 40 μg / kg / day. In some embodiments, Mozobil® is used in conjunction with G-CSF to recruit and collect hematopoietic stem cells into the peripheral blood. In some embodiments, the stem cells are purified. In some embodiments, unpurified stem cells are used according to the methods disclosed herein. Stem cell purification methods include, but are not limited to, flow cytometry, isolex systems (see, e.g., Klein et al. (2001) Bone Marrow Transplant. 28(11):1023-9, Prince et al. (2002) Cytotherapy 4(2):137-45), and immunomagnetic separation (Prince et al. (2002) Cytotherapy 4(2):147-55, Handgretinger et al. (2002) Bone Marrow Transplant. 29(9):731-6, Chou et al. (2005) Breast Cancer. 12(3):178-88). Each of these references is specifically incorporated herein by reference, particularly with respect to procedures, cell compositions, and dosages for hematopoietic stem cell and progenitor cell transplantation.

[0245] In some embodiments, the minimum dose injected into the recipient for graft survival is 1 to 2 × 10¹⁶ units per kg of body weight for autografts and / or allografts. 6 These are individual CD34+ cells. The cells to be adopted may be fresh, frozen, or previously cultured. They may be fetal, neonatal, or adult. Hematopoietic stem cells may be obtained from fetal liver, bone marrow, umbilical cord blood, peripheral blood, particularly G-CSF or GM-CSF mobilized peripheral blood, or any other conventional source. Cells for engraftment are isolated from other cells arbitrarily, and the manner in which stem cells are isolated from other cells of hematopoiesis or other lineages is not important to this disclosure.

[0246] The resulting ability of manipulated FOXP3-expressing cells to respond to or suppress the proliferation and activation of effector T cells and other immune cells is incorporated herein by reference, as well as by performing, for example, but not limited to, manipulated FOXP3-expressing 3H-thymidine assays or flow cytometry-based suppression assays to measure the suppression of proliferation and cytokine production in subpopulations of T cells and other immune cells (see, for example, Thornton et al. (1998) J. Exp. Med. 1998. 188:287-296, Schneider et al. (2011) Methods Mal. Biol. 707:233-241, Baecher-Allan et al. (2005) Clin. lmmunol. 115:10-18, McMurchy et al. (2012) Eur. J. lmmunol. 42:27-34).

[0247] In some embodiments, FOXP3 production in cells transduced with a FOXP3 donor vector is assessed, for example, by using a real-time RT-PCR assay at the FOXP3 mRNA level or a Western blot assay at the FOXP3 protein level. In some embodiments, the ability of CRISPR / Cas9 and FOXP3 homologous donor vectors to confer physiological Treg characteristics to CD4+ T lymphocytes is assessed in vitro using proliferation or suppression assays disclosed herein.

[0248] In some embodiments, the use of polynucleotides comprising the FOXP3 donor construct described herein in the manufacture of a drug for treating a subject is provided.

[0249] In some embodiments, the use of polynucleotides comprising the FOXP3 donor construct described herein for treating a subject is provided.

[0250] Adaptation This disclosure provides a method for treating an autoimmune disease or condition, allograft rejection, or xenograft rejection in a subject requiring such treatment, the method comprising administering a therapeutically effective amount of the composition, pharmaceutical composition, polynucleotide, system, or cells described herein to the subject. The disclosure also provides a method for preventing or improving the symptoms of an autoimmune disease or condition, allograft rejection, or xenograft rejection in a subject requiring such treatment, the method comprising administering a therapeutically effective amount of the composition, pharmaceutical composition, polynucleotide, system, or cells described herein to the subject. In some embodiments, the compositions disclosed herein (e.g., polynucleotides encoding the FOXP3 donor construct of this disclosure, vectors containing polynucleotides encoding the FOXP3 donor construct of this disclosure, the FOXP3 donor construct of this disclosure, or cells expressing the FOXP3 donor construct of this disclosure) can be used to treat a disease or condition, for example, an autoimmune disease, allograft rejection, xenograft rejection, or any disease or condition in which suppression of the immune response results in a prophylactic or therapeutic effect. Allograft recipients treated with the compositions described herein include recipients of any organ or tissue that can be allografted, that is, transplanted between genetically non-identical individuals of the same species. Xenograft recipients treated with the compositions described herein include recipients of any organ or tissue that can be xenografted, that is, transplanted from one species to another. For example, in some embodiments, a xenograft recipient treated according to the methods disclosed herein is a kidney, heart, lung, or another organ or tissue of a different species from the recipient's species.

[0251] Autoimmune diseases or conditions are known to those skilled in the art and can be treated using the methods disclosed herein, regardless of the origin or source of the autoimmunity. In some embodiments, the diseases or disorders treated with the compositions, pharmaceutical compositions, polynucleotides, systems or cells described herein include lupus nephritis, anti-glomerular basement membrane nephritis, autoimmune hepatitis, primary biliary cholangitis, primary sclerosing cholangitis, anti-synthetase syndrome, interstitial cystitis, myocarditis, post-myocardial infarction syndrome, subacute bacterial endocarditis, alopecia areata, autoimmune angioedema, autoimmune urticaria, bullous pemphigus, herpetiform dermatitis, discoid lupus erythematosus, acquired epidermolysis bullosa, erythema nodosum, bullous pemphigoid of pregnancy, lichen planus, and lichen sclerosing. Linear IgA disease, Morphea, Pemphigus vulgaris, Psoriasis, Systemic scleroderma, Vitiligo, Addison's disease, Autoimmune polyendocrine syndrome types 1-3, Autoimmune pancreatitis, Type 1 diabetes, Autoimmune thyroiditis, Graves' disease, Endometriosis, Autoimmune orchitis, Sjögren's syndrome, Autoimmune enteropathy, Celiac disease, Crohn's disease, Esophageal achalasia, Ulcerative colitis, Antiphospholipid syndrome, Aplastic anemia, Autoimmune hemolytic anemia, Autoimmune lymphoproliferative syndrome, Autoimmune neutropenia, Autoimmune thrombocytopenic purpura, Cold agglutinin disease, Essential purpura Cryoglobulinemia (combined form), Evans syndrome, pernicious anemia, aplastic erythropoiesis, thrombocytopenia, painful steatosis, adult-onset Still syndrome, ankylosing spondylitis, CREST syndrome, drug-induced lupus, enthesitis-associated arthritis, eosinophilic fasciitis, juvenile arthritis, chronic Lyme disease, mixed connective tissue disease, relapsing rheumatoid arthritis, Parry-Romberg syndrome, Personage-Turner syndrome, psoriatic arthritis, relapsing polychondritis, retroperitoneal fibrosis, rheumatic fever, rheumatoid arthritis, sarcoidosis, Schnitzler syndrome, systemic lupus erythematosus Dermatomyositis, fibromyalgia, inclusion body myositis, myasthenia gravis, neuromuscular totonia, paraneoplastic cerebellar degeneration, polymyositis, acute disseminated encephalomyelitis, acute motor axonal neuropathy, anti-NMDA receptor encephalitis, chronic inflammatory demyelinating polyneuropathy, Guillain-Barré syndrome, Hashimoto's encephalopathy, idiopathic inflammatory demyelinating disease, Lambert-Eaton myasthenic syndrome, multiple sclerosis, progressive inflammatory neuropathy, restless legs syndrome, transverse myelitis, autoimmune retinopathy, autoimmune uveitis, Cogan's syndrome, Graves' ophthalmopathy, intermediate uveitis,This includes lignite conjunctivitis, Mohren's ulcer, neuromyelitis optica, opsoclonus-myoclonus syndrome, optic neuritis, scleritis, sympathetic ophthalmitis, autoimmune inner ear disease, Behçet's syndrome, eosinophilic granulomatosis with polyangiitis, giant cell arteritis, IgA vasculitis, Kawasaki disease, leukocytosis-destroying vasculitis, lupus vasculitis, rheumatic vasculitis, polyarteritis nodosa, polymyalgia rheumatica, or urticarial vasculitis.

[0252] Kits and manufactured products The Disclosure also provides (i) cells genetically modified to express the FOXP3 donor construct of the Disclosure, i.e., cells comprising one or more polynucleotides encoding the FOXP3 donor construct of the Disclosure, or one or more vectors encoding the FOXP3 donor construct of the Disclosure (e.g., hematopoietic cells, preferably T cells), or a pharmaceutical composition comprising cells, and optionally (ii) a kit comprising instructions for use. The Disclosure also provides manufactured articles comprising cells genetically modified to express the FOXP3 donor construct of the Disclosure, one or more polynucleotides encoding the FOXP3 donor construct of the Disclosure, or a pharmaceutical composition comprising the Pharmaceutical Composition of the Disclosure.

[0253] In some embodiments, the kit or product comprises in one or more containers at least a polynucleotide or vector encoding the FOXP3 donor construct of the Disclosure, a cell genetically modified to express the FOXP3 donor construct of the Disclosure, or a composition (e.g., a pharmaceutical composition) comprising the polynucleotide, vector, or cell disclosed herein.

[0254] In some embodiments, the kit or product includes at least a polynucleotide or vector encoding the FOXP3 donor construct of the Disclosure, a cell genetically modified to express the FOXP3 donor construct of the Disclosure, or a composition (e.g., a pharmaceutical composition) comprising the polynucleotide, vector, or cell disclosed herein, and optionally a brochure.

[0255] One of ordinary skill in the art will readily recognize that the polynucleotides, vectors, cells, and compositions of the present disclosure, pharmaceutical compositions comprising the polynucleotides, vectors, or cells of the present disclosure, or combinations thereof, can be readily incorporated into one of the established kit formats well-known in the art.

[0256] In some embodiments, a kit or product comprises, for example, a polynucleotide or vector encoding a FOXP3 donor construct of the present disclosure, or a composition (e.g., a pharmaceutical composition) comprising a polynucleotide, vector, and optionally a vial having a solvent, in a dried form in a container (e.g., a glass vial).

[0257] In some embodiments, a kit or product comprises, for example, a polynucleotide or vector encoding a FOXP3 donor construct of the present disclosure, or a composition (e.g., a pharmaceutical composition) comprising a polynucleotide, vector, at least one container, and another container having a transfection reagent.

[0258] In some embodiments, the present disclosure provides a kit or product comprising a gRNA for CRISPR / Cas9-mediated insertion in the FOXP3 gene, wherein the gRNA targets the recognition / insertion site ATCCACCGTTGAGAGCTGGG (SEQ ID NO: 1).

Examples

[0259] Example 1 - Preparation of Constructs Excluding the C-to-G mutation at site 7,121, the DNA sequence of the FOXP3 gene, including nucleotides 6,631-7,130 (SEQ ID NO: 2) and 7,131-7,630 (SEQ ID NO: 3) as found in PubMed acceptance number 50943, was newly synthesized using BioXP 3200. Sequences corresponding to FOXP3 exons 1, 2, 3, and 4 (SEQ ID NOs: 4, 5, 6, and 7) were newly synthesized and ligated to the 3' end of the synthetic sequence corresponding to nucleotides 6631-7130. The sequences of the bidirectional PGK promoter (SEQ ID NO: 8) or the bidirectional ubiquitin promoter (UbC) (SEQ ID NO: 10), both of which are the minicytomegalovirus (CMV) promoter (SEQ ID NO: 9), the low affinity nerve growth factor receptor gene lacking the intracellular signaling domain (NGFR) (SEQ ID NO: 11), and the SV40 poly(A) signal (SEQ ID NO: 12), were PCR amplified, and the PGK / mini CMV promoter and UbC / mini CMV promoter were cloned between the FOXP3 exon and NGFR-SV40-polyA, respectively, so that NGFR-SV40-polyA is transcribed in the opposite direction of the FOXP3 exon sequence. This large polynucleotide was cloned into a plasmid containing AAV2 inverted terminal repeats (SEQ ID NOs: 13 and 14) obtained from Cell Biolabs Inc. (https: / / www.cellbiolabs.com / aav-expression-and-packaging), and the AAV2-framed polynucleotide was substituted to construct the pAAV.FOXP3.PGKProm.NGFR and pAAV.FOXP3.UbCProm.NGFR constructs. Recombinant AAV6.FOXP3 vectors were generated in HEK293 cells using the AAV.FOXP3.NGFR polynucleotide, the AAV2-Rep-AAV6-Cap plasmid, and the Ad helper plasmid (obtained from Cell Biolabs Inc.). Furthermore, FOXP3 homology arms were inserted between the AAV ITR and the SV40 polynucleotide and FOXP3 exon 4, respectively.Therefore, the FOXP3.PGKprom.NGFR-ITR polynucleotide (SEQ ID NO: 15) contains an AAV-ITR, a PGK / mini CMV promoter located between the delta-LNGFR gene and FOXP3 exons 1-4, the SV40 poly downstream of the delta-LNGFR gene, and one FOXP3 homology arm between the SV40 poly and one AAV ITR, as well as another FOXP3 homology arm between FOXP3 exon 4 and the other AAV ITR. The FOXP3.UbCprom.NGFR-ITR polynucleotide (SEQ ID NO: 16) contains an AAV-ITR, a ubiquitin C / mini CMV promoter located between the delta-LNGFR gene and FOXP3 exons 1-4, the SV40 poly downstream of the delta-LNGFR gene, and one FOXP3 homology arm between the SV40 poly and one AAV ITR, as well as another FOXP3 homology arm between FOXP3 exon 4 and the other AAV ITR. Sequence Table 1

Table 1

[0260] Example 2 - General Procedure for CD4+ T Cell Manipulation Human PBMCs obtained by apheresis of healthy donor and viable CD4+ T cells were purified from the PBMCs by negative selection using the EasySep Human CD4+ T Cell Concentration Kit (STEMCELL Technologies), and then frozen for use or directly cultured for editing.

[0261] CD4+ T cells were thawed and 1 × 10⁶ anti-CD3 / anti-CD28 Dynabeads were added to T cell medium in a 1:1 bead:cell ratio. 6 Cells / ml were activated in T cell medium. CD4+ T cells in the absence of anti-CD3 / anti-CD28 Dynabeads were used as unstimulated control cells.

[0262] Thaw the AAV6.FOXP3.NGFR donor vector and apply the virus vector to 1 × 10 cells. 3 Each gene copy was added to a CD4+ T cell / Dynabead culture.

[0263] TracrRNA:crRNA complexes were annealed by combining 200 μM tracrRNA and 200 μM crRNA in a 1:1 ratio (each with a final concentration of 100 μM), incubated at 95°C for 5 minutes, and then cooled at room temperature for approximately 10 minutes. The crRNA target sequence used was ATCCACCGTTGAGAGCTGGG (SEQ ID NO: 1).

[0264] The ribonucleoprotein (RNP) complex was generated by mixing 17 μg of Cas9, 120 pmol of annealed RNA complex, and 100 pmol of ssODN (to enhance the electroporation of the RNP complex), and incubating the mixture at room temperature for 10 minutes.

[0265] Anti-CD3 / anti-CD28 Dynabead-stimulated CD4+ T cells were washed several times and resuspended in a complete P3 Nucleofector solution. Pre-formed RNP complexes were added to the T cell-nucleofector solution, and nucleofection was induced using either program CM-138 on Amaxa 4D-Nucleofector for stimulated cells versus unstimulated cells, or program DS-137 on Amaxa 4D-Nucleofector for unstimulated cells.

[0266] Next, FOXP3-engineered T cells were washed with StemCell RoboSep Buffer II and isolated using MAC isolation (Miltenyi Kit 130-099-023). For this purpose, approximately 10 μl of T cells in 60 μl of StemCell RoboSep buffer were used. 7 FOXP3-modified T cells were combined with 20 μl of Miltenyi FcR blocking reagent and 20 μl of Miltenyi CD271 microbead blocking reagent. The mixture was incubated at 4°C for 15 minutes, and the cells were separated on an LS MAC column. The experimental procedure is shown in Figure 3A. The modified T cells were either stored for further processing or submitted for FACS analysis for FOXP3 and cleaved NGFR expression. Flow cytometry analysis of the modified T cells revealed a population of T cells expressing both FOXP3 and cleaved NGFR (Figure 3B). Further culture of NGFR-selected and modified T cells for one week allowed for the purification of the population of FOXP3-modified cells (Figures 4A and 4B).

[0267] Engineered and purified FOXP3 T cells were tested for suppressor function by co-culturing them with CD25-CD4+ T cells (responder T cells) for 4 days, and then the responder T cells were assayed for proliferation as indicated by dilution of Cell Trace Violet. Responder T cells were also phenotypic analyzed for several surface markers that are indicators of T cell activation. Furthermore, the supernatant of the responder T cell cultures was collected and assayed for cytokines. Figure 5A shows flow cytometry scans of cell trace violet (x axis) and PD-1 expression (y axis) of unstimulated responder T cells or responder T cells stimulated with T cell stimulating reagents (anti-CD3, anti-CD28, anti-CD2). These are in the absence of engineered and purified FOXP3 Treg cells or co-culturified with engineered and purified FOXP3 Treg cells in different Treg vs. responsive T cell ratios. Unstimulated responder T cells did not proliferate (left panel of Figure 5A, 2.02% proliferative T cells), while 70.3% of stimulated responder T cells proliferated in the absence of engineered Tregs (right panel of Figure 5A). As the Treg-to-responder T cell ratio increased, the proportion of proliferating responder T cells decreased (Figure 5A, panels 1-6). Figure 5B shows histograms of replication indices for unstimulated and stimulated responder T cells after co-culture with engineered Tregs at different Treg-to-responder cell ratios. These data demonstrate that engineered purified Treg cells efficiently inhibited the proliferation of stimulated responder T cells.

[0268] Cell surface CD154, CD49d, PD-1, CD25, CD45RA, and CCR7 were detected on unstimulated responder T cells and responder T cells stimulated with T cell stimulants (anti-CD3, anti-CD28, anti-CD2) in the absence or presence of engineered FOXP3 T cells, at different Treg:responder T cell ratios. It can be easily observed that engineered FOXP3 Tregs prevented the upregulation of CD154, CD49d, PD-1, and CD25 on responder T cells (Figures 6A and 6B). Furthermore, engineered FOXP3 Treg cells prevented the downregulation of CD45RA and CCR7 on responder T cells (Figure 6C).

[0269] The secreted cytokines IL-2, IL-4, and IL-10 were measured in the supernatant of responder T cell cultures in unstimulated responder T cells and in the absence or presence of manipulated FOXP3 T cells with different Treg:responder T cell ratios, or in the presence of T cell stimulating reagents (anti-CD3, anti-CD28, anti-CD2). It can be easily observed that manipulated FOXP3 Tregs suppressed IL-2 secretion and increased the secretion of the 7A anti-inflammatory cytokines IL-10 and IL-4 (Figures 7B and 7C).

[0270] Example 3 - Generation of engineered FOXP3 T cells that specifically suppress responder T cell activation by porcine cells. Human PBMCs obtained by apheresis of healthy donor and viable CD4+ T cells were purified from the PBMCs by negative selection using the EasySep Human CD4+ T Cell Concentration Kit (STEMCELL Technologies), and then frozen for use or directly cultured for editing.

[0271] CD4+ T cells were thawed and 1 × 10⁶ anti-CD3 / anti-CD28 Dynabeads were added to T cell medium in a 1:1 bead:cell ratio. 6Cells / ml were activated in T cell medium. CD4+ T cells in the absence of anti-CD3 / anti-CD28 Dynabeads were used as unstimulated control cells.

[0272] Thaw the AAV6.FOXP3.NGFR donor vector and apply the virus vector to 1 × 10 cells. 3 Each gene copy was added to a CD4+ T cell / Dynabead culture.

[0273] TracrRNA:crRNA complexes were annealed by combining 200 μM tracrRNA and 200 μM crRNA in a 1:1 ratio (each with a final concentration of 100 μM), incubated at 95°C for 5 minutes, and then cooled at room temperature for approximately 10 minutes. The crRNA target sequence was ATCCACCGTTGAGAGCTGGG.

[0274] The ribonucleoprotein (RNP) complex was generated by mixing 17 μg of Cas9, 120 pmol of annealed RNA complex, and 100 pmol of ssODN (to enhance the electroporation of the RNP complex), and incubating the mixture at room temperature for 10 minutes.

[0275] Anti-CD3 / anti-CD28 Dynabead-stimulated CD4+ T cells were washed several times and resuspended in a complete P3 Nucleofector solution. Pre-formed RNP complexes were added to the T cell-nucleofector solution, and nucleofection was induced using either program CM-138 on Amaxa 4D-Nucleofector for stimulated cells versus unstimulated cells, or program DS-137 on Amaxa 4D-Nucleofector for unstimulated cells.

[0276] Next, FOXP3-engineered T cells were washed with StemCell RoboSep Buffer II and isolated using MAC isolation (Miltenyi Kit 130-099-023). For this purpose, approximately 10 μl of T cells in 60 μl of StemCell RoboSep buffer were used. 7Individual FOXP3-engineered T cells were combined with 20 μl of Miltenyi FcR blocking reagent and 20 μl of Miltenyi CD271 microbead blocking reagent, and the mixture was incubated at 4°C for 15 minutes. The cells were separated on an LS MAC column. The engineered FOXP3 T cells obtained from the LS MAC column were suspended in T cell medium with 400 U / ml of IL-2.

[0277] Fresh CD4+ cells from the same donor as the CD4+ cells used to generate the engineered FOXP3 Treg cells were used as responder T cells. Fresh CD4+ T responder cells were stained with Cell Trace Violet, and 1×10 6 Individual fresh CD4+ T responder cells were mixed with engineered FOXP3 Treg cells at ratios of 1:1, 1:2, 1:4, 1:8, and 1:16 Tregs per fresh CD4+ T responder cell. Equivalent 1×10 4 Individual fresh CD4+ T responder cells were incubated with 1×10 4 Individual primary porcine pulmonary artery endothelial cells. The cell mixture was incubated in a culture dish at 37°C + 5% CO2 for 7 days, and then the responder T cells were assayed for proliferation as indicated by dilution of Cell Trace Violet. Responder T cells were also phenotypically analyzed for activation surface markers.

[0278] To discriminate between responder T cells and engineered FOXP3 Treg cells, the cells were stained for NGFR prior to phenotypic analysis so that engineered FOXP3 Tregs expressing NGFR could be excluded from the phenotypic analysis.

[0279] Flow cytometry scans of Cell Trace Violet dilutions and CD25 expression in unstimulated responder T cells showed low proliferation, while scans of stimulated responder T cells in the absence of engineered Treg cells showed high cell proliferation (left two panels in Figure 8A). Responder T cell proliferation was reduced in the presence of engineered Treg cells with increasing Treg:responder T cell ratio (Figure 8A, comparing the seventh and third panels). The rate of maximal activation of stimulated responder T cells in the absence of engineered Treg cells was suppressed with increasing Treg:responder T cell ratio (Figure 8B), and the rate of maximal IFN-γ secretion was also suppressed with increasing Treg:responder T cell ratio (Figure 8C).

[0280] These results demonstrate that engineered FOXP3 Treg cells can efficiently suppress the activation of responder T cells stimulated by porcine cells. These results will influence the use of engineered FOXP3 Treg cells in xenotransplantation.

[0281] Example 5 - Generation of engineered FOXP3 T cells that specifically suppress responder T cell activation by mismatched human donor cells. Human PBMCs obtained by apheresis of healthy donor and viable CD4+ T cells were purified from the PBMCs by negative selection using the EasySep Human CD4+ T Cell Concentration Kit (STEMCELL Technologies), and then frozen for use or directly cultured for editing.

[0282] Fresh CD4+ cells, 1 × 10 4 A CD4+ T cell is divided into 1 × 10⁶ cells. 4Allogeneic hPAEC-stimulated CD4+ T cells were activated on allogeneic hPAEC-stimulated primary human pulmonary artery endothelial cells (allo-hPAECs) by incubation. The cell mixture was cultured at 37°C + 5% CO2 for 2 days. As a control, bulk Treg cells were generated using inactivated fresh CD4+ cells from the same donor. On day 2 of CD4+ T cell activation on allogeneic hPAECs, non-adherent CD4+ T cells were removed from adherent allogeneic hPAECs. Allogeneic hPAEC-stimulated CD4+ T cells were then washed, and 1 × 10⁶ of allogeneic hPAEC-stimulated T cells and non-stimulated T cells were collected. 6 T cells / ml T cell medium was incubated with 50 U / ml IL-2 and further cultured at 37°C + 5% CO2 for 1 day.

[0283] Thaw the AAV6.FOXP3.NGFR donor vector and apply the virus vector to 1 × 10 cells. 3 Each gene copy was added to a CD4+ T cell / Dynabead culture.

[0284] TracrRNA:crRNA complexes were annealed by combining 200 μM tracrRNA and 200 μM crRNA in a 1:1 ratio (each with a final concentration of 100 μM), incubated at 95°C for 5 minutes, and then cooled at room temperature for approximately 10 minutes. The crRNA target sequence was ATCCACCGTTGAGAGCTGGG (SEQ ID NO: 1).

[0285] The ribonucleoprotein (RNP) complex was generated by mixing 17 μg of Cas9, 120 pmol of annealed RNA complex, and 100 pmol of ssODN (to enhance the electroporation of the RNP complex), and incubating the mixture at room temperature for 10 minutes.

[0286] Allogeneic-hPAEC-stimulated and unstimulated T cells were washed several times and resuspended in a complete P3 Nucleofector solution. Pre-formed RNP complexes were added to the T cell-Nucleofector solution, and nucleofection was induced in allogeneic-hPAEC-stimulated cells using program CM-138 on the Amaxa 4D-Nucleofector. Unstimulated T control cells were nucleofected using DS-137 on the Amaxa 4D-Nucleofector.

[0287] Next, FOXP3-modified allogeneic-hPAEC-stimulated T cells and FOXP3-modified unstimulated T cells were incubated at room temperature for 5–10 minutes and then transferred to T cell medium for 1 day of culture. Subsequently, FOXP3-modified allogeneic-hPAEC-stimulated and unstimulated T cells were washed with StemCell RoboSep buffer II and isolated using MAC isolation (Miltenyi kit 130-099-023) as described above. The isolated FOXP3-modified allogeneic-hPAEC-stimulated and unstimulated T cells were incubated in 100 μl of T cell medium and 400 units / ml of IL-2.

[0288] Engineered allogeneic-hPAEC-stimulated and engineered unstimulated Treg cells were used as responder T cells, along with fresh CD4+ T cells from the same donor.

[0289] Fresh CD4+ responder T cells were mixed with FOXP3-manipulated allogeneic hPAEC-stimulated and unstimulated T cells in different Treg:responder T cell ratios of 1:1, 1:2, 1:4, 1:8, 1:16, and 1:32. Subsequently, 1 × 10⁻¹⁶ cells were mixed. 4 Individual fresh CD4+ T responder cells, 1 × 10⁶ 4 Individual allogeneic hPAEC-stimulated Treg cells and unstimulated Treg cells were mixed, and the cell mixture was incubated in a culture dish at 37°C + 5% CO2 for 7 days. Subsequently, responder T cells were assayed for proliferation as indicated by dilution of Cell Trace Violet, and phenotypic analysis was performed for activation surface markers.

[0290] To distinguish between responder T cells and engineered FOXP3 Treg cells, cells were stained for NGFR before phenotypic analysis so that engineered FOXP3 Tregs expressing NGFR could be excluded from the analysis.

[0291] Flow cytometry scans of Cell Trace Violet diluted cells and CD25 expression in unstimulated responder T cells showed low proliferation, while scans of stimulated responder T cells in the absence of engineered Treg cells showed high cell proliferation (top two panels of Figure 9). Responder T cell proliferation was suppressed in the presence of bulk engineered Treg cells and Treg cells directed towards target cells (directional Tregs) with an increased Treg:responder T cell ratio (Figure 9, second and third column panels).

[0292] In the absence of manipulated Treg cells, and in the presence of bulk Tregs or allogeneic hPAEC-specific Tregs, stimulated responder T cell activation showed efficient suppression of responder T cell activation at all Treg:responder T cell ratios (Figure 10A).

[0293] Furthermore, the proportion of maximum T cell activation in responder T cells in the presence of bulk Tregs or allogeneic hPAEC-specific Tregs also showed effective suppression of responder T cell activation in both Treg populations. Only at a Treg:responder T cell ratio of 1:32 were bulk Treg cells less efficient at suppressing responder T cell activation than allogeneic hPAEC-specific Tregs (Figure 10B).

[0294] These results demonstrate that engineered human pulmonary artery endothelial cell-specific FOXP3 Treg cells and engineered FOXP3 bulk Tregs can efficiently suppress responder T cell activation by human pulmonary artery endothelial cells. These results will influence the use of engineered FOXP3 Treg cells in cell and / or tissue transplantation.

[0295] The abstract and abstract section may describe one or more exemplary embodiments of the invention as envisioned by the inventors, and are therefore not intended to limit the scope of the invention and the appended claims in any way.

[0296] The present invention has been described above with the help of functional configuration blocks illustrating the implementation of the specified functions and their relationships. The boundaries of these functional configuration blocks are arbitrarily defined herein for the sake of convenience of description. Alternative boundaries can be defined, provided that the specified functions and their relationships are adequately implemented.

[0297] The foregoing descriptions of specific embodiments so fully reveal the general nature of the invention that others can readily modify and / or adapt such specific embodiments for various uses without departing from the general concept of the invention, without requiring any experimentation beyond what is necessary, by applying knowledge within the scope of the art of the art. Therefore, such adaptations and modifications are intended to be within the meaning and scope of equivalents of the disclosed embodiments, based on the teachings and guidance presented herein. It is understood that the language or terminology used herein is for descriptive purposes and not for restrictive purposes, and thereby the language or terminology used herein should be interpreted by those skilled in the art in light of the teachings and guidance.

[0298] The breadth and scope of the present invention should not be limited by any of the exemplary embodiments described above, but rather should be defined solely by the following claims and their equivalents.

[0299] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. Similar or equivalent methods and materials may be used in the practice or testing of the present invention, but preferred methods and materials are described herein.

[0300] All publications, patent applications, patents, and other reference materials described herein are incorporated in their entirety by reference. Database entries and electronic publications disclosed in this disclosure are incorporated in their entirety by reference. The versions of database entries or electronic publications incorporated by reference in this application are the most recent versions of the database entries or electronic publications that were publicly available at the time this application was filed. Database entries corresponding to gene or protein identifiers disclosed in this application (e.g., genes or proteins identified by accession numbers or database identifiers in public databases such as Genbank, Refseq, or Uniprot) are incorporated in their entirety by reference. The incorporated gene or protein-related information is not limited to the sequence data contained within the database entry. The incorporated information includes the entire contents of the database entry in the most recent version of the database that was publicly available at the time this application was filed. In case of any inconsistency, this specification, including definitions, shall prevail. In addition, materials, methods, and examples are illustrative and not intended to limit the scope of this application.

Claims

1. A method for producing a polynucleotide for the expression of FOXP3, the method comprising: (i) providing a first nucleotide sequence comprising a coding strand and a target locus, wherein the coding strand comprises one or more regulatory elements and a FOXP3 gene, and comprises the target locus comprising an intron sequence of the FOXP3 gene; (ii) providing a second nucleic acid sequence comprising a heterologous promoter operably linked to a polynucleotide comprising at least one FOXP3 exon or a portion of a FOXP3 exon; (iii) providing a nuclease; and (iv) performing a gene editing process on the first nucleotide sequence, editing the intron sequence and inserting the second nucleic acid into the target locus, wherein the insertion of the second nucleic acid results in the expression of FOXP3.

2. The method according to claim 1, wherein the second nucleotide sequence further comprises a polynucleotide encoding a selectable marker protein.

3. The method according to claim 1 or 2, wherein the promoter is a bidirectional promoter that controls the transcription of the polynucleotide comprising at least one FOXP3 exon or a portion thereof, and the polynucleotide encoding the selectable marker protein, in opposite directions.

4. The method according to any one of claims 2 to 4, wherein the selectable marker protein is a cell surface protein.

5. The method according to any one of claims 2 to 5, wherein the selectable marker protein is a truncated low-affinity nerve growth factor receptor protein.

6. The method according to any one of claims 1 to 5, wherein the second nucleotide sequence comprises exons 1, 2, and 3 of FOXP3, and the target locus is located in the intron between exon 2 and exon 3 of the FOXP3 gene of the first nucleotide sequence.

7. The method according to any one of claims 1 to 5, wherein the second nucleotide sequence comprises exons 1, 2, 3, and 4 of FOXP3, and the target gene locus is located in the intron between exon 3 and exon 4 of the FOXP3 gene of the first nucleotide sequence.

8. The method according to any one of claims 1 to 7, wherein the nuclease is Cas9, zinc finger nuclease, TALEN, manipulated meganuclease, or restriction endonuclease.

9. A polynucleotide for FOXP3 expression, prepared by the method described in any one of claims 1 to 8.

10. A polynucleotide comprising a coding chain comprising a polynucleotide encoding a selectable marker protein and a heterologous promoter operably ligated to the first exon of the FOXP3 gene, wherein the polynucleotide further comprises a second and optionally third exon of the FOXP3 gene, and the heterologous promoter is located between the polynucleotide encoding the selectable marker protein and the first exon of the FOXP3 gene.

11. The polynucleotide according to claim 10, wherein the heterologous promoter is bidirectional, promoting the transcription of the polynucleotide encoding the selectable marker protein in one direction and promoting the transcription of the first exon of the FOXP3 gene in the opposite direction.

12. The polynucleotide according to claim 10 or 11, wherein the selectable marker protein is a cell surface protein.

13. The polynucleotide according to any one of claims 10 to 12, wherein the selectable marker protein is a truncated low-affinity nerve growth factor receptor protein.

14. A polynucleotide-containing system comprising (i) a bidirectional heterologous promoter operably ligated to a polynucleotide encoding a selectable marker protein and the first exon of the FOXP3 gene, and (ii) a nuclease.

15. The system according to claim 14, wherein the polynucleotide further comprises a 5' arm and a 3' arm, each homologous to a portion of the intron sequence of the FOXP3 gene.

16. The system according to claim 15, wherein the 5' arm and the 3' arm of the polynucleotide are homologous to a portion of an intron located between the second and third exons of the FOXP3 gene, and the polynucleotide comprises the first and second FOXP3 exons.

17. The system according to claim 16, wherein the 5' arm and the 3' arm of the polynucleotide are homologous to a portion of an intron located between the third and fourth exons of the FOXP3 gene, and the polynucleotide comprises the first, second, and third FOXP3 exons.

18. The system according to any one of claims 14 to 17, wherein the nuclease is (i) Cas9, and the system further comprises a guide RNA, (ii) a zinc finger nuclease, (iii) a TALEN nuclease, (iv) an engineered meganuclease, or (v) a restriction endonuclease.

19. The system according to any one of claims 14 to 18, wherein the selectable marker protein is a cell surface protein.

20. The system according to any one of claims 14 to 19, wherein the cell surface protein is a truncated low-affinity nerve growth factor receptor protein.

21. A method for inducing FOXP3 expression in cells, comprising introducing the polynucleotides described in claims 9 to 13 or the systems described in claims 14 to 20 into the cells.

22. The method according to claim 21, further comprising measuring the cell surface expression of the cleaved low affinity nerve growth factor receptor on the cell, wherein the expression level of the cleaved low affinity nerve growth factor receptor indicates the level of FOXP3 expression in the cell.

23. A method for suppressing T cell activation using engineered regulatory T cells, the method comprising: preparing engineered regulatory T cells by inducing FOXP3 expression in T cells using the polynucleotides described in claims 1 to 8, claims 9 to 13, or the system described in claims 14 to 20; and administering the engineered regulatory T cells to a subject having unengineered T cells, wherein the activation of the unengineered T cells by T cell activation stimulation is suppressed.

24. A method for suppressing T cell activation using engineered regulatory T cells, the method comprising: contacting T cells with mismatched donor cells; isolating donor cell-responsive T cells; inducing FOXP3 expression in donor cell-responsive T cells using the method according to any one of claims 1 to 8; a polynucleotide according to any one of claims 9 to 13; or a system according to any one of claims 14 to 20 for preparing engineered donor cell-responsive T cells; administering the engineered donor cell-responsive T cells to a subject having unengineered T cells and mismatched donor cells; and suppressing the activation of the unengineered T cells by the mismatched donor cells.

25. The method according to claim 23 or 24, wherein the manipulated regulatory T cells are human cells.

26. The method according to claim 24 or 25, wherein the non-matching donor cells are human cells.

27. A vector comprising a polynucleotide containing a selectable marker protein and a bidirectional heterologous promoter operably ligated to a polynucleotide encoding at least the first exon of the FOXP3 gene.

28. The vector according to claim 27, wherein the polynucleotide further comprises a 5' arm and a 3' arm, each homologous to a portion of the intron and / or exon sequence of the FOXP3 gene.

29. The vector according to claim 27 or 28, wherein the selectable marker protein is a cell surface protein.

30. The vector according to any one of claims 27 to 29, wherein the cell surface protein is a truncated low-affinity nerve growth factor receptor protein.

31. The vector according to any one of claims 27 to 30, wherein the vector is a viral vector.

32. The vector according to claim 31, wherein the viral vector is selected from the group consisting of adeno-associated virus vectors, adenovirus vectors, retrovirus vectors, orthomyxovirus vectors, paramyxovirus vectors, papovavirus vectors, picornavirus vectors, lentivirus vectors, herpes simplex virus vectors, vaccinia virus vectors, poxvirus vectors, and alphavirus vectors.

33. A cell comprising a polynucleotide according to any one of claims 9 to 13, a system according to any one of claims 14 to 20, or a vector according to any one of claims 27 to 32.

34. A pharmaceutical composition comprising the system according to any one of claims 14 to 20, the vector according to any one of claims 27 to 32, or the cell according to claim 33, and a pharmaceutically acceptable carrier or excipient.

35. A method for inducing, regulating, or enhancing the expression of the FOXP3 gene in a subject, comprising administering to the subject the system according to any one of claims 14 to 20, the polynucleotide according to any one of claims 9 to 13, the vector according to any one of claims 27 to 32, the cell according to claim 33, or the pharmaceutical composition according to claim 34.

36. A method for controlling inflammation in a subject requiring such control, comprising operably binding a heterologous promoter to the FOXP3 gene, or part thereof, and, conversely, operably binding the heterologous promoter to a polynucleotide encoding a selectable marker protein in the subject, wherein the heterologous promoter promotes the transcription of the FOXP3 gene, or part thereof, the nucleotide sequence of the selectable marker protein, or the transcription of the FOXP3 gene controls inflammation in the subject.

37. The method according to claim 36, further comprising administering to the subject a therapeutically effective amount of a polynucleotide according to any one of claims 9 to 13, a system according to any one of claims 14 to 20, a vector according to any one of claims 27 to 32, a cell according to claim 33, or a pharmaceutical composition according to claim 34.

38. A method for creating genetically modified cells, (a) To provide cells, wherein the cells contain a first nucleic acid that includes at least one target gene locus, (b) Introducing the Cas9 protein or a second nucleic acid encoding the Cas9 protein into the cells, (c) Introducing a third nucleic acid encoding at least one CRISPR guide sequence, wherein the at least one CRISPR guide sequence is configured to hybridize to at least one target locus. (d) Introducing a fourth nucleic acid into the cells, wherein the fourth nucleic acid comprises a selectable marker protein and a bidirectional heterologous promoter operably ligated to a nucleic acid sequence encoding at least a first exon of the FOXP3 gene, A method comprising the Cas9 protein cleaving the first nucleic acid together with the CRISPR guide sequence, and the homology-directed repair of the cell introducing the fourth nucleic acid into the first nucleic acid at at least one target gene locus, thereby genetically modifying the cell.

39. The method according to claim 38, wherein the target gene locus is an intron of the FOXP3 gene.

40. The method according to claim 38 or 39, wherein the selectable marker protein is a cell surface protein.

41. The method according to any one of claims 38 to 40, wherein the cell surface protein is a truncated nerve growth factor receptor protein.

42. A method for reducing xenotransplant rejection in a patient, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method of claim 33, before, simultaneously with, or after transplanting a xenotransplant into the patient, wherein the administered cells reduce xenotransplant rejection.

43. A method for increasing immune tolerance to xenotransplantation in a patient, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method of claim 33, before or at the same time as transplanting a xenotransplant to the patient, wherein the administered cells increase immune tolerance to the xenotransplantation.

44. A method for reducing allogeneic transplant rejection in a patient, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method of claim 33, before or at the same time as the transplantation of an allogeneic transplant in the patient, wherein the administered cells reduce allogeneic transplant rejection.

45. A method for increasing a patient's immune tolerance to an allogeneic transplant, the method comprising administering to the patient a therapeutically effective amount of cells prepared according to the method of claim 33, before, simultaneously with, or after transplanting an allogeneic transplant to the patient, wherein the administered cells increase the immune tolerance to the allogeneic transplant.

Images