Adhesion Proteins

Abstract

The present invention provides a novel polypeptide. The polypeptide found by the inventors of the present invention does not have self-cohesive properties and has adhesive properties. The adhesive polypeptide according to the present invention comprises a fragment of the amino acid sequence represented by SEQ ID NO: 1. The adhesive polypeptide according to a specific embodiment of the present invention includes, from among the amino acid sequence represented by SEQ ID NO: 1, amino acids at positions 22-50 and positions 161-175, and also includes, from among amino acids at positions 2847-3093, deletion of a region required to impart self-cohesive properties.

Description

[Technical field]

[0001] The present disclosure relates to adhesive polypeptides that do not have self-aggregation properties and uses thereof. [Background technology]

[0002] Acinetobacter sp. Tol5, which the present inventors previously isolated from a biofilter, is a non-pathogenic Gram-negative bacterium that exhibits high cell self-aggregation and high adhesion to various material surfaces, from hydrophobic plastic carriers to hydrophilic glass and metal surfaces. As a factor that brings about such adhesive properties, which have not been reported in other microorganisms, the present inventors discovered a novel bacterio-nanofiber present on the bacterial cell surface, and further identified a new protein that constitutes the nanofiber. This protein belongs to the trimer autotransporter adhesin (TAA) family of Gram-negative bacteria, and the present inventors named it AtaA (Non-Patent Document 1). Proteins belonging to the TAA family form homotrimers and have a common basic structure of signal peptide-head-neck-stalk-membrane anchor from the amino terminus to the carboxy terminus (Non-Patent Document 2). The membrane anchor domain, also called the translocator domain, forms a beta barrel in the outer membrane and transports the passenger domain, which is composed of the head-neck-stalk after the signal peptide is cleaved in the periplasm, to the outside of the cell and presents it on the cell surface as a fiber. The head side of the passenger domain becomes the tip of the fiber, which corresponds to the amino-terminal side of the mature protein. However, TAAs exist in monomeric polypeptide chains ranging from small ones with about 300 amino acid residues to large ones with more than 3000 amino acid residues, and the amino acid sequences, especially the types and arrangement of domains and motifs that compose the passenger domain, are diverse. The monomeric polypeptide chain that composes AtaA discovered by the present inventors consists of 3630 amino acids (including the signal peptide), making it one of the largest among TAA. It has a unique primary structure in which multiple long repeat sequences are arranged in a mosaic pattern on a long stalk. This repeat sequence is formed by repeating and mixing several types of domains. The head is also one of the domains, and in addition to the tip of the fiber, there is another one in the middle of the stalk, closer to the membrane anchor.

[0003] AtaA is extremely useful for immobilizing microorganisms, and is expected to be applied to various bioprocesses (see, for example, Patent Documents 1 and 2). In addition, in a previous patent application (Patent Document 3), the present inventors reported that various functional peptides and proteins can be introduced into AtaA and displayed on the surface of microorganisms. In Patent Document 1, AtaA and the gene encoding it (ataA gene) were called AadA and aadA gene, respectively. [Prior art documents] [Patent documents]

[0004] [Patent Document 1] International Publication No. 2009 / 104281 Brochure [Patent Document 2] International Publication No. 2014 / 156736 Brochure [Patent Document 3] International Publication No. 2015 / 030171 Brochure [Non-patent literature]

[0005] [Non-Patent Document 1] Ishikawa, M.; Nakatani, H.; Hori, K., AtaA, a new member of the trimeric autotransporter adhesins from Acinetobacter sp. Tol 5 mediating high adhesiveness to various abiotic surfaces.PLoS One 2012,7,(11),e48830. [Non-Patent Document 2] Linke, D.; Riess, T.; Autenrieth, IB; Lupas, A.; Kempf, VA, Trimeric autotransporter adhesins: variable structure, common function.Trends Microbiol.2006,14,(6),264-270. Summary of the Invention [Means for solving the problem]

[0006] As a result of intensive research, the present inventors have discovered that the AtaA protein can exhibit adhesiveness and self-aggregation even when only the passenger domain is cleaved from the cell surface and purified. Furthermore, they have discovered that adhesiveness and self-aggregation are carried out by the same domain. Nevertheless, they have unexpectedly discovered a new fact that an AtaA fragment that maintains adhesiveness but lacks self-aggregation can be obtained by deleting a domain different from the domain responsible for self-aggregation from the AtaA passenger domain cleaved from the cell. The present disclosure also relates to applications of the adhesive polypeptide of the present disclosure, such as a method for immobilizing and / or adhering a functionalizing entity.

[0007] The improved AtaA in the present disclosure was found not in a state where it grows out of a cell, but in the case of a protein obtained by isolating and purifying AtaA. In one specific embodiment, the absence of a C-terminal membrane binding site for this purpose can be one of the characteristics. In addition, the absence of a signal peptide as an adhesive protein can be one of the non-limiting representative characteristics. These characteristics, unlike the conventionally known AtaA, can be used as a protein material separated from a microorganism. In the present disclosure, it was found that when present on a cell, AtaA self-aggregates even without Chead. However, when separated from a cell and Chead is deleted, the AtaA fragment loses its self-aggregation property. These characteristics are not found in conventional AtaA.

[0008] Thus, the present disclosure provides: (1) A polypeptide that does not have self-aggregation properties and has adhesive properties, and that comprises a fragment of the amino acid sequence shown in SEQ ID NO: 1 or a modified sequence thereof. (2) A polypeptide according to any of the preceding items, comprising a sequence corresponding to amino acids 22 to 50 and 161 to 175 of the amino acid sequence shown in SEQ ID NO: 1 or a modified sequence thereof, and comprising one or more amino acid substitutions, additions, deletions or combinations thereof in the range of the sequence corresponding to amino acids 2847 to 3093 of the amino acid sequence shown in SEQ ID NO: 1. (3) The polypeptide according to any one of the preceding items, wherein the sequence range corresponding to amino acid positions 2847 to 3093 of the amino acid sequence shown in SEQ ID NO: 1 corresponds to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1. (4) The polypeptide according to any one of the preceding items, which lacks the entire sequence corresponding to amino acids 2855 to 3093 of the amino acid sequence shown in SEQ ID NO:1. (5) (A) a sequence corresponding to amino acids 1 to 3518 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, The sequence corresponding to amino acid positions 2855 to 3093 of SEQ ID NO: 1 contains at least one amino acid substitution, addition, deletion, or a combination thereof; A polypeptide comprising a sequence corresponding to amino acids 22 to 50 and 161 to 175 of SEQ ID NO:1, or a modified sequence thereof; (B) a sequence corresponding to amino acids 1 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, The sequence corresponding to amino acid positions 2855 to 3093 contains at least one amino acid substitution, addition, deletion, or a combination thereof; a polypeptide comprising a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; (C) a sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, a polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; (D) a portion of amino acids 1 to 3518 of the amino acid sequence shown in SEQ ID NO:1; The sequence corresponding to amino acid positions 2855 to 3093 of SEQ ID NO: 1 contains at least one amino acid substitution, addition, deletion, or a combination thereof; A polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175 of SEQ ID NO:1, or a modified sequence thereof; (E) a sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, a polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; (F) a sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof. A polypeptide comprising: (5A) (a) an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; or (b) an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; or (c) a sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; or (d) a sequence corresponding to amino acids 1 to 257 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof. 3. The polypeptide according to any one of the preceding items, (5B) (i) a polypeptide comprising an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; (ii) a polypeptide comprising an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; (iii) a polypeptide comprising an amino acid sequence corresponding to amino acids 1 to 268 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; or (iv) A polypeptide comprising an amino acid sequence corresponding to amino acids 1 to 257 of the amino acid sequence shown in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof. 3. The polypeptide according to any one of the preceding items, (5C) The polypeptide according to any one of the preceding items, which is an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. (5D) The polypeptide according to any one of the preceding items, which is an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. (5D) The polypeptide according to any one of the preceding items, which is an amino acid sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. (5E) The polypeptide according to any one of the preceding items, which is an amino acid sequence corresponding to amino acids 1 to 257 of the amino acid sequence set forth in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. (6) The polypeptide according to any one of the preceding items, which consists of an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO:1. (7) The polypeptide according to any one of the preceding items, which consists of an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO:1. (8) The polypeptide according to any one of the preceding items, which consists of an amino acid sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO:1. (9) The polypeptide according to any one of the preceding items, which consists of an amino acid sequence corresponding to amino acids 1 to 257 of the amino acid sequence shown in SEQ ID NO:1. (10) The polypeptide according to any one of the preceding items, wherein the modified sequence comprises a modification by conservative substitution. (11) The polypeptide according to any one of the preceding items, which is derived from Acinetobacter. (12) The polypeptide according to any one of the preceding items, wherein the Acinetobacter bacterium is Acinetobacter sp. Tol5 strain. (13) The polypeptide according to any one of the preceding items, further comprising an amino acid sequence different from SEQ ID NO:1. (14) The polypeptide according to any one of the preceding items, wherein the different amino acid sequence is fused to the fragment. (15) A complex of the polypeptide according to any one of the above items and a functionality-imparting entity. (16) A composition for adhering and / or fixing a first object to a second object without self-aggregation, comprising any of the polypeptides described in the above items or any of the complexes described in the above items. (17) The composition according to any of the preceding items for monolayer adhesion of the first object to the second object. (18) The composition according to any of the preceding items, wherein the first subject and the second subject are the same. (19) The composition according to any of the preceding items, wherein the first object and the second object are different. (20) The composition according to any of the preceding items, wherein at least one of the first object or the second object is a functionality-imparting entity. (21) The composition according to any of the preceding items, wherein the functionalizing entity is a peptide and / or a protein. (22) The composition according to any one of the preceding items, wherein the functionalization entity is streptavidin, neutral avidin, or a modified form thereof. (23) The composition according to any of the preceding items, wherein the functionality-imparting entity is a cell. (24) The composition according to any of the preceding items, wherein the second object is a support. (25) The composition according to any of the preceding items, wherein the support is a liposome. (26) A composition for adhering and / or immobilizing a first object to a second object without self-aggregation, comprising a polypeptide according to any of the preceding items or a complex according to any of the preceding items, wherein the first object is a peptide comprising the different amino acid sequence or the functionalization entity. (27) A method for adhering and / or fixing a first object to a second object, comprising acting on a first and / or second object with a polypeptide described in any of the above items or a complex described in any of the above items. (28) A method according to any of the preceding items for monolayer adhesion of the first object to the second object. (29) The method according to any of the preceding items, wherein the first subject and the second subject are the same. (30) The method according to any of the preceding items, wherein the first subject and the second subject are different. (31) The method according to any of the preceding items, wherein at least one of the first object or the second object is a functionality-imparting entity. (32) The method according to any of the preceding items, wherein the functionalizing entity is a peptide and / or a protein. (33) The method according to any one of the preceding items, wherein the functionalization entity is streptavidin, neutral avidin, or a modified form thereof. (34) The method according to any of the preceding items, wherein the function-imparting entity is a cell. (35) The method according to any of the preceding items, wherein the second object is a support. (36) The method according to any one of the preceding items, wherein the support is a liposome. (37) A method for adhering and / or immobilizing the peptide comprising a different amino acid sequence or the functional entity to a second object without causing self-aggregation, comprising allowing the polypeptide according to any of the above items or the complex according to any of the above items to act on the second object. (38) A support on which the polypeptide according to any one of the above items or the complex according to any one of the above items is immobilized. (39) The support according to any of the preceding items, wherein the support is selected from the group consisting of lipid bilayers, glass, silica, silicon, ceramics, silicon dioxide, plastics, metals, titanium, acrylics, and natural and synthetic polymers. (40) Use of a polypeptide according to any of the preceding items or a complex according to any of the preceding items for adhering and / or fixing a first object to a second object without self-aggregation. (41) The use according to any one of the preceding items, wherein the use is for monolayer adhesion of the first object to the second object. (42) The use according to any of the preceding items, wherein the first subject and the second subject are the same. (43) The use according to any of the preceding items, wherein the first subject and the second subject are different. (44) The use according to any of the preceding items, wherein at least one of the first object or the second object is a functionality-imparting entity. (45) The use according to any of the preceding items, wherein the functionalizing entity is a peptide and / or a protein. (46) The use according to any one of the preceding items, wherein the functionalization entity is streptavidin, neutral avidin, or a modified form thereof. (47) The use according to any of the preceding items, wherein the functionalizing entity is a cell. (48) The use according to any of the preceding items, wherein the second object is a support. (49) The use according to any of the preceding items, wherein the support is a liposome. (50) Use of the polypeptide according to any of the preceding items or the complex according to any of the preceding items for adhering and / or immobilizing a first object to a second object without self-aggregation, wherein the first object is a peptide comprising the different amino acid sequence or the functionalization entity.

[0009] It is contemplated that the present disclosure may provide one or more of the above features in combinations other than those specifically described. Still further embodiments and advantages of the present disclosure will be recognized by those skilled in the art upon reading and understanding the following detailed description, if necessary. Effect of the Invention

[0010] Using the present disclosure, it is possible to fix and / or adhere adhesive polypeptides (including fusion polypeptides) and / or complexes of the adhesive polypeptides of the present disclosure and functional entities without self-aggregation. In one aspect, the present disclosure makes it possible to fix and / or adhere adhesive polypeptides (including fusion polypeptides) and functional entities onto the membrane of a liposome. Thus, the adhesive polypeptides of the present disclosure are useful in separation processes in the pharmaceutical and chemical industries, regenerative medicine, cell engineering, medical engineering, biosensors, and material engineering such as surface modification and design of functional materials. [Brief description of the drawings]

[0011] [Figure 1]FIG. 1 shows cell aggregation analysis by microscopic observation. FIG. 1A shows a model system for aggregation analysis. In FIG. 1A, ellipses indicate cells, dark ellipses indicate cells expressing mRFP (red fluorescent protein), and light ellipses indicate cells expressing EGFP (green fluorescent protein). The upper center of FIG. 1A shows cell aggregation patterns when both cells have aggregation activity, and the lower center shows cell aggregation patterns when only mRFP-expressing cells have aggregation activity and EGFP-expressing cells do not have aggregation activity. The third from the left of FIG. 1A shows cell presence patterns when each cell aggregate is divided into 2 μm sections. The rightmost part of FIG. 1A shows a graph in which the presence patterns of each cell are counted based on the ratio of cells emitting GFP fluorescence. In the graph, the horizontal axis represents the ratio of cells emitting GFP fluorescence, and from the left, 0-20%, 20-40%, 40-60%, 60-80%, and 80-100% of cells are observed to be GFP fluorescent, and the vertical axis represents the ratio of the number of compartments in which the ratio of cells emitting GFP fluorescence was observed. Figure 1B shows an image of a cell aggregate formed by mixing Acinetobacter sp. Tol5 strain expressing mRFP and normal AtaA protein with Acinetobacter sp. Tol5 strain expressing EGFP and normal AtaA protein, and a histogram of the ratio of cells expressing EGFP in the microcompartments. Figure 1C shows images of cell aggregates formed by mixing Acinetobacter sp. Tol5 strain expressing mRFP and normal AtaA protein with the ΔAtaA Acinetobacter sp. Tol5 strain expressing EGFP, and a histogram of the percentage of cells expressing EGFP in the microcompartments. [Diagram 2]Figure 2 shows aggregation experiments using full-length AtaA protein or partial deletion strains. Figure 2A shows the domain structures of (1) AtaA with a structure lacking Nhead, (2) AtaA with a structure lacking a part of Nstalk, (3) AtaA with a structure lacking a part of Nstalk, (4) AtaA with a structure lacking a part of Nstalk, (5) AtaA with a structure lacking Chead in addition to a part of Nstalk, and (6) AtaA with a structure lacking most of Cstalk (FGG domain preserved). Figure 2B shows images of cell aggregates formed by mixing Acinetobacter sp. Tol5 strain expressing mRFP and normal AtaA protein with Acinetobacter sp. Tol5 strain expressing EGFP and normal AtaA protein or the six types of partial deletions in Figure 2A, and a histogram of the proportion of cells expressing EGFP in the microcompartments. [Diagram 3] FIG. 3 shows that the Nhead recombinant protein has a secondary structure. FIG. 3A shows, from the top to the bottom, the construct design of the Nhead recombinant protein and the domain structure of the AtaA fragment portion of the Nhead recombinant protein. FIG. 3B shows the results of CD spectrum measurement of the Nhead recombinant protein. In FIG. 3B, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). FIG. 3C shows the amino acid sequence of the Nhead recombinant protein (AtaA59-325-GCN4pII-His) and a detailed explanation thereof. [Figure 4] Figure 4 shows the results of measuring the adhesiveness of microorganisms using mutants lacking the loop structure in the Nhead domain. The axes of the graph show, from left to right, the results when using an AtaA-deficient strain (ΔataA), wild type (AtaA), ΔNhead-deficient strain, Δ1st loop-deficient strain, and Δ2nd loop-deficient strain, with the black bars corresponding to the adhesiveness to polystyrene plates and the gray bars corresponding to the adhesiveness to glass plates. The vertical axis of the graph shows the adhesiveness of microorganisms measured by A590. [Diagram 5]Figure 5 shows the dispersibility and self-aggregation of E. coli recombinant Nhead. The horizontal axis of the graph shows the size (d.nm) of the Nhead purified product, and the vertical axis shows the volume (ratio) of the Nhead purified product. [Figure 6] 6 shows micrographs of aggregates of Acinetobacter sp. Tol5 strain. The left side shows a micrograph of an aggregate of Acinetobacter sp. Tol5 strain, and the right side shows a micrograph of the case where an AVL peptide was added to Acinetobacter sp. Tol5 strain. [Figure 7] Figure 7 shows the adhesiveness of E. coli recombinant Nhead measured by QCM-D. Figure 7A shows adhesion to a polystyrene sensor, and Figure 7B shows adhesion to a silica sensor. In each graph, the vertical axis shows the amount of adhesion in terms of Δf7 / 7 (Hz) value, and the horizontal axis shows time. The arrows on the graph indicate, from the left, the time when 50 μg / ml Nhead was added, the time when Nhead was added again, the time when rinsing was performed, the time when 0.1 mM AVL peptide was added, and the time when rinsing was performed again. [Figure 8] Figure 8 shows the autoaggregation and microbial immobilization rates of strains expressing AtaA variants of WChead, in which the Nhead of full-length AtaA was replaced with Chead. Figure 8A shows the autoaggregation rates of a strain not expressing AtaA (ΔAtaA), a wild-type strain (AtaA), a strain expressing AtaA lacking Nhead (ΔNhead), and a strain expressing AtaA variants of WChead (WChead). Figure 8B shows the immobilization rates on polystyrene and glass surfaces of the wild-type strain (AtaA), a strain expressing AtaA lacking Nhead (ΔNhead), and a strain expressing AtaA variants of WChead (WChead). [Figure 9]FIG. 9 shows that the Nhead-SNAP fusion peptide has a secondary structure. FIG. 9A is a diagram showing, from the top to the bottom, the construct design of the Nhead-SNAP fusion peptide and the domain structure of the AtaA fragment portion of the Nhead-SNAP fusion peptide. FIG. 9B shows the results of CD spectrum measurement of the Nhead-SNAP fusion peptide. In FIG. 9B, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). FIG. 9C shows the amino acid sequence of the Nhead-SNAP fusion peptide (AtaA59-325-GCN4pII-SNAP-His) and a detailed explanation thereof. [Figure 10] FIG. 10 shows the immobilization of Nhead-SNAP fusion peptide to various material surfaces. FIG. 10A shows a model for investigating the immobilization of Nhead-SNAP fusion peptide to various material surfaces by a fluorescent molecular substrate of SNAP protein fused to Nhead, and corresponds to the steps of dropping Nhead-SNAP fusion peptide onto the material surface, dropping fluorescent molecular substrate, washing, and fluorescence measurement, from the left. FIG. 10B shows the fluorescence when only Nhead-SNAP fusion peptide or SNAP protein is attached to various materials, and the columns of the photographs show glass, polystyrene, titanium, and polytetrafluoroethylene resin materials from the left, and the rows of the photographs show the fluorescence when no protein is attached, when Nhead-SNAP fusion peptide is attached, and when SNAP protein is attached, from the top. [Figure 11]Figure 11 shows the antibacterial properties of a surface when the antibacterial peptide CAP18 with a benzylguanyl (BG) group is immobilized on a polystyrene surface via an Nhead-SNAP fusion peptide. The columns of photographs show, from left to right, a surface with nothing attached, a surface with an Nhead-SNAP fusion peptide attached, and a surface with a SNAP protein attached. The rows of photographs show, from top to bottom, a surface without the antibacterial peptide applied (not coated with the antibacterial peptide) and a surface with the antibacterial peptide applied (coated with the antibacterial peptide). The white areas in each photograph represent the fluorescence from Pseudomonas aeruginosa (fluorescently stained) attached to the material surface. The fewer the white areas, the more microorganisms are killed and do not attach, and therefore the higher the antibacterial properties. The middle photograph in the bottom row has almost no white areas compared to the other photographs, and shows a high antibacterial effect against Pseudomonas aeruginosa. [Figure 12] FIG. 12 shows that the SNAP-Nhead fusion peptide having the SNAP protein at the N-terminus has a secondary structure. FIG. 12A shows, from the top to the bottom, a diagram clearly illustrating the construct design of the SNAP-Nhead fusion peptide and the domain structure of the AtaA fragment portion of the SNAP-Nhead fusion peptide. FIG. 12B shows the results of CD spectrum measurement of the SNAP-Nhead fusion peptide. In FIG. 12B, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). FIG. 12C shows the amino acid sequence of the SNAP-Nhead fusion peptide (SNAP-AtaA60-325-GCN4pII-His) and a detailed explanation thereof. [Figure 13]FIG. 13 shows a comparison between the case where SNAP protein is fused to the N-terminus side of Nhead (SNAP-Nhead) and the case where SNAP protein is fused to the C-terminus side (Nhead-SNAP). The graph shows a comparison of adhesiveness between Nhead-SNAP fusion peptide and SNAP-Nhead fusion peptide. The vertical axis of the graph shows the fluorescence intensity at 535 nm, and the horizontal axis shows, from the left, the case where nothing is attached, the case where Nhead-SNAP fusion peptide is attached, the case where SNAP-Nhead fusion peptide is attached, and the case where SNAP protein is attached. In the graph, the black axis shows the case where BG-modified CAP18 (BG) is not added, and the white axis shows the fluorescence intensity when BG-modified CAP18 (BG) is added. The difference between the black axis and the white axis shows the amount of the fluorescent substrate that cannot be attached due to the attachment of BG-modified CAP18, that is, the amount equivalent to the amount of BG-modified CAP18 attached. [Figure 14] FIG. 14 shows that the Nhead-SNAP fusion peptide without the GCN4pII tag has a secondary structure. FIG. 14A shows, from the top to the bottom, the construct design of the Nhead-SNAP_ΔGCN4pII fusion peptide and a diagram clearly showing the domain structure of the AtaA fragment portion of the Nhead-SNAP_ΔGCN4pII fusion peptide. FIG. 14B shows the results of CD spectrum measurement of the Nhead-SNAP_ΔGCN4pII fusion peptide. In FIG. 14B, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). FIG. 14C shows the amino acid sequence of the Nhead-SNAP_ΔGCN4pII fusion peptide (AtaA59-325-SNAP-His) and a detailed explanation thereof. [Figure 15]Figure 15 shows that the Nhead-SNAP fusion peptide with the coiled coil region at the N-terminus of Nstalk deleted (ΔCC) has a secondary structure. Figure 15A shows, from the top to the bottom, the construct design of the Nhead-SNAP_ΔCC fusion peptide with the coiled coil, which is part of the FGG domain at the N-terminus of Nstalk, deleted, and the domain structure of the AtaA fragment of the Nhead domain-SNAP_ΔCC fusion peptide. Figure 15B shows the results of CD spectrum measurement of the Nhead-SNAP_ΔCC fusion peptide. In Figure 15B, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). Figure 15C shows the amino acid sequence of the Nhead-SNAP_ΔCC fusion peptide (AtaA59-314-GCN4pII-SNAP-His) and its detailed explanation. [Figure 16] Figure 16 shows the results of the immobilization test of the various Nhead-SNAP fusion peptides shown in Figures 9, 14, and 15. The results show the amount of immobilized fluorescent molecule substrate measured based on the fluorescence intensity of the fluorescent molecule, which is a substrate of the SNAP protein and forms a covalent bond with the SNAP protein. The graphs show the results of the fluorescent molecule immobilization test when polystyrene (PS) plates are coated with, from the left, Non (only the fluorescent molecule substrate is added without coating with protein), Nhead-SNAP fusion peptide, Nhead-SNAP_ΔGCN4pII fusion peptide, and Nhead-SNAP_ΔCC fusion peptide, and the vertical axis of the graph shows the fluorescence value (535 nm). [Figure 17] FIG. 17 shows that E. coli recombinant Nhead and streptavidin form a complex. The graph shows the results of measuring the particle size of Nhead or streptavidin (SA) alone, or a mixture of the two, by dynamic light scattering (DLS). The horizontal axis of the graph shows the particle size, and the vertical axis shows the particle abundance ratio in volume ratio. In the graph, the broken line with a peak near a particle size of 10 nm corresponds to the measurement results of Nhead alone and SA alone, and the broken line with a peak at a particle size exceeding 1000 nm corresponds to the measurement results of the complex of Nhead and SA. [Figure 18]FIG. 18 shows that E. coli recombinant Nhead binds to neutral avidin. The graph shows the results of measuring the particle size of Nhead alone, neutral avidin alone, and a mixture of the two by dynamic light scattering (DLS). The horizontal axis of the graph shows the particle size (nm), and the vertical axis shows the abundance ratio of each particle (volume %). The horizontal axis of the graph shows the particle size, and the vertical axis shows the abundance ratio of particles in volume ratio. In the graph, the broken line with a peak near a particle size of 10 nm corresponds to the measurement results of Nhead alone and neutral avidin alone, and the broken line with a peak at a particle size of more than 1000 nm corresponds to the measurement results of the complex of Nhead and neutral avidin. [Figure 19] Figure 19 shows the results of a comparative example, which shows that E. coli recombinant Nhead and avidin do not bind to each other and do not form a complex. The graph shows the results of measuring the particle sizes of Nhead, avidin alone, and a mixture of the two by dynamic light scattering (DLS). The horizontal axis of the graph shows the particle size, and the vertical axis shows the particle abundance ratio in volume ratio. [Figure 20] FIG. 20 shows the immobilization of bacteria on a plate whose surface is coated with E. coli recombinant Nhead. FIG. 20A shows an experimental system for detecting the immobilization of bacteria. FIG. 20B shows a photograph of the immobilized Bacillus subtilis on the left and the immobilized E. coli on the right. For each bacterium, the photographs show, from the left, no coating, BSA coating, and Nhead coating. In each photograph, fluorescently stained bacterial cells appear white. [Figure 21] Figure 21 shows particle analysis of liposomes with Nhead-SNAP fusion peptide immobilized on the surface (Nhead surface-modified liposomes). In Figure 21, the vertical axis of the graph shows the ratio (%) based on the number of liposome diameters, and the horizontal axis shows the diameter of the liposomes. [Figure 22]Figure 22 shows the immobilization of Nhead-SNAP fusion peptide on the surface of liposomes (Nhead surface-modified liposomes). In Figure 22, the vertical axis of the graph shows the fluorescence intensity of Alexa Fluor 647, and the horizontal axis shows the results for Nhead surface-modified liposomes via benzylguanyl (BG) groups and unmodified normal liposomes when 0 μM, 1 μM, and 10 μM of Nhead-SNAP fusion peptide were added, respectively. [Figure 23] Figure 23 shows the construct design of E. coli recombinant NheadNstalk (NhNs)-SNAP fusion peptide. The upper row shows the full length of AtaA protein, and the lower row shows NhNs-SNAP fusion peptide. The full length sequence in the upper row shows the domain group structure of AtaA protein, which corresponds from the left to the right to the SP (signal peptide), Nhead, Nstalk, Chead, Cstalk, and TM (membrane anchor) domains. The lower row shows the structure of the fusion peptide, which corresponds from the left to the right to the Nhead, Nstalk, GCN4 adaptor, SNAP protein, and Strep tag. [Figure 24] 24 shows micrographs of NhNs fiber surface-modified liposomes and control normal liposomes. The left side shows a photograph of NhNs fiber surface-modified liposomes, and the right side shows a photograph of unmodified normal liposomes (control). [Diagram 25] FIG. 25 shows the results of DLS analysis of the particle shape of liposomes modified with the NhNs fiber surface. For comparison, FIG. 25A shows the results of DLS analysis of Acinetobacter sp. Tol5 strain and ΔataA mutant strain suspended in pure water, where the open dots indicate the results for Acinetobacter sp. Tol5 strain and the gray dots indicate the results for the ΔataA mutant strain. FIG. 25B shows that Tol5 strain cells do not self-aggregate in pure water. FIG. 25C shows the results of DLS analysis of NhNs fiber surface-modified liposomes and unmodified liposomes, where the open dots indicate the results for NhNs fiber surface-modified liposomes and the gray dots indicate the results for unmodified liposomes. [Figure 26]FIG. 26 shows an adhesion assay using liposomes modified with the NhNs fiber surface. FIG. 26A shows the results of an experiment in which liposomes were attached to a polystyrene plate, with the left side showing the adhesion results of liposomes modified with NhNs fiber using benzylguanyl group (BG) liposomes, and the right side showing the adhesion results of control unmodified liposomes using egg phosphatidylcholine (PC) liposomes. FIG. 26B shows the results of an experiment in which liposomes were attached to a glass plate, with the left side showing the adhesion results of liposomes modified with the NhNs fiber surface, and the right side showing the adhesion results of control unmodified liposomes. FIG. 26C shows the results of an enzyme reaction test using NhNs fiber-modified liposomes in which β-glucuronidase (GUS) was encapsulated and immobilized on a polystyrene plate. In the graph, the axis showing data with circles corresponds to the data for NhNs fiber surface-modified liposomes encapsulating GUS, the axis showing data with triangles corresponds to the data for unmodified liposomes encapsulating GUS, and the axis showing data with squares corresponds to the data for NhNs fiber surface-modified liposomes not containing GUS. [Figure 27] FIG. 27 shows that the SpyCatcher-Nhead fusion peptide fused with SpyCatcher has a secondary structure. FIG. 27A shows, from the top to the bottom, the construct design of the SpyCatcher-Nhead fusion peptide and a diagram clearly showing the domain structure of the AtaA fragment portion of the SpyCatcher-Nhead fusion peptide. FIG. 27B shows the amino acid sequence of the SpyCatcher-Nhead fusion peptide (SpyCatcher-AtaA59-325-GCN4pII-His) and its detailed explanation. FIG. 27C shows the results of CBB staining of the SpyCatcher-Nhead fusion peptide. In FIG. 27C, the molecular weight is shown on the left, and the arrow on the right indicates the molecular weight of the SpyCatcher-Nhead fusion peptide. FIG. 27D shows the results of CD spectrum measurement of the SpyCatcher-Nhead fusion peptide. In FIG. 27D, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). [Figure 28]FIG. 28 shows that the SpyTag-GFP fusion peptide fused with SpyTag has a secondary structure. FIG. 28A shows the construct design of SpyTag-GFP. FIG. 28B shows the amino acid sequence of the SpyTag-GFP fusion peptide (SpyTag-GFP-His) and its detailed description. FIG. 28C shows the result of CBB staining of the SpyTag-GFP fusion peptide. In FIG. 28C, the molecular weight is shown on the left, and the arrow on the right indicates the molecular weight of the SpyTag-GFP fusion peptide. FIG. 28D shows the result of CD spectrum measurement of the SpyTag-GFP fusion peptide. In FIG. 28D, the horizontal axis of the graph indicates wavelength (nm), and the vertical axis indicates CD (mdeg). [Figure 29] FIG. 29 shows that SpyCatcher-Nhead binds to SpyTag-GFP. FIG. 29A shows an experimental system for detecting the binding between SpyCatcher-Nhead and SpyTag-GFP. FIG. 29B shows the results of detecting the binding between SpyCatcher-Nhead and SpyTag-GFP by CBB staining. In FIG. 29B, the CBB staining data correspond to, from the left, a molecular weight marker, SpyTag-GFP alone, SpyCatcher-Nhead alone, and a mixture of SpyCatcher-Nhead and SpyTag-GFP. The molecular weight is shown on the left, and the arrows on the right indicate the molecular weights of the GFP-Nhead binding product, the SpyCatcher-Nhead fusion peptide, and the SpyTag-GFP fusion peptide. [Diagram 30]FIG. 30 shows that SpyTag-GFP can be immobilized on a polystyrene plate via SpyCatcher-Nhead. FIG. 30A shows a model diagram of immobilizing SpyTag-GFP by immobilizing SpyCatcher-Nhead on a polystyrene (PS) plate and binding SpyTag-GFP to it. FIG. 30B shows the results of measuring the amount of immobilized GFP based on the fluorescence intensity of GFP. The graphs show the results of the immobilization test of GFP molecules when a polystyrene plate was coated with, from the left, SpyTag-GFP alone, SpyTag-GFP and Nhead, and SpyTag-GFP and SpyCatcher-Nhead, and the vertical axis of the graph shows the relative fluorescence intensity (excitation wavelength 485 nm / fluorescence wavelength 535 nm). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0012] The present disclosure will be described below while showing the best mode. Throughout this specification, the expression of the singular form should be understood to include the concept of the plural form, unless otherwise specified. Therefore, the singular article (for example, in the case of English, "a", "an", "the", etc.) should be understood to include the concept of the plural form, unless otherwise specified. In addition, it should be understood that the terms used in this specification are used in the sense commonly used in the field, unless otherwise specified. Therefore, unless otherwise defined, all technical terms and scientific and technical terms used in this specification have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. In case of conflict, the present specification (including definitions) will take precedence.

[0013] The following provides definitions of terms particularly used in this specification and / or explains basic technical content as appropriate.

[0014] (Definition of terms) As used herein, the terms "adhere" and "adhesion" and "immobilize" and "immobilization" are used interchangeably and in the sense commonly used in the art, meaning to make at least a portion of the object of "adhesion" or "immobilization" immobilize, at least relatively, from a fixed position on the object to which it is adhered or immobilized.

[0015] In this specification, "aggregate" is used in the sense that it is usually used in this technical field, and means that a polypeptide or the like in a dispersed state gathers in a mass with the polypeptide itself or with other polypeptides or the like. In particular, when the same type of polypeptide chain aggregates with each other, it is said to self-aggregate (self-aggregation). For example, in the case of AtaA, a phenomenon occurs in which a mass is formed by the aggregation of multiple AtaAs with each other, so it can be said that it has a self-aggregation ability. Since the adhesive polypeptide of the present disclosure does not have self-aggregation properties, in one example, it does not adhere in a stack, which is advantageous in situations where adhesion in a stack is not preferable.

[0016] Furthermore, the lack of self-aggregation allows the polypeptide to be uniformly dispersed in the adhesive composition, enabling a uniform stress state to be generated, thereby enabling stronger adhesion or fixation.

[0017] In addition, the property of maintaining adhesion without self-aggregation is useful in the following applications: That is, the adhesive polypeptides of the present disclosure are useful for controlling the functions of fusion products and functionalization entities in separation processes in the pharmaceutical and chemical industries, regenerative medicine, cell engineering, medical engineering, biosensors, and material engineering such as surface modification and design of functional materials, by adhering or immobilizing fusion products and functionalization entities in a monolayer.

[0018] As used herein, "bind" or "bound" is used in the sense commonly used in the art, and means a physical or chemical association between two substances or a combination thereof. In particular, in the present disclosure, the interaction between an adhesive polypeptide and streptavidin, neutral avidin, or a modified form thereof, etc., corresponds to "binding" in the present specification. In the present specification, "binding" corresponds to a specific interaction, and is therefore also referred to as "specific binding". On the other hand, adhesion or fixation is due to a non-specific interaction.

[0019] As used herein, the terms "separation" and "separate" are used in the sense commonly used in the art, and refer to the release of at least a portion of the "bonded" state between two or more substances that are in a "bonded" state.

[0020] As used herein, the term "disintegration" or "disintegrate" is used in the sense commonly used in the art, and means that at least a portion of the "aggregated" state between two or more substances that are in an "aggregated" state is released.

[0021] In this specification, "AtaA" refers to a protein belonging to the trimeric autotransporter adhesin (TAA) family of gram-negative bacteria. AtaA forms a homotrimer and has a domain group structure arranged in the order of signal peptide-Nhead-Nstalk-Chead-Cstalk-membrane anchor from the amino terminus to the carboxy terminus. Furthermore, Nhead, Nstalk, Chead, and Cstalk contain various domains such as Ylhead, Trp-ring, GIN, and FGG, and some domains are repeated. Each domain is connected by a structure such as a neck or coiled coil. The amino acid sequence and nucleic acid sequence of a fragment sequence of AtaA that does not contain a signal peptide at the N-terminus, has a methionine added to the beginning, and has a binding site to the outer membrane of a microbial cell deleted, so to speak, separated from the cell, are shown in SEQ ID NOs: 1 and 2, respectively. In SEQ ID NOs: 1 and 2, Nhead (including neck) corresponds to amino acid positions 2 to 258 and nucleic acid positions 4 to 774, Nstalk corresponds to amino acid positions 259 to 2846 and nucleic acid positions 775 to 8538, Chead (excluding neck) corresponds to amino acid positions 2855 to 3093 and nucleic acid positions 8563 to 9279, and Cstalk (including β-barrel-containing portion) corresponds to amino acid positions 3094 to 3518 and nucleic acid positions 9280 to 10554. Furthermore, there are two loop structures related to adhesiveness in the Nhead domain, and these loop structures correspond to amino acid positions 22 to 50 and 161 to 175, and nucleic acid positions 64 to 150 and 481 to 525, respectively. Chead may be involved in self-aggregation.

[0022] As used herein, "Acinetobacter" refers to the genus Acinetobacter in biological classification. The genus Acinetobacter typically includes the Acinetobacter sp. Tol5 strain. The Acinetobacter sp. Tol5 strain is a strain having toluene decomposition ability isolated from an exhaust gas treatment reactor, and is available from the Hori Katsutoshi Laboratory, Nagoya University. The adhesive polypeptides of the present disclosure include, but are not limited to, those produced by the Acinetobacter sp. Tol5 strain belonging to the genus Acinetobacter.

[0023] In this specification, the term "functionalizing entity" is used in the sense commonly used in the technical field, and means an entity having any function or action. The functionalizing entity is bound by the adhesive polypeptide or a fragment thereof in the present disclosure, and the function or action thereof is typically various functions or actions useful in separation processes in the pharmaceutical and chemical industries, regenerative medicine, cell engineering, medical engineering, biosensors, material engineering such as surface modification and design of functional materials, etc., including, but not limited to, functions such as labeling. In one embodiment, the functionalizing entity is a protein and / or peptide. In a specific embodiment, the functionalizing entity is streptavidin, neutral avidin, or a modified form thereof. In another embodiment, the functionalizing entity is a cell.

[0024] In this specification, the term "streptavidin" is used in the sense commonly used in the technical field, and refers to streptavidin produced by the genus Streptomyces, or its variants, derivatives, or equivalents. Examples of its amino acid sequence include, but are not limited to, those identified by P22629-1 and its nucleic acid sequence by X03591. In this specification, "streptavidin" typically binds to biotin with high affinity. In this specification, "neutral avidin" is used in the same sense as "neutra(avidin)" and the like, and refers to a modified avidin (particularly a deglycosylated form) that has a pI value near neutrality and suppresses nonspecific binding. "Neutral avidin" also typically binds to biotin with high affinity. "Streptavidin" and "neutral avidin" have the property of specifically binding to the adhesive polypeptide of the present disclosure.

[0025] As used herein, the term "liposome" is used in the sense commonly used in the art, and refers to a vesicle that is a spherical self-assembly formed by amphiphilic molecules containing a polar hydrophilic group and a lipidic lipophilic group, has a lipid bilayer structure, and forms a substantially closed structure in an aqueous medium. Liposomes can encapsulate DNA, proteins, peptides, etc. in their interior. In certain embodiments, liposomes are used as transport vesicles. In another embodiment, liposomes are useful as artificial cells.

[0026] As used herein, a "corresponding" amino acid or nucleic acid or portion refers to an amino acid or nucleotide in a polypeptide or polynucleotide molecule (e.g., AtaA, etc.) that has or is predicted to have the same action as a specific amino acid or nucleotide or portion in a polypeptide or polynucleotide that is used as a reference for comparison, and in particular in adhesive polypeptides, refers to an amino acid that is present at a similar position in a site essential for adhesion and contributes to adhesiveness in a similar manner. For example, in the case of an antisense molecule, it may be a similar portion in an orthologue that corresponds to a specific portion of the antisense molecule. The corresponding amino acid may be, for example, a specific amino acid that is cysteinized, glutathionylated, formed with an SS bond, oxidized (e.g., oxidation of the methionine side chain), formylated, acetylated, phosphorylated, glycosylated, myristylated, or the like. Alternatively, the corresponding amino acid may be an amino acid that is responsible for trimerization. Such a "corresponding" amino acid or nucleic acid may be a region or domain that spans a certain range. Therefore, in such a case, it is referred to as a "corresponding" region or domain in this specification.

[0027] As used herein, "fusion" means that two or more molecules (e.g., polypeptides or nucleic acids) or parts thereof are linked by a covalent bond. When two or more parts are polypeptides and are covalently linked to form a complex, the resulting fusion product or fusion product is a fusion protein or fusion peptide, which may also be called a chimeric peptide. In the case of a polypeptide fusion, a nucleic acid fusion is usually produced by linking the base sequences of nucleic acids encoding two types of polypeptides, and the fusion peptide is produced as a recombinant protein using the nucleic acid fusion product as a blueprint.

[0028] As used herein, the term "complex" is used in the sense commonly used in the art, and refers to any construct containing two or more parts. For example, when one part is a polypeptide, the other part may be a polypeptide or other substances (e.g., sugars, lipids, nucleic acids, other carbohydrates, and even cells, etc.). As used herein, the two or more parts constituting the complex may be bonded in a non-covalent manner (e.g., hydrogen bonds, ionic bonds, hydrophobic interactions, van der Waals forces, etc.). Thus, as used herein, the term "complex" includes molecules formed by linking multiple types of molecules such as polypeptides, polynucleotides, lipids, sugars, and low-molecular-weight molecules. In addition, the two or more parts of a complex formed by a bond other than a covalent bond may be separated by a simple method. Examples of the simple method include operations such as applying shear stress by physical means such as stirring, adding a compound, changing solution conditions such as pH and salt concentration, and changing the temperature.

[0029] It is well known in the art that a certain amino acid can be replaced by another amino acid with similar hydrophobicity index and still produce a protein with similar biological function (e.g., an equivalent protein in adhesiveness).In such amino acid replacement, the hydrophobicity index is preferably within ±2, more preferably within ±1, and even more preferably within ±0.5.It is understood in the art that such amino acid replacement based on hydrophobicity is efficient.Hydrophilicity index is also considered in making variants. As described in U.S. Patent No. 4,554,101, the following hydrophilicity indexes are assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartic acid (+3.0±1); glutamic acid (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (-0.5); histidine (-0.5); cysteine ​​(-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); and tryptophan (-3.4). It is understood that an amino acid can be substituted with another that has a similar hydrophilicity index and still provides a biological equivalent. In such amino acid substitutions, the hydrophilicity index is preferably within ±2, more preferably within ±1, and even more preferably within ±0.5.

[0030] In the present disclosure, "conservative substitution" refers to an amino acid substitution in which the hydrophilicity index or / and hydrophobicity index of the original amino acid and the substituted amino acid are similar as described above.Examples of conservative substitution are well known to those skilled in the art, and include, but are not limited to, the following substitutions within each group: arginine and lysine; glutamic acid and aspartic acid; serine and threonine; glutamine and asparagine; and valine, leucine, and isoleucine.

[0031] As used herein, "variants," "derivatives," "analogs," or "mutants" (such as adhesive polypeptides) are used interchangeably and preferably, but without limitation, include molecules that contain a region that is substantially homologous to a protein of interest (e.g., adhesive polypeptides), and in the case of amino acid sequences, nucleic acid sequences (nucleotide sequences, base sequences), such sequences are referred to as "modified sequences," "derived sequences," "analogous sequences," or "mutated sequences." Such molecules, in various embodiments, are at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% identical over the same size of the amino acid sequence or when compared to sequences aligned by computer homology programs known in the art, or the nucleic acid encoding such molecules is capable of hybridizing to sequences encoding the component proteins under (highly) stringent, moderately stringent, or non-stringent conditions. This refers to a protein that is a product of protein modification by amino acid substitution, deletion and addition, respectively, and the variant or derivative still exhibits the biological function of the original protein, although not necessarily to the same degree. The variant may have a sequence that is preferably 70% or more identical to the original sequence, more preferably 80% or more identical, even more preferably 90% or more identical, even more preferably 95% or more identical, 98% or more identical, 99% or more identical. For example, the biological function of such a protein can be examined by suitable and available in vitro assays described herein or known in the art. As used herein, "functionally active" refers to a polypeptide, i.e., a fragment or derivative, that has a structural function, a regulatory function, or a biochemical function of a protein, such as a biological activity, according to the embodiment to which the polypeptide, i.e., the fragment or derivative, of the present disclosure relates. Thus, in one embodiment, the variant of the present disclosure refers to a functional equivalent.

[0032] In the present disclosure, a fragment of an adhesive polypeptide is a polypeptide that includes any region of an adhesive polypeptide, and does not necessarily have all of the biological functions of a naturally occurring adhesive polypeptide, so long as it functions for the purposes of the present disclosure (e.g., fixing and / or adhering without self-aggregation).

[0033] As used herein, "protein", "polypeptide", "oligopeptide" and "peptide" are used interchangeably herein to refer to a polymer of amino acids of any length. The length of a protein, polypeptide or peptide of the present disclosure may preferably include a minimum of 237 amino acid residues and a maximum of 3364 amino acid residues, more preferably a minimum of 256 amino acid residues and a maximum of 2846 amino acid residues. The polymer may be linear, branched or cyclic. The amino acids may be natural, non-natural or modified amino acids. The term may also include those assembled into a complex of multiple polypeptide chains. The term also includes naturally or artificially modified amino acid polymers. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, methylation, trimethylation or any other manipulation or modification (e.g., conjugation with a labeling moiety). This definition also includes, for example, polypeptides containing one or more analogs of amino acids (e.g., including unnatural amino acids, etc.), peptide-like compounds (e.g., peptoids), and other modifications known in the art. In this specification, "amino acid" is a general term for organic compounds having an amino group and a carboxyl group. When a polypeptide according to an embodiment of the present disclosure contains a "specific amino acid sequence", any amino acid in the amino acid sequence may be chemically modified. Any amino acid in the amino acid sequence may form a salt or a solvate. Any amino acid in the amino acid sequence may be L-type or D-type. Even in such cases, the protein according to an embodiment of the present disclosure can be said to contain the above-mentioned "specific amino acid sequence". Examples of chemical modifications that amino acids contained in proteins undergo in vivo include N-terminal modifications (e.g., acetylation, myristoylation, etc.), C-terminal modifications (e.g., amidation, glycosylphosphatidylinositol addition, etc.), and side chain modifications (e.g., phosphorylation, glycosylation, etc.). The amino acids may be natural or unnatural as long as they satisfy the purpose of the present disclosure.

[0034] As used herein, "polynucleotide", "oligonucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of nucleotides of any length. This term also includes "oligonucleotide derivative" or "polynucleotide derivative". "Oligonucleotide derivative" or "polynucleotide derivative" refers to an oligonucleotide or polynucleotide that contains a derivative of nucleotides or has a bond between nucleotides that is different from the usual one, and are used interchangeably. Specific examples of such oligonucleotides include 2'-O-methyl-ribonucleotides, oligonucleotide derivatives in which the phosphodiester bond in an oligonucleotide has been converted to a phosphorothioate bond, oligonucleotide derivatives in which the phosphodiester bond in an oligonucleotide has been converted to an N3'-P5' phosphoramidate bond, oligonucleotide derivatives in which the ribose and phosphodiester bond in an oligonucleotide have been converted to a peptide nucleic acid bond, oligonucleotide derivatives in which the uracil in an oligonucleotide has been replaced with C-5 propynyl uracil, oligonucleotide derivatives in which the uracil in an oligonucleotide has been replaced with C-5 thiazole uracil, oligonucleotide derivatives in which the cytosine in an oligonucleotide has been replaced with C-5 propynyl cytosine, oligonucleotide derivatives in which the cytosine in an oligonucleotide has been replaced with phenoxazine-modified cytosine, oligonucleotide derivatives in which the ribose in DNA has been replaced with 2'-O-propyl ribose, and oligonucleotide derivatives in which the ribose in an oligonucleotide has been replaced with 2'-methoxyethoxy ribose. Unless otherwise indicated, a particular nucleic acid sequence is also intended to encompass conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.Specifically, degenerate codon substitutions can be achieved by creating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). As used herein, "nucleic acid" is also used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide. As used herein, "nucleotide" may be natural or non-natural.

[0035] As used herein, the term "gene" refers to a factor that determines a genetic trait, and may refer to a "polynucleotide," an "oligonucleotide," and a "nucleic acid."

[0036] In this specification, the "homology" of a gene refers to the degree of identity between two or more gene sequences, and generally, "homology" refers to a high degree of identity or similarity. Therefore, the higher the homology between two genes, the higher the identity or similarity between those sequences. Whether two types of genes have homology can be examined by direct comparison of the sequences, or in the case of nucleic acids, by hybridization methods under stringent conditions. When two gene sequences are directly compared, the genes have homology when the DNA sequences between the gene sequences are typically at least 50% identical, preferably at least 70% identical, and more preferably at least 80%, 90%, 95%, 96%, 97%, 98% or 99% identical. The concept of "homology" also applies to amino acid sequences, and in this case, the numerical value of identity can be interpreted as being replaced with the amino acid sequence. Thus, as used herein, a "homolog" or "homologous gene product" refers to a protein in another species, preferably a microorganism, more preferably a bacterium, that performs the same biological function as the protein components of the fusions, etc., further described herein. Such a homolog may also be referred to as an "orthologous gene product." It is understood that such homologs, homologous gene products, orthologous gene products, etc., may also be used as long as they are consistent with the purposes of the present disclosure.

[0037] Amino acids may be referred to herein by either their commonly known three-letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides may also be referred to by their commonly accepted one-letter codes. In this specification, the comparison of similarity, identity, and homology of amino acid and base sequences is calculated using the sequence analysis tool BLAST with default parameters. Identity searches can be performed, for example, using NCBI's BLAST2.7.1 (published 2017.10.19). The value of "identity" in this specification usually refers to the value when aligned under default conditions using the above BLAST. However, if a higher value is obtained by changing the parameters, the highest value is taken as the identity value. If identity is evaluated in multiple regions, the highest value among them is taken as the identity value. "Similarity" is a value that takes into account similar amino acids in addition to identity.

[0038] In one embodiment of the present disclosure, "several" may be, for example, 10, 8, 6, 5, 4, 3, or 2, or any of these values ​​or less. It is known that a polypeptide that has one or several amino acid residues deleted, added, inserted, or substituted with other amino acids maintains its biological activity (Mark et al., Proc Natl Acad Sci USA. 1984 Sep; 81(18): 5662-5666., Zoller et al., Nucleic Acids Res. 1982 Oct 25; 10(20): 6487-6500., Wang et al., Science. 1984 Jun 29; 224(4656): 1431-1433.). A polypeptide with deletions or the like can be prepared, for example, by site-directed mutagenesis or random mutagenesis. For example, KOD-Plus-Mutagenesis Kit (TOYOBO CO., LTD.) can be used for site-directed mutagenesis. Polypeptides having the same activity as the wild type can be selected from mutant polypeptides into which deletions or the like have been introduced by performing various characterizations such as FACS analysis and ELISA.

[0039] In one embodiment of the present disclosure, the numerical value of identity, etc., "70% or more" may be, for example, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% or more, or may be within the range of any two of the starting numerical values. The above-mentioned "identity" is calculated by calculating the ratio of the number of homologous amino acids in two or more amino acid sequences according to a known method as described above. Specifically, before calculating the ratio, the amino acid sequences of the amino acid sequences to be compared are aligned, and gaps are introduced into a part of the amino acid sequence if necessary to maximize the ratio of identical amino acids. Methods for alignment, methods for calculating the ratio, methods for comparison, and computer programs related thereto are conventionally well known in the art (for example, BLAST, etc., as described above). In this specification, "identity" and "similarity" can be expressed as values ​​measured by BLAST of NCBI, unless otherwise specified. When comparing amino acid sequences with BLAST, the algorithm Blastp can be used with the default settings. The measurement results are expressed as numbers as Positives or Identities.

[0040] As used herein, the term "polynucleotide that hybridizes under stringent conditions" refers to well-known conditions commonly used in the art. Such polynucleotides can be obtained by colony hybridization, plaque hybridization, Southern blot hybridization, or the like, using a polynucleotide selected from the polynucleotides disclosed herein as a probe. Specifically, the term refers to a polynucleotide that can be identified by hybridizing a filter on which DNA derived from colonies or plaques is immobilized in the presence of 0.7 to 1.0 M NaCl at 65°C, and then washing the filter at 65°C using a 0.1 to 2-fold concentration of SSC (saline-sodium citrate) solution (the composition of a 1-fold concentration SSC solution is 150 mM sodium chloride and 15 mM sodium citrate). For example, the following conditions can be adopted as the "stringent conditions." (1) using low ionic strength and high temperature for washing (e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50°C), (2) using a denaturing agent such as formamide during hybridization (e.g., 50% (v / v) formamide with 0.1% bovine serum albumin / 0.1% Ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer pH 6.5, with 750 mM sodium chloride, 75 mM sodium citrate at 42°C), or (3) incubating overnight at 37°C in a solution containing 20% ​​formamide, 5x SSC, 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 mg / ml denatured sheared salmon sperm DNA, followed by washing the filters with 1x SSC at approximately 37-50°C. The formamide concentration may be 50% or more, and the washing time may be 5, 15, 30, 60, or 120 minutes or more.Factors that affect the stringency of the hybridization reaction include temperature, salt concentration, and more. For details, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995). Examples of "highly stringent conditions" are 0.0015M sodium chloride, 0.0015M sodium citrate, 65-68°C, or 0.015M sodium chloride, 0.0015M sodium citrate, and 50% formamide, 42°C. Hybridization can be performed according to the method described in experimental books such as Molecular Cloning 2nd ed., Current Protocols in Molecular Biology, Supplement 1-38, DNA Cloning 1: Core Techniques, A Practical Approach, Second Edition, Oxford University Press (1995). Here, sequences that hybridize under stringent conditions preferably exclude sequences that contain only A or T sequences. Moderately stringent conditions can be readily determined by one of skill in the art based on, for example, the length of the DNA, and are set forth in Sambrook et al., Molecular Cloning: A Laboratory Manual, No. 3, Vol. 1, 7.42-7.45 Cold Spring Harbor Laboratory Press, 2001, and include the use of, for nitrocellulose filters, a pre-wash solution of 5xSSC, 0.5% SDS, 1.0 mM EDTA (pH 8.0), hybridization conditions of about 50% formamide, 2xSSC-6xSSC (or other similar hybridization solutions, such as Stark's solution in about 50% formamide at about 42°C) at about 40-50°C, and wash conditions of 0.5xSSC, 0.1% SDS at about 60°C.Thus, a polypeptide as used in this disclosure also includes a polypeptide encoded by a nucleic acid molecule that hybridizes under high or moderate stringency conditions to a nucleic acid molecule encoding a polypeptide specifically described in this disclosure.

[0041] The adhesive polypeptide of the present disclosure may preferably be "purified" or "isolated". As used herein, a "purified" substance or biological factor (e.g., nucleic acid or protein, etc.) refers to a substance or biological factor from which at least a portion of naturally associated factors have been removed. Thus, the purity of the biological factor in a purified biological factor is usually higher (i.e., concentrated) than the state in which the biological factor is normally present. As used herein, the term "purified" means that the same type of biological factor is present in an amount of preferably at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably at least 98% by weight. The substance or biological factor used in the present disclosure is preferably a "purified" substance. As used herein, an "isolated" substance or biological factor (e.g., nucleic acid or protein, etc.) refers to a substance or biological factor from which naturally associated factors have been substantially removed. The term "isolated" as used herein does not necessarily denote purity, as this can vary depending on the purpose, but, if necessary, preferably means that at least 75% by weight, more preferably at least 85% by weight, even more preferably at least 95% by weight, and most preferably at least 98% by weight of the same type of biological factor is present. The materials used in this disclosure are preferably "isolated" materials or biological factors.

[0042] As used herein, the terms "fragment" and "fragment" are used interchangeably herein and refer to a polypeptide or polynucleotide having a sequence length of 1 to n-1 relative to a full-length polypeptide or polynucleotide (length is n). The length of a fragment can be appropriately changed depending on the purpose, and for example, the lower limit of the length for a polypeptide can be 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50 or more amino acids, and a length represented by an integer not specifically listed here (e.g., 11, etc.) can also be a suitable lower limit. A fragment of a polypeptide of the present disclosure is preferably 237 or more and 3364 or less, more preferably 256 or more and 2846 or less. For example, the lower limit may be 237 amino acids, 256 amino acids, 300 amino acids, 400 amino acids, 500 amino acids, 600 amino acids, 700 amino acids, 800 amino acids, 900 amino acids, 1000 amino acids, etc., and the upper limit may be 1000 amino acids, 1100 amino acids, 1200 amino acids, 1300 amino acids, 1400 amino acids, 1500 amino acids, 1600 amino acids, 1700 amino acids. , 1800 amino acids, 1900 amino acids, 2000 amino acids, 2100 amino acids, 2200 amino acids, 2300 amino acids, 2400 amino acids, 2500 amino acids, 2600 amino acids, 2700 amino acids, 2800 amino acids, 2846 amino acids, 2900 amino acids, 3000 amino acids, 3100 amino acids, 3200 amino acids, 3300 amino acids, 3364 amino acids, but are not limited thereto, and other lengths are also possible as long as the desired properties (e.g., lack of self-aggregation, maintenance of adhesiveness) are maintained. In addition, in the case of polynucleotides, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides are included, and lengths represented by integers not specifically listed here (e.g., 11, etc.) may also be suitable as lower limits. As used herein, such fragments are understood to fall within the scope of the present disclosure, for example, if the full-length molecule functions as an adhesive molecule, so long as the fragment itself also has the function as an adhesive polypeptide.

[0043] As used herein, the term "biological function" refers to a specific function that a gene, a nucleic acid molecule, or a polypeptide related thereto may have in vivo or in vitro, including, but not limited to, adhesiveness. As used herein, a biological function may be exerted by a corresponding "biological activity." As used herein, "biological activity" refers to an activity that a certain factor (e.g., polynucleotide, protein, etc.) may have, including activities that exert various functions (e.g., adhesiveness). "Biological activity" may be an activity exerted in vivo, or an activity exerted in vitro by secretion, etc. For example, when a certain factor is an enzyme, its biological activity includes its enzymatic activity. Such biological activity can be measured by techniques well known in the art. Thus, "activity" refers to various measurable indicators that indicate or reveal binding (either directly or indirectly); affect a response (i.e., have a measurable effect in response to some exposure or stimulus); and can also include, for example, the affinity of a compound to bind directly to a polypeptide or polynucleotide of the present disclosure, or, for example, a measure of the amount of an upstream or downstream protein or other similar function after some stimulus or event.

[0044] As used herein, the term "expression" of a gene, polynucleotide, polypeptide, etc. refers to a gene, etc. undergoing a certain action in vivo to become a different form. Preferably, the term refers to a gene, polynucleotide, etc. being transcribed and translated to become a polypeptide, but transcription to produce an mRNA is also an embodiment of expression. Thus, as used herein, the term "expression product" includes such a polypeptide or protein, or mRNA. More preferably, such a polypeptide form may be one that has undergone post-translational processing. For example, the expression level of an adhesive polypeptide can be determined by any method. Specifically, the expression level of an adhesive polypeptide can be known by evaluating the amount of the adhesive polypeptide's mRNA, the amount of the adhesive polypeptide, and the biological activity of the adhesive polypeptide. The amount of the adhesive polypeptide's mRNA, polypeptide, or protein can be determined by methods detailed elsewhere in this specification or other methods known in the art.

[0045] As used herein, the term "functional equivalent" refers to any entity that has the same intended function but a different structure compared to the original entity of interest. Thus, it is understood that the functional equivalent of the "adhesive polypeptide" of the present disclosure is not the adhesive polypeptide of the present disclosure itself, but includes its mutant or variant (e.g., amino acid sequence variant, etc.) that has the biological action of the adhesive polypeptide, as well as those that can be changed into a mutant or variant that has the biological action of the adhesive polypeptide at the time of acting (e.g., including a nucleic acid that codes for the mutant or variant, and a vector, cell, etc. that contains the nucleic acid). In the present disclosure, it is understood that the functional equivalent of the adhesive polypeptide can be used in the same way as the adhesive polypeptide, even if not specifically mentioned. The functional equivalent can be found by searching a database, etc. As used herein, "search" refers to using a certain nucleic acid sequence to find other nucleic acid sequences that have a specific function and / or property, electronically, biologically, or by other methods. Examples of electronic searches include, but are not limited to, BLAST (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85: 2444-2448 (1988)), Smith and Waterman method (Smith and Waterman, J. Mol. Biol. 147: 195-197 (1981)), and Needleman and Wunsch method (Needleman and Wunsch, J. Mol. Biol. 48: 443-453 (1970)). Examples of biological searches include, but are not limited to, stringent hybridization, macroarrays in which genomic DNA is attached to a nylon membrane or the like, or microarrays in which genomic DNA is attached to a glass plate (microarray assay), PCR, and in situ hybridization. As used herein, it is intended that the gene used in the present disclosure should also include corresponding genes identified by such electronic and biological searches.

[0046] As a functional equivalent of the present disclosure (polypeptide, etc.), an amino acid sequence in which one or more amino acids have been inserted, substituted or deleted, or added to one or both ends thereof can be used. In the present specification, "an amino acid sequence in which one or more amino acids have been inserted, substituted or deleted, or added to one or both ends thereof" means that the amino acid sequence has been modified by a well-known technical method such as site-directed mutagenesis, or by natural mutation, by substitution of a number of amino acids to the extent that may occur naturally. The modified amino acid sequence may be, for example, one in which 1 to 30, preferably 1 to 20, more preferably 1 to 9, even more preferably 1 to 5, and particularly preferably 1 to 2 amino acids have been inserted, substituted or deleted, or added to one or both ends thereof. The modified amino acid sequence may preferably be an amino acid sequence having one or more (preferably one or several, or 1, 2, 3, or 4) conservative substitutions in the amino acid sequence of SEQ ID NO: 1 or 4. Here, "conservative substitution" means replacing one or more amino acid residues with other chemically similar amino acid residues so as not to substantially alter the function of the protein. For example, a hydrophobic residue may be replaced with another hydrophobic residue, a polar residue may be replaced with another polar residue having the same charge, and the like. Functionally similar amino acids that can be used for such substitutions are known in the art for each amino acid. Specific examples of non-polar (hydrophobic) amino acids include alanine, valine, isoleucine, leucine, proline, tryptophan, phenylalanine, and methionine. Polar (neutral) amino acids include glycine, serine, threonine, tyrosine, glutamine, asparagine, and cysteine. Positively charged (basic) amino acids include arginine, histidine, and lysine. Negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

[0047] As used herein, the term "support" refers to a substance capable of supporting peptides, proteins, polynucleotides, cells, bacteria, or viruses, as well as sugars, lipids, and other small molecules. Any substance capable of forming a solid surface can be used as a material for use as a support, and examples thereof include, but are not limited to, lipid bilayers (e.g., liposomes), glass, silica, silicon, ceramics, silicon dioxide, plastics, metals (including alloys), titanium, acrylic, natural and synthetic polymers (e.g., polystyrene, polypropylene, polyethylene, polyvinyl chloride, cellulose, chitosan, dextran, nylon, polyurethane, polycarbonate, polylactic acid, and polytetrafluoroethylene (PTFE)).

[0048] As used herein, the term "kit" refers to a unit in which the parts to be provided (e.g., enzymes, buffer solutions, instructions, etc.) are provided, usually separated into two or more compartments. This kit form is preferred when the purpose is to provide a composition that should not be provided in a mixed state for reasons of stability, etc., but is preferably mixed and used immediately before use. Such a kit is advantageously provided with instructions or instructions, preferably describing how to use the parts to be provided (e.g., enzymes) or how to dispose of the reagents or waste liquid after use. When the kit is used as a reagent kit in this specification, the kit usually includes instructions describing how to use the enzymes, etc.

[0049] In this specification, the term "instructions" refers to instructions for a user on how to use the present disclosure. The instructions contain text instructing how to use the present disclosure. If necessary, the instructions are prepared in accordance with a format specified by the supervisory agency of the country in which the present disclosure is implemented (e.g., the Ministry of Health, Labor and Welfare or the Ministry of Agriculture, Forestry and Fisheries in Japan, the Food and Drug Administration (FDA), the Department of Agriculture (USDA), etc. in the United States), and it is clearly stated that the instructions have been approved by the supervisory agency. The instructions may be provided in paper form, but are not limited thereto, and may also be provided in the form of, for example, electronic media (e.g., a homepage provided on the Internet, e-mail).

[0050] (Preferred embodiment) The preferred embodiments of the present disclosure are described below. The embodiments provided below are provided for a better understanding of the present disclosure, and it is understood that the scope of the present disclosure should not be limited to the following description. Therefore, it is clear that a person skilled in the art can make appropriate modifications within the scope of the present disclosure in light of the description in this specification. It is also understood that the following embodiments of the present disclosure can be used alone or in combination.

[0051] (Adhesive polypeptides that do not have self-aggregation properties) In one aspect, the present disclosure provides a novel fragment of an adhesive polypeptide or a variant thereof that does not have self-aggregation properties and has adhesive properties, and a nucleic acid encoding the same.

[0052] In a representative aspect, the present disclosure provides a fragment of AtaA or a variant thereof that does not have the ability to self-aggregate and has adhesive properties.

[0053] In certain embodiments, the disclosure provides representative sequences of adhesive polypeptides and variants thereof, typically obtained from Acinetobacter sp. strain Tol5.

[0054] In one embodiment, the present disclosure provides a polypeptide that does not have self-aggregation properties and has adhesive properties, and includes a fragment of the amino acid sequence shown in SEQ ID NO: 1 or a variant thereof.

[0055] In a specific embodiment, the adhesive polypeptide of the present disclosure includes a sequence corresponding to amino acid positions 22 to 50 and 161 to 175 of the amino acid sequence shown in SEQ ID NO: 1 or a modified sequence thereof, and includes one or more amino acid substitutions, additions, deletions, or combinations thereof in the range of the sequence corresponding to amino acid positions 2847 to 3093 of the amino acid sequence shown in SEQ ID NO: 1. Preferably, the range of the sequence corresponding to amino acid positions 2847 to 3093 of the amino acid sequence shown in SEQ ID NO: 1 corresponds to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1. More preferably, the adhesive polypeptide of the present disclosure lacks the entire sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1. In a specific embodiment, the modified sequence includes a modification by conservative substitution.

[0056] In certain embodiments, the present disclosure provides a method for the preparation of a pharmaceutical composition comprising: (1) A sequence corresponding to amino acids 1 to 3518 of the amino acid sequence shown in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof, The sequence corresponding to amino acid positions 2855 to 3093 of SEQ ID NO: 1 contains at least one amino acid substitution, addition, deletion, or a combination thereof; A polypeptide comprising a sequence corresponding to amino acids 22 to 50 and 161 to 175 of SEQ ID NO:1, or a modified sequence thereof; (2) A sequence corresponding to amino acids 1 to 3093 of the amino acid sequence shown in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof, The sequence corresponding to amino acid positions 2855 to 3093 contains at least one amino acid substitution, addition, deletion, or a combination thereof; a polypeptide comprising a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; (3) A sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, a polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; (4) A portion of amino acids 1 to 3518 of the amino acid sequence shown in SEQ ID NO:1 (here, "a portion" refers to a portion that is missing from the full-length sequence, and includes fragments as well as sequences that are missing an intermediate portion), The sequence corresponding to amino acid positions 2855 to 3093 of SEQ ID NO: 1 contains at least one amino acid substitution, addition, deletion, or a combination thereof; A polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175 of SEQ ID NO:1, or a modified sequence thereof; (5) A sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, a polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; (6) A sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; or (7) A sequence corresponding to amino acids 1 to 257 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof. The present invention provides a polypeptide,

[0057] In certain embodiments, the present disclosure provides a method for producing a pharmaceutical composition comprising: (a) an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acid positions 22 to 50 and 161 to 175, or a modified sequence thereof; (b) an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence shown in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof, a polypeptide having a sequence corresponding to amino acids 22 to 50 and 161 to 175, or a modified sequence thereof; (c) a sequence corresponding to amino acids 1 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof; or (d) a sequence corresponding to amino acids 1 to 257 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof, A polypeptide having a sequence corresponding to amino acids 22-50 and 161-175, or a modified sequence thereof. The present invention provides a polypeptide which is

[0058] In certain embodiments, the present disclosure provides a method for producing a pharmaceutical composition comprising: (1) a polypeptide which is an amino acid sequence corresponding to amino acids 1 to 2854 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; (2) a polypeptide having an amino acid sequence corresponding to amino acids 1 to 2846 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; (3) a polypeptide that is an amino acid sequence corresponding to amino acids 1 to 268 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; or (4) a polypeptide having an amino acid sequence corresponding to amino acids 1 to 257 of the amino acid sequence set forth in SEQ ID NO:1, or a modified sequence thereof, or a fragment thereof; The present invention provides a polypeptide,

[0059] In a specific embodiment, the adhesive polypeptide of the present disclosure is an amino acid sequence corresponding to amino acid positions 1 to 2854 or 2 to 2854 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. Preferably, the adhesive polypeptide of the present disclosure consists of an amino acid sequence corresponding to amino acid positions 1 to 2854 or 2 to 2854 of the amino acid sequence shown in SEQ ID NO: 1.

[0060] In a specific embodiment, the adhesive polypeptide of the present disclosure is an amino acid sequence corresponding to amino acid positions 1 to 2846 or 2 to 2846 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. Preferably, the adhesive polypeptide of the present disclosure consists of an amino acid sequence corresponding to amino acid positions 1 to 2846 or 2 to 2846 of the amino acid sequence shown in SEQ ID NO: 1.

[0061] In a specific embodiment, the adhesive polypeptide of the present disclosure is an amino acid sequence corresponding to amino acids 1 to 268 or 2 to 268 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. Preferably, the adhesive polypeptide of the present disclosure consists of an amino acid sequence corresponding to amino acids 1 to 268 or 2 to 268 of the amino acid sequence shown in SEQ ID NO: 1.

[0062] In a specific embodiment, the adhesive polypeptide of the present disclosure is an amino acid sequence corresponding to amino acids 1 to 257 or 2 to 257 of the amino acid sequence shown in SEQ ID NO: 1, or a modified sequence thereof, or a fragment thereof. Preferably, the adhesive polypeptide of the present disclosure consists of an amino acid sequence corresponding to amino acids 1 to 257 or 2 to 257 of the amino acid sequence shown in SEQ ID NO: 1.

[0063] In some embodiments, the adhesive polypeptide of the invention is derived from Acinetobacter. In a particular embodiment, the Acinetobacter is Acinetobacter sp. Tol5 strain.

[0064] In some embodiments, the adhesive polypeptide of the present disclosure further comprises an amino acid sequence different from SEQ ID NO: 1. In certain embodiments, the different amino acid sequence is fused to the adhesive polypeptide of the present disclosure. In one embodiment, the different amino acid sequence is the amino acid sequence encoding the SNAP protein.

[0065] In certain embodiments, the present disclosure provides a complex of an adhesive polypeptide of the present disclosure and a functionalization entity.

[0066] In one embodiment, the polypeptide of the present disclosure or its complex with a functionalizing entity may have the ability to adhere and / or immobilize a first object to a second object, or not self-aggregate, or both.

[0067] In one embodiment, the polypeptide of the present disclosure or its complex with a functionalizing entity is capable of adhering said first object in a monolayer.

[0068] In certain embodiments, the first subject and the second subject are the same, while in other embodiments, the first subject and the second subject are different.

[0069] In one embodiment, at least one of the first object or the second object is a functionalizing entity. Examples of functionalizing entities include, but are not limited to, those having functions useful for biosensors, separation and labeling of biomolecules, regenerative medicine, production of bio-organic-inorganic hybrid materials, surface modification and functionalization, fermentation industry, pharmaceutical industry, chemical industry, biofuel production, wastewater treatment, bioremediation, etc. In a specific embodiment, the functionalizing entity is a protein and / or a peptide. In a more specific embodiment, the functionalizing entity is streptavidin, neutral avidin, derivatives thereof, enzymes, antibodies, fluorescent molecules, receptors, functional peptides (antibacterial, fluorescent, signaling factors, inducers, etc.), nucleic acid aptamers, serum components, etc.

[0070] In one embodiment, the disclosed polypeptide, fusion polypeptide, or complex with a functionalizing entity thereof is used to attach and / or immobilize cells. The cells to be attached and / or immobilized may be any cells, including, but not limited to, animal cells, plant cells, and microbial cells.

[0071] In one embodiment, the second object is a support. In a particular embodiment, the support is a liposome.

[0072] In one embodiment, a polypeptide, fusion polypeptide, or complex with a functionalizing entity of the present disclosure has the ability to adhere a polypeptide having an amino acid sequence different from AtaA contained in the polypeptide, or a functionalizing entity contained in the complex, to a second target.

[0073] (Production of adhesive polypeptides) In one embodiment, the adhesive and fusion polypeptides of the present disclosure are produced by a microbial expression system.

[0074] The adhesive polypeptide of the present disclosure or its fusion polypeptide can be produced as a recombinant protein in E. coli by a method commonly used in laboratories. That is, a gene encoding an AtaA fragment or a fusion peptide obtained by fusing the fragment with a peptide is inserted into an appropriate position of an appropriate E. coli expression vector such as the pET system, E. coli is transformed, and gene expression is induced by adding an inducer or constitutively expressed under a constitutive expression promoter. The protein is often produced in the cytoplasm, but it can also be secreted and produced in the periplasm. In the latter case, the signal peptide inherent to the AtaA protein or a gene sequence encoding a signal peptide incorporated in an E. coli expression vector is connected to the 5'-end side of the protein coding for the protein, so that the protein is produced in a form in which the signal peptide is added to the amino-terminal side of the protein. Note that the signal peptide is cleaved and removed when the produced protein is secreted into the periplasm, so that the resulting AtaA fragment or its fusion protein does not contain a signal peptide. The protein produced in the cells is usually separated and purified from the soluble components, but it may also be separated from the inclusion body and then refolded to obtain an active protein. The produced protein can be separated and purified by a commonly used affinity purification method using a His tag or a strepto tag fused to the protein in advance. Furthermore, when a SNAP protein or the like is fused, it may be separated and purified using a molecule having a benzylguanyl (BG) group. To further increase the degree of purification, ion exchange chromatography, gel filtration, or the like may be used in combination.

[0075] In this method for producing an adhesive polypeptide using a microorganism, detailed conditions such as the method for expressing the adhesive polypeptide, the host for expressing the adhesive polypeptide, and the method for purifying the adhesive polypeptide secreted from the host can be appropriately adjusted by those skilled in the art. Furthermore, the adhesive polypeptide of the present disclosure can also be expressed using various expression systems such as a secretory production system and a cell-free expression system in addition to the intracellular expression system of a microorganism.

[0076] The methods for causing the above-mentioned microorganisms to produce a desired polypeptide, including the adhesive polypeptide of the present disclosure, are merely exemplary, and a person skilled in the art can easily design and construct a DNA fragment to be inserted into an expression vector by creating a synthetic gene using techniques commonly used in the technical field and referring to the nucleic acid sequence (base sequence) or amino acid sequence of the gene of the present disclosure.

[0077] (Use of Polypeptides) In one aspect, the adhesive polypeptide of the present disclosure is useful in material engineering processes. In another aspect, the adhesive polypeptide of the present disclosure is useful in industries using bioprocesses. In an embodiment, the adhesive polypeptide of the present disclosure can efficiently carry out bioprocesses in technical fields such as material engineering processes such as surface modification and material design, fermentation industry, pharmaceutical industry, chemical industry, biofuel production, wastewater treatment, bioremediation, regenerative medicine, cell engineering, medical engineering, and biosensors by densely confining and fixing proteins, peptides, or cells.

[0078] In another aspect, the adhesive polypeptide of the present disclosure can be used for biosensors, environmental purification, etc. by immobilizing liposomes containing enzymes, etc. In particular, when used in the environment, unlike living cells, it cannot proliferate, and therefore has the advantage that there is almost no risk of biohazard or destruction of ecosystems even if recombinant genes or proteins are used.

[0079] (General technology) The molecular biological techniques, biochemical techniques, and microbiological techniques used in this specification are well known and commonly used in the art, and are described, for example, in Sambrook J. et al. (1989). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor and its 4th Ed. (2012), Okada Masato and Miyazaki Kaori, 2011, Protein Experimental Notes, Revised 4th Edition, Vol. 1 and 2, Yodosha, and the like, the relevant parts of which (which may be in their entirety) are incorporated by reference in this specification.

[0080] (Note) In this specification, "or" is used when "at least one or more" of the items listed in the sentence can be employed. The same applies to "alternative." In this specification, when it is specified that "within a range of two values," the range includes the two values ​​themselves.

[0081] All references cited herein, including scientific literature, patents, patent applications, and the like, are hereby incorporated by reference in their entirety to the same extent as if each was specifically set forth.

[0082] The present disclosure has been described above by showing preferred embodiments for ease of understanding. The present disclosure will be described below based on examples, but the above description and the following examples are provided for illustrative purposes only and are not provided for the purpose of limiting the present disclosure. Therefore, the scope of the present disclosure is not limited to the embodiments or examples specifically described in this specification, but is limited only by the scope of the claims. EXAMPLES

[0083] Examples are described below. The handling of organisms used in the following examples complied with the standards stipulated by Nagoya University, regulatory authorities, and the Cartagena Protocol, when necessary. The specific reagents used were the products described in the examples, but equivalent products from other manufacturers (Sigma-Aldrich, Fujifilm Wako Pure Chemical Industries, Nacalai Tesque, R&D Systems, USCN Life Science INC, Thermo Fisher Scientific, Kanto Chemical, Funakoshi, Tokyo Kasei, Merck, etc.) can also be used.

[0084] (Example 1: Search for cell surface molecules that form aggregates together with AtaA during cell aggregation) In this example, a cell aggregation analysis by microscopic observation obtained by the experimental method shown in the experimental model of FIG. 1A is shown.

[0085] (method) Tol5 strain expressing mRFP (red fluorescent protein) and normal AtaA protein was mixed with Acinetobacter sp. Tol5 strain expressing EGFP (green fluorescent protein) and normal AtaA protein, or ΔAtaA strain. The formed cell aggregates were observed under a microscope, and the obtained images were divided into microscopic regions to calculate the percentage of cells expressing EGFP.

[0086] (result) Figure 1B shows an image of a cell aggregate formed by mixing Acinetobacter sp. Tol5 strain expressing EGFP and Acinetobacter sp. Tol5 strain expressing mRFP, and a histogram of the percentage of cells expressing EGFP in the microcompartments. Both fluorescent protein expression strains express normal AtaA protein. Figure 1C shows an image of a cell aggregate formed by mixing Acinetobacter sp. Tol5 strain expressing normal AtaA protein and mRFP and ΔAtaA strain expressing EGFP, and a histogram of the percentage of cells expressing EGFP in the microcompartments. In Figure 1B, cells expressing EGFP were uniformly present in the cell aggregate, and the histogram of the percentage of cells expressing EGFP showed a peak in the center. In contrast, in Figure 1C, cells expressing EGFP were not incorporated into the cell aggregate, and the histogram of the percentage of cells expressing EGFP showed a peak at the edge.

[0087] (Consideration) AtaA-expressing cells did not form aggregates with other cell surface molecules, but aggregated with other AtaA-expressing cells, indicating that the cell self-aggregation of the Tol5 strain was due to the interaction between AtaA molecules.

[0088] Example 2: Search for self-aggregating domains In this example, a search was conducted for domains in the AtaA protein that are involved in self-aggregation.

[0089] (method) (1) AtaA with a structure lacking Nhead (SEQ ID NO: 7), (2), (3), and (4) AtaA with a structure lacking a part of Nstalk (SEQ ID NO: 9, 11, and 13, respectively), (5) AtaA with a structure lacking Chead in addition to a part of Nstalk (SEQ ID NO: 15), and (6) AtaA with a structure lacking most of Cstalk (preserving the FGG domain) (SEQ ID NO: 17) were designed (Fig. 2A). Each partial deletion was constructed by cutting, deleting, and recombining the link between the domains based on the domain annotation so as not to destroy the structure, or, even if it was unavoidable to cut within the domain, by utilizing the repeat sequence present in AtaA, the domain and amino acid sequence were conserved even after the deletion. Furthermore, when the repeat sequence within the domain could not be used, the periodicity of the coiled coil was utilized so that the periodicity of the coiled coil was restored after cutting, deleting, and recombining.

[0090] For each partial deletion, expression constructs were constructed using pAtaA, pDONR221::ataA, and synthetic gene fragments in which the ataA gene had been cloned. The expression constructs were then conjugated with the donor strain E. coli S17-1 (Simon, R.; Priefer, U.; Puhler, A., Bio-Technol 1983, 1, (9), 784-791) to transform the 4140 strain, an ataA gene deletion mutant of Tol5, to obtain transformed strains (domain deletion strains) expressing each partial deletion. The wild-type strain expressing the full-length AtaA was transformed with the mRFP gene, and the domain deletion strain was transformed with the EGFP gene to produce strains that exhibited red and green fluorescence, respectively. These transformed strains were then used to evaluate cell aggregation properties by the same method as described in Example 1.

[0091] (result) The results are shown in Figure 2B. When Acinetobacter sp. Tol5 strain expressing normal AtaA protein was mixed with Acinetobacter sp. Tol5 strain expressing AtaA protein with (1) Nhead-deficient structure, the incorporation of domain-deficient cells expressing EGFP into the cell mass was not observed. On the other hand, the domain-deficient cells expressing partial deletions other than (1) were uniformly present in the cell mass, and the histogram of the proportion of cells expressing EGFP showed a peak in the center.

[0092] (Consideration) (1) The wild-type Tol5 strain expressing the full-length AtaA protein was unable to aggregate only with the Acinetobacter sp. Tol5 strain expressing an AtaA protein with a deleted Nhead structure, but was able to aggregate with the Acinetobacter sp. Tol5 strain expressing an AtaA protein with a deleted structure other than Nhead, indicating that the Nheads of AtaA are essential for the self-aggregation of microbial cells, that is, for the interaction between AtaAs. In other words, it was suggested that the self-aggregation of Nheads causes intermolecular interactions of AtaA.

[0093] (Example 3: Design, production and folding analysis of Nhead recombinant protein) In this example, a construct was designed for expressing the Nhead domain of AtaA as a recombinant protein that folds normally.

[0094] (method) (Construct construction) For the first time, we have attempted to produce Nhead, the functional site responsible for the adhesion and self-aggregation of AtaA, as a recombinant protein in E. coli. The construct design of the Nhead recombinant protein (SEQ ID NO: 19) is shown in Figure 3A. AtaA folds correctly and functions by forming a homotrimer in which three polypeptide chains of the same species come together. Designing a recombinant protein construct is extremely difficult, and even for protein engineering experts, it is not easy to design a trimer to be properly formed and folded correctly. The structure of Nhead was assumed to be mainly composed of β-strands based on the primary structure (amino acid sequence). It was expected that trimer formation by the association of β-strands would be difficult, and we thought that the neck present on the C-terminus of Nhead should also be included in the construct. In addition, we decided to link the GCN4pII tag, which is a coiled coil structure known to promote trimer formation, to Nhead. In order to link well with GCN4pII, we designed it to maintain the periodicity of the coiled coil by linking it to the GCN4pII tag via a coiled coil that is part of the FGG domain at the N-terminus tip of Nstalk. Furthermore, to facilitate separation and purification, a His tag was also introduced to the C-terminus of the GCN4pII tag. The amino acid sequence of the Nhead recombinant protein designed in this way (amino acid fragment from positions 59 to 325 of the AtaA sequence, corresponding to amino acid fragment from positions 2 to 268 of SEQ ID NO:1) is shown in Figure 3C. The origin of the sequence is also shown. To prepare this construct, a gene fragment encoding amino acids 1 to 268 of SEQ ID NO:1 was inserted into the restriction enzyme XbaI / BsaI digestion fragment of the pIBA-GCN4tri-His vector, and pIBA::Nhead recombinant DNA (pIBA-GCN4tri-His::ataA 59-325 To determine whether the purified Nhaed recombinant protein was properly folded, we analyzed its secondary structure using CD spectroscopy.

[0095] (Purification of Nhead recombinant protein) BL21 star(DE3;pIBA-GCN4tri-His::ataA59-325 An overnight culture of ) was diluted 1:100 in LB medium and incubated at 37°C for 3 h. After incubation, 0.2 μg / ml anhydrotetracycline (AHTC) was added to the medium and further incubated at 28°C for 6 h. Cells were harvested by centrifugation at 5,000×g for 15 min at 4°C, resuspended in lysis buffer (20 mM Tris-HCl, 150 mM NaCl and 20 mM imidazole, pH 9.0) and lysed at 1,000 bar for 10 min using a high-pressure homogenizer (LAB 2000, SMT Co., Ltd.). After centrifugation at 10,000×g for 15 min at 4°C, the supernatant was loaded onto a Ni-NTA Superflow column (Qiagen NV) and unbound proteins were removed by washing twice with lysis buffer. The bound protein was eluted with elution buffer (20 mM Tris-HCl, 150 mM NaCl, and 400 mM imidazole, pH 9.0). The eluted protein was loaded onto an anion exchange column (HiTrap Q HP, GE Healthcare), and the flow-through fraction containing the recombinant protein was dialyzed against 50 mM phosphate buffer (pH 6.0). The recombinant protein was then purified using a cation exchange column (HiTrap SP HP, GE Healthcare) with a linear concentration gradient of 0 to 1,000 mM NaCl in phosphate buffer (pH 6.0). The peak fraction containing the recombinant protein was concentrated by ultrafiltration using a centrifugal filter device (Amicon ultra, EMD Millipore) and loaded onto a gel filtration column (HiLoad 26 / 60 Superdex 200pg, GE Healthcare) equilibrated with 25 mM Tris-HCl (pH 9.0) for gel filtration purification.

[0096] (Folding analysis of purified Nhead recombinant protein) The CD spectrum of the purified Nhead recombinant protein was measured using a J-725 spectropolarimeter (JASCO Corporation). The parameters were set as follows: wavelength 190–250 nm, scan speed 100 nm / min, scan interval 0.1 nm, response 0.25 s, and bandwidth 1.0 nm.

[0097] (result) CD spectrum analysis showed that the Nhead recombinant protein produced in E. coli and purified had a secondary structure rather than a random coil state, suggesting that it was folded (Fig. 3B). We then performed crystallization and determined the crystal structure of Nhead. As a result, we found that Nhead has two characteristic loops (loop 1 and loop 2) that are not found in the head domains of other TAAs.

[0098] (Example 4: Functional evaluation of loops on Nhead) We investigated whether the first and second loops characteristic of Nhead are involved in the nonspecific adhesiveness of AtaA.

[0099] (method) (Construction of AtaA mutant strain) Using the cloned ataA gene fragment, mutants (SEQ ID NOs: 21 and 23) in which each loop was deleted one by one were generated by inverse PCR, and were then introduced into the ataA gene-deficient Tol5 strain 4140 (ΔataA) and expressed. These loop-deficient mutants, as well as the wild-type strain (AtaA), ΔataA, and Nhead-deficient strain (ΔNhead, SEQ ID NO: 7) for comparison, were subjected to microbial adhesion tests using polystyrene (PS) plates and glass plates.

[0100] (method) (Microbial adhesion test) The collected cells were washed three times with ultrapure water and then analyzed by OD 660The cells were suspended in BS-N medium so that the pH was 0.5. The cell suspensions (200 μL each) were placed into wells of a 96-well polystyrene (PS) or glass plate. After 2 h of incubation at 28°C without shaking, the cell suspensions were removed by micropipette, and each well was rinsed three times with 120 μL of BS-N medium. The fixed cells were stained with 200 μL of 0.1% crystal violet solution for 15 min. After three rinses with 200 μL of BS-N medium, the dye was eluted from the cells using 200 μL of 70% ethanol, and the absorbance at 590 nm (A590) of the eluate was measured by a microplate reader. The composition of BS-N medium is described in the paper (S. Ishii, J. Koki, H. Unno, K. Hori; Two Morphological Types of Cell Appendages on a Strongly Adhesive Bacterium, Acinetobacter sp. Strain Tol5, Appl. Environ. Microbiol. 70, (2004) 5026-5029) and the paper (H. Watanabe, Y. Tanji, H. Unno, K. Hori; Rapid Conversion of Toluene by an Acinetobacter sp. Tol5 Mutant Showing Monolayer Adsorption to Water-Oil Interface, J. Biosci. Bioeng. 106 (2008) 226-230).

[0101] (result) The results of the adhesion test are shown in Figure 4. The graph in Figure 4 shows the adhesion of microorganisms as a function of A 590 The results are shown in Fig. 1. The first and second loop deletion mutants showed significantly reduced adhesion, indicating that these two loops are essential for AtaA adhesion.

[0102] (Example 5: Evaluation of autoaggregation of recombinant Nhead expressed in E. coli) During purification of the Nhead recombinant protein, we were able to obtain a sample that did not aggregate. Therefore, in this example, we evaluated the self-aggregation of the recombinant Nhead expressed in Escherichia coli by dynamic light scattering (DLS).

[0103] (method) The recombinant protein was dissolved in PBS buffer to a concentration of 0.2 mg / ml to prepare a sample solution. 40 μL of the sample solution was placed in a quartz cell, and the particle shape was measured using a DLS measurement device (Zetasizer Nano ZSP, Malvern Instruments, UK) equipped with a He-Ne laser (wavelength 633 nm). The temperature was 25°C, the equilibration time was 120 seconds, and the scattering angle was 173°.

[0104] (Results and Discussion) The results are shown in Figure 5. Unexpectedly, the recombinant Nhead expressed in E. coli did not show autoaggregation. Therefore, it was revealed that the recombinant Nhead expressed in E. coli shows different properties from Nhead on AtaA expressed in Acinetobacter sp. Tol5 strain.

[0105] Example 6: Characteristics of aggregates of Acinetobacter sp. Tol5 strain The inventors found by chance that the AVL peptide interacts with the first and second loops of Nhead and has the function of disrupting the aggregates of Acinetobacter sp. Tol5 cells by AtaA. In this example, the disruption of the aggregates of Acinetobacter sp. Tol5 cells by the peptide was observed under a microscope.

[0106] (method) The aggregates of Acinetobacter sp. Tol5 in the flow cell and Acinetobacter sp. Tol5 in the presence of the AVL peptide were observed under a microscope. The flow cell used was a homemade one as described below.

[0107] (Preparation of flow cell) The basic structure of the flow cell system constructed in this disclosure is a silicone tube for sending cell suspension or fluid, and a glass tube for observing cells is connected to it. To construct a rectangular parallelepiped flow cell system, silicone tubes with a length of 300 mm, an inner diameter of 1 mm, and an outer diameter of 2 mm were connected to both ends of a rectangular parallelepiped glass (Vitrocom) with a length of 50 mm and each inner diameter dimension of 1 mm, and the connection parts were sealed with paraffin film. The inlet silicone tube was connected to a syringe pump (Legato 200, KD Scientific) via a three-way stopcock (Terumo Corporation), and fluid was sent to the cell observation part (flow cell) of the rectangular parallelepiped glass tube.

[0108] A Tol5 cell suspension suspended in BS-N medium was passed through the flow cell at a rate of 64 μl / min for 30 minutes to allow the Tol5 cell aggregates to adhere to the glass flow cell. Then, BS-N medium containing 0.1 mM AVL peptide was passed through the flow cell at the same rate, and the behavior of the attached Tol5 cell aggregates was observed with a digital microscope (Keyence VHX-200).

[0109] (Results and Discussion) The results are shown in Figure 6. The cell aggregates of Acinetobacter sp. Tol5 strain were observed to be disintegrated by the AVL peptide. Even when a medium not containing the peptide was flowed at the same speed, the aggregates were not affected at all. This indicates that the AVL peptide has the function of disintegrating the self-aggregation of Nheads of AtaA.

[0110] (Example 7: Measurement of adhesiveness of E. coli recombinant Nhead) In this example, the adhesiveness of recombinant Nhead expressed in Escherichia coli was measured by QCM-D.

[0111] (method) A sample solution was prepared by dissolving recombinant Nhead protein (SEQ ID NO: 19) in a PBS solution at a concentration of 50 μg / ml. The device used was Q-Sense E4 (Biolin scientific, Sweden), and the sensor was made of polystyrene (PS) or silica. First, PBS buffer was flowed at a flow rate of 250 μl / min and the device was allowed to stabilize. Then, the sample solution was flowed at the same flow rate for 1.5 minutes, the flow was stopped and the device was left to stand for 15 minutes, and the sample solution was again flowed at the same flow rate for 1.5 minutes. The flow was stopped again and the device was left to stand for 10 minutes, after which the PBS buffer was flowed at the same flow rate for 1 minute to rinse the device, and the flow was stopped and the device was left to stand for 5 minutes. Next, 0.1 mM AVL peptide solution was flowed at the same flow rate for 2 minutes, and the flow was stopped and the device was left to stand for 15 minutes. Finally, the PBS buffer was flowed at the same flow rate for 2 minutes, the flow was stopped, and the device was left to stand for 10 minutes to complete the measurement.

[0112] (result) The results are shown in Figures 7A and 7B. For both the polystyrene and silica sensors, the Δf7 / 7(Hz) value decreased immediately after the addition of Nhead and reached a plateau. No change in the Δf7 / 7(Hz) value was observed even after the subsequent steps of resupplying Nhead, rinsing with buffer, adding AVL peptide, and rinsing with buffer for the second time.

[0113] (Consideration) When E. coli recombinant Nhead was added, it instantly adhered to the sensor and reached equilibrium. After that, even if the E. coli recombinant Nhead solution was resupplied, no change in the Δf7 / 7 (Hz) value was observed, so it was thought that Nhead did not adhere anew. From these findings, it is considered that E. coli recombinant Nhead has adhesion to polystyrene and silica surfaces but does not laminate. This reflects that E. coli recombinant Nhead does not have self-aggregation properties. In addition, it is thought that E. coli recombinant Nhead attached to the surface will not peel off just by rinsing with a buffer solution. Subsequently, even when AVL peptide, which disrupts the self-aggregation of native Nhead, was supplied, no separation was observed. This fact also shows that E. coli recombinant Nhead does not exhibit self-aggregation and does not adhere in layers. Separation by re-rinsing was not observed. From the above, it was found that E. coli recombinant Nhead adheres to the solid surface in a monolayer without lamination. The slight fluctuation in the signal due to re-supply of Nhead, rinsing, supply of AVL peptide, and re-rinsing is considered to be noise due to the operation.

[0114] (Example 8: Self-aggregation and microbial immobilization rate of cells expressing WChead) In the seventh example, when present at the tip of AtaA on a microbial cell, Nhead exerts adhesiveness and self-aggregation, but the recombinant Nhead protein produced in E. coli exhibits only adhesiveness and does not exhibit self-aggregation, which was an unpredictable and puzzling result even for the researchers involved. From an applied perspective, this unexpected property of the recombinant Nhead protein provides a useful function of monolayer adhesion to material surfaces. Therefore, in order to elucidate the reason for this, we decided to explore the functions of domains other than Nhead in more detail. It is a public fact that Chead is not involved in adhesion and self-aggregation when present on AtaA on a microbial cell (K. Koiwai, MD Hartmann, D. Linke, AN Lupas and K. Hori; Structural basis for toughness and flexibility in the C-terminal passenger domain of an Acinetobacter trimeric autotransporter adhesin, J. Biol. Chem. 291 (2016) 3705-3724.). However, Chead is present at the base of the AtaA fiber. At this location, it is difficult for Chead to interact with surfaces or other AtaA molecules. However, we hypothesized that if Chead, which has a similar structure (Ylhead), were located at the tip of the AtaA fiber like Nhead, it would also function as adhesive and self-aggregating. Therefore, we decided to create a WChead mutant in which the Nhead of AtaA was replaced with Chead. In this example, we measured the self-aggregation and microbial immobilization rate of microbial cells expressing WChead.

[0115] (method) The WChead variant was created by deleting the Nhead domain of the full-length AtaA protein and incorporating the Chead domain in that region, so that it has a domain group structure of Chead-Nstalk-Chead-Cstalk (SEQ ID NO: 25). The cell adhesiveness of this WChead strain was compared with that of the wild-type strain (AtaA), the ΔAtaA strain, and the ΔNhead strain. The adhesiveness was tested using the same adhesive test method as in Figure 4. For the autoagglutination test, the microbial cells were plated on BS-N medium at initial OD 660 A bacterial suspension was prepared in which the bacterial concentration was suspended to a value of 0.5. This suspension was used to examine the self-aggregation by a tube-settling assay. The detailed procedure of this method is as described in M. Ishikawa, K. Shigemori, A. Suzuki, and K. Hori; Evaluation of adhesiveness of Acinetobacter sp. Tol5 to abiotic surfaces, J. Biosci. Bioeng. 113 (2012) 719-725. However, the test tube was left to stand for 3 hours.

[0116] (result) The results are shown in Figures 8A and 8B. In Figure 8A, the autoaggregation observed in wild-type AtaA disappeared in the ΔNhead-deficient strain, indicating that Nhead is involved in autoaggregation. Furthermore, autoaggregation was observed when WChead was expressed, indicating that Chead also exhibits autoaggregation when present at the tip of the AtaA fiber, just like Nhead. In Figure 8B, the microbial adhesiveness observed in wild-type AtaA was reduced in the WChead-expressing strain to the same extent as the ΔNhead-deficient strain, making it clear that Chead does not exhibit adhesiveness like Nhead, even if it is located at the tip of the AtaA fiber. In other words, we discovered the unexpected fact that although Chead does not have adhesiveness, it can exhibit coagulation depending on its position on the AtaA fiber, that is, it potentially has self-aggregation function.

[0117] (Consideration) It is known that the passenger domain of AtaA cleaved from the fiber has adhesive and self-aggregation abilities. This passenger domain contains both Nhead and Chead. It is believed that when the AtaA fiber is cleaved from the cell, the Chead on the AtaA fiber is released from the steric hindrance when it is present on the cell surface, and is able to exert its potential self-aggregation function. When the AtaA fiber is present on the cell surface, the protein is aligned, so the Nhead at the tip alone can exert a sufficient force to cause cell aggregation. However, since the passenger domain fiber of AtaA cleaved from the cell loses its orientation, the contact efficiency between Nheads is reduced compared to when it is present on the cell. Therefore, self-aggregation cannot be exerted by Nhead alone. However, when Chead is present, the domain with aggregative properties is located near both ends of the fiber, and it exhibits self-aggregation. In other words, it is believed that the AtaA fragment cleaved from the microbial cell exhibits self-aggregation when it has both Nhead and Chead, but does not exhibit self-aggregation when it has only Nhead without Chead. Therefore, when an AtaA fragment that does not contain a Chead, or an AtaA fragment that has a Chead with a mutation that eliminates the self-aggregation function of the Chead, contains an Nhead, the resulting recombinant protein has adhesion function but not self-aggregation function.

[0118] Example 9: Immobilization of fusions with Nhead fusion peptides An example of immobilizing a functional protein on a material surface using the monolayer adhesiveness of Nhead is shown below. For this purpose, a fusion peptide (SEQ ID NO: 27) was designed in which the SNAP protein was fused to Nhead as a model protein. The construct design is shown in FIG. 9A. The SNAP protein was fused between the GCN4pII tag and His tag of the Nhead recombinant protein shown in FIG. 3. The sequence of this Nhead-SNAP fusion peptide is shown in FIG. 9C. As an indicator of whether the purified Nhaed-SNAP fusion peptide was correctly folded, the secondary structure was analyzed by CD spectroscopy.

[0119] (method) pIBA-GCN4tri-His::ataA 59-325 A DNA construct was prepared by combining a fragment amplified by inverse PCR from the above and a separately prepared DNA fragment encoding the SNAP protein (SNAP-DNA) by In-Fusion cloning. This was introduced into E. coli for production, and the fusion peptide was purified. The specific procedure is as described in Example 3.

[0120] (result) Analysis of the CD spectrum demonstrated that the Nhead-SNAP fusion peptide produced in E. coli and purified formed a secondary structure rather than a random coil state (Fig. 9B).

[0121] Example 10: Immobilization of Nhead-SNAP fusion peptide onto various material surfaces In this example, we attempted to immobilize the Nhead-SNAP fusion peptide on the surfaces of glass, polystyrene (PS), titanium (Ti), and polytetrafluoroethylene resin (PTFE).

[0122] (method) The procedure for immobilizing the fusion peptide on the surface is shown in FIG. 10A. Four layers of polyvinyl chloride tape (VT-196; Nichiban) were attached to Teflon (registered trademark) tape (Nittoko Tape No. 303; Nitto Denko), and holes with a diameter of 5 mm were made at 1.5 cm intervals using a hole punch. Before use, the Teflon tape was peeled off and attached to the target material to create a polyvinyl chloride test well with a depth of 0.8 mm on the flat material. 1 μM of Nhead-SNAP fusion peptide solution was dropped into the well and left to stand for 1 hour. As negative controls, a blank well with nothing added and a well with only SNAP protein added were also prepared. In order to quantify the fusion peptide immobilized on the surface, 1 μM of SNAP Surface488, a fluorescent substrate molecule of the SNAP protein fused to Nhead, was dropped and left to stand at 37° C. for 1 hour, thereby covalently binding the fluorescent substrate to the SNAP protein via the benzylguanyl group. After washing five times with PBS, the sections were exposed to green LED light containing an excitation wavelength of 506 nm using a fluorescent scanner for 120 seconds, and the 526 nm fluorescence was photographed.

[0123] (result) The results are shown in Figure 10B. Fluorescence was observed on all substrates to which the Nhead-SNAP fusion peptide was added. Therefore, it was demonstrated that the Nhead-SNAP fusion peptide could be attached and fixed to all materials used in the experiment via Nhead. It was also shown that the SNAP protein alone could not be fixed to the substrate.

[0124] (Example 11: Immobilization of antimicrobial peptides using Nhead-SNAP fusion peptides) In this example, we attempted to impart antibacterial activity to the surface of a material by immobilizing an antibacterial peptide using an Nhead-SNAP fusion peptide.

[0125] (method) 15 μl of 3 μM Nhead-SNAP fusion peptide solution was added to a 12-hole highly water-repellent printed slide glass (Matsunami Glass Industry) and left to stand at room temperature for 1 hour. Washing was performed three times with 20 μl of PBS, and 9 μM benzylguanyl (BG)-modified CAP18 antimicrobial peptide was added and incubated at 37° C. for 1 hour to covalently bind the antimicrobial peptide to the SNAP protein portion of the fusion peptide. Then, washing was performed three times with 20 μl of PBS. 15 μl of M9 medium (OD600=0.01) in which Pseudomonas aeruginosa PAO1 was suspended was added thereto and left to stand at room temperature for 15 minutes. After removing the microbial suspension, washing was performed three times with 20 μl of M9 medium. Then, 15 μl of M9 medium was added and static culture was performed at 37° C. for 10 hours. After incubation, the plates were washed three times with PBS, and the microbial cells were stained with SYTO9 (final concentration 3.34 μM) for 15 minutes. After washing five times with PBS, the biofilms formed on the plates were observed using a confocal laser microscope.

[0126] (result) The results are shown in Figure 11. When the back-gated antimicrobial peptide was added to the polystyrene surface coated with Nhead-SNAP, the peptide was immobilized and biofilm formation by Pseudomonas aeruginosa was suppressed. However, the addition of the back-gated antimicrobial peptide to the surface coated with SNAP protein alone and to the untreated surface did not suppress the biofilm formation by Pseudomonas aeruginosa. It was confirmed that the SNAP protein itself does not have the ability to adhere to surfaces, and the antimicrobial peptide itself does not show the ability to adsorb to surfaces. Therefore, it has become possible to create functional surfaces such as antibacterial surfaces by immobilizing the SNAP protein to a surface using Nhead as an adhesive tag and further binding the back-gated functional molecule to SNAP.

[0127] (Example 12: Preparation of SNAP-Nhead-GCN4pII fusion peptide having SNAP protein on the N-terminus) The purpose of this example was to prepare Nhead (SEQ ID NO: 29) having the SNAP protein at its N-terminus and to clarify whether it folds normally.

[0128] (method) Using pDONR::ataA, in which the ataA gene was cloned, and the SNAP-DNA fragment, overlapping PCR was performed to identify (1) the nucleotide sequence upstream of the ataA gene ( GA ATT C A DNA was prepared by fusing (1) AT CTC CTA AGG AAA AGC GAT (SEQ ID NO: 5; the underlined portion is the EcoRI restriction enzyme recognition sequence), (2) a base sequence encoding the AtaA signal peptide recognition sequence (amino acid positions 1 to 59 of SEQ ID NO: 4)-SNAP protein-glycine linker, and (3) a base sequence encoding the tip of Nhead (positions 7 to 35 of SEQ ID NO: 2 (up to the restriction enzyme XmnI cleavage site)). By ligating this to the EcoRI- and XmnI-digested fragment of pDONR::ataA, the AtaA signal peptide recognition sequence and Nhead (to be precise, A fusion gene fragment was constructed that encodes a polypeptide in which the SNAP protein and a glycine linker were inserted between the SNAP protein and the glycine linker (the first alanine residue was removed). Using this as a template, a DNA fragment encoding the Nhead and coiled-coil portion (amino acids 3 to 268 of SEQ ID NO: 1) of SNAP protein-glycine linker-AtaA was amplified by PCR. This was inserted into the pIBA-GCN4tri-His vector in the same manner as in Example 3, and the pIBA::SNAP-Nhead fusion peptide (pIBA::SANP-AtaA 60-325 ) was prepared. This was introduced into Escherichia coli to produce a recombinant protein. The production and purification of the SNAP-Nhead fusion peptide, and confirmation of whether the purified fusion peptide was correctly folded were carried out in accordance with Example 3.

[0129] (result) The results are shown in Figure 12. CD spectrum analysis showed that the SNAP-Nhead fusion peptide produced in E. coli and purified had a secondary structure rather than a random coil state, and was presumed to be folded.

[0130] (Example 13: Immobilization ability and functional evaluation of SNAP-Nhead fusion peptide) In this example, the function of immobilizing an antimicrobial peptide using the SNAP-Nhead fusion peptide prepared in Example 12 was evaluated.

[0131] (method) First, the fusion peptide immobilized on the surface is reacted with the backgrowth-modified antimicrobial peptide CAP18, which is covalently bonded to the SNAP protein in the fusion peptide. Next, the fluorescent substrate of the SNAP protein is reacted with the immobilized fusion peptide, and the fluorescent substrate is covalently bonded to the SNAP protein that was left vacant because the antimicrobial peptide could not bind. The binding efficiency of CAP18 to the fusion peptide can be examined by comparing this fluorescence intensity with the fluorescence intensity when the fluorescent substrate is reacted without reacting with CAP18 in advance. To this end, 100 μl of the fusion peptide solution (1 μM) was applied to a black polystyrene 96-well plate and allowed to stand at room temperature for 1 hour to immobilize the fusion peptide on the plate. After washing three times with 110 μl of PBS, 100 μl of 3 μM backgrowth-modified CAP18 antimicrobial peptide solution was added and incubated at 37 ° C for 1 hour to allow the reaction. After washing three times with 110 μl of PBS, 100 μl of 3 μM SNAP surface488 was applied and allowed to react for another 1 hour at 37 ° C. Finally, the plate was washed five times with 110 μl of PBS, and the fluorescence intensity at a wavelength of 535 nm was measured using a plate reader with 485 nm excitation light. On the other hand, the fluorescence intensity when SNAP Surface488 was applied, excluding the reaction process with CAP18, was also measured using the same method. In addition to the SNAP-Nhead fusion peptide, this test was also performed on the Nhead-SNAP fusion peptide and the original SNAP protein as controls.

[0132] (result) The results are shown in Figure 13. The SNAP-Nhead fusion peptide caused a similar reduction in fluorescence value as the Nhead-SNAP fusion peptide. Therefore, it was concluded that the SNAP-Nhead fusion peptide has a peptide immobilization ability similar to that of the Nhead-SNAP fusion peptide.

[0133] (Consideration) It was shown that when the Nhead recombinant protein is used as an adhesive tag, the peptide to be immobilized can be fused to either the carboxy- or amino-terminal side of Nhead.

[0134] Example 14: Preparation of Nhead-SNAP fusion peptide without GCN4pII tag The purpose of this example was to clarify whether the GCN4pII tag, which was fused to the AtaA fragment in the hope of assisting its trimerization, is essential or dispensable for folding of the recombinant E. coli Nhead protein.

[0135] (method) The construct design (SEQ ID NO: 31) of the fusion peptide prepared in this example is shown in FIG. 14A. The construct DNA constructed during the preparation of the Nhead-SNAP fusion peptide shown in Example 9 was used to delete the region encoding the GCN4pII tag by inverse PCR to construct the desired construct DNA. The amino acid sequence of this construct Nhead-SNAP_ΔGCN4pII fusion peptide is shown in FIG. 14C. The fusion peptide was purified according to the purification method of the Nhead recombinant protein described in Example 3. The CD spectrum of the purified fusion peptide was measured by the same method as in Example 3.

[0136] (result) CD spectrum analysis showed that the Nhead-SNAP_ΔGCN4pII fusion peptide produced in E. coli and purified formed a secondary structure rather than a random coil state and was folded (FIG. 14B).

[0137] (Consideration) From the above results, it is considered that the trimerization tag, GCN4pII tag, is not essential in the design and construction of E. coli recombinant Nhead protein and its fusion peptide.

[0138] (Example 15: Preparation of Nhead-SNAP fusion peptide without coiled-coil region) The purpose of this example was to clarify whether it is possible to produce an E. coli recombinant protein using only the Nhead domain region (Nhead-neck) by removing the coiled-coil region from the Nhead-SNAP fusion peptide shown in Example 9, and whether the resulting construct is capable of folding and thus has activity.

[0139] (method) The construct design (SEQ ID NO: 33) of the fusion peptide prepared in this Example is shown in FIG. 15A. The construct DNA constructed in the preparation of the Nhead-SNAP fusion peptide shown in Example 9 was used to delete the region encoding the coiled coil by inverse PCR to construct the desired construct DNA. The amino acid sequence of this construct Nhead-SNAP_ΔCC fusion peptide is shown in FIG. 15C. The fusion peptide was purified according to the purification method of the Nhead recombinant protein described in Example 3. The CD spectrum of the purified fusion peptide was measured by the same method as in Example 3.

[0140] (result) CD spectrum analysis showed that the Nhead-SNAP_ΔCC fusion peptide produced in E. coli and purified formed a secondary structure rather than a random coil state and was folded (FIG. 15B).

[0141] (Consideration) Based on the above results, it is believed that the coiled-coil portion is unnecessary in the design and construction of the E. coli recombinant Nhead protein and its fusion peptide.

[0142] (Example 16: Functional evaluation of various fusion peptides of Nhead and SNAP proteins) In this example, the immobilization ability was evaluated for various fusion peptides of Nhead and SNAP protein prepared in Examples 14 and 15. The immobilization amount of the fusion peptide was evaluated using a fluorescent substrate of the SNAP protein.

[0143] (method) The fusion peptide was immobilized on a black polystyrene 96-well plate by a method similar to that of Example 13, and SNAP Surface488 was bound to the fusion peptide, and the amount was quantified by measurement using a plate reader. However, unlike Example 13, the fusion peptide was not bound to CAP18 in advance.

[0144] (result) It was revealed that both the Nhead-SNAP_ΔGCN4pII fusion peptide and Nhead-SNAP_ΔCC had immobilization ability equal to or greater than that of the Nhead-SNAP fusion peptide.

[0145] (Consideration) It is clear that there is no need to use the GCN4pII tag or to retain the coiled-coil domain of AtaA when fusing functional peptides, as Nhead and Nhead fusion peptides fold correctly and are functional in their absence.

[0146] (Example 17: Practical application of E. coli recombinant Nhead as a surface adhesion protein) In this example, it is demonstrated that E. coli recombinant Nhead binds to streptavidin to form a complex.

[0147] (method) According to Example 5, the particle shape of the protein in the E. coli recombinant Nhead alone, streptavidin (SA) alone, and a mixed solution of Nhead and SA was measured by DLS. In the case of a single protein solution, the concentration of the sample solution was adjusted to 0.2 mg / ml as in Example 5. In the case of mixing two types of proteins, equal amounts of sample solutions adjusted to 0.2 mg / ml were mixed and left to stand for 5 minutes. Then, 40 μl of the mixed solution was used for the measurement.

[0148] (result) The results are shown in Figure 17. When E. coli recombinant Nhead or SA was used alone, a single molecule peak appeared at 5 to several tens of nm. When these were mixed, the peak shifted to several thousand nm, which is far greater than the sum of the single molecules of E. coli recombinant Nhead and SA. This indicates that a large number of molecules of both proteins aggregated while forming a complex.

[0149] (Example 18: Binding of E. coli recombinant Nhead to neutral avidin) In this example, it is demonstrated that E. coli recombinant Nhead binds to neutral avidin to form a complex.

[0150] (method) The same procedure as in Example 17 was carried out, except that the SA in Example 17 was replaced with neutral avidin in this example.

[0151] (result) The results are shown in Figure 18. When E. coli recombinant Nhead or neutral avidin was used alone, a single molecule peak appeared at 5 to several tens of nm. When these were mixed, the peak shifted to several thousand nm, which is far greater than the sum of the single molecules of E. coli recombinant Nhead and neutral avidin. This indicates that a large number of molecules of both proteins aggregated while forming a complex.

[0152] (Comparative Example 1: Interaction between E. coli recombinant Nhead and avidin) In this example, it is shown that E. coli recombinant Nhead does not bind to avidin.

[0153] (method) The same procedure as in Example 17 was carried out, except that SA in Example 17 was replaced with avidin in this example.

[0154] (result) The results are shown in Figure 19. E. coli recombinant Nhaed alone, avidin alone, and the mixture of both proteins all showed single molecule peaks at 5 to several tens of nm, demonstrating that E. coli recombinant Nhead cannot bind to avidin and therefore no complex is formed.

[0155] (Consideration) The complex formation function of E. coli Nhead with other proteins was shown to be a specific interaction that selects partners.

[0156] Example 19: Immobilization of cells In this example, we demonstrate that two types of bacterial cells can be immobilized on plates whose surfaces are coated with E. coli recombinant Nhead. (method) The outline of the method is shown in Figure 20A. E. coli recombinant Nhead was coated on a plate. Bacillus subtilis or Escherichia coli adjusted to a certain concentration was dropped onto the plate and incubated for 6 hours. After that, the plate was washed with pure water (DW), and each cell was stained with a nuclear stain. The cells fixed on the plate were observed under a confocal microscope.

[0157] (result) The results are shown in Figure 20B. Cell fixation was observed on the plates on which either Bacillus subtilis or E. coli was dropped. Cell fixation was not observed on the plates that were not coated with Nhead or on the plates on which BSA was dropped instead of Nhead.

[0158] (Example 20: Preparation and confirmation of liposomes with Nhead-SNAP fusion peptide immobilized on the surface (Nhead surface-modified liposomes)) (method) (Preparation of Nhead surface-modified liposomes) The Nhead-SNAP fusion peptide shown in Example 9 was reacted with benzylguanyl (BG)-modified liposomes to produce the liposomes. The BG-modified liposomes were produced as follows.

[0159] A round-bottom flask containing 300 μl of 50 mg / ml egg yolk phosphatidylcholine (COATSOME NC-50 (EPC), Yuka Sangyo) dissolved in chloroform was rotated for 1 h under vacuum. The lipid film was hydrated with Buffer A (10 mM HEPES, pH 7.6, 50 mM potassium glutamate) or Buffer B (10 mM Tris-HCl (pH 9.0)) supplemented with 25 μM AlexaFluor647 to obtain 300 μL of 50 mg / ml lipid solution. For samples with GUS, 2 μM GUS was added to Buffer A. For samples for electron microscopy, 1 mg / mL BSA was added to Buffer B. These lipid solutions were sonicated for 10 min and vortexed for 10 s. The lipid solutions were further subjected to five freeze-thaw cycles. The liposome suspension was then extruded by a mini extruder (Avanti Polar Lipids, Alabaster, AL, USA) using a 0.8 μm VCTP Isopore membrane filter at room temperature. 300 μL of giant unilamellar vesicles (LUVs) prepared with buffer A or B were washed by adding 1200 μL of buffer A or buffer B, respectively, centrifuging at 20,000 × g for 30 min, and replacing the supernatant with 1200 μL of buffer A or B. The washing step was repeated four times.

[0160] BG liposomes were prepared as follows: 14 μl of 2 mM BG-DSPE (PEG200) dissolved in chloroform was first hydrated with Buffer A or B by rotating for 15 min under vacuum in a glass microtube, and then the BG-DSPE solution was added to the LUV solution to a final concentration of 93 μM, incubated at room temperature for 20 h, and washed four times as described above.

[0161] The liposome (LUV) solution and the Nhead-SNAP fusion peptide solution (10 μM) were mixed in a low-adsorption 1.5 mL tube (MS-4215M; Sumitomo Bakelite). The BG-modified LUV liposomes and the fusion peptide were reacted by incubating at 37 ° C for 30 minutes to obtain Nhead-modified liposomes. The mixture was centrifuged at 8000 × g and 4 ° C for 5 minutes, the supernatant was removed, and the liposome pellet was resuspended in 50 μl of 10 mM Tris-HCl (pH 9.0) at room temperature to obtain an Nhead surface-modified liposome solution.

[0162] (method) (Confirmation of Nhead surface-modified liposomes) By measuring the particle shapes of unmodified liposomes and Nhead surface-modified liposomes by DLS, it was confirmed whether the modified liposomes were properly prepared. The DLS measurement method was performed as shown in Example 5.

[0163] (Results and Discussion) The results are shown in Figure 21. The E. coli recombinant Nhead-SNAP surface-modified liposomes showed a diameter peak at about 90 nm, whereas the unmodified normal liposomes showed a diameter peak at about 60 nm. This result indicates that immobilization of E. coli recombinant Nhead-SNAP on the liposome surface increased the liposome diameter due to surface modification, but did not cause liposome aggregation, resulting in monodispersity. This is because the E. coli recombinant Nhead and its SNAP protein fusion peptide do not have the property of aggregation.

[0164] (Example 21: Analysis of adhesive properties of Nhead surface-modified liposomes) (method) 45 μl of the liposome suspension (corresponding to the concentration of Nhead-SNAP fusion peptide: 1 μM or 10 μM) was dropped into a 96-well polystyrene plate (Becton, Dickinson and Company) and mixed with 5 μl of 10× phosphate-buffered saline (1.37 M NaCl, 27 mM KCl, 81 mM Na2HPO4·7H2O, 14.7 mM KH2PO4). To allow the liposome particles to adhere to the surface of the plate, the plate containing the liposome suspension was centrifuged at 700 g for 30 min at room temperature. To remove unbound liposomes, the wells were washed 2 to 4 times with buffer (9.0 mM Tris-HCl (pH 9.0), 137 mM NaCl, 2.7 mM KCl, 8.1 mM Na2HPO4 7H2O, 1.47 mM KH2PO4), and 50 μl of 10 mM Tris-HCl buffer (pH 9.0) was added to the wells. Liposome adhesion was evaluated by measuring the fluorescent signal of AF647 encapsulated in the liposomes using a microplate reader (ARVO X3; PerkinElmer). The fluorescent signal was quantified using the top reading mode to improve the signal-to-noise ratio. When detecting the fluorescence from the attached liposomes, the bottom was masked with black plastic tape.

[0165] (Results and Discussion) The results are shown in Figure 22. The BG-modified liposomes mixed with Nhead-SNAP were observed to adhere to the polystyrene plate in an Nhead concentration-dependent manner. However, the non-BG-modified liposomes used as a comparative example were not surface-modified with Nhead, and therefore did not adhere to the plate.

[0166] (Example 22: Preparation and confirmation of liposomes with NheadNstalk (NhNs)-SNAP fusion peptide immobilized on the surface (NheadNstalk fiber surface-modified liposomes) In this example, liposomes having NheadNstalk (NhNs)-SNAP fusion peptide immobilized on their surface were prepared and confirmed.

[0167] (method) (Preparation of NhNs-SNAP fusion peptide) The pIBA-GCN4tri-strept-tag::NhNs-SNAP construct DNA was prepared using the Nhead-SNAP fusion peptide and pDONR::ataA shown in Example 9. The E. coli BL21(DE3) strain was transformed with the DNA. The resulting recombinant E. coli was grown at OD 3000 to 10000 in LB medium containing 100 μg / ml ampicillin at 37°C. 600 The culture was continued until the affinity of the cultured cells reached 0.5 to 0.7, 0.2 μg / ml of anhydrotetracycline was added, and the cells were further cultured at 18°C ​​for 16 hours to produce the NhNs-SNAP fusion peptide (SEQ ID NO: 35). A schematic diagram of the fusion peptide is shown in Figure 23. The upper row shows the full-length AtaA protein, and the lower row shows the NhNs-SNAP fusion peptide. Using a cell lysate of recombinant E. coli that had produced the fusion peptide intracellularly and BG-modified LUV, NhNs fiber surface-modified liposomes were prepared as described below.

[0168] (Preparation of liposomes with NhNs-SNAP fusion peptide immobilized on the surface) The suspension of BG-modified liposomes was mixed with 2.0 mg / mL of cell extract from Escherichia coli BL21(DE3) transformant strain that produced NhNs-SNAP fusion peptide. After incubation at 4°C for 1 hour in a rotor, the mixture was centrifuged at 15,000 g for 10 minutes to precipitate the NhNs fiber surface-modified liposome particles. The precipitated liposome particles were washed twice with 10 mM Tris-HCl (pH 9.0) buffer and resuspended in the same buffer.

[0169] (Observation of the prepared NhNs fiber surface-modified liposomes) The modification of the liposomes was confirmed by observing the obtained NhNs fiber surface-modified liposomes under an electron microscope. The liposome suspension was diluted 50-fold in 10 mM Tris-HCl buffer (pH 9.0). The liposomes were adsorbed onto a carbon-coated copper film (400 mesh) and stained with 2% phosphotungstic acid solution (pH 7.0) for 10 seconds. The grid was then vacuum-dried for 10 minutes. The grid was observed using a transmission electron microscope (JEM-1400 plus, JEOL Ltd.) at an accelerating voltage of 100 kV. Digital images (3296 × 2472 pixels) were acquired by a CCD camera (EM-14830RUBY2, JEOL Ltd.).

[0170] (result) The results are shown in Figure 24. Electron microscopy revealed that NheadNstalk fibers were fixed to the surface of the liposome, and that the surface layer of the liposome was modified with the fusion peptide.

[0171] (Example 23: Evaluation of dispersion and aggregation properties of NheaNstalk fiber-modified liposomes) (method) The DLS measurements were performed in the same manner as in Examples 5 and 17. However, for comparison, Acinetobacter sp. Tol5 and ΔataA mutant strains were also measured. The bacterial cell culture was harvested by centrifugation at 8,000 g, washed five times with pure water, and then analyzed at OD 0 with pure water. 660 = 0.05 and measured.

[0172] (Results and Discussion) The results of Example 23 are shown in FIG. 25. The results of FIG. 25A revealed that the size distribution of bacterial cells differed in the presence and absence of AtaA. The size of most of the Acinetobacter sp. Tol5 strain was about 1720 nm, which was about 440 nm larger than that of ΔataA, which was about 1280 nm. This corresponded to the size of native AtaA (225 nm × 2). Also, as shown in FIG. 25B, in the 100 mM KCl solution, the aggregates settled and the liquid became transparent, whereas in pure water, the cells did not self-aggregate but remained suspended, so the liquid became cloudy. That is, even Tol5 cells with native AtaA did not self-aggregate in pure water. Therefore, the small peak seen around 5500 nm in Tol5 in FIG. 25A does not indicate aggregates of the Tol5 strain. Considering the diameter, it is inferred that it is a small cell group of about 10 cells weakly entangled.

[0173] From the results in Figure 25C, the diameter of the NhNs fiber surface-modified liposomes was approximately 1280 nm, 455 nm larger than the diameter of the unmodified liposomes, approximately 825 nm. This is approximately twice the length of the NheadNstalk, which is 180 nm. Furthermore, it was revealed that the NhNs fiber surface-modified liposomes also do not exhibit self-aggregation. The peak seen around 5000 nm, similar to Tol5 in Figure 25A, is also thought to be not an aggregate of NhNs fiber surface-modified liposomes.

[0174] (Example 24: Adhesion assay of NheadNstalk fiber-modified liposomes and enzyme reaction with adherent liposomes) In this example, adhesion by NhNs fiber surface-modified liposomes and enzyme reaction by immobilized liposomes are demonstrated.

[0175] (method) (Adhesion Assay) The same procedure as in Example 20 was carried out, except that the adhesion to a 96-well glass-bottom plate (Matsunami Glass Industry) was also evaluated in addition to the polystyrene plate.

[0176] (Enzyme reaction) For the enzyme reaction, 2 μM β-glucuronidase (GUS) was encapsulated during the preparation of liposomes. The liposomes were immobilized on a plate and the enzyme activity was measured by the following method.

[0177] For the enzyme assay with GUS encapsulated in liposomes attached to the plate surface, the liposome suspension was diluted 50-fold with 10 mM Tris-HCl buffer (pH 9.0), and 50 μL of the suspension was placed in a polystyrene well plate. The liposomes were attached to the plate surface by centrifugation. After washing away the unfixed liposomes, 50 μL of 10 mM Tris-HCl buffer containing 10 μM TokyoGreen-β GlcU (Goryo Chemical) as a substrate for GUS was added to each well. The hydrolysis reaction was detected as a fluorescent signal at the indicated time points using a microplate reader. The excitation and emission wavelengths were 485 nm and 535 nm, respectively.

[0178] (result) The results of Example 24 are shown in Figure 26. In both Figures 26A (polystyrene plate) and 26B (glass plate), significant fluorescence was measured when NhNs fiber surface-modified liposomes were obtained by mixing BG-modified liposomes with cell lysate, and this fluorescence increased with increasing protein concentration of the cell lysate. Conversely, no fluorescence was observed in the case of control unmodified liposomes (EggPC liposomes) that were not modified with BG groups.

[0179] The results of measuring the enzyme activity are shown in Fig. 26C. Significant fluorescence indicating an enzyme reaction was observed in the wells where NhNs fiber surface-modified liposomes were immobilized. (Consideration) By modifying the surface of liposomes with NheadNstalk, it became possible to immobilize liposomes on the surfaces of various materials, and it was demonstrated that chemical reactions can be carried out using enzymes encapsulated in the immobilized liposomes.

[0180] Example 25: Analysis of self-aggregation and adhesion using modified AtaA polypeptides In this example, a comparison of self-aggregation and adhesion properties is performed using various AtaA polypeptides.

[0181] (method) Using a method similar to that of the above-mentioned Examples, or an experimental method routinely performed in the technical field known to those skilled in the art, or a commercially available kit, expression constructs encoding various domain-deleted, modified and / or mutant forms having lengths of 237 amino acids or more and 3364 amino acids or less derived from the AtaA protein are designed. The self-aggregation and / or adhesive properties of these various deleted, modified or mutant forms are analyzed using a method similar to that of the above-mentioned Examples.

[0182] (Example 26: Preparation of fusion peptides with tags and / or proteins other than SNAP protein) In this example, the SpyTag / SpyCatcher system was introduced into the immobilization technology, and fusion proteins with tags and / or proteins other than the SNAP protein were produced, establishing a technology for immobilizing proteins on the surface of materials.

[0183] (method) (Construction of SpyCatcher-Nhead expression plasmid) pIBA-SNAP-AtaA 59-325 A DNA fragment containing a region other than the SNAP tag was amplified by PCR using -GCN4tri-His as a template, and a DNA fragment containing SpyCatcher was amplified by PCR using pDEST14-SpyCatcher002 (Addgene) as a template. These fragments were ligated using NEBuilder HiFi DNA Assembly to create pIBA-SpyCatcher-AtaA. 59-325 -GCN4tri-His (SEQ ID NO: 36) was constructed (Figure 27). Primer used 1. GGATCCAGTGGTAGCGGAGGTGGAGGTGCTAC (SEQ ID NO: 38) 2. GATGTCGTAATCCATTTTTTGCCCTCGTTATCTAG (SEQ ID NO: 39) 3. GATTACGACATCCCAACG (SEQ ID NO: 40) 4. GCTACCACTGGATCCAGTATG (SEQ ID NO: 41)

[0184] (Construction of SpyTag-GFP expression plasmid) Using pIVEX-SNAP-GFP (Addgene) as a template, DNA fragments containing the vector region and GFP were amplified by PCR, and then they were joined using NEBuilder HiFi DNA Assembly to construct pIVEX-SpyTag-GFP-his (sequence number 37) (Figure 28). Primer used 1. GGTCATCACCACCATCATCATTAATGAGGATCCGGCTG (SEQ ID NO: 42) 2. AGGCGTCCACCATCACGATAGTAGGCACCATGGAGCCCAGGCCCA (SEQ ID NO: 43) 3. TGATGGTGGACGCCTACAAGCGTTACAAGGGCTTGGGAAGCGGCCG (SEQ ID NO: 44) 4. ATGGTGGTGATGACCGCCTCCTTTGTAGAGCTCATCCATG (SEQ ID NO: 45)

[0185] (Expression and purification of SpyCatcher-Nhead (SEQ ID NO: 36)) 20 ml of the bacterial culture solution cultured overnight at 37°C was inoculated into 2 L of LB medium (100 μg / ml Amp). After shaking culture at 37°C for 3 hours, AHTC was added as an inducer at 200 μg / l and shaking culture was continued at 28°C for 4 hours. The bacteria were collected by centrifugation (6,000 rpm, 10 min, 4°C, R12A6 rotor; Hitachi Koki) and suspended in 200 ml of lysis buffer (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 9.0). The suspended bacteria were disrupted at 1000 bar for 10 min using a French press (LAB2000; SMT COMPANY) and centrifuged (9,000 rpm, 10 min, 4°C, R12A6 rotor). The supernatant of the disruption solution was passed through Ni-NTA Superflow beads (Qiagen) equilibrated with lysis buffer, and then 10 ml of wash buffer (25 mM Tris-HCl, 150 mM NaCl, 50 mM imidazole, pH 9.0) and 50 ml of elution buffer (25 mM Tris-HCl, 150 mM NaCl, 400 mM imidazole, pH 9.0) were passed through to elute the proteins adsorbed on the column. The collected protein solution was subjected to anion exchange column chromatography using a HiTrap Q HP column (column volume 5 ml; GE Healthcare). The buffer used was 25 mM Tris-HCl (pH 9.0), and elution was performed using a concentration gradient of 0-2 M NaCl. The eluted fractions containing SpyCatcher-Nhead were collected and dialyzed against 50 mM Phosphate-NaOH (pH 6.0) at 4°C using a dialysis tube (Standard RC Tubing MWCO: 12-14 kD; Spectra / por 4 Dialysis Membrane). The solution was collected from the tube and subjected to cation exchange column chromatography using a HiTrap SP HP column (column volume 5 ml; GE Healthcare). The buffer used was 50 mM Phosphate-NaOH (pH 6.0), and elution was performed using a concentration gradient of 0-2 M NaCl.The elution fractions containing SpyCatcher-Nhead were collected and subjected to gel filtration column chromatography using 25 mM Tris-HCl (pH 9.0) on a Superdex 200 column (column volume 320 ml; GE Healthcare). The elution fractions containing SpyCatcher-Nhead were collected and concentrated by ultrafiltration using Amicon Ultra-15 Centrifugal filters Ultracel-10k (Merck MILLIPORE) and buffer exchanged to 25 mM Tris-HCl (pH 7.0). The protein concentration after concentration was measured by BCA assay (Pierce BCA Protein Assay Kit; Thermo Fisher Scientific).

[0186] (Expression and purification of SpyTag-GFP (SEQ ID NO: 37)) 20 ml of the bacterial culture solution cultured overnight at 37°C was inoculated into 2 L of LB medium (100 μg / ml Amp). After shaking culture at 37°C for 7 hours, isopropyl-β-thiogalactopyranoside (IPTG) was added as an inducer to a concentration of 1 mM, and shaking culture was continued at 37°C for 3 hours. The bacteria were collected by centrifugation (6,000 rpm, 10 min, 4°C, R12A6 rotor; Hitachi Koki) and suspended in 200 ml of lysis buffer (25 mM Tris-HCl, 150 mM NaCl, 20 mM imidazole, pH 9.0). The suspended bacteria were disrupted at 1000 bar for 10 minutes using a French press (LAB2000; SMT COMPANY), and centrifuged (9,000 rpm, 10 min, 4°C, R12A6 rotor). The supernatant of the disruption solution was passed through Ni-NTA Superflow beads (Qiagen) equilibrated with lysis buffer, and then 10 ml of wash buffer (25 mM Tris-HCl, 150 mM NaCl, 50 mM imidazole, pH 9.0) and 50 ml of elution buffer (25 mM Tris-HCl, 150 mM NaCl, 400 mM imidazole, pH 9.0) were passed through to elute the proteins adsorbed on the column. The collected protein solution was subjected to anion exchange column chromatography using a HiTrap Q HP column (column volume 5 ml; GE Healthcare). The buffer used was 25 mM Tris-HCl (pH 9.0), and elution was performed using a concentration gradient of 0-2 M NaCl. The flow-through fraction containing SpyCatcher-Nhead was collected and subjected to gel filtration column chromatography using 25 mM Tris-HCl (pH 9.0) on a Superdex 200 column (column volume 320 ml; GE Healthcare). The eluted fraction containing SpyCatcher-Nhead was collected and concentrated by ultrafiltration using Amicon Ultra-15 Centrifugal filters Ultracel-10k (Merck MILLIPORE) and buffer exchanged to 25 mM Tris-HCl (pH 7.0).The protein concentration after concentration was measured by BCA assay (Pierce BCA Protein Assay Kit; Thermo Fisher Scientific).

[0187] (Binding test of SpyTag-GFP and SpyCatcher-Nhead) Nhead-SpyCatcher and SpyTag-GFP-his were each prepared at 1 μM using 25 mM Tris-HCl (pH 7). 20 μl of Nhead-SpyCatcher solution and 20 μl of SpyTag-GFP-his solution were mixed and left to stand at 37°C for 5 minutes. Then, the change in electrophoretic mobility was examined by SDS-PAGE and CBB staining (Figure 29).

[0188] (Immobilization of SpyTag-GFP onto a polystyrene plate using SpyCatcher-Nhead) Nhead-SpyCatcher, SpyTag-GFP-his, and Nhead were each prepared at 0.2 μM using PBS. 100 μl of Nhead-SpyCatcher solution, Nhead solution, or PBS was dropped onto a 96-well black polystyrene plate for fluorescence measurement (655086; Greiner Bio-One) and left to stand at 28 °C for 1 hour. After removing the solution from each well by pipetting, the plate was washed twice with 100 μl of PBS. 100 μl of SpyTag-GFP-his solution was dropped into the washed well and left to stand at 37 °C for 5 min, after which each well was washed five times with 100 μl of PBS. 100 μl of PBS was added to the washed well, and the fluorescence intensity at an excitation wavelength of 485 nm / fluorescence wavelength of 535 nm was measured using a plate reader (ARVO X3; Perkin Elmer) (Figure 30).

[0189] (result) The results are shown in Figure 30. It was demonstrated that proteins can be immobilized on the material surface via Nhead even in a system using the SpyTag / SpyCatcher system.

[0190] (Notes) As described above, the present disclosure has been illustrated using preferred embodiments of the present disclosure, but the above description and examples are provided for illustrative purposes only and are not provided for the purpose of limiting the present disclosure. Therefore, it is understood that the present invention is not limited to the embodiments or examples specifically described in this specification, and its scope should be interpreted only by the claims. It is understood that the patents, patent applications and literature cited in this specification should be incorporated by reference to this specification in the same manner as if the contents themselves were specifically described in this specification. This application claims priority to Japanese Patent Application No. 2019-132488 filed on July 18, 2019 at the Japan Patent Office, the contents of which are incorporated by reference in their entirety in this application. [Industrial Applicability]

[0191] The present disclosure has utility in industries that use bioprocessing. [Sequence List Free Text]

[0192] SEQ ID NO: 1: Amino acid sequence of the AtaA fragment excluding the signal peptide and including methionine at the start SEQ ID NO:2: Nucleic acid sequence of the AtaA fragment excluding the signal peptide and including methionine at the start SEQ ID NO:3: Full length nucleic acid sequence of AtaA SEQ ID NO: 4: Full-length amino acid sequence of AtaA SEQ ID NO: 5: Sequence of the primer used for cloning of ataA SEQ ID NO: 6: Nucleic acid sequence of AtaA in the Nhead-deleted configuration (Example 2) SEQ ID NO: 7: Amino acid sequence of AtaA in the Nhead-deleted structure (Example 2) SEQ ID NO: 8: Nucleic acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 9: Amino acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 10: Nucleic acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 11: Amino acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 12: Nucleic acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 13: Amino acid sequence of AtaA with a partially deleted structure in Nstalk (Example 2) SEQ ID NO: 14: Nucleic acid sequence of AtaA with a structure in which a part of Nstalk is deleted, and Chead is deleted (Example 2) SEQ ID NO: 15: Amino acid sequence of AtaA with a structure in which a part of Nstalk is deleted, and Chead is deleted (Example 2) SEQ ID NO: 16: Nucleic acid sequence of AtaA in a structure in which most of Cstalk has been deleted (the FGG domain has been preserved) (Example 2) SEQ ID NO: 17: Amino acid sequence of AtaA in a structure in which most of Cstalk has been deleted (the FGG domain has been preserved) (Example 2) SEQ ID NO: 18: AtaA 59-325 - Nucleic acid sequence of GCN4pII-His (Example 3) SEQ ID NO: 19: AtaA 59-325 -Amino acid sequence of GCN4pII-His (Example 3) SEQ ID NO: 20: Nucleic acid sequence of AtaA Δ1st loop variant (Example 4) SEQ ID NO: 21: Amino acid sequence of AtaA Δ1st loop variant (Example 4) SEQ ID NO: 22: Nucleic acid sequence of AtaA Δ2nd loop variant (Example 4) SEQ ID NO: 23: Amino acid sequence of AtaA Δ2nd loop variant (Example 4) SEQ ID NO: 24: Nucleic acid sequence of the WChead variant of AtaA (Example 8) SEQ ID NO: 25: Amino acid sequence of WChead variant of AtaA (Example 8) SEQ ID NO:26: AtaA 59-325 - Nucleic acid sequence of GCN4pII-SNAP-His (Example 9) SEQ ID NO:27: AtaA 59-325 -Amino acid sequence of GCN4pII-SNAP-His (Example 9) SEQ ID NO: 28: SNAP-AtaA 60-325- Nucleic acid sequence of GCN4pII-His (Example 12) SEQ ID NO: 29: SNAP-AtaA 60-325 -Amino acid sequence of GCN4pII-His (Example 12) SEQ ID NO:30: AtaA 59-325 - Nucleic acid sequence of SNAP-His (Example 14) SEQ ID NO:31: AtaA 59-325 -Amino acid sequence of SNAP-His (Example 14) SEQ ID NO:32: AtaA 59-314 - Nucleic acid sequence of GCN4pII-SNAP-His (Example 15) SEQ ID NO:33: AtaA 59-314 -Amino acid sequence of GCN4pII-SNAP-His (Example 15) SEQ ID NO: 34: Nucleic acid sequence of NhNs-SNAP (Example 22) SEQ ID NO: 35: Amino acid sequence of NhNs-SNAP (Example 22) SEQ ID NO: 36: Amino acid sequence of SpyCatcher-Nhead (Example 26) SEQ ID NO: 37: Amino acid sequence of SpyTag-GFP (Example 26) SEQ ID NO: 38: Sequence of the primer used to construct the SpyCatcher-Nhead expression plasmid (Example 26) SEQ ID NO: 39: Sequence of the primer used to construct the SpyCatcher-Nhead expression plasmid (Example 26) SEQ ID NO: 40: Sequence of the primer used to construct the SpyCatcher-Nhead expression plasmid (Example 26) SEQ ID NO: 41: Sequence of the primer used to construct the SpyCatcher-Nhead expression plasmid (Example 26) SEQ ID NO: 42: Sequence of the primer used to construct the SpyTag-GFP expression plasmid (Example 26) SEQ ID NO: 43: Sequence of the primer used to construct the SpyTag-GFP expression plasmid (Example 26) SEQ ID NO: 44: Sequence of the primer used to construct the SpyTag-GFP expression plasmid (Example 26) SEQ ID NO: 45: Sequence of the primer used to construct the SpyTag-GFP expression plasmid (Example 26)

Claims

1. (1) A polypeptide comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, not having self-aggregation properties, and having adhesive properties; or (2) A complex of the polypeptide of (1) with a functionalizing entity.

1. A composition for adhering and / or immobilizing a first object to a second object without self-aggregation, comprising:

2. The composition of claim 1 for monolayer adhesion of the first object to the second object.

3. The composition of claim 1 or 2, wherein the first object and the second object are the same.

4. The composition of claim 1 or 2, wherein the first object and the second object are different.

5. The composition of any one of claims 1 to 4, wherein at least one of the first object or the second object is a functionality-imparting entity.

6. The composition of claim 5 , wherein the functionalizing entity is a peptide and / or a protein.

7. The composition of claim 6, wherein the functionalizing entity is streptavidin, neutral avidin, or a modified version thereof.

8. The composition of claim 5 , wherein the functionalizing entity is a cell.

9. The composition of any one of claims 1 to 8, wherein the second object is a substrate.

10. The composition of claim 9 , wherein the support is a liposome.

11. (1) A polypeptide comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acids 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, not having self-aggregation properties and having adhesive properties, and further comprising an amino acid sequence different from SEQ ID NO: 1; or (2) A complex of a polypeptide having an adhesive property and a functionalizing entity, the complex comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, and not having self-aggregation property; 1. A composition for adhering and / or immobilizing a first object to a second object without self-aggregation, comprising:

12. (1) A polypeptide comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acids 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, not having self-aggregation properties and having adhesive properties, and further comprising an amino acid sequence different from SEQ ID NO: 1; or (2) A complex of a polypeptide having an adhesive property and a functionalizing entity, the complex comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, and not having self-aggregation property; A method for adhering and / or fixing a peptide comprising a different amino acid sequence or a functional entity to a second object without causing self-aggregation, comprising:

13. (1) A polypeptide comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, not having self-aggregation properties, and having adhesive properties; or (2) A complex of the polypeptide of (1) with a functionalizing entity. for adhering and / or fixing a first object to a second object without self-aggregation.

14. The use according to claim 13, wherein the use is for monolayer adhesion of the first object to the second object.

15. 15. The use according to claim 13 or 14, wherein the first subject and the second subject are the same.

16. The use according to claim 13 or 14, wherein the first subject and the second subject are different.

17. The use according to any one of claims 13 to 16, wherein at least one of the first object or the second object is a functionality-imparting entity.

18. The use according to claim 17, wherein the functionalizing entity is a peptide and / or a protein.

19. 19. The use according to claim 18, wherein the functionalizing entity is streptavidin, neutral avidin or a modified version thereof.

20. The use according to claim 17, wherein the functionalizing entity is a cell.

21. The use according to any one of claims 13 to 20, wherein the second object is a support.

22. The use according to claim 21 , wherein the support is a liposome.

23. (1) A polypeptide comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acids 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, not having self-aggregation properties and having adhesive properties, and further comprising an amino acid sequence different from SEQ ID NO: 1; or (2) A complex of a polypeptide having an adhesive property and a functionalizing entity, the complex comprising a sequence having at least 90% sequence identity to the amino acid sequence of positions 2 to 257 of SEQ ID NO: 1, not comprising a sequence corresponding to amino acid positions 2855 to 3093 of the amino acid sequence shown in SEQ ID NO: 1, and not having self-aggregation property; Use of said method for adhering and / or immobilizing a first object to a second object without self-aggregation, wherein said first object is a peptide comprising said different amino acid sequence or said functionalizing entity.

Images