Manufacturing and use of recombinant self-complementary AAV vectors
A two-plasmid transfection system with optimized combinations and reagents enhances AAV vector production, addressing yield and efficiency challenges, resulting in improved scAAV vectors for gene therapy.
Patent Information
- Authority / Receiving Office
- JP · JP
- Patent Type
- Applications
- Current Assignee / Owner
- LOGICBIO THERAPEUTICS INC
- Filing Date
- 2023-04-28
- Publication Date
- 2026-05-21
AI Technical Summary
Existing methods for producing adeno-associated virus (AAV) vectors, particularly self-complementary AAV (scAAV) vectors, face challenges in yield, packaging efficiency, and replicable AAV levels, which hinder their effectiveness in gene therapy applications.
A two-plasmid transfection system comprising specific combinations of sequence elements and transfection reagents enhances the production of AAV vectors, including scAAV, by optimizing plasmid ratios and using chemical transfection reagents like cationic lipids, resulting in improved viral vector yields and packaging efficiency.
The two-plasmid system significantly improves AAV vector production, achieving higher yields and packaging efficiency, with a high proportion of non-empty capsids, making it suitable for therapeutic applications in genetic disorders.
Smart Images

Figure 2026516329000001_ABST
Abstract
Description
[Background technology]
[0001] Genetic disorders caused by dysfunctional genes account for the majority of diseases worldwide. Gene therapy is emerging as a promising form of treatment aimed at mitigating the effects of genetic disorders. [Overview of the project] [Means for solving the problem]
[0002] This disclosure provides methods and techniques for improving the design and / or production of adeno-associated virus (AAV) vectors, including, for example, self-complementary AAV (scAAV) vectors. According to various embodiments, this disclosure provides insights that specific design elements and / or transfection conditions of an expression construct (e.g., plasmid) can significantly affect one or more properties and / or characteristics of viral (e.g., AAV (e.g., scAAV)) production (including, for example, one or more viral vector yields, packaging efficiency, and / or replicable AAV levels).
[0003] This disclosure, in particular, shows that a two-plasmid transfection system comprising a specific combination of sequence elements (e.g., a rep gene or gene variant, a cap gene or gene variant, one or more helper virus genes or gene variants, and / or one or more target genes) may be effective in enhancing the downstream production of viral vectors (e.g., AAV (e.g., scAAV)) used in gene therapy. For example, in some embodiments, this disclosure provides the finding that a two-plasmid transfection system comprising a specific combination of wild-type sequence elements (e.g., a rep gene or gene variant, one or more helper virus genes or gene variants, one or more viral promoters) may be effective in enhancing the production of viral vectors (e.g., AAV (e.g., scAAV)).
[0004] In some embodiments, the disclosure shows that a two-plasmid transfection system comprising specific combinations of sequence elements that can be combined with various transfection reagents (e.g., chemical transfection reagents comprising lipids, polymers, and cationic molecules (e.g., one or more cationic lipids)) may be effective in enhancing the production of scAAV vectors.
[0005] In some embodiments, the disclosure provides the finding that optimizing the plasmid ratio in a two-plasmid system can provide further improvements in the production of one or more embodiments of viral vectors, e.g., AAV vectors (e.g., scAAV vectors) (including, e.g., viral vector yield, packaging efficiency, and / or one or more replicable AAV levels). While not wishing to be bound by any particular theory, the disclosure shows that transfection with a two-plasmid system comprising a first plasmid containing a viral helper gene (e.g., an adenovirus gene or a herpesvirus gene) and either an AAV rep gene or an AAV cap gene, and a second plasmid containing a payload and either an AAV rep gene or an AAV cap gene, can produce improved viral vector (e.g., AAV (e.g., scAAV)) yields compared to the reference.
[0006] In some embodiments, the disclosure provides a plasmid comprising at least one of the following: a polynucleotide sequence encoding an AAV cap gene, a polynucleotide sequence encoding an AAV rep gene, a polynucleotide sequence encoding a payload and adjacent ITRs, and / or a polynucleotide sequence encoding one or more viral helper genes. In some embodiments, the provided plasmid further comprises a polynucleotide sequence encoding a promoter, e.g., a native p5 promoter, a native p40 promoter, a CMV promoter, and / or one or more wild-type promoters. In some embodiments, the provided plasmid further comprises a polyA sequence. In some embodiments, the provided plasmid further comprises an intron, e.g., an intron between the promoter and the AAV rep gene. In some embodiments, the provided plasmid further comprises a polynucleotide sequence encoding a wild-type viral helper gene. In some embodiments, the plasmid provided further comprises one or more transgenes, such as methylmalonyl-CoA mutase (MUT), UDP-glucuronosyltransferase 1-1 (UGT1A1), cystathionine β-synthase (CBS), galactose-1-phosphate uridyltransferase (GALT), or variants thereof. In some embodiments, the plasmid provided does not contain a polynucleotide sequence encoding a nuclease.
[0007] In some embodiments, first and second provided plasmids are present in the composition, and each plasmid comprises different sequence elements (e.g., a polynucleotide sequence encoding an AAV cap gene, a polynucleotide sequence encoding an AAV rep gene, a polynucleotide sequence encoding a payload and adjacent ITRs, and / or a polynucleotide sequence encoding one or more viral helper genes). In some embodiments, the provided composition comprises a first plasmid containing a polynucleotide sequence encoding an AAV cap gene and a second plasmid containing a polynucleotide sequence encoding an AAV rep gene. In some embodiments, the provided composition comprises a first plasmid containing a polynucleotide sequence encoding a payload and adjacent ITRs, and a second plasmid containing a polynucleotide sequence encoding one or more viral helper genes. In some embodiments, the provided composition comprises a first plasmid containing a polynucleotide sequence encoding one or more viral helper genes and a second plasmid containing a polynucleotide sequence encoding a payload and adjacent ITRs. In some embodiments, the provided composition is formulated to co-deliver the first and second plasmids to cells. In some embodiments, the provided composition comprises the first and second plasmids in a specific ratio to achieve a specific ratio between the two plasmids. In some embodiments, the provided composition comprises a larger amount of the first plasmid compared to the second plasmid. In some embodiments, the provided composition comprises the first and second plasmids, with a ratio of the first plasmid to the second plasmid ranging from 1.5:1 or greater to a maximum of 10:1. In some embodiments, the provided composition comprises a first plasmid containing a polynucleotide sequence encoding one or more viral helper genes, and a second plasmid containing a polynucleotide sequence encoding a payload and adjacent ITRs.In some embodiments, the provided composition comprises a first plasmid containing polynucleotide sequences encoding one or more viral helper genes and rep genes, and a second plasmid containing polynucleotide sequences encoding a payload and adjacent ITR and cap genes.
[0008] In some embodiments, the provided composition comprises one or more polynucleotide sequences comprising a polynucleotide sequence encoding one or more enhancer sequences, a polynucleotide sequence encoding one or more promoter sequences, a polynucleotide sequence encoding one or more intron sequences, a polynucleotide sequence encoding a gene, and a polynucleotide sequence comprising a polyA sequence. In some embodiments, the provided polynucleotide sequence encoding the payload comprises a polynucleotide sequence comprising a first nucleic acid sequence and a second nucleic acid sequence, wherein the first nucleic acid sequence comprises at least one gene, the second nucleic acid sequence is located at 5' or 3' relative to the first nucleic acid sequence and, when incorporated into the target integration site, promotes the production of two independent gene products, the third nucleic acid sequence is located at 5' relative to the polynucleotide and comprises a sequence homologous to the genomic sequence 5' of the target integration site, and the fourth nucleic acid sequence is located at 3' relative to the polynucleotide and comprises a sequence homologous to the genomic sequence 3' of the target integration site. In some embodiments, the provided target integration site comprises the 3' end of an endogenous gene. In some embodiments, the provided third nucleic acid sequence is homologous to the DNA sequence upstream of the stop codon of the endogenous gene. In some embodiments, the provided fourth nucleic acid sequence is homologous to the DNA downstream of the stop codon of an endogenous gene. In some embodiments, the provided target integration site is located within the genome of a cell. In some embodiments, the provided target integration site is located within the genome of a liver, muscle, or CNS cell.
[0009] In some embodiments, the provided composition includes a composition used for packaging AAV vectors. In some embodiments, the provided composition is used in a method for producing packaged AAV vectors. In some embodiments, the provided composition is delivered to cells such as mammalian cells, liver cells, muscle cells, CNS cells, or cells isolated from a subject. In some embodiments, the provided composition is delivered to cells by a chemical transfection reagent containing cationic molecules and / or cationic lipids. In some embodiments, the provided composition includes a packaged AAV vector composition. In some embodiments, the provided compositions may be administered in a therapeutic method to subjects in need, such as subjects having or suspected of having one or more of the following conditions: propionic acidemia, Wilson's disease, hemophilia, Crigler-Nadjar syndrome, methylmalonic acidemia (MMA), alpha-1 antitrypsin deficiency (A1ATD), glycogen storage disease (GSD), Duchenne muscular dystrophy, limb-girdle muscular dystrophy, X-linked myotubular myopathy, Parkinson's disease, mucopolysaccharidosis, hemophilia A, hemophilia B, hereditary angioedema (HAE), galactosemia, viral infections, cancer, chronic kidney disease, diabetes mellitus (e.g., type II diabetes mellitus), muscle wasting, neurodegenerative disorders, severe combined immunodeficiency (SCID), growth hormone deficiency, wounds, obesity, inflammatory disorders, cardiovascular diseases, rheumatoid arthritis, neutropenia, asthma, or hemophilia (e.g., hemophilia A). In some embodiments, the provided composition does not contain a nuclease.
[0010] In one embodiment, a payload / Cap plasmid comprising a polynucleotide sequence encoding a cap gene and a polynucleotide sequence encoding scAAV, wherein the payload / Cap plasmid does not contain a polynucleotide encoding a rep gene, is provided herein.
[0011] In some embodiments, the polynucleotide sequence encoding scAAV includes a left-terminal ITR and a right-terminal ITR, where (i) the left-terminal ITR includes the sequence CTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTG (SEQ ID NO: 18); and (ii) the right-terminal ITR includes [ka] (iii) the sequence includes; or (iii) the left-terminal ITR includes the sequence of sequence number 18 and the right-terminal ITR includes the sequence of sequence number 19.
[0012] In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 11, or SEQ ID NO: 12. In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding the cap gene is inserted before position 550 of SEQ ID NO: 20.
[0013] In some embodiments, the polynucleotide sequence encoding scAAV includes a polynucleotide sequence encoding the transgene. In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, with the polynucleotide sequence encoding the transgene inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is one or more of the following: propionyl-CoA carboxylase methylmalonyl-CoA mutase (MUT), UDP-glucuronosyltransferase 1-1 (UGT1A1), cystathionine β-synthase (CBS), galactose-1-phosphate uridyltransferase (GALT), or variants thereof.
[0014] In some embodiments, the cap gene is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11.08, AAVC11.09, AAVC11.10, AAVC11.11, AAVC11.12, AAVC11.13, AAVC11. Selected from the cap genes of 14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, sheep AAV, or hybrid AAV.
[0015] In another embodiment, the following compositions are provided herein: one of the payload / Cap plasmids disclosed herein; and a Rep / Helper plasmid comprising the polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1, or SEQ ID NO: 2, but not comprising the polynucleotide sequence encoding the cap gene.
[0016] In some embodiments, the composition comprises two or fewer distinct plasmids.
[0017] In some embodiments, the composition is used to produce an AAV vector.
[0018] In another embodiment, a host cell comprising any one of the payloads / Cap plasmids disclosed herein or any one of the compositions disclosed herein is provided herein.
[0019] In some embodiments, the host cell is a mammalian host cell.
[0020] In some embodiments, the mammalian host cell is or is a derivative of HEK293F cells. In some embodiments, the mammalian host cell is HEK293F cells. In some embodiments, the derivative of HEK293F cells is a clonal derivative of HEK293F cells having one or more of the following characteristics: (i) absence of SV40 large T antigen; (ii) ability to grow in suspension culture at a density >12 million cells / mL in a medium of known composition; and / or (iii) ability to produce an AAV titer greater than 5×10 10 vg / mL. In some embodiments, the clonal derivative of HEK293 cells is VPC 2.0 cells.
[0021] In another aspect, provided herein is a method for producing a packaged scAAV vector, comprising delivering any one of the compositions disclosed herein to a cell and incubating the cell for a time and under conditions sufficient to produce a packaged scAAV vector.
[0022] In some embodiments, delivery comprises using a chemical transfection reagent. In some embodiments, the chemical transfection reagent comprises a cationic lipid-based transfection reagent. In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is or is a derivative of HEK293F cells. In some embodiments, the mammalian cell is HEK293F cells. In some embodiments, the derivative of HEK293F cells is a clonal derivative of HEK293F cells having one or more of the following characteristics: (i) absence of SV40 large T antigen; (ii) ability to grow in suspension culture at a density >12 million cells / mL in a medium of known composition; and / or (iii) ability to produce an AAV titer greater than 5×10 10 vg / mL. In some embodiments, the clonal derivative of HEK293 cells is VPC 2.0 cells.
[0023] In another aspect, a population of purified self-complementary adeno-associated virus (scAAV) particles, wherein the scAAV particles comprise a capsid protein and a polynucleotide encoding a payload sequence and adjacent inverted terminal repeats (ITRs), and a population of scAAV viral particles is provided herein having a proportion of non-empty capsids of 85% or more.
[0024] In some embodiments, the population has a proportion of non-empty capsids of 90% to 99%. In some embodiments, the population has a proportion of non-empty capsids of 92% to 97%. In some embodiments, the population has a proportion of non-empty capsids of about 95%.
[0025] In some embodiments, the capsid protein is selected from the capsid proteins of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11.08, AAVC11.09, AAVC11.10, AAVC11.11, AAVC11.12, AAVC11.13, AAVC11.14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, ovine AAV, or hybrid AAV.
Brief Description of the Drawings
[0026] [Figure 1]This graph shows the results of a ratio test comparing the indicated Rep / Helper to Payload / Cap ratios for scAAV production using two plasmids (2P) compared to production using three plasmids (3P). This graph shows that the best Rep / Helper to Payload / Cap ratio in this experiment was 1:3, and that yield improvements were observed at molar ratios of 1:5:1 to 1:6 compared to the three plasmid system. [Figure 2] This graph shows the percentage of non-empty capsids under the given conditions. The percentage of non-empty capsids was higher for scAAV purified from scAAV production at 2P compared to scAAV produced at 3P. [Figure 3] This is an image of a sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel, showing that the purified 2P scAAV and purified 3P scAAV had a purity of 100%. [Figure 4] These are images of alkali gels used to examine the size of the target genome of scAAV9 produced by two-plasmid and three-plasmid systems. [Figure 5] This is a series of graphs showing that scAAV9-SMN1 produced by 2-plasmid and 3-plasmid systems exhibits similar in vivo efficacy. [Figure 6] This graph shows the results of 2P scAAV and 3P scAAV production in different cell lines. [Modes for carrying out the invention]
[0027] definition To facilitate understanding of this disclosure, certain terms are first defined below. Further definitions of the following terms and other terms are provided throughout this specification. Publications and other reference materials referenced herein to provide context for this disclosure and further details on its practice are incorporated herein by reference.
[0028] The articles “a” and “an” are used herein to refer to one or more (e.g., at least one) grammatical objects of the article. For example, “an element” means one or more elements.
[0029] About: When used herein in relation to a value, the terms "about" or "approximately" refer to a value that is similar in context to the referenced value. Generally, a person skilled in the art familiar with the context will understand the degree of variation that is encompassed by "about" in that context. For example, in some embodiments, the terms "about" or "approximately" may encompass values ranging from 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less than that of the referenced value.
[0030] Codon Optimization: As used herein, the term “codon optimization” refers to the process of modifying codons in a given gene in such a way that the polypeptide sequence encoded by the gene remains the same, but the modified codons improve the expression process of the polypeptide sequence. For example, if the polypeptide is a human protein sequence and is to be expressed in E. coli, codon optimization of the DNA sequence to change human codons to codons that are more effective for expression in E. coli will often result in improved expression.
[0031] Combination therapy: As used herein, the term “combination therapy” refers to a clinical intervention in which a subject is simultaneously exposed to two or more treatment regimens (e.g., two or more therapeutic agents). In some embodiments, two or more treatment regimens may be administered concurrently. In some embodiments, two or more treatment regimens may be administered sequentially (e.g., the first regimen is administered before any dose of the second regimen). In some embodiments, two or more treatment regimens are administered in overlapping dosing regimens. In some embodiments, the administration of combination therapy may involve administering one or more therapeutic agents or modalities to a subject receiving other agents or modalities. In some embodiments, combination therapy does not necessarily require that the individual agents be administered together (or always simultaneously) in a single composition. In some embodiments, the two or more therapeutic agents or modalities of combination therapy are administered separately, for example, in separate compositions, via separate routes of administration (e.g., one agent orally and the other intravenously), and / or at different time points in time to the subject. In some embodiments, two or more therapeutic agents may be administered together in a combination composition or in a combination compound (for example, as part of a single chemical complex or covalent bond) via the same route of administration and / or simultaneously.
[0032] Equivalent: As used herein, the term “equivalent” means two or more drugs, entities, situations, sets of conditions, etc., that are sufficiently similar, though not identical to one another, to be comparable, to the extent that a person skilled in the art can reasonably draw conclusions based on observed differences or similarities. In some embodiments, a comparable set of conditions, situations, individuals, or groups is characterized by several substantially identical features and one or a few diverse features. A person skilled in the art will understand, in context, what degree of identity is required in any given situation for two or more such drugs, entities, situations, sets of conditions, etc., to be considered comparable. For example, a person skilled in the art will understand that a set of situations, individuals, or groups are equivalent if they are characterized by a sufficient number and variety of substantially identical features to justify a reasonable conclusion that differences between different sets of situations, individuals, or groups, or the results or phenomena obtained or observed, are caused by or exhibit various variations of those features.
[0033] Inclusion: Any composition or method described herein as “including” one or more named elements or steps is open-ended, meaning that while the named elements or steps are essential, other elements or steps may be added within the scope of the composition or method. To avoid redundancy, any composition or method described as “comprising” (or “comprises”) one or more named elements or steps also describes a corresponding, more restrictive composition or method that “consistes essentially of” (or “consists essentially of”) the same named elements or steps, meaning that the composition or method includes the named essential elements or steps and may also include additional elements or steps that do not substantially affect the basic and novel features of the composition or method. Furthermore, any composition or method described herein as "comprising" or "consisting essentially of" one or more named elements or processes is understood to also describe a corresponding, more limited, closed-end composition or method "consisting of" (or "consists of") the named elements or processes, in order to exclude any other unnamed elements or processes. In any composition or method disclosed herein, any known or disclosed equivalent of any named essential element or process may be substituted for that element or process.
[0034] Corresponding: As used herein, the term “corresponding” may be used to indicate the position / identity of a structural element in a compound or composition by comparison with a suitable reference compound or composition. For example, in some embodiments, monomeric residues in a polymer (e.g., amino acid residues in a polypeptide or nucleic acid residues in a polynucleotide) may be identified as “corresponding” to residues in a suitable reference polymer. For example, those skilled in the art will understand that, for simplification, residues in polypeptides are often indicated using a standard numbering system based on the reference-related polypeptide, and as a result, the amino acid “corresponding” to the residue at position 190 does not necessarily have to be, for example, the 190th amino acid in a particular amino acid chain, but rather corresponds to the residue found at position 190 in the reference polypeptide. Those skilled in the art will readily understand how to identify “corresponding” amino acids. For example, those skilled in the art will be familiar with various sequence alignment techniques, including software programs such as BLAST, CS-BLAST, CUSASW++, DIAMOND, FASTA, GGSEARCH / GLSEARCH, Genoogle, HMMER, HHpred / HHsearch, IDF, Infernal, KLAST, USEARCH, parasail, PSI-BLAST, PSI-Search, ScalaBLAST, Sequilab, SAM, SSEARCH, SWAPHI, SWAPHI-LS, SWIMM, or SWIPE, which can be used, for example, to identify "corresponding" residues in polypeptides and / or nucleic acids in accordance with this disclosure.
[0035] Derivatives: As used herein, the term “derivative” refers to a structural analogue of a reference substance. That is, a “derivative” is a substance that exhibits great structural similarity to a reference substance, for example, sharing a core structure or consensus structure, but also differing in certain individual ways. In some embodiments, a derivative is a substance that can be produced from a reference substance by chemical manipulation. In some embodiments, a derivative is a substance that can be produced by performing a synthetic process that is substantially similar to the process used to produce the reference substance (for example, sharing several steps).
[0036] Modified: Generally, the term “modified” refers to a form that has been manipulated by human hands. For example, a polynucleotide is considered “modified” if two or more sequences that are not linked together in order in nature are manipulated by human hands so that they are directly linked to each other in the modified polynucleotide. For example, in some embodiments of this disclosure, the modified polynucleotide includes a regulatory sequence that is found in nature to operably associate with a first coding sequence but not with a second coding sequence, and is linked by human hands to operably associate with the second coding sequence. Similarly, a cell or organism is considered “modified” if its genetic information has been manipulated to change (for example, new genetic material that did not previously exist is introduced, for example, by transformation, mating, somatic hybridization, transfection, transduction, or other mechanisms, or existing genetic material is altered or removed, for example, by substitution or deletion mutation, or by a mating protocol). As is common practice and as understood by those skilled in the art, a modified polynucleotide or cellular offspring is typically referred to as “modified” even if actual manipulation has been performed on the original entity.
[0037] Excipients: As used herein, this refers to non-therapeutic agents that may be included in a pharmaceutical composition, for example, to provide or contribute to a desired viscosity or stabilizing effect. In some embodiments, suitable pharmaceutical excipients include, for example, starch, glucose, lactose, sucrose, gelatin, malt, rice, wheat flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk powder, glycerol, propylene glycol, water, ethanol, and the like.
[0038] Expression: As used herein, “expression” of a nucleic acid sequence means one or more of the following: (1) production of an RNA template from a DNA sequence (e.g., by transcription); (2) processing of an RNA transcript (e.g., by splicing, editing, 5' cap formation, and / or 3' end formation); (3) translation of RNA into a polypeptide or protein; and / or (4) post-translational modification of a polypeptide or protein.
[0039] Gene: As used herein, the term “gene” refers to a DNA sequence within a chromosome that codes for a gene product (e.g., an RNA product and / or a polypeptide product). In some embodiments, a gene includes a coding sequence (e.g., a sequence that codes for a particular gene product), and in some embodiments, a gene includes a non-coding sequence. In some specific embodiments, a gene may include both coding (e.g., exon) and non-coding (e.g., intron) sequences. In some embodiments, a gene may include one or more regulatory elements (e.g., promoters, enhancers, silencers, termination signals) that may control or influence one or more modes of gene expression (e.g., cell type-specific expression, inducible expression).
[0040] Gene product or expression product: As used herein, the terms “gene product” or “expression product” generally refer to RNA transcribed from a gene (preprocessing and / or postprocessing) or polypeptides encoded by RNA transcribed from a gene (pre-modification and / or post-modification).
[0041] Homology: As used herein, the term “homology” refers to the overall relationship between polymer molecules, for example, between polypeptide molecules or between polynucleotide molecules. In some embodiments, polymer molecules are considered “homology” to one another if their sequences are identical by at least 80%, 85%, 90%, 95%, or 99%. In some embodiments, polymer molecules are considered “homology” to one another if their sequences are similar by at least 80%, 85%, 90%, 95%, or 99%, or if such similarity is achieved over a desired stretch of the entire sequence.
[0042] Identity: As used herein, the term “identity” refers to the overall relationship between polymer molecules, for example between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or polypeptide molecules. In some embodiments, polymer molecules are considered “substantially identical” to one another if their sequences are identical by at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%. The percentage of identity between two nucleic acid sequences or polypeptide sequences can be calculated, for example, by aligning the two sequences for the purpose of best comparison (for example, gaps can be introduced in one or both of the first and second sequences for best alignment, and non-identical sequences can be ignored for the purpose of comparison). In certain embodiments, the length of the sequences to be aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or substantially 100% of the length of the reference sequence. The nucleotides at corresponding positions are then compared. The molecules at a given position are identical if a position in the first sequence is occupied by the same residue (e.g., a nucleotide or amino acid) at the corresponding position in the second sequence. The identity percentage between two sequences is a function of the number of identical positions shared in the sequences, taking into account the number of gaps that need to be introduced to optimally align the two sequences and the length of each gap. The comparison of sequences and the determination of the identity percentage between two sequences can be achieved using mathematical algorithms. For example, the identity percentage between two nucleotide sequences can be determined using the Meyers and Miller (CABIOS, 1989, 4:11-17) algorithm, which is incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparison performed using the ALIGN program utilizes a PAM120 weighted residue table, a 12-gap length penalty, and a 4-gap penalty.Alternatively, the percentage of identity between two nucleotide sequences can be determined using the GAP program in the GCG software package, which utilizes the NWSgapdna.CMP matrix.
[0043] “Improved,” “Increased,” or “Decreased”: As used herein, these terms, or grammatically equivalent comparative terms, indicate values relative to equivalent reference measures. For example, in some embodiments, an evaluation value achieved by the agent of interest (e.g., a therapeutic agent) may be “improved” compared to an evaluation value obtained with an equivalent reference agent. Or, further, in some embodiments, an evaluation value achieved in the object or system of interest may be “improved” compared to an evaluation value obtained in the same object or system under different conditions (e.g., before or after an event such as administration of the agent of interest), or in a different equivalent object (e.g., an equivalent object or system different from the object or system of interest in the presence of one or more indicators of the particular disease, disorder, or condition of interest, or before exposure to the conditions or agent). In some embodiments, comparative terms refer to statistically relevant differences (e.g., differences in incidence and / or magnitude sufficient to achieve statistical significance). A person skilled in the art will recognize, or be able to readily determine, the degree of difference and / or incidence necessary or sufficient to achieve such statistical significance in a given context.
[0044] In vitro: As used herein, the term "in vitro" refers to an event that occurs in an artificial environment, such as a test tube or reaction vessel, or in a cell culture, rather than within a multicellular organism.
[0045] In vivo: As used herein, this term refers to events occurring within multicellular organisms such as humans and non-human animals. In the context of cell-based systems, this term may be used to refer to events occurring within living cells (as opposed to, for example, in vitro systems).
[0046] Marker: As used herein, a marker refers to an entity or part whose presence or level is characteristic of a particular condition or event. In some embodiments, the presence or level of a particular marker may be characteristic of the presence or stage of a disease, disorder, or condition. For example, in some embodiments, the term refers to a gene expression product that is characteristic of a particular tumor, a subclass of tumor, or a stage of tumor. Or, further, in some embodiments, the presence or level of a particular marker correlates with the activity (or level of activity) of a particular signaling pathway that may be characteristic of a particular class of tumor, for example. The statistical significance of the presence or absence of a marker may vary depending on the particular marker. In some embodiments, the detection of a marker is highly specific in that it reflects the likelihood that the tumor is of a particular subclass. Such specificity may come at the cost of sensitivity (i.e., a negative result may occur even if the tumor is expected to express the marker). Conversely, a highly sensitive marker may be less specific than a less sensitive marker. A useful marker does not need to distinguish a particular subclass of tumor with 100% accuracy.
[0047] Nucleic acid: As used herein, in its broadest sense, refers to any compound and / or substance that is incorporated into or can be incorporated into an oligonucleotide chain. In some embodiments, nucleic acid is a compound and / or substance that is incorporated into or can be incorporated into an oligonucleotide chain via a phosphodiester bond. As is evident from the context, in some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides), and in some embodiments, “nucleic acid” refers to an oligonucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” is or contains RNA, and in some embodiments, “nucleic acid” is or contains DNA. In some embodiments, nucleic acid is one or more native nucleic acid residues, or contains or consists of them. In some embodiments, nucleic acid is one or more nucleic acid analogs, or contains or consists of them. In some embodiments, nucleic acid analogs differ from nucleic acids in that they do not utilize a phosphodiester backbone. For example, in some embodiments, nucleic acid is one or more “peptide nucleic acids,” which are known in the art and have peptide bonds instead of phosphodiester bonds in their backbone. Alternatively, in some embodiments, the nucleic acid has one or more phosphorothioate bonds and / or 5'-N-phosphoramidite bonds instead of phosphodiester bonds. In some embodiments, the nucleic acid is, contains, or consists of one or more natural nucleosides (e.g., adenosine, thymidine, guanosine, cytidine, uridine, deoxyadenosine, deoxythymidine, deoxyguanosine, and deoxycytidine).In some embodiments, the nucleic acid is, contains, or consists of one or more nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyladenosine, 5-methylcytidine, C-5 propynylcytidine, C-5 propynyluridine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyluridine, C5-propynylcytidine, C5-methylcytidine, 2-aminoadenosine, 7-deazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, 0(6)-methylguanine, 2-thiocytidine, methylated bases, intercalated bases, and combinations thereof). In some embodiments, the nucleic acid contains one or more modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose) compared to the sugars in natural nucleic acids. In some embodiments, the nucleic acid has a nucleotide sequence encoding a functional gene product such as RNA or protein. In some embodiments, the nucleic acid contains one or more introns. In some embodiments, the nucleic acid is prepared by one or more of the following: isolation from natural sources, enzymatic synthesis by polymerization based on complementary templates (in vivo or in vitro), replication in recombinant cells or recombinant systems, and chemosynthesis. In some embodiments, the nucleic acid has a residue length of at least 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 20, 225, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 600, 700, 800, 900, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or more. In some embodiments, nucleic acids are partially or entirely single-stranded, and in some embodiments, nucleic acids are partially or entirely double-stranded.In some embodiments, the nucleic acid has a nucleotide sequence comprising at least one element encoding a polypeptide, or is a complement to a polypeptide-encoding sequence. In some embodiments, the nucleic acid has enzymatic activity.
[0048] Peptides: As used herein, the term "peptides" typically refers to polypeptides having a relatively short length, for example, less than about 100 amino acids, less than about 50 amino acids, less than about 40 amino acids, less than about 30 amino acids, less than about 25 amino acids, less than about 20 amino acids, less than about 15 amino acids, or less than 10 amino acids.
[0049] pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulant, that is involved in transporting or carrying the compound of interest from one organ or part of the body to another. Each carrier must be “acceptable” in the sense that it is compatible with the other components of the formulation and is not harmful to the subject. Some examples of materials that can function as pharmaceutically acceptable carriers include sugars such as lactose, glucose, and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives, such as sodium carboxymethylcellulose, ethylcellulose, and cellulose acetate; tragacanth powder; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; glycols such as propylene glycol; polyols such as glycerin, sorbitol, mannitol, and polyethylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethyl alcohol; pH buffer solutions; polyesters, polycarbonates, and / or polyacid anhydrides; and other non-toxic suitable substances used in pharmaceutical formulations.
[0050] Pharmaceutical Composition: As used herein, the term “pharmaceutical composition” means an activator formulated with one or more pharmaceutically acceptable carriers. In some embodiments, the activator is present in a unit dose appropriate for administration in a therapeutic regimen, demonstrating a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, the pharmaceutical composition may be formulated for administration in solid or liquid form, specifically including: oral administration, e.g., oral tablets (aqueous or non-aqueous or suspension), tablets, e.g., buccal, sublingual, and those targeting internal absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, e.g., sterile solutions or suspensions, or as sustained-release formulations, e.g., by subcutaneous, intramuscular, intravenous, or epidural injection; topical application, e.g., creams, ointments, or controlled-release patches or sprays applied to the skin, lungs, or oral cavity; e.g., intravaginal or intrarectal, sublingual, intraocular, or transdermal, or transnasal, pulmonary, and other mucosal surfaces.
[0051] Polypeptide: The term “polypeptide,” as used herein, generally has the meaning recognized in the art as a polymer of at least three amino acids. Those skilled in the art will understand that the term “polypeptide” is intended to be sufficiently general to encompass not only polypeptides having the complete sequences cited herein, but also polypeptides representing functional fragments of such complete polypeptides (i.e., fragments that retain at least one activity). Furthermore, those skilled in the art will understand that protein sequences generally tolerate several substitutions that do not impair activity. Thus, any polypeptide that retains activity, shares at least about 30–40%, often about 50%, 60%, 70%, or more than 80% overall sequence identity, and more typically includes at least one region of identity that is much higher, often more than 90%, 95%, 96%, 97%, 98%, or more than 99%, in one or more highly conserved regions, and usually includes at least three to four, often up to 20 or more amino acids together with another polypeptide of the same class, is included within the scope of the related term “polypeptide” as used herein. Polypeptides may contain L-amino acids, D-amino acids, or both, and may contain any of the various amino acid modifications or analogs known in the art. Useful modifications include, for example, terminal acetylation, amidation, and methylation. In some embodiments, proteins may include natural amino acids, unnatural amino acids, synthetic amino acids, and combinations thereof. The term "peptide" is generally used to refer to polypeptides having a length of less than about 100 amino acids, less than about 50 amino acids, less than 20 amino acids, or less than 10 amino acids. In some embodiments, proteins are antibodies, antibody fragments, their biologically active portions, and / or characteristic portions thereof.
[0052] To prevent or Prevent: When used herein in connection with the occurrence of a disease, disorder, and / or condition, this means reducing the risk of developing a disease, disorder, and / or condition, and / or delaying the onset of one or more characteristics, signs, or symptoms of the disease, disorder, or condition. If the onset of the disease, disorder, or condition is delayed over a predetermined period of time, prevention may be deemed complete.
[0053] Risk: As understood from the context, the “risk” of a disease, disorder, and / or condition refers to the possibility that a particular individual may develop the disease, disorder, and / or condition. In some embodiments, the risk is expressed as a percentage. In some embodiments, the risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, or up to 100%. In some embodiments, the risk is expressed as a risk relative to a reference sample or group of reference samples. In some embodiments, the reference sample or group of reference samples has a known risk of the disease, disorder, condition, and / or event. In some embodiments, the reference sample or group of reference samples is derived from an individual comparable to a particular individual. In some embodiments, the relative risk is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or higher.
[0054] Subject: As used herein, the term “Subject” means an organism, typically a mammal (e.g., a human, and in some embodiments, a prenatal human form). In some embodiments, the Subject is suffering from the relevant disease, disorder, or condition. In some embodiments, the Subject is susceptible to the disease, disorder, or condition. In some embodiments, the Subject exhibits one or more symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the Subject does not exhibit any symptoms or characteristics of the disease, disorder, or condition. In some embodiments, the Subject is a person who has one or more characteristic features of susceptibility to or risk of the disease, disorder, or condition. In some embodiments, the Subject is a patient. In some embodiments, the Subject is an individual who is and / or has been diagnosed and / or treated.
[0055] Substantially: As used herein, the term “substantially” refers to a qualitative condition indicating the overall or nearly overall range or degree of the desired feature or characteristic. Those skilled in the biological art will understand that biological and chemical phenomena, if any, are rarely completed and / or proceed completely, or achieve or avoid absolute results. Therefore, the term “substantially” is used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.
[0056] Susceptibility: Individuals who are “susceptible” to a disease, disorder, and / or condition are individuals who are at a higher risk of developing the disease, disorder, and / or condition than the general population. In some embodiments, individuals who are susceptible to a disease, disorder, and / or condition may not have been diagnosed with that disease, disorder, and / or condition. In some embodiments, individuals who are susceptible to a disease, disorder, and / or condition may exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, individuals who are susceptible to a disease, disorder, and / or condition may not exhibit symptoms of that disease, disorder, and / or condition. In some embodiments, individuals who are susceptible to a disease, disorder, and / or condition will develop that disease, disorder, and / or condition. In some embodiments, individuals who are susceptible to a disease, disorder, and / or condition will not develop that disease, disorder, and / or condition.
[0057] Therapeutic agent: As used herein, the term “therapeutic agent” means a substance that, when administered to a subject, has a therapeutic effect and / or induces a desired biological and / or pharmacological effect. In some embodiments, a therapeutic agent is any substance that can be used to alleviate, relieve, reduce, inhibit, prevent, delay the onset of, reduce the severity of, and / or reduce the incidence of one or more symptoms or characteristics of a disease, disorder, and / or condition.
[0058] Treatment: As used herein, the term “treatment” (also “treat” or “treating”) means administering a therapy that partially or completely alleviates, remits, reduces, inhibits, delays the onset of, reduces the severity of, and / or reduces the incidence of one or more signs, symptoms, features, and / or causes of a particular disease, disorder, and / or condition. In some embodiments, such treatment may be for subjects who do not show signs of the disease, disorder, and / or condition in question, and / or for subjects who show only initial signs of the disease, disorder, and / or condition. Alternatively, such treatment may be for subjects who show one or more established signs of the disease, disorder, and / or condition in question. In some embodiments, treatment may be for subjects who have been diagnosed with the disease, disorder, and / or condition in question. In some embodiments, treatment may be for subjects who are known to have one or more susceptibility factors that are statistically correlated with an increased risk of developing the disease, disorder, and / or condition in question. Thus, in some embodiments, treatment may be prophylactic; in some embodiments, treatment may be therapeutic.
[0059] Variant: As used herein, the term “variant” refers to an entity that exhibits significant structural identity with a reference entity but is structurally different from the reference molecule in the presence or level of one or more chemical parts compared to the reference entity. In some embodiments, a variant is also functionally different from its reference entity. Generally, whether a particular entity is appropriately considered a “variant” of a reference entity depends on the degree of structural identity with the reference entity. As will be understood by those skilled in the art, any biological or chemical reference entity has certain characteristic structural elements. A variant is, by definition, a distinct chemical entity that shares one or more such characteristic structural elements. To give just a few examples, a polypeptide may have a characteristic sequence element consisting of a plurality of amino acids having designated positions relative to each other in linear or three-dimensional space and / or contributing to a particular biological function, and a nucleic acid may have a characteristic sequence element consisting of a plurality of nucleotide residues having designated positions relative to each other in linear or three-dimensional space. In some embodiments, the variant polypeptide or nucleic acid may differ from the reference polypeptide or nucleic acid as a result of one or more differences in the amino acid or nucleotide sequence and / or one or more differences in the chemical parts (e.g., carbohydrates, lipids, phosphate groups) that are covalent components of the polypeptide or nucleic acid (e.g., bonded to the polypeptide or nucleic acid backbone). In some embodiments, the variant polypeptide or nucleic acid exhibits overall sequence identity with the reference polypeptide or nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. In some embodiments, the variant polypeptide or nucleic acid exhibits overall sequence identity with a portion of the reference polypeptide or nucleic acid of at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, or 99%. Alternatively, or further, in some embodiments, the variant polypeptide or nucleic acid does not share at least one characteristic sequence element with the reference polypeptide or nucleic acid.In some embodiments, the reference polypeptide or nucleic acid has one or more biological activities that may differ from the variant. For example, in some embodiments, the variant polypeptide or nucleic acid shares one or more biological activities of the reference polypeptide or nucleic acid and further includes one or more sequence changes (e.g., deletions, insertions, truncations, codon optimizations, etc.). In some embodiments, the variant polypeptide or nucleic acid lacks one or more biological activities of the reference polypeptide or nucleic acid. In some embodiments, the variant polypeptide or nucleic acid exhibits a reduced level of one or more biological activities compared to the reference polypeptide or nucleic acid. In some embodiments, the polypeptide or nucleic acid of interest is considered a “variant” of the parent or reference polypeptide or nucleic acid if it has an amino acid or nucleotide sequence that is identical to that of the reference except for a few sequence changes at specific positions. Typically, about 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, or less than 2% of residues in the variant are substituted, inserted, or deleted compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains about 10, about 9, about 8, about 7, about 6, about 5, about 4, about 3, about 2, or about 1 substituted residue compared to the reference. Often, the variant polypeptide or nucleic acid contains a very small number (e.g., less than about 5, about 4, about 3, about 2, or about 1) of substituted, inserted, or deleted functional residues (i.e., residues involved in specific biological activity) compared to the reference. In some embodiments, the variant polypeptide or nucleic acid contains about 5, about 4, about 3, about 2, or about 1 or fewer additions or deletions compared to the reference, and in some embodiments, it contains no additions or deletions. In some embodiments, the variant polypeptide or nucleic acid contains about 25, about 20, about 19, about 18, about 17, about 16, about 15, about 14, about 13, about 10, about 9, about 8, about 7, less than about 6, generally less than about 5, about 4, about 3, or about 2 additions or deletions compared to the reference. In some embodiments, the reference polypeptide or nucleic acid is naturally occurring. In some embodiments, the reference polypeptide or nucleic acid is a human polypeptide or nucleic acid.
[0060] gene therapy Genetic disorders caused by dysfunctional genes account for nearly 80% of the approximately 7,136 diseases reported as of 2019 (see Genetic and Rare Diseases Information Center and Global Genes). It is estimated that more than 330 million people worldwide suffer from genetic disorders, with nearly half of these cases occurring in children. However, only about 500 human diseases are estimated to be treatable with available drugs, indicating a need for new therapies and treatment options to address a significant proportion of these genetic disorders. Gene therapy is an emerging form of treatment that aims to mediate the effects of genetic disorders by delivering genetic material to a target. In some embodiments, gene therapy may include the transcription and / or translation of introduced genetic material, and / or integration of introduced genetic material into the host genome via the administration of nucleic acids, viruses, or genetically modified microorganisms (see FDA guidelines). Gene therapy may make it possible to deliver therapeutic genetic material to any specific cells, tissues, and / or organs of the target for treatment. In some embodiments, gene therapy involves introducing a therapeutic gene or transgene into host cells. In any of the embodiments disclosed below, AAV may be scAAV.
[0061] Viral gene therapy Viruses have emerged as attractive vehicles for gene therapy due to their ability to express high levels of payloads (e.g., transgenes) and, in some embodiments, their ability to stably express payloads (e.g., transgenes) within the host genome. Recombinant AAVs are common viral vectors in gene therapy because they often have high viral yields, mild immune responses, and the ability to infect different cell types.
[0062] Conventional AAV gene therapy involves modifying rAAV to deliver a therapeutic payload (e.g., a transgene) to target cells without integration into chromosomal DNA. One or more payloads (e.g., transgenes) can be expressed from non-integrated genetic elements called episomes located within the cell nucleus. While conventional gene therapy may be effective in the initially transduced cells, episomal expression is transient and gradually decreases over time, particularly with cell turnover. Episomal expression may be effective for cells with longer lifespans (e.g., cells that exist for a significant portion of the subject's life). However, conventional gene therapy can be a drawback when applied to subjects early in life (e.g., during childhood), as rapid tissue growth during development can diminish the therapeutic effect of the payload (e.g., transgene), potentially leading to eventual loss.
[0063] GENERIDE®, a second type of AAV gene therapy, utilizes homologous recombination repair (HDR), a natural DNA repair process that typically helps maintain the integrity of the cellular genome. GENERIDE® uses HDR to insert one or more payloads (e.g., transgenes) into specific target loci within the genomic sequence. In some embodiments, GENERIDE® utilizes endogenous promoters at one or more target loci to induce high levels of tissue-specific expression. GENERIDE® eliminates the need for exogenous nucleases or promoters, thereby reducing the harmful effects often associated with those elements. Furthermore, the GENERIDE® platform technology has the potential to overcome some of the main limitations of both conventional gene therapies and conventional gene editing techniques, particularly in treating genetic disorders in pediatric patients. GENERIDE® delivers genes into the cell nucleus using, for example, an AAV vector. Next, by utilizing the cellular HDR mechanism, the modified gene can be stably incorporated into the target genome at a location regulated by an endogenous promoter. This makes it possible to sustain protein production even as the body's cells divide over time, something that is not possible with conventional AAV gene therapy.
[0064] Previous research on non-destructive gene targeting is described in International Publication No. 2013 / 158309, which is incorporated herein by reference. Previous research on nuclease-free genome editing is described in International Publication No. 2015 / 143177, which is incorporated herein by reference. Previous research on non-destructive gene therapy for treating MMA is described in International Publication No. 2020 / 032986, which is incorporated herein by reference. Previous research on gene therapy monitoring is described in International Publication No. 2020 / 214582, which is incorporated herein by reference.
[0065] Virus structure and function Viral vector A viral vector comprises a virus or viral chromosome material into which a heterologous nucleic acid sequence can be inserted for introduction into a target sequence of interest (e.g., into genomic DNA within a cell). Various viruses can be used as viral vectors, including, for example, single-stranded DNA (ssDNA) viruses, double-stranded DNA (dsDNA) viruses, and / or RNA viruses that have a DNA phase in their life cycle. In some embodiments, the viral vector is or contains adeno-associated virus (AAV) or an AAV variant. In some embodiments, the viral vector is or contains scAAV or an scAAV variant.
[0066] In some embodiments, the vector particle is a single unit of a virus comprising a capsid that capsidates a virus-based polynucleotide (e.g., a wild-type viral genome or a recombinant viral vector). In some embodiments, the vector particle is or comprises an AAV vector particle. In some embodiments, the AAV vector particle refers to a vector particle comprising at least one AAV capsid protein and a capsidated AAV vector. In some embodiments, the vector particle (also referred to as a viral vector) comprises at least one AAV capsid protein and a capsidated AAV (e.g., scAAV) vector, the vector further comprising one or more heterologous polynucleotide sequences.
[0067] Capsid protein In some embodiments, the expression construct comprises a polynucleotide sequence encoding a capsid protein derived from one or more AAV subtypes, including naturally occurring AAVs and recombinant AAVs. In some embodiments, the expression constructs are AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11.08, AAVC11.09, AAVC11.10, AAVC11.11 (referred to as sL65 interchangeably in this specification), AAVC11.12, AAVC11.13, AAVC11.14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV-LK03, AAVs comprising AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV13, AAVrh.8, avian AAVs, bovine AAVs, canine AAVs, equine AAVs, primate AAVs, non-primate AAVs, sheep AAVs, hybrid AAVs (e.g., AAVs comprising one or more sequences of one AAV subtype and one or more sequences of a second subtype), and / or AAVs comprising mutant AAV capsid proteins or chimeric AAV capsids (e.g., capsids having polynucleotide sequences derived from two or more different serotypes of AAV), or polynucleotide sequences encoding capsid proteins derived from such variants.
[0068] In some embodiments, a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) is packaged within a capsid protein (e.g., a capsid protein derived from one or more AAV subtypes). In some embodiments, the capsid protein provides increased or enhanced transduction of cells (e.g., human or mouse cells) compared to a reference capsid protein. In some embodiments, the capsid protein provides increased or enhanced transduction of a specific cell or tissue type (e.g., hepatotropic, myotropic, CNS-tropic) compared to a reference capsid protein. In some embodiments, the capsid protein increases or enhances the transduction of cells or tissues (e.g., liver, muscle, and / or CNS) by at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 200%, 300%, 400%, 500%, 600%, 700%, 800%, 900%, 1000%, or more compared to a reference capsid protein. In some embodiments, the capsid protein increases or enhances the transduction of cells or tissues (e.g., liver, muscle, and / or CNS) by at least about 1.2 times, 1.5 times, 2 times, 3 times, 4 times, 5 times, 6 times, 7 times, 8 times, 9 times, 10 times, 11 times, 12 times, 13 times, 14 times, 15 times, 16 times, 17 times, 18 times, 19 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, or more compared to a reference capsid protein.
[0069] Structure and Function of AAV AAV is a parvovirus composed of an icosahedral protein capsid and a single-stranded DNA genome. The AAV viral capsid contains three subunits, VP1, VP2, and VP3, and two terminal inversion repeat (ITR) regions at the ends of the genome sequence. The ITRs function as origins of replication and play a role in viral packaging. The viral genome also contains rep and cap genes, which are associated with replication and capsid packaging, respectively. In most wild-type AAV, the rep genes encode four proteins necessary for viral replication: Rep78, Rep68, Rep52, and Rep40. The cap genes encode the capsid subunits and assembly-activating proteins (AAPs) that facilitate the assembly of viral particles. AAV is generally replication-deficient and requires the presence of a helper virus or helper virus function (e.g., herpes simplex virus (HSV) and / or adenovirus (AdV)) to replicate in infected cells. For example, in some embodiments, AAV requires the adenovirus E1A, E2A, E4, and VA RNA genes to replicate within host cells.
[0070] Recombinant AAV Generally, recombinant AAV (rAAV) vectors may contain many of the same elements as wild-type AAV, including similar capsid sequences and structures, as well as polynucleotide sequences that are not of AAV origin (e.g., polynucleotides heterologous to AAV). In some embodiments, rAAV replaces the natural wild-type AAV sequence with a polynucleotide sequence encoding the payload. For example, in some embodiments, rAAV contains a polynucleotide sequence encoding one or more genes intended for therapeutic purposes (e.g., for gene therapy). rAAV may be modified to remove one or more wild-type virus-coding sequences. For example, rAAV may contain only one ITR and / or fewer genes (e.g., rep and cap genes) required for packaging than are found in wild-type AAV. Gene expression by rAAV is generally limited to one or more genes totaling 5kb or less, because larger sequences are not efficiently packaged within the viral capsid. In the case of scAAVs, in some examples, the coding sequence of the transgene is approximately 1.4kb or less (e.g., 1bp-1.4kb, 10bp-1.4kb, 100bp-1.4kb, 200bp-1.4kb, 300bp-1.4kb, 400bp-1.4kb, 500bp-1.4kb, 600bp-1.4kb, 700bp-1.4kb, 800bp-1.4kb, 900bp-1.4kb, 1kb-1.4kb, 1.1kb-1.4kb, 1.2kb-1.4kb, or 1.3kb-1.4kb). In some embodiments, for example, two or more rAAVs can be used to provide a larger payload portion, for example, to provide the entire coding sequence of a gene that is usually too large to fit into a single AAV.
[0071] In particular, this disclosure provides a viral vector comprising one or more polypeptides described herein. In some embodiments, rAAV comprises one or more capsid proteins (e.g., AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11.08, AAVC11.09, AAVC11.10, AAVC11.11 (hereinafter interchangeably referred to as sL65), AAVC11.12, AAVC11.13, AAVC11.14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.1 9. May include AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, sheep AAV, hybrid AAV (e.g., an AAV comprising one or more sequences of one AAV subtype and one or more sequences of a second subtype), and / or one or more capsid proteins derived from AAV, including mutant AAV capsid proteins or chimeric AAV capsids (e.g., capsids having polynucleotide sequences derived from two or more different serotypes of AAV). In some embodiments, rAAV may include one or more polynucleotide sequences encoding a gene or nucleic acid of interest (e.g., a gene for treating a genetic disease / disorder and / or inhibitory nucleic acid sequence).
[0072] AAV vectors may be able to replicate in infected host cells (replicable) or they may not be able to replicate in infected host cells (non-replicable). Replicable AAV (rcAAV) requires the presence of one or more functional AAV packaging genes. Recombinant AAV vectors are generally designed to be non-replicable in mammalian cells to reduce the likelihood of rcAAV being generated by recombination with sequences encoding AAV packaging genes. In some embodiments, rAAV vector preparations, such as those described herein, are designed to contain only a small amount, if present, of the rcAAV vector. In some embodiments, the rAAV vector preparation contains rAAV vector 10 2 Each contains less than approximately one rcAAV. In some embodiments, the rAAV vector preparation contains rAAV vector 10 4 Each contains less than approximately one rcAAV. In some embodiments, the rAAV vector preparation contains rAAV vector 10 8 Each contains less than approximately one rcAAV. In some embodiments, the rAAV vector preparation contains rAAV vector 10 12 Each sample contains less than approximately one rcAAV. In some embodiments, the rAAV vector preparation does not contain an rcAAV vector.
[0073] SCAAV Discount Payload / Cap Plasmid A payload / Cap plasmid that can be used for the production of scAAV vectors is provided herein. For example, a payload / Cap plasmid comprising a polynucleotide sequence encoding a cap gene and a polynucleotide sequence encoding scAAV, but not comprising a polynucleotide encoding a rep gene, is provided herein.
[0074] In some embodiments, the polynucleotide sequence encoding scAAV includes a left-terminal ITR and a right-terminal ITR. In some embodiments, (i) the left-terminal ITR includes the sequence of SEQ ID NO: 18; (ii) the right-terminal ITR includes the sequence of SEQ ID NO: 19; or (iii) the left-terminal ITR includes the sequence of SEQ ID NO: 18 and the right-terminal ITR includes the sequence of SEQ ID NO: 19.
[0075] In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 11, or SEQ ID NO: 12, or a sequence having at least 80% identity to SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 11, or SEQ ID NO: 12 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding the cap gene is inserted before position 550 of SEQ ID NO: 20.
[0076] In some embodiments, the polynucleotide sequence encoding scAAV includes a polynucleotide sequence encoding the transgene. Any suitable transgene can be used. In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, and the polynucleotide sequence encoding the transgene is inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is or includes a gene or variant thereof listed in Figure 29 of International Publication No. 2022 / 182986.
[0077] Composition: Furthermore, compositions comprising any of the payloads / Cap plasmids disclosed herein are provided herein. For example, compositions comprising any one of the payloads / Cap plasmids disclosed herein and a Rep / helper plasmid comprising the polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1, or SEQ ID NO: 2, but not comprising the polynucleotide sequence encoding the cap gene, are provided herein.
[0078] In some embodiments, the composition comprises two or fewer distinct plasmids.
[0079] In some embodiments, the plasmid ratio of Rep / helper plasmid to payload / cap plasmid is 1.5:1 to 1:10. In some embodiments, the plasmid ratio of Rep / helper plasmid to payload / cap plasmid is 1.5:1 to 1:6. In some embodiments, the plasmid ratio of Rep / helper plasmid to payload / cap plasmid is 1:3.
[0080] In some embodiments, the Rep / helper plasmid lacks a polynucleotide sequence encoding a 23K endoprotease (which contributes to the assembly of the adenovirus virion) and / or a polynucleotide sequence encoding a fiber element (one of the three major adenovirus capsid proteins).
[0081] For example, in another embodiment, the following compositions are provided herein: (i) a payload / Cap plasmid comprising a polynucleotide sequence encoding a cap gene and a polynucleotide sequence encoding scAAV, wherein the payload / Cap plasmid does not contain a polynucleotide sequence encoding a rep gene; and (ii) a Rep / helper plasmid comprising a polynucleotide sequence encoding a rep gene and a polynucleotide sequence comprising one or more viral helper genes, wherein the Rep / helper plasmid does not contain a polynucleotide sequence encoding a cap gene, and the plasmid ratio of the Rep / helper plasmid to the payload / Cap plasmid is 1.5:1 to 1:10.
[0082] In some embodiments, the plasmid ratio of Rep / helper plasmid to payload / cap plasmid is 1.5:1 to 1:6. In some embodiments, the plasmid ratio of Rep / helper plasmid to payload / cap plasmid is 1:3.
[0083] In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 11, or SEQ ID NO: 12. In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20. In some embodiments, the polynucleotide sequence encoding the cap gene is inserted before position 550 of SEQ ID NO: 20.
[0084] In some embodiments, the polynucleotide sequence encoding scAAV encodes a terminal inversion repeat (ITR) at the left end and a payload adjacent to the ITR at the right end. Any suitable ITR may be used, including any ITR disclosed herein (e.g., in Table 5) or its variants. In some embodiments, (i) the left-terminal ITR contains the sequence of SEQ ID NO: 18; (ii) the right-terminal ITR contains the sequence of SEQ ID NO: 19; or (iii) the left-terminal ITR contains the sequence of SEQ ID NO: 18 and the right-terminal ITR contains the sequence of SEQ ID NO: 19.
[0085] In some embodiments, the payload includes a transgene. In some embodiments, the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, with the polynucleotide sequence encoding the transgene inserted before position 626 of SEQ ID NO: 20. In some embodiments, the transgene is or includes a gene or variant thereof listed in Figure 29 of International Publication Brochure No. 2022 / 182986.
[0086] Any suitable transgene, including any of the transgenes disclosed herein, may be included in an scAAV vector such as those disclosed herein.
[0087] Any suitable cap gene may be used in scAAV vectors such as those disclosed herein. In some embodiments, the cap gene is AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11.08, AAVC11.09, AAVC11.10, AAVC11.11, AAVC11.12, AAVC11.13, AAVC11. Selected from the cap genes of 14, AAVC11.15, AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh.74, AAVrh.10, AAVhu.37, AAVrh.K, AAVrh.39, AAV12, AAV13, AAVrh.8, avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, sheep AAV, or hybrid AAV.
[0088] Any suitable Rep / helper plasmid may be used to produce scAAV vectors such as those disclosed herein. In some embodiments, the Rep / helper plasmid comprises the polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1, or SEQ ID NO: 2.
[0089] In some embodiments, the composition comprises two or fewer distinct plasmids.
[0090] Host cells and production methods for SCAAV In some embodiments, one of the compositions disclosed herein is used to produce an AAV (e.g., scAAV) vector.
[0091] In another embodiment, a host cell comprising any one of the compositions disclosed herein is provided herein. In some embodiments, the host cell is a mammalian host cell. In some embodiments, the mammalian host cell is a HEK293F cell or a derivative of a HEK293F cell. In some embodiments, the mammalian host cell is a HEK293F cell. In some embodiments, the derivative of a HEK293F cell is a clonal derivative of a HEK293F cell having one or more of the following properties: (i) lack of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of >12 million cells / mL in a medium of known composition; and / or (iii) 5 × 10 10 It is possible to produce an AAV titer greater than vg / mL. In some embodiments, the clonal derivative of HEK293 cells is a virus-producing cell (VPC) 2.0 cell.
[0092] In another embodiment, a method for producing a packaged scAAV vector is provided herein, comprising delivering one of the compositions disclosed herein to cells and incubating the cells for a time and under conditions sufficient to produce a packaged scAAV vector.
[0093] In some embodiments, delivery involves using a chemical transfection reagent. In some embodiments, the chemical transfection reagent includes a cationic lipid-based transfection reagent. In some embodiments, the cells are mammalian cells. In some embodiments, the mammalian cells are HEK293F cells or derivatives of HEK293F cells. In some embodiments, the mammalian cells are HEK293F cells. In some embodiments, a derivative of HEK293F cells is a clonal derivative of HEK293F cells having one or more of the following characteristics: (i) absence of SV40 large T antigen; (ii) ability to grow in suspension culture at a density > 12 million cells / mL in a medium of known composition; and / or (iii) ability to generate an AAV titer greater than 5×10 10 vg / mL. In some embodiments, the clonal derivative of HEK293F cells is VPC2.0 cells. In another aspect, provided herein is a host cell comprising any one of the payload / Cap plasmids disclosed herein or any one of the compositions disclosed herein. In some embodiments, the host cell is a mammalian cell. In some embodiments, the mammalian cells are HEK293F cells or derivatives of HEK293F cells. In some embodiments, the mammalian cells are HEK293F cells. In some embodiments, a derivative of HEK293F cells is a clonal derivative of HEK293F cells having one or more of the following characteristics: (i) absence of SV40 large T antigen; (ii) ability to grow in suspension culture at a density > 12 million cells / mL in a medium of known composition; and / or (iii) ability to generate an AAV titer greater than 5×10 10 vg / mL. In some embodiments, the clonal derivative of HEK293F cells is VPC2.0 cells.
[0094] heterologous nucleic acid payload In some embodiments, one or more vectors or constructs described herein may comprise one or more polynucleotide sequences encoding one or more payloads. Depending on the embodiment, any of the various payloads (e.g., those having diagnostic and / or therapeutic purposes) may be used alone or in combination. In some embodiments, the payload may be or comprise a polynucleotide sequence encoding a peptide or polypeptide. In some embodiments, the payload is a peptide having intracellular or extracellular activity that facilitates a biological process for treating a medical condition. In some embodiments, the payload may be or comprise a transgene (also referred to herein as a gene of interest (GOI)). In some embodiments, the payload may be or comprise one or more terminal inverted repeat (ITR) sequences (e.g., one or more AAV ITRs). In some embodiments, the payload may be or comprise one or more transgenes comprising adjacent ITR sequences. The ITR sequence may be one of the sequences listed in Table 5, or a sequence having at least 80% identity to one of the sequences listed in Table 5 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the ITR sequence includes a left-terminal ITR containing the sequence of sequence number 18, or a sequence having at least 80% identity to sequence number 18 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the ITR sequence includes a right-terminal ITR containing the sequence of sequence number 19, or a sequence having at least 80% identity with sequence number 19 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity).In some embodiments, the ITR sequence includes (i) a left-terminal ITR containing the sequence of SEQ ID NO: 18 or a sequence having at least 80% identity to SEQ ID NO: 18 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity), and (ii) a right-terminal ITR containing the sequence of SEQ ID NO: 19 or a sequence having at least 80% identity to SEQ ID NO: 19 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the payload may be or may include one or more transgenes containing adjacent homologous arm sequences. In some embodiments, the payload may be or may include one or more transgenes containing adjacent homologous arm sequences and adjacent ITRs. In some embodiments, the payload may be or include one or more heterologous nucleic acid sequences encoding a reporter gene (e.g., a fluorescent or luminescent reporter). In some embodiments, the payload may be or include one or more biomarkers (e.g., proxies for payload expression). In some embodiments, the expression construct includes one or more transcription termination sequences (e.g., poly-A sequences). In some embodiments, the expression construct includes one or more promoter sequences. In some embodiments, the expression construct includes one or more enhancer sequences. In some embodiments, the expression construct includes one or more intron sequences. In some embodiments, the payload may include sequences for polycistronic expression (e.g., 2A peptides or intron sequences, including internal ribosome entry sites). In some embodiments, a 2A peptide is a small peptide sequence (e.g., about 18-22 amino acids) that enables the co-expression of two or more distinct protein products within a single coding sequence. In some embodiments, a 2A peptide can enable the co-expression of two or more distinct protein products regardless of the arrangement of the protein coding sequence. In some embodiments, the 2A peptide is or contains a consensus motif (e.g., DVEXNPGP).In some embodiments, the 2A peptide facilitates protein cleavage. In some embodiments, the 2A peptide is or comprises a viral sequence (e.g., foot-and-mouth disease virus (F2A), equine rhinitis A virus, porcine tesiovirus type 1 (P2A), or Thosea asigna virus (T2A)).
[0095] In some embodiments, the biomarker is or includes a 2A peptide (e.g., P2A, T2A, E2A, and / or F2A). In some embodiments, the biomarker is or includes a furin cleavage motif (see Tian et al., FurinDB: A Database of 20-Residue Furin Cleavage Site Motifs, Substrates and Their Associated Drugs (2011), Int. J. Mol. Sci., vol. 12: 1060-1065). In some embodiments, the biomarker is or includes a tag (e.g., an immunological tag). In some embodiments, the payload may include one or more functional nucleic acids (e.g., one or more siRNAs or miRNAs). In some embodiments, the payload may include one or more inhibitory nucleic acids (e.g., ribozymes, miRNAs, siRNAs, or shRNAs, among others). In some embodiments, the payload may include one or more nucleases (e.g., Cas proteins, endonucleases, TALENs, ZFNs).
[0096] Transgene In some embodiments, the transgene is a modified gene selected to improve one or more signs and / or symptoms of a disease, disorder, or condition. In some embodiments, the transgene can be incorporated into the host cell genome by using a vector as contained herein. In some embodiments, the transgene is a functional version of a disease-related gene found in host cells (i.e., a gene isoform associated with the manifestation or exacerbation of a disease, disorder, or condition). In some embodiments, the transgene is an optimized version of a disease-related gene found in host cells (e.g., a codon-optimized variant or an expression-optimized variant). In some embodiments, the transgene is a variant of a disease-related gene found in host cells (e.g., a functional gene fragment or a variant thereof). In some embodiments, the transgene is a gene that causes the expression of a peptide normally expressed in one or more healthy tissues. In some embodiments, the transgene is a gene that causes the expression of a peptide normally expressed in hepatocytes. In some embodiments, the transgene is a gene that causes the expression of a peptide normally expressed in muscle cells. In some embodiments, the transgene is a gene that causes the expression of a peptide normally expressed in central nervous system cells.
[0097] In some embodiments, the transgene may be, or may include, a gene that causes the expression of a peptide that is not normally expressed in one or more healthy tissues (e.g., an ectopically expressed peptide). In some embodiments, the transgene is a gene that causes the expression of a peptide that is ectopically expressed in one or more healthy tissues (e.g., liver, muscle, central nervous system (CNS)). In some embodiments, the transgene is a gene that causes the expression of a peptide that is ectopically expressed in one or more healthy tissues and is normally expressed in one or more healthy tissues (e.g., liver, muscle, central nervous system (CNS)).
[0098] In some embodiments, the transgene may be or may include a gene encoding a functional nucleic acid. In some embodiments, the therapeutic agent may be or include a drug (e.g., ribozymes, guide RNA (gRNA), antisense oligonucleotide (ASO), miRNA, siRNA, and / or shRNA) that has a therapeutic effect on host cells or targets. For example, in some embodiments, the therapeutic agent facilitates a biological process for treating a medical condition, e.g., a disease, disorder, or at least one symptom of a condition.
[0099] In some embodiments, transgene expression in the subject substantially arises from integration at the target locus. In some embodiments, more than 75% (e.g., more than 80%, more than 85%, more than 90%, more than 95%, more than 99%, more than 99.5%) of the total transgene expression in the subject originates from transgene integration at the target locus. In some embodiments, less than 25% (e.g., less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%) of the total transgene expression in the subject originates from sources other than transgene integration at the target locus (e.g., episomal expression, integration at non-target loci).
[0100] In some embodiments, the transgene is transiently expressed in the subject (e.g., episomal expression induced by plasmids, minicircle DNA, viruses, etc.). In some embodiments, more than 75% of the total transgene expression in the subject (e.g., more than 80%, more than 85%, more than 90%, more than 95%, more than 99%, more than 99.5%) is derived from transient expression. In some embodiments, less than 25% of the total transgene expression in the subject (e.g., less than 20%, less than 15%, less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%) is derived from sources other than transient expression (e.g., integration at non-target loci). In some embodiments, the transgene is transiently expressed in the subject for more than one week after treatment (e.g., episomal expression induced by plasmids, minicircle DNA, viruses, etc.). In some embodiments, the transgene is transiently expressed in the subject for more than one month after treatment (e.g., episomal expression induced by plasmids, minicircle DNA, viruses, etc.).
[0101] In some embodiments, the transgene is transiently expressed in subjects for at least one week after treatment at a level equivalent to that observed at least one day after treatment (e.g., episomal expression mediated by plasmids, minicircle DNA, viruses, etc.). In some embodiments, the transgene is transiently expressed in subjects for at least one month after treatment at a level equivalent to that observed at least one day after treatment (e.g., episomal expression mediated by plasmids, minicircle DNA, viruses, etc.).
[0102] In some embodiments, the transgene is transiently expressed in subjects for more than one week after treatment at a reduced level compared to the level observed more than one day after treatment (e.g., episomal expression by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in subjects for more than one month after treatment at a reduced level compared to the level observed more than one day after treatment (e.g., episomal expression by plasmid, minicircle DNA, virus, etc.).
[0103] In some embodiments, the transgene is transiently expressed in the subject within one month or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in the subject within two months or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in the subject within three months or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in the subject within four months or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in the subject within five months or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.). In some embodiments, the transgene is transiently expressed in the subject within six months or less after treatment (e.g., episomal expression mediated by plasmid, minicircle DNA, virus, etc.).
[0104] Homologous arms In some embodiments, the viral vector described herein includes one or more adjacent polynucleotide sequences having significant sequence homology to the target locus (e.g., homologous arms). In some embodiments, the homologous arms are adjacent to a polynucleotide sequence encoding a payload (e.g., a transgene). In some embodiments, the homologous arms are adjacent to a polynucleotide sequence encoding a transgene. In some embodiments, the homologous arms induce site-specific integration of the payload (e.g., a transgene). In some embodiments, the payload may include both homologous arms and a transgene, with the homologous arms inducing site-specific integration of the transgene.
[0105] In some embodiments, the homologous arms are of the same length (also referred to herein as balanced homologous arms or uniform homologous arms). In some embodiments, a viral vector containing homologous arms of the same length, wherein the homologous arms are at least constant in length, provides an improved effect (e.g., an improved target incorporation rate). In some embodiments, the homologous arms are 50 nt to 500 nt in length. In some embodiments, the homologous arms are 50 nt to 100 nt in length. In some embodiments, the homologous arms are 100 nt to 1000 nt in length. In some embodiments, the homologous arms are 200 nt to 1000 nt in length. In some embodiments, the homologous arms are 500 nt to 1500 nt in length. In some embodiments, the homologous arms are 1000 nt to 2000 nt in length. In some embodiments, the homologous arms are longer than 2000 nt. In some embodiments, each homologous arm is at least 750 nt in length. In some embodiments, each homologous arm is at least 1000 nt in length. In some embodiments, each homologous arm is at least 1250 nt in length. In some embodiments, the homologous arms are less than 1000 nt in length.
[0106] In some embodiments, the homologous arms are of different lengths (also referred to herein as unbalanced homologous arms or heterogeneous homologous arms). In some embodiments, a viral vector containing unbalanced homologous arms of different lengths provides an improved effect (e.g., increased target site integration rate) compared to a reference sequence. In some embodiments, a viral vector containing homologous arms of different lengths, where each homologous arm is at least a constant length, provides an improved effect (e.g., increased target site integration rate) compared to a reference sequence (e.g., a viral vector containing homologous arms of the same length, or a viral vector containing one or more homologous arms less than 1000 nt in length).
[0107] In some embodiments, each homologous arm is longer than 50 nt. In some embodiments, each homologous arm is longer than 100 nt. In some embodiments, each homologous arm is longer than 200 nt. In some embodiments, each homologous arm is longer than 500 nt. In some embodiments, each homologous arm is at least 750 nt. In some embodiments, each homologous arm is at least 1000 nt. In some embodiments, one homologous arm is at least 750 nt and the other homologous arm is at least 1000 nt. In some embodiments, one homologous arm is at least 750 nt and the other homologous arm is at least 1100 nt. In some embodiments, one homologous arm is at least 750 nt and the other homologous arm is at least 1200 nt. In some embodiments, one homologous arm is at least 750 nt and the other homologous arm is at least 1300 nt. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1400 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1500 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1600 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1700 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1800 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 1900 nt long. In some embodiments, one homologous arm is at least 750 nt long and the other homologous arm is at least 2000 nt long.In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1100 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1200 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1300 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1400 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1500 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1600 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1700 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1800 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 1900 nt long. In some embodiments, one homologous arm is at least 1000 nt long and the other homologous arm is at least 2000 nt long. In some embodiments, one homologous arm is at least 1300 nt long and the other homologous arm is at least 1400 nt long. In some embodiments, the 5' homologous arm is longer than the 3' homologous arm. In some embodiments, the 3' homologous arm is longer than the 5' homologous arm.
[0108] In some embodiments, the homologous arm contains at least 70% homology to the target locus. In some embodiments, the homologous arm contains at least 80% homology to the target locus. In some embodiments, the homologous arm contains at least 90% homology to the target locus. In some embodiments, the homologous arm contains at least 95% homology to the target locus. In some embodiments, the homologous arm contains at least 99% homology to the target locus. In some embodiments, the homologous arm contains 100% homology to the target locus.
[0109] In some embodiments, viral vectors containing homologous arms result in an increased target site integration rate compared to a reference sequence (e.g., a viral vector lacking homologous arms). In some embodiments, viral vectors containing homologous arms result in a target site integration rate of 0.01% or higher (e.g., 0.05% or higher, 0.1% or higher, 0.2% or higher, 0.3% or higher, 0.4% or higher, 0.5% or higher, 0.6% or higher, 0.7% or higher, 0.8% or higher, 0.9% or higher, 1% or higher, 1.5% or higher, 2% or higher, 5% or higher, 10% or higher, 20% or higher, 30% or higher). In some embodiments, viral vectors containing homologous arms result in a time-dependent increase in target site integration rate. In some embodiments, the target site integration rate increases over time compared to an initial measurement of target site integration. In some embodiments, the time-dependent target site integration rate is at least 1.5 times (e.g., 1.5 times, 2 times, 3 times, 4 times, 5 times, 10 times, 20 times, 30 times, 40 times, 50 times, 60 times, 70 times, 80 times, 90 times, 100 times, 200 times) higher than the initial measurement of target site integration. In some embodiments, the target site integration rate is measured after 1 day or more. In some embodiments, the target site integration rate is measured after 1 week or more. In some embodiments, the target site integration rate is measured after 1 month or more. In some embodiments, the target site integration rate is measured after 1 year or more. In some embodiments, the target site integration rate is measured by evaluating one or more biomarkers (e.g., biomarkers including 2A peptide). In some embodiments, the target site integration rate is measured by evaluating one or more isolated nucleic acids (e.g., mRNA, gDNA). In some embodiments, the target site integration rate is measured by evaluating gene expression (e.g., by immunohistochemical staining).
[0110] [Table 1]
[0111] In some embodiments, viral vectors containing homologous arms of different lengths can provide improved gene editing in a species or model system of a species (e.g., mouse, human, or a model thereof). In some embodiments, the viral vector may contain different combinations of homologous arm lengths if it is optimized for expression in a particular species or model system of a particular species (e.g., mouse, human, or a model thereof). In some embodiments, a viral vector containing a particular combination of homologous arm lengths can provide improved gene editing in one species or model system of one species (e.g., human, humanized mouse model) compared to a second species or model system of a second species (e.g., mouse, pure mouse model). In some embodiments, a viral vector containing a particular combination of homologous arm lengths may be optimized for a higher level of gene editing in one species or model system of one species (e.g., human, humanized mouse model) compared to a second species or model system of a second species (e.g., mouse, pure mouse model).
[0112] In some embodiments, homologous arms induce the integration of the transgene immediately after a highly expressed endogenous gene. In some embodiments, homologous arms induce the integration of the transgene without interfering with endogenous gene expression (non-interfering integration).
[0113] Treatment method The compositions and constructs disclosed herein can be used in any in vitro or in vivo application to express a payload (e.g., a transgene) from a specific target locus within a cell while maintaining the expression of endogenous genes at and around the target locus. For example, the compositions and constructs disclosed herein may be used to treat a target disorder, disease, or medical condition (e.g., by gene therapy).
[0114] In some embodiments, treatment includes obtaining or maintaining a desired pharmacological and / or physiological effect. In some embodiments, the desired pharmacological and / or physiological effect may include completely or partially preventing the disease (e.g., preventing the symptoms of the disease). In some embodiments, the desired pharmacological and / or physiological effect may include completely or partially curing the disease (e.g., curing adverse effects associated with the disease). In some embodiments, the desired pharmacological and / or physiological effect may include preventing the recurrence of the disease. In some embodiments, the desired pharmacological and / or physiological effect may include slowing the progression of the disease. In some embodiments, the desired pharmacological and / or physiological effect may include reducing the symptoms of the disease. In some embodiments, the desired pharmacological and / or physiological effect may include preventing the regression of the disease. In some embodiments, the desired pharmacological and / or physiological effect may include stabilizing and / or reducing symptoms associated with the disease. In some embodiments, treatment includes administering the composition before, during, or after the onset of the disease (e.g., before, during, or after the appearance of disease-related symptoms). In some embodiments, treatment includes combination therapy (e.g., by one or more therapies comprising different types of therapies).
[0115] Target disease In some embodiments, the compositions and constructs disclosed herein may be used as disease components to treat any disease of interest, including genetic defects or abnormalities.
[0116] In some embodiments, homocystinuria (HCU) can be treated using compositions and constructs disclosed herein. In some embodiments, treatment comprises introducing polynucleotide sequences encoding one or more target transgenes (e.g., cystathionine β-synthase (CBS) and / or variants thereof). In some embodiments, treatment comprises reducing abnormal proteins (e.g., non-functional proteins) associated with HCU. In some embodiments, treatment comprises reducing signs and / or symptoms associated with HCU (e.g., lens displacement, myopia, iris nystagmus, cataracts, optic nerve atrophy, glaucoma, retinal detachment, retinal damage, indicators of developmental delay, intellectual disability, depression, anxiety, obsessive-compulsive disorder, spider legs, genu valgus, pes cavus, scoliosis, pectus pigeon, pectus excavatum, osteoporosis, increased blood clot formation, thromboembolism, pulmonary embolism, fragile skin, depigmentation, facial flushing, inguinal hernia, pancreatitis, kyphosis, spontaneous pneumothorax).
[0117] In some embodiments, hereditary tyrosinemia can be treated using compositions and constructs disclosed herein. In some embodiments, treatment involves introducing polynucleotide sequences encoding one or more target transgenes (e.g., fumarylacetoacetate hydrolase (FAH) and / or variants thereof). In some embodiments, treatment involves reducing abnormal proteins (e.g., non-functional proteins) associated with hereditary tyrosinemia. In some embodiments, treatment involves reducing signs and / or symptoms associated with hereditary tyrosinemia (e.g., hepatomegaly, jaundice, liver disease, cirrhosis, hepatocellular carcinoma, fever, diarrhea, bloody stools, vomiting, splenomegaly, edema, coagulation disorders, renal dysfunction, rickets, weakness, hypertonia, intestinal obstruction, tachycardia, hypertension, neurological seizures, respiratory failure, cardiomyopathy).
[0118] In some embodiments, Wilson's disease can be treated using compositions and constructs disclosed herein. In some embodiments, the treatment involves introducing polynucleotide sequences encoding one or more target transgenes (e.g., ATP7B, and / or variants thereof). In some embodiments, the treatment involves reducing abnormal proteins (e.g., non-functional proteins) associated with Wilson's disease. In some embodiments, the treatment involves reducing signs and / or symptoms associated with Wilson's disease (e.g., fatigue, loss of appetite, abdominal pain, jaundice, Kaiser-Fleischer rings, edema, speech disorders, dysphagia, loss of physical coordination, uncontrolled movements, muscle rigidity, liver disease, anemia, depression, schizophrenia, amenorrhea, infertility, kidney stones, renal tubular disorders, arthritis, osteoporosis, osteophytes).
[0119] Targeted embedding In some embodiments, the compositions and constructs provided herein induce the integration of a payload (e.g., a transgene and / or functional nucleic acid) at a target gene locus (e.g., an endogenous gene). In some embodiments, the compositions and constructs provided herein induce the integration of a payload at a target gene locus specific to a particular cell type (e.g., a tissue-specific gene locus). In some embodiments, payload integration occurs in a specific tissue (e.g., liver, central nervous system (CNS), muscle, kidney, blood vessel). In some embodiments, payload integration occurs in multiple tissues (e.g., liver, central nervous system (CNS), muscle, kidney, blood vessel).
[0120] In some embodiments, the compositions and constructs provided herein induce payload integration at target loci considered to be safe harbor sites (e.g., albumin, apolipoprotein A2 (ApoA2), haptaglobin). In some embodiments, the target loci may be selected from any genomic site suitable for use with the methods and compositions provided herein. In some embodiments, the target loci encodes a polypeptide. In some embodiments, the target loci encodes a polypeptide that is highly expressed in a subject (e.g., a subject free from disease, disorder, or condition, or a subject suffering from disease, disorder, or condition). In some embodiments, payload integration occurs at the 5' or 3' end of one or more endogenous genes (e.g., genes encoding polypeptides). In some embodiments, payload integration occurs between the 5' or 3' ends of one or more endogenous genes (e.g., genes encoding polypeptides).
[0121] In some embodiments, the compositions and constructs provided herein induce payload integration at target loci with minimal or no off-target integration (e.g., integration at non-target loci). In some embodiments, the compositions and constructs provided herein induce payload integration at target loci with reduced off-target integration compared to a reference composition or construct (e.g., compared to a composition or construct that does not contain adjacent homologous sequences).
[0122] In some embodiments, the integration of the transgene at the target locus allows for the expression of the payload without interfering with the expression of the endogenous gene. In some embodiments, the integration of the transgene at the target locus allows for the expression of the payload from the endogenous promoter. In some embodiments, the integration of the transgene at the target locus interferes with the expression of the endogenous gene. In some embodiments, the integration of the transgene at the target locus interferes with the expression of the endogenous gene without adversely affecting the target cell and / or object (e.g., by targeting a safe harbor site). In some embodiments, the integration of the transgene at the target locus eliminates the need for the use of nucleases (e.g., Cas proteins, endonucleases, TALENs, ZFNs). In some embodiments, the integration of the transgene at the target locus is assisted by the use of nucleases (e.g., Cas proteins, endonucleases, TALENs, ZFNs).
[0123] In some embodiments, integration of the transgene at a target locus confers a selective advantage (e.g., increased viability of multiple cells compared to other cells in the tissue). In some embodiments, the selective advantage may result in an increased percentage of one or more cells in the tissue expressing the transgene.
[0124] Composition: In some embodiments, the compositions can be produced using methods and constructs provided herein (e.g., viral vectors (e.g., AAV vectors (e.g., scAAV vectors))). In some embodiments, the compositions include liquid, solid, and gaseous compositions. In some embodiments, the compositions include additional components (e.g., diluents, stabilizers, excipients, adjuvants). In some embodiments, further components may include, among other things, buffers (e.g., phosphates, citrates, organic acid buffers), antioxidants (e.g., ascorbic acid), low molecular weight polypeptides (e.g., less than 10 residues), various proteins (e.g., serum albumin, gelatin, immunoglobulins), hydrophilic polymers (e.g., polyvinylpyrrolidone), amino acids (e.g., glycine, glutamine, asparagine, arginine, lysine), carbohydrates (e.g., monosaccharides, disaccharides, glucose, mannose, dextrin), chelating agents (e.g., EDTA), sugar alcohols (e.g., mannitol, sorbitol), counterions that form salts (e.g., sodium, potassium), and / or nonionic surfactants (e.g., Tween®, Pluronics®, polyethylene glycol (PEG)). In some embodiments, the aqueous carrier is a pH-buffered aqueous solution.
[0125] In some embodiments, the compositions provided herein may be provided in a range of doses. In some embodiments, the compositions provided herein may be provided in a single dose. In some embodiments, the compositions provided herein may be provided in multiple doses. In some embodiments, the compositions may be provided over a period of time. In some embodiments, the compositions may be provided at specific intervals (e.g., variable intervals, set intervals). In some embodiments, the dose may vary depending on the dosage form and route of administration. In some embodiments, the compositions provided herein may be provided in doses of 1e11 to 1e14 vg / kg. In some embodiments, the compositions provided herein may be provided in doses of 1e12 to 1e13 vg / kg. In some embodiments, the compositions provided herein may be provided in doses of 1e12 to 1e14 vg / kg. In some embodiments, the compositions provided herein may be provided in doses of 1e14 to 1e15 vg / kg. In some embodiments, the compositions provided herein may be provided in doses of 1e14 vg / kg or less. In some embodiments, the compositions provided herein may be provided in doses of 1 e15 vg / kg or less.
[0126] Route of administration In some embodiments, the compositions provided herein may be administered to a subject via one (or more) of the various routes known in the art (e.g., parenteral, subcutaneous, intravenous, intracranial, intraspinal, intraocular, intramuscular, vaginal, intraperitoneal, supercutaneous, intradermal, rectal, lung, intraosseous, oral, buccal, portal, arterial, tracheal, or nasal). In some embodiments, the compositions provided herein may be introduced into cells, which may then be introduced into a subject (e.g., hepatocytes, muscle cells, central nervous system (CNS) cells, blood cells). In some embodiments, the compositions provided herein may be introduced via delivery methods known in the art (e.g., injection, catheter).
[0127] Method for producing viral vectors Production of viral vectors Prior to this disclosure, the production of a viral vector (e.g., AAV (e.g., scAAV)) typically involves the use of three distinct expression constructs (e.g., plasmids), one comprising a viral rep gene or gene variant (e.g., AAV rep gene) and a viral cap gene or gene variant (e.g., AAV cap gene), one comprising one or more viral helper genes or gene variants (e.g., adenovirus helper genes), and one comprising a payload (e.g., a transgene containing adjacent ITRs). As used herein, the upstream production process refers to the steps involved in the creation of the viral vector, and the downstream production process refers to the steps involved in the subsequent process of the viral vector at the point of creation (i.e., the point at which the desired payload and other components have been incorporated into the vector). In particular, this disclosure recognizes the limitations of conventional three-plasmid systems or viral vectors for production. In some embodiments, the constructs and methods described herein are designed to overcome the limitations of conventional three-plasmid systems for producing viral vectors by using the two-plasmid system described herein.
[0128] In some embodiments, the production of a viral vector (e.g., an AAV vector (e.g., a scAAV vector)) may include both an upstream process for generating the viral vector (e.g., cell-based culture) and a downstream process for processing the viral vector (e.g., purification, formulation, etc.). In some embodiments, the upstream process may include one or more of the following: cell proliferation, cell culture, cell transfection, cell lysis, viral vector production, and / or viral vector recovery.
[0129] In some embodiments, the downstream steps may include one or more of the following: separation, filtration, concentration, clarification, purification, chromatography (e.g., affinity, ion exchange, hydrophobic, mixed modes), centrifugation (e.g., ultracentrifugation), and / or formulation.
[0130] In some embodiments, the constructs and methods described herein are designed to improve viral vector yield (e.g., AAV vector yield (e.g., scAAV vector yield)), reduce the level of replicable viral vector (e.g., replicable AAV (rcAAV)), improve viral vector packaging efficiency (e.g., AAV vector capsid packaging (e.g., scAAV vector capsid packaging)), and / or any combination thereof, compared to the reference constructs or methods of Xiao et al. 1998 and Grieger et al. 2015, each of which is incorporated herein by reference in whole, for example.
[0131] Cell lines and transfection reagents In some embodiments, viral vector production involves the use of cells (e.g., cell cultures). In some embodiments, viral vector production involves the use of cell cultures of one or more cell lines (e.g., mammalian cell lines). In some embodiments, viral vector production involves the use of the HEK293F cell line or its variants (e.g., HEK293T, HEK293F cell lines). In some embodiments, cells can be grown in a suspension. In some embodiments, the cells consist of adherent cells. In some embodiments, cells can be grown in a medium that does not contain animal components (e.g., animal serum). In some embodiments, cells can be grown in serum-free medium (e.g., F17 medium, Expi293 medium). In some embodiments, the cells are HEK293F cells or derivatives of HEK293F cells. In some embodiments, the cells are HEK293F cells. In some embodiments, HEK293F cell derivatives are clonal derivatives of HEK293F cells having one or more of the following characteristics: (i) lack of SV40 large T antigen; (ii) capable of growth in suspension culture at a density of >12 million cells / mL in a known composition medium; and / or (iii) 5 × 10 10It is possible to produce an AAV titer greater than vg / mL. In some embodiments, the clonal derivative of HEK293F cells is VPC2.0 cells. In some embodiments, viral vector production involves transfection of cells with an expression construct (e.g., plasmid). In some embodiments, cells are selected for high expression of the viral vector (e.g., AAV vector). In some embodiments, cells are selected for high viral vector packaging efficiency (e.g., packaging of the AAV vector capsid). In some embodiments, cells are selected for improved transfection efficiency (e.g., by a chemical transfection reagent containing a cationic molecule). In some embodiments, cells are modified to high expression of the viral vector (e.g., AAV vector). In some embodiments, cells are modified to increase viral vector packaging efficiency (e.g., packaging of the AAV vector capsid). In some embodiments, cells are modified to improve transfection efficiency (e.g., by a chemical transfection reagent containing a cationic molecule). In some embodiments, cells may be modified or selected for two or more of the above attributes. In some embodiments, cells are contacted with one or more expression constructs (e.g., plasmids). In some embodiments, cells are contacted with one or more transfection reagents (e.g., chemical transfection reagents including lipids, polymers, and cationic molecules) and one or more expression constructs. In some embodiments, cells are contacted with one or more cationic molecules (e.g., cationic lipids, PEI reagents) and one or more expression constructs. In some embodiments, cells are contacted with PEIMAX reagents and one or more expression constructs. In some embodiments, cells are contacted with FectoVir-AAV reagents and one or more expression constructs. In some embodiments, cells are contacted with AAV-MAX reagents (e.g., AAV-MAX transfection reagents, AAV-MAX boosters, and / or AAV-MAX enhancers) and one or more expression constructs.In some embodiments, cells are contacted with one or more transfection reagents and one or more expression constructs in a specific ratio. In some embodiments, the ratio of transfection reagents to expression constructs is such that it improves viral vector production (e.g., improved vector yield, improved packaging efficiency, and / or improved transfection efficiency).
[0132] Expression construct In some embodiments, the expression construct is or comprises one or more polynucleotide sequences (e.g., plasmids). In some embodiments, the expression construct comprises specific polynucleotide sequence elements (e.g., payload, promoter, viral gene, etc.). In some embodiments, the expression construct comprises a polynucleotide sequence encoding a viral gene (e.g., rep gene or cap gene or gene variant, one or more helper virus genes or gene variants). In some embodiments, a particular type of expression construct comprises a particular combination of polynucleotide sequence elements. In some embodiments, a particular type of expression construct does not comprise a particular combination of polynucleotide sequence elements. In some embodiments, a particular expression construct does not comprise polynucleotide sequence elements encoding both the rep gene and the cap gene and / or gene variants.
[0133] In some embodiments, the expression construct comprises a polynucleotide sequence encoding a wild-type viral gene (e.g., a wild-type rep gene, a cap gene, a viral helper gene, or a combination thereof). In some embodiments, the expression construct comprises a polynucleotide sequence encoding a viral helper gene or gene variant (e.g., a herpesvirus gene or gene variant, an adenovirus gene or gene variant). In some embodiments, the expression construct comprises a polynucleotide sequence encoding one or more gene copies (e.g., 1 copy, 2 copies, 3 copies, 4 copies, 5 copies, etc.) expressing one or more wild-type Rep proteins. In some embodiments, the expression construct comprises a polynucleotide sequence encoding a single gene copy expressing one or more wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, Rep78, or a combination thereof). In some embodiments, the expression construct comprises a polynucleotide sequence encoding one or more wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, Rep78, or a combination thereof). In some embodiments, the expression construct comprises a polynucleotide sequence encoding at least four wild-type Rep proteins (e.g., Rep68, Rep40, Rep52, and Rep78). In some embodiments, the expression construct comprises a polynucleotide sequence encoding each of Rep68, Rep40, Rep52, and Rep78. In some embodiments, the expression construct comprises a polynucleotide sequence encoding one or more wild-type adenovirus helper proteins (e.g., E2 and E4).
[0134] In some embodiments, the expression construct includes a wild-type polynucleotide sequence encoding a wild-type viral gene (e.g., rep gene, cap gene, helper gene). In some embodiments, the expression construct includes a modified polynucleotide sequence (e.g., codon-optimized) encoding a wild-type viral gene (e.g., rep gene, cap gene, helper gene). In some embodiments, the expression construct includes a modified polynucleotide sequence encoding a modified viral gene (e.g., rep gene, cap gene, helper gene). In some embodiments, the modified viral gene is designed and / or modified for specific improvements (e.g., improved transduction, tissue specificity, size reduction, reduced immune response, improved packaging, reduced rcAAV levels, etc.).
[0135] In various embodiments, the expression constructs disclosed herein may offer improved flexibility and modularity compared to prior art. In some embodiments, the expression constructs disclosed herein may allow for the substitution of various polynucleotide sequences (e.g., different rep genes, cap genes, payloads, helper genes, promoters, etc.) while providing specific improvements (e.g., improved viral vector yield, improved packaging, reduced rcAAV levels, etc.). In some embodiments, the expression constructs disclosed herein may be adapted to various upstream production processes (e.g., different cell culture conditions, different transfection reagents, etc.) while providing specific improvements (e.g., improved viral vector yield, improved packaging, reduced rcAAV levels, etc.).
[0136] In some embodiments, different types of expression constructs include different combinations of polynucleotide sequences. In some embodiments, one type of expression construct includes one or more polynucleotide sequence elements (e.g., payload, promoter, viral gene, etc.) that are not present in other types of expression constructs. In some embodiments, one type of expression construct includes a polynucleotide sequence element encoding a viral gene (e.g., rep gene or cap gene or gene variant) and a polynucleotide sequence element encoding a payload (e.g., transgene and / or functional nucleic acid). In some embodiments, one type of expression construct includes a polynucleotide sequence element encoding one or more viral genes (e.g., rep gene or cap gene or gene variant and / or one or more helper virus genes). In some embodiments, one type of expression construct includes a polynucleotide sequence element encoding one or more viral genes, where the viral genes are derived from one or more types of viruses (e.g., AAV and adenovirus-derived genes or gene variants). In some embodiments, the gene and / or gene variant is an adenovirus-derived viral gene. In some embodiments, the adenovirus-derived viral gene is one or more of the following: E2A (e.g., E2A DNA-binding protein (DBP)), E4 (e.g., E4 open reading frame (ORF) 2, ORF3, ORF4, ORF6 / 7), VA, and / or its variants. In some embodiments, the expression construct is used to produce a viral vector (e.g., by cell culture). In some embodiments, the expression construct is brought into contact with cells in combination with one or more transfection reagents (e.g., chemical transfection reagents). In some embodiments, the expression construct is brought into contact with cells in combination with one or more transfection reagents in a specific ratio. In some embodiments, different types of expression constructs are brought into contact with cells in combination with one or more transfection reagents in a specific ratio (e.g., by weight ratio).In some embodiments, different types of expression constructs are brought into contact with cells in a ratio (e.g., by weight) of approximately 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1.5:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10. In some embodiments, different types of expression constructs are brought into contact with cells in a ratio (e.g., by weight) of approximately 1:3. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio (e.g., by weight) of approximately 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1.5:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10. In some embodiments, a first expression construct containing one or more payloads and a second expression construct containing one or more viral helper genes are brought into contact with cells in a ratio (e.g., by weight) of approximately 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, 1.5:1, 1:1, 1:1.5, 1:2, 1:3, 1:4, 1:5, 1:6, 1:7, 1:8, 1:9, or 1:10. In some embodiments, expression constructs in specific ratios improve the production of AAV (e.g., scAAV) (e.g., improved viral vector yield, improved packaging efficiency, and / or improved transfection efficiency). In some embodiments, cells are contacted with two or more expression constructs (e.g., sequentially or substantially simultaneously). In some embodiments, three or more expression constructs are contacted with cells. In some embodiments, the expression construct comprises one or more promoters (e.g., one or more exogenous promoters). In some embodiments, the promoter is or comprises CMV, RSV, CAG, EF1α, PGK, A1AT, C5-12, MCK, desmin, p5, p40, or a combination thereof. In some embodiments, the expression construct comprises one or more promoters upstream of a specific polynucleotide sequence element (e.g., a rep gene or cap gene or gene variant).In some embodiments, the expression construct includes one or more promoters downstream of a specific polynucleotide sequence element (e.g., a rep gene, a cap gene, or a gene variant).
[0137] In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 or greater and up to 3:1, where the yield of viral titers is at least 1.5 times greater than that obtained by administering a reference system (e.g., a 3 plasmid comprising 1) AAV rep and AAV cap sequences, 2) relevant sequences derived from helper viruses, and 3) separate plasmids encoding one of the payloads). In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 or greater and up to 5:1, where the yield of viral titers is at least 1.5 times greater than that obtained by administering a reference system (e.g., a 3 plasmid comprising 1) AAV rep and AAV cap sequences, 2) relevant sequences derived from helper viruses, and 3) separate plasmids encoding one of the payloads). In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 or higher and up to 6:1, where the yield of viral titers is at least 1.5 times greater than that obtained by administering a reference system (e.g., a 3 plasmid comprising 1) AAV rep and AAV cap sequences, 2) relevant sequences derived from helper viruses, and 3) separate plasmids encoding one of the payloads). In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 or higher and up to 8:1, where the yield of viral titers is at least 1.5 times greater than that obtained by administering a reference system (e.g., a 3 plasmid comprising 1) AAV rep and AAV cap sequences, 2) relevant sequences derived from helper viruses, and 3) separate plasmids encoding one of the payloads).In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 or greater and up to 10:1, where the yield of viral titers is at least 1.5 times greater than that obtained by administering a reference system (e.g., 3 plasmids containing separate plasmids encoding 1) AAV rep and AAV cap sequences, 2) relevant sequences derived from helper viruses, and 3) one of the payloads, respectively.
[0138] In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 10:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:3. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 9:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 8:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 7:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 6:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 5:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 4:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 3:1 to 1:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 2:1 to 1:1.
[0139] In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 2:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 3:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 4:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 5:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 6:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 7:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 8:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 9:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1:1 to 10:1. In some embodiments, a first expression construct containing one or more viral helper genes and a second expression construct containing one or more payloads are brought into contact with cells in a ratio of 1.5:1.
[0140] In some embodiments, the expression construct comprises one or more polynucleotide sequences encoding elements (e.g., selection markers, origins of replication) required for cell culture (e.g., bacterial cell culture, mammalian cell culture). In some embodiments, the expression construct comprises one or more polynucleotide sequences encoding antibiotic resistance genes (e.g., kanamycin resistance genes, ampicillin resistance genes). In some embodiments, the expression construct comprises one or more polynucleotide sequences encoding bacterial origins of replication (e.g., colE1 origin).
[0141] In some embodiments, the expression construct includes one or more transcription termination sequences (e.g., polyA sequences). In some embodiments, the expression construct includes one or more BGH polyA, FIX polyA, SV40 polyA, synthetic polyA, or a combination thereof. In some embodiments, the expression construct includes one or more transcription termination sequences downstream of a specific sequence element (e.g., a rep gene or cap gene or gene variant). In some embodiments, the expression construct includes one or more transcription termination sequences upstream of a specific sequence element (e.g., a rep gene or cap gene or gene variant).
[0142] In some embodiments, the expression construct includes one or more intron sequences. In some embodiments, the expression construct includes one or more introns of different origins (e.g., known genes), including but not limited to FIX introns, albumin introns, or combinations thereof. In some embodiments, the expression construct includes one or more introns of different lengths (e.g., 133 bp to 4 kb). In some embodiments, the expression construct includes one or more intron sequences upstream of a specific sequence element (e.g., a rep gene or cap gene or gene variant). In some embodiments, the expression construct includes one or more intron sequences within a specific sequence element (e.g., a rep gene or cap gene or gene variant). In some embodiments, the expression construct includes one or more intron sequences downstream of a specific sequence element (e.g., a rep gene or cap gene or gene variant). In some embodiments, the expression construct includes one or more intron sequences after a promoter (e.g., a p5 promoter). In some embodiments, the expression construct includes one or more intron sequences before a rep gene or gene variant. In some embodiments, the expression construct comprises one or more intron sequences between the promoter and the rep gene or gene variant. In some embodiments, the compositions provided herein comprise an expression construct. In some embodiments, the composition comprises (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wild-type adenovirus helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding one or more cap genes and one or more payloads.
[0143] In some embodiments, the composition includes a first expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequences or variants thereof in Table 3 below. In some embodiments, the composition includes a first expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a portion of the sequences or variants thereof in Table 3 below. In some embodiments, the composition includes a first expression construct comprising the sequences in Table 3 below. In some embodiments, the composition includes a first expression construct comprising the sequences in Table 3 below. In some embodiments, the composition includes a first expression construct comprising a portion of the sequences in Table 3 below.
[0144] [Table 3-1]
[0145] [Table 3-2]
[0146] [Table 3-3]
[0147] [Table 3-4]
[0148] [Table 3-5]
[0149] [Table 3-6]
[0150] Table 3-7
[0151] Table 3-8
[0152] Table 3-9
[0153] Table 3-10
[0154] Table 3-11
[0155] Table 3-12
[0156] Table 3-13
[0157] Table 3-14
[0158] Table 3-15
[0159] Table 3-16
[0160] Table 3-17
[0161] Table 3-18
[0162] Table 3-19
[0163] Table 3-20
[0164] Table 3-21
[0165] Table 3-22
[0166] Table 3-23
[0167] Table 3-24
[0168] Table 3-25
[0169] In some embodiments, the compositions provided herein include expression constructs. In some embodiments, the compositions include (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wild-type adenovirus helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding one or more cap genes and one or more payloads.
[0170] In some embodiments, the composition includes a second expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequences or variants thereof in Table 4 below. In some embodiments, the composition includes a second expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with a portion of the sequences or variants thereof in Table 4 below. In some embodiments, the composition includes a second expression construct comprising the sequences in Table 4 below. In some embodiments, the composition includes a second expression construct comprising a portion of the sequences in Table 4 below.
[0171] In some embodiments, the composition comprises a second expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with SEQ ID NO: 11. In some embodiments, the composition comprises a second expression construct comprising (i) SEQ ID NO: 11; (ii) a polynucleotide sequence encoding the cap gene; and (iii) a polynucleotide sequence encoding the payload (e.g., a transgene, ITR, 2A peptide, homologous arm, or a combination thereof). In some embodiments, the composition comprises a second expression construct comprising SEQ ID NO: 11, with the polynucleotide sequence encoding the cap gene inserted before position 2025 and the polynucleotide sequence encoding the payload, which comprises the polynucleotide sequence encoding the transgene, inserted after position 2663. In some embodiments, the composition comprises a second expression construct comprising SEQ ID NO: 11, with the polynucleotide sequence encoding the cap gene inserted before position 2025 and the polynucleotide sequence encoding the payload, which comprises the polynucleotide sequence encoding the transgene, inserted after position 2663.
[0172] In some embodiments, the composition comprises a second expression construct comprising a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with SEQ ID NO: 20. In some embodiments, the composition comprises a second expression construct comprising (i) SEQ ID NO: 20; (ii) a polynucleotide sequence encoding the cap gene; and (iii) a polynucleotide sequence encoding the payload (e.g., a transgene, ITR, 2A peptide, homologous arm, or a combination thereof). In some embodiments, the composition comprises a second expression construct comprising SEQ ID NO: 20, wherein the polynucleotide sequence encoding the cap gene is inserted before position 550, and the polynucleotide sequence encoding the payload, which includes the polynucleotide sequence encoding the transgene, is inserted before position 626. In some embodiments, the composition comprises a second expression construct comprising SEQ ID NO: 20, wherein the polynucleotide sequence encoding the cap gene is inserted before position 550, and the polynucleotide sequence encoding the payload, which includes the polynucleotide sequence encoding the transgene, is inserted before position 626.
[0173] [Table 4-1]
[0174] [Table 4-2]
[0175] [Table 4-3]
[0176] [Table 4-4]
[0177] [Table 4-5]
[0178] Table 4-6
[0179] Table 4-7
[0180] Table 4-8
[0181] Table 4-9
[0182] Table 4-10
[0183] Table 4-11
[0184] Table 4-12
[0185] Table 4-13
[0186] Table 4-14
[0187] Table 4-15
[0188] Table 4-16
[0189] Table 4-17
[0190] Table 4-18
[0191] Table 4-19
[0192] Table 4-20
[0193] Table 4-21
[0194] Table 4-22
[0195] Table 4-23
[0196] Table 4-24
[0197] Table 4-25
[0198] Table 4-26
[0199] Table 4-27
[0200] Table 4-28
[0201] Table 4-29
[0202] Table 4-30
[0203] Table 4-31
[0204] Table 4-32
[0205] Table 4-33
[0206] In some embodiments, the composition comprises (i) a first expression construct comprising a polynucleotide sequence encoding one or more rep genes and a polynucleotide sequence encoding one or more wild-type adenovirus helper proteins; and (ii) a second expression construct comprising a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a capsid protein and a polynucleotide sequence encoding a gene (or a variant thereof). In some embodiments, the composition comprises (i) a first expression construct comprising a sequence outlined in Figure 29 of International Publication No. 2022 / 182986, which is incorporated in whole hereby by reference; and (ii) a second expression construct comprising a polynucleotide sequence encoding a payload comprising a polynucleotide sequence encoding a capsid outlined in Figure 29 of International Publication No. 2022 / 182986 and a polynucleotide sequence encoding a gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986. In some embodiments, the composition comprises (i) a first expression construct comprising the sequence outlined in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising a polynucleotide encoding a payload comprising a polynucleotide sequence encoding a capsid outlined in Figure 29 of International Publication No. 2022 / 182986 and a polynucleotide sequence encoding a gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986, wherein the first and second expression constructs exist in combinations such as those outlined in the single column of Figure 29 of International Publication No. 2022 / 182986.In some embodiments, the composition comprises (i) a first expression construct comprising the sequence outlined in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising a polynucleotide encoding a payload comprising a polynucleotide sequence encoding a capsid outlined in Figure 29 of International Publication No. 2022 / 182986 and a polynucleotide sequence encoding a gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986, wherein the first and second expression constructs exist in combinations such as outlined in a single column of Figure 29 of International Publication No. 2022 / 182986, and a composition comprising such combinations of the first and second expression constructs can be administered to one or more cells to produce an exemplary viral vector product, as outlined in Figure 29 of International Publication No. 2022 / 182986.
[0207] In some embodiments, the composition comprises (i) a first expression construct comprising the sequence outlined in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 11, wherein a polynucleotide sequence encoding a payload containing the polynucleotide sequence encoding the gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted after position 2663 of Sequence ID No. 11, and a polynucleotide sequence encoding the capsid outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted before position 2025 of Sequence ID No. 11. In some embodiments, the composition comprises (i) a first expression construct comprising the sequence shown in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 11, wherein a polynucleotide sequence encoding a payload containing a polynucleotide sequence encoding the gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted after position 2663 of Sequence ID No. 11, and a polynucleotide sequence encoding the capsid outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted before position 2025 of Sequence ID No. 11, and the first and second expression constructs exist in combinations such as those outlined in a single column of Figure 29 of International Publication No. 2022 / 182986.In some embodiments, the composition comprises (i) a first expression construct comprising the sequence shown in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 11, wherein a polynucleotide sequence encoding a payload comprising gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 Thus, the polynucleotide encoding the capsid outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted before position 2025 of Sequence ID No. 11, and the first and second expression constructs exist in combinations such as outlined in a single column of Figure 29 of International Publication No. 2022 / 182986, and a composition containing such a combination of the first and second expression constructs can be administered to one or more cells to produce an exemplary viral vector product, as outlined in Figure 29 of International Publication No. 2022 / 182986.
[0208] In some embodiments, the composition comprises (i) a first expression construct comprising the sequence outlined in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 12, wherein a polynucleotide sequence encoding a payload containing a polynucleotide sequence encoding the gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted between positions 2011 and 2026 of Sequence ID No. 12, and a nucleotide sequence encoding the capsid outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted between positions 2446 and 2453 of Sequence ID No. 12. In some embodiments, the composition comprises (i) a first expression construct comprising the sequence shown in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 12, wherein a polynucleotide sequence encoding a payload containing a polynucleotide sequence encoding the gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted between positions 2011–2026 of Sequence ID No. 12, and a polynucleotide sequence encoding the capsid outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted between positions 2446–2453 of Sequence ID No. 12, and the first and second expression constructs exist in combinations outlined in a single column of Figure 29 of International Publication No. 2022 / 182986.In some embodiments, the composition comprises (i) a first expression construct comprising the sequence shown in Figure 29 of International Publication No. 2022 / 182986; and (ii) a second expression construct comprising the sequence of Sequence ID No. 12, wherein a polynucleotide sequence encoding a payload containing a polynucleotide sequence encoding the gene (or a variant thereof) outlined in Figure 29 of International Publication No. 2022 / 182986 is inserted between positions 2011 and 2026 of Sequence ID No. 12. A polynucleotide sequence encoding the capsid, outlined in Figure 29, is inserted between positions 2446 and 2453 of Sequence ID No. 12, and the first and second expression constructs exist in combinations as outlined in a single column of Figure 29 of International Publication No. 2022 / 182986, and compositions containing such combinations of the first and second expression constructs can be administered to one or more cells to produce exemplary viral vector products, as outlined in Figure 29 of International Publication No. 2022 / 182986. In some embodiments, the insertion of the polynucleotide sequence into Sequence ID No. 12 results in the removal, exchange, and / or deletion of an intervening portion of the polynucleotide sequence (for example, insertion between positions 2011 and 2026 results in the deletion of a conventional nucleotide at positions 2012 and 2025 and the insertion of the polynucleotide sequence).
[0209] In some embodiments, the composition comprises a first expression construct (e.g., plasmid) containing a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequence or variant thereof of Table 3, and a second expression construct (e.g., plasmid) containing a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequence or variant thereof of Table 4. In some embodiments, the composition comprises a first plasmid (e.g., Rep / Helper plasmid) containing a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequence or variant thereof in Table 3, and a second plasmid (e.g., Payload / Cap plasmid) containing a sequence having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequence or variant thereof in Table 4.
[0210] ITR array Exemplary ITR sequences are shown in Table 5. In some embodiments, ITRs as disclosed herein include sequences having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% sequence identity with the sequences listed in Table 5 or their variants.
[0211] With respect to the scAAV vector, in some embodiments, the ITR sequence includes a left-terminal ITR containing the sequence of sequence number 18, or a sequence having at least 80% identity with sequence number 18 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the ITR sequence includes a right-terminal ITR containing the sequence of sequence number 19, or a sequence having at least 80% identity with sequence number 19 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity). In some embodiments, the ITR sequence includes (i) a left-terminal ITR containing the sequence of sequence number 18, or a sequence having at least 80% identity with sequence number 18 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity), and (ii) a right-terminal ITR containing the sequence of sequence number 19, or a sequence having at least 80% identity with sequence number 19 (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity).
[0212] [Table 5]
[0213] Method for characterizing AAV virus vectors According to various embodiments, a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) can be characterized by evaluating various features and / or properties. In some embodiments, the evaluation of the viral vector can be carried out at various points in the production process. In some embodiments, the evaluation of the viral vector can be carried out after the completion of the upstream production process. In some embodiments, the evaluation of the viral vector can be carried out after the completion of the downstream production process.
[0214] Virus yield In some embodiments, characterization of a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) includes evaluation of viral yield (e.g., viral titer). In some embodiments, characterization of a viral vector includes evaluation of viral yield before purification and / or filtration. In some embodiments, characterization of a viral vector includes evaluation of viral yield after purification and / or filtration. In some embodiments, characterization of a viral vector includes evaluation of whether the viral yield is 1 e10 vg / mL or greater. In any of the embodiments described above, the viral vector may be scAAV.
[0215] In some embodiments, characterization of a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) includes evaluating whether the viral yield in the crude cell lysate is 1 e11 vg / mL or greater. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the crude cell lysate is 5 e11 vg / mL or greater. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the crude cell lysate is 1 e12 vg / mL or greater. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the crude lysate is between 5 e9 vg / mL and 5 e11 vg / mL. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the crude lysate is between 5 e9 vg / mL and 1 e10 vg / mL. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the crude lysate is between 1 e10 vg / mL and 1 e11 vg / mL. In some embodiments, characterization of the viral vector includes evaluating whether the viral yield in the crude lysate is 1e11vg / mL to 1e12vg / mL. In some embodiments, characterization of the viral vector includes evaluating whether the viral yield in the crude lysate is 1e12vg / mL to 1e13vg / mL. In any of the embodiments described above, the viral vector may be scAAV.
[0216] In some embodiments, characterization of a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) includes evaluating whether the viral yield in the purified formulation is 1e11vg / mL or greater. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the purified formulation is 1e12vg / mL or greater. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the purified formulation is between 1e10vg / mL and 1e15vg / mL. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the purified formulation is between 1e11vg / mL and 1e15vg / mL. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the purified formulation is between 1e12vg / mL and 1e14vg / mL. In some embodiments, characterization of a viral vector includes evaluating whether the viral yield in the purified formulation is between 1e13 and 1e14vg / mL. In any of the embodiments described above, the viral vector may be scAAV.
[0217] In some embodiments, the methods and compositions provided herein can provide viral vector (e.g., AAV vector (e.g., scAAV vector)) yields equivalent to or improved compared to prior methods known in the art. For example, in some embodiments, a method provided for producing and / or manufacturing a viral vector, including the use of a two-plasmid transfection system, provides a viral vector yield equivalent to or improved compared to a three-plasmid system. In some embodiments, a method provided for producing and / or manufacturing a viral vector, including the use of a two-plasmid transfection system with a specific combination of sequence elements, provides a viral vector yield equivalent to or improved compared to a two-plasmid system with different combinations of sequence elements. In some embodiments, a method provided for producing and / or manufacturing a viral vector, including the use of a two-plasmid transfection system with a specific plasmid ratio, provides a viral vector yield equivalent to or improved compared to a two-plasmid system with different plasmid ratios. In some embodiments, a method provided for producing and / or manufacturing a viral vector, including the use of a two-plasmid transfection system with a specific plasmid ratio, provides a viral vector yield equivalent to or improved compared to a reference (e.g., a two-plasmid system with different plasmid ratios, a three-plasmid system) under specific culture conditions. In some embodiments, methods provided for producing and / or manufacturing viral vectors, including the use of a two-plasmid transfection system with specific plasmid ratios, provide equivalent or improved viral vector yields compared to reference systems (e.g., two-plasmid systems, three-plasmid systems with different plasmid ratios) under large-scale culture conditions (e.g., greater than 100 mL, greater than 250 mL, greater than 1 L, greater than 10 L, greater than 20 L, greater than 30 L, greater than 40 L, greater than 50 L, etc.). In any of the embodiments described above, the viral vector may be scAAV.
[0218] Virus packaging In some embodiments, characterization of a viral vector (e.g., AAV vector (e.g., scAAV vector)) involves evaluating the viral packaging efficiency (e.g., the percentage of complete capsid relative to empty capsid). In some embodiments, characterization of a viral vector involves evaluating the viral packaging efficiency before purification and / or concentration of the complete capsid (e.g., cesium chloride-based density gradient, iodixanol-based density gradient, or ion-exchange chromatography). In some embodiments, characterization of a viral vector involves evaluating whether the viral packaging efficiency is 20% or higher (e.g., 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%) before purification and / or filtration. In some embodiments, characterization of a viral vector involves evaluating the viral packaging efficiency before purification and / or concentration of the complete capsid. In some embodiments, characterization of the viral vector includes evaluating whether the viral packaging efficiency is 50% or greater after purification and / or filtration (e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%). In any of the embodiments described above, the viral vector may be scAAV. In some embodiments, the methods and compositions provided herein can provide packaging efficiencies equivalent to or better than prior methods known in the art. For example, in some embodiments, a method provided for producing and / or manufacturing a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) including the use of a two-plasmid transfection system provides packaging efficiencies equivalent to or better than a three-plasmid system. In some embodiments, a method provided for producing and / or manufacturing a viral vector including the use of a two-plasmid transfection system with a specific combination of sequence elements provides packaging efficiencies equivalent to or better than a two-plasmid system with a different combination of sequence elements. In some embodiments, a method provided for producing and / or manufacturing a viral vector including the use of a two-plasmid transfection system with a specific plasmid ratio provides packaging efficiencies equivalent to or better than a two-plasmid system with a different plasmid ratio. In any of the embodiments described above, the viral vector may be scAAV.
[0219] Reproducible vector levels In some embodiments, characterization of a viral vector (e.g., an AAV vector (e.g., an scAAV vector)) includes evaluation of the level of the replicable vector. In some embodiments, characterization of a viral vector includes evaluation of the level of the replicable vector before purification and / or filtration. In some embodiments, characterization of a viral vector includes evaluation of the level of the replicable vector after purification and / or filtration. In some embodiments, characterization of a viral vector includes evaluation of whether the level of the replicable vector is rcAAV less than or equal to 1 at 1E10vg. In any of the embodiments described above, the viral vector may be scAAV.
[0220] In some embodiments, the methods and compositions provided herein can provide comparable or reduced levels of replicable vectors compared to prior methods known in the art. For example, in some embodiments, the methods provided for producing viral vectors (e.g., AAV vectors (e.g., scAAV vectors)), including the use of a two-plasmid transfection system, provide comparable or reduced levels of replicable vectors compared to a three-plasmid system. In some embodiments, the methods provided for producing viral vectors, including the use of a two-plasmid transfection system with a particular combination of sequence elements, provide comparable or reduced levels of replicable vectors compared to a two-plasmid system with a different combination of sequence elements. In some embodiments, the methods provided for producing viral vectors, including the use of a two-plasmid transfection system that includes one or more intron sequences inserted into the rep gene, provide comparable or reduced levels of replicable vectors compared to a two-plasmid system that does not include the intron sequence. In any of the foregoing embodiments, the viral vector can be scAAV.
Example
[0221] Illustration Example 1: Determination of the molar ratio of Rep / helper:payload / Cap plasmids optimized to achieve improved volumetric yields in a two-plasmid scAAV system In this example, it is demonstrated that the optimal molar ratio of Rep / helper:payload / Cap plasmids for achieving the highest volumetric yield with scAAV9-SMN1 is 1:3, and that molar ratios of 1:5:1 to 1:6 exhibit improved yields compared to a three-plasmid system.
[0222] The volume yield of AAV vectors in HEK293F cells was tested using transient transfection with a two-plasmid system as described herein. The first plasmid, Payload / Cap, contained a payload with a target gene (GOI) adjacent to a terminal inversion repeat (ITR) derived from the AAV genome, and an AAV cap gene encoding a capsid virus protein of a specific AAV serotype. In this experiment, the serotype was AAV9, and the GOI was the transgene, Survival Motor Neuron (SMN)1. The second plasmid, Rep / Helper, contained an adenovirus-derived AAV rep gene, as well as E2A, E4, and VA helper genes. Different molar ratios of Rep / Helper:Payload / Cap were tested. In the three-plasmid system, three individual plasmids were used, including the helper plasmid, the Rep / Cap plasmid, and the payload plasmid. The molar ratio of these plasmids in transfection was 1.31:1.54:1.
[0223] HEK293F cells were grown in a 125 mL shaking flask for evaluation of the volume yield of the AAV vector. Cells were counted using a ViCell® XR cell counter, confirming a viable cell density of 2.0e6–2.6e6 cells / mL and a viability exceeding 95% at the time of transfection. The transfection mixture was then prepared by sterile filtration of plasmid DNA with Expi293 medium as the "DNA medium". The plasmid was filtered through a Corning 0.22 μm polyethersulfone (PES) bottle-top filter by first moistening the membrane with Expi293 medium, adding an appropriate amount of pDNA to the bottle top, vacuuming the filter, and finally washing away any remaining DNA on the filter with the remaining medium based on calculations. The transfection reagent FectoVIR®-AAV was then added to the DNA medium bottle. The transfection mixture was kept at room temperature for 30 minutes. After the required time had elapsed, the transfection mixture was added to the culture medium at a 10% culture medium integration rate (e.g., 10 mL of transfection mixture was added to 100 mL of culture medium), and the cells were incubated at 37°C for 72 hours. Different molar ratios of Rep / helper plasmids and payload / Cap plasmids were tested (Table 6). The transfection parameters are shown in Table 7.
[0224] [Table 6]
[0225] [Table 7]
[0226] Cells were harvested 72 hours after transfection. 5 mL of culture medium was transferred to a 15 mL centrifuge tube, and 50 μL of benzoase at 10 units / μL in Expi293 medium solution was added to this tube. The tube was then incubated horizontally at 37°C and 145 RPM for 15 minutes. Next, 500 μL of lysis buffer (500 mM Tris pH 8, 20 mM MgCl2, 10% polysorbate-20) was added to the tube and incubated under the same conditions for 90 minutes. Finally, 500 μL of 5 M NaCl was added to the tube and incubated under the same conditions for 30 minutes. After incubation with NaCl, the cell lysates were centrifuged at 3200 g in a centrifuge to precipitate the collected culture medium. 1 mL of the supernatant containing AAV particles was collected in a 1.5 mL Eppendorf tube and stored at -80°C until preparation for sample analysis.
[0227] The titer of the vector genome was quantified by droplet digital polymerase chain reaction (ddPCR) in lysed crude samples. In this assay, test samples were treated with and without a high-salt resistant nuclease to confirm that the residual plasmid DNA was packaged within the AAV capsid (and therefore nuclease-resistant). Next, the samples were treated with proteinase K to extract the DNA from the capsid. The samples were diluted and mixed with a ddPCR master mix containing a primer / probe set that specifically binds to the vector payload. Droplets of each sample were generated using a Bio-Rad Automated Droplet Generator and then thermocycled to amplify the target DNA using standard PCR. Positive and negative droplets were quantified using a Bio-Rad QX200 Droplet Reader and analyzed using Poisson distribution analysis. The copy number of the vector amplicon was corrected in the sample preparation to obtain the vector genome concentration in copies / mL.
[0228] Example 2: scAAV produced using the 2 plasmid system had a higher percentage of non-empty capsids than scAAV produced using the 3 plasmid system. In this example, it is demonstrated that a two-plasmid system as described herein offers an advantage in packaging efficiency compared to a three-plasmid system when generating scAAV (e.g., scAAV9-SMN1), both before and after enriching the complete capsid by CsCl gradient ultracentrifugation.
[0229] HEK293F cells were grown in a 2.8 L shaking flask for use in vector production. Cells were counted using a ViCell® XR cell counter, confirming a viable cell density of 2.0e6–2.6e6 cells / mL and a viability exceeding 95% at the time of transfection. The transfection mixture was then prepared by sterile filtration of plasmid DNA with Expi293 medium as the "DNA medium". The plasmid was filtered through a Corning 0.22 μm PES bottle-top filter by first moistening the membrane with Expi293 medium, adding an appropriate amount of pDNA to the bottle top, vacuuming the filter, and finally washing away any remaining DNA on the filter with the remaining medium based on calculations. The transfection reagent FectoVIR®-AAV was then added to the DNA medium bottle. The transfection mixture was kept at room temperature for 30 minutes. After the required time had elapsed, the transfection mixture was added to the culture medium at a 10% culture medium integration rate (e.g., 10 mL of transfection mixture was added to 100 mL of culture medium), and the cells were incubated at 37°C for 72 hours. The molar ratio of Rep / helper plasmid to payload / Cap plasmid was 1:3. The molar ratio of helper:Rep / Cap:payload for the three plasmids in the three plasmid systems was 1.31:1.54:1. Lysates were purified by affinity chromatography, and packaging efficiency was measured before and after CsCl-based density gradient ultracentrifugation. The percentage of empty / complete capsids in the AAV vectors was determined using size exclusion chromatography along with dual-wavelength detection measured by high-performance liquid chromatography (HPLC). The two detection wavelengths selected to show capsidized transgenes and capsid proteins were 260 nm and 230 nm, respectively. 260 nm was for monitoring DNA, while 230 nm was for monitoring capsid proteins. Since this method cannot distinguish between partial and complete capsids, the results are shown as the percentage of non-empty capsids. The results are shown in Figure 2 and Table 8.
[0230] [Table 8]
[0231] Example 3: The purity of the vector is equivalent between the purified scAAV produced by the 2-plasmid system and the purified scAAV produced by the 3-plasmid system. The purity of the three AAV structural proteins (VP1, VP2, and VP3) present in the samples was determined using sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Purified scAAV9-SMN1 produced by two-plasmid and three-plasmid systems was mixed with lithium dodecyl sulfate (LDS) sample buffer and dithiothreitol (DTT), and then denatured by heat. The denatured samples and molecular weight markers were loaded onto Bis-Tris gels, and the protein species were separated based on relative size by applying an electric field. After electrophoresis, the gels were stained with Imperial Protein Stain, washed, and imaged using a LI-COR Odyssey® CLx imager. The protein intensity of each band present in all test samples was quantified using ImageJ software. The purity of the viral proteins was determined by the percentage ratio of the sum of the peak areas of VP1, VP2, and VP3 products to the cumulative total peak area. Any peaks other than the product peaks (VP1, VP2, VP3) were considered impurities. The results are shown in Figure 3. The SDS-PAGE gel in the figure shows that the purity of the purified 2P scAAV and purified 3P scAAV was 100%.
[0232] Example 4: The scAAV9-SMN1 vector produced using both the 2-plasmid system and the 3-plasmid system was packaged with a double-stranded AAV genome. In this example, alkaline agarose gel analysis was used to confirm the size of the vector genome packaged in the AAV capsid. Each 2E10vg vector was loaded onto an alkaline gel and run at 40V for approximately 16 hours in a refrigerated room. The gel was stained with SYBR Gold nucleic acid gel and imaged using a BioRad ChemiDoc® MP imager. The results are shown in Figure 4. This figure shows the alkaline gels used to verify the size of the target genome of scAAV9 produced by the 2-plasmid and 3-plasmid systems.
[0233] Example 5: scAAV9-SMN1 produced by the 2-plasmid system and the 3-plasmid system exhibited equivalent efficacy in vivo. Vectors produced using the 2-plasmid and 3-plasmid systems were purified by affinity chromatography using POROS® AAVX affinity resin. The complete capsid vectors were concentrated by density gradient ultracentrifugation using cesium chloride and dialyzed against PBS using an Amicon® cartridge.
[0234] Mice (C57BL / 6) were injected with compositions containing packaged viral vectors produced using 2-plasmid and 3-plasmid systems at a dose of 1 e13 vg / kg. The payload contained the human SMN1 gene following the CAG promoter sequence. Liver, brain, and muscle tissue were collected 3 days after administration, and at 1, 2, 4, and 8 weeks.
[0235] The in vivo efficacy of the vectors was demonstrated by measuring episomal copy number (ECN) and hSMN1 RNA levels in different tissues (Figure 5). The results showed that scAAV9-SMN1 produced by the 2-plasmid and 3-plasmid systems exhibited similar in vivo efficacy.
[0236] Example 6: Evaluation of scAAV production using a two-plasmid method in various cell lines In this example, scAAV production using a two-plasmid system was evaluated in different cell lines compared to a three-plasmid system. 3P scAAV and 2P scAAV (with a 1:3 ratio of Rep / Helper and Payload / Cap) showed a 2- to 3-fold enhancement in the VPC2.0 cell line compared to the Hek293F cell line (Figure 6). These results indicate that scAAV can be produced using different cell lines, and that the crude titer can be increased 2- to 3-fold in the VPC2.0 cell line.
[0237] VPC2.0 cells and HEK293F cells were grown in 2.8 L shaking flasks for use in vector production. Cells were counted using a ViCell® XR cell counter, and it was confirmed that the viable cell density was 2.0e6–2.6e6 cells / mL and the viability was over 95% at the time of transfection. VPC2.0 cells were grown in a viral production medium supplemented with 4 mM GlutaMAX® supplement, resulting in a final density of 3 × 10⁶ cells. 6 The solution was diluted to a viable cell / m² ratio. AAV-MAX enhancer was added to the cells at a dilution of 1:100 (i.e., 1000 μl was added to transfect 100 mL of cells). The cells were incubated on a shaker in a 37°C incubator while the transfection mixture was prepared.
[0238] Next, as the "DNA medium," the transfection mixture was prepared by sterile filtration of plasmid DNA with Expi293 medium for the Hek293F cell line and Viral-Plex® Complexation Buffer for the VPC2.0 cell line. The plasmid was filtered by passing it through a Corning 0.22 μm PES bottle-top filter. First, the membrane was moistened with Expi293 medium for the Hek293F cell line and Viral-Plex® Complexation Buffer for the VPC2.0 cell line, an appropriate amount of pDNA was added to the bottle top, the filter was vacuumed, and finally, any DNA remaining on the filter was washed away with the remaining medium based on calculations. Then, the transfection reagent FectoVIR®-AAV was added to the DNA medium bottle for the Hek293F cell line. For VPC2.0 cells, the AAV-MAX transfection booster and AAV-MAX transfection reagent were mixed in a new tube to form an AAV-MAX transfection booster / AAV-MAX transfection reagent complex. 300 μL of AAV-MAX transfection booster was added to 100 mL of culture medium, followed by 600 μL of AAV-MAX transfection reagent, and then mixed by gentle pipetting. The pre-mixed AAV-MAX transfection booster / AAV-MAX transfection reagent complex was then added to a DNA medium bottle for the VPC2.0 cell line.
[0239] The transfection mixtures of both cell lines were kept at room temperature for 30 minutes. After the time had elapsed, the transfection mixtures were added to the culture medium at a 10% culture medium integration rate (e.g., 10 mL of transfection mixture was added to 100 mL of culture medium), and the cells were incubated at 37°C for 72 hours. The molar ratio of Rep / helper plasmid to payload / Cap plasmid was 1:3. The molar ratio of helper:Rep / Cap:payload for the three plasmids in the three plasmid systems was 1.31:1.54:1.
[0240] Cells were harvested 72 hours after transfection. 5 mL of culture medium was transferred to a 15 mL centrifuge tube, and 50 μL of benzonase at 10 units / μL in the culture medium solution was added to this tube. The tube was then incubated horizontally at 37°C and 145 RPM for 15 minutes. Next, 500 μL of lysis buffer (500 mM Tris pH 8, 20 mM MgCl2, 10% polysorbate-20) was added to the tube and incubated under the same conditions for 90 minutes. Finally, 500 μL of 5 M NaCl was added to the tube and incubated under the same conditions for 30 minutes. After incubation with NaCl, the cell lysates were centrifuged at 3200 g in a centrifuge to precipitate the collected culture medium. 1 mL of the supernatant containing AAV particles was collected in a 1.5 mL Eppendorf tube and stored at -80°C until preparation for sample analysis.
[0241] The titer of the vector genome was quantified by droplet digital polymerase chain reaction (ddPCR) in lysed crude samples. In this assay, test samples were treated with and without a high-salt resistant nuclease to confirm that the residual plasmid DNA was packaged within the AAV capsid (and therefore nuclease-resistant). Next, the samples were treated with proteinase K to extract the DNA from the capsid. The samples were diluted and mixed with a ddPCR master mix containing a primer / probe set that specifically binds to the vector payload. Droplets of each sample were generated using a Bio-Rad Automated Droplet Generator and then thermocycled to amplify the target DNA using standard PCR. Positive and negative droplets were quantified using a Bio-Rad QX200 Droplet Reader and analyzed using Poisson distribution analysis. The copy number of the vector amplicon was corrected in the sample preparation to obtain the vector genome concentration in copies / mL.
[0242] Equal parts Those skilled in the art will be able to recognize or confirm numerous equivalents to the specific embodiments described herein simply by performing ordinary experiments. The scope of this disclosure is intended to be as set forth in the following claims, rather than being limited to the above description.
Claims
1. A payload / Cap plasmid comprising a polynucleotide sequence encoding the cap gene and a polynucleotide sequence encoding scAAV, but not comprising a polynucleotide encoding the rep gene.
2. The polynucleotide sequence encoding scAAV includes an ITR at the left terminal and an ITR at the right terminal, (i) The ITR of the left vertex includes the sequence CTGCGCGCTCGCGCTCACTGAGGCGCGCGCGCGCAAAGCCGCGCGCGCGCGCGCACCTTTTGGTCGCGCGCGCTCCAGTGAGCGCGCGCGCGCAGAGAGAGAGAGTG (sequence number 18); (ii) The ITR at the right end is 【Chemistry 2】 Includes an array of; or, (iii) The payload / Cap plasmid according to claim 1, wherein the left-terminal ITR contains the sequence of SEQ ID NO: 18, and the right-terminal ITR contains the sequence of SEQ ID NO:
19.
3. The payload / Cap plasmid according to claim 1 or 2, wherein the payload / Cap plasmid comprises the polynucleotide sequence of SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 11, or SEQ ID NO:
12.
4. The payload / Cap plasmid according to claim 3, wherein the payload / Cap plasmid comprises the polynucleotide sequence of Sequence ID No.
20.
5. The payload / Cap plasmid according to claim 4, wherein the polynucleotide sequence encoding the cap gene is inserted before position 550 of sequence number 20.
6. The payload / Cap plasmid according to any one of claims 1 to 5, wherein the polynucleotide sequence encoding scAAV includes a polynucleotide sequence encoding the transgene.
7. The payload / Cap plasmid according to claim 6, wherein the payload / Cap plasmid includes the polynucleotide sequence of SEQ ID NO: 20, and the polynucleotide sequence encoding the transgene is inserted before position 626 of SEQ ID NO:
20.
8. The payload / Cap plasmid according to claim 6 or 7, wherein the introduced gene is one or more of the following: methylmalonyl-CoA mutase (MUT), UDP-glucuronosyltransferase 1-1 (UGT1A1), cystathionine β-synthase (CBS), galactose-1-phosphate uridyltransferase (GALT), or variants thereof.
9. The aforementioned cap gene is found in AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAVC11.01, AAVC11.02, AAVC11.03, AAVC11.04, AAVC11.05, AAVC11.06, AAVC11.07, AAVC11. 08, AAVC11.09, AAVC11.10, AAVC11.11, AAVC11.12, AAVC11.13, AAVC11.14, AAVC11.15 , AAVC11.16, AAVC11.17, AAVC11.18, AAVC11.19, AAV-DJ, AAV-LK03, AAV-LK19, AAVrh. 74, AAVrh. 10, AAVhu. 37, AAVrh. K, AAVrh. 39, AAV12, AAV13, AAVrh.
8. A payload / Cap plasmid according to any one of claims 1 to 8, selected from the cap gene of avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, sheep AAV, or hybrid AAV.
10. A composition, A payload / Cap plasmid according to any one of claims 1 to 9; A composition comprising a Rep / helper plasmid containing the polynucleotide sequence of SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 1, or SEQ ID NO: 2, and a Rep / helper plasmid that does not contain the polynucleotide sequence encoding the cap gene.
11. The composition according to claim 10, wherein the composition comprises two or fewer distinct plasmids.
12. The composition according to claim 10 or 11 for use in the production of AAV vectors.
13. A host cell comprising a payload / Cap plasmid according to any one of claims 1 to 9 or a composition according to any one of claims 10 to 12.
14. The host cell according to claim 13, which is a mammalian host cell.
15. The host cell according to claim 13 or 14, wherein the mammalian host cell is a HEK293F cell or a derivative of a HEK293F cell.
16. The host cell according to claim 15, wherein the mammalian host cell is a HEK293F cell.
17. The aforementioned derivative of HEK293F cells possesses one or more of the following properties: (i) Absence of SV40 large T antigen; (ii) Capable of growth in suspension culture at a density of >12 million cells / mL in a medium of known composition; and / or (iii) 5 x 10 10 It is possible to produce an AAV titer greater than vg / mL. The host cell according to claim 15, which is a clone derivative of a HEK293F cell having the properties of HEK293F.
18. The host cell according to claim 17, wherein the clonal derivative of the HEK293 cell is a virus-producing cell (VPC) 2.0 cell.
19. A method for producing a packaged scAAV vector, comprising delivering a composition according to any one of claims 10 to 12 to cells and incubating the cells for a time and under conditions sufficient to produce a packaged scAAV vector.
20. The method according to claim 19, wherein the delivery includes using a chemical transfection reagent.
21. The method according to claim 20, wherein the chemical transfection reagent includes a cationic lipid-based transfection reagent.
22. The method according to any one of claims 19 to 21, wherein the cells are mammalian cells.
23. The method according to claim 22, wherein the mammalian cell is a HEK293F cell or a derivative of a HEK293F cell.
24. The method according to claim 23, wherein the mammalian cell is a HEK293F cell.
25. The aforementioned derivative of HEK293F cells possesses one or more of the following properties: (i) Absence of SV40 large T antigen; (ii) Capable of growth in suspension culture at a density of >12 million cells / mL in a medium of known composition; and / or (iii) 5 x 10 10 It is possible to produce an AAV titer greater than vg / mL. The method according to claim 23, wherein the clonal derivative of HEK293F cells is having the properties of HEK293F cells.
26. The method according to claim 25, wherein the clonal derivative of HEK293 cells is VPC2.0 cells.