Tobacco plants with reduced levels of nicotinic alkaloids

Genetic modifications in tobacco plants, utilizing alleles like nic1, nic2, and myc2a, achieve low nicotine levels, addressing addiction concerns and toxin exposure by producing commercially viable tobacco varieties with reduced alkaloid content.

JP2026524832APending Publication Date: 2026-07-24NORTH CAROLINA STATE UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
JP · JP
Patent Type
Applications
Current Assignee / Owner
NORTH CAROLINA STATE UNIV
Filing Date
2024-06-12
Publication Date
2026-07-24

AI Technical Summary

Technical Problem

Developing tobacco varieties that exhibit ultra-low levels of nicotine accumulation has been historically challenging, necessitating genetic methodologies to produce novel tobacco varieties with reduced nicotine levels to address addiction concerns and reduce human exposure to tobacco smoke toxins.

Method used

Tobacco plants with reduced nicotine alkaloid content are produced through genetic modifications, including the use of alleles such as nic1, nic2, and myc2a with reduced expression and/or function, and suppression of specific gene expressions, utilizing methods like CRISPR/Cas9 to achieve low concentrations of nicotine, nornicotine, anatabine, and anabasine.

Benefits of technology

The resulting tobacco plants have significantly lower nicotine and related alkaloid levels, providing a commercially valuable alternative to current varieties and reducing the risk of addiction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure 2026524832000001
    Figure 2026524832000001
  • Figure 2026524832000002
    Figure 2026524832000002
  • Figure 2026524832000003
    Figure 2026524832000003
Patent Text Reader

Abstract

This disclosure provides compositions and methods relating to tobacco plants. In particular, this disclosure provides novel methods for producing tobacco plants with low nicotinic alkaloid content and any related tobacco products. Tobacco plants produced according to the methods of this disclosure have reduced levels of nicotinic alkaloids (e.g., nicotine) compared to both naturally occurring tobacco plants and transgenic tobacco plants, and therefore represent a commercially valuable alternative to currently available tobacco varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] Cross - Reference to Related Applications This application claims priority and benefit under 35 U.S.C. § 119(e) to U.S. Provisional Patent Application No. 63 / 508,735, filed on Jun. 16, 2023, which is hereby incorporated by reference in its entirety for all purposes.

[0002] Incorporation by Reference of Electronically Submitted Materials A computer - readable nucleotide / amino acid sequence listing, submitted herewith and identified as follows, is hereby incorporated by reference in its entirety: one 4,741 - byte Byte ASCII (text) file named "NCSU - 42104 - 601", created on Jun. 12, 2024.

[0003] The present disclosure provides compositions and methods related to tobacco plants. In particular, the present disclosure provides tobacco plants with a reduced nicotine - alkaloid content and novel methods for producing any related tobacco products. Tobacco plants produced according to the methods of the present disclosure have a reduced concentration of nicotine - alkaloids (e.g., nicotine) compared to both naturally occurring and transgenic tobacco plants, and thus represent a commercially valuable alternative to currently available tobacco varieties.

Background Art

[0004] Nicotine is the most abundant pyridine alkaloid, typically produced by tobacco (Nicotiana tabacum L.), but in some plants, nornicotine (its demethylated metabolite) may be more abundant due to increased gene activity encoding the nicotine demethylase enzyme. Because nicotine contributes to the addiction to combustible cigarettes, some public health agencies are recommending research to forcibly lower nicotine levels in these combustible cigarettes in the future to reduce human exposure to toxins associated with tobacco smoke (U.S. Food and Drug Administration, 2018). Nicotine levels in cigarette leaves: 0.4 mg g -1 The World Health Organization (WHO) recommends reducing nicotine levels to the following non-addictive levels (WHO, 2015). The U.S. Food and Drug Administration's Center for Tobacco Products suggests that exposure to smoke only from combustible tobacco containing tobacco leaves in the range of 0.2–0.7 mg of nicotine per cigarette may be associated with a reduced likelihood of addiction (USFDA, 2018). Historically, developing tobacco varieties that routinely exhibit such ultra-low levels of leaf nicotine accumulation has been challenging. Therefore, there is a need for genetic methodologies that can be used to develop novel tobacco varieties that accumulate nicotine below the proposed tolerance levels. [Overview of the Initiative]

[0005] Embodiments of the present disclosure include tobacco varieties, or any part thereof, that contain at least one nicotinic alkaloid at a reduced concentration compared to the corresponding naturally occurring tobacco plant, or a part thereof.

[0006] In some embodiments, the varieties are non-transgenic.

[0007] In some embodiments, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine.

[0008] In some embodiments, at least one nicotinic alkaloid is nicotine, and the variety contains 0.29% or less nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine. In some embodiments, nornicotine is undetectable in the variety. In some embodiments, at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less anatabine. In some embodiments, anatabine is undetectable in the variety. In some embodiments, at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less anabasine. In some embodiments, anabasine is undetectable in the variety.

[0009] In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.29% or less nicotine and 0.02% or less nornicotine.

[0010] In some embodiments, the variety includes a nic1 allele with reduced expression and / or function compared to wild-type NIC1. In some embodiments, the variety includes a nic2 allele with reduced expression and / or function compared to wild-type NIC2. In some embodiments, the nic1 and / or nic2 alleles are derived from at least one of the following tobacco varieties or strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21.

[0011] In some embodiments, the variety contains a myc2a allele with reduced expression and / or function compared to wild-type MYC2a. In some embodiments, the myc2a allele contains at least one nucleotide deletion compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the myc2a allele contains 1 to 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the myc2a allele contains 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the deletions produce a cleaved MYC2A protein. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele is derived from N. tabacum.

[0012] In some embodiments, the varieties further include suppression of expression in at least one of the following varieties: BBL (also known as NBB1), A622, quinolate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), ornithine decarboxylase (ODC), aspartate oxidase (AO), quinolinic acid synthase (QS), N-methylputrescine oxidase (MPO), NtERF221, NtMYC1a, NtMYC1b, or NtMYC2b.

[0013] In some embodiments, the variety is the NCLA161 variety or derived therefrom.

[0014] Embodiments of this disclosure also include offspring plants, seeds, or cells produced from any of the tobacco varieties described herein.

[0015] Embodiments of this disclosure also include tobacco products derived from any of the tobacco varieties or parts thereof described herein. In some embodiments, the product is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snuff, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco. In some embodiments, the product is selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco products, cigars, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.

[0016] Embodiments of this disclosure also include methods for producing tobacco varieties containing at least one nicotinic alkaloid at a reduced concentration compared to the corresponding naturally occurring tobacco plant or a portion thereof. According to these embodiments, the method includes crossing a first tobacco variety containing a first low-nicotine trait with a second tobacco variety containing a second low-nicotine trait to produce offspring plants. In some embodiments, the offspring plants contain at least one nicotinic alkaloid at a reduced concentration compared to either parent plant.

[0017] In some embodiments, the method includes backcrossing.

[0018] In some embodiments of the method, at least one nicotinic alkaloid is nicotine, and the variety contains 0.29% or less nicotine. In some embodiments of the method, at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine. In some embodiments of the method, nornicotine is undetectable in the variety. In some embodiments of the method, at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less anatabine. In some embodiments of the method, anatabine is undetectable in the variety. In some embodiments of the method, at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less anabasine. In some embodiments of the method, anabasine is undetectable in the variety.

[0019] In some embodiments of the method, the first and / or second low-nicotine trait comprises a nic1 allele with reduced expression and / or function compared to wild-type NIC1. In some embodiments of the method, the first and / or second low-nicotine trait comprises a nic2 allele with reduced expression and / or function compared to wild-type NIC2. In some embodiments of the method, the first and / or second tobacco variety comprises a nic1 and / or nic2 allele derived from at least one of the following tobacco varieties or strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21.

[0020] In some embodiments of the method, the first and / or second tobacco variants contain a myc2a allele with reduced expression and / or function compared to wild-type MYC2a. In some embodiments of the method, the myc2a allele contains at least one nucleotide deletion compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments of the method, the myc2a allele contains 1 to 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments of the method, the myc2a allele contains 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments of the method, the deletions produce a cleaved MYC2A protein. In some embodiments of the method, the myc2a allele contains a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 2. In some embodiments of the method, the myc2a allele contains a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 2. In some embodiments of the method, the myc2a allele contains a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments of the method, the myc2a allele is derived from N. tabacum.

[0021] In some embodiments of the method, the first low-nicotine trait comprises nic1 and / or nic2 alleles with reduced expression and / or function compared to wild-type NIC1 and / or NIC2, and the second low-nicotine trait comprises myc2a alleles with reduced expression and / or function compared to wild-type MYC2a.

[0022] In some embodiments of the method, the first tobacco variety, the second tobacco variety, and the offspring plants are non-transgenic.

[0023] Embodiments of this disclosure also include seeds or cells obtained from offspring plants produced according to any of the methods described herein.

[0024] Embodiments of the present disclosure also include tobacco products derived from progeny plants produced according to any of the methods described herein. In some embodiments, the product is selected from the group consisting of leaf tobacco, cut tobacco, shredded tobacco, ground tobacco, powdered tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snus, pipe tobacco, cigarettes, cigarillos, cigars, chewing tobacco. In some embodiments, the product is selected from the group consisting of cigarillos, cigarettes, kretek cigarettes, filtered cigarettes, self-made rolled cigarettes, hand-rolled cigarettes, sticks or pods for heated tobacco, cigars, tobacco-containing gums, tobacco-containing lozenges, and chewing tobacco.

[0025] Embodiments of the present disclosure also include methods for producing Nicotiana tabacum plants with reduced nicotine alkaloid content. According to these embodiments, the method involves combining, in a Nicotiana tabacum plant, (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) the recessive allele of nic1 and / or the recessive allele of nic2. In some embodiments, the Nicotiana tabacum plant has a reduced nicotine alkaloid content compared to a corresponding, naturally occurring, or untransformed control tobacco plant.

[0026] In some embodiments of the method, the Nicotiana tabacum plant includes the homozygous recessive allele of nic1 and / or the homozygous recessive allele of nic2.

[0027] In some embodiments of the method, the one or more genetic recombinations that reduce the expression and / or function of MYC2A are introduced by transcription activator-like effector nuclease (TALEN), meganuclease, zinc finger nuclease, CRISPR / Cas9 system, CRISPR / Cpf1 system, CRISPR / Csm1 system, gene knock-in technology or science and technology, or any combination thereof.

[0028] In some embodiments, the method further comprises suppressing expression in at least one Nicotiana tabacum plant of BBL (also known as NBB1), A622, quinolinate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), ornithine decarboxylase (ODC), aspartate oxidase (AO), quinolinate synthase (QS), N-methylputrescine oxidase (MPO), NtERF221, NtMYC1a, NtMYC1b, or NtMYC2b. In some embodiments, the variety is the NCLA161 variety or is derived therefrom.

[0029] Embodiments of the present disclosure also include Nicotiana tabacum plants produced by any of the methods described herein. In some embodiments of the method, the plant comprises (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

[0030] Embodiments of the present disclosure also include progeny plants or seeds produced from any of the plants described herein. In some embodiments, the progeny plants or seeds comprise (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

[0031] Embodiments of the present disclosure also include tobacco products comprising tobacco derived from any of the Nicotiana tabacum plants described herein. In some embodiments, the plant comprises (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

[0032] In some embodiments, tobacco is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snuff, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco. In some embodiments, the product is a nicotine-reduced tobacco product selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco, cigars, snuff, snuff, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco. [Modes for carrying out the invention]

[0033] Embodiments of the present disclosure include novel methods for producing tobacco plants with low nicotinic alkaloid content and any related tobacco products. Tobacco plants produced according to the methods of the present disclosure have lower concentrations of nicotinic alkaloids, including nicotine, nornicotine, anatabine, and anabasine, compared to both naturally occurring tobacco plants and transgenic tobacco plants, and therefore represent a commercially valuable alternative to currently available tobacco varieties.

[0034] The section headings used in this section and throughout the disclosure herein are for structural purposes only and are not intended to limit the scope of the information.

[0035] 1.Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art. In case of any conflict, including definitions, this document shall prevail. Preferred methods and materials are described below, but similar or equivalent methods and materials described herein may also be used in the practice or testing of this disclosure. All publications, patent applications, patents, and other references referenced herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative and not intended to limit the scope of this disclosure.

[0036] The term “approximately” is as understood by those skilled in the art and will vary to some extent depending on the context in which the word is used. Where there is use of an item that is not obvious to those skilled in the art, “approximately” will mean plus or minus 10% of the particular item, taking into account the context in which the item is used. For example, in some embodiments, “approximately” means plus or minus 5% of a particular term. Certain ranges are indicated herein by the number preceding the term “approximately.” The term “approximately” is used herein to give a literal indication of the exact number preceding the word, as well as a number that is close to or approximates the number preceding the word. When determining whether a number is close to or approximates a specifically enumerated number, the close or approximate, unenumerated number may be a number that, in the context in which the number is indicated, gives a substantial equivalent to the specifically enumerated number.

[0037] The terms “comprise,” “include,” “having,” “has,” “can,” “contain,” and their variations as used herein are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms “a,” “and,” and “the” include multiple referents unless otherwise clearly indicated in the context. This disclosure also considers other embodiments that “include,” “consist of,” and “essentially consist of,” the embodiments or elements described herein, whether expressly described or not.

[0038] In this specification, when describing numerical ranges, each intervening value having a similar degree of precision within that range is explicitly intended. For example, for the range 6 to 9, the digits 7 and 8 are intended in addition to 6 and 9, and for the range 6.0 to 7.0, the digits 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly intended.

[0039] As used herein, the term “nucleic acid molecule” refers to any nucleic acid-containing molecule, including but not limited to DNA or RNA. This term refers to, but not limited to, four acetylcytosine, 8-hydroxy-N6-methyladenosine, aziridinylcytosine, pseudoisocytosine, 5-(carboxyhydroxylmethyl)uracil, 5-fluorouracil, 5-bromouracil, 5-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl-aminomethyluracil, dihydrouracil, inosine, N6-isopentenyladenine, 1-methyladenine, 1-methylpseuduracil, 1-methylguanine, 1-methylirinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguadene, 3-methylcytosine, 5-methylisocytosine, N6-methyladenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl The sequence includes any known DNA and RNA base analogs, including 2-2-thiouracil, β-D-mannoylqueosine, 5'-methoxycarbonylmethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetate methyl ester, uracil-5-oxyacetic acid, oxybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, N-uracil-5-oxyacetate methyl ester, uracil-5-oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, and 2,6-diaminopurine.

[0040] The term “gene” refers to a nucleic acid (e.g., DNA) sequence containing a coding sequence for the production of polypeptides, precursors, or RNA (e.g., rRNA, tRNA, sRNA, microRNA, lincRNA). Polypeptides may be coded by the full-length coding sequence or by any portion of the coding sequence, as long as the desired activity or functional properties (e.g., enzymatic activity, ligand binding, signaling, immunogenicity, etc.) of the full-length or fragment are preserved. The term also encompasses the coding region of a structural gene and sequences located adjacent to the coding region at both the 5' and 3' ends, at a distance of approximately 1 kb or more at either end, such that the gene corresponds to the length of full-length mRNA. Sequences located on the 5' side of the coding region and present on mRNA are referred to as the 5' untranslated sequence. Sequences located on the 3' side or downstream of the coding region and present on mRNA are referred to as the 3' untranslated sequence. The term “gene” encompasses both the cDNA and genomic forms of genes. The genome type or clone of a gene contains a coding region interrupted by a non-coding sequence, which is called an “intron,” “intervening region,” or “intervening sequence.” An intron is a segment of a gene that is transcribed into nuclear RNA (hnRNA), and introns may contain regulatory elements such as enhancers. Introns are not present in messenger RNA (mRNA) transcripts because they are removed from the nucleus or primary transcript or “spliced ​​out.” mRNA functions during translation to identify the sequence or order of amino acids in a nascent polypeptide.

[0041] As used herein, the term “heterogene” means a gene that does not exist in its natural environment. For example, heterogenes include genes from one species that are introduced into another species. Heterogenes also include genes that are natural to an organism that have been modified in several ways (e.g., mutation, addition to multiple copies, binding to unnatural regulatory sequences). Heterogenes are distinguished from natural genes in that they are bound to DNA sequences that are not typically found to be naturally associated with gene sequences within a chromosome, or to parts of a chromosome that are not found in nature (e.g., genes expressed at loci where genes are not normally expressed).

[0042] As used herein, “operably linked” means a functional link between two or more elements. For example, an operably linked element between a polynucleotide of interest and a regulatory element (e.g., a promoter) is a functional link that enables the expression of the polynucleotide of interest. The operably linked elements may be continuous or discontinuous.

[0043] As used herein, “gene expression” means the biosynthesis or production of a gene product, including the transcription and / or translation of the gene product.

[0044] As used herein, the term “oligonucleotide” refers to a short, single-stranded polynucleotide chain. Oligonucleotides are typically less than approximately 300 residues long (e.g., 15–100), but as used herein, the term is also intended to encompass longer polynucleotide chains. Oligonucleotides are often referred to by their length. For example, a 24-residue oligonucleotide is called a “24mer.” Oligonucleotides can form secondary and tertiary structures by self-hybridization or by hybridization to other polynucleotides. Such structures may include, but are not limited to, double-stranded, hairpin, cruciate, bent, and triple-stranded structures.

[0045] The terms "homology" and "homology" refer to the degree of identity. There may be partial or complete homology. Partially homologous sequences are sequences that are less than 100% identical to another sequence.

[0046] As used herein, the terms “complementary” or “complementarity” refer to polynucleotides (e.g., sequences of nucleotides such as oligonucleotides or target nucleic acids) that are related by the rules of base pairing. For example, the sequence “5'-AGT-3'” is complementary to the sequence “3'-TCA-5'”. Complementarity may be “partial,” in which case only some of the nucleic acid bases match according to the base pairing rules. Alternatively, there may be “complete” or “whole” complementarity between nucleic acids. The degree of complementarity between nucleic acid chains has a significant impact on the efficiency and strength of hybridization between nucleic acid chains. Complementarity is particularly important in amplification reactions and detection methods that depend on the binding between nucleic acids. Both terms can also be used to refer to individual nucleotides, among other things, in the context of polynucleotides. For example, a particular nucleotide in an oligonucleotide may be described as complementary or incompatible with a nucleotide in another nucleic acid chain by contrasting or comparing it with the complementarity between the oligonucleotide and the rest of the nucleic acid chain.

[0047] In some contexts, the term “complementarity” and related terms (e.g., “complementary,” “complementary”) mean nucleotides of a nucleic acid sequence that can bond to another nucleic acid sequence by hydrogen bonding, for example, nucleotides that can form base pairs by Watson-Crick base pairing or other base pairing. Nucleotides that can form base pairs, for example, complementary nucleotides, are cytosine and guanine, thymine and adenine, adenine and uracil, and guanine and uracil. The percentage of complementarity does not need to be calculated over the entire length of the nucleic acid sequence. The percentage of complementarity may be limited to a specific region in the nucleic acid sequence where base pairing is occurring, for example, beginning with the first base-pairing nucleotide and ending with the last base-pairing nucleotide. As used herein, a complement of a nucleic acid sequence means an oligonucleotide that “antiparallel associates” with the nucleic acid sequence when aligned such that one 5' end pairs with the other 3' end. Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention, such as inosine and 7-deazaguanine. Complementarity does not need to be perfect. Stable double helixes may contain mismatched base pairs or unmatched bases. Those skilled in nucleic acid technology can experimentally measure the stability of a double helix by considering, for example, the length of the oligonucleotide, the base composition and sequence of the oligonucleotide, its ionic strength, and the occurrence rate of mismatched base pairs.

[0048] Therefore, in some embodiments, “complementary” means that the first nucleic acid sequence is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to the complement of the second nucleic acid sequence in regions of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleic acid bases, or that the two sequences hybridize under stringent hybridization conditions. “Fully complementary” means that each nucleic acid base of the first nucleic acid can be paired with each other at the corresponding position of the second nucleic acid. For example, in a particular embodiment, an oligonucleotide in which each nucleic acid base is complementary to the nucleic acid has a nucleic acid base sequence that is identical to the complement of the nucleic acid over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more nucleic acid bases.

[0049] As used herein, “double-stranded nucleic acid” can be a portion of a nucleic acid, a region of a longer nucleic acid, or an entire nucleic acid. “Double-stranded nucleic acid” can be, for example, double-stranded DNA, double-stranded RNA, double-stranded DNA / RNA hybrids, etc. Single-stranded nucleic acids having a secondary structure (e.g., a base-paired secondary structure) and / or a higher-order structure are included in “double-stranded nucleic acid.” For example, a triple-stranded structure is considered “double-stranded.” In some embodiments, any base-paired nucleic acid is a “double-stranded nucleic acid.”

[0050] The term “isolated,” when used in relation to nucleic acids, such as “isolated oligonucleotide” or “isolated polynucleotide,” refers to a nucleic acid sequence that is identified and isolated from at least one component or contaminant typically associated with its natural source. An isolated nucleic acid exists in a different form or context than in which it is found in nature. In contrast, unisolated nucleic acids, such as DNA and RNA, are found in the state in which they naturally occur. For example, a given DNA sequence (e.g., a gene) is found on a host cell chromosome adjacent to neighboring genes, and an RNA sequence, such as a specific mRNA sequence encoding a particular protein, is found in a cell as a mixture with numerous other mRNAs encoding numerous proteins. However, an isolated nucleic acid encoding a given protein includes, for example, nucleic acids in a cell that normally expresses a given protein, where the nucleic acid is in a different chromosomal location than in a natural cell, or otherwise adjacent to nucleic acid sequences that differ from those found naturally. Isolated nucleic acids, oligonucleotides, or polynucleotides can exist in single-stranded or double-stranded forms. When isolated nucleic acids, oligonucleotides, or polynucleotides are used to express proteins, the oligonucleotide or polynucleotide may contain at least a sense strand or coding strand (i.e., the oligonucleotide or polynucleotide may be single-stranded), but may also contain both a sense strand and an antisense strand (i.e., the oligonucleotide or polynucleotide may be double-stranded).

[0051] As used herein, “locus” refers to a chromosomal region where a polymorphic nucleic acid, phenotypic factor, gene, or marker is located. Loci in this disclosure contain one or more polymorphisms in a population. For example, alternative alleles are present in some individuals. As used herein, “allele” means an alternative nucleic acid sequence at a particular locus. The length of an allele can be as short as one nucleotide, but is usually greater. For example, a first allele may arise on one chromosome, while a second allele may arise on a second homologous chromosome, for example, between different chromosomes in a heterozygous individual, or between different homozygous or heterozygous individuals in a population. As used herein, the term “chromosomal spacing” refers to a continuous linear span of genomic DNA present on a single chromosome.

[0052] As used herein, “import” or “to import” means the transfer of a desired allele of a locus from one genetic background to another.

[0053] As used herein, “crossed” or “to cross” means to produce offspring through fertilization (e.g., cells, seeds, or plants), and includes crossing between a sexually fertilized plant and a self-fertilized plant.

[0054] As used herein, “backcross” and “backcross” refer to the process by which offspring plants are repeatedly backcrossed with one of their parents. In a backcross scheme, the “donor” parent refers to the parent plant that possesses the desired gene or locus to be introduced. The “recipient” parent (used once or more) or “recurrent” parent (used two or more times) refers to the parent plant into which the gene or locus is transferred. This initial cross produces the F1 generation. The term “BC1” refers to the second use of a recurrent parent, “BC2” refers to the third use of a recurrent parent, and so on. In some embodiments, backcrossing is repeated, and offspring individuals of each successive backcross generation are themselves backcrossed to the genotype of the same parent.

[0055] As used herein, “single-gene-converted” or “single-gene-converted” means a plant developed using a plant breeding technique known as backcrossing, or by genetic modification, in which, in addition to a single gene transferred to the variety by backcrossing or genetic modification, essentially all of the desired morphological and physiological characteristics of the variety are restored.

[0056] As used herein, the term “variety” means a group of plants that share certain characteristics that distinguish them from other plants of the same variety. Varieties are often, though not always, commercially available. While possessing one or more distinct traits, varieties are also characterized by very little overall variability among individuals within the variety. Varieties of “pure strains” can be produced by several generations of self-pollination and selection, or by vegetative propagation from a single parent using tissue or cell culture techniques. Varieties may essentially originate from another strain or variety. As defined by the International Convention for the Protection of New Varieties of Plants (December 2, 1961; revised in Geneva on November 10, 1972, October 23, 1978, and March 19, 1991), a variety is "essentially derived from" the first variety if it a) is primarily derived from the first variety, or primarily derived from a variety primarily derived from the first variety, while retaining the expression of essential features resulting from a single genotype or combination of genotypes of the first variety; b) is clearly distinguishable from the first variety; and c) matches the first variation in the expression of essential features resulting from a single genotype or combination of genotypes of the first variety, except for differences resulting from induction. Essentially derived varieties can be obtained, for example, by selecting variant individuals from naturally occurring or induced mutants, somaclonal variants, the first variety, backcrosses, or transformed plants. The first tobacco variety, and the second tobacco variety from which the first variety is essentially derived, are considered to have essentially the same genetic background. A “stem,” as distinguished from a variety, most often refers to a group of plants used non-commercially, for example, in botanical surveys. While a stem usually shows little overall variation among individuals in one or more traits, there may be some variation among individuals in other traits.

[0057] As used herein, in the context of marker-assisted selection or breeding, “selecting” means the act of choosing or selecting desired individuals, usually from a population, based on certain predetermined criteria.

[0058] As used herein, the term “phenotype” means one or more detectable features of a cell or organism that may be influenced by a genotype. Phenotypes may be observable with the naked eye or by any other evaluation means known in the art, such as microscopy, biochemical analysis, genomic analysis, or assays for specific disease resistance. In some cases, the phenotype is directly controlled by a single gene or locus, for example, a “single gene trait.” In other cases, the phenotype is the result of several genes.

[0059] As used herein, the terms “hereditary mutation” or “hereditary alteration” mean hereditary genetic recombination that is introduced into a gene and alters the expression or activity of the product encoded by the gene. Such recombination can be located in any sequence region of a gene, for example, in the promoter, 5'UTR, exon, intron, 3'UTR, or terminator region. In one embodiment, the mutation reduces, inhibits, or eliminates the expression or activity of the gene product. In another embodiment, the mutation increases, elevates, enhances, or enhances the expression or activity of the gene product. In one embodiment, the mutation is not a natural polymorphism present in a particular tobacco variety or cultivar. As used herein, “mutalytic allele” means an allele from which the allele derives the locus containing the mutation. As used herein, “mutatogenicity” means producing a mutation without a transgene, or in which the mutation-associated transgene does not remain in the final mutant. In one embodiment, the mutagenicity is cisgenic. In another embodiment, the mutagenicity is due to gene or genome editing. In a further embodiment, mutagenicity is due to random mutagenesis, for example, chemical (e.g., EMS) or physical (r-irradiation) mutagenesis.

[0060] As used herein, “polymorphism” means the presence of one or more variations in a population. Polymorphism may manifest as variations in the nucleotide sequence of a nucleic acid or variations in the amino acid sequence of a protein. Polymorphism includes the presence of one or more variations in one or more loci of nucleic acid sequences or nucleic acid features within a population of one or more individuals. Variation may include, but is not limited to, changes in one or more nucleotide bases, insertions of one or more nucleotides, or deletions of one or more nucleotides. Polymorphism may arise from random processes in nucleic acid replication, such as unequal crossovers, genome duplication, and chromosome disruption and fusion, from mutation introduction, as a result of mobile genomic elements, from copy number variations, and during the process of meiosis. Variation may be commonly found or present at low frequency in a population; the former may have great practical applications in general plant breeding, while the latter may be associated with rare but significant phenotypic variations. Useful polymorphisms include single nucleotide polymorphisms (SNPs), insertions or deletions in DNA sequences (indels), simple sequence repeats (SSRs) in DNA sequences, restriction fragment length polymorphisms (RELPs), and tagged SNPs. Genetic markers, genes, DNA-derived sequences, RNA-derived sequences, promoters, the 5' untranslated region of genes, the 3' untranslated region of genes, microRNAs, siRNAs, tolerance loci, satellite markers, transgenes, mRNAs, ds mRNAs, transcription profiles, and methylation patterns can also be considered polymorphisms. In addition, the presence or absence of the aforementioned elements, or variations in copy number, may also constitute polymorphisms.

[0061] As used herein, the term “plant” includes the whole plant, transplanted plants, plant ancestors and offspring, as well as plant parts including seeds, shoots, stems, roots (including tubers), rhizomes, scions, and plant cells, tissues, and organs. A plant can be any form including suspension, embryo, meristematic region, callus cells, leaves, gametophyte, sporophyte, pollen, and microspores. Plants particularly useful in the methods of this disclosure include all plants belonging to the family Nicotiana.

[0062] As used herein, the term “tobacco” means any plant of the genus Nicotiana that produces nicotinic alkaloids. Tobacco also means products containing substances produced by Nicotiana plants, and therefore include, for example, dried and aged tobacco, tobacco strips (tobacco with the stems removed), shredded tobacco, expanded tobacco, reconstituted tobacco, cigarettes, cigars, chewing tobacco, and smokeless tobacco forms such as snuff and snus. The nicotine content of reconstituted tobacco is lower than that of tobacco used in the manufacture of reconstituted tobacco due to the non-tobacco components contained in the finished reconstituted tobacco sheet. Expanded tobacco has a higher filling capacity than shredded tobacco in cigarettes due to the increased volume of expanded tobacco. Examples of Nicotiana species include, but are not limited to, Nicotiana acaulis, Nicotiana acuminata, and Nicotiana acuminata var.multiflora, Nicotiana africana, Nicotiana alata, Nicotiana amplexicaulis, Nicotiana arentsii, Nicotiana attenuata, Nicotiana benavidesii, Nicotiana benthamiana, Nicotiana bigelovii, Nicotiana bonariensis, Nicotiana cavicola, Nicotiana clevelandii, Nicotiana cordifolia, Nicotiana corymbosa, Nicotiana debneyi, Nicotiana excelsior, Nicotiana forgetiana, Nicotiana fragrans, Nicotiana glauca, Nicotiana glutinosa, Nicotiana goodspeedii, Nicotiana gossei, Nicotiana hybrid, Nicotiana ingulba, Nicotiana kawakamii, Nicotiana knightiana, Nicotiana langsdorffii, Nicotiana linearis, Nicotiana longiflora, Nicotiana maritima, Nicotiana megalosiphon, Nicotiana miersii, Nicotiana noctiflora, Nicotiana nudicaulis, Nicotiana obtusifolia, Nicotiana occidentalis, Nicotiana occidentalis subsp. hesperis、Nicotiana otophora、Nicotiana paniculata、Nicotiana pauciflora、Nicotiana petunioides、Nicotiana plumbaginifolia、Nicotiana quadrivalvis、Nicotiana raimondii、Nicotiana repanda、Nicotiana rosulata、Nicotiana rosulata subsp.ingulba, Nicotiana rotundifolia, Nicotiana rustica, Nicotiana setchellii, Nicotiana simulans, Nicotiana solanifolia, Nicotiana spegazzinii, Nicotiana stocktonii, Nicotiana suaveolens, Nicotiana sylvestris, Nicotiana tabacum, Nicotiana thyrsiflora, Nicotiana tomentosa, Nicotiana tomentosiformis, Nicotiana trigonophylla, Nicotiana umbratica, Nicotiana undulata, Nicotiana velutina, Nicotiana wigandioides, and Nicotiana x sanderae. .

[0063] As used herein, the term “transgenic plant” means a plant that contains nucleic acid sequences that are also present in another organism or species, or that are optimized from another organism or species compared to the host codon usage frequency. Plant cells of both monocots and dicots / angiosperms, or gymnosperms, can be transformed in various ways known to those skilled in the art. See, for example, Klein et al., Biotechnology 4: 583-590 (1993); Bechtold et al., CRAcad.Sci.Paris 316:1194-1199 (1993); Bent et al., Mol.Gen. Genet.204:383-396 (1986); Paszowski et al., EMBO J.3: 2717-2722 (1984); Sagi et al., Plant Cell Rep.13: 262-266 (1994).

[0064] Unless otherwise defined herein, scientific and technical terms used in connection with this disclosure shall have meanings generally understood by those skilled in the art. For example, any technical terms used herein in connection with cell and tissue culture, molecular biology, plant biology, genetics, and protein and nucleic acid chemistry and hybridization, as well as these techniques, are well known and commonly used in the art. The meaning and scope of terms shall be clear, but in the event of any potential ambiguity, the definitions provided herein shall take precedence over any dictionary or external definitions. Furthermore, unless otherwise required by context, singular terms shall include plural forms, and plural terms shall include singular forms.

[0065] 2. Low-nicotine tobacco plants Tobacco alkaloid accumulation is considered a complex trait influenced by numerous genes and environmental factors. Historically, researchers have used allele variability at the NIC1 and NIC2 loci (also known as loci A and B) to investigate how to achieve lower nicotine levels in tobacco. The NIC2 locus has been found to consist of a series of genes at N. tabacum junction 19 that encode ethylene response factor (ERF) transcription factors, which have an overall impact on the expression of structural genes in the tobacco alkaloid biosynthesis pathway. This gene cluster is found in "LA Burley21" (a backcross-derived Burley21 with a deletion in the nic1 / nic1 nic2 / nic2 version). A similar gene array is located at or near the Nic1 locus of N. tabacum junction 7, where the epigenetically silenced allele of ERF199 is thought to underlie the effects of alkaloid accumulation at this locus in LA Burley21. Such variability has been used in the development of low-alkaloid breeding strains such as LA Burley21 and LAFC53. However, materials that are homozygous for recessive alleles at the NIC1 and NIC2 loci have an average nicotine level of 0.4 mg g when used alone. -1 We do not routinely produce dried and matured leaves below a certain level.

[0066] Embodiments of this disclosure include a method for developing tobacco varieties to generate novel tobacco genotypes, in which genetic mutations at the NIC1 and NIC2 loci derived from LAFC53 (Chaplin, 1975) are combined with a mutant allele of the N.tabacum gene Myc2a, which encodes a transcription factor that positively regulates the expression of genes in the nicotine biosynthesis pathway. A harmful 5bp mutation in Myc2a was previously identified in Tobacco Introduction TI313 from the US Nicotiana Germplasm Collection (Burner et al., 2022). Surprisingly and unexpectedly, the homozygous combination of the nic1 and nic2 alleles from LAFC53 and the mutant myc2a allele from TI313 exhibits significantly lower nicotine levels than tobacco genotypes that are homozygous for nic1 and nic2 alone from LAFC53. This suggests that the addition of the mutant myc2a allele further suppresses the overall expression of nicotine biosynthesis genes compared to that produced by the recessive nic1 and nic2 alleles alone. The results of this approach include some of the lowest nicotine levels reported in tobacco plants, as well as tobacco genotypes that result in corresponding reductions in anabasine, anatabine, and nornicotine.

[0067] As described above, embodiments of the present disclosure include tobacco varieties, or any part thereof, that contain at least one nicotinic alkaloid at a reduced concentration compared to the corresponding naturally occurring tobacco plant, or a part thereof. In some embodiments, tobacco varieties produced according to the methods of the present disclosure contain at least one nicotinic alkaloid selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine. In some embodiments, the varieties are non-transgenic.

[0068] In some embodiments, the tobacco varieties of the Disclosure contain reduced concentrations of nicotine. In some embodiments, the tobacco varieties contain 0.30% or less of nicotine. In some embodiments, the tobacco varieties contain 0.29% or less of nicotine. In some embodiments, the tobacco varieties contain 0.28% or less of nicotine. In some embodiments, the tobacco varieties contain 0.27% or less of nicotine. In some embodiments, the tobacco varieties contain 0.26% or less of nicotine. In some embodiments, the tobacco varieties contain 0.25% or less of nicotine. In some embodiments, the tobacco varieties contain 0.24% or less of nicotine. In some embodiments, the tobacco varieties contain 0.23% or less of nicotine. In some embodiments, the tobacco varieties contain 0.22% or less of nicotine. In some embodiments, the tobacco varieties contain 0.21% or less of nicotine. In some embodiments, the tobacco varieties contain 0.20% or less of nicotine. In some embodiments, the tobacco varieties contain 0.19% or less of nicotine. In some embodiments, the tobacco varieties contain 0.18% or less of nicotine. In some embodiments, the tobacco variety contains 0.17% or less nicotine. In some embodiments, the tobacco variety contains 0.16% or less nicotine. In some embodiments, the tobacco variety contains 0.15% or less nicotine. In some embodiments, the tobacco variety contains 0.14% or less nicotine. In some embodiments, the tobacco variety contains 0.13% or less nicotine. In some embodiments, the tobacco variety contains 0.12% or less nicotine. In some embodiments, the tobacco variety contains 0.11% or less nicotine. In some embodiments, the tobacco variety contains 0.10% or less nicotine. In some embodiments, the tobacco variety contains 0.09% or less nicotine. In some embodiments, the tobacco variety contains 0.08% or less nicotine. In some embodiments, the tobacco variety contains 0.07% or less nicotine. In some embodiments, the tobacco variety contains 0.06% or less nicotine. In some embodiments, the tobacco variety contains 0.05% or less nicotine. In some embodiments, the tobacco variety contains 0.04% or less nicotine.In some embodiments, the tobacco variety contains 0.03% or less nicotine. In some embodiments, the tobacco variety contains 0.02% or less nicotine. In some embodiments, the tobacco variety contains 0.01% or less nicotine.

[0069] In some embodiments, the tobacco variety contains about 0.1% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.25% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.15% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.20% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.25% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.25% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.20% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.25% to about 0.29% nicotine.

[0070] In some embodiments, the tobacco varieties of the Disclosure contain reduced concentrations of nornicotine. In some embodiments, the varieties contain 0.02% or less of nornicotine. In some embodiments, the varieties contain 0.01% or less of nornicotine. In some embodiments, the varieties contain 0.009% or less of nornicotine. In some embodiments, the varieties contain 0.008% or less of nornicotine. In some embodiments, the varieties contain 0.007% or less of nornicotine. In some embodiments, the varieties contain 0.006% or less of nornicotine. In some embodiments, the varieties contain 0.005% or less of nornicotine. In some embodiments, the varieties contain about 0.005% to about 0.01% of nornicotine. In some embodiments, the varieties contain about 0.006% to about 0.01% of nornicotine. In some embodiments, the varieties contain about 0.007% to about 0.01% of nornicotine. In some embodiments, the varieties contain about 0.008% to about 0.01% of nornicotine. In some embodiments, the variety contains about 0.009% to about 0.01% nornicotine. In some embodiments, the variety contains about 0.005% to about 0.009% nornicotine. In some embodiments, the variety contains about 0.005% to about 0.008% nornicotine. In some embodiments, the variety contains about 0.005% to about 0.007% nornicotine. In some embodiments, the variety contains about 0.005% to about 0.006% nornicotine. In some embodiments, nornicotine is undetectable or above the detection limit in the variety.

[0071] In some embodiments, the tobacco varieties of the Disclosure contain reduced concentrations of anatabin. In some embodiments, the varieties contain 0.02% or less of anatabin. In some embodiments, the varieties contain 0.01% or less of anatabin. In some embodiments, the varieties contain 0.009% or less of anatabin. In some embodiments, the varieties contain 0.008% or less of anatabin. In some embodiments, the varieties contain 0.007% or less of anatabin. In some embodiments, the varieties contain 0.006% or less of anatabin. In some embodiments, the varieties contain 0.005% or less of anatabin. In some embodiments, the varieties contain about 0.005% to about 0.01% of anatabin. In some embodiments, the varieties contain about 0.006% to about 0.01% of anatabin. In some embodiments, the varieties contain about 0.007% to about 0.01% of anatabin. In some embodiments, the varieties contain about 0.008% to about 0.01% of anatabin. In some embodiments, the variety contains about 0.009% to about 0.01% anatabine. In some embodiments, the variety contains about 0.005% to about 0.009% anatabine. In some embodiments, the variety contains about 0.005% to about 0.008% anatabine. In some embodiments, the variety contains about 0.005% to about 0.007% anatabine. In some embodiments, the variety contains about 0.005% to about 0.006% anatabine. In some embodiments, anatabine is undetectable or above the detection limit in the variety.

[0072] In some embodiments, the tobacco varieties of the Disclosure contain anabasin at a reduced concentration. In some embodiments, the varieties contain 0.002% or less of anabasin. In some embodiments, the varieties contain 0.001% or less of anabasin. In some embodiments, the varieties contain 0.0009% or less of anabasin. In some embodiments, the varieties contain 0.0008% or less of anabasin. In some embodiments, the varieties contain 0.0007% or less of anabasin. In some embodiments, the varieties contain 0.0006% or less of anatabine. In some embodiments, the varieties contain 0.0005% or less of anabasin. In some embodiments, the varieties contain 0.0004% or less of anabasin. In some embodiments, the varieties contain 0.0003% or less of anabasin. In some embodiments, the varieties contain 0.0002% or less of anabasin. In some embodiments, the varieties contain 0.0001% or less of anabasin. In some embodiments, the variety contains about 0.0004% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0005% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0006% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0007% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0008% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0009% to about 0.002% anabasin. In some embodiments, the variety contains about 0.001% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0015% to about 0.002% anabasin. In some embodiments, the variety contains about 0.0004% to about 0.0015% anabasin. In some embodiments, the variety contains about 0.0004% to about 0.008% anabasin. In some embodiments, the variety contains about 0.0005% to about 0.0015% anabasin. In some embodiments, the variety contains about 0.0008% to about 0.0012% anabasin. In some embodiments, anabasin is undetectable or above the detection limit in the variety.

[0073] In some embodiments, the variety includes a nic1 allele with reduced expression and / or function compared to wild-type NIC1. In some embodiments, the variety includes a nic2 allele with reduced expression and / or function compared to wild-type NIC2. In some embodiments, the variety includes nic1 and nic2 alleles with reduced expression and / or function compared to wild-type NIC1 and wild-type NIC2. In some embodiments, the nic1 and / or nic2 alleles are derived from at least one of the following varieties or strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21. In some embodiments, the first and / or second tobacco variety includes a nic1 and / or nic2 null allele (deletion). In some embodiments, the nic1 and / or nic2 null alleles are derived from other N. tabacum germplasm.

[0074] In some embodiments, the variety contains a myc2a allele with reduced expression and / or function compared to wild-type MYC2a. In some embodiments, the myc2a allele contains at least one nucleotide deletion compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the myc2a allele contains 1 to 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the myc2a allele contains 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO: 1. In some embodiments, the deletions produce a truncated MYC2A protein. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 70% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 75% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 80% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele contains a nucleic acid sequence that is at least 85% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele includes a nucleic acid sequence that is at least 90% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele includes a nucleic acid sequence that is at least 95% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele includes a nucleic acid sequence that is at least 98% identical to SEQ ID NO: 2. In some embodiments, the myc2a allele is derived from N. tabacm.

[0075] In some embodiments, the tobacco varieties of the Disclosure are non-transgenic (e.g., without xenotransgenes). According to these embodiments, the tobacco varieties of the Disclosure can be produced by breeding (e.g., backcrossing) various tobacco strains having the desired trait(s) corresponding to at least one nicotinic alkaloid at reduced concentrations. Therefore, the tobacco varieties produced according to any embodiment of the Disclosure do not exist in nature.

[0076] As will be understood by those skilled in the art based on this disclosure, tobacco varieties having at least one nicotinic alkaloid described herein in reduced concentrations can also be produced using a transgenic approach. In some embodiments, the tobacco varieties of this disclosure can be manipulated to include one or more traits corresponding to at least one nicotinic alkaloid in reduced concentrations. For example, tobacco plants can be manipulated to include nic1 and / or nic2 alleles substantially similar to those found in LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21. These nic1 and / or nic2 alleles may have one or more genetic alterations (e.g., deletions, cleavage, loss of function, or mass morphological mutations) that result in at least one nicotinic alkaloid in reduced concentrations. Furthermore, tobacco plants can be manipulated to include a myc2a allele substantially similar to that found in TI313. This myc2a allele may have one or more genetic alterations (e.g., deletions, cleavages, loss of function, or mass-morphological mutations) resulting in reduced concentrations of at least one nicotinic alkaloid. Such genetic alterations can be manipulated using any means known in the art, including, but not limited to, transcriptional activation-like effector nucleases (TALENs), meganucleases, zinc finger nucleases, and clustered, regularly spaced short palindromic repeats (CRISPR) / Cas9, CRISPR / Cpf1, CRISPR / Csm1 systems, or any combination thereof (see, for example, Gaj et al., Trends in Biotechnology, 31(7):397-405 (2013)).

[0077] In some embodiments, the present technology provides a method for producing tobacco plants with reduced nicotinic alkaloid content, the method comprising combining (a) a genetic recombination that reduces the expression and / or function of MYC2A compared to a corresponding, naturally occurring or untransformed control tobacco plant, and (b) a recessive allele of nic1 and / or a recessive allele of nic2 within a tobacco plant (e.g., Nicotiana tabacum).

[0078] In some embodiments, introducing the recessive allele of nic1 and / or the recessive allele of nic2 may include incorporating one or more of the recessive alleles into a tobacco plant (e.g., Nicotiana tabacum) that, through conventional breeding, contains one or more genetically modified organisms that reduce the expression and / or function of MYC2A in the tobacco plant compared to, for example, a wild-type tobacco plant.

[0079] In some embodiments, tobacco plants produced by the methods of this scientific technology, having (a) a genetic modification that reduces the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2, are at least about 40% (e.g., at least about 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%) compared to the corresponding, naturally occurring, or untransformed control tobacco plants. Contains nicotinic alkaloid content reduced to %, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, or more, or any range or value within these. In some embodiments, the reduced nicotinic alkaloid in the tobacco plant may be nicotine, and the nicotine content may be reduced by about 90% or more (e.g., about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more) compared to the corresponding, naturally occurring, or untransformed control tobacco plant.

[0080] In some embodiments, tobacco plants produced by the methods of this scientific technique, having (a) a genetic modification that reduces the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2, contain reduced concentrations of nicotine. In some embodiments, the tobacco variety contains 0.29% or less of nicotine. In some embodiments, the tobacco variety contains 0.28% or less of nicotine. In some embodiments, the tobacco variety contains 0.27% or less of nicotine. In some embodiments, the tobacco variety contains 0.26% or less of nicotine. In some embodiments, the tobacco variety contains 0.25% or less of nicotine. In some embodiments, the tobacco variety contains 0.24% or less of nicotine. In some embodiments, the tobacco variety contains 0.23% or less of nicotine. In some embodiments, the tobacco variety contains 0.22% or less of nicotine. In some embodiments, the tobacco variety contains 0.21% or less of nicotine. In some embodiments, the tobacco variety contains 0.20% or less of nicotine. In some embodiments, the tobacco variety contains 0.19% or less nicotine. In some embodiments, the tobacco variety contains 0.18% or less nicotine. In some embodiments, the tobacco variety contains 0.17% or less nicotine. In some embodiments, the tobacco variety contains 0.16% or less nicotine. In some embodiments, the tobacco variety contains 0.15% or less nicotine. In some embodiments, the tobacco variety contains 0.14% or less nicotine. In some embodiments, the tobacco variety contains 0.13% or less nicotine. In some embodiments, the tobacco variety contains 0.12% or less nicotine. In some embodiments, the tobacco variety contains 0.11% or less nicotine. In some embodiments, the tobacco variety contains 0.10% or less nicotine. In some embodiments, the tobacco variety contains 0.09% or less nicotine. In some embodiments, the tobacco variety contains 0.08% or less nicotine. In some embodiments, the tobacco variety contains 0.07% or less nicotine. In some embodiments, the tobacco variety contains 0.06% or less nicotine. In some embodiments, the tobacco variety contains 0.05% or less nicotine.In some embodiments, the tobacco variety contains 0.04% or less nicotine. In some embodiments, the tobacco variety contains 0.03% or less nicotine. In some embodiments, the tobacco variety contains 0.02% or less nicotine. In some embodiments, the tobacco variety contains 0.01% or less nicotine.

[0081] In some embodiments, the tobacco variety contains about 0.1% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.25% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.15% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.20% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.25% to about 0.30% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.25% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.20% nicotine. In some embodiments, the tobacco variety contains about 0.1% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.15% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.20% to about 0.29% nicotine. In some embodiments, the tobacco variety contains about 0.25% to about 0.29% nicotine.

[0082] In some embodiments, tobacco plants produced by the methods of this scientific technique, having (a) a genetic modification that reduces the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2, contain reduced concentrations of nornicotine. In some embodiments, the plants contain about 0.02% or less of nornicotine, about 0.01% or less of nornicotine, or about 0.005% or less of nornicotine. In some embodiments, the plants contain about 0.005% to about 0.02% of nornicotine, or about 0.01% to about 0.02% of nornicotine. In some embodiments, nornicotine is undetectable or above the detection limit in tobacco.

[0083] In some embodiments, tobacco plants produced by the methods of this scientific technique, having (a) a genetic modification that reduces the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2, contain anatabine at a reduced concentration. In some embodiments, the plants contain 0.01% or less of anatabine. In some embodiments, the plant contains approximately 0.001% to 0.01% anatabine, approximately 0.002% to 0.01% anatabine, approximately 0.003% to 0.01% anatabine, approximately 0.004% to 0.01% anatabine, approximately 0.005% to 0.01% anatabine, approximately 0.006% to 0.01% anatabine, approximately 0.007% to 0.01% anatabine, approximately 0.008% to 0.01% anatabine, or approximately 0.009% to 0.01% anatabine. In some embodiments, anatabine is undetectable or beyond the detection limit in the tobacco plant.

[0084] In some embodiments, tobacco plants produced by the methods of this scientific technique, having (a) a genetic modification that reduces the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2, contain reduced concentrations of anabasin. In some embodiments, the plants contain about 0.0004% to about 0.002% anabasin, about 0.0004% to about 0.0015% anabasin, about 0.0004% to about 0.008% anabasin, about 0.0005% to about 0.0015% anabasin, and 0.0008% to about 0.0012% anabasin. In some embodiments, anabasin is undetectable or above the detection limit in the tobacco plants.

[0085] As described herein, genetic recombination can be carried out using any means known in the art, including, but not limited to, transcriptional activation-like effector nucleases (TALENs), meganucleases, zinc finger nucleases, CRISPR / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, gene knock-in techniques or scientific technologies, or any combination thereof.

[0086] For example, in some embodiments, the methods of this scientific technique relate to the use of a CRISPR / Cas system that binds to a target site in a region of interest within the genome, wherein the CRISPR / Cas system comprises a CRISPR / Cas nuclease and an engineered crRNA / tracrRNA (or a single guide RNA (sgRNA) or guide RNA (gRNA)). In some embodiments, the CRISPR system generally comprises (i) a polynucleotide encoding a Cas protein and (ii) at least one sgRNA for RNA-guided genome recombination in plant cells. Non-limiting examples of Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Cys3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Smr1, Cmr3, Cmr4, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, their homologs, or modified versions thereof. In some embodiments, the Cas protein is the Streptococcus pyogenes Cas9 protein. These enzymes are well known. For example, the amino acid sequence of the S. pyogenes Cas9 protein can be found in the SwissProt database under accession number Q99ZW2. In some embodiments, the method of this scientific technique relates to the use of a CRISPR / Cpf1 system that binds to a target site in a region of interest within the genome. In some embodiments, the method of this scientific technique relates to the use of a CRISPR / Csm1 system that binds to a target site in a region of interest within the genome.

[0087] In some embodiments, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 system recognizes a target site in myc2a. In some embodiments, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 system generates specific sequence changes in myc2a, such as mutations resulting in the deletion of one or more nucleotides and / or nucleotide substitutions, which result in reduced activity / expression of MYC2A (e.g., deletion, cleavage, loss of function, or mass morphogenesis). In some embodiments, the CRISPR / Cas, CRISPR / Cpf1, or CRISPR / Csm1 system generates specific sequence changes by gene knock-in or gene substitution. Methods for gene knock-in or gene substitution are well known in the art. CRISPR-based methods for gene knock-in or gene substitution can utilize homologous recombination repair (HDR) mechanisms, non-homologous end joining (NHEJ) mechanisms, or both HDR and NHEJ mechanisms. An unrestricted example of a CRISPR-based method utilizing both HDR and NHEJ mechanisms is called tandem repeat HDR (TR-HDR), described in Lu et al., “Targeted, efficient sequence insertion and replacement in rice,” Nature Biotechnology, 38(12):1402-1407.doi: 10.1038 / s41587-020-0581-5, (2020), which is incorporated herein by reference in its entirety.

[0088] In some embodiments, the methods described herein utilize a meganuclease DNA-binding domain for binding to a target region within the genome of a plant cell. Meganucleases are typically engineered versions of naturally occurring restriction enzymes, with extended DNA recognition sequences (e.g., about 14 to about 40 base pairs in length). Meganucleases (also known as homing endonucleases) are generally classified into five families based on their sequence and structural motifs: the LAGLIDADG family, the GIY-YIG family, the His-Cyst box family, the PD-(D / E)XK family, and the HNH family. In some embodiments, meganucleases include engineered homing endonucleases. Recognition sequences for homing endonucleases and meganucleases such as I-Sce, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII are well known.

[0089] In some embodiments, the meganuclease is adapted to recognize a target in the myc2a allele. In some embodiments, the meganuclease generates a specific sequence change in the myc2a allele, such as a mutation resulting in the deletion of one or more nucleotides, and / or a nucleotide substitution, which results in a reduction of MYC2A activity / expression (e.g., deletion, cleavage, loss of function, or mass morphogenesis mutation).

[0090] In some embodiments, the methods described herein edit plant genomes by introducing double-strand breaks (DSBs) using transcription-activating-like effector nucleases (TALENs). TALENs are restriction enzymes that can be manipulated to cleave specific sequences of DNA. TALENs are constructed by fusing a TAL effector DNA-binding domain to a DNA-cleaving domain (e.g., a nuclease domain, such as one derived from FokI endonuclease). Transcription-activating-like effectors (TALEs) can be manipulated according to methods well known in the art to bind to a desired DNA sequence, and when combined with a nuclease, this provides a technique for cleaving DNA at a specific location. For example, in some embodiments, the use of TALEN techniques generates specific sequence changes in the myc2a allele, such as mutations resulting in the deletion of one or more nucleotides, and / or nucleotide substitutions, which result in a reduction of MYC2A activity / expression (e.g., deletion, cleavage, loss of function, or mass morphogenesis).

[0091] In some embodiments, the compositions and methods described herein edit plant genomes by introducing double-strand breaks (DSBs) using zinc finger nucleases (ZFNs). ZFNs are artificial restriction enzymes produced by fusing a zinc finger DNA-binding domain to a DNA-cleaving domain (e.g., a nuclease domain, such as one derived from FokI endonuclease). ZFNs can be recombined to bind and cleave DNA at specific locations. A ZFN contains two protein domains. The first domain is a DNA-binding domain, which contains a eukaryotic transcription factor and a zinc finger. The second domain is a nuclease domain containing a FokI restriction enzyme, which is responsible for cleaving DNA. ZFNs can be recombined according to methods well known in the art to bind to a desired DNA sequence and cleave DNA at specific locations. For example, after a target sequence is identified in a nicotine biosynthesis gene, the corresponding (ZFN) sequence is recombined and inserted into a plasmid. A plasmid is inserted into a target cell, where it is translated to produce a functional ZFN, which then enters the nucleus, where it binds to and cleaves a double-strand break (DSB) in its target sequence. Since the DSB is repaired either by homologous repair or by non-homologous end joining, such an approach can be used to introduce an exogenous DNA sequence into a target gene. For example, in some embodiments, the use of ZFN technology generates a specific sequence change in the myc2a allele, such as a mutation resulting in the deletion of one or more nucleotides and / or nucleotide substitutions, which results in a reduction in the activity / expression of MYC2A (e.g., deletion, cleavage, loss of function, or mass morphogenesis variation).

[0092] In some embodiments, the present technology further includes suppressing the expression of endogenous genes encoding transcription factors that positively regulate alkaloid production, such as the NtERF221, NtMYC1a, NtMYC1b, and / or NtMYC2b genes, thereby reducing nicotinic alkaloid levels in plants.

[0093] In some embodiments, the present technology further includes suppressing the expression of one or more nicotinic alkaloid biosynthesis genes, such as BBL (also known as NBB1), A622, QPT (quinolate phosphoribosyltransferase), PMT (putrescine methyltransferase), ODC (ornithine decarboxylase), AO (aspartate oxidase), QS (quinolinic acid synthase), and MPO (N-methylputrescine oxidase), thereby reducing nicotinic alkaloid levels in plants.

[0094] Examples of methods that can be used to repress ERF199, ERF189, NtERF221, NtMYC1a, NtMYC1b, NtMYC2b, BBL, A622, QPT, PMT, ODC, AO, QS, and / or MPO genes include, but are not limited to, antisense-sense co-repression, RNAi, artificial microRNA, virus-induced gene silencing (VIGS), targeted mutagenesis, and / or related genome recombination methods including, but are not limited to, transcription-activating effector nucleases (TALENs), meganucleases, zinc finger nucleases, and clustered, regularly spaced short palindromic repeats (CRISPR) / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, or any combination thereof.

[0095] As described above, embodiments of the Disclosure also include offspring plants, seeds, or cells produced from any of the tobacco varieties described herein, produced using transgenic and / or non-transgenic methods. Embodiments of the Disclosure also include tobacco products derived from any of the tobacco varieties or parts thereof described herein. In some embodiments, tobacco products are selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, tobacco extracts, smokeless tobacco, moist or dry snuff, snuff, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco. In some embodiments, tobacco products are selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco, cigars, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.

[0096] Embodiments of the present disclosure also include methods for producing tobacco varieties containing at least one nicotinic alkaloid at a reduced concentration compared to a naturally occurring corresponding tobacco plant or a portion thereof. According to these embodiments, the method includes crossing a first tobacco variety containing a first low-nicotine trait with a second tobacco variety containing a second low-nicotine trait to produce offspring plants. In some embodiments, the offspring plants contain at least one nicotinic alkaloid at a reduced concentration compared to either the first or second tobacco variety. In some embodiments, the method includes backcrossing. Such tobacco varieties having at least one nicotinic alkaloid at a reduced concentration can be produced using transgenic and / or non-transgenic methods, as will be recognized by those skilled in the art.

[0097] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the variety contains 0.30% or less nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine. In some embodiments, at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less anatabine. In some embodiments, at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.30% or less nicotine and 0.02% or less nornicotine.

[0098] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the variety contains 0.29% or less nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine. In some embodiments, at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less anatabine. In some embodiments, at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.29% or less nicotine and 0.02% or less nornicotine.

[0099] In some embodiments, and as further described above, at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine, and the variety contains 0.25% or less nicotine. In some embodiments, at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine. In some embodiments, at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less anatabine. In some embodiments, at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less anabasine. In some embodiments, at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.25% or less nicotine and 0.02% or less nornicotine.

[0100] In some embodiments, the first and / or second low-nicotine trait includes a nic1 allele with reduced expression and / or function compared to wild-type NIC1. In some embodiments, the first and / or second low-nicotine trait includes a nic2 allele with reduced expression and / or function compared to wild-type NIC2. In some embodiments, the first and / or second tobacco variety includes a nic1 and / or nic2 allele derived from at least one of the following varieties or strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21. In some embodiments, the first and / or second tobacco variety includes a nic1 and / or nic2 null allele (deletion). In some embodiments, the nic1 and / or nic2 null allele is derived from another N. tabacum germplasm. In some embodiments, the first and / or second tobacco varieties contain a myc2a allele with reduced expression and / or function compared to the wild-type MYC2a. In some embodiments, the myc2a allele is derived from N. tabacum.

[0101] In some embodiments of the method, the first low-nicotine trait comprises nic1 and / or nic2 alleles with reduced expression and / or function compared to wild-type NIC1 and / or NIC2, and the second low-nicotine trait comprises myc2a alleles with reduced expression and / or function compared to wild-type MYC2a. In some embodiments of the method, the first tobacco variety, the second tobacco variety, and the offspring plants are non-transgenic.

[0102] Embodiments of this disclosure also include seeds or cells obtained from offspring plants produced according to any of the methods described herein.

[0103] Embodiments of this disclosure also include tobacco products derived from offspring plants produced according to any of the methods described herein. In some embodiments, the product is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, reconstituted tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snuff, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco. In some embodiments, the product is selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco, cigars, snuff, snuff, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco. Self-made cigarettes are produced using an empty tobacco tube and a tabletop injector machine for injecting tobacco leaves into the empty tobacco tube. Hand-rolled cigarettes are produced by hand-rolling typical flat rolling paper. Tobacco heating devices, also known as heated tobacco products or heated tobacco products, are electrical devices that heat tobacco to below its combustion point within a device's pod or stick, producing an aerosol (without smoke) that is available for inhalation. Examples of commercially available products include IQOS® and Glo®.

[0104] Embodiments of the present disclosure also include methods for producing Nicotiana tabacum plants with reduced nicotinic alkaloid content. According to these embodiments, the method comprises combining (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2 in a Nicotiana tabacum plant. In some embodiments, the Nicotiana tabacum plant has a reduced nicotinic alkaloid content compared to a corresponding, naturally occurring, or untransformed control tobacco plant. In some embodiments of the method, the Nicotiana tabacum plant contains a homozygous recessive allele of nic1 and / or a homozygous recessive allele of nic2.

[0105] In some embodiments of the method, one or more genetic recombinations that reduce the expression and / or function of MYC2A are introduced by transcriptional activation-like effector nucleases (TALENs), meganucleases, zinc finger nucleases, CRISPR / Cas9 systems, CRISPR / Cpf1 systems, CRISPR / Csm1 systems, gene knock-in techniques or scientific technologies, or any combination thereof.

[0106] In some embodiments, the method further comprises suppressing the expression of at least one of the following in Nicotiana tabacum plants: BBL (also known as NBB1), A622, quinolate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), ornithine decarboxylase (ODC), aspartate oxidase (AO), quinolinic acid synthase (QS), N-methylputrescine oxidase (MPO), NtERF221, NtMYC1a, NtMYC1b, or NtMYC2b. In some embodiments, the variety is the NCLA161 variety or derived therefrom.

[0107] Embodiments of this disclosure also include Nicotiana tabacum plants produced by the methods described herein. In some embodiments of the method, the plants include (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) recessive alleles of nic1 and / or nic2.

[0108] Embodiments of this disclosure also include offspring plants or seeds produced from any of the plants described herein. In some embodiments, the offspring plants or seeds include (a) one or more genetic recombinations that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

[0109] Embodiments of this disclosure also include tobacco products comprising tobacco derived from any of the Nicotiana tabacum plants described herein. In some embodiments, the plant comprises (a) one or more genetic modifications that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

[0110] In some embodiments, tobacco is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snuff, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco. In some embodiments, the product is a nicotine-reduced tobacco product selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco, cigars, snuff, snuff, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.

[0111] Sequence. The following nucleic acid sequences are referenced throughout this disclosure.

[0112] Wild-type myc2a(K326):

[0113]

[0114] Cleavage-type myc2a (TI313 from Burner et al. 2022):

[0115] ATGACGGATTATAGAATACCAACGATGACTAATATATGGAGCAATACTACATCCGATGATAATATGATGGAAGCTTTTTTATCTTCTGATCCGTCGTCGTTTTGGCCCGGAACAACTACTACACCAACTCCCCGGAGTTCAGTTTCTCCAGCGCCGGCGCCGGTGACGGGGATTGCCGGAGACCCATTAAAGTCTATGCCATATTTCAACCAAGAGTCACTGCAACAGCGACTCCAGACTTTAATCGATGGGGCTCGCAAAGGGTGGACGTATGCCATATTTTGGCAATCGTCTGTTGTGGATTTCGCGAGCCCCTCGGTTTTGGGGTGGGGAGATGGGTATTATAAAGGTGAAGAAGATAAAAATAAGCGTAAAACGGCGTCGTTTTCGCCTGACTTTATCACGGAACAAGCACACCGGAAAAAGGTTCTCCGGGAGCTGAATTCTTTAATTTCCGGCACACAAACCGGTGGTGAAAATGATGCTGTAGATGAAGAAGTAACTGATACTGAATGGTTTTATTTCCATGACACAATCGTTTGTTAA (SEQ ID NO: 2).

Example

[0116] As will be obvious to those skilled in the art, other suitable modifications and adaptations of the methods disclosed herein are readily applicable and recognizable and may be made using suitable equivalents without departing from the scope of the disclosure or the aspects and embodiments disclosed herein. Having described the disclosure in detail, the following examples will provide a clearer understanding of the disclosure, and these are intended only to illustrate some aspects and embodiments of the disclosure and should not be considered to limit the scope of the disclosure. All journal references, U.S. patents, and publication disclosures referenced herein are incorporated herein by reference in their entirety.

[0117] This disclosure has several embodiments, as illustrated by the following non-limiting embodiments.

[0118] Example 1 Given the possibility that the nicotine levels in conventional cigarettes may be forcibly lowered to below the so-called "subthreshold of addiction" in various countries around the world (including the United States), there is commercial interest among manufacturers in tobacco varieties that produce dried leaves with nicotine levels that would enable them to achieve their target nicotine levels. Currently, nicotine levels of 0.04% to 0.08% in cigarette tobacco leaves are being discussed and / or recommended by regulatory authorities. Superior hot-air dried tobacco varieties with excellent agrochemical properties that would routinely accumulate nicotine at such low levels (when grown under conventional agricultural management systems and averaged across all stem locations) are not currently available to the tobacco industry.

[0119] Accordingly, embodiments of the present disclosure include a newly established low-nicotine tobacco hybrid, NCLA161 (nic1 and nic2 alleles derived from LAFC53 combined with a mutant myc2a allele from N. tabacumt). The source of the genetic variability at the NIC1 and NIC2 loci that affects the low nicotine content was derived from the hot-air-dried tobacco breeding strain LAFC53 (Chaplin, 1975). The source of the mutant allele myc2a was Tobacco Introduction TI313 (Burner et al., 2022). Using a backcross breeding method (Fehr, 1987), the nic1 and nic2 alleles from LAFC53 and the mutant myc2a allele from TI313 were combined under triple homozygous conditions in the excellent genetic background of the hot-air-dried tobacco variety "K326". After six generations of backcrossing, followed by two generations of self-pollination, a stable BC6F3 line with triple homozygosity, known as NCLA161, was established. The NCLA161 variety is non-transgenic.

[0120] More specifically, five plants each of NCLA161, K326, and K326 22 (a nearly homogeneous version of K326 previously developed, with recessive nic1 and nic2 alleles backcrossed) were transplanted into 3.79-liter pots in a greenhouse. The greenhouse experiment design was a randomized, fully block design, with the bottom 1-2 inches of each pot submerged in a 5-gallon bucket of water for soil irrigation. To stimulate alkaloid biosynthesis, the plants were covered (removal of the apical inflorescence or apical meristem) when approximately 50% of the plants had flowered. Lateral meristems (suckers) were manually removed from the leaf axils approximately every other day after the top was removed, until the leaves were harvested. The top two leaves of each plant were harvested 21 days after the top was removed, treated with etephon according to the manufacturer's recommendations (Arysta LifeScience, Cary, NC), air-dried, crushed, and passed through a 1 mm sieve. The alkaloid profiles were determined using gas chromatography according to the methodology described above (Lewis et al. 2015).

[0121] The average nicotine content of NCLA161 was found to be approximately 1% of the average nicotine content of K326 and approximately 40% of that of K326 22 (Table 1), thus suggesting that novel genotypes containing mutations in nic1, nic2, and myc2a have a desirable synergistic effect on reducing the nicotine content of tobacco leaves. The concentrations of nornicotine, anabasine, and anatabine in NCLA161 were undetectable compared to those observed in K326 itself.

[0122] [Table 1-1] [Table 1-2]

[0123] These results demonstrate that NCLA161, the novel hybrid variety of this disclosure, accumulates nicotine at lower levels than many other publicly reported varieties. This novel hybrid was developed using naturally occurring genetic variations and conventional breeding approaches, as described herein (i.e., no gene editing, genetic modification, or novel breeding approaches were used to develop these substances). This hybrid can be grown anywhere in the world without concerns regarding regulations concerning the results of gene editing or genetic modification breeding. Thus, the tobacco hybrid NCLA161 offers the commercial advantage of exceptionally low levels of nicotine, nornicotine, anabasine, and anatabin, while simultaneously having a less restrictive regulatory burden as a non-transgenic, non-genetically modified plant. In accordance with these data, embodiments of this disclosure include the NCLA161 variety, or varieties derived therefrom.

[0124] Example 2 Field trials were conducted to evaluate the reduction in nicotinic alkaloid levels of the tobacco varieties disclosed herein. Low-alkaloid inbred lines derived from K326 and three backcrosses were evaluated in two North Carolina field environments during the 2023 growing season. The experiments were conducted at the Upper Coastal Plain Research Station (RockyMount, NC) and the Oxford Tobacco Research Station (Oxford, NC). The experimental design used in each environment was a fully randomized block design, including three replications. Each plot consisted of a single row of 20 plants, which were managed according to standard hot-air drying production methods in North Carolina. The spacing within and between rows was 56 cm and 122 cm at each location, respectively.

[0125] Tobacco plots were harvested four times in each of two environments, according to their maturation and ripening rates. The harvested leaves were hot-air dried and weighed. Using a weighted average standard, 50 g of a composite sample of dried leaves was collected from each plot. The oven-dried samples were ground and analyzed for alkaloid composition using gas chromatography. The results are shown in Table 2 below.

[0126] [Table 2]

[0127] Unless otherwise specified, all analytes of nicotinic alkaloids (e.g., nicotine) have been measured on a dry weight basis using the materials described herein. As those skilled in the art will understand based on this disclosure, the levels of nicotine, nornicotine, anatabine, and anabasine can be measured by several methods known in the art. For example, nicotinic alkaloids can be quantified using gas chromatography (GC) and high-performance liquid chromatography (see, for example, Lisko et al 2013, Anal Chem. March 19; 85(6): 3380-3384, which provides a method for measuring the amount of nicotinic alkaloids in tobacco filters and tobacco). The analysis of tobacco alkaloids (e.g., nornicotine, anatabine, and anabasine) can also be performed by gas chromatography (GC) in combination with a wide range of detection techniques, including, but not limited to, flame ionization detection (FID), nitrogen-phosphorus detection (NPD), and mass spectrometry (MS). Other analytical approaches included high-performance liquid chromatography-ultraviolet detection (HPLC-UV), capillary zone electrophoresis-ultraviolet detection (CZE-UV), micellar electrokinetic capillary chromatography-ultraviolet detection (MECC-UV), nitrogen chemiluminescence detection (NCD), and microemulsion electrodynamic chromatography-ultraviolet detection (MEKC-UV).

[0128] biological deposit The regenerated material from each of the breeding strains, NCLA161, is deposited at the Crop and Soil Sciences Department, North Carolina State University, Raleigh, NC 27695. Specifically, NCLA161 is deposited under receipt number N23-303-2. Third-party experts pre-approved by North Carolina State University (NCSU) can obtain samples of biological material for any of the strains by submitting a written request to the address below: Ramsey S. Lewis, University Faculty Scholar and Charles and Marilyn Stuber, Distinguished Professor of Plant Breeding, Campus Box 7620, Crop and Soil Sciences Department, North Carolina State University, Raleigh, NC 27695 (tel: (919)-513-4802).

[0129] Except as permitted by 37 1.808(b) of the Federal Code of Rules, all restrictions imposed on the public availability of deposited biological material will be irreversibly removed upon the granting of a patent from this application or any application referencing it for priority.

Claims

1. A tobacco variety or part thereof that contains at least one nicotinic alkaloid at a reduced level compared to the corresponding tobacco plant or part thereof that exists naturally.

2. The tobacco variety according to claim 1, wherein the variety is non-transgenic.

3. The tobacco variety according to claim 1 or claim 2, wherein the at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine.

4. The tobacco variety according to any one of claims 1 to 3, wherein the at least one nicotinic alkaloid is nicotine, and the variety contains 0.29% or less nicotine.

5. The tobacco variety according to any one of claims 1 to 4, wherein the at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine.

6. The tobacco variety according to any one of claims 1 to 5, wherein the at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less of anatabine.

7. The tobacco variety according to any one of claims 1 to 6, wherein the at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less of anabasine.

8. The tobacco variety according to claim 1 or 2, wherein the at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.29% or less nicotine and 0.02% or less nornicotine.

9. The tobacco variety according to any one of claims 1 to 8, wherein the variety comprises a nic1 allele whose expression and / or function is reduced compared to wild-type NIC1.

10. The tobacco variety according to any one of claims 1 to 9, wherein the variety comprises a nic2 allele whose expression and / or function is reduced compared to the wild-type nic2.

11. The tobacco variety according to claim 9 or 10, wherein the nic1 and / or nic2 alleles are derived from at least one of the following strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21.

12. The tobacco variety according to any one of claims 1 to 8, wherein the variety contains a myc2a allele whose expression and / or function is reduced compared to the wild-type MYC2a.

13. The tobacco variety according to claim 12, wherein the myc2a allele comprises at least one nucleotide deletion compared to the wild-type MYC2a allele shown in SEQ ID NO:

1.

14. The tobacco variety according to claim 12, wherein the myc2a allele contains 1 to 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO:

1.

15. The tobacco variety according to claim 12, wherein the myc2a allele contains five nucleotide deletions compared to the wild-type MYC2a allele shown in Sequence ID No.

1.

16. The aforementioned deletion produces a cleaved MYC2A protein, according to any one of claims 13 to 15.

17. The tobacco variety according to any one of claims 12 to 16, wherein the myc2a allele includes a nucleic acid sequence that is at least 70% identical to sequence number 2.

18. The tobacco variety according to any one of claims 12 to 16, wherein the myc2a allele comprises a nucleic acid sequence that is at least 80% identical to sequence number 2.

19. The tobacco variety according to any one of claims 12 to 16, wherein the myc2a allele includes a nucleic acid sequence that is at least 90% identical to sequence number 2.

20. The tobacco variety according to any one of claims 12 to 19, wherein the myc2a allele is derived from N. tabacum.

21. The tobacco variety according to any one of claims 9 to 20, further comprising suppression of expression in at least one of the varieties selected from NBB1, A622, quinolate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), ornithine decarboxylase (ODC), aspartate oxidase (AO), quinolinic acid synthase (QS), N-methylputrescine oxidase (MPO), NtERF221, NtMYC1a, NtMYC1b, or NtMYC2b.

22. The tobacco variety according to any one of claims 1 to 22, wherein the variety is the NCLA161 variety or derived therefrom.

23. A descendant plant, seed, or cell produced from any of the tobacco varieties described in claims 1 to 22.

24. A tobacco product derived from any of the tobacco varieties described in claims 1 to 22, or any part thereof.

25. The tobacco product according to claim 24, wherein the product is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, recombined tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snus, pipe tobacco, cigarettes, cigarillo tobacco, cigar tobacco, and chewing tobacco.

26. The tobacco product according to claim 24, wherein the product is selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled cigarettes, sticks or pods for heated tobacco products, cigars, snuff, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.

27. A method for producing a tobacco variety containing at least one nicotinic alkaloid at a reduced level compared to the corresponding naturally occurring tobacco plant or a part thereof, wherein the method is: This includes crossing a first tobacco variety containing a first low-nicotine trait with a second tobacco variety containing a second low-nicotine trait to produce offspring plants. The method wherein the offspring plant contains at least one nicotinic alkaloid in a reduced concentration compared to either the first tobacco variety or the second tobacco variety.

28. The method according to claim 27, wherein the method includes backcrossing.

29. The method according to claim 27 or claim 28, wherein the at least one nicotinic alkaloid is selected from the group consisting of nicotine, nornicotine, anatabine, and anabasine.

30. The method according to any one of claims 27 to 29, wherein the at least one nicotinic alkaloid is nicotine, and the variety contains 0.29% or less nicotine.

31. The method according to any one of claims 27 to 30, wherein the at least one nicotinic alkaloid is nornicotine, and the variety contains 0.02% or less nornicotine.

32. The method according to any one of claims 27 to 31, wherein the at least one nicotinic alkaloid is anatabine, and the variety contains 0.01% or less of anatabine.

33. The method according to any one of claims 27 to 32, wherein the at least one nicotinic alkaloid is anabasine, and the variety contains 0.002% or less of anabasine.

34. The method according to any one of claims 27 to 33, wherein the at least one nicotinic alkaloid is nicotine and nornicotine, and the variety contains 0.29% or less nicotine and 0.02% or less nornicotine.

35. The method according to any one of claims 27 to 34, wherein the first low-nicotine trait and / or the second low-nicotine trait comprises a nic1 allele with reduced expression and / or function compared to wild-type NIC1.

36. The method according to any one of claims 27 to 35, wherein the first low-nicotine trait and / or the second low-nicotine trait comprises a nic2 allele with reduced expression and / or function compared to wild-type NIC2.

37. The method according to any one of claims 27 to 36, wherein the first tobacco variety and / or the second tobacco variety comprises nic1 and / or nic2 alleles derived from at least one of the following strains: LAFC53, LAK326, LATN90, MAFC5, LMAFC34, LAMD609, Lonibow, Vector21-41, LA Burley21, LI Burley21, and HI Burley21.

38. The method according to any one of claims 27 to 37, wherein the first and / or second tobacco variety comprises a myc2a allele with reduced expression and / or function compared to wild-type MYC2a.

39. The method according to claim 38, wherein the myc2a allele comprises at least one nucleotide deletion compared to the wild-type MYC2a allele shown in SEQ ID NO:

1.

40. The method according to claim 39, wherein the myc2a allele contains 1 to 5 nucleotide deletions compared to the wild-type MYC2a allele shown in SEQ ID NO:

1.

41. The method according to claim 40, wherein the myc2a allele comprises a deletion of five nucleotides compared to the wild-type MYC2a allele shown in SEQ ID NO:

1.

42. The method according to any one of claims 39 to 41, wherein the deletion generates a cleaved MYC2A protein.

43. The method according to any one of claims 39 to 42, wherein the myc2a allele includes a nucleic acid sequence that is at least 70% identical to sequence number 2.

44. The method according to any one of claims 39 to 42, wherein the myc2a allele includes a nucleic acid sequence that is at least 80% identical to sequence number 2.

45. The method according to any one of claims 39 to 42, wherein the myc2a allele includes a nucleic acid sequence that is at least 90% identical to sequence number 2.

46. The method according to any one of claims 39 to 45, wherein the myc2a allele is derived from N. tabacum.

47. The method according to any one of claims 27 to 46, wherein the first low-nicotine trait comprises a nic1 and / or nic2 allele with reduced expression and / or function compared to wild-type NIC1 and / or NIC2, and the second low-nicotine trait comprises a myc2a allele with reduced expression and / or function compared to wild-type MYC2a.

48. The method according to any one of claims 27 to 47, wherein the first tobacco variety, the second tobacco variety, and the offspring plants are non-transgenic.

49. Seeds or cells obtained from a progeny plant produced according to the method of claim 48.

50. A tobacco product derived from a progeny plant produced according to the method described in claim 48.

51. The tobacco product according to claim 50, wherein the product is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, recombined tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snus, pipe tobacco, cigarettes, cigarillo tobacco, cigar tobacco, and chewing tobacco.

52. The tobacco product according to claim 50, wherein the product is selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled cigarettes, sticks or pods for heated tobacco products, cigars, snuff, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.

53. A method for producing Nicotiana tabacum plants with reduced nicotinic alkaloid content, wherein the method is: In the plant Nicotiana tabacum, (a) One or more recombinant genes that reduce the expression and / or function of MYC2A, (b) comprising combining the recessive allele of nic1 and / or the recessive allele of nic2, The method wherein the Nicotiana tabacum plant has a reduced nicotinic alkaloid content compared to a corresponding, naturally occurring, or untransformed control tobacco plant.

54. The method according to claim 53, wherein the Nicotiana tabacum plant comprises a homozygous recessive allele of nic1 and / or a homozygous recessive allele of nic2.

55. The method according to claim 53 or claim 54, wherein one or more gene recombinations that reduce the expression and / or function of MYC2A are introduced by transcriptional activation-like effector nuclease (TALEN), meganuclease, zinc finger nuclease, CRISPR / Cas9 system, CRISPR / Cpf1 system, CRISPR / Csm1 system, gene knock-in technology or scientific technology, or a combination thereof.

56. The method according to any one of claims 53 to 55, further comprising suppressing the expression of at least one of NBB1, A622, quinolate phosphoribosyltransferase (QPT), putrescine N-methyltransferase (PMT), ornithine decarboxylase (ODC), aspartate oxidase (AO), quinolinic acid synthase (QS), N-methylputrescine oxidase (MPO), NtERF221, NtMYC1a, NtMYC1b, or NtMYC2b in the Nicotiana tabacum plant.

57. A Nicotiana tabacum plant produced by the method of any one of claims 53 to 56, wherein the plant comprises (a) one or more genetic modifications that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

58. A progeny plant or seed produced from the plant according to claim 57, wherein the progeny plant or seed comprises (a) one or more genetic modifications that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

59. A tobacco product comprising tobacco derived from the Nicotiana tabacum plant according to claim 57, wherein the plant comprises (a) one or more genetic modifications that reduce the expression and / or function of MYC2A, and (b) a recessive allele of nic1 and / or a recessive allele of nic2.

60. (a) The tobacco is selected from the group consisting of loose tobacco, shredded tobacco, cut tobacco, ground tobacco, powdered tobacco, recombined tobacco, tobacco extract, smokeless tobacco, moist or dry snuff, snus, pipe tobacco, cigarettes, cigarillo tobacco, cigars, and chewing tobacco, or (b) The tobacco product according to claim 59, wherein the product is a nicotine-reduced tobacco product selected from the group consisting of cigarillos, cigarettes, cretic cigarettes, filter cigarettes, self-made cigarettes, hand-rolled tobacco, sticks or pods for heated tobacco products, cigars, snuff, snus, tobacco-containing gum, tobacco-containing lozenges, and chewing tobacco.