Method for preparing organosilicon compounds having selective cytochrome P450 variants, and related compounds and compositions.

Abstract

A method for preparing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group, having a cytochrome P450 variant that promotes oxidation of a silicon-bonded hydrocarbyl group in the presence of an oxidizing agent. The method comprises: combining a cytochrome P450 variant, an initial organosilicon compound having at least one silicon-bonded hydrocarbyl group, and a cofactor to obtain a reaction mixture; and exposing the reaction mixture to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group of the initial organosilicon compound, thereby preparing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. Cytochrome P450 variants suitable for use in this method are also disclosed, along with methods for manipulating and optimizing them. Nucleic acids and compositions encoding cytochrome P450 variants, expression vectors, and host cells containing them are also disclosed.

Description

[Technical Field]

[0001] (Cross-reference of related applications) This application claims priority and all advantages of U.S. Provisional Patent Application No. 63 / 458,712, filed on 12 April 2023, the contents of which are incorporated herein by reference.

[0002] (Field of invention) This disclosure relates, more broadly, to catalysts and methods for preparing organosilicon compounds having at least one silicon-bonded carbinol and / or at least one silanol group, and more specifically to cytochrome protein variant catalysts for selectively oxidizing a silicon-bonded hydrocarbyl group in an organosilicon compound to at least one silicon-bonded carbinol and / or at least one silanol group, and to methods for using the same.

[0003] (Description of related technologies) Silicones are polymer materials used in many commercial applications, primarily due to their significant advantages over many carbon-based analogues. More precisely, silicones, also called polymerized siloxanes or polysiloxanes, contain inorganic silicon-oxygen backbone chains (...-Si-O-Si-O-Si-O-...) with organic side groups bonded to silicon atoms. Two or more of these backbones can be linked together using the organic side groups. By varying the Si-O-chain length, side groups, and crosslinking, silicones with a wide variety of properties and compositions can be synthesized, and the consistency of the silicone network structure varies from liquid to gel, rubber, and rigid plastic. Silicone and siloxane-based materials are used in countless end applications and environments, including as components in a wide variety of industrial, home care, and personal care formulations.

[0004] Various organosilicon compounds and organic polysiloxanes are used as precursors or diluents for preparing many silicone and siloxane-based materials, as well as other products in the silicon industry. Such organosilicon compounds and organic polysiloxanes are also used as synthetic intermediates in organic synthesis, as monomer building blocks for silicone-organic hybrid materials, and as catalysts for certain reactions.

[0005] Such organosilicon compounds and organic polysiloxanes possess desirable properties, including stability and longevity under extreme conditions, including exposure to temperature changes and ultraviolet light. However, while these properties are desirable for many end-use applications, the stability of many organosilicon compounds and organic polysiloxanes results in their accumulation in the environment.

[0006] Furthermore, if such organosilicon compounds and organopolysiloxanes are non-functional, they cannot readily react to form other reaction products, and as a result, they are more difficult to filter or remove from, for example, waste or reaction products. [Overview of the project]

[0007] A method is provided for preparing organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group. The method comprises preparing a reaction mixture by combining a cytochrome P450 mutant, an initial organosilicon compound, and a cofactor. The cytochrome P450 mutant promotes the oxidation of silicon-bonded hydrocarbyl groups to silicon-bonded carbinol or silanol groups in the presence of an oxidizing agent, and the initial organosilicon compound has at least one silicon-bonded hydrocarbyl atom. The method also comprises exposing the reaction mixture to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl groups of the initial organosilicon compound, converting them to a silicon-bonded carbinol or silicon-bonded silanol organosilicon compound, thereby preparing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0008] A method for preparing reaction products is also provided. This method includes: preparing a reaction reaction; exposing the reaction reaction to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group and convert it to a functional group to obtain an organosilicon compound having a functional group; and reacting the functional group of the organosilicon compound with a group that reacts with the functional group of the organosilicon compound to prepare a reaction product.

[0009] Cytochrome P450 variants are also provided. One of the cytochrome P450 variants includes or encodes the nucleic acid sequence of SEQ ID NO: 1 or a conservatively modified variant thereof. Another of the cytochrome P450 variants includes or encodes the nucleic acid sequence of SEQ ID NO: 2 or a conservatively modified variant thereof. Another cytochrome P450 variant includes or encodes the nucleic acid sequence of SEQ ID NO: 3 or a conservatively modified variant thereof. Another cytochrome P450 variant includes or encodes the nucleic acid sequence of SEQ ID NO: 4 or a conservatively modified variant thereof. Another cytochrome P450 variant includes or encodes the nucleic acid sequence of SEQ ID NO: 5 or a conservatively modified variant thereof. Another cytochrome P450 variant includes or encodes the nucleic acid sequence of SEQ ID NO: 6 or a conservatively modified variant thereof. Another cytochrome P450 variant contains or encodes the nucleic acid sequence of SEQ ID NO: 7 or a conservatively modified variant thereof. Another cytochrome P450 variant contains or encodes the nucleic acid sequence of SEQ ID NO: 8 or a conservatively modified variant thereof. Another cytochrome P450 variant contains or encodes the nucleic acid sequence of SEQ ID NO: 9 or a conservatively modified variant thereof. Another cytochrome P450 variant contains or encodes the nucleic acid sequence of SEQ ID NO: 10 or a conservatively modified variant thereof. [Modes for carrying out the invention]

[0010] A method is provided for preparing organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group. Generally, the method involves exposing a reaction mixture containing a cytochrome P450 variant and an initial organosilicon compound to an oxidizing agent to prepare organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group. More specifically, the cytochrome P450 variant is capable of promoting the oxidation of at least one silicon-bonded hydrocarbyl group and its conversion to at least one silicon-bonded carbinol group and / or at least one silanol group, and the initial organosilicon compound contains at least one silicon-bonded hydrocarbyl group that can be oxidized to obtain an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0011] In particular, while the enzymatic manipulation of silicon-adjacent functional groups in various organosilicon compounds is known, the present invention is considered to represent a first biocatalytic transformation of a silicon-bonded hydrocarbyl group (i.e., Si-R, where R is hydrocarbyl) to a silanol group (i.e., Si-OH) or a silicon-bonded carbinol group (i.e., Si-R'-OH, where R' is also hydrocarbyl), as illustrated by the examples and described herein. Accordingly, it will be understood that certain aspects of the present invention described herein with respect to this method can be practiced individually or in various combinations, i.e., without being limited to any particular end use, composition, formulation, etc. Such aspects include novel cytochrome P450 variants, related materials and compositions, and various methods for preparing them.

[0012] As will be understood by those skilled in the art, the methods and materials described herein relate in general to biocatalysis (i.e., the use of biological systems and / or materials to accelerate chemical reactions), and more specifically to protein-based biocatalysis. For clarity, specific terms used herein are listed and explained below.

[0013] The terms “protein,” “peptide,” and “polypeptide” are used interchangeably herein to refer to polymers of amino acid residues (i.e., molecules having two or more amino acids linked together by peptide bonds), or assemblies of multiple polymers of amino acid residues. In some cases, more specific terms may be used with respect to one or more specific oligopeptides (i.e., peptides containing 20 or fewer, optionally 10 or fewer amino acids, e.g., di-, tri-, tetra-, and pentapeptides), polypeptides (i.e., peptides containing more than 10, optionally more than 20 amino acids), proteins (i.e., organic compounds containing amino acids linked via peptide bonds in a linear chain and folded into a spherical form), enzymes (i.e., functional proteins containing optional cofactors, multiple proteins, etc.), etc., which may be modified (e.g., naturally and / or synthetically via glycosylation, acetylation, phosphorylation, etc.), branched, etc. Such terminology applies to amino acid polymers, which are artificial chemical mimics of naturally occurring amino acids in which one or more amino acid residues correspond, as well as naturally occurring (i.e., natural) amino acid polymers and amino acid polymers that do not exist naturally (i.e., synthetic, engineered, etc.). The identity and order of specific amino acid residues in a protein are generally referred to as the "amino acid sequence."

[0014] The term "amino acid" includes both naturally occurring and non-naturally occurring amino acids as their stereoisomers. In this context, the stereoisomers of amino acids generally refer to enantiomers of opposite stereochemistry at the α-carbon atom, such as the l-stereoisomer (i.e., left-handed isomer) and d-stereoisomer (i.e., right-handed isomer) of the same α-amino acid. For example, the stereoisomer (l-stereoisomer) of a naturally occurring amino acid refers to its enantiomer, i.e., the d-stereoisomer. As can be seen from certain examples below, amino acids may be represented herein by either their commonly known three-letter symbols or the single-letter symbols recommended by the Biochemical Nomenclature Commission of the International Union of Pure and Applied Chemistry and the International Union of Biochemistry (IUPAC-IUB). For example, I-amino acids may be represented herein by their commonly known three-letter symbol (e.g., Arg for I-arginine) or by their uppercase single-letter amino acid symbol (e.g., R for I-arginine). d-amino acids may be represented herein by their commonly known three-letter symbol (e.g., d-Arg for d-arginine) or by their lowercase single-letter amino acid symbol (e.g., r for d-arginine).

[0015] Naturally occurring amino acids include those encoded by the genetic code, as well as their natural derivatives / modifications (e.g., hydroxyproline, γ-carboxyglutamate, O-phosphoserine, etc.). Examples of naturally occurring α-amino acids include alanine (Ala;A), cysteine ​​(Cys;C), aspartic acid (Asp;D), glutamic acid (Glu;E), phenylalanine (Phe;F), glycine (Gly;G), histidine (His;H), isoleucine (Ile;I), arginine (Arg;R), lysine (Lys;K), leucine (Leu;L), and methionine (Met;M). Examples include asparagine (Asn;N), proline (Pro;P), glutamine (Gln;Q), serine (Ser;S), threonine (Thr;T), valine (Val;V), tryptophan (Trp;W), and tyrosine (Tyr;Y), as well as combinations thereof.Similarly, examples of stereoisomers of naturally occurring α-amino acids include d-alanine (d-alanine, d-Ala), d-cysteine (d-cysteine, d-Cys), d-aspartic acid (d-aspartic acid, d-Asp), d-glutamic acid (d-glutamic acid, d-Glu), d-phenylalanine (d-phenylalanine, d-Phe), d-histidine (d-histidine, d-His), d-isoleucine (d-isoleucine, d-Ile), d-arginine (d-arginine, d-Arg), d-lysine (d-lysine, d-Lys), d-leucine (d-leucine, d-Leu), d-methionine (d-methionine, d-Met), d-asparagine (d-asparagine, d-Asn), d-proline (d-proline, d-Pro), d-glutamine (d-glutamine, d-Gln), d-serine (d-serine, d-Ser), d-threonine (d-threonine, d-Thr), d-valine (d-valine, d-Val), d-tryptophan (d-tryptophan, d-Trp), and d-tyrosine (d-tyrosine, d-Tyr). Examples of non-naturally occurring (i.e., unnatural) amino acids include various amino acid analogs and mimetics, as well as synthetic amino acids in either the l or d configuration (e.g., N-substituted glycine, and N-methyl amino acids, etc.). Examples of amino acid analogs include non-natural amino acids having the same basic chemical structure as naturally occurring amino acids (i.e., α-carbon bonded to hydrogen, a carboxyl group, and an amino group), but with a modified side chain group, or a modified peptide backbone (e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium, etc.). An “amino acid mimetic” refers to a chemical compound having a structure different from the general chemical structure of an amino acid, but functioning in a manner similar to a naturally occurring amino acid.

[0016] Regarding the amino acid sequence of a protein, one of ordinary skill in the art will recognize that individual substitutions, additions, or deletions in which single amino acids or a small percentage of amino acids in the sequence are modified, added, and / or deleted may be referred to as "conservative modifications" of the amino acid sequence, and that such modifications result in substitution of amino acids with chemically similar amino acids, and in particular, do not substantially or completely change the function of the protein. Similarly, proteins having conservatively modified sequences may be referred to as "conservatively modified variants" of the wild-type or other unmodified protein sequences. Unless otherwise indicated, a particular amino acid sequence is to be understood to implicitly include conservatively modified variants in addition to the explicitly recited sequence.

[0017] As understood by one of ordinary skill in the art, chemically similar amino acids are not limited, and tables of conservative substitutions showing functionally similar amino acids are well known in the art. For example, substitutions may be made in which one aliphatic amino acid (e.g., G, A, I, L, V, etc.) is replaced with another aliphatic amino acid, an aliphatic amino acid having a polar uncharged group (e.g., C, S, T, M, N, Q, etc.) is replaced with another such aliphatic amino acid, a basic amino acid (e.g., K, R, H, etc.) is replaced with a different basic amino acid, etc. In some instances, conservative substitutions may include replacing an amino acid having an acidic side chain (e.g., E or D) with an uncharged counterpart (e.g., Q or N, respectively), or vice versa. Each of the following eight groups contains other exemplary amino acids that may be conservative substitutions for one another. 1) Alanine (A) and glycine (G); 2) Aspartic acid (D) and glutamic acid (E); 3) Asparagine (N) and glutamine (Q); 4) Arginine (R) and lysine (K); 5) Isoleucine (I), leucine (L), methionine (M), and valine (V); 6) Phenylalanine (F), tyrosine (Y), and tryptophan (W); 7) Serine (S) and threonine (T); and 8) Cysteine (C) and methionine (M).

[0018] The terms “oligonucleotide,” “nucleic acid,” and “polynucleotide” are used interchangeably herein and refer to polymers comprising nucleotides, i.e., deoxyribonucleic acid (DNA) and / or ribonucleic acid (RNA) in any single-stranded, double-stranded, or multi-stranded form (i.e., single-stranded, double-stranded, and multi-stranded DNA and / or RNA, including genomic DNA, cDNA, and DNA-RNA hybrids), as well as polymers comprising purines, pyrimidines, or other nucleotide bases that may be naturally occurring or non-naturally occurring bases (e.g., chemically modified, biochemically modified, synthetic, and / or derivatized nucleotide bases). As will be understood by those skilled in the art, polynucleotides may be described in relation to the peptide encoded thereby, and consequently, terms such as “nucleotide sequence encoding a peptide” may be used to refer to the DNA segment involved in the formation of the peptide chain. Such segments may include regions before and / or after a given coding region (i.e., a leader sequence and / or trailer sequence) involved in the transcription / translation or regulation of a gene product, as well as intervening sequences (introns) between individual coding segments (exons). Therefore, terms such as “nucleic acid” can be used interchangeably with genes, cDNA, and mRNA encoded by genes. Unless specifically limited, this term also encompasses nucleic acids containing known analogs of natural / reference nucleotides that have similar binding properties to the reference nucleic acid and can be metabolized in a similar manner to naturally occurring nucleotides.

[0019] The identity and order of specific nucleotide bases in a polynucleotide are generally referred to as a “nucleic acid sequence.” As with the amino acid sequences described above, unless otherwise specified, a particular nucleic acid sequence should be understood to implicitly include conserved modified variants of the sequence, in addition to the explicitly indicated nucleic acid sequence. Conserved modified variants of polynucleotides generally include degenerate codon substitutions, complementary sequences, or orthologous sequences, compared to a given wild-type or other unmodified nucleic acid sequence. As is known in the art, degenerate codon substitutions can be achieved by generating sequences in which the third position of a selected codon is substituted with a mixed base and / or a deoxyinosine residue.

[0020] As used herein with respect to the original enzyme or gene of a first family or species, the term “homologous” refers to a distinct enzyme or gene of a second family or species that is determined by functional, structural, or genomic analysis to be the enzyme or gene of a second family or species corresponding to the original enzyme or gene of the first family or species.

[0021] The terms “homologous” or “homologous” are used herein in reference to similar sequences of polynucleotides and / or nucleic acids. For example, a first protein is “homologous” or “homologous” to a second protein if the amino acid sequence encoded by its gene is similar to the amino acid sequence of the second gene. Alternatively, a first protein is homologous to a second protein if the two proteins have “similar” amino acid sequences. Thus, the term “homologous protein” is intended to mean that two proteins have similar amino acid sequences. Similarly, the term “functional homolog” refers to each member of a subgroup of homologs or homologous sequences that share a common functionality, i.e., the primary function by which proteins, genes, sequences, etc., are named and / or utilized. For example, the function of an accelerator is to promote the transcription of a gene or nucleotide sequence, and the function of an enzyme is to catalyze a particular chemical reaction or family of chemical reactions. Thus, the term “functional” encompasses all reaction rates and all enzyme efficiencies exhibited by a given protein. In certain embodiments, homology between two proteins indicates a common lineage linked by evolution. Homogenies will often be understood to have functional, structural, or genomic similarities. For example, in certain embodiments, homologous sequences share at least 70% sequence identity, e.g., at least 80%, alternatively at least 90%, alternatively at least 95%, or alternatively at least 99%. Techniques are known that allow for the easy cloning of enzyme or gene homologs using gene probes and PCR. The identity of the cloned sequence as a homolog can be confirmed using functional assays and / or by genomic mapping of the gene.

[0022] As described above, this method utilizes cytochrome P450 mutants capable of oxidizing silicon-bonded hydrocarbyl groups to silicon-bonded carbinol or silanol groups. More specifically, the cytochrome P450 mutants facilitate, and are not otherwise limited, the selective oxidation of at least one silicon-bonded hydrocarbyl group (i.e., Si-R, where R is hydrocarbyl) of the initial organosilicon compound to a silanol group (i.e., Si-OH) or a silicon-bonded carbinol group (Si-R'OH, where R' is a hydrocarbon group), as will be described in more detail below.

[0023] As will be understood by those skilled in the art, the term “cytochrome P450” as used herein refers to enzymes classified or otherwise characterized as members of the cytochrome P450 enzyme family, which is known to include a large superfamily of heme-thiolate proteins that typically have an active site containing Fe(III)-protoporphyrin IX cofactor (i.e., a heme-iron center) proximal to a highly conserved cysteine ​​thiolate residue. In the resting state, the remaining axial iron coordination site is occupied by water molecules. However, the heme-iron center is capable of binding molecular oxygen at this axial iron coordination site, giving rise to innate catalytic reactivity.

[0024] Cytochrome P450 enzymes are involved in the metabolism of a wide variety of exogenous and endogenous compounds, often functioning as terminal oxidases in multicomponent electron transport chains, such as P450-containing monooxygenase systems. Cytochrome P450 enzymes are known to catalyze the oxidative transformation of countless carbon centers, including oxidation and hydroxylation, epoxidation, oxidative ring coupling, and desaturation of carbon. A common chemical mechanism used to rationalize the oxidative activity of most naturally occurring cytochrome P450 enzymes is perphenyl (FeO2). 3+) involves intermediates and odd-electron chemistry. In particular, the heme-iron center activates molecular oxygen in the presence of an electron source (e.g., nicotinamide adenine dinucleotide (NADH) or nicotinamide adenine dinucleotide phosphate (NADPH), e.g., from adjacent fusion reductase domains, accessory cytochrome P450 reductase enzymes, etc.) to produce a water molecule and an iron(IV)-oxoporphyrin radical cation intermediate, conventionally known as "P450 compound 1". More specifically, after induction of the first electron transfer (e.g., via substrate binding), the molecular oxygen binds to the ferrous heme center to obtain a dioxygen adduct (e.g., Fe-O2). The Fe-O2 adduct is reduced via a second electron transfer to obtain a peroxo intermediate, which undergoes rapid dipronation (i.e., double protonation) to release water and yield an iron(IV) oxo intermediate (i.e., P450 compound 1). Alternatively, P450 compound 1 can be formed using a hydrogen peroxide shunt, which avoids the need for an electron source. The highly reactive iron(IV) oxo intermediate then reacts with the substrate at CH or C=C bonds (e.g., via extraction of hydrogen atoms or electrons, followed by repulsion of oxygen, rearrangement, etc.) to influence oxidative transformation (e.g., hydroxylation, epoxidation, etc.).

[0025] As is understood in the art, both the genes encoding cytochrome P450 enzymes and the enzymes themselves can be designated according to the usual nomenclature rules using the root symbol "CYP" to indicate the superfamily, followed by: 1) a number indicating the gene family, 2) a capital letter indicating the subfamily, and 3) a number indicating the individual gene. For example, the gene designated "CYP102A1" is isolated from the soil bacterium Bacillus megaterium and encodes the enzyme CYP102A1 (also known as cytochrome P450 BM3), which promotes the NADPH-dependent hydroxylation of long-chain fatty acids from the ω-1 to ω-3 position. Typically, members of the CYP family share at least 40% amino acid identity, while members of the subfamily share at least 55% amino acid identity.

[0026] As described above, this method utilizes cytochrome P450 variants. As used herein in the context of “protein variants” or “enzyme variants” (e.g., cytochrome P450 variants), the term “variant” refers to a protein or enzyme containing at least one amino acid mutation (e.g., substitution) relative to its wild-type version, including chimeric enzymes containing sequences or amino acid blocks rearranged from two, three, or more different proteins. However, it should be understood that a particular protein variant does not necessarily need to be prepared via intentional mutagenesis, but could instead be a naturally occurring enzyme exhibiting desired activity and / or substrate specificity (i.e., selective silane oxidation) not naturally shown by one or more homologous wild-type enzymes. Therefore, as used herein, the term “cytochrome P450 variant” should be understood to encompass a specific cytochrome P450 variant specified by a given sequence and provided according to certain aspects of this disclosure, as well as certain wild-type cytochrome P450 variants suitable for use in this method, which are described in further detail below. Furthermore, it should be understood that cytochrome P450 mutants may contain, or may be, fragments of cytochrome P450 enzymes that exhibit the activity and / or substrate specificity necessary to prepare organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0027] The cytochrome P450 mutants used in this method are capable of oxidizing the silicon-bonded hydrocarbyl group of the initial organosilicon compound to obtain a silicon-bonded carbinol group and / or silanol group in the organosilicon compound, and are not particularly limited in other respects. Therefore, examples of cytochrome P450 mutants suitable for use in this method include those that promote the selective oxidation of the silicon-bonded hydrocarbyl group (i.e., Si-R, where R is hydrocarbyl) of the initial organosilicon compound to a silicon-bonded carbinol group (i.e., Si-R'-OH, where R' is a hydrocarbon group derived from the oxidation of R) and / or silanol group (i.e., Si-OH), as will be described in more detail below.

[0028] Cytochrome P450 mutants are typically engineered variants of the P450 BM3 (CYP102A1) protein. For example, in some such embodiments, a cytochrome P450 mutant is a variant of cytochrome P450 BM3 that includes structural mutations such as amino acid substitutions, deletions, duplications, and / or insertions. In certain embodiments, the structural mutation is an amino acid substitution.

[0029] As will be understood by those skilled in the art, cytochrome P450 BM3 is a self-contained 118-kDa monooxygenase having a flavin adenine dinucleotide (FAD) and a flavin mononucleotide (FMN)-containing NADPH-dependent reductase domain fused to the C-terminus of its heme domain. The nucleotide and amino acid sequences of cytochrome P450 BM3 can be obtained from public databases such as the GenBank database, maintained by the National Center for Biotechnology Information (NCBI) under the International Nucleotide Sequence Database Collaboration (INSDC), or the UniProt database, maintained by the UniProt Consortium under accession number P14779.

[0030] In some embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity to the nucleic acid sequence described in SEQ ID NO: 1, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity to the nucleic acid sequence described in SEQ ID NO: 1. In certain embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in SEQ ID NO: 1. When the cytochrome P450 variant has the nucleic acid sequence described in SEQ ID NO: 1, the cytochrome P450 variant includes a V79 mutation, typically a V79A mutation, to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an A83 mutation, typically an A83V mutation, to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an F88 mutation, typically an F88G mutation, in relation to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes a P143 mutation, typically a P143S mutation, in relation to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes a T176 mutation, typically a T176I mutation, in relation to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an A185 mutation, typically an A185V mutation, in relation to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an S227 mutation, typically an S227R mutation, in relation to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 contains an H237 mutation, typically an H237Q mutation, to the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 contains an E253 mutation, typically an E253G mutation, to the nucleic acid sequence of cytochrome P450 BM3.In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an A291 mutation, typically an A291V mutation, in the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an L354 mutation, typically an L354V mutation, in the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an I367 mutation, typically an I367V mutation, in the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an E443 mutation, typically an E443K mutation, in the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes an F108 silent mutation, typically an F108F silent mutation, in the nucleic acid sequence of cytochrome P450 BM3. In these or other embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes the E273 silent mutation, typically the E273E silent mutation, to the nucleic acid sequence of cytochrome P450 BM3. In specific embodiments, the cytochrome P450 variant of SEQ ID NO: 1 includes the V79A, A83V, F88G, P143S, T176I, A185V, S227R, H237Q, E253G, A291V, L354V, I367V, E443K mutations, as well as the F108F and E273E silent mutations, to the nucleic acid sequence of cytochrome P450 BM3.

[0031] In specific embodiments, the cytochrome P450 variant includes the T328 mutation in relation to the nucleic acid sequence of SEQ ID NO: 1. For example, in some such embodiments, the T328 mutation is the T328M mutation. In these or other embodiments, the cytochrome P450 variant includes the A329 mutation in relation to the nucleic acid sequence of SEQ ID NO: 1. For example, in some such embodiments, the A329 mutation is the A329F mutation. In these or other embodiments, the cytochrome P450 variant includes the I454 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 1. For example, in some such embodiments, the I454 silent mutation is the I454I silent mutation. In certain embodiments, the cytochrome P450 variant includes the T328M and A329F mutations in relation to the nucleic acid sequence of SEQ ID NO: 1, as well as the I454 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 1. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity to the nucleic acid sequence described in SEQ ID NO: 2, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity to the nucleic acid sequence described in SEQ ID NO: 2. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in SEQ ID NO: 2.

[0032] In specific embodiments, the cytochrome P450 variant includes a D35 mutation in relation to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the D35 mutation is a D35G mutation. In these or other embodiments, the cytochrome P450 variant includes an I123 mutation in relation to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the I123 mutation is an I123T mutation. In these or other embodiments, the cytochrome P450 variant includes an L250 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the L250 silent mutation is an L250L silent mutation. In these or other embodiments, the cytochrome P450 variant includes an E338 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the E338 silent mutation is an E338E silent mutation. In these or other embodiments, the cytochrome P450 variant includes an L342 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the L342 silent mutation is the L342L silent mutation. In these or other embodiments, the cytochrome P450 variant includes the E381 silent mutation with respect to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the E381 silent mutation is the E381E silent mutation. In these or other embodiments, the cytochrome P450 variant includes the P387 silent mutation with respect to the nucleic acid sequence of SEQ ID NO: 2. For example, in some such embodiments, the P387 silent mutation is the P387P silent mutation. In certain embodiments, the cytochrome P450 variant includes both the D35G and I123T mutations, as well as the L250L, E388E, L342L, E381E, and P387P silent mutations with respect to the nucleic acid sequence of SEQ ID NO: 2. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity to the nucleic acid sequence described in Sequence ID No. 3, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity to the nucleic acid sequence described in Sequence ID No. 3.In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, and alternatively 100% identical to the nucleic acid sequence described in Sequence ID No. 3.

[0033] In specific embodiments, the cytochrome P450 variant includes a G353 mutation in relation to the nucleic acid sequence of SEQ ID NO: 3. For example, in some such embodiments, the D35 mutation is the D353E mutation. In these or other embodiments, the cytochrome P450 variant includes an L250 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 3. For example, in some such embodiments, the L250 silent mutation is the L250L silent mutation. In these or other embodiments, the cytochrome P450 variant includes an E338 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 3. For example, in some such embodiments, the E338 silent mutation is the E338E silent mutation. In these or other embodiments, the cytochrome P450 variant includes an L342 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 3. For example, in some such embodiments, the L342 silent mutation is the L342L silent mutation. In these or other embodiments, the cytochrome P450 variant includes an E381 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 3. For example, in some such embodiments, the E381 silent mutation is the E381E silent mutation. In these or other embodiments, the cytochrome P450 variant includes the P387 silent mutation with respect to the nucleic acid sequence of Sequence ID No. 3. For example, in some such embodiments, the P387 silent mutation is the P387P silent mutation. In certain embodiments, the cytochrome P450 variant includes the D353E mutation with respect to the nucleic acid sequence of Sequence ID No. 3, as well as the L250L, E388E, L342L, E381E, and P387P silent mutations. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity with respect to the nucleic acid sequence described in Sequence ID No. 4, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with respect to the nucleic acid sequence described in Sequence ID No. 4. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in Sequence ID No. 4.

[0034] In specific embodiments, the cytochrome P450 variant includes the F329 mutation to the nucleic acid sequence of Sequence ID No. 4. For example, in some such embodiments, the F329 mutation is the F329S mutation. In these or other embodiments, the cytochrome P450 variant includes the D423 silent mutation to the nucleic acid sequence of Sequence ID No. 4. For example, in some such embodiments, the D423 silent mutation is the D423D silent mutation. In certain embodiments, the cytochrome P450 variant includes both the F329 mutation and the D432D silent mutation to the nucleic acid sequence of Sequence ID No. 4. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity to the nucleic acid sequence described in Sequence ID No. 5, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity to the nucleic acid sequence described in Sequence ID No. 5. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in Sequence ID No. 5.

[0035] In specific embodiments, the cytochrome P450 variant includes the F166 mutation with respect to the nucleic acid sequence of Sequence ID No. 5. For example, in some such embodiments, the F166 mutation is the F166L mutation. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity with respect to the nucleic acid sequence described in Sequence ID No. 6, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with respect to the nucleic acid sequence described in Sequence ID No. 6. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identity with respect to the nucleic acid sequence described in Sequence ID No. 6.

[0036] In specific embodiments, the cytochrome P450 variant includes the Y52 mutation with respect to the nucleic acid sequence of SEQ ID NO: 6. For example, in some such embodiments, the Y52 mutation is the Y52V mutation. In these or other embodiments, the cytochrome P450 variant includes the V185 mutation with respect to the nucleic acid sequence of SEQ ID NO: 6. For example, in some such embodiments, the V185 mutation is the V185M mutation. In certain embodiments, the cytochrome P450 variant includes both the Y52V and V185M mutations with respect to the nucleic acid sequence of SEQ ID NO: 6. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity with respect to the nucleic acid sequence described in SEQ ID NO: 7, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with respect to the nucleic acid sequence described in SEQ ID NO: 7. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in Sequence ID No. 7.

[0037] In specific embodiments, the cytochrome P450 variant includes an N96 mutation in relation to the nucleic acid sequence of SEQ ID NO: 7. For example, in some such embodiments, the N96 mutation is the N95S mutation. In these or other embodiments, the cytochrome P450 variant includes a D215 mutation in relation to the nucleic acid sequence of SEQ ID NO: 7. For example, in some such embodiments, the D215 mutation is the D215G mutation. In these or other embodiments, the cytochrome P450 variant includes a T439 mutation in relation to the nucleic acid sequence of SEQ ID NO: 7. For example, in some such embodiments, the T439 mutation is the T439S mutation. In these or other embodiments, the cytochrome P450 variant includes an H286 silent mutation in relation to the nucleic acid sequence of SEQ ID NO: 7. In certain embodiments, the cytochrome P450 variant includes the N96S, D215G, and T439S mutations, as well as the H286H silent mutation, in relation to the nucleic acid sequence of SEQ ID NO: 7. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity to the nucleic acid sequence described in SEQ ID NO: 8, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity to the nucleic acid sequence described in SEQ ID NO: 8. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in SEQ ID NO: 8.

[0038] In specific embodiments, the cytochrome P450 variant includes the S73 mutation with respect to the nucleic acid sequence of SEQ ID NO: 8. For example, in some such embodiments, the S73 mutation is the S73G mutation. In these or other embodiments, the cytochrome P450 variant includes the G86 mutation with respect to the nucleic acid sequence of SEQ ID NO: 8. For example, in some such embodiments, the G86 mutation is the V1G86A mutation. In certain embodiments, the cytochrome P450 variant includes both the S73G and G86A mutations with respect to the nucleic acid sequence of SEQ ID NO: 8. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity with respect to the nucleic acid sequence described in SEQ ID NO: 9, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with respect to the nucleic acid sequence described in SEQ ID NO: 9. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identical to the nucleic acid sequence described in Sequence ID No. 9.

[0039] In specific embodiments, the cytochrome P450 variant includes an R48 mutation with respect to the nucleic acid sequence of SEQ ID NO: 9. For example, in some such embodiments, the R48 mutation is an R48G mutation. In some such embodiments, the cytochrome P450 variant includes a nucleic acid sequence having at least 70% identity with respect to the nucleic acid sequence described in SEQ ID NO: 10, for example, at least 75%, alternatively at least 80%, alternatively at least 85%, alternatively at least 90%, or alternatively at least 95% identity with respect to the nucleic acid sequence described in SEQ ID NO: 10. In certain such embodiments, the cytochrome P450 variant includes a nucleic acid sequence that is more than 95%, alternatively more than 96%, alternatively more than 97%, alternatively more than 98%, alternatively more than 99%, or alternatively 100% identity with respect to the nucleic acid sequence described in SEQ ID NO: 10.

[0040] With respect to specific nucleic acid sequences of cytochrome P450, conventional numbering used to identify / indicate specific amino acid residues ignores the initial methionine residue (e.g., encoded by the start codon), and as such, it is understood by those skilled in the art that the first residue following the initial methionine is the first numbered residue in the sequence. Accordingly, with respect to the above mutations, such residues may be assigned or otherwise designated based on conventional numbering of cytochrome P450 variants rather than sequential numbering, and as such, it is understood that, for example, the V79, A83, F88, P143, and T176 mutations may instead be referred to as the V78, A82, F87, P142, and T175 mutations, respectively. Furthermore, it is readily understood by those skilled in the art that SEQ ID NOs: 1 to 10 are nucleic acid sequences that encode amino acid sequences, and that the nucleic acid sequences SEQ ID NOs: 1 to 10 can be translated into unique amino acid sequences.

[0041] It should also be understood that cytochrome P450 variants may include mutations (e.g., substitutions) in one or more residues other than those described above, as alternative or additional mutations. Generally, suitable residues for mutations to prepare cytochrome P450 variants suitable for this method are determined by those skilled in the art (e.g., based on the specific wild-type enzyme to be modified, the initial organosilicon compound that may be oxidized, the conditions under which the method is used, etc.) and generally include conserved residues that can affect the reaction properties of the enzyme (e.g., heme-iron center reactivity, selectivity, solvent tolerance, and / or enzyme cofactor dependence). For example, in some embodiments, cytochrome P450 variants include mutations that enable the incorporation of non-natural cofactors such as alternative heme cofactors (e.g., protoporphyrin IX, or other porphyrin molecules containing metals other than iron, such as cobalt, rhodium, copper, ruthenium, iridium, and manganese) and / or alternative reducing cofactors (e.g., NADH vs. NADPH). Such residues can be identified using any technique known in the art, including crystallographic studies, phylogenetic studies, and mutagenesis studies, and these procedures are well known.

[0042] Mutations can be introduced into the sequence of cytochrome P450 variants using standard gene synthesis and / or cloning techniques, such as directional mutagenesis, random mutagenesis, and various combinations thereof. Examples of such techniques include error-prone polymerase chain reaction (PCR), cassette mutagenesis, oligonucleotide directional mutagenesis, parallel PCR, random mutagenesis with reassembly via random fragmentation and cross-priming, chemical mutagenesis, irradiation, DNA shuffling, and modifications and / or combinations thereof. In certain embodiments, cytochrome P450 variants are prepared using directional mutagenesis (i.e., introducing specific nucleotide changes at a given location), such as PCR site-directed mutagenesis, cassette mutagenesis, whole plasmid mutagenesis, Kunkel method, or combinations thereof. Certain techniques are selected based on the specific cytochrome P450 variant to be prepared. For example, in certain embodiments, directional mutagenesis techniques can be used to selectively substitute one or more of the conserved residues described above. In these or other embodiments, one or more of the mutagenesis techniques described above may also be used under low-precision polymerization conditions to introduce random point mutations over long sequences, or to mutagenesis a mixture of fragments of unknown sequences. Therefore, it will be understood that the above techniques are not limiting, and other techniques may also be utilized.

[0043] In one embodiment, cytochrome P450 mutants are manipulated using directional evolution. In such embodiments, directional evolution is utilized to optimize cytochrome P450 mutants by generating a saturated mutagenesis library (e.g., via single-site saturated mutagenesis, dual-site saturated mutagenesis, etc.) and selecting cytochrome P450 mutants that exhibit improved activity at screening, as described in more detail below.

[0044] As will be understood by those skilled in the art, saturated mutagenesis is a technique used to introduce random mutations at predetermined locations in an encoded protein. More specifically, saturated mutagenesis typically utilizes an artificial gene sequence synthesized using one or more primers containing degenerate codons to introduce mutagenesis at the location to be optimized. Each of the three positions within the degenerate codon encodes a base such as adenine (A), cytosine (C), thymine (T), or guanine (G), or a degenerate position such as K (representing G and T), M (representing A and C), R (representing A and G), S (representing C and G), W (representing A and T), Y (representing C and T), B (representing C, G, and T), D (representing A, G, and T), H (representing A, C, and T), V (representing A, C, and G), or N (representing A, C, G, and T). For example, the degenerate codon "NDT" contains 12 codons (i.e., N=[A,C,G,T]; D=[A,G,T]; T=[T]), which collectively encode 12 amino acids (Phe, Leu, Ile, Val, Tyr, His, Asn, Asp, Cys, Arg, Ser, and Gly). Similarly, the degenerate codon NNN contains all 64 codons and encodes all 20 naturally occurring amino acids, and is therefore considered "completely randomized." It will be understood that certain amino acids are encoded by more codons than others, and as a result, the exact ratio of encoded amino acids in a given degenerate codon is not equal. Furthermore, degenerate codons are typically selected to minimize the presence of stop codons. For example, the restricted degenerate codons "NNK" and "NNS" can be used to encode the same number of amino acids as "NNN" (i.e., all 20 naturally occurring amino acids), but with a significantly reduced content of encoded stop codons. Therefore, in certain embodiments, a mixture of degenerate primers may be used to achieve desired parameters, including overlap and stop codon content, as well as the presentation of selected chemical and / or physical properties of the encoded amino acids, such as charge, size, electronics, polarity, hydrophilicity, and hydrophobicity. Such a mixture may contain any number of different degenerate primers in any proportion.Methods and procedures for selecting the optimal combination of degenerate primers are known to those skilled in the art. For example, computational tools for selecting specific degenerate codons are known and can be used to control the corresponding encoded amino acids. Specific primers suitable for introducing the above-mentioned mutations are provided in the following examples herein.

[0045] It should be understood that the evolving parent protein / enzyme may be a wild-type protein or enzyme, or a mutant, variant, etc. Generally, the parent protein is selected from cytochrome P450 proteins such as cytochrome P450 BM3. Therefore, the parent polynucleotides used when creating the mutagenic library, as well as the entire vector containing the nucleic acid encoding the parent protein of interest, may be commercially available and can therefore be prepared, purchased, or otherwise obtained from any suitable commercial or non-commercial source.

[0046] Once prepared (for example, by introducing one or more mutations into a target gene encoding a parental cytochrome P450 using one or more of the techniques described above), the evolved polynucleotide is cloned into a suitable vector according to methods well known in the art and introduced into a suitable host cell for expression (e.g., via transformation, transfection, infection, etc.). Suitable vectors, host cells, and techniques are readily selected by those skilled in the art. Examples of suitable vectors include a variety of plasmids and viruses known to be compatible with host cells expressing oxidases or oxygenases. Examples of suitable host cells include bacterial cells (e.g., derived from Escherichia coli, Bacillus, Pseudomonas, etc.), yeast cells (e.g., derived from Saccharomyces cerevisiae, etc.), fungal cells (e.g., derived from Aspergillus), insect cells, etc. In certain embodiments, plant and / or other animal cells (e.g., mammals, humans, etc.) may also be used. Such host cells may be transformed, transfected, or infected as needed by any preferred method, including electroporation, chemotransfer of DNA, fungal infection, viral infection, microinjection, microprojectile transformation, or other techniques known in the art.

[0047] Following expression, evolved cytochrome P450 mutants are then tested / screened (e.g., using silane oxidation / silanol formation monitored in vivo or in vitro via chromatography and / or spectroscopy, in combination with organosilicon compounds, as described later) to identify specific mutants exhibiting desired activity or properties, and optimally, higher activity (i.e., more beneficial) than the parental cytochrome P450 protein. Any such identified mutants may then be isolated, purified, and / or characterized as necessary and, optionally, subjected to assays designed to further test functional activity, etc. It will be understood that identified mutants may also be utilized in further rounds of directional evolution, i.e., as parental proteins prepared (e.g., via the procedures described above) for subsequent production of cytochrome P450 mutants. Various aspects of directional evolution techniques suitable for use in the manipulation and / or optimization of cytochrome P450 mutants will be better understood with consideration of the specific procedures described in the following examples.

[0048] As can be understood from the above description of the directional evolutionary process and the further description below, nucleic acids (i.e., nucleic acid molecules) encoding cytochrome P450 variants are also provided herein. The nucleic acid molecule may be a DNA molecule or an RNA molecule and may be any form suitable for use in the preparation of cytochrome P450 variants (e.g., any of the above forms). Thus, the nucleic acid molecule may encode a cytochrome P450 variant or its precursor, for example, a pro-form or pre-pro-form of a cytochrome P450 variant, and optionally include a signal sequence or other heterologous amino acid moiety (e.g., a tag) for secretion and / or purification. For example, to facilitate protein purification, affinity tags (e.g., His6-tag (SEQ ID NO: 17), glutathione S-transferase (GST), etc.) may be added to the N and / or C-terminus of a cytochrome P450 variant protein expressed from an expression vector using the nucleic acid.

[0049] In some embodiments, the nucleic acid molecule is produced via gene synthesis (i.e., it is a synthetic nucleic acid). In some such embodiments, the synthetic nucleic acid is codon-optimized for expression. For example, in certain embodiments, the synthetic nucleic acid may be manipulated to lack certain internal restriction endonuclease sites. Similarly, in certain embodiments, the nucleic acid molecule may include an expression control sequence, i.e., a sequence that enables the expression of the nucleic acid molecule in a desired host cell, or otherwise may be operably ligated thereto. Examples of suitable expression control sequences and vectors are known in the art.

[0050] Therefore, non-human organisms transformed or transfected with nucleic acid molecules (i.e., transgenic organisms) are also provided, which may be prepared by any known homologous recombination method or other techniques for gene transcription, such as those described herein.

[0051] For example, nucleic acid molecules can be located on a vector. Therefore, expression vectors containing nucleic acid sequences encoding cytochrome P450 variants are also provided. Generally, expression vectors are not limited to viral vectors, plasmids, phages, phagemids, cosmids, fosmids, bacteriophages (e.g., bacteriophage P1-derived vectors (PACs)), baculovirus vectors, yeast plasmids, artificial chromosomes (e.g., bacterial artificial chromosomes (BACs), yeast artificial chromosomes (YACs), mammalian artificial chromosomes (MACs), human artificial chromosomes (HACs), etc.), or other such vectors capable of promoting the expression of cytochrome P450 variants, which are readily apparent to those skilled in the art.

[0052] Expression vectors may include chromosomal, non-chromosomal, and / or synthetic DNA sequences. In certain embodiments, the expression vector includes a promoter operably ligated to a nucleic acid sequence encoding a cytochrome P450 variant. In such embodiments, the promoter is not particularly limited and may be selected from viral, bacterial, archaeal, fungal, insect, plant, and / or mammalian promoters. In certain embodiments, the promoter is a structural promoter. In some embodiments, the promoter is an inducible promoter. In other embodiments, the promoter is tissue-specific, environmentally regulated, and / or developmentally regulated.

[0053] Examples of expression vectors include pCWori vectors, pET vectors (e.g., pET22), pQE vectors, pBluescript vectors, pNH vectors, lambda-ZAP vectors, pKLAC1 vectors, pKLAC2 vectors, pMT vectors, BacPak baculovirus vectors, pSyn_1 vectors, pCR-TOPO vectors, pChlamy_1 vectors, pAdeno-X adenovirus vectors, and pBABE retrovirus vectors, which are available from various commercial suppliers. Additional examples of expression vectors include ptrc99a, pKK223-3, pDR540, pRIT2T, pRSET, pGEM1, pMAL, pBR322 (i.e., ATCC37017), pXT1, pSG5, pSVK3, pBPV, pMSG, pSVLSV40, pcDNA3.3, pcDNA4 / TO, pcDNA6 / TR, pLenti6 / TR, and their derivatives and modifications. It will be understood that any other vectors that are replicable and viable in host cells may also be utilized.

[0054] Cytochrome P450 mutants can be expressed in all cell types, including bacterial cells, archaeal cells, yeast cells, fungal cells, insect cells, plant cells, and mammalian cells. Examples of bacterial host cells include BL21 Escherichia coli, DE3 strain Escherichia coli, Escherichia coli M15, DH5α, DH10β, HB101, T7 Express Competent Escherichia coli (NEB), B. subtilisin cells, Pseudomonas floresens cells, as well as cyanobacterial cells such as Chlamydomonas reinhardtii cells and Synechococcus elongate cells. Examples of archaeal host cells include Pyrococcus furiosus, Metallosphera sedula, Thermococcus litoralis, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Pyrococcus abyssi, Sulfolobus solfataricus, Pyrococcus woesei, and Sulfolobus shibatae. Examples of fungal host cells include yeast cells from the genera Saccharomyces (e.g., S. cerevisiae), Pichia (e.g., P. pastoris), Kluyveromyces (e.g., K. lactis), Hansenula, and Yarrowia, as well as filamentous fungal cells from the genera Aspergillus, Trichoderma, and Myceliophthora. Examples of insect host cells include Sf9 cells, Sf21 cells, Hi-Five cells, BTI-TN-5B1-4 Trichophusia ni cells derived from Spodoptera frugiperda, and Schneider 2(S2) and Schneider 3(S3) cells derived from Drosophila melanogaster. Examples of mammalian host cells include HEK293 cells, HeLa cells, CHO cells, COS cells, Jurkat cells, NSO hybridoma cells, baby hamster kidney (BHK) cells, MDCK cells, and NIH-3T3 fibroblasts.Examples of plant host cells include those derived from tobacco, tomato, potato, corn, rice, lettuce, and spinach plants, as well as other plant cells that have a short production time and / or obtain reasonable biomass with standard cultivation techniques. These host cells will also be understood to exemplify non-human organisms containing nucleic acid molecules in certain embodiments, as described above.

[0055] In some embodiments, cytochrome P450 mutants exhibit enhanced activity with respect to silicon oxidation in this method compared to the corresponding wild-type cytochrome P450 protein. For example, in certain embodiments, cytochrome P450 mutants exhibit at least 1.5 times higher activity than the corresponding wild-type protein, e.g., at least 2 times, alternatively at least 5 times, alternatively at least 10 times, alternatively at least 20 times, alternatively at least 25 times, alternatively at least 50 times, alternatively at least 100 times, alternatively at least 250 times, alternatively at least 500 times, alternatively at least 1000 times, alternatively at least 2000 times higher activity than the corresponding wild-type protein (i.e., when evaluated under the same conditions according to this method).

[0056] Cytochrome P450 variants can be used in this method in any form. For example, in certain embodiments, the cytochrome P450 variant is used as a whole cell catalyst, i.e., a composition containing a host cell expressing the cytochrome P450 variant. Examples of such host cells, as well as various techniques for preparing such a whole cell catalyst containing the cytochrome P450 variant, are described above. Thus, in some embodiments, this method comprises preparing a whole cell catalyst containing (e.g., expressing) the cytochrome P450 variant, and then combining the whole cell catalyst with an organosilicon compound to prepare an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. In certain embodiments, the cytochrome P450 variant is used as a cell lysate, i.e., a composition containing the lysate product of the whole cell catalyst containing the cytochrome P450 variant described above. In yet other embodiments, the cytochrome P450 variant is used as an isolated enzyme. For example, in such embodiments, the method includes isolating and / or purifying the cytochrome P450 mutant from host cells expressing the cytochrome P450 mutant and / or the cell lysates to obtain the isolated cytochrome P450 mutant, and then combining it with an organosilicon compound to prepare an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0057] As described above, a method for preparing organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group involves preparing a reaction mixture by combining a cytochrome P450 variant, an initial organosilicon compound, and a cofactor. More specifically, the initial organosilicon compound contains at least one silicon-bonded hydrocarbyl group that can be oxidized to a silicon-bonded carbinol group or a silanol group (i.e., a silicon-bonded hydroxyl group) when the reaction mixture is exposed to an oxidizing agent. The silicon-bonded hydrocarbyl group is unsubstituted and does not contain heteroatoms.

[0058] The initial organosilicon compound can vary widely with respect to other substituents bonded to silicon. Each silicon-bonded hydrocarbyl group present in the initial organosilicon compound is independently selected. For clarity and consistency, the following references to “silicon-bonded hydrocarbyl group” or “hydrocarbyl group” refer to at least one hydrocarbyl group in the initial organosilicon compound, but can also apply to other silicon-bonded hydrocarbyl groups present in the initial organosilicon compound, whether or not they are oxidized via this method, and this should not be interpreted as meaning that each hydrocarbyl group is identical.

[0059] Suitable hydrocarbyl groups for inclusion in initial organosilicon compounds and for oxidation via this method include monovalent hydrocarbon moieties, as well as their derivatives and modifications, which can independently be linear, branched, cyclic, or combinations thereof, and saturated or unsaturated. However, the hydrocarbyl groups of initial organosilicon compounds oxidized via this method are unsubstituted. With respect to such hydrocarbyl groups, the term "unsubstituted" refers to a hydrocarbon moiety composed of carbon and hydrogen atoms, i.e., without heteroatomic substituents. The term "substituted" refers to a hydrocarbon moiety in which at least one hydrogen atom is replaced by an atom or group other than hydrogen (e.g., a halogen atom, alkoxy group, amine group, etc.) (i.e., as a pendant or terminal substituent), a carbon atom in the hydrocarbon chain / backbone is replaced by an atom other than carbon (e.g., a heteroatom such as oxygen, sulfur, or nitrogen) (i.e., as part of the chain / backbone), or both.

[0060] Linear and branched hydrocarbyl groups can independently be saturated or unsaturated, and if unsaturated, they can be conjugated or non-conjugated. Cyclic hydrocarbyl groups can independently be monocyclic or polycyclic, and include cycloalkyl groups, aryl groups, and heterocycles, which can be aromatic, saturated, non-aromatic, and / or non-conjugated. Examples of combinations of linear and cyclic hydrocarbyl groups include alkaryl groups and aralkyl groups. General examples of hydrocarbon moieties suitable for use in or as hydrocarbyl groups include alkyl groups, aryl groups, alkenyl groups, alkynyl groups, and their derivatives, modifications, and combinations thereof. Examples of alkyl groups include methyl, ethyl, propyl (e.g., isopropyl and / or n-propyl), butyl (e.g., isobutyl, n-butyl, tert-butyl, and / or sec-butyl), pentyl (e.g., isopentyl, neopentyl, and / or tert-pentyl), hexyl, etc. (i.e., other linear or branched saturated hydrocarbon groups, e.g., having more than six carbon atoms). Examples of aryl groups include phenyl, tolyl, xylyl, naphthyl, benzyl, dimethylphenyl, etc., as well as their derivatives and modifications, which may overlap with alkaryl groups (e.g., benzyl) and aralkyl groups (e.g., tolyl, dimethylphenyl, etc.). Examples of alkenyl groups include vinyl, allyl, propenyl, isopropenyl, butenyl, isobutenyl, pentenyl, heptenyl, hexenyl, cyclohexenyl groups, etc., as well as their derivatives and modifications.

[0061] In certain embodiments, the silicon-bonded hydrocarbyl group of the initial organosilicon compound is an unsubstituted hydrocarbyl group having 1 to 12 carbon atoms. For example, in some such embodiments, the hydrocarbyl group is an alkyl group, such as an alkyl group having 1 to 6, alternatively 1 to 5, or alternatively 1 to 4 carbon atoms. Specific examples of alkyl groups include methyl, ethyl, propyl (e.g., n-propyl and isopropyl), butyl (e.g., n-butyl, sec-butyl, iso-butyl, and tert-butyl), pentyl, hexyl, heptyl, and the like, as well as their derivatives and / or modifications. In other embodiments, the hydrocarbyl group is an unsubstituted alkenyl group having 2 to 6 carbon atoms, for example, 2 to 5, alternatively 2 to 4, or alternatively 2 to 3 carbon atoms.

[0062] In certain embodiments, the hydrocarbyl group is selected from substituted and unsubstituted aryl, alkaryl, and aralkyl groups having 1 to 12 carbon atoms, for example, 2 to 12, alternatively 2 to 10, alternatively 3 to 10, alternatively 3 to 8, and alternatively 4 to 8 carbon atoms. In certain embodiments, at least one R is independently selected from unsubstituted aryl, alkaryl, and aralkyl groups.

[0063] In certain embodiments, the initial organosilicon compound may also include substituted hydrocarbyl groups that are not oxidized by the method of the present invention. For example, the initial organosilicon compound may include one or more halocarbon groups.

[0064] Common examples of halocarbon groups include halogenated alkyl groups (e.g., any of the above alkyl groups in which one or more hydrogen atoms are replaced by halogen atoms such as F or Cl), aryl groups (e.g., any of the above aryl groups in which one or more hydrogen atoms are replaced by halogen atoms such as F or Cl), and halogenated derivatives of the hydrocarbon moiety described above, such as combinations thereof. Examples of alkyl halogenated groups include fluoromethyl, 2-fluoropropyl, 3,3,3-trifluoropropyl, 4,4,4-trifluorobutyl, 4,4,4,3,3-pentafluorobutyl, 5,5,5,4,4,3,3-heptafluoropentyl, 6,6,6,5,5,4,4,3,3-nonafluorohexyl, 8,8,8,7,7-pentafluorooctyl, 2,2-difluorocyclopropyl, 2,3-difluorocyclobutyl, 3,4-difluorocyclohexyl, and 3,4-difluoro-5-methylcycloheptyl, chloromethyl, chloropropyl, 2-dichlorocyclopropyl, 2,3-dichlorocyclopentyl, and their derivatives and modifications. Examples of aryl halogenated groups include chlorobenzyl, pentafluorophenyl, fluorobenzyl, and their derivatives and modifications.

[0065] In specific embodiments, the initial organosilicon compound comprises only silicon-bonded unsubstituted hydrocarbyl groups selected from the above, and does not contain silicon-bonded substituted hydrocarbyl groups.

[0066] The initial organosilicon compounds are not limited and may include any combination of siloxy groups. Furthermore, the initial organosilicon compounds may not contain siloxy groups, which are typically only present in organosilicon compounds containing one or more siloxane bonds; these may be alternatively referred to as organosiloxanes or polyorganosiloxanes.

[0067] Examples of suitable siloxy groups include [M], [D], [T], and [Q] units / siloxy groups, which, as understood in the art, each represent an individual functional structural unit present in siloxanes such as organosiloxanes and organopolysiloxanes. More specifically, [M] is of the general formula R’’3SiO 1 / 2 represents a monofunctional unit, [D] is of the general formula R’’2SiO 2 / 2 represents a difunctional unit, [T] is of the general formula R’’SiO 3 / 2 represents a trifunctional unit, and [Q] is of the general formula SiO 4 / 2 represents a tetrafunctional unit, shown by the following general structural moieties:

[0068] [Chemical formula]

[0069] In these general structural moieties, each R” is independently a monovalent substituent, for example, the silicon-bonded hydrocarbyl group of the first silicon compound above.

[0070]

[0071] In certain embodiments, the initial organosilicon compound does not contain T and / or Q siloxy units. In these or other embodiments, the initial organosilicon compound consists of only M and / or D siloxy units. Alternatively, the initial organosilicon compound can be an organosilane or an organosiloxane. The organosilane can be a monosilane, disilane, trisilane, or polysilane. Similarly, the organosiloxane can be a disiloxane, trisiloxane, or polysiloxane. In various embodiments, the initial organosilicon compound has the general formula (I) or (II),(R 1 2SiO 2 / 2 ) n (I) R 1 3Si(O-SiR 1 2) m R 1 (II) R 13Si-(D-SiR 1 2) m R 1 (III) In the formula, each R 1 is an independently selected unsubstituted hydrocarbyl group or H, except R 1 At least one of them is a hydrocarbyl group, the subscript n is 3 to 8, the subscript m is 0 to 15, and each D is an independently selected divalent linking group.

[0072] In specific embodiments, the initial organosilicon compound has the above general formula (I). As is understood in the art, when the initial organosilicon compound has general formula (I), the initial organosilicon compound is a cyclic siloxane. Since the subscript n is 3 to 8, the cyclic siloxane has 3 to 8 Dsiloxy units.

[0073] Examples of cyclic siloxanes include hexamethylcyclotrisiloxane (D3), octamethylcyclotetrasiloxane (D4), decamethylcyclopentasiloxane (D5), dodecamethylcyclohexasiloxane (D6), 1,1-diethylhexamethylcyclotetrasiloxane, phenylheptamethylcyclotetrasiloxane, 1,1-diphenylhexamethylcyclotetrasiloxane, and 1,3,5,7-tetravinyltetramethylcyclotetra Examples include siloxanes, 1,3,5,7-tetramethylcyclotetrasiloxane, 1,3,5,7-tetracyclohexyltetramethylcyclotetrasiloxane, tris(3,3,3-trifluoropropyl)trimethylcyclotrisiloxane, 1,3,5,7-tetra(p-vinylphenyl)tetramethylcyclotetrasiloxane, and 1,3,5,7-tetra[3-(p-vinylphenyl)propyl]tetramethylcyclotetrasiloxane. Furthermore, mixtures of different cyclic siloxanes may be used.

[0074] In another specific embodiment, the initial organosilicon compound has the above general formula (II). When the subscript m is 0, the initial organosilicon compound of general formula (II) is a silane compound. When the subscript m is 1, the initial organosilicon compound of general formula (II) is a disiloxane compound. When the subscript m is 2, the initial organosilicon compound of general formula (II) is a trisiloxane compound, etc.

[0075] When the initial organosilicon compound has the above general formula (II) and the subscript m is 0, specific examples of organosilicon compounds include, but are not limited to, silanes having the following formulas: Me4Si, Et4Si, Me3EtSi, Me2Ph2Si, Vi4Si, PhSiVi3, MeSiVi3, PhMeSiVi2, Ph2SiVi2, and PhSi(CH2CH=CH2)3 (wherein Me is methyl, Eth is ethyl, Ph is phenyl, and Vi is vinyl).

[0076] The initial organosilicon compound has the above general formula (II), where the subscript m is 1, and each R 1 If R is methyl, the initial organosilicon compound is hexamethyldisiloxane. Those skilled in the art will see that each R 1 Based on the selection of the subscript m, other species of siloxane compounds within the range of the above general formula (II) can be easily understood.

[0077] In another specific embodiment, the initial organosilicon compound has the above general formula (III). The initial organosilicon compound of general formula (III) differs from that based on general formula (II) based on the selection of the divalent bonding group D. For example, when D is oxygen (-O-), the initial organosilicon compound of general formula (III) is in general formula (II) where the subscript m is 1 and each R 1If the same is true between general formulas (II) and (III), then it is the same as that of general formula (II). However, the divalent linking group D is typically a hydrocarbon group. In specific embodiments, the divalent linking group D is a hydrocarbon group that does not contain a heteroatom. In further specific embodiments, the divalent linking group D is unsubstituted.

[0078] The preferred hydrocarbon group is as described above with respect to the hydrocarbyl group of the initial organosilicon compound, except that the hydrocarbyl group of the initial organosilicon compound is monovalent and the linking group D is divalent. Therefore, as is readily understood in the art, the hydrogen atom is removed from any of the above hydrocarbyl groups when used as a divalent linking group D. For example, the hydrocarbyl group of the initial organosilicon compound may be methyl (-CH3), while the divalent linking group D of the initial organosilicon compound may be methylene (-CH2-). The divalent linking group may also be branched. As one specific example, if the divalent linking group is -C2H4-, it may be represented by a linear -CH2CH2- or a branched CH(CH3). Those skilled in the art will readily understand other linear and branched structures suitable for the divalent linking group D. Furthermore, the divalent linking group may contain or consist of an arylene group instead of, for example, a linear hydrocarbon group or a saturated hydrocarbon group. In a particular embodiment, the divalent linking group D has 1 to 10 carbon atoms, alternatively 1 to 9, alternatively 1 to 8, alternatively 1 to 7, alternatively 1 to 6, alternately 1 to 5, alternatively 1 to 4, alternatively 1 to 3, or alternatively 1 or 2 carbon atoms.

[0079] In certain embodiments, the initial organosilicon compound has general formula (III), where the subscript m is 0. In these embodiments, the initial organosilicon compound has general formula R 1 3Si-D-SiR 1 It has 3. When D is methylene, for example, the initial organosilicon compound has the general formula R 1 3Si-CH2-SiR 1 It has 3.

[0080] In specific embodiments, the initial organosilicon compound may be a silicone fluid. Specific examples of suitable silicone fluids include hexamethylcyclotrisiloxane, octamethylcyclotetrasiloxane, decamethylcyclopentasiloxane, dodecamethylcyclohexasiloxane, octamethyltrisiloxane, decamethyltetrasiloxane, dodecamethylpentasiloxane, tetradecamethylhexasiloxane, hexadeamethylheptasiloxane, heptamethyl-3-{(trimethylsilyl)oxy)}trisiloxane, hexamethyl-3,3, Examples include bis{(trimethylsilyl)oxy}trisiloxane, pentamethyl{(trimethylsilyl)oxy}cyclotrisiloxane, and polydimethylsiloxane, polyethylsiloxane, polymethylethylsiloxane, polymethylphenylsiloxane, polydiphenylsiloxane, caprylylmethicone, hexamethyldisiloxane, heptamethyloctyltrisiloxane, hexyltrimethicone, and their derivatives, modifications, and combinations thereof.

[0081] The initial organosilicon compounds can be prepared, or otherwise obtained as prepared compounds. Methods for preparing initial organosilicon compounds are known in the art, and such compounds and suitable starting materials are commercially available from various suppliers. If the preparation of the initial organosilicon compound is part of the present method, it is typically carried out before combining the initial organosilicon compound with a cytochrome P450 variant.

[0082] Similarly, the initial organosilicon compound may be used in any form, e.g., neat (i.e., without solvent, carrier vehicle, diluent, etc.) or placed in a carrier vehicle, e.g., a solvent or dispersant. For example, the initial organosilicon compound may be placed in a carrier vehicle, such as one of those described herein. It will be understood that, when used, acrylooxy-functionalized organosilicon monomers may be combined with a carrier vehicle before, during, or after combining with a cytochrome P450 variant. In some embodiments, the initial organosilicon compound is used without a carrier vehicle, or substantially without one. For example, in certain embodiments, the method may include stripping volatile substances and / or solvents from the initial organosilicon compound, or distilling the initial organosilicon compound from a solvent, volatile substances, etc., to prepare the initial organosilicon compound for use in the method.

[0083] The initial organosilicon compound may contain one organosilicon compound, or alternatively, two or more organosilicon compounds, such as two, three or more organosilicon compounds that differ from each other in terms of structure, viscosity, hydrocarbyl groups, etc.

[0084] The initial organosilicon compound may be used in any amount selected by those skilled in the art, for example, depending on the specific components selected for the reaction, the reaction parameters used, and the scale of the reaction (e.g., the total amount of the initial organosilicon compound to be reacted, and / or the total amount of organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group to be prepared).

[0085] A method for preparing organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group comprises combining a cytochrome P450 variant and an initial organosilicon compound, a cofactor, and optionally any other components to be utilized (collectively, “reacting components”) in the presence of an oxidizing agent. As will be understood by those skilled in the art, the reaction of the initial organosilicon compound and the oxidizing agent facilitated by the cytochrome P450 variant generally requires no active steps other than combining the components. As described above, the reactions of this method may be generally defined as oxidation and / or hydroxylation reactions, or otherwise characterized, and certain parameters and conditions of the reaction may be selected by those known in the art of such reactions for preparing organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0086] Typically, the reactants react in a vessel or reactor to prepare an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. More specifically, the reactants are typically combined in a vessel to prepare a reaction mixture, resulting in the preparation of an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group from the reaction mixture.

[0087] As described above, the reaction mixture may contain components other than the cytochrome P450 variant, the initial organosilicon compound, and the oxidizing agent. Typically, the oxidizing agent is atmospheric oxygen, which, due to its inherent availability under ambient conditions, does not require any active step in incorporating the oxidizing agent. Alternatively, the oxidizing agent may be a peroxide, which can be any peroxide source. For example, the cytochrome P450 variant and the initial organosilicon compound are typically combined in the presence of a carrier vehicle (e.g., solvent, diluent, fluid, etc., or a combination thereof) so that the reaction mixture includes a solution, emulsion, suspension, slurry, two-phase mixture, or a combination thereof. The specific solvent, carrier, and / or diluent used, and the amounts of each used, are independently selected by those skilled in the art, for example, based on the specific reactants used, the specific initial organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group to be prepared, the scale of the reaction, etc. For example, it is understood by those skilled in the art that biocatalytic reactions can be carried out heterogeneously using one or more components suspended but not dissolved in a carrier vehicle, for example. However, typically, certain reaction components are used as a homogeneous mixture (i.e., before the reaction mixture is formed), and / or the reaction mixture itself is substantially homogeneous. Generally, the solvent, carrier, and / or diluent used are selected to help fluidize and / or miscible one or more of the reaction components without promoting undesirable reactions of the reaction components. Examples of specific carrier vehicles include solvents, fluids, etc., suitable for adequately transporting, dissolving, and / or dispersing any components of the reaction mixture during the preparation of organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0088] Examples of suitable solvents include aqueous solvents (e.g., water and water-miscible organic solvents), organic solvents, fluids, oils (e.g., organic oils and / or silicone oils), and combinations thereof. Typically, the carrier vehicle contains water or, alternatively, an aqueous solvent essentially derived from water. However, in certain embodiments, additional and / or alternative carrier fluids and / or diluents may also be used, such as any of those described herein. For example, in some embodiments, the carrier vehicle contains an organic solvent. Examples of organic solvents include alcohols such as methanol, ethanol, isopropanol, butanol, and n-propanol; ketones such as acetone, methyl ethyl ketone, and methyl isobutyl ketone; aromatic hydrocarbons such as benzene, toluene, and xylene; aliphatic hydrocarbons such as heptane, hexane, and octane; glycol ethers such as propylene glycol methyl ether, dipropylene glycol methyl ether, propylene glycol n-butyl ether, propylene glycol n-propyl ether, and ethylene glycol n-butyl ether; acetates such as ethyl acetate, butyl acetate, ethylene glycol monoethyl ether acetate, and propylene glycol methyl ether acetate; halogenated hydrocarbons such as dichloromethane, 1,1,1-trichloroethane, and chloroform; dimethyl sulfoxide; dimethylformamide, acetonitrile; tetrahydrofuran; white spirit; mineral spirit; naphtha; n-methylpyrrolidone, and others, as well as derivatives, modifications, and combinations thereof. In certain embodiments, the carrier vehicle contains a polar organic solvent, such as a water-compatible solvent. Specific examples of such polar organic solvents include methanol, ethanol, 1-propanol, 2-propanol, 2-methyl-2-propanol, 2-butanone, tetrahydrofuran, acetone, and combinations thereof.

[0089] In certain embodiments, the carrier vehicle includes an organic fluid, typically containing organic oils, including volatile and / or semi-volatile hydrocarbons, esters, and / or ethers. A common example of such an organic fluid is C6-C 16 Alkan, C8-C 16 Isoalkanes (e.g., isodecane, isododecane, isohexadecane, etc.), C8-C 16 Examples of suitable organic fluids include volatile hydrocarbon oils such as branched esters (e.g., isohexyl neopentanoate, isodecyl neopentanoate, etc.), as well as derivatives, modifiers, and combinations thereof. Additional examples of suitable organic fluids include aromatic hydrocarbons, aliphatic hydrocarbons, alcohols having more than 3 carbon atoms, aldehydes, ketones, amines, esters, ethers, glycols, glycol ethers, acetates, alkyl halides, aromatic halides, and combinations thereof. Examples of hydrocarbons include isododecane, isohexadecane, and Isopar L(C) 11 ~C 13 ), Isopar H(C 11 ~C 12 Examples include hydrogenated polydecenes. Ethers and esters include isodecyl neopentanoates, neopentyl glycol heptanoates, glycol distearates, dicaprylyl carbonates, diethylhexyl carbonates, propylene glycol n-butyl ethers, ethyl-3 ethoxypropionate, propylene glycol methyl ether acetate, tridecyl neopentanoates, propylene glycol methyl ether acetate (PGMEA), propylene glycol methyl ether (PGME), octyldodecyl neopentanoates, diisobutyl adipates, diisopropyl adipates, propylene glycol dicaprylate / dicaplate, octyl ethers, octyl palmitates, and combinations thereof.

[0090] In some embodiments, the carrier vehicle includes a silicone fluid. The silicone fluid is typically a low-viscosity and / or volatile siloxane. When used as a carrier vehicle, the silicone fluid may be different from the initial organosilicon compound used in this method, or the initial organosilicon compound itself may function as the carrier fluid in the reaction mixture.

[0091] Other carrier vehicles can also be used. For example, in some embodiments, the carrier vehicle includes an ionic liquid. Examples of ionic liquids include combinations of anions and cations. Generally, anions are selected from alkyl sulfate anions, tosylate anions, sulfonic acid anions, bis(trifluoromethanesulfonyl)imide anions, bis(fluorosulfonyl)imide anions, hexafluorophosphate anions, tetrafluoroborate anions, etc., and cations are selected from imidazolium cations, pyrrolidinium cations, pyridinium cations, lithium cations, etc. However, combinations of multiple cations and anions can also be used. Typical examples of ionic liquids include 1-butyl-1-methylpyrrolidinium bis(trifluoromethanesulfonyl)imide, 1-methyl-1-propylpyrrolidinium bis-(trifluoromethanesulfonyl)imide, 3-methyl-1-propylpyridinium bis(trifluoromethanesulfonyl)imide, N-butyl-3-methylpyridinium bis(trifluoromethanesulfonyl)imide, 1-methyl-1-propylpyridinium bis(trifluoromethanesulfonyl)imide, diallyldimethylammonium bis(trifluoromethanesulfonyl)imide, and methyltrioctylammonium bis(trifluoromethanesulfonyl)imide. Examples include mido, 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide, 1,2-dimethyl-3-propylimidazolium bis(trifluoromethanesulfonyl)imide, 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide, 1-vinylimidazolium bis(trifluoromethanesulfonyl)imide, 1-allyliimidazolium bis(trifluoromethanesulfonyl)imide, 1-allyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide, lithium bis(trifluoromethanesulfonyl)imide, and their derivatives, modifications, and combinations.

[0092] The carrier vehicle may include a combination of different vehicles / solvents / diluents, etc., which may be miscible or immiscible with each other. For example, as mentioned above, the reaction mixture may be homogeneous or heterogeneous (e.g., in the form of emulsions such as water-in-oil emulsion, silicone-in-oil emulsion, oil-in-water emulsion, or oil-in-silicone emulsion).

[0093] In certain embodiments, the reaction mixture may include one or more additional components, which are selected by those skilled in the art in consideration of the specific parameters used in this method. Examples of such additional components include buffers (e.g., M9-N buffer, 2-(N-morpholino)ethanesulfonic acid (MES), 2-[4-(2-hydroxy-ethyl)piperazine-1-yl]ethanesulfonic acid (HEPES), 3-morpholinopropane-1-sulfonic acid (MOPS), 2-amino-2-hydroxy-methyl-propane-1,3-diol (TRIS), potassium phosphate, sodium phosphate, phosphate-buffered saline, sodium citrate, sodium acetate, sodium borate, etc.), reducing agents and / or cofactors (e.g., NADPH, NADP+ (with a cofactor regeneration system), NADH, sodium dithionate, dithiothreitol (DTT), β-mercaptoethanol (BME), tris(2-carboxyethyl)phosphine (TCEP), etc.), chelating agents (e.g., 2-({2-[bis(carboxymethyl)amino]ethyl}(carboxymethyl)amino) acetic acid) Examples include acids (EDTA, ethylene glycol-bis(2-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA), 1,2-bis(o-aminophenoxy)ethane-N,N,N',N'-tetraacetic acid (BAPTA), etc.), salts (e.g., halides of sodium, calcium, potassium, magnesium, etc., such as NaCl, KCl, CaCl2), cosolvents and / or diluents (e.g., dimethyl sulfoxide, dimethylformamide, ethanol, methanol, isopropanol, glycerol, tetrahydrofuran, acetone, acetonitrile, acetic acid, etc.), denaturants (e.g., urea, guanidium hydrochloride, etc.), detergents (sodium dodecyl sulfate and Triton-X100), and / or surfactants (e.g., cationic, anionic, nonionic, and / or zwitterionic surfactants), sugars (e.g., glucose, sucrose, etc.), and combinations thereof.

[0094] If used, such additional components may be used in any amount, amount added, and / or to a preferred concentration that can be readily determined by those skilled in the art. Generally, such components, if used, are typically present in the reaction mixture at concentrations of 1 μM to 1 M, for example, about 1 μM, 10 μM, or 100 μM, about 1 mM, 10 mM, 25 mM, 50 mM, 100 mM, 250 mM, or 500 mM, or about 1 M. In some embodiments, a reducing agent is used in a substoichiometric amount relative to the initial organosilicon compound. If used, the cosolvent may be injected into the reaction mixture in amounts of 1 to 75% (v / v), for example, 1 to 50%, alternatively 1 to 25%, alternatively 1 to 10%, or alternatively 1 to 5%.

[0095] As described above, cytochrome P450 mutants can be used in this method in any form, such as whole cell catalysts, cell lysates, or protein isolates. Alternatively, cytochrome P450 mutants can be used in the form of lyophilized cell lysates, which can be hydrated with deionized water to obtain reconstituted lysates. It will be understood that the reaction mixture may contain a suspension of such cells and / or cellular components. For example, the reaction may be carried out in vivo using intact cells expressing cytochrome P450 mutants, and as a result, in some embodiments, the method involves preparing a suspension of the whole cell catalyst in a suitable medium supplemented with nutrients (e.g., mineral micronutrients, glucose, and other energy sources, cofactors if required for the reaction). As will be understood by those skilled in the art, the yield of organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group can be partially controlled by selecting the cell density in the reaction mixture. For example, in some embodiments, a reaction mixture containing a cell suspension exhibiting an optical density in the range of 0.1 to approximately 50 at 600 nm may be used. However, it will be understood that densities outside this range may also be used, depending, for example, the type of host cell used, the specific cytochrome P450 mutant expressed, etc.

[0096] In certain embodiments, the reaction mixture is pH-adjusted and / or controlled. pH may be monitored, adjusted, and controlled by any method known in the art, and pH adjustment generally involves adding an acid (e.g., HCl), a base (e.g., NaOH), a buffer, or a combination thereof to the reaction mixture itself (i.e., after it is formed) or to one or more of the reactants. For example, in certain embodiments, the cytochrome P450 variant is used in a pH-adjusted and / or controlled composition before being combined with the initial organosilicon compound. Generally, the reaction is carried out at a pH of 7 to about 9, alternatively about 8. For example, in certain embodiments, the reaction mixture is formulated to have a pH of 7.5 to 8.5, e.g., 7.6 to 8.4, alternatively 7.7 to 8.3, alternatively 7.8 to 8.2, alternatively 7.9 to 8.1 (e.g., at formation and / or during the reaction). In certain embodiments, the pH of the reaction mixture is adjusted and / or maintained at a pH of about 8 during the reaction. In light of the description herein, it should be understood that values ​​outside these ranges may also be used, as will be understood by those skilled in the art. For example, in certain embodiments, a specific pH of the reaction mixture is typically adjusted to optimize the activity of the particular cytochrome P450 variant being used and may also be changed during the process (e.g., in real time) to increase / decrease the rate of the oxidation reaction and / or to completely halt the reaction.

[0097] The reactive components can be used in various amounts and / or ratios selected by those skilled in the art.

[0098] Typically, cytochrome P450 variants are used in catalytic amounts, i.e., substoichiometric amounts relative to the initial organosilicon compound. For example, in certain embodiments, cytochrome P450 variants are used in amounts of 0.001–10 mol%, e.g., 0.001–5 mol%, alternatively 0.001–1 mol%, alternatively 0.001–0.5 mol%, alternatively 0.001–0.2 mol%, or alternatively 0.01–0.2 mol%. In these or other embodiments, cytochrome P450 variants may be used in amounts sufficient to provide a reaction mixture having a concentration of at least 0.1 μM of cytochrome P450 variant, e.g., 0.1–10 μM, alternatively 0.1–5 μM, or alternatively 0.1–1 μM. In some embodiments, the cytochrome P450 variant is used in an amount sufficient to provide a reaction mixture having a concentration of 1–15 μM, for example, 1–10 μM, of the cytochrome P450 variant.

[0099] The amount of initial organosilicon compound used in this method is not limited and is selected considering the size / scale of the reaction, the specific species and characteristics of the cytochrome P450 mutant used, and the input amount. Generally, the initial organosilicon compound is used in an amount sufficient to provide a reaction reaction having a concentration of at least 1 mM, for example, 1-50 mM, alternatively 1-25 mM, alternatively 1-15 mM, alternatively 5-15 mM, or alternatively 5-10 mM. However, concentrations outside these ranges may also be used, and those skilled in the art will select a specific amount of initial organosilicon compound considering the reaction parameters used. For example, in some embodiments, the initial organosilicon compound is used considering, for example, the specific silicone-acrylate polymer to be prepared, the specific monomer used, etc.

[0100] This method may utilize any conditions suitable for promoting the catalytic oxidation of the initial organosilicon compound in the reaction mixture, and any techniques, apparatus, or procedures known in the art to achieve such conditions. For example, if the reaction is carried out at a high temperature as described below, the vessel or reactor may be heated or cooled in any suitable manner, for example, via a jacket, mantle, exchanger, bath, coil, etc. Similarly, this method may include stirring the reaction mixture during and / or after formation. Stirring, for example, when combined in the reaction mixture, can promote mixing and contact of the reactants. This method may also include independently using other conditions adjusted to enhance contact with stirring (e.g., simultaneously or continuously) or without stirring (i.e., independently of stirring, instead of stirring). These or other conditions may consequently be effective conditions for increasing the reaction yield of organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group. The conditions may independently be ambient conditions (e.g., room temperature and / or atmospheric pressure) and / or non-ambient parameters (e.g., low or high temperature and / or reduced or high pressure). In addition, reaction parameters may be changed dynamically, in real time (i.e., during the reaction), or statically (e.g., over the duration of the reaction or over any part thereof). For example, temperature, pH, stirring, oxygen content, and other parameters may be independently selected or changed during the reaction.

[0101] Since oxidizing agents such as oxygen are necessary components of oxidation reactions, the reactions are typically carried out under aerobic conditions. However, the reactions can be carried out under inert atmospheres such as nitrogen or argon, as long as the oxidizing agent is introduced into the reaction mixture or otherwise present in the reaction mixture. For example, the oxidizing agent can be introduced by exposing the reaction mixture to the ambient atmosphere, via an oxygen bubbler, or otherwise combined with the reaction mixture. Therefore, it will be understood that the reaction mixture is typically prepared in the presence of oxygen, but can also be prepared under anaerobic conditions and then combined with and / or exposed to oxygen.

[0102] The reaction can be carried out at any temperature compatible with the cytochrome P450 variant. Generally, the reaction is carried out at temperatures between 4°C and 45°C. In some embodiments, the reaction is carried out at high temperatures. The high temperature is selected and controlled depending on the specific reaction component chosen, such as whether the cytochrome P450 variant is provided as an isolated enzyme or in the form of a whole-cell catalyst. Thus, the high temperature will be readily selected by those skilled in the art, taking into account the selected reaction conditions and parameters, as well as the description herein. Typically, the high temperature ranges from above 25°C (ambient temperature) to 45°C, for example, 30–45°C, alternatively 30–40°C, or alternatively 35–40°C.

[0103] The time required for a reaction to prepare an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group is a function of the scale used, reaction parameters and conditions, and the reactants selected. In certain embodiments, the reaction may be carried out for several minutes to several hours, for example, from 5 minutes to 72 hours. However, the components and conditions of the hydrolysis reaction are typically selected to promote hydrolysis during durations of 30 minutes to 48 hours, e.g., 1 to 48 hours, alternatively 4 to 48 hours, or alternatively 4 to 24 hours. However, it should be understood that, in consideration of the description herein, durations outside these ranges / values ​​may also be utilized, as will be understood by those skilled in the art. For example, on a relatively large scale (e.g., more than 1 kg, alternatively more than 5 kg, alternatively more than 10 kg, alternatively more than 50 kg, or alternatively more than 100 kg), or with difficult substrates, the reaction may be carried out for more than one day, e.g., at least 1 day, alternatively at least 2 days, alternatively at least 3 days, or alternatively at least 5 days.

[0104] Generally, the reaction of components in a reaction mixture prepares a reaction product containing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. In particular, throughout the course of the reaction, the reaction mixture involves increasing the amount of organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group that is prepared, and decreasing the amount of the initial organosilicon compound used in the reaction. After the reaction is complete (e.g., the initial organosilicon compound is consumed and no additional amount of organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group is prepared), the reaction mixture may be referred to as a reaction product containing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. Thus, the reaction product typically includes any residual amounts of the reaction components, as well as their decomposition and / or reaction products. For example, if the reaction is carried out in a carrier vehicle, the reaction product includes its solvent / fluid.

[0105] Accordingly, in certain embodiments, the method further includes isolating an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group from the reaction product. As used herein with respect to an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group in the reaction product, the term “isolate” refers to the process of increasing the relative concentration of the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group compared to other compounds combined with it (e.g., in the reaction product or a purified version thereof). Thus, as understood in the art, isolation may include removing other compounds from such combinations (i.e., reducing the amount of impurities in the reaction product combined with the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group), and / or removing the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group itself from the combination. Any suitable technique and / or protocol for isolation may be used. Examples of suitable isolation techniques include centrifugation, distillation, concentration / stripping / evaporation, washing and / or extraction, filtration, partition / phase separation (e.g., based on solubility, freezing point, etc.), and chromatography (e.g., column chromatography, size exclusion chromatography, ion exchange chromatography, affinity chromatography, hydrophobic interaction chromatography, reversed-phase chromatography, etc.). As will be understood by those skilled in the art, any of these techniques may be used in combination with any other techniques (i.e., sequentially) to isolate organosilicon compounds having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0106] It should be understood that isolation may involve, and therefore may be referred to as, purifying an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. However, purifying an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group may involve alternative and / or additional techniques compared to those used in isolating an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. For example, in certain embodiments in which a whole cell catalyst or cell lysate is used, isolating an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group may generally involve extracting the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group from the reaction product, or removing other components (e.g., peptides, biological materials, fats, fibers, oils, carriers, solvents, etc.) from the reaction product to obtain a crude reaction product (which is subsequently purified) containing the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. Regardless of the specific technique selected, the isolation and / or purification of the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group may be carried out in conjunction with the reaction itself (i.e., in line) and therefore automated. In other cases, purification may be a standalone procedure in which a reaction product comprising an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group is provided.

[0107] In certain embodiments, as described above, the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group, prepared according to the present method, is provided as a component of the reaction product or as a purified / isolated form thereof. Such a composition may comprise one or more components in addition to the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group.

[0108] It should be understood that the methods described herein are not limited to any particular use, but rather can be used in any use involving the oxidation of a suitable initial organosilicon compound to a corresponding organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group. For example, in some embodiments, the methods are used to prepare organosilicon compounds as final compounds for a desired end use (e.g., as independent compounds or as components of functional compositions) or as precursors for use in other reactions (e.g., condensation or other such reactions for functionalizing and / or derivatizing other organosilicon compounds).

[0109] The organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group formed by this method is a function of the initial organosilicon compound used. In certain embodiments, at least one silicon-bonded hydrocarbyl group is oxidized in the organosilicon compound prepared by this method to a silanol group. In these or other embodiments, at least one silicon-bonded hydrocarbyl group is oxidized in the organosilicon compound prepared by this method to a silicon-bonded carbinol group. In yet another embodiment, this method oxidizes at least one silicon-bonded hydrocarbyl group of the initial organosilicon compound to a silanol group, and oxidizes at least one silicon-bonded hydrocarbyl group of the initial organosilicon compound to a carbinol group.

[0110] Typically, the silicon-bonded hydrocarbyl group of the initial organosilicon compound and the silicon-bonded carbinol group of the organosilicon compound formed by this method have the same number of carbon atoms. Typically, the oxidation of the silicon-bonded hydrocarbyl group and its conversion to a silicon-bonded carbinol group involves the substitution of carbon-hydrogen bonds into C-OH bonds. Any carbon atom in the silicon-bonded hydrocarbyl group can be oxidized in this method, and the oxidation and conversion are not limited to terminal carbon atoms in the silicon-bonded hydrocarbyl group of the initial organosilicon compound.

[0111] A method for preparing reaction products is also provided. This method includes: preparing a reaction reaction; exposing the reaction reaction to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group and convert it to a functional group to obtain an organosilicon compound having a functional group; and reacting the functional group of the organosilicon compound with a group that reacts with the functional group of the organosilicon compound to prepare a reaction product.

[0112] The functional group of the organosilicon compound is at least one silanol group and / or a silicon-bonded carbinol group. The group that reacts with the functional group of the organosilicon compound can be readily determined by those skilled in the art based on the desired reaction product and its end use. For example, the functional group of an organosilicon compound may be condensed with another functional group of another organosilicon compound, and as a result, the reaction product prepared by this method is a condensation product of organosilicon compounds prepared using the catalyst of the present invention. For example, in one embodiment, the reaction product is formed between two organosilicon compounds, or between an organosilicon compound and another organosilicon compound having a silicon-bonded hydrolyzable group or a hydroxyl group, via a condensation catalyst. In these embodiments, the functional group of the organosilicon compound reacts in the presence of a condensation catalyst.

[0113] The condensation catalyst can be any condensation catalyst typically used to promote the condensation of silicon-bonded hydroxy(silanol) groups to form Si-O-Si bonds. Examples of condensation catalysts include, but are not limited to, amines, metals (e.g., lead, tin, zinc, iron, titanium, zirconium) and organic ligands (e.g., carboxyl, hydrocarbyl, alkoxyl, etc.). In certain embodiments, the condensation catalyst can be selected from tin(II) and tin(IV) compounds such as tin dilaurate, tin dioctoate, dibutyltin dilaurate, dibutyltin diacetate, and tetrabutyltin, as well as titanium compounds such as titanium tetrabutoxide. In these or other embodiments, the condensation catalyst can be selected from zinc-based, iron-based, and zirconium-based catalysts.

[0114] Conventionally, organosilicon compounds having only silicon-bonded hydrocarbyl groups are nonreactive, highly stable, and offer longevity and stability. However, while longevity and stability are desirable properties in many end-use applications, it is also desirable to decompose, remove, or otherwise convert certain organosilicon compounds. Therefore, the method of the present invention converts potentially nonreactive initial organosilicon compounds into organosilicon compounds having functional groups (i.e., silicon-bonded carbinol or silanol groups), enabling their further reactions and uses. As an example, the method of the present invention can be used to extract organosilicon compounds from waste streams or other by-product streams, otherwise the organosilicon compounds must be volatilized or filtered at a significant cost. [Examples]

[0115] The following examples illustrating embodiments of the present disclosure are intended to illustrate the present invention and not to limit it. Unless otherwise noted, all reactions are carried out under aerobic conditions. References to specific mutations in exemplary cytochrome P450 mutants are made using conventional residue identification / numbering, ignoring the initial methionine residue (i.e., M1) shown in the sequence list (i.e., SEQ ID NOs. 1-5).

[0116] material The following examples illustrating embodiments of the present disclosure are intended to illustrate the present invention and not to limit it. Unless otherwise noted, all reactions are carried out under aerobic conditions. References to specific mutations in exemplary cytochrome P450 mutants are made using conventional residue identification / numbering, ignoring the initial methionine residue (i.e., M1) shown in the sequence list.

[0117] Unless otherwise specified, all other solvents, substrates, and reagents are purchased from various commercial suppliers (e.g., Sigma-Aldrich, VWR, Alfa Aesar) or otherwise obtained and used as received (i.e., without further purification).

[0118] Phusion polymerase and DpnI will be purchased from New England Biolabs (NEB, Ipswich, MA).

[0119] The trace metal mixture used in the protein expression protocol is the trace metal mixture described in FWStudier, Protein production by auto-induction in high density shaking cultures, Protein Expr. Purif. 2005, 41, 207-234, and the relevant composition is incorporated herein by reference.

[0120] Biocatalytic reaction analysis was performed using an Agilent 7820A or Agilent 8890 gas chromatograph equipped with a 5977B mass spectrometer detector and a DB-5MS capillary column (30 m long, 0.250 mm diameter, 0.25 μm film thickness, using split-mode capillary implantation and electron collision ionization). Calibration curves were generated using appropriate serial dilutions of materials with 5 mM 1,3,5-trimethoxybenzene or 5 mM D4 as internal standards. Yields were determined by adjusting the calculated product concentration relative to the internal standard, taking into account the dilution factor of the enzymatic reaction extraction.

[0121] Glucose-6-phosphate dehydrogenase (196 U / mg) was dissolved in sodium citrate buffer at pH 7.4 to a final concentration of 196 U / mL. The glucose-6-phosphate dehydrogenase stock was aliquoted into individual PCR tubes in 200 μL portions and rapidly frozen in liquid nitrogen (LN2) or powdered dry ice before use. For biocatalytic reactions, the NADPH cofactor regeneration system stock was dissolved in 14 mM NADP in 100 mM Tris buffer at pH 7. + It was prepared by combining 1.12 M glucose-6-phosphate and 56 U / mL glucose-6-phosphate dehydrogenase (stock concentration).

[0122] Cloning, mutagenesis, and plasmid transformation and isolation Site-saturation mutagenesis (SSM) experiments were performed using primers with degenerate codons (NDT, VHG, TGG) according to the "22-codon trick" known in the art (ACS Synth Biol. 2013, 2, 83-92), and using a modified QuikChange® protocol. The PCR conditions were as follows: Phusion GC buffer 1×, 200 mM dNTPs (each), 0.5 μM forward primer, 0.5 μM reverse primer, and 0.02 U / μL Phusion polymerase. Thermocycling conditions are outlined in Table 1. After completion of PCR, the remaining template was digested with DpnI (1 μL). Then, gel purification was performed using gel electrophoresis (1% agarose gel containing SYBR Gold nucleic acid gel stain), and the DNA was visualized on a blue transmission light system. Next, the DNA was isolated using the Zymoclean DNA gel recovery kit. The purified PCR product was then assembled using the Gibson assembly protocol known in the art (Nature Methods 2009, 6, 343-345).

[0123] [Table 1]

[0124] The cleavage in the ampicillin / carbenicillin cassette was introduced into error-prone PCR, resulting in two skeleton fragments (i.e., pET22(b)+ vector) and one fragment encoding the cleavage enzyme or complete enzyme. Mutations within the full-length fragment were introduced by varying the MnCl2 concentration during PCR amplification. The insertion PCR conditions were as follows: 1X standard Taq buffer, 200 mM dNTPs (each), 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.08 U / μL Taq polymerase, and 200–400 μM MnCl2. After completion of PCR, the remaining template was digested with DpnI (1 μL). The thermocyclization conditions for insertion PCR are outlined in Table 3. The skeleton PCR conditions were as follows: Phusion GC buffer 1×, 5% DMSO, 200 mM dNTPs (each), 0.5 μM forward primer, 0.5 μM reverse primer, and 0.02 U / μL Phusion polymerase. Skeleton fragment 1 (BB1) uses primers Amp_int_forward and NSS007. Skeleton fragment 2 (BB2) uses primers HF1-V2 and Amp_int_reverse. The primer sequences of NSS005, NSS007, HR1-V2, HF1-V2, Amp_int_forward, and Amp_int_reverse are disclosed in Table 2. The thermocyclization conditions for BB1 / BB2 are outlined in Table 4. After completion of PCR, the remaining template was digested with DpnI (1 μL). Gel purification was performed using gel electrophoresis (1% agarose gel containing SYBR Gold nucleic acid gel stain), and DNA was visualized on a blue transmission light system. DNA was isolated using the Zymoclean DNA gel recovery kit. The purified PCR products were then assembled using the Gibson assembly protocol known in the art (Nature Methods 2009, 6, 343-345).

[0125] [Table 2]

[0126] [Table 3]

[0127] [Table 4]

[0128] Recombination via a staggered stretching process Staggered extension process (StEP) PCR was performed using an equimolar recombinant mutant plasmid, with this mixture used as template DNA. StEP PCR was then performed according to standard protocols understood in the art (Nature Biotechnology 1998, 16, 258-261 and Nature Protocols 2006, 1, 1865-1871), by varying the annealing temperature and using shorter extension times. The PCR conditions were as follows: 1× standard Taq buffer, 200 mM dNTPs (each), 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.08 U / μL Taq polymerase. Thermocycling conditions for StEP insert recombination are disclosed in Table 5. Amplification of the recombinant fragments was performed using the Phusion PCR protocol. The PCR conditions were as follows: Phusion GC buffer 1×, 200 mM dNTPs (each), 0.5 μM primer NSS005, 0.5 μM primer HR1-V2, and 0.02 U / μL Phusion polymerase. Thermocycling conditions for amplification of the StEP insert are disclosed in Table 6. After completion of PCR, the remaining template was digested with DpnI (1 μL). The recombinant insert was purified by purified gel electrophoresis (1% agarose gel containing SYBR Gold nucleic acid gel stain), and the DNA was visualized on a blue transmission light system. The recombinant insert library was purified and inserted into the pET22(b)+ vector using Gibson assembly (Nature Methods 2009, 6, 343-345). The BB1 / BB2 fragments were as understood in the art.

[0129] [Table 5]

[0130] [Table 6]

[0131] Transformation and isolation of plasmid / Gibson products T7 Express Competent E. coli cells were used in all experiments. Plasmids were mixed with competent cells in PCR tubes on ice. The mixture was kept on ice for 30 minutes, and then transformed by heat shock treatment of the mixture in a 42°C water bath for exactly 10 seconds. After recovering on ice for 5 minutes, the cells were diluted in SOC medium and plated onto Luria-Bertani agar plates supplemented with carbenicillin (1 mg / mL).

[0132] Plasmids were isolated from stationary-phase cultures using miniprep (Qiagen), and sequencing was performed by Laragen, Inc. (Culver City, CA) using the T7 promoter and HR1-V2 terminator primer.

[0133] Small-scale enzyme screening For small-scale biocatalytic reactions using cell lysates, the reaction vessel was either a 96-well plate constructed from individual snap-cap 2.0 mL microtubes or individual 1.0 mL autosampler necklace shell vials. The 96-well plates of individual shell vials were constructed by inserting 1.0 mL autosampler necklace shell vials into a 96-well microtiter plate, using a USA Scientific 1000 μL pipette tip rack as an alignment guide. After adding all biocatalytic reaction components, the snap-cap vials were sealed by capping them individually. The 96-well shell vial plates were sealed by capping them with an additional 96-well microtiter plate and centrifuged (3000 g, 1 min, 25°C).

[0134] After preparing libraries using single-site saturation mutagenesis (SSM), error-prone PCR (epPCR), or staggered extension process (StEP), 84 single colonies were randomly selected and cultured in 400 mL of LB medium (LBcarb) containing 0.1 mg / mL of carbenicillin in sterile 96-well culture plates. The plates typically consisted of 8 wells inoculated with single colonies expressing the parent enzyme, 2 sterile wells, and Tm9D8 * The cultures contained two wells inoculated with single colonies expressing the gene. The cultures were covered with a microporous film and grown at 37°C, 220 rpm, and 80% relative humidity for 12–16 hours. Another sterile 96-well culture plate was filled with 930 mL of Terrific Broth Medium (TBcarb) containing 0.1 mg / mL of carbenicillin. The TBcarb-containing plate was inoculated with LBcarb preculture (20 mL / well) and incubated at 37°C, 220 rpm, and 80% relative humidity for 3 hours. The plate was then cooled on ice for 30 minutes and induced with 0.5 mM IPTG, 1 mM ALA, and X FeCl3 / trace metal master mix (final concentration), and then expressed at 22°C and 220 rpm for 16–22 hours. After expression, cells were pelleted by centrifugation (4500 g, 15 min, 4°C), and the supernatant was discarded. The pelletized cells were sealed in airtight foil and stored in a -20°C freezer for at least 16 hours before thawing.

[0135] A 96-well plate containing frozen cell cultures was thawed at 25°C for 10 minutes. The pelleted cells were then resuspended in a lysis buffer (400 μL / well) containing 1 mg / mL lysozyme, 0.07 mg / mL DNAse, and 2 mM MgCl2. The cells were then lysed at 37°C and 160 rpm for 1 hour. The cell debris was then pelleted by centrifugation (4500 g, 15 min, 4°C). The biocatalytic reaction vessel was then filled with an NADPH cofactor regeneration system (12.5 μL / vessel) or NADPH (12.5 μL / vessel) to obtain final reaction concentrations of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock was prepared by dissolving the appropriate substrate in the specified cosolvent. Next, the cell lysate was added to the reaction vessel (325 μL / reaction), followed by the substrate (12.5 μL / reaction) to obtain a final concentration of 10 mM substrate. Immediately after adding the substrate, the reaction vessel was sealed and shaken at 800 rpm for 4 hours at 25°C. After 4 hours of reaction, the reaction vessel was opened and 5 mM 1,3,5-trimethoxybenzene or 5 mM D4 in ethyl acetate was rapidly added (400-450 μL / well). The organic and aqueous phases were mixed using a vortex mixer (microtube) or by pipetting the mixture up and down with a multichannel pipette. Phase separation in the microtube was accelerated by centrifugation at 14,000 g and 4°C for 15 minutes. The 96-well shell vial plate was sealed with sealing foil and centrifuged at 4,000 g and 4°C for 15 minutes. Next, aliquots of the organic phase (200 μL / reaction) were transferred to individual 400 μL flat-bottom glass inserts in 2 mL screw-cap vials sealed with red sil septum screw caps. Analysis was performed using GC / MS, and the product concentration and yield were determined by the response to a 1,3,5-trimethoxybenzene internal standard using a calibration curve.

[0136] Determination of heme protein concentration Heme protein concentrations were determined for purified protein and cell lysates by performing a CO-binding assay. Heme protein solution was added to clear plastic flat-bottom 96-well plates (180 μL / well) with 3–6 replicas per protein. Then, a 300 mM sodium dithionite solution in 1 M pH 8 potassium phosphate buffer (20 μL / well) was added to each well. Absorbance was then measured at 450 nm and 490 nm using a multimode microplate reader. The well plates were then placed in a CO chamber. The atmosphere in the chamber was evacuated using a vacuum pump, and the chamber was refilled with CO to atmospheric pressure. The well plates were incubated in the CO atmosphere for 30 minutes, and then measured again at 450 nm and 490 nm using a microplate reader. Baer's Law was used to determine the heme protein concentration in the solution, using a ΔA of 450-490, an ε450-490 value of 0.091, a dilution factor of 1.1, and a path length of 0.74 cm between the CO-bound and reduced samples.

[0137] Protein purification procedure For purification, the cell pellet was frozen at -20°C for at least 24 hours. The cells were thawed and resuspended in binding buffer (20 mM Tris-HCl, 100 mM sodium chloride, 20 mM imidazole, pH 7.0, approximately 5 mL / g of moist cells) and lysed by sonication (QSonica Q500 sonicator, 25% amplitude, 33% duty cycle, 2 min). The lysate was clarified by centrifugation (4500 g, 10 min) and subsequently filtered (0.20 μm syringe filter). The protein was purified by elution with a gradient of 20–500 mM imidazole using a purification apparatus equipped with an HP column. The fraction containing the target protein was pooled. The fraction containing the purified enzyme was pooled and concentrated by repeated centrifugation and dilution in Tris-buffer (0.1 m, pH 7) in an ultracentrifugation filter (10 kDa molecular weight cutoff). The proteins were concentrated to a final concentration of 5–100 μM (as defined below). The concentrated proteins were divided into aliquots (50–100 μL), rapidly frozen on powdered dry ice, and stored at -80°C. Protein concentration was determined by a CO-binding assay.

[0138] Preparation Example X1: Small-scale enzyme reaction for systematic verification Enzyme activity was verified as follows: Escherichia coli transformed with the pET22b(+) construct encoding P450 was grown in 5 mL of LBcarb medium at 37°C and 220 rpm for 16–20 hours. Subsequently, 0.5 mL of this pre-culture was inoculated into 50 mL of TBcarb medium in a sterile 125 mL Erlenmeyer flask covered with sterile aluminum foil. The culture was incubated at 37°C and shaken at 220 rpm for approximately 2–4 hours until the optical cell density (OD600) at 600 nm was 0.7–0.9. The expression culture was then cooled in an ice bath for 30 minutes and induced with 0.5 mM IPTG, 1 mM ALA, and 3.5 μM FeCl3 / trace metal master mix (final concentration), followed by expression at 22°C and 220 rpm for 16–22 hours. After expression, the culture was transferred to a tare-weighted 50 mL Falcon tube and pelletized by centrifugation (4500 g, 15 minutes, 4°C), with the supernatant discarded. The pelletized cells were stored in a -20°C freezer for at least 16 hours before lysis in a sealed Falcon tube.

[0139] Falcon tubes containing frozen cell cultures were thawed at 25°C for 10 minutes. The pelleted cells were then resuspended in lysis buffer (4 mL / 1 g pellet) containing 1 mg / mL lysozyme, 0.07 mg / mL DNAse, and 2 mM MgCl2. The cells were then lysed at 37°C and 180 rpm for 1 hour. The lysed culture was then transferred to a 2.0 mL microcentrifuge tube and centrifuged at 14000 g and 4°C for 15 minutes. The supernatant lysate was reconstituted in a 15 mL Falcon tube. NADPH cofactor regeneration system (12.5 μL / container) or NADPH (12.5 μL / container) was then added to a 2.0 mL microcentrifuge tube to obtain final reaction concentrations of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock was prepared by dissolving the appropriate substrate in the specified co-solvent. The cell lysate was then added to the reaction vessel (325 μL / reaction), followed by the substrate (12.5 μL / well) to obtain a final substrate concentration of 10 mM. Immediately after substrate addition, the microtube was sealed and shaken at 800 rpm for 4 hours at 25°C. After 4 hours, the reaction vessel was opened and 5 mM 1,3,5-trimethoxybenzene in ethyl acetate was rapidly added (400-450 μL / reaction). The organic and aqueous phases were mixed using a vortex mixer. Phase separation was accelerated by centrifugation at 14,000 g and 4°C for 15 minutes. Aliquots of the organic phase (200 μL / reaction) were then transferred to individual 400 μL flat-bottom glass inserts in 2 mL screw-cap vials sealed with red sil septum screw caps. Analysis was performed using GC / MS, and product concentration and yield were determined by the response to a 1,3,5-trimethoxybenzene internal standard using a calibration curve. Superior mutants for subsequent mutagenesis were selected by comparing the product yield with the product yield relative to the putative protein concentration. Heme protein concentration was determined by performing a CO-binding assay on cell lysates.

[0140] Preparation Example X2: Verification of the evolutionary lineage from LSilOx4 to LSilOx5 Unvalidated LBcarb cultures (80 mL / well) with improved activity, identified from an LSilOx4 error-prone PCR library, were inoculated in four separate batches into 24-well plates containing 3.75 mL of TBcarb. In each plate, four wells were used as sterile controls, and two wells were used for TM9D8. * Four wells were used for the parent enzyme, LSILOX4, as a negative control. The cultures were covered with a microporous film and grown at 37°C, 205 rpm, and 80% relative humidity for 3 hours. The plates were then cooled on ice for 30 minutes and induced with 0.5 mM IPTG, 1 mM ALA, and 3.5 μM FeCl3 / trace metal master mix, followed by expression at 22°C and 205 rpm for 16–22 hours. After expression, cells were pelleted by centrifugation (4500 g, 15 min, 4°C), and the supernatant was discarded. The pelleted cells were sealed in airtight foil and stored in a freezer at -20°C for at least 16 hours before lysis.

[0141] A 24-well plate containing frozen cell cultures was thawed at 25°C for 10 minutes. The pelleted cells were then resuspended in a lysis buffer (1.1 mL / well) containing 1 mg / mL lysozyme, 0.07 mg / mL DNAse, and 2 mM MgCl2. The cells were then lysed at 37°C and 135 rpm for 1 hour. The cell debris was then pelleted by centrifugation (4500 g, 15 min, 4°C). A 2.0 mL microtube was then filled with an NADPH cofactor regeneration system (25 mL / reaction) to obtain final reaction concentrations of 0.5 mM NADP+, 40 mM glucose-6-phosphate, and 2 U / mL glucose-6-phosphate dehydrogenase or 10 mM NADPH. A 280 mM substrate stock was prepared by dissolving L3 in ethanol. Next, the cell lysate was added to the reaction vessel (650 mL / reaction), followed by the substrate (25 mL / reaction) to obtain a final substrate concentration of 10 mM. Immediately after adding the substrate, the reaction vessel was sealed and shaken at 800 rpm for 4 hours at 25°C. After 4 hours of reaction, the reaction vessel was opened and 5 mM 1,3,5-trimethoxybenzene in ethyl acetate was rapidly added (800 mL / reaction). The organic and aqueous phases were mixed using a vortex mixer. Phase separation in the microtubes was accelerated by centrifugation at 14,000 g and 4°C for 15 minutes. Then, aliquots of the organic phase (200 mL / reaction) were transferred to individual 400 mL flat-bottom glass inserts in 2 mL screw-cap vials sealed with red sil septum screw caps. Analysis was performed using GC / MS, and the product concentration and yield were determined by the response to the 1,3,5-trimethoxybenzene internal standard using a calibration curve.

[0142] Preparation Example X3: Small-scale enzymatic reaction using purified protein NADPH (12.5 μL / container) was added to a 2.0 mL microcentrifuge tube to obtain a final reaction concentration of 10 mM NADPH. A 320 mM substrate stock was prepared by dissolving the appropriate substrate in 200 proof ethanol. A total of 375 μL of purified protein and buffer was added to the reaction vessel to obtain a final protein concentration of 5 μM, followed by the addition of substrate (12.5 μL / well) to obtain a final substrate concentration of 10 mM. Immediately after adding the substrate, the microcentrifuge tube was sealed and shaken at 800 rpm for 4 hours at 25°C. After 4 hours of reaction, the reaction vessel was opened and 5 mM D4 in ethyl acetate was rapidly added (400 μL / reaction). The organic and aqueous phases were mixed using a vortex mixer. Phase separation was accelerated by centrifugation at 14,000 g and 4°C for 15 minutes. Next, aliquots of the organic phase (200 μL / reaction) were transferred to individual 400 μL flat-bottom glass inserts in 2 mL screw-cap vials sealed with red sil septum screw caps. Analysis was performed using GC / MS, and product concentration and yield were determined by the response to a D4 internal standard using a calibration curve.

[0143] [Table 7]

[0144] The reaction conditions are as described in Preparation Example X3: 10 mM L2, purified P450BM3 mutant, 10 mM NADPH, 100 mM Tris buffer at pH 7, 3.6% EtOH, 25°C, 4 hours, aerobic.

[0145] Hexamethyldisiloxane system reaction

[0146] [ka]

[0147] [Table 8]

[0148] The reaction conditions are as described in Preparation Example X2: 10 mM L3, P450BM3 mutant in lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate dehydrogenase, 0.5 mM NADP+, 100 mM Tris buffer at pH 7, 3.6% EtOH, 25°C, 4 hours, aerobic.

[0149] Octamethyltrisiloxane system reaction

[0150] [ka]

[0151] [Table 9]

[0152] The reaction conditions were as described in Preparation Example X1: 10 mM D4, P450BM3 mutant in lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate dehydrogenase, 0.5 mM NADP+, 100 mM Tris buffer at pH 7, 3.6% EtOH, 25°C, 4 hours, aerobic.

[0153] Octamethycyclotetrasiloxane strain verification reaction

[0154] [ka]

[0155] [Table 10]

[0156] The reaction conditions are as described in Preparation Example X3: 10 mM L2, 5 μM purified P450BM3 mutant or control, 10 mM NADPH, 100 mM Tris buffer at pH 7, 3.6% EtOH, 25°C, 4 hours, aerobic.

[0157] Hexamethyldisiloxane Brook rearrangement

[0158] [ka]

[0159] [Table 11]

[0160] The reaction conditions are as described in Preparation Example X3: 10 mM L2, 5 μM purified P450BM3 mutant or control, 10 mM NADPH, 100 mM Tris buffer at pH 7, 3.6% EtOH, 25°C, 4 hours, aerobic.

[0161] MM CH2OH Brook rearrangement reaction using

[0162] [ka]

[0163] [Table 12]

[0164] The reaction conditions are as described in Preparation Example X1: 10 mM L3, P450BM3 mutant in lysate, 40 mM glucose-6-phosphate, 2 U / mL glucose-6-phosphate dehydrogenase, 0.5 mM NADP+, 100 mM Tris buffer at pH 7, 3.6% co-solvent or an equal volume of co-solvent-free buffer, 25°C, 4 hours, aerobic.

[0165] Cosolvent-promoting enzyme reaction

[0166] [ka]

[0167] [Table 13]

[0168] DNA sequence of LSilOx1 [SEQ ID NO: 1]

[0169] LSilOx2 DNA sequence [SEQ ID NO: 2]

[0170] DNA sequence of LSilOx3 [SEQ ID NO: 3]

[0171] DNA sequence of LSilOx4 [SEQ ID NO: 4]

[0172] DNA sequence of LSilOx5 [SEQ ID NO: 5]

[0173] DNA sequence of LSilOx6 [SEQ ID NO: 6]

[0174] DNA sequence of LSilOx7 [SEQ ID NO: 7]

[0175] DNA sequence of CSilOx1 [SEQ ID NO: 8]

[0176] DNA sequence of CSilOx2 [SEQ ID NO: 9]

[0177] DNA sequence of CSilOx3 [SEQ ID NO: 10]

[0178] DNA sequence of NSS005 [SEQ ID NO: 11] AACTTTAAGAAGGAGATATACATATGACAATTAAAGAAATGCCTCAGCCA

[0179] DNA sequence of NSS007 [SEQ ID NO: 12] TGGCTGAGGCATTTCTTTAATTGTCATATGTATATCTCCTTCTTAAAGTT

[0180] DNA sequence of HR1-V2 [SEQ ID NO: 13] CTTTTTTAGCAGACTGTTCAGTGCTAGGTGAAGGAATACC

[0181] DNA sequence of HF1-V2 [SEQ ID NO: 14] GGTATTCCTTCACCTAGCACTGAACAGTCTGCTAAAAAAG

[0182] DNA sequence of Amp_int_forward [SEQ ID NO: 15] GCTAACCGCTTTTTTGCACAACATG

[0183] DNA sequence of Amp_int_reverse [SEQ ID NO: 16] TTGTGCAAAAAAGCGGTTAGCTCC

Claims

1. A method for preparing an organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group, The reaction is prepared by combining a cytochrome P450 mutant that promotes the oxidation of silicon-bonded hydrocarbyl groups to silicon-bonded carbinol or silanol groups in the presence of an oxidizing agent, an initial organosilicon compound having at least one silicon-bonded hydrocarbyl group, and a cofactor. A method comprising: exposing the reaction mixture to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group and convert it to a silicon-bonded carbinol group or a silicon-bonded silanol group, thereby preparing the organosilicon compound having at least one silicon-bonded carbinol group and / or at least one silanol group.

2. The method according to claim 1, wherein the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO: 1 or a conservatively modified variant thereof.

3. The method according to claim 1, wherein the cytochrome P450 variant comprises the nucleic acid sequence of SEQ ID NO: 1, or a conservatively modified variant thereof having at least one mutation from T328, A329, D35, I123, G253, F329, F166, Y52, V185, N96, D215, T439, S73, G86, or R48 to the nucleic acid sequence of SEQ ID NO:

1.

4. The method according to claim 3, wherein the cytochrome P450 variant includes (i) the T328M mutation, (ii) the A329F mutation, (iii) the D35G mutation, (iv) the I123T mutation, (v) the G253E mutation, (vi) the F329S mutation, (v) the F166L mutation, (vi) the Y52V mutation, (vii) the V185M mutation, (viiii) the N96S mutation, (ix) the D215G mutation, (x) the T439S mutation, (xi) the S73G mutation, (xi) the G86A mutation, (xiiii) the R48G mutation, or any combination of (xiv)(i) to (xiiii) for the nucleic acid sequence of SEQ ID NO:

1.

5. (i) The cytochrome P450 variant includes the nucleic acid sequence of SEQ ID NO: 2 or a conservatively modified variant thereof, or (ii) The cytochrome P450 variant includes the nucleic acid sequence of SEQ ID NO: 3 or a conservatively modified variant thereof, or (iii) The cytochrome P450 variant includes the nucleic acid sequence of SEQ ID NO: 4 or a conservatively modified variant thereof, or (iv) The cytochrome P450 variant includes the nucleic acid sequence of SEQ ID NO: 5 or a conservatively modified variant thereof, or (v) The cytochrome P450 variant includes the nucleic acid sequence of SEQ ID NO: 6 or The method according to claim 1, comprising the conservatively modified variant, or (vi) the cytochrome P450 variant comprising the nucleic acid sequence of SEQ ID NO: 7 or a conservatively modified variant thereof, or (vii) the cytochrome P450 variant comprising the nucleic acid sequence of SEQ ID NO: 8 or a conservatively modified variant thereof, or (viiii) the cytochrome P450 variant comprising the nucleic acid sequence of SEQ ID NO: 9 or a conservatively modified variant thereof, or (ix) the cytochrome P450 variant comprising the nucleic acid sequence of SEQ ID NO: 10 or a conservatively modified variant thereof.

5. The method according to any one of claims 1 to 4, wherein the cytochrome P450 mutant comprises a non-natural heme cofactor.

6. The method according to any one of claims 1 to 5, wherein the preparation of the reaction mixture comprises combining the initial organosilicon compound with a host cell or non-human organism expressing the cytochrome P450 variant, its lysate, its purified protein, or its lyophilized form.

7. The method according to claim 6, wherein the host cell or non-human organism is further defined as an Escherichia coli cell.

8. The method according to any one of claims 1 to 7, wherein the initial organosilicon compound does not contain a silicon-bonded carbinol group.

9. The initial organosilicon compound has general formula (I), (II), or (III), (R) １ ２ SiO ２／２ ) ｎ (I) R １ ３ Si(O-SiR １ ２ ) ｍ R １ (II) R １ ３ Si-(D-SiR １ ２ ) ｍ R １ (III) In the formula, each R １ However, R is an independently selected unsubstituted hydrocarbyl group or H, provided that R １ The method according to any one of claims 1 to 8, wherein at least one of the groups is a hydrocarbyl group, the subscript n is 3 to 8, the subscript m is 0 to 15, and each D is an independently selected divalent linking group.

10. Each R １ However, independently selected from alkyl groups, alkenyl groups, aryl groups, and hydrogen, provided that at least one R １ The method according to claim 9, wherein the group is an alkyl group, an alkenyl group, or an aryl group.

11. The method according to any one of claims 1 to 10, wherein the reaction mixture further comprises (i) a carrier vehicle, (ii) a buffer solution, or (iii) both the carrier vehicle and the buffer solution.

12. A method for preparing a reaction product, The reaction is prepared by combining a cytochrome P450 mutant that promotes the oxidation of silicon-bonded hydrocarbyl groups to a functional group selected from silicon-bonded carbinol or silanol groups in the presence of an oxidizing agent, with an initial organosilicon compound having at least one silicon-bonded hydrocarbyl group. The reaction mixture is exposed to an oxidizing agent to oxidize the silicon-bonded hydrocarbyl group, convert it to the functional group, and obtain an organosilicon compound having the functional group. A method comprising reacting the functional group of the organosilicon compound with a group that reacts with the functional group of the organosilicon compound, thereby preparing the reaction product.

Images