Modified microorganisms
By modifying the hlyCABD operon into two segments with independently controlled promoters, the delivery of cargo molecules to eukaryotic cells is significantly improved, addressing the limitations of existing systems and achieving enhanced yield and reliability in protein secretion.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- PROKARIUM LTD
- Filing Date
- 2023-10-20
- Publication Date
- 2026-04-22
AI Technical Summary
Existing delivery systems for recombinant proteins to the interstitial space between eukaryotic cells, such as the tumor microenvironment, are limited by the complex regulation of the hly operon, which hampers yield and robustness of protein production.
The hlyCABD operon is modified by splitting it into two segments, each operably linked to an independently controlled promoter, with the first segment encoding a cargo molecule upstream of the hlyAs translocation sequence and the second segment comprising hly genes involved in secretion, allowing for optimized transcription and secretion of cargo molecules.
This approach enhances the delivery of cargo molecules into the interstitial space by up to 10 times, providing a more efficient and reliable method for therapeutic protein and peptide delivery to eukaryotic cells.
Smart Images

Figure 2026512928000001_ABST
Abstract
Description
[Technical Field]
[0001] This invention relates to bio-attenuated Gram-negative bacteria modified to enable the delivery of biological molecules. [Background technology]
[0002] Recombinant protein secretion from bacterial chassis has been investigated as a strategy for delivering relevant cargo from within the cell envelope (Freudl et al., 2018). This can facilitate the purification and processing of biotechnically relevant proteins downstream of the envelope (Freudl, R., et al., 2018) and enable the proactive delivery of pharmacological molecules to appropriate tissues in vivo (e.g., tumors in immuno-oncology) (Carrier, MJ, et al., 1992; Yang, EY and Shah, K., 2020; Ruano-Gallego, D., et al., 2019).
[0003] Bacteria such as Salmonella enterica can spontaneously colonize the tumor microenvironment (TME) (Hoffman, RM, 2011). Therefore, relevant proteins and peptides can be targeted and delivered in vivo to enhance the initial immune response triggered by exposure to Salmonella's pathogen-associated molecular patterns (Chen, J., et al., 2021). Salmonella typically secretes proteins using a needle-like structure-dependent specific pathway, allowing protein effectors to be injected into mammalian cells (Lhocine, N., et al., 2015; Park, D., et al., 2018). After needle assembly and puncture of a mammalian host, a series of proteins (effectors) containing a specific signal peptide are translocated to the host cytoplasm, where they can induce, for example, bacterial uptake (Park, D., et al., 2018). However, fusing recombinant proteins to the recognized signal peptide only enables intracellular protein secretion, not secretion into the interstitial space, which may be more therapeutically important.
[0004] Urinary tract pathogenic strains of Escherichia coli (E. coli) can excrete pore-forming toxins (hemolysins), which are involved in red blood cell lysis, into the interstitial space using a specialized secretory pathway called the type 1 secretory system (T1SS) (Thomas, S., et al., 2014). This pathway depends on two transport proteins, HlyB and HlyD, which are bound to the bacterial inner membrane and periplasm, respectively (Gentschev, I., et al., 2002). When the toxin HlyA is expressed and its approximately 60-base pair-long signal peptide (HlyAs) at its C-terminus is recognized, the TolB1D2 complex interacts with TolC, opening a pore that allows HlyA to move out of the cytoplasm while it is still unfolded. HlyC, the final protein in this pathway, activates the toxicity of HlyA by transferring its acyl group to two internal lysines (Lys564 and Lys690) while HlyA is still in the bacterial cytoplasm (i.e., before it is transported).
[0005] In the chromosome, the hly genomic island is composed of four genes, hlyCABD, and one regulatory activator, hlyR (Gentschev, I., et al., 2002; Nagamatsu, K., et al., 2015; Nieto, J.M., et al., 2000; Pourhassan, N.Z., et al., 2022; Khosa, S., et al., 2018; Madrid, C., et al., 2002). In addition to the control by the product of hlyR, the toxin expression is regulated by multiple genetic elements such as the operator polar sequence (ops) and the RfaH binding sequence (Gentschev, I., et al., 2002; Nagamatsu, K., et al., 2015; Wang, B., M. et al., 2022). These genetic elements are involved in the trans - suppression of the Rho - independent terminator existing between hlyA and hlyB, splitting the operon into two (Gentschev, I., et al., 2002;), stress - related sensor CpxR, physicochemical sensors (e.g., pH and osmotic pressure) HhA and H - NS (Gentschev, I., et al., 2002; Nieto, J.M., et al., 2000; Madrid, C., et al., 2002), enhancer elements such as the AU - rich region between hlyC and hlyA that can recruit RpsA (also known as S1) (Pourhassan, N.Z., et al., 2022; Khosa, S., et al., 2018).
[0006] When designing synthetic organisms for delivering relevant proteins to the interstitial space between eukaryotic cells, such as within the tumor microenvironment (TME), the complex regulation of the hly operon can limit the yield and robustness of recombinant protein production.
[0007] Therefore, there is a need for a new delivery system for cargo molecules to the interstitial space between eukaryotic cells. Summary of the Invention
[0008] The inventors have surprisingly found that the hlyCABD operon (Figure 1) can be modified to enable the delivery of cargo molecules into the interstitial space between eukaryotic cells (Figure 2).
[0009] In a first aspect, the present invention provides a live attenuated Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is split into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, wherein the first segment comprises a heterologous polynucleotide encoding a cargo molecule upstream of the hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprises hly genes involved in secretion.
[0010] In a second aspect, the present invention provides a vaccine composition comprising a live attenuated Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is split into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, wherein the first segment comprises a heterologous polynucleotide encoding a cargo molecule upstream of the hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprises hly genes involved in secretion.
[0011] In a third embodiment, the present invention provides a method for treating, preventing, inhibiting, preventing recurrence of or controlling a disease in a subject, the method comprising administering to the subject a weakened gram-negative live bacterium, the weakened gram-negative live bacterium comprising a modified hlyCABD operon, the modified hlyCABD operon being divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule substituting for the hlyA gene, and the second segment comprising the hly gene involved in secretion.
[0012] In a fourth embodiment, the present invention relates to the true tumor microenvironment in a subject suffering from a tumor. A method is provided for delivering therapeutic molecules into the interstitial space between nuclear cells, the method comprising the steps of: i) modifying a bio-attenuated Gram-negative bacterium, the bio-attenuated Gram-negative bacterium comprising a modified hlyCABD operon, the modified hlyCABD operon being divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, wherein the first segment comprises a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, wherein the heterologous polynucleotide encoding the cargo molecule substitutes for the hlyA gene, and wherein the second segment comprises the hly gene involved in secretion; and ii) administering the modified Gram-negative bacterium to a target requiring it. [Brief explanation of the drawing]
[0013] [Figure 1] Figure 1 is a schematic diagram of the hly operon encoding the type 1 secretion system (T1SS). The hly operon is tightly controlled by multiple proteins and signals. [Figure 2]Figure 2 is a schematic diagram of a redesigned T1SS derived from E. coli. It is shown that the cargo region and structural region are separated into two transcription units independently regulated by promoters P1 and P2. Furthermore, to evaluate the effect of the hlyC gene on cargo secretion yield, two variants of the cargo region were constructed: one in which the hlyC gene is upstream of the secretible cargo, and another lacking the hlyC gene. [Figure 3A] Figure 3 shows the secretion of the reporter protein mScarlet under altered T1SS configurations. Figure 3A shows the evaluation of the effect of the cargo protein to structural protein transcription ratio on transport by manipulating the strengths of promoters P1 and P2. Analysis of the protein content in the supernatant revealed that increasing the strength of the cargo promoter increased the amount of protein detected in the supernatant by up to 10 times. Interestingly, increasing the strength of the promoters controlling the expression of structural genes increased the protein yield by up to 64 times. [Figure 3B] Figure 3B shows that when the same circuit was used, but hlyC was added upstream of the cargo, the overall pattern observed previously was preserved, but the protein transport level was one-quarter (four times lower). This may be due to the binding of Hha-derived H-NS downstream of hlyC, or the cellular burden caused by the additional hlyC expression. [Figure 4A] Figure 4A shows the secretion of recombinant protein LLO (also known as listerolysin O) under different configurations of T1SS. The reporter gene mScarlet was replaced with hly from Listeria monocytogenes, and its transport to the culture supernatant was evaluated under all configurations. The observed pattern of increased secretion with increasing promoter P2 intensity was conserved, but the total transported protein amount was lower than in the case of the reporter protein mScarlet. [Figure 4B]Figure 4B shows that, contrary to previous observations as shown in Figure 3, the addition of hlyC does not result in a decrease in transport, and the observed pattern of increased hlyBD expression correlating with increased secretion is also conserved. This suggests that the decrease previously observed in Figure 3 may be due to the burden on protein expression in cells. [Figure 5A] Figure 5 shows the two-plasmid system used to enable the regulation of cargo transport yield. By separating the two circuits into independent plasmids, it becomes possible to regulate cargo transport yield by combinations of promoter strength and copy number. This allows for screening of optimal experimental conditions that can optimize yield without placing an excessive burden on the bacterial carrier. In this experiment, we evaluated the transport of mScarlet in the T1SS dual plasmid system. The mScarlet-hlyA fusion was controlled by progressively stronger promoters (2 (SEQ ID NO: 22), 4 (SEQ ID NO: 23), 6 (SEQ ID NO: 24)), while hlyBD was controlled by similarly increasing promoters. As a result, the combination of the strongest promoters (cargo-hlyA:6, hlyBD:6) was found to have the highest transport yield but to be cellularly burdensome (see Figure 5B). Transport was evaluated as relative luminescence units (RLU) from NanoLuc, which emits light in proportion to the cargo in the supernatant because the cargo has a HiBit tag at its N-terminus; growth was recorded as absorbance at 600 nm (see Figure 5C). [Figure 5B]Figure 5 shows the two-plasmid system used to enable the regulation of cargo transport yield. By separating the two circuits into independent plasmids, it becomes possible to regulate cargo transport yield by combinations of promoter strength and copy number. This allows for screening of optimal experimental conditions that can optimize yield without placing an excessive burden on the bacterial carrier. In this experiment, we evaluated the transport of mScarlet in the T1SS dual plasmid system. The mScarlet-hlyA fusion was controlled by progressively stronger promoters (2 (SEQ ID NO: 22), 4 (SEQ ID NO: 23), 6 (SEQ ID NO: 24)), while hlyBD was controlled by similarly increasing promoters. As a result, the combination of the strongest promoters (cargo-hlyA:6, hlyBD:6) was found to have the highest transport yield but to be cellularly burdensome (see Figure 5B). Transport was evaluated as relative luminescence units (RLU) from NanoLuc, which emits light in proportion to the cargo in the supernatant because the cargo has a HiBit tag at its N-terminus; growth was recorded as absorbance at 600 nm (see Figure 5C). [Figure 5C]Figure 5 shows the two-plasmid system used to enable the regulation of cargo transport yield. By separating the two circuits into independent plasmids, it becomes possible to regulate cargo transport yield by combinations of promoter strength and copy number. This allows for screening of optimal experimental conditions that can optimize yield without placing an excessive burden on the bacterial carrier. In this experiment, we evaluated the transport of mScarlet in the T1SS dual plasmid system. The mScarlet-hlyA fusion was controlled by progressively stronger promoters (2 (SEQ ID NO: 22), 4 (SEQ ID NO: 23), 6 (SEQ ID NO: 24)), while hlyBD was controlled by similarly increasing promoters. As a result, the combination of the strongest promoters (cargo-hlyA:6, hlyBD:6) was found to have the highest transport yield but to be cellularly burdensome (see Figure 5B). Transport was evaluated as relative luminescence units (RLU) from NanoLuc, which emits light in proportion to the cargo in the supernatant because the cargo has a HiBit tag at its N-terminus; growth was recorded as absorbance at 600 nm (see Figure 5C). [Modes for carrying out the invention]
[0014] Detailed explanation To facilitate understanding of this invention, certain terms are first defined. Additional definitions are provided throughout the detailed description.
[0015] In this specification, the term “non-natural bacteria or bacteria” refers to bacterial (prokaryotic) cells that have been genetically modified or “engineered” to be altered from naturally occurring cells. Such genetic modification may, for example, involve the incorporation of additional genetic information into the cell, modification of existing genetic information, or deletion of existing genetic information. This can be achieved, for example, by transfecting cells with recombinant plasmids or by directly modifying the bacterial genome. Furthermore, bacterial cells may be genetically modified, for example, by chemical mutagenesis to achieve attenuation, a method that will be well known to those skilled in the art. Thus, the term “non-natural bacteria or bacteria” may refer to both recombinantly modified and non-recombinantly modified strains.
[0016] As used herein, "heterogeneic polynucleotide" refers to polynucleotides introduced into bio-attenuated Gram-negative bacteria, that is, the introduction of polynucleotides that were not previously present. Tastes good. Therefore, the bio-attenuated Gram-negative bacteria disclosed herein are recombinant strains. In the context of the present invention, heterologous polynucleotides may be DNA or RNA molecules intended for delivery to eukaryotic cells. In the context of the present invention, heterologous polynucleotides may encode proteins or peptides intended for delivery to eukaryotic cells. In the context of the present invention, heterologous polynucleotides may encode RNA molecules intended for delivery to eukaryotic cells. The resulting RNA molecule or protein is also referred to herein as "cargo" or "cargo molecule". In a particularly preferred embodiment, the encoded DNA or RNA molecule is a mammalian DNA or RNA molecule.
[0017] As used herein, the term “preventive treatment” refers to a medical procedure aimed at prevention, rather than treatment or cure of an infection or disease. In this invention, this applies particularly to vaccine compositions. As used herein, the term “prevention” is not absolute and may include partial prevention of an infection or disease and / or one or more symptoms of such infection or disease. In contrast, the term “therapeutic treatment” refers to a medical procedure aimed at treating or curing an infection or disease or symptoms associated therewith, as understood in the art.
[0018] The terms “tumor,” “cancer,” “malignant tumor,” and “neoplastic” are used interchangeably and refer to cells or cell populations whose growth, proliferation, and survival are greater than those of normal corresponding cells, such as cell proliferation disorders or differentiation disorders. Proliferation is usually uncontrolled. The term “malignant tumor” refers to invasion into neighboring tissues. The term “metastasis” refers to the spread or dissemination of a tumor, cancer, or neoplasm to other sites, locations, or regions within a subject that are distinct from the primary tumor or cancer. In one embodiment, cancer is malignant. In another embodiment, cancer is non-malignant.
[0019] The term “effective dose” or “pharmaceutically effective dose” refers to a quantity of a drug sufficient to deliver a desired biological or therapeutic outcome. This outcome could be a reduction, improvement, palliation, reduction, delay, and / or alleviation of one or more signs, symptoms, or causes of a disease, or any other desired change in the biological system. In the context of cancer, an effective dose may include a quantity sufficient to shrink a tumor and / or reduce the rate of tumor growth (such as a quantity that inhibits tumor growth), or a quantity sufficient to prevent or delay the growth of other undesirable cells. In some embodiments, an effective dose is a quantity sufficient to delay cancer or tumor development, extend survival, or induce stabilization.
[0020] In some embodiments, a therapeutically effective dose is sufficient to prevent or delay recurrence. A therapeutically effective dose may be administered in one or more doses. A therapeutically effective dose of an agent or combination may result in one or more of the following: (i) reducing the number of cancer cells; (ii) reducing tumor size; (iii) inhibiting, delaying, to some extent slowing, and preferably stopping, the invasion of cancer cells into peripheral organs; (iv) inhibiting tumor metastasis (i.e., to some extent slowing, and preferably stopping); (v) inhibiting tumor growth; (vi) preventing or delaying tumor development and / or recurrence; and / or (vii) alleviating to some extent one or more symptoms associated with cancer.
[0021] For example, in the treatment of tumors, a "therapeutably effective dose" can induce a tumor reduction of at least approximately 5%, e.g., at least approximately 10%, approximately 20%, or more than approximately 60% compared to baseline measurements. Baseline measurements may be obtained from untreated subjects.
[0022] A therapeutically effective amount of the therapeutic compound reduces tumor size or improves the target symptom. This can be done. A person skilled in the art would be able to determine such an amount based on factors such as the size of the subject, the severity of the subject's symptoms, and the specific composition or route of administration selected.
[0023] The terms “treatment” or “therapy” refer to the administration of an active agent for the purpose of curing, restoring, reducing, alleviating, altering, repairing, improving, enhancing, or influencing a condition (e.g., a disease) or its symptoms, or for the purpose of preventing or delaying the onset of symptoms, complications, or biochemical signs of a condition, or for the purpose of preventing or suppressing the further development of a disease, condition, or disorder in a statistically significant manner.
[0024] In this specification, the term “subject” is intended to include both human and non-human animals. Preferred subjects include human patients requiring enhancement of the immune response. The method is particularly suitable for treating human patients with disorders that can be treated by enhancing the immune response. In certain embodiments, the method is particularly suitable for the in vivo treatment of neoplastic or infectious diseases.
[0025] The use of alternatives (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. Where used herein, the indefinite article "a" or "an" should be understood to refer to "one or more" of any listed or enumerated components.
[0026] As used herein, “approximately” means within an acceptable margin of error for a particular value as determined by those skilled in the art, and this margin of error depends in part on how the value is measured or determined, i.e., on the constraints of the measurement system. For example, “approximately” may mean within one or more standard deviations according to the practice of those skilled in the art. Alternatively, “approximately” may mean a range of up to 20%. Where a particular value is given in this specification and claims, unless otherwise specified, “approximately” should be interpreted as being within an acceptable margin of error for that particular value.
[0027] The inventors have surprisingly found that the hlyCABD operon (shown in Figure 1) can be modified to enable the delivery of cargo molecules into the interstitial space between eukaryotic cells (Figure 2). To provide a more rational control of this system and standardized applications, the inventors have made rational improvements to the hly genome island. As a starting point, the hly operon was separated into two segments: a first segment ("cargo region") and a second segment ("structural region"). The process of separating the four genes of the hlyCABD operon into two segments allows for transcriptional separation of genes involved in cargo production and activation (hlyC, hlyA) from genes involved in secretion (hlyB, hlyD). The toxin sequence of hlyA can be replaced with a reporter gene (e.g., mScarlet) or, in fact, a heterologous nucleotide encoding any other cargo molecule, while maintaining the transfer peptide (HlyAs). By manipulating the strength of the promoters upstream of each segment, the optimal transcription levels of the cargo and secretion modules were screened. The results described herein indicate that functional translocation is obtained by dividing the operon into two segments, and that this translocation is further enhanced by increasing the transcription levels of both segments. Accordingly, the present invention relates to a bio-attenuated Gram-negative bacterium containing a modified hly operon.
[0028] Some Gram-negative bacteria use type 1 secretory systems (T1SSs) to transport proteins across the inner and outer membranes to the extracellular environment. Of these T1SSs, the α-hemolysin (HlyA) secretory system of E. coli is the most detailed and well-characterized. By utilizing T1SSs, bacteria can transport proteins and other cargo molecules to the extracellular environment after they have been taken up and broken down by bacteria. Not only does it become accessible, but by being released from the bacterial cytoplasm, it can be actively presented to eukaryotic cells of the host immune system. HlyA is a bacterial toxin and a virulence factor. The secretion and activation of HlyA are determined by the hlyCABD operon. In summary, once HlyA is transcribed and translated, there are three components that regulate the transport of HlyA: HlyB, HlyD, and TolC. HlyB and HlyD are inner membrane proteins (may be present in the HlyB-HlyD complex fixed to the inner membrane of Gram-negative bacterial cells), while TolC is present in the outer membrane of Gram-negative bacterial cells. HlyA has a transfer signal sequence known as HlyAs at its C-terminus. When HlyAs is recognized by the HlyB-HlyD complex, contact with TolC is induced, and TolC forms a transperiplasmic transport channel between the inner and outer membranes. HlyC is involved in the activation of HlyA. Therefore, by substituting the HlyA toxin with heterologous nucleotides encoding proteins or other cargo molecules, it becomes possible to transport specific heterologous proteins or other target molecules from the carrier organism to the extracellular space via the C-terminal HlyAs sequence.
[0029] Accordingly, in a first embodiment, the present invention provides a bioattenuated Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is divided into a first segment and a second segment, each segment operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprising an hly gene involved in secretion.
[0030] Therefore, the bio-attenuated Gram-negative bacteria of the present invention are envisioned to function as an efficient and reliable method for delivering or transporting cargo molecules from the bacterial cytoplasm to the extracellular space, including the interstitial space between eukaryotic cells. Accordingly, the bacterial strains disclosed herein are recombinant strains comprising a modified hlyCABD operon containing heterologous polynucleotides encoding cargo molecules. Thus, the heterologous polynucleotides have a nucleotide coding structure that enables their transcription, and if the cargo molecule is a protein, subsequently enables translation into the encoded cargo molecule.
[0031] The modified hlyCABD operon is expected to be divided into a first segment and a second segment, each segment being operablely linked to an independently controlled promoter.
[0032] The first segment ("cargo region") is expected to consist of heterogeneous polynucleotides encoding cargo molecules, located upstream of the hlyAs translocation sequence.
[0033] As used herein, the term “cargo” is well known to those skilled in the art and refers to a molecule of a particular purpose intended to be translocated, delivered, carried, or transported from one location to another. In particular, cargo molecules can be translocated from the cytoplasm of a bacterial cell to the extracellular environment surrounding a eukaryotic cell. In preferred embodiments, the cargo molecule is a protein and / or peptide. The cargo molecule may be a heterologous protein that is not naturally present in the carrier bacterial cell. The cargo peptide and / or protein may be a therapeutic peptide and / or therapeutic protein. While the cargo molecule of the present invention is assumed to be a protein or peptide, other cargo types include DNA and RNA molecules. Thus, in another embodiment, the cargo molecule is an RNA molecule. As used herein, the terms “RNA” and “ribonucleic acid” are used interchangeably and refer to nucleic acids composed of ribonucleic acid bases consisting of uracil, adenine, guanine, and cytosine. These terms and concepts are well known to those skilled in the art. Examples of RNA molecules include messenger RNA (mRNA), small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), transfer RNA (tRNA), self-amplifying RNA (saRNA), and ribosomal RNA (rRNA). Therefore, the RNA cargo molecule may be an mRNA molecule. As used herein, the terms "mRNA" and "messenger RNA" are used interchangeably and refer to single-stranded RNA molecules involved in protein synthesis. Eukaryotic mRNA molecules are transcribed from DNA in the nucleus of eukaryotic cells, and then transported from the nucleus to the cytoplasm of the eukaryotic cell, where the mRNA molecule is translated into protein. Bacterial mRNA molecules are transcribed from uncompartmentalized DNA and translated in the cytoplasm in conjunction with transcription. These terms and concepts are well known to those skilled in the art. RNA molecules are transcribed and translated within the bacterial cell. For example, a bio-attenuated Gram-negative bacterium can encode up to 10 different heterologous mRNA molecules, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different heterologous mRNA molecules.The cargo mRNA molecule itself may encode a peptide and / or protein, and that peptide and / or protein may be a therapeutic peptide and / or therapeutic protein.
[0034] In one embodiment, if the cargo is a therapeutic peptide and / or therapeutic protein, the therapeutic peptide and / or therapeutic protein may be a cytokine, chemokine, antibody or its functional fragment, cytotoxic agent, cancer agent, or any combination thereof. The invention disclosed herein provides a live attenuated Gram-negative bacterium in which the cargo molecule is expressed within the bacterium itself before transport. For example, a live attenuated Gram-negative bacterium may encode up to 10 different cargo (protein) molecules, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 different cargo (protein) molecules.
[0035] It is also conceivable that a heterologous polynucleotide encoding the cargo molecule is fused with the hlyAs sequence encoding the translocation peptide HlyAs. In one embodiment, when the cargo molecule is a protein or peptide, the HlyAs translocation peptide is located at the C-terminus of the cargo molecule. The length of the HlyAs protein is approximately 50 to 220 amino acids. In some embodiments, the HlyAs protein is 218 amino acids long. Several structural and sequence motifs within HlyAs have been identified as important to their signaling function through studies using site-directed mutagenesis, CD, and NMR spectroscopy (Holland, IB, et al., 1990; Koronakis, V., 1989; Jarchau, T., et al., 1994). As used herein, the terms “translocation sequence,” “signal sequence,” and “target sequence” may be used interchangeably and refer to genes that encode a translocation peptide or protein, which are recognized by cellular transport mechanisms and targeted for transport or secretion from the cell. Translocation peptides are typically found at the N-terminus or C-terminus of peptides or proteins that are intended to be translocated from one location to another. Translocation sequences generally encode peptides with specific amino acid sequences or motifs that are recognized by intracellular transport machinery. In the case of the hlyCABD operon, the HlyAs translocation is recognized by the HlyB and HlyD structural proteins, which bind to TolC to form a transperiplasmic channel, thereby enabling the translocation of HlyAs (and any cargo fused with it) across the inner and outer membranes of attenuated Gram-negative bacteria.
[0036] In one embodiment, the heterologous polynucleotide encoding the cargo molecule is located upstream of the HlyAs sequence. In another embodiment, the heterologous polynucleotide encoding the cargo molecule is located downstream of an independently controlled promoter. In yet another embodiment, the heterologous polynucleotide encoding the cargo molecule is located upstream of the HlyAs sequence and downstream of an independently controlled promoter.
[0037] In another embodiment, the hlyCABD operon may further include the hlyC gene. HlyC is associated with the activation of HlyA. However, according to the literature, HlyC Because the region on the 3' end can affect secretion yield, in another embodiment, the hlyCABD operon may further include a functional fragment or portion of the hlyC gene. In one embodiment, the hlyC gene or its functional fragment is located upstream of a heterogeneous polynucleotide encoding a cargo molecule upstream of the hlyAs translocation sequence. In another embodiment, the hlyC gene or its functional fragment is located downstream of an independently controlled promoter. In yet another embodiment, the hlyC gene or its functional fragment is located upstream of a heterogeneous polynucleotide encoding a cargo molecule upstream of the hlyAs translocation sequence and downstream of an independently controlled promoter.
[0038] In another embodiment, after secretion, the cargo molecule retains the HlyAs translocation peptide. In yet another embodiment, after secretion, the HlyAs translocation peptide is removed from or cleaved from the cargo molecule.
[0039] It is envisioned that the secretion of any cargo molecule may be optimized. In one embodiment, if the cargo molecule is a peptide or protein, the folding rate of the cargo can be modified. According to the literature, it has been suggested that the lower the folding rate of a cargo molecule, the higher the secretion rate. In another embodiment, the translation efficiency of the cargo molecule may be modified through the fitting of the ribosome binding sequence. In yet another embodiment, due to the redundancy of the genetic code, one or more codons in the heterologous polynucleotide encoding the cargo molecule can modify the coding sequence without changing the encoded amino acid (synonymous codon modification). Those skilled in the art will recognize that the folding rate, translation efficiency, and coding sequence can be optimized for each peptide, protein, or gene involved, and depend on the properties of the cargo molecule (gene, peptide, or protein cargo molecule) and its intended use.
[0040] The second segment ("structural region") is presumed to contain the hly gene involved in secretion.
[0041] In the context of the hlyCABD operon, the hly genes involved in secretion are hlyB and hlyD. Therefore, in one embodiment, the second segment includes the hlyB and hlyD genes. The hlyB and hlyD genes are also called T1SS structural genes. In one embodiment, the hlyB gene is upstream of the hlyD gene. In another embodiment, the hlyB gene is downstream of an independently regulated promoter. In yet another embodiment, the hlyB gene is upstream of the hlyD gene and downstream of an independently regulated promoter.
[0042] The inventors of the present invention have surprisingly found that splitting the operon into two segments results in a functional translocation, and this translocation increases with increasing the transcription levels of both segments. Thus, the modified hlyCABD operon of the present invention is split into two segments: a first segment and a second segment, each segment operably linked to an independently controlled promoter, the first segment containing a heterologous polynucleotide encoding a cargo molecule upstream of the hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule being replaced by the hlyA gene, and the second segment containing the hly gene involved in secretion. In bioattenuated Gram-negative bacteria, the heterologous polynucleotide is operably linked to an independently controlled promoter to enable transcription and translation of the heterologous polynucleotide, as well as production of the cargo molecule. Furthermore, to enable transcription and translation of the hly gene involved in secretion, the hly gene involved in secretion is operably linked to an independently controlled promoter. In this specification, the term “independently controlled promoter” refers to a promoter controlled by a different regulatory element than another promoter in the system. In particular, the promoter controlling the expression of the first segment may be different from, or have a different regulatory mechanism than, the promoter controlling the expression of the second segment.
[0043] Temporal control of expression can be achieved by using different promoters, including invasion-related SPI-1, SPI-4, or flagella-related promoters. Suitable promoters include, but are not limited to, invF, hilA, hilD, sicA, siiE, flhDC, and fliC.
[0044] In preferred embodiments, independently controlled promoters are strong promoters, and when strong promoters are used, high-rate transcription is initiated. As used herein, the terms “strong promoter” and “active promoter” are used interchangeably and refer to promoters that result in high transcription rates of the genes under their control. Genes controlled by strong promoters recruit RNA polymerase more frequently and therefore produce more mRNA and more product protein than genes controlled by weak promoters. Any strong promoter is suitable as long as it performs the function disclosed herein, but particularly preferred examples of strong promoters include, but are not limited to, the ptrc promoter, ptet promoter, pcon5 promoter, pBAD promoter, placUV5 promoter, invasion-associated promoters (e.g., SPI-1, SPI-4, or flagella), intracellular promoters (SPI-2), host cytoplasmic promoters, or pTac promoters. Other preferred examples include, but are not limited to, uphT (glucose-6-phosphate) and frubKA (fructose). SPI-1 is an invasion-associated promoter that is active outside of host cells when bacteria are attempting to invade the host cell. Additional promoters for use in the present invention include, but are not limited to, the trc promoter, tac promoter, trp promoter, lac operon promoter, lac / tac promoter, tac / trc promoter, trp / lac promoter, bad / ara promoter, ssaG promoter, pagC promoter, nirB promoter, dps promoter, or spv promoter. As used herein, the term “cytoplasmic promoter” refers to an intracellular promoter of bacteria. Host cytoplasmic promoters for use in the present invention may include, but are not limited to, uhpT, mntH, entC, fhuE, iroN, fepB, fepA, fhuA, sitA, stn3250, sufA, yjjZ, soxS, and sfbA. In one embodiment, the SPI-2 gene is the ssa gene.Suitable promoters include, but are not limited to, ssaV, ssaJ, ssaU, ssaK, ssaL, ssaM, ssaO, ssaP, ssaQ, ssaR, ssaS, ssaT, ssaD, ssaE, ssaG, ssaI, ssaC, and ssaH. Other vacuolar promoters include PipB2, zinT, and mtgC. In preferred embodiments, PipB2 and ssaG can be used for intracellular delivery. PipB2 is a potent SPI-2-dependent promoter compared to other SPI-2 promoters. SPI-2 promoters can also be used to activate the expression of the type 1 secretion system (T1SS), which facilitates the transport of hemolysin from Listeria. The strength of the selected promoter for each segment can be manipulated to increase the secretion efficiency of cargo molecules (Figures 3 and 4). Table 1 details the promoters used for screening.
[0045] [Table 1-1]
[0046] Table 1 continued [Table 1-2]
[0047] The bacteria of the present invention are bio-attenuated Gram-negative bacteria. Examples of bio-attenuated Gram-negative bacteria for use in the present invention include, but are not limited to, Salmonella, Escherichia coli, Shigella, Pseudomonas, Moraxella, Helicobacter, Stenotrophomonas, Budelovibrio, Legionella, Chlamydia, and Yersinia. However, in one embodiment, the bio-attenuated Gram-negative bacterium is Salmonella. Salmonella may be Salmonella Typhi or Salmonella Typhimurium.
[0048] In another embodiment of the present invention, the bio-attenuated Gram-negative bacteria are genetically modified non-natural bacteria.
[0049] Accordingly, the present invention discloses bio-attenuated Gram-negative bacteria genetically modified to produce bacterial strains capable of effectively delivering various cargo molecules. As those skilled in the art will understand, genes can be mutated by many methods well known in the art, such as homologous recombination using recombinant plasmids targeted to the gene of interest. Here, a modified gene homologous to the target gene is incorporated into a suitable nucleic acid vector (e.g., plasmid or bacteriophage) and transfected into target cells. The homologous modified gene is then recombined with the native gene and substituted or mutated to achieve the desired inactivating mutation. Such modifications may be to the coding portion of the gene or to a regulatory portion such as the promoter region. As those skilled in the art will understand, any suitable gene modification technique can be used to mutate the gene of interest, such as the CRISPR / Cas system, e.g., CRISPR / Cas 9, to produce the bacterial strains disclosed herein. Table 2 details the sequences used to construct the expression plasmid.
[0050] [Table 2-1]
[0051] Table 2 continued [Table 2-2]
[0052] Table 2 continued [Table 2-3]
[0053] Table 2 continued [Table 2-4]
[0054] Therefore, numerous methods and techniques for genetically modifying bacterial strains will be well known to those skilled in the art. These techniques include those necessary to introduce heterologous genes into bacteria, either by integration into chromosomes or through the introduction of stable, self-replicating genetic elements. Exemplary methods for genetically modifying (also called “transformation” or “engineered modification”) bacterial cells include bacteriophage infection, transduction, conjugation, lipofection, or electroporation. A general discussion of these methods and other methods in molecular and cellular biochemistry can be found in Molecular Cloning: A Laboratory Manual, 3rd Ed. Standard textbooks such as Sambrook et al., Harbor Laboratory Press 2001; Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley & Sons 1999); and Protein Methods (Bollag et al., John Wiley & Sons 1996) describe these methods, and these are incorporated herein by reference.
[0055] In a preferred embodiment, the viable attenuated Gram-negative bacterium is Salmonella. The viable attenuated Gram-negative bacterium may be selected from the group consisting of Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09 (also known as ZH9), x9633, x639, x9640, x8444, DTY88, ZH9PA, MD58, WT05, ZH26, SL7838, SL7207, VNP20009, A1-R, or any combination thereof. In a more preferred embodiment, the viable attenuated Gram-negative bacterium is M01ZH09 (also known as ZH9). These viable attenuated strains are readily available, readily identifiable to those skilled in the art, and commonly used. For example, EP 2 801 364 A1 discloses Ty21a, CVD 908-htrA, CVD 909, Ty800, M01ZH09, χ9633, χ9640, and χ8444. Furthermore, EP 3 917 565 A1 discloses in detail the ZH9 strains, including ZH9PA, and their derivatives. Further literature on these strains can be found, in particular, in Petrovska 2004, Hindle 2002, Lehouritis 2017, and Kimura 2010. This also includes derivatives and variants of these strains, including genetically modified and genetically engineered strains.
[0056] Genetically modified non-natural bacteria may further contain one or more gene cassettes. Such gene cassettes may be used to deliver additional prokaryotic molecules to support the function of genetically modified non-natural bacteria that modulate the immune system, or to support the activity of cargo molecules.
[0057] The present invention provides a method for delivering cargo molecules into extracellular spaces, including the interstitial space between eukaryotic cells. Accordingly, the present invention provides a bacterial delivery system with broad applicability across numerous disease areas. As those skilled in the art will understand, such a system offers significant and extensive therapeutic benefits. Heterogeneous polypeptides may encode cargo molecules that are therapeutic peptides, therapeutic proteins, and / or heterogeneous antigens (depending on the indication being treated). In preferred embodiments, the therapeutic peptide or protein is a cytokine, chemokine, antibody, or functional fragment thereof, a cytotoxic agent, an oncologist, or any combination thereof. More preferably, the therapeutic protein produced may be IL-15, IL-21, CXCL9, CXCL10, IL-18, IL-27, IFNγ, IFNα, IFNβ, IL-1, or any combination thereof. In one embodiment, a bio-attenuated Gram-negative bacterium is used, comprising a modified hlyCABD operon encoding a therapeutic cargo molecule intended to be secreted into the extracellular space between eukaryotic cells. As used herein, the terms “extracellular environment,” “extracellular space,” “extracellular compartment,” or “pericellular space” are interchangeable and refer to the extracellular region within a multicellular organism, i.e., the area outside the cell membrane, occupied by the extracellular matrix. The extracellular environment consists of three compartments: the interstitial compartment, the intravascular compartment, and the transcellular compartment.
[0058] In one embodiment, cargo molecules are intended to be secreted into the interstitial space. As used herein, the terms “interstitial compartment,” “interstitial environment,” “interstitial space,” “tissue space,” or “peristitial space” are used interchangeably and refer to the space surrounding tissue cells (i.e., the space outside blood and lymphatic vessels and parenchymal cells), also known as the tissue microenvironment. The interstitial space consists of two main phases: the interstitial fluid, which provides the direct microenvironment between eukaryotic cells, and the structural molecules that make up the extracellular matrix. Eukaryotic cells may be mammalian cells. In a preferred embodiment, eukaryotic cells are human cells. If eukaryotic cells are human cells, the target cells may be cancerous or non-cancerous human cells.
[0059] The tissue microenvironment is relevant to solid tumors and hematological malignancies. Herein, the terms “tumor microenvironment” or “TME” are used interchangeably and refer to the local environment surrounding a tumor, the tumor stromal space, and the interstitial fluid. The TME is formed by tumors and is predominantly dominated by tumor-induced interactions, but may also contain tumor-mobilized immune effector cells, fibroblasts, signaling molecules, and blood vessels. Therefore, it is conceivable to modify bio-attenuated Gram-negative bacteria to deliver therapy-related proteins into the stromal space of the TME in tumor-affected subjects.
[0060] In one embodiment of the present invention, the live attenuated Gram-negative bacteria are administered intratumorally, peripleurally, intravenously, intraperitoneally, subcutaneously, intradermally, or orally. In a more preferred embodiment, the live attenuated Gram-negative bacteria are administered intratumorally. However, other methods of administration may be used in some cases. Thus, in certain cases, the live attenuated Gram-negative bacteria of the present invention may be administered by injection, infusion, continuous infusion, intradermally, intra-arterially, intralesionally, intravaginally, intrarectally, intramuscularly, subcutaneously, subconjunctivally, intramucosally, intrapericardially, intraumbilically, intraocularly, intracranially, intra-articularly, intraprostatically, intrapleurally, intratracheally, intranasally, via catheter, via lavage, or by any other method known to those skilled in the art or any combination of the above (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990).
[0061] The amount of attenuated Gram-negative bacteria administered to the target is sufficient to deliver the cargo molecules into the interstitial space at a concentration high enough to exert the desired effect. Those skilled in the art will readily understand that the exact amount administered depends on many factors, such as the disease being treated and the medical history of the target.
[0062] Bio-attenuated Gram-negative bacteria are 10 5 from 10 12It can be administered at a dosage between CFUs, where CFU is the colony forming unit. For example, suitable dosages are 10 5 and 10 6 CFUs, 10 5 and 10 7 CFUs, 10 5 and 10 8 CFUs, 10 5 and 10 9 CFUs, 10 5 and 10 10 CFUs, 10 5 and 10 11 CFUs, 10 6 and 10 7 CFUs, 10 6 and 10 8 CFUs, 10 6 and 10 9 CFUs, 10 6 and 10 10 CFUs, 10 6 and 10 11 CFUs, 10 6 and 10 12 CFUs, 10 7 and 10 8 CFUs, 10 7 and 10 9 CFUs, 10 7 and 10 10 CFUs, 10 7 and 10 11 CFUs, 10 7 and 10 12 CFUs, 10 8 and 10 9 CFUs, 10 8 and 10 10 CFUs, 10 8 and 10 11 CFUs, 10 8 and 10 12 CFUs, 10 9 and 10 10 CFUs, 10 9 and 10 11 CFUs, 10 9 and 10 12 CFUs, 10 10 and 10 11 CFUs, 10 10 and 1012 During the CFU period, or 10 11 and 10 12 This can be between CFUs. Live attenuated Gram-negative bacteria may be administered as a single dose or multiple doses. The specific number of doses administered is understood to depend on the specific cargo molecule being delivered and the specific indication being treated.
[0063] In one embodiment, the bio-attenuated Gram-negative bacteria of the present invention are envisioned to enable the delivery of therapeutically relevant cargo molecules to the interstitial space between eukaryotic cells of tumor-affected subjects. Accordingly, the bio-attenuated Gram-negative bacteria disclosed herein may also be used for therapeutic purposes. For example, the bio-attenuated Gram-negative bacteria may be used to treat, mitigate, inhibit, prevent, prevent recurrence of, or control diseases. In a preferred embodiment, the disease is a human disease. In a more preferred embodiment, the disease may be a neoplasm, an infectious disease, a cardiovascular disease, a neurodegenerative disease, a gastrointestinal disease, a respiratory disease, a kidney disease, a liver disease, an autoimmune disease, an inflammatory disease, or a genetic disease. In a preferred embodiment, the bio-attenuated Gram-negative bacteria are intended for use in treating, mitigate, inhibit, prevent, prevent recurrence of, or control neoplasms or infectious diseases.
[0064] When the disease being treated is a neoplasm, the neoplasm may be associated with a solid tumor or a hematological malignancy. In a particular aspect, the neoplasm may be associated with a cancer selected from prostate cancer, esophageal cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, pancreatic cancer, brain tumor, mesothelioma, hepatocellular carcinoma, lymphoma, leukemia, gastric cancer, endometrial cancer, vulvar cancer, vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin cancer, or sarcoma.
[0065] Neoplasms, tumors, and cancers include benign, malignant, metastatic, and non-metastatic forms, and include any stage (I, II, III, IV, or V) or grade of malignancy (G1, G2, G3, etc.) of a neoplasm, tumor, or cancer, or neoplasms, tumors, cancers, or metastases that are progressing, worsening, stable, or in remission. Cancers that can be treated according to the present invention include, but are not limited to, cells or neoplasms of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestinal tract, gums, head, kidney, liver, lung, nasopharynx, neck, ovaries, prostate, skin, stomach, testes, tongue, or uterus. Small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatous cell carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma (malignant); cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; columnar adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyps; familial adenomatous polyposis adenocarcinoma; solid carcinoma; carcinoid tumor (malignant); bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobic cell carcinoma; eosinophilic carcinoma; eosinophilic adenocarcinoma; basophilic Cancer; Clear cell adenocarcinoma; Granular cell carcinoma; Follicular adenocarcinoma; Papillary and follicular adenocarcinoma; Non-encapsulated sclerosing carcinoma; Adrenocortical carcinoma; Cancer; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; invasive tubular carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease of the breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; thymoma (malignant) Ovarian stromal tumor (malignant); Theca cell tumor (malignant); Granulosa cell tumor (malignant); Androblastoma (malignant); Sertoli cell carcinoma; Leydig cell tumor (malignant); Lipid cell tumor (malignant); Paraganglioma (malignant); Extramammary paraganglioma (malignant); Pheochromocytoma; Angiosarcoma; Malignant melanoma; Apigmented melanoma; Superficial spreading melanoma; Malignant melanoma in giant pigmented nevus; Epithelioid cell melanoma; Blue nevus (malignant); Sarcoma; Fibrosarcoma; Fibrous Histiocytoma (malignant); myxosarcoma; liposarcoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor; Müllerian mixed tumor; nephroblastoma; hepatoblastoma; carcinosarcoma; mesenchymal tumor (malignant); Brenner tumor (malignant); phyllodes tumor (malignant); synovial sarcoma; mesothelioma (malignant); undifferentiated germ cell tumor; embryonal carcinoma; teratoma (malignant); ovarian goiter (malignant); choriocarcinoma; mesonephroma (malignant); angiosarcoma; hemangioendothelioma (malignant); Kaposi's sarcoma;Hemangiocarcinoma (malignant); Lymphangiosarcoma; Osteosarcoma; Periosteal osteosarcoma; Chondrosarcoma; Chondroblastoma (malignant); Mesenchymal chondrosarcoma; Giant cell tumor of bone; Ewing's sarcoma; Odontogenic tumor (malignant); Ameloepilae fibrosarcoma; Ameloblastoma (malignant); Ameloepilae fibrosarcoma; Pineal glandoma (malignant); Chordoma; Glioma (malignant); Ependymoma; Astrocytoma; Protoplasmic astrocytoma; Fibrous astrocytoma; Astroblastoma; Glioblastoma; Oligodendroglioma; Oligodendroblastoma; Primitive neuroectodermal tumor; Cerebellar sarcoma; Gangloblastoma; Neuroblastoma; Retinoblastoma; Olfactory neuroblastoma; Meningioma (malignant); Neurofibrosarcoma; Nerve Schwannoma (malignant); granular cell tumor (malignant); malignant lymphoma; Hodgkin lymphoma; Hodgkin lymphoma; paragranuloma; small lymphocytic lymphoma (malignant); large cell diffuse lymphoma (malignant); follicular lymphoma (malignant); mycosis fungoides; other specified non-Hodgkin lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative bowel disease; leukemia; lymphocytic leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myelosarcoma; and hairy cell leukemia. Preferably, the neoplastic disease may be a tumor associated with cancer and / or other forms of carcinoma selected from prostate cancer, liver cancer, kidney cancer, lung cancer, breast cancer, colorectal cancer, pancreatic cancer, brain tumor, hepatocellular carcinoma, lymphoma, leukemia, gastric cancer, endometrial cancer, vulvar cancer, vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, head and neck cancer, skin cancer, and soft tissue sarcoma. The tumor may be metastatic or malignant.
[0066] In a preferred manner, neoplasms are associated with cancer selected from bladder cancer, prostate cancer, lung cancer, mesothelioma, hepatocellular carcinoma, melanoma, esophageal cancer, gastric cancer, endometrial cancer, vulvar cancer, vaginal cancer, cervical cancer, ovarian cancer, colorectal cancer, head and neck cancer, or breast cancer.
[0067] In a second embodiment, the present invention provides a vaccine composition comprising a bio-attenuated Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprising an hly gene involved in secretion.
[0068] In one embodiment, the vaccine composition of the present invention may be for therapeutic use. For example, live attenuated Gram-negative bacteria may be used for the treatment, mitigation, inhibition, prevention, recurrence prevention, or control of a disease.
[0069] The vaccine compositions disclosed herein are particularly intended for use in the treatment, mitigation, inhibition, prevention of recurrence, or control of infectious diseases, such as diseases caused by bacteria, viruses, parasites, or fungi. In such cases, the heterologous polynucleotides of the present invention may encode antigens of specific infectious disease causative agents to elicit an immune response in the host. Alternatively, the vaccine compositions disclosed herein may be used as cancer vaccines. In such cases, the vaccine compositions include Gram-negative bacteria containing heterologous polynucleotides encoding cancer antigens that can elicit an immune response in the host. Thus, it is understood that a wide range of cancers and infectious diseases can be prevented / treated using the bacteria and methods disclosed herein. In other cases, heterologous polynucleotides may encode siRNA or shRNA molecules designed to enhance immune anti-infective function or tissue anti-infective defense.
[0070] The vaccine composition of the present invention may further comprise an adjuvant, a pharmaceutically acceptable carrier, or an excipient.
[0071] As used herein, “pharmaceutically acceptable carriers / adjuvants / diluents / excipients” include, but are not limited to, any solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antimicrobials, antifungals), isotonic agents, absorption retarders, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavorings, and colorants, as well as any material and combination thereof known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289–1329). Examples include, but are not limited to, disodium hydrogen phosphate, soy peptone, potassium dihydrogen phosphate, ammonium chloride, sodium chloride, magnesium sulfate, calcium chloride, sucrose, borate buffer, sterile saline (0.9% NaCl), and sterile water.
[0072] Suitable aqueous and non-aqueous carriers that may be used in the vaccine composition of the present invention include water, ethanol, polyols (such as glycerol, propylene glycol, and polyethylene glycol), and suitable mixtures thereof, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Appropriate fluidity can be maintained, for example, by the use of coating materials such as lecithin, by maintaining the required particle size in the case of dispersions, and by the use of surfactants.
[0073] The vaccine compositions disclosed herein may further contain adjuvants such as preservatives, wetting agents, emulsifiers, and dispersants. Prevention of the presence of unwanted microorganisms can be ensured by both the sterilization procedures described above and the inclusion of various antimicrobial and antifungal agents, such as parabens, chlorobutanol, and phenolsorbic acid. It may also be desirable to include isotonic agents such as sugars and sodium chloride in the composition. Furthermore, the absorption of the injectable pharmaceutical form can be extended by including absorption retarders such as aluminum monostearate or gelatin. The vaccine compositions may also optionally contain additional therapeutic agents known to be effective, for example, in infectious diseases or neoplasms. Accordingly, the vaccine compositions disclosed herein may also contain antiretroviral agents, antibiotics, antifungal agents, antiparasitic agents, and anticancer agents.
[0074] The vaccine composition may also contain additional components intended to enhance the immune response in the target after administration. Examples of such additional components include aluminum salts such as aluminum hydroxide, aluminum oxide, and aluminum phosphate; oily adjuvants such as Freund's complete adjuvant and Freund's incomplete adjuvant; mycolate-based adjuvants (e.g., trehalose dimycolate); bacterial lipopolysaccharides (LPS); peptidoglycans (e.g., glycoproteins such as murein, mucopeptide, or N-opaca, muramyl dipeptide [MDP], or MDP analogs); proteoglycans (e.g., extracted from Klebsiella pneumoniae); streptococcal preparations (e.g., OK432); muramyl dipeptide; and immunostimulatory complexes (EP 109 942, EP 180 564, and EP 231). "Iscoms" disclosed in 039), saponins, DEAE-dextran, neutral oils (such as miglyol), vegetable oils (such as arachis oil), liposomes, polyols, Ribi adjuvants (see, for example, GB-A-2 189 141), vitamin E, Carbopol, interferons (e.g., IFN-α, IFN-γ, or IFN-β), or interleukins, particularly those that stimulate cell-mediated immunity (e.g., IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, and IL-17).
[0075] The attenuated Gram-negative live bacteria of the vaccine compositions disclosed herein may comprise any one or any combination of the characteristics of the attenuated Gram-negative live bacteria disclosed herein. In a third embodiment, the present invention provides a method for treating, preventing, inhibiting, preventing recurrence or controlling a disease in a subject, comprising administering to the subject an attenuated Gram-negative live bacteria, wherein the attenuated Gram-negative live bacteria comprises a modified hlyCABD operon, the modified hlyCABD operon being divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprising an hly gene involved in secretion.
[0076] A method for treating, preventing, suppressing, preventing recurrence of, or controlling a disease in the subject matter of the third embodiment may include one or more of the embodiments described above with respect to any prior embodiment.
[0077] In a fourth embodiment, the present invention provides a method for delivering a therapeutic molecule to the interstitial space between eukaryotic cells in a tumor microenvironment in a subject suffering from a tumor, the method comprising the steps of: i) modifying a bio-attenuated Gram-negative bacterium, the bio-attenuated Gram-negative bacterium comprising a modified hlyCABD operon, the modified hlyCABD operon being divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, and the heterologous polynucleotide encoding the cargo molecule ii) a step of replacing the hlyA gene, wherein the second segment comprises the hly gene involved in secretion, and ii) administering the modified Gram-negative bacteria to a subject requiring it.
[0078] In one embodiment of a fourth aspect of the present invention, the therapeutic molecule may be a protein or a peptide. In another embodiment of the present invention, the therapeutic molecule may be an RNA molecule that is translated following a protein or peptide. The term “therapeutic molecule” refers to any molecule that can result in the reduction, improvement, palliation, reduction, delay, and / or alleviation of one or more signs, symptoms, or causes of a disease or other desired change in a biological system. For example, in the context of cancer, the therapeutic molecule may be one that reduces the size of a tumor.
[0079] In subjects suffering from a tumor of the fourth embodiment, a method for delivering therapeutic molecules into the interstitial space between eukaryotic cells in the tumor microenvironment may include one or more of the embodiments described above with respect to any prior embodiment.
[0080] Bio-attenuated Gram-negative bacteria comprising the modified hylCABD operon of the present invention may also have applications that enable the safe, efficient, and reliable delivery of RNA molecules to target eukaryotic cells. Accordingly, in one embodiment, a method for delivering RNA molecules to eukaryotic cells using the modified bio-attenuated Gram-negative bacteria disclosed herein is provided. As used herein, the term “bactofection” refers to the process of introducing genetic material from bacteria (e.g., Salmonella) into mammalian cells. Specifically, in the context of the present invention, the term “bactofection” refers to the use of bio-attenuated Gram-negative bacteria to deliver RNA molecules into the cytoplasm of target eukaryotic cells after the bio-attenuated Gram-negative bacteria have been delivered to the eukaryotic cells. The SPI-2 promoter can be used to promote the transport of hemolysin from Listeria and activate the expression of a type 1 secretory system (T1SS) that enables, for example, the release of bacterial cells from vacuoles into the cytoplasm of eukaryotic cells. [Examples]
[0081] Construction of a combinatorial library with different promoters controlling the expression of T1SS cargo genes and structural genes. To navigate the optimal expression ratio between secretible elements (e.g., mScarlet fused with the T1SS signal peptide hlyAs fused at the C-terminus) and structural elements (i.e., HlyB and HlyD), these two sites were separated by a bidirectional terminator (BBa_B1006) and independently controlled by promoters of different strengths (pro1, proA, proB, proC). Furthermore, it has been reported that the gene hlyC, encoded upstream of hlyA on the native genome island, encodes a region that influences the secretion efficiency of hlyA and other cargoes. Therefore, two types of secretion sites were created: one containing hlyC and one without. Taking all of this into consideration, a total of 32 plasmids were designed, each with a unique P1 / P2 and hlyC composition.
[0082] The fragments were converted into dsDNA blocks using integrated DNA technologies (IDT). The dsDNA blocks were cloned into pJET plasmids, validated by sequencing, and used as reference material. Fragments for Golden Gate assembly (GGA) were prepared from the validated plasmids by PCR.
[0083] The plasmid library was processed via BsaI-dependent GGA using an ECHO 525 liquid handling platform. The mixed DNA volume was increased to 3 μL on a 96-well PCR plate (reaction volume, 5 μL), and 2 μL of NEB Bridge + BsaI (1.667 μL of NEB Bridge and 0.333 μL of BsaI) was added for each reaction. To ensure successful reaction, the mixed sample was properly mixed, centrifuged, and subjected to 30 cycles of 4 minutes at 37°C and 2 minutes at 16°C (~4 hours reaction time). The resulting assembly was transformed into DH5a (only 2 μL).
[0084] Plasmid assemblies were first visually inspected (to ensure there were no colonies with a red background), and then cultured in pairs overnight. Plasmids were miniprepped, and primer T1SSVal_PF / R01 (CGACTGAGCCTTTCGTTTTATTTGATGCC (SEQ ID NO: 15), GGTCATTACTGGATCTATCAACAGGAGTCCAAG (SEQ ID NO: 16), TA=58℃, text=35sec, ampicon=6379 / 5866bp) was validated by PCR using CloneAmp. Plasmids that successfully amplified were subjected to sequencing (one clone per plasmid) using primer T1SSVal_PF01 and SQ_mscarlet_for (gcatggacgaactgtataagggatcc (SEQ ID NO: 17)).
[0085] Evaluation of the T1SS expression landscape The library plasmid was transformed into DH5α cells by heat shock (standard protocol), plated onto vLBA, and cultured overnight at 37°C. Chloramphenicol 12.5 μg mL -1 Three single colonies per construct were picked and inoculated into 1 mL of vLBA on a 96-well plate containing [component name missing], and incubated overnight at 200 rpm and 37°C. The samples were then diluted 1:100 with 500 μL of chloramphenicol-supplemented vLBA. 100 μL was transferred to a 96-well plate, shaken at 700 rpm and 37°C, and growth was monitored over time using a Clariostar. The remaining volume was grown in a deep-well plate under the same conditions.
[0086] The HiBit assay was performed on the supernatant of bacterial cultures grown in deep-well plates at 37°C. Samples were OD 600 The plates were left to stand until the cell density reached ~0.5, after which aliquots were collected and processed as follows: (1) Aliquots were extracted from deep well plates (100 μL) and the cell density (OD) was measured. 600(1) Cells were spun down from all plates at 4000xg at room temperature for 10 minutes. (2) The supernatant was carefully transferred to a new plate. (4) 10 μL of the supernatant was mixed with a pre-prepared HiBit MasterMix (10 μL) and used to measure the amount of HiBit tags in the supernatant by measuring the luminescence.
[0087] OD 600 No significant difference was observed. Analysis using the HiBit Assay showed that increasing the intensity of P1 (cargo promoter) increased the amount of cargo in the supernatant, independently of the expression of structural genes from P2. This can be explained by the autosecretion ability of the fluorescent protein and the release of proteins from cell turnover. Therefore, to evaluate the effect of increased P2 intensity on secretion, the results were normalized by P1 intensity. In this case, higher levels of structural gene expression promote secretion. The experiment was repeated using three more independent clones different from those already tested. The results obtained were also consistent with previously obtained data.
[0088] Obtaining reproducible secretion results by exchanging mScarlet cargo and LLO. Plasmid libraries using LLO (also known as ListeroLysin O) instead of mScarlet were obtained by BbsI-dependent golden gate assembly in a 96-well PCR plate (reaction volume, 2 μL) using the previously prepared library and a block encoding hly from Listeria monocytogenes surrounded by appropriate BbsI sites. Standard conditions were used (0.67 μL NEB Bridge, 0.264 μL 10 μM hly insert, 0.5 μL 2.5 μM vector, 0.132 μL BbsI, 0.434 μL water). To ensure a successful reaction, the mixed samples were properly mixed, centrifuged, and subjected to 30 cycles of 4 minutes at 37°C followed by 2 minutes at 16°C (~4 hours reaction). The resulting assemblies were transformed into DH5a. Plasmid assemblies were confirmed by sequencing.
[0089] Effective plasmids were extracted from the library and transformed into DH5α cells using heat shock (standard protocol). These cells were plated in vLBA and cultured overnight at 37°C. A total of three single colonies were extracted from each construct and treated with 12.5 μg mL of chloramphenicol. -1 The sample was inoculated into 1 mL of vLBA on a 96-deep-well plate containing [component name missing] and incubated overnight at 200 rpm and 37°C. The sample was then diluted 1:100 with 500 μL of chloramphenicol-supplemented vLBA. 100 μL of this diluted sample was transferred to a 96-well plate, shaken at 700 rpm and 37°C, and growth was monitored over time using a Clariostar. The remaining sample was grown in a deep-well plate under the same conditions.
[0090] The cells were treated as described above (see previous section), and the secretion levels of all samples were measured using HiBit-induced luminescence. Overall, all samples proliferated similarly (endpoint OD). 600 (The range is the same). As previously observed, the higher the intensity of p2 (T1SS gene), the higher the transport rate. Interestingly, the higher the p1, the higher the transport rate in general, which contradicts the "less is more" hypothesis when expressing cargo in the cytoplasm.
[0091] Finally, as has been observed elsewhere, using a fluorescent protein (mScarlet) instead of a composite cargo (hly) reduces cargo transport volume by approximately 10 times.
[0092] Dual plasmid expression system To more precisely control the expression levels of the two systems, a dual plasmid expression system was designed and constructed. In this system, the plasmid containing the cargo is incorporated into the p15A ori plasmid (approximately 10 copies / cell), enabling in-frame cloning (BsaI-dependent) of the cargo associated with the hlyAs sequence. Further control of the expression level can be achieved by cloning the desired promoter in a BsaI-dependent manner. Such cargo transport is achieved by introducing a second plasmid (e.g., pSC101, ~5 copies / cell) with a suitable origin of replication that expresses the hlyBD operon under the control of the associated promoter introduced via a BsaI-dependent golden gate, as previously done in cargo-hlyAs fusion. Both plasmids were constructed using the same eBlocks previously used in the single plasmid system.
[0093] To test this system, the pro1 (hlyAs-1), proC (hlyAs-4), and J23199 (hlyAs-6) promoters were cloned upstream of the mscarlet-hlyAs fusion to construct three cargo plasmids with increased relative expression levels. In parallel, three plasmids containing hlyBD (hlyBD-1, hlyBD-4, hlyBD-6) were constructed under the control of the same promoters. These were co-transformed into Salmonella ZH9 using electroporation with a standard protocol and 100 ng of each vector, and then treated with 25 μg mL of each antibiotic (carbenicillin and kanamycin). -1 The cells were selected on LB agar medium supplemented with [component name] at 37°C for 16 hours. A single plasmid (cargo only) control was also transformed and selected with carbenicillin.
[0094] Subsequently, single colonies (3 per construct) were extracted and inoculated into LB medium supplemented with the same concentration of appropriate antibiotics as in the solid medium. The samples were cultured in a 96-well plate for 16 hours and diluted 1:500 with 1 mL of fresh medium. Growth was then monitored from 100 μL aliquots cultured at 700 rpm, 37°C for 16 hours, and the remaining culture medium was cultured under the same conditions in a shaking incubator. After growth, the samples were spun down at 4000 x g for 15 minutes, and the supernatant was transferred to a new 96-well plate. 10 μL aliquots of each supernatant were subjected to the HiBit analysis described above.
[0095] Therefore, the results disclosed herein support the use of a dual plasmid expression system that can optimize yield without placing an excessive burden on the bacterial carrier.
[0096] [Table 3]
[0097] [Table 4]
[0098] [Table 5]
[0099] [Table 6]
[0100] [Table 7]
[0101] [Table 8]
[0102] [Table 9]
[0103] Table 10
[0104] Table 11
[0105] Table 12
[0106] Table 13
[0107] Table 14
[0108] Table 15
[0109] Table 16
[0110] Table 17
[0111] Table 18
[0112] Table 19
[0113]
Table 20
[0114]
Table 21
[0115]
Table 22
[0116]
Table 23
[0117] References Carrier, M.J., et al., Expression of human IL-1 beta in Salmonella typhimurium. A model system for the delivery of recombinant therapeutic proteins in vivo. J Immunol, 1992. 148(4): p. 1176-81.
[0118] Chen, J., et al., Salmonella flagella confer anti-tumor immunological effect via activating Flagellin / TLR5 signalling within tumor microenvironment. Acta Pharm Sin B, 2021. 11(10): p. 3165-3177.
[0119] Freudl, R., Signal peptides for recombinant protein secretion in bacterial expression systems. Microb Cell Fact, 2018. 17(1): p. 52.
[0120] Gentschev, I., G. Dietrich, and W. Goebe l, The E. coli alpha-hemolysin secretion system and its use in vaccine development. Trends Microbiol, 2002. 10(1): p. 39-45.
[0121] Hoffman, R.M., Tumor-seeking Salmonella amino acid auxotrophs. Curr Opin Biotechnol, 2011. 22(6): p. 917-23.
[0122] Holland, I.B. et al. (1990) The mechanism of secretion of hemolysin and other polypeptides from Gram-negative bacteria. J. Bioenerg. Biomembr. 22, 473-491.
[0123] Jarchau, T. et al. (1994) Selection for transport competence of C-terminal polypeptides derived from Escherichia coli hemolysin: the shortest peptide capable of autonomous HlyB / HlyDdependent secretion comprises the C-terminal 62 amino acids of HlyA. Mol. Gen. Genet. 245, 53-60.
[0124] Khosa, S., et al., An A / U-Rich Enhancer Region Is Required for High-Level Protein Secretion through the HlyA Type I Secretion System. Appl Environ Microbiol, 2018. 84(1).
[0125] Koronakis, V. (1989) Isolation and analysis of the C-terminal signal directing export of Escherichia coli hemolysin protein across both bacterial membranes. EMBO J. 8, 595-605.
[0126] Lhocine, N., et al., Apical invasion of intestinal epithelial cells by Salmonella typhimurium requires villin to remodel the brush border actin cytoskeleton. Cell Host Microbe, 2015. 17(2): p. 164-77.
[0127] Madrid, C., et al., Temperature- and H-NS-dependent regulation of a plasmid-encoded virulence operon expressing Escherichia coli hemolysin. J Bacteriol, 2002. 184(18): p. 5058-66.
[0128] Nagamatsu, K., et al., Dysregulation of Escherichia coli alpha-hemolysin expression alters the course of acute and persistent urinary tract infection. Proc Natl Acad Sci U S A, 2015. 112(8): p. E871-80.
[0129] Nieto, J.M., et al., Expression of the hemolysin operon in Escherichia coli is modulated by a nucleoid-protein complex that includes the proteins Hha and H-NS. Mol Gen Genet, 2000. 263(2): p. 349-58.
[0130] Park, D., et al., Visualization of the type III secretion mediated Salmonella-host cell interface using cryo-electron tomography. Elife, 2018. 7.
[0131] Pourhassan, N.Z., et al., Optimized Hemolysin Type 1 Secretion System in Escherichia coli by Directed Evolution of the Hly Enhancer Fragment and Including a Terminator Region. Chembiochem, 2022. 23(6): p. e202100702.
[0132] Ruano-Gallego, D., et al., Screening and purification of nanobodies from E. coli culture supernatants using the hemolysin secretion system. Microbial Cell Factories, 2019. 18(1): p. 47.
[0133] Thomas, S., I.B. Holland, and L. Schmitt, The Type 1 secretion pathway - the hemolysin system and beyond. Biochim Biophys Acta, 2014. 1843(8): p. 1629-41.
[0134] Wang, B., M. Mittermeier, and I. Artsimovitch, RfaH May Oppose Silencing by H-NS and YmoA Proteins during Transcription Elongation. J Bacteriol, 2022. 204(4): p. e0059921.
[0135] Yang, E.Y. and K. Shah, Nanobodies: Next Generation of Cancer Diagnostics and Therapeutics. Front Oncol, 2020. 10: p. 1182.
Claims
1. A bio-attenuated Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is divided into a first segment and a second segment, each segment operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprising an hly gene involved in secretion.
2. The bio-attenuated Gram-negative bacterium according to claim 1, wherein an independently controlled promoter operably linked to the first segment is located upstream of a heterogeneous polynucleotide encoding a cargo molecule.
3. The bio-attenuated Gram-negative bacterium according to claim 1 or 2, wherein the first segment further comprises an hlyC gene or a fragment thereof upstream of a heterologous polynucleotide encoding a cargo molecule.
4. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably linked to the first segment is located upstream of the hlyC gene or a fragment thereof.
5. The bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein the hly gene involved in secretion is hlyB and hlyD.
6. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably linked to the second segment is located upstream of the hlyB gene.
7. The bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein the cargo molecule is a peptide and / or a protein.
8. The bio-attenuated Gram-negative bacterium according to claim 7, wherein the peptide and / or protein is a therapeutic peptide and / or therapeutic protein.
9. The bio-attenuated Gram-negative bacterium according to any one of claims 1 to 6, wherein the cargo molecule is an RNA molecule.
10. The bio-attenuated Gram-negative bacterium according to claim 9, wherein the RNA molecule is an mRNA molecule.
11. The bio-attenuated Gram-negative bacterium according to claim 10, wherein the mRNA molecule encodes a therapeutic protein and / or therapeutic peptide.
12. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably coupled to the first segment is a potent promoter.
13. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably coupled to the first segment comprises a PipB2, ssaG, or proC promoter.
14. An independently controlled promoter operably connected to the first segment, p A bio-attenuated Gram-negative bacterium according to claim 13, which is an roC promoter.
15. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably coupled to the second segment is a potent promoter.
16. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, wherein an independently controlled promoter operably coupled to the second segment comprises a PipB2, ssaG, or proC promoter.
17. The bio-attenuated Gram-negative bacterium according to claim 16, wherein the independently controlled promoter operably coupled to the second segment is a proC promoter.
18. A bio-attenuated Gram-negative bacterium according to any of the preceding claims, for therapeutic use.
19. The bio-attenuated Gram-negative bacteria described in claim 18, for use in the treatment, mitigation, inhibition, prevention, or control of neoplasms, infectious diseases, cardiovascular diseases, neurodegenerative diseases, gastrointestinal diseases, respiratory diseases, kidney diseases, liver diseases, autoimmune diseases, inflammatory diseases, or genetic diseases, preferably for use in the treatment, mitigation, inhibition, prevention, or control of recurrence of neoplasms or infectious diseases.
20. The use of the method according to claim 19, wherein the neoplastic disease is a solid cancer and / or hematological malignancy. Bio-attenuated Gram-negative bacteria for use.
21. The aforementioned solid tumors and / or hematological malignancies include prostate cancer, esophageal cancer, liver cancer, and kidney cancer. Cancer, lung cancer, breast cancer, colorectal cancer, bladder cancer, breast cancer, pancreatic cancer, brain tumor, mesothelioma, hepatocellular carcinoma, lymphoma, leukemia, stomach cancer, prostate cancer, endometrial cancer, vulvar / vaginal cancer, cervical cancer, ovarian cancer, thyroid cancer, melanoma, carcinoma, head and neck cancer, skin A bio-attenuated Gram-negative bacterium for use according to claim 20, wherein the neoplasm is a cancer selected from cysts or sarcomas, and preferably the neoplasm is related to a cancer selected from bladder cancer, lung cancer, mesothelioma, hepatocellular carcinoma, melanoma, esophageal cancer, gastric cancer, ovarian cancer, colorectal cancer, head and neck cancer, prostate cancer, endometrial cancer, cervical cancer, or breast cancer.
22. A vaccine composition comprising a live attenuated live Gram-negative bacterium comprising a modified hlyCABD operon, wherein the modified hlyCABD operon is divided into a first segment and a second segment, each segment operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hlyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hlyA gene, and the second segment comprising an hly gene involved in secretion.
23. The vaccine composition according to claim 22, wherein the vaccine composition further comprises an adjuvant, a pharmaceutically acceptable carrier, or an excipient.
24. The vaccine composition according to claim 22 or 23, comprising a live attenuated live Gram-negative bacterium according to any one of claims 2 to 17.
25. A method for treating, preventing, inhibiting, preventing recurrence of or controlling a disease in a subject, the method comprising administering to the subject a bio-attenuated Gram-negative bacterium, the bio-attenuated Gram-negative bacterium comprising a modified hlyCABD operon, the modified hlyCABD operon being divided into a first segment and a second segment, each segment being operably coupled to an independently controlled promoter, the first segment having a cargo molecule upstream of the hlyAs translocation sequence A method comprising a heterogeneous polynucleotide encoding a cargo molecule, wherein the heterogeneous polynucleotide encoding the cargo molecule replaces the hlyA gene, and the second segment comprises the hly gene involved in secretion.
26. A method for treating, preventing, inhibiting, preventing recurrence of or controlling a disease in the subject of claim 25, wherein the method comprises a bio-attenuated Gram-negative bacterium as described in any one of claims 2 to 17.
27. A method for delivering a therapeutic molecule to the interstitial space between eukaryotic cells in the tumor microenvironment of a subject affected by a tumor, comprising the steps of: i) modifying a bio-attenuated Gram-negative bacterium comprising a modified hylyCABD operon, wherein the bio-attenuated Gram-negative bacterium comprises a modified hylyCABD operon, wherein the modified hylyCABD operon is divided into a first segment and a second segment, each segment being operably linked to an independently controlled promoter, the first segment comprising a heterologous polynucleotide encoding a cargo molecule upstream of an hylyAs translocation sequence, the heterologous polynucleotide encoding the cargo molecule replacing the hylyA gene, and the second segment comprising an hyly gene involved in secretion; and ii) administering the modified Gram-negative bacterium to a subject requiring its use.
28. A method for delivering a therapeutic molecule to the interstitial space between eukaryotic cells in the tumor microenvironment of a tumor-affected subject according to claim 27, comprising the bio-attenuated bacteria according to any one of claims 2 to 17.