Pathogen control composition and its use

Abstract

Disclosed herein are pathogen control compositions comprising a plurality of plant messenger packs (e.g., plant extracellular vesicles (EVs), or fragments, portions, or extracts thereof, that are useful in methods for treating or preventing infection in animals and / or reducing the fitness of pathogens (e.g., animal pathogens) or their vectors. [Selection diagram] None

Description

[Background technology]

[0001] Pathogens, including animal pathogens (e.g., bacteria, fungi, parasites, or viruses), cause serious diseases in humans and animals. While numerous means are used to control animal pathogens or their vectors, there is an increasing demand for safe and effective pathogen control strategies. Thus, there is a need in the art for new methods and compositions for controlling animal pathogens. Summary of the Invention [Means for solving the problem]

[0002] Disclosed herein are pathogen control compositions comprising a plurality of plant messenger packs that are useful in methods for treating infection in an animal in need thereof, preventing infection in an animal at risk thereof, or reducing the fitness of pathogens (e.g., animal pathogens) or their vectors.

[0003] In one aspect, the disclosure features a pathogen control composition that includes a plurality of plant messenger packs (PMPs), where the composition is formulated for delivery to an animal, and the composition includes at least 5% PMPs, measured by wt / vol, percent PMP protein composition, and / or percent lipid composition (e.g., by measuring fluorescently labeled lipids).

[0004] In another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, where the composition is formulated for delivery to an animal pathogen, and the composition includes at least 5% PMPs.

[0005] In another aspect, the disclosure features a pathogen control composition comprising a plurality of PMPs, wherein the composition is formulated for delivery to an animal pathogen vector, and the composition comprises at least 5% PMPs.

[0006] In yet another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, wherein the composition is stable at room temperature for at least 1 day and / or stable at 4°C for at least 1 week.

[0007] In some embodiments of the pathogen control composition, the plurality of PMPs in the composition are present at a concentration effective to reduce the fitness of an animal pathogen or animal pathogen vector. In some embodiments, the plurality of PMPs in the composition are present at a concentration effective to treat infection in an animal infected with a pathogen. In other embodiments, the plurality of PMPs in the composition are present at a concentration effective to prevent infection in an animal at risk of infection with a pathogen.

[0008] In another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, where the plurality of PMPs in the composition are at a concentration effective to reduce the fitness of an animal pathogen.

[0009] In another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs in the composition are at a concentration effective to reduce the fitness of an animal pathogen vector.

[0010] In yet another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs in the composition are at a concentration effective to treat an infection in an animal infected with a pathogen.

[0011] In yet another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs in the composition are at a concentration effective to prevent infection in an animal at risk of infection with a pathogen.

[0012] In some embodiments of the pathogen control composition, the plurality of PMPs in the composition are at a concentration of at least 0.01 ng, 0.1 ng, 1 ng, 2 ng, 3 ng, 4 ng, 5 ng, 10 ng, 50 ng, 100 ng, 250 ng, 500 ng, 750 ng, 1 μg, 10 μg, 50 μg, 100 μg, or 250 μg PMP protein / ml. In some embodiments, the plurality of PMPs further comprises an additional pathogen control agent.

[0013] In another aspect, the disclosure features a pathogen control composition including a plurality of PMPs, where each of the plurality of PMPs includes a heterologous pathogen control agent, and the composition is formulated for delivery to an animal pathogen of agricultural or veterinary interest or its vector.

[0014] In some embodiments of the pathogen control composition, the heterologous pathogen control agent is an antibacterial agent such as doxorubicin, an antifungal agent, a virucide, an antiviral agent, an insecticide, a nematicide, an antiparasitic agent, or an insect repellent. In some embodiments, the antibacterial agent is an antibiotic such as vancomycin, penicillin, cephalosporin, monobactam, carbapenem, macrolide, aminoglycoside, quinolone, sulfonamide, tetracycline, glycopeptide, lipoglycopeptide, oxazolidinone, rifamycin, tuberactinomycin, chloramphenicol, metronidazole, tinidazole, nitrofurantoin, teicoplanin, telavancin, linezolid, cycloserine 2, bacitracin, polymyxin B, viomycin, or capreomycin.

[0015] In some embodiments of the pathogen control composition, the antifungal agent is an allylamine, imidazole, triazole, thiazole, polyene, or echinocandin.

[0016] In some embodiments of the pathogen control composition, the insecticide is a chloronicotinyl, neonicotinoid, carbamate, organophosphate, pyrethroid, oxadiazine, spinosyn, cyclodiene, organochlorine, fiprole, mectin, diacylhydrazine, benzoylurea, organotin, pyrrole, dinitroterpenol, METI, tetronic acid, tetramic acid, or phthalamide.

[0017] In some embodiments of the pathogen control composition, the heterologous pathogen control agent is a small molecule (eg, an antibiotic or secondary metabolite), a nucleic acid (eg, an inhibitory RNA), or a polypeptide.

[0018] In some embodiments of the pathogen control composition, a heterologous pathogen control agent is encapsulated by, embedded in, or conjugated to the surface of each of the plurality of PMPs. In some embodiments, each of the plurality of PMPs further comprises an additional pathogen control agent.

[0019] In some embodiments, the pathogen is a bacterium (e.g., Pseudomonas species (e.g., Pseudomonas aeruginosa), Escherichia species (e.g., Escherichia coli), Streptococcus species, Pneumococcus species, Shigella species, Salmonella species, or Campylobacter species), a fungus (e.g., Saccharomyces species or Candida species), a parasitic insect (e.g., Cimex species), a parasitic nematode (e.g., Heligmosomoides species), or a parasitic protozoan (e.g., Trichomonas species).

[0020] In some embodiments of the pathogen control composition, the vector is a mosquito, tick, mite, or louse.

[0021] In some embodiments of the pathogen control composition, the composition is stable at room temperature for at least 1 day and / or at 4°C for at least 1 week; at 4°C for at least 24 hours, 48 ​​hours, 7 days, or 30 days; or at temperatures of at least 20°C, 24°C, or 37°C.

[0022] In some embodiments of the pathogen control composition, the plurality of PMPs in the composition are at a concentration effective to reduce the fitness of an animal pathogen or animal pathogen vector; at a concentration effective to treat infection in an animal infected with the pathogen; or at a concentration effective to prevent infection in an animal at risk of infection with the pathogen.

[0023] In some embodiments, the plurality of PMPs in the composition is at a concentration of at least 0.01 ng, 0.1 ng, 1 ng, 2 ng, 3 ng, 4 ng, 5 ng, 10 ng, 50 ng, 100 ng, 250 ng, 500 ng, 750 ng, 1 μg, 10 μg, 50 μg, 100 μg, or 250 μg PMP protein / mL.

[0024] In some embodiments, the composition comprises an agriculturally acceptable carrier or a pharmaceutically acceptable carrier. In some embodiments, the composition is formulated to stabilize PMP. In some embodiments, the composition is formulated as a liquid, solid, aerosol, paste, gel, or gas composition. In some embodiments, the composition comprises at least 5% PMP.

[0025] In another embodiment, the disclosure features a pathogen control composition comprising a plurality of PMPs, wherein the PMPs are isolated from a plant by a process including the steps of: (a) providing an initial sample from a plant or part thereof, wherein the plant or part thereof comprises EVs; (b) isolating a crude PMP fraction from the initial sample, wherein the crude PMP fraction has a reduced level of at least one contaminant or unwanted component from the plant or part thereof relative to the level in the initial sample; (c) purifying the crude PMP fraction, thereby producing a plurality of pure PMPs, wherein the plurality of pure PMPs has a reduced level of at least one contaminant or unwanted component from the plant or part thereof relative to the level in the crude EV fraction; (d) loading the plurality of PMPs of step (c) with a pathogen control agent; and (e) formulating the PMPs of step (d) for delivery to an animal pathogen of agricultural or veterinary interest or its vector.

[0026] In another aspect, the disclosure features an animal pathogen comprising any one of the pathogen control compositions described herein.

[0027] In another aspect, the disclosure features an animal pathogen vector including any one of the pathogen control compositions described herein.

[0028] In yet another aspect, the disclosure features a method of delivering a pathogen control composition to an animal, the method including administering to the animal any one of the pathogen control compositions described herein.

[0029] In yet another embodiment, the disclosure features a method of treating an infection in an animal in need thereof, the method including administering to the animal an effective amount of any one of the compositions described herein.

[0030] In yet another embodiment, the disclosure features a method of preventing infection in an animal at risk thereof, where the method includes administering to the animal an effective amount of any one of the pathogen control compositions described herein, wherein the method reduces the likelihood of infection in the animal relative to an untreated animal.

[0031] In some embodiments of the aforementioned methods, the infection is caused by a pathogen, and the pathogen is a bacterium (e.g., Pseudomonas species, Escherichia species, Streptococcus species, Pneumococcus species, Shigella species, Salmonella species, or Campylobacter species), a fungus (e.g., Saccharomyces species or Candida species), a virus, a parasitic insect (e.g., Cimex species), a parasitic nematode (e.g., Heligmosomoides species), or a parasitic protozoan (e.g., Trichomonas species).

[0032] In some embodiments, the pathogen control composition is administered to the animal orally, intravenously, or subcutaneously.

[0033] In another aspect, the disclosure features a method of delivering a pathogen control composition to a pathogen, the method including contacting the pathogen with any one of the pathogen control compositions described herein.

[0034] In another aspect, the disclosure features a method of reducing the fitness of a pathogen, the method including delivering any one of the pathogen control compositions described herein to the pathogen, wherein the method reduces the fitness of the pathogen relative to an untreated pathogen.

[0035] In some embodiments, the method comprises delivering the composition to at least one habitat where the pathogen grows, lives, reproduces, feeds or infests, hi some embodiments, the composition is delivered as a pathogen edible composition for ingestion by the pathogen.

[0036] In some embodiments of the aforementioned methods, the pathogen is a bacterium (e.g., Pseudomonas spp., Escherichia spp., Streptococcus spp., Pneumococcus spp., Shigella spp., Salmonella spp., or Campylobacter spp.), a fungus (e.g., Saccharomyces spp. or Candida spp.), a parasite (e.g., Cimex spp.), a parasitic nematode (e.g., Heligmosomoides spp.), or a parasitic protozoan (e.g., Trichomonas spp.).

[0037] In some embodiments, the composition is delivered as a liquid, solid, aerosol, paste, gel, or gas.

[0038] In another aspect, the disclosure features a method of reducing the fitness of an animal pathogen vector, the method including delivering to the vector an effective amount of any one of the pathogen control compositions described herein, wherein the method reduces the fitness of the vector relative to an untreated vector.

[0039] In some embodiments, the method includes delivering the composition to at least one habitat where the vector grows, lives, reproduces, feeds, or infests. In some embodiments, the composition is delivered as an ingestible composition for ingestion by the vector. In some embodiments, the vector is an insect, such as a mosquito, tick, mite, or louse. In some embodiments, the composition is delivered as a liquid, solid, aerosol, paste, gel, or gas.

[0040] In another aspect, the disclosure features a method of treating an animal having a fungal infection, where the method includes administering to the animal an effective amount of a pathogen control composition including a plurality of PMPs.

[0041] In another aspect, the disclosure features a method of treating an animal having a fungal infection, where the method includes administering to the animal an effective amount of a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes an antifungal agent.

[0042] In some embodiments, the antifungal agent is a nucleic acid that inhibits expression of a fungal gene that causes a fungal infection. In some embodiments, the gene is Enhanced Filamentous Growth Protein (EFG1). In some embodiments, the fungal infection is caused by Candida albicans.

[0043] In some embodiments, the composition comprises a PMP from Arabidopsis.

[0044] In some embodiments, the method reduces or substantially eliminates a fungal infection.

[0045] In another aspect, the disclosure features a method of treating an animal having a bacterial infection, where the method includes administering to the animal an effective amount of a pathogen control composition including a plurality of PMPs.

[0046] In another aspect, the disclosure features a method of treating an animal having a bacterial infection, where the method includes administering to the animal an effective amount of a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes an antibacterial agent.

[0047] In some embodiments, the antibacterial agent is amphotericin B.

[0048] In some embodiments, the bacterium is a Pseudomonas species, an Escherichia species, a Streptococcus species, a Pneumococcus species, a Shigella species, a Salmonella species, or a Campylobacter species.

[0049] In some embodiments, the composition comprises a PMP from Arabidopsis.

[0050] In some embodiments, the method reduces or substantially eliminates a bacterial infection.

[0051] In some embodiments, the animal is a veterinary subject or a livestock animal.

[0052] In another aspect, the disclosure features a method of reducing the fitness of a parasitic insect, where the method includes delivering to the parasitic insect a pathogen control composition including a plurality of PMPs.

[0053] In another aspect, the disclosure features a method of reducing the fitness of a parasitic insect, the method including delivering to the parasitic insect a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes an insecticide.

[0054] In some embodiments, the insecticide is a peptide nucleic acid.

[0055] In some embodiments, the parasite is a bed bug.

[0056] In some embodiments, the method reduces the fitness of the parasitic insect relative to an untreated parasitic insect.

[0057] In another aspect, the disclosure features a method of reducing the fitness of a parasitic nematode, where the method includes delivering to the parasitic nematode a pathogen control composition including a plurality of PMPs.

[0058] In another aspect, the disclosure features a method of reducing the fitness of a parasitic nematode, the method including delivering to the parasitic nematode a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes a nematicide.

[0059] In some embodiments, the parasitic nematode is Heligmosomoides polygyrus.

[0060] In some embodiments, the method reduces the fitness of the parasitic nematode relative to untreated parasitic nematodes.

[0061] In another aspect, the disclosure features a method of reducing the fitness of a protozoan parasite, where the method includes delivering to the protozoan parasite a pathogen control composition including a plurality of PMPs.

[0062] In another aspect, the disclosure features a method for reducing the fitness of a protozoan parasite, the method including delivering to the protozoan parasite a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes an antiparasitic agent.

[0063] In some embodiments, the protozoan parasite is Trichomonas vaginalis (T. vaginalis).

[0064] In some embodiments, the method reduces the fitness of the protozoan parasite relative to an untreated protozoan parasite.

[0065] In another aspect, the disclosure features a method of reducing the fitness of an insect vector of an animal pathogen, where the method includes delivering to the vector a pathogen control composition including a plurality of PMPs.

[0066] In another aspect, the disclosure features a method for reducing the fitness of an insect vector of an animal pathogen, where the method includes delivering to the vector a pathogen control composition including a plurality of PMPs, wherein the plurality of PMPs includes an insecticide.

[0067] In some embodiments, the method reduces the fitness of the vector relative to an untreated vector. In some embodiments, the insect is a mosquito, tick, mite, or louse.

[0068] Other features and advantages of the invention will become apparent from the following detailed description and claims.

[0069] definition As used herein, the term "animal" refers to humans, domestic animals, farm animals or veterinary mammals (including, for example, dogs, cats, horses, rabbits, zoo animals, cows, pigs, sheep, chickens and non-human primates).

[0070] As used herein, "reducing the fitness of a pathogen" includes, but is not limited to, the following desired effects: (1) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the population of the pathogen; (2) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the reproductive rate of the pathogen; (3) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the mobility of the pathogen; (4) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the body weight or mass of the pathogen; , 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction; (5) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the metabolic rate or activity of the pathogen; or (6) about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in pathogen transmission by the pathogen (e.g., vertical or horizontal transmission of a pathogen from one insect to another). Reduction in pathogen fitness can be determined, for example, as compared to an untreated pathogen.

[0071] As used herein, "reducing the fitness of a vector" refers to, but is not limited to, the following desired effects: (1) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the population of vectors; (2) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the reproduction rate of vectors (e.g., insects, such as mosquitoes, ticks, mites, or lice); (3) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the reproduction rate of vectors (e.g., insects, such as mosquitoes, ticks, mites, or lice); (3) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the mobility of a vector (e.g., an insect, e.g., a mosquito, tick, mite, or louse); (4) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the body weight of a vector (e.g., an insect, e.g., a mosquito, tick, mite, or louse); (5) about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more reduction in the metabolic rate or activity of a vector (e.g., an insect, e.g., a mosquito, tick, mite, or louse). (6) a 0%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or greater increase; (7) a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or greater decrease in vector-vector pathogen transmission (e.g., vertical or horizontal transmission of a vector from one insect to another) by a vector (e.g., an insect such as a mosquito, tick, mite, or louse); (8) a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, (8) a reduction of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in vector (e.g., insect, such as mosquito, tick, mite, or louse) lifespan; (9) an increase of about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or more in vector (e.g., insect, such as mosquito, tick, mite, or louse) susceptibility to a pesticide (e.g., insecticide);or (10) refers to a disruption of any physiological function of a vector or any activity carried out by said vector as a result of administration of a vector control composition described herein, including any one or more of about a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, 100% or greater reduction in vector competitiveness by the vector (e.g., an insect, such as a mosquito, tick, mite, or louse). Reduction in vector fitness can be determined, for example, relative to an untreated vector;

[0072] As used herein, the term "formulated for delivery to an animal" refers to a pathogen control composition that includes a pharmaceutically acceptable carrier.

[0073] As used herein, the term "formulated for delivery to a pathogen" refers to a pathogen control composition that includes a pharmaceutically acceptable carrier or an agriculturally acceptable carrier.

[0074] As used herein, the term "formulated for delivery to a vector" refers to a pathogen control composition that includes an agriculturally acceptable carrier.

[0075] As used herein, the term "infection" refers to the presence or colonization of a pathogen in, on, or around an animal (e.g., one or more parts of an animal), particularly when the infection reduces the fitness of the animal, for example, by causing disease, disease symptoms, or an immune (e.g., inflammatory) response.

[0076] As used herein, the terms "nucleic acid" and "polynucleotide" are interchangeable and refer to linear or branched, single- or double-stranded RNA or DNA, or hybrids thereof, regardless of length (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 100, 150, 200, 250, 500, 1000, or more nucleic acids). The term also encompasses RNA / DNA hybrids. Nucleotides are typically linked in nucleic acids by phosphodiester bonds; however, the term "nucleic acid" also encompasses nucleic acid analogs having other types of linkages or backbones (e.g., phosphoroamide, phosphorothioate, phosphorodithioate, O-methylphosphoramidate, morpholino, locked nucleic acid (LNA), glycerol nucleic acid (GNA), threose nucleic acid (TNA), and peptide nucleic acid (PNA) linkages or backbones, among others). Nucleic acids can be single-stranded, double-stranded, or contain portions of both single-stranded and double-stranded sequence. Nucleic acids can contain any combination of deoxyribonucleotides and ribonucleotides and any combination of bases, including, for example, adenine, thymine, cytosine, guanine, uracil, and modified or non-standard bases (including, for example, hypoxanthine, xanthine, 7-methylguanine, 5,6-dihydrouracil, 5-methylcytosine, and 5-hydroxymethylcytosine).

[0077] As used herein, the term "pathogen" refers to an organism, such as a microorganism or invertebrate, that causes disease or disease symptoms in an animal, for example, by (i) directly infecting the animal, (ii) producing a substance that causes disease or disease symptoms in the animal (e.g., bacteria that produce pathogenic toxins, etc.), and / or (iii) eliciting an immune (e.g., inflammatory response) in the animal (e.g., biting insects, such as bed bugs). As used herein, pathogens include, but are not limited to, bacteria, protozoa, parasites, fungi, nematodes, insects, viroids, and viruses, or combinations thereof, where each pathogen, alone or in combination with another pathogen, can cause disease or symptoms in humans.

[0078] As used herein, the term "pathogen control composition" refers to an antibacterial, antifungal, antiviral, antiparasitic (e.g., helminthic), antiparasiticide, antiparasitic, insecticide, nematicide, or vector repellent composition that includes a plurality of plant messenger (PMP) packs. Each of the plurality of PMPs can include a pathogen control agent, e.g., a heterologous pathogen control agent.

[0079] As used herein, the terms "peptide," "protein," or "polypeptide" encompass naturally occurring or non-naturally occurring amino acid chains (either D- or L-amino acids) regardless of length (e.g., at least 2, 3, 4, 5, 6, 7, 10, 12, 14, 16, 18, 20, 25, 30, 40, 50, 100 amino acids or more), post-translational modification (e.g., glycosylation or phosphorylation), or the presence of one or more non-aminoacyl groups (e.g., sugars, lipids, etc.) covalently linked to the peptide, including, for example, natural proteins, synthetic or recombinant polypeptides and peptides, hybrid molecules, peptoids, or peptidomimetics.

[0080] As used herein, the "percent identity" between two sequences is determined by the BLAST 2.0 algorithm described in Altschul et al., (1990) J. Mol. Biol. 215:403-410. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information.

[0081] As used herein, the term "pathogen control agent" refers to an agent, composition, or substance contained therein that controls or reduces the fitness (e.g., kills or inhibits the growth, reproduction, division, reproduction, or spread) of agricultural, environmental, or household / residential pathogens or pathogen vectors, such as insects, mollusks, nematodes, fungi, bacteria, or viruses. Pathogen control agents are understood to include naturally occurring or synthetic insecticides (larvicides or adulticides), insect growth regulators, acaricides (miticides), molluscicides, nematicides, ectoparasiticides, bactericides, fungicides, or herbicides. The term "pathogen control agent" may further include antibiotics, antivirals, pesticides, antifungals, antiparasitics, nutrients, and / or agents that stop or slow the movement of pathogens or pathogen vectors. In some examples, the pathogen control agent is an allelochemical. As used herein, an "allelochemical" or "allelochemical agent" is a substance produced by an organism (e.g., a plant) that can affect the physiological function (e.g., germination, growth, survival, or reproduction) of another organism (e.g., a pathogen or pathogen vector).

[0082] The pathogen control agent may be heterologous. As used herein, the term "heterologous" refers to an agent (e.g., a pathogen control agent) that is either (1) foreign to the plant (e.g., derived from a source other than the plant or plant part in which the PMP is produced) (e.g., added using a loading method described herein), or (2) endogenous to the plant cell or tissue in which the PMP is produced, but present in the PMP at a concentration higher than naturally occurring (e.g., higher than the concentration present in naturally occurring plant extracellular vesicles) (e.g., added to the PMP using a loading method described herein, genetic engineering, in vitro, or in vivo methods).

[0083] As used herein, the term "plant" refers to a whole plant, plant organ, plant tissue, seed, plant cell, seed, and its progeny. Plant cells include, without limitation, cells of seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, or microspores. Plant parts include differentiated and undifferentiated tissues, including, but not limited to, roots, stems, shoots, leaves, pollen, seeds, fruits, harvested material, tumor tissue, sap, and various forms of cells and cultures (e.g., single cells, protoplasts, embryos, and callus tissue). Plant tissues can be of plants or plant organs, tissues, or cell cultures. In addition, plants can be genetically engineered to produce heterologous proteins or RNAs, for example, of any of the pathogen control compositions in the methods or compositions described herein.

[0084] As used herein, the term "plant extracellular vesicle," "plant EV," or "EV" refers to an encapsulated lipid bilayer structure naturally occurring in a plant. Optionally, the plant EV contains one or more plant EV markers. As used herein, the term "plant EV marker" refers to a component naturally associated with a plant, such as a plant protein, a protein nucleic acid, a plant small molecule, a plant lipid, or a combination thereof, including, but not limited to, any of the plant EV markers listed in the Appendix. In some examples, the plant EV marker is an identifying marker for the plant EV marker but is not an agricultural agent. In some examples, the plant EV marker is both an identifying marker for the plant EV marker and an agricultural agent (e.g., bound to or encapsulated in multiple PMPs, or not directly bound to or encapsulated in multiple PMPs).

[0085] As used herein, the term "plant messenger pack" or "PMP" refers to lipid structures (e.g., lipid bilayers, monolayers, multilayers; e.g., vesicular lipid structures) having a diameter of approximately 5-2000 nm (e.g., at least 5-1000 nm, at least 5-500 nm, at least 400-500 nm, at least 25-250 nm, at least 50-150 nm, or at least 70-120 nm), including lipid or non-lipid components (e.g., peptides, nucleic acids, or small molecules) bound thereto, obtained (e.g., enriched, isolated, or purified) from a plant source or a fragment, part, or extract thereof, enriched, isolated, or purified from a plant, plant part, or plant cell, where enrichment or isolation refers to removal of one or more contaminants or unwanted elements from the source plant. PMPs can be highly purified preparations of naturally occurring EVs. Preferably, at least 1% (e.g., at least 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99% or 100%) of contaminants or unwanted elements from the source plant, one or more contaminants or unwanted elements from the source plant, such as plant cell wall elements; pectin; plant organelles (e.g., mitochondria; plastids such as chloroplasts, leucoplasts or amyloplasts; and nuclei); plant chromatin (e.g., plant chromosomes); or plant molecular aggregates (e.g., protein aggregates, protein-nucleic acid aggregates, lipoprotein aggregates or lipid-protein structures) is removed. Preferably, the PMP is at least 30% pure (e.g., at least 40% pure, at least 50% pure, at least 60% pure, at least 70% pure, at least 80% pure, at least 90% pure, at least 99% pure, or at least 100% pure) with respect to one or more contaminants or unwanted elements from the source plant as measured by weight (w / w), spectral imaging (% transmittance), or conductivity (S / m).

[0086] PMPs can optionally include an additional agent, such as a heterofunctional agent, e.g., a pathogen control agent, a repellent, a polynucleotide, a polypeptide, or a small molecule. PMPs can carry or be associated with additional agents (e.g., heterofunctional agents) in a variety of ways that allow for delivery of the agent to the target plant, such as by encapsulating the agent, incorporating the agent into the lipid bilayer structure, or associating (e.g., conjugating) the agent with the surface of the lipid bilayer structure. Heterofunctional agents can be incorporated into PMPs either in vivo (e.g., in plants) or in vitro (e.g., in tissue cells, cell cultures, or synthetically incorporated). As used herein, the term "repellent" refers to an agent, composition, or substance contained therein that prevents pathogen vectors (e.g., insects, such as mosquitoes, ticks, mites, or lice) from accessing or remaining on animals. A repellent may, for example, reduce the number of pathogen vectors on or near an animal, but not necessarily kill or reduce the fitness of the pathogen vectors.

[0087] As used herein, the term "treatment" refers to administering a pharmaceutical composition to an animal for prophylactic and / or therapeutic purposes. "Preventing an infection" refers to prophylactic treatment of an animal that is not yet sick, but is susceptible to or otherwise at risk of a particular disease. "Treating an infection" refers to administering treatment to an already sick animal to improve or stabilize the animal's condition.

[0088] As used herein, the term "treating an infection" refers to administering treatment to an individual already suffering from a disease to improve or stabilize the individual's condition. This can include reducing pathogen colonization by one or more pathogens in, on, or around an animal compared to the initial amount (e.g., by about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) and / or enabling a benefit to the individual (e.g., a reduction in colonization sufficient to alleviate symptoms). In such instances, treating an infection can manifest as a reduction in symptoms (e.g., by about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%). In some cases, the compositions and methods are effective in increasing the chances of survival of an individual (e.g., about a 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase) or increasing the overall survival rate of a population (e.g., about a 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase). For example, the compositions and methods can be effective in "substantially eliminating" the infection, which refers to a reduction in the infection sufficient to sustainably alleviate symptoms in the animal (e.g., for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months).

[0089] As used herein, the term "preventing infection" refers to preventing an increase in colonization by one or more pathogens in, on, or around an animal in an amount sufficient to maintain an initial pathogen population (e.g., approximately the amount present in a healthy individual) (e.g., about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100%), preventing the onset of infection, and / or preventing symptoms or conditions associated with infection. For example, an individual may receive prophylactic treatment to prevent fungal infection while preparing for an invasive medical procedure (e.g., surgery, such as receiving a transplant, stem cell therapy, graft, prosthesis, long-term or frequent intravenous catheterization, or treatment in an intensive care unit) in an immunocompromised individual (e.g., an individual with cancer, HIV / AIDS, or taking immunosuppressants) or an individual undergoing long-term antibiotic therapy.

[0090] As used herein, the term "stable PMP composition" (e.g., a composition comprising loaded or unloaded PMP) refers to a composition that can be maintained at room temperature for a period of time (e.g., at least 24 hours, at least 48 hours, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 30 days, at least 60 days, or at least 90 days), optionally within a specified temperature range (e.g., at least 24°C (e.g., at least 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C), at least 20°C (e.g., at least 20°C, 21°C, or 32°C)). , 22°C, or 23°C), at least 4°C (e.g., at least 5°C, 10°C, or 15°C), at least -20°C (e.g., at least -20°C, -15°C, -10°C, or 0°C), or at least -80°C (e.g., at least -80°C, -70°C, -60°C, -50°C, -40°C, or -30°C)). %, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%; or optionally within a specified temperature range (e.g., at least 24°C (e.g., at least 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C), at least 20°C (e.g., at least 20°C, 21°C, 22°C, or 23°C), at least 4°C (e.g., at least 5°C, 10°C, or 15°C), at least -20°C (e.g., at least -20°C, -15°C, -10°C, "PMP composition" refers to a PMP composition that retains at least 5% (e.g., at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%) of its activity (e.g., pathogen control and / or repellent activity) compared to the initial activity of the PMP (e.g., at the time of production or formulation) at temperatures below 100°C (e.g., 0°C or 0°C) or at least -80°C (e.g., at least -80°C, -70°C, -60°C, -50°C, -40°C, or -30°C).

[0091] As used herein, the term "untreated" refers to an animal or pathogen vector that has not been contacted with or delivered a pathogen control composition, including an individual animal that has not received the pathogen control composition, and the same treated animal is evaluated at a time point prior to delivery of the pathogen control composition, or the same treated animal is evaluated in an untreated portion of the animal.

[0092] As used herein, the term "vector" refers to an insect that can carry or transmit an animal pathogen from a reservoir to an animal. Exemplary vectors include insects, such as those with piercing-sucking mouthparts such as those found in the orders Hemiptera and some Hymenoptera and Diptera, such as mosquitoes, honeybees, wasps, midges, lice, tsetse flies, fleas and ants, and members of the class Arachnidae, such as ticks and mites.

[0093] As used herein, the term "juice sac" or "juice vesicle" refers to the juice-containing membrane-bound component of the endocarp (carpel) of a citrus fruit, e.g., citrus fruit. In some aspects, the sac is separated from other parts of the fruit, such as the peel (exocarp or flavedo), endocarp (mesocarp, albedo, or pith), stylus (placenta), division wall, or seed. In some aspects, the sac is from a grapefruit, lemon, lime, or orange. [Brief explanation of the drawings]

[0094] [Figure 1A] Schematic diagram showing the protocol for grapefruit PMP production using a disruptive juicing step involving the use of a blender, followed by ultracentrifugation and sucrose gradient purification. Images of grapefruit juice after centrifugation at 1000 × g for 10 minutes and the sucrose gradient banding pattern after ultracentrifugation at 150,000 × g for 2 hours are included. [Figure 1B]1 is a plot of PMP particle size distribution measured by Spectradyne NCS1. [Figure 2] Schematic diagram showing the protocol for grapefruit PMP production using a gentle juicing step involving the use of a mesh filter, followed by centrifugation and sucrose gradient purification. Images of grapefruit juice after centrifugation at 1000 × g for 10 minutes and the sucrose gradient banding pattern after ultracentrifugation at 150,000 × g for 2 hours are included. [Figure 3A] Figure 1 shows a schematic diagram of the grapefruit PMP purification protocol using ultracentrifugation followed by size exclusion chromatography (SEC) to isolate PMP-containing fractions. The eluted SEC fractions are analyzed for particle concentration (NanoFCM), median particle size (NanoFCM), and protein concentration (BCA). [Figure 3B] This graph shows the particle concentration per mL in eluted size exclusion chromatography (SEC) fractions (NanoFCM). The fraction containing the majority of PMP ("PMP fraction") is indicated by an arrow. PMP is eluted in fractions 2 to 4. [Figure 3C] 1 is a series of graphs and tables showing particle size (nm) for selected SEC fractions as measured using NanoFCM. The graphs show the PMP size distribution for fractions 1, 3, 5, and 8. [Figure 3D] Graph showing protein concentration (μg / mL) in SEC fractions as measured using a BCA assay. The fraction containing most PMPs ("PMP fraction") is labeled, and the arrow indicates the fraction containing contaminants. [Figure 4A] Figure 1 shows a schematic diagram of a protocol for scaled PMP production from 1 liter of grapefruit juice (approximately 7 grapefruits) using a juice extractor, followed by differential centrifugation to remove large debris, 100x concentration of the juice using TFF, and size exclusion chromatography (SEC) to isolate the PMP-containing fraction. The SEC elution fractions are analyzed for particle concentration (NanoFCM), median particle size (NanoFCM), and protein concentration (BCA). [Figure 4B]FIG. 1 is a pair of graphs showing protein concentration (BCA assay, top panel) and particle concentration (NanoFCM, bottom panel) of SEC elution liquid volume (ml) from a scaled starting material of 1000 ml of grapefruit juice, showing a large amount of contaminants in the late SEC elution volume. [Figure 4C] Figure 10 shows that incubation of the crude grapefruit PMP fraction with a final concentration of 50 mM EDTA, pH 7.15, followed by overnight dialysis using a 300 kDa membrane successfully removed contaminants present in the late SEC elution fraction, as indicated by absorbance at 280 nm. There was no difference in the dialysis buffers used (calcium / magnesium-free PBS, pH 7.4, MES pH 6, Tris pH 8.6). [Figure 4D] Figure 1 shows that incubation of the crude grapefruit PMP fraction with a final concentration of 50 mM EDTA, pH 7.15, followed by overnight dialysis using a 300 kDa membrane, successfully removed contaminants present in the late elution fraction after SEC, as shown by BCA protein analysis (which is sensitive to the presence of sugars and pectin in addition to detecting protein). There was no difference in the dialysis buffers used (calcium / magnesium-free PBS, pH 7.4, MES pH 6, Tris pH 8.6). [Figure 5A] FIG. 1 is a schematic diagram showing the protocol for PMP production from grapefruit juice using a juice extractor followed by differential centrifugation to remove large debris, incubation with EDTA to inhibit the formation of pectin polymers, sequential filtration to remove large particles, 5x concentration / washing by TFF, overnight dialysis to remove contaminants, further concentration by TFF (20x final) and SEC to isolate the PMP-containing fraction. [Figure 5B] 1 is a graph showing the absorbance at 280 nm (AU) of eluted grapefruit SEC fractions using multiple SEC columns. PMP elutes in early fractions 4-6, while contaminants elute in later fractions. [Figure 5C]1 is a graph showing the protein concentration (μg / ml) of eluted grapefruit SEC fractions using multiple SEC columns. PMPs are eluted in early fractions 4-6, while contaminants are eluted in later fractions. [Figure 5D] 1 is a graph showing the absorbance at 280 nm (AU) of eluted lemon SEC fractions using multiple SEC columns. PMPs are eluted in early fractions 4-6, while contaminants are eluted in later fractions. [Figure 5E] 1 is a graph showing protein concentration (μg / ml) of eluted lemon SEC fractions using multiple SEC columns. PMPs are eluted in early fractions 4-6, while contaminants are eluted in later fractions. [Figure 5F] Scatter plots and graphs showing particle size in grapefruit PMP-containing SEC fractions after 0.22 μm sterile filtration. The top panel is a scatter plot of particles in the combined SEC fractions as measured by nanoflow cytometry (NanoFCM). The bottom panel is a particle size (nm) distribution graph of gated particles (background subtracted). PMP concentration (particles / ml) and median particle size (nm) were determined using bead standards according to NanoFCM instructions. [Figure 5G] Scatter plots and graphs showing particle sizes in lemon PMP-containing SEC fractions after 0.22 μm sterilized filtration. The top panel is a scatter plot of particles in the combined SEC fractions as measured by nanoflow cytometry (NanoFCM). The bottom panel is a particle size (nm) distribution graph of gated particles (background subtracted). PMP concentration (particles / ml) and median particle size (nm) were determined using bead standards according to the NanoFCM instructions. [Figure 5H] 1 is a graph showing grapefruit and lemon PMP stability at 4° C. as determined by PMP concentration (PMP particles / ml) at various time points (days since production) as measured by NanoFCM. [Figure 5I]1 is a bar graph showing the stability of lemon (LM) PMP after freeze-thaw cycles at −20° C. and −20° C. compared to lemon PMP stored at 4° C., as determined by PMP concentration (PMP particles / ml) after 1 week of storage at the indicated temperatures, as measured by NanoFCM. [Figure 6A] 1 is a graph showing particle concentration (particles / ml) in eluted BMS plant cell culture SEC fractions as measured by nanoflow cytometry (NanoFCM). PMPs were eluted in SEC fractions 4-6. [Figure 6B] 1 is a graph showing the absorbance (AU) at 280 nm in eluted BMS SEC fractions as measured on a SpectraMax® spectrophotometer. PMP eluted in fractions 4-6; fractions 9-13 contained contaminants. [Figure 6C] 1 is a graph showing protein concentration (μg / ml) in eluted BMS SEC fractions as determined by BCA analysis. PMP eluted in fractions 4-6; fractions 9-13 contained contaminants. [Figure 6D] Scatter plot showing particles in combined BMS PMP-containing SEC fractions as measured by nanoflow cytometry (NanoFCM). PMP concentration (particles / ml) was determined using bead standards according to NanoFCM instructions. [Figure 6E] 6D shows the particle size distribution (nm) of BMS PMPs for the gated particles (background subtracted) of Figure 6D. The median PMP particle size (nm) was determined using Exo bead standards according to the NanoFCM instructions. [Figure 7A]Figure 1 shows a scatter plot and graphs showing DyLight800nm-labeled grapefruit PMPs as measured by nanoflow cytometry (NanoFCM). The top panel is a scatter plot of particles in the combined SEC fractions. The PMP concentration (4.44 x 1012 PMPs / ml) was determined using a bead standard according to the NanoFCM instructions. The bottom panel is a particle size (nm) distribution graph of grapefruit DyLight800-PMPs. The median PMP particle size was determined using an Exo bead standard according to the NanoFCM instructions. The median grapefruit DyLight800-PMP particle size was 72.6nm + / - 14.6nm (SD). [Figure 7B] Figure 1 shows a scatter plot and graphs showing DyLight800nm-labeled lemon PMPs as measured by nanoflow cytometry (NanoFCM). The median PMP concentration (5.18 x 1012 PMPs / ml) was determined using a bead standard according to the NanoFCM instructions. The bottom panel is a particle size (nm) distribution graph of grapefruit DyLight800-PMPs. PMP particle size was determined using an Exo bead standard according to the NanoFCM instructions. The median lemon DyLight800-PMP particle size was 68.5 nm + / - 14 nm (SD). [Figure 7C] Figure 1 is a bar graph showing the uptake of DyL800-labeled PMPs from grapefruit and lemon by bacteria (E. coli and P. aeruginosa) and yeast (S. cerevisiae) after 2 hours of treatment. Uptake was determined as relative fluorescence intensity (AU), which was normalized to the relative fluorescence intensity of the dye-only treated microorganism control. [Figure 8A]Scatter plots and graphs showing purified lemon PMPs (combined pelleted PMP SEC fractions) as measured by nanoflow cytometry (NanoFCM). The top panel is a scatter plot of particles in the combined SEC fractions. The final lemon PMP concentration (1.53 x 10 PMPs / ml) was determined using a bead standard according to the NanoFCM instructions. The bottom panel is a particle size (nm) distribution graph of purified lemon PMPs. The bottom panel is a particle size (nm) distribution graph of gated particles. The median PMP particle size was determined using an Exo bead standard according to the NanoFCM instructions. The median lemon PMP particle size was 72.4 nm + / - 19.8 nm (SD). [Figure 8B] Scatter plots and graphs showing Alexa Fluor® 488 (AF488)-labeled lemon PMPs as measured by nanoflow cytometry (NanoFCM). The top panel is a scatter plot. Particles were gated for FITC fluorescent signal relative to unlabeled particles and background signal. Labeling efficiency was 99%, as determined by the number of fluorescent particles relative to the total number of particles detected. The final AF488-PMP concentration (1.34 x 10 PMPs / ml) was determined from the number of fluorescent particles and using a bead standard of known concentration according to the NanoFCM instructions. The bottom panel is a particle size (nm) distribution graph of AF488-labeled lemon PMPs. The median PMP particle size was determined using an Exo bead standard according to the NanoFCM instructions. The median lemon PMP particle size was 72.1 nm + / - 15.9 nm (SD). [Figure 9A] Figure 1 shows the absorbance at 280 nm (AU) of eluted grapefruit SEC fractions generated from various SEC columns (columns A, B, C, D, and E) as measured on a SpectraMax® spectrophotometer. PMP eluted in fractions 4-6. [Figure 9B]Scatter plot showing purified grapefruit PMPs (combined pelleted PMP SEC fractions) as measured by nanoflow cytometry (NanoFCM). The final grapefruit PMP concentration (6.34 x 10 PMPs / ml) was determined using a bead standard according to the NanoFCM instructions. [Figure 9C]

[0023] Figure 1 is a graph showing the particle size (nm) distribution of purified grapefruit PMP. The median PMP particle size was determined using Exo bead standards according to the NanoFCM instructions. The median grapefruit PMP particle size was 63.7 nm + / - 11.5 nm (SD). [Figure 9D] 1 is a graph showing the absorbance (AU) at 280 nm of the eluted lemon SEC fractions from the various SEC columns used, as measured on a SpectraMax® spectrophotometer. PMP eluted in fractions 4-6. [Figure 9E] Scatter plot showing purified lemon PMP (combined with pelleted PMP SEC fraction) as measured by nanoflow cytometry (NanoFCM). The final lemon PMP concentration (7.42 x 10 PMP / ml) was determined using a bead standard according to the NanoFCM instructions. [Figure 9F] 1 is a graph showing the particle size (nm) distribution of purified lemon PMP. The median PMP particle size was determined using Exo bead standards according to the NanoFCM instructions. The median lemon PMP particle size was 68 nm + / - 17.5 nm (SD). [Figure 9G] 1 is a bar graph showing the DOX loading capacity (pg DOX per 1000 PMPs) of lemon (LM) and grapefruit (GF) PMPs actively (ultrasound / extrusion) or passively (incubation) loaded with doxorubicin. Loading capacity was calculated as the quotient of the total DOX concentration (pg / mL) in the PMP-DOX sample (assessed by fluorescence intensity measurements (Ex / Em = 485 / 550 nm) using a SpectraMax® spectrophotometer) divided by the total PMP concentration (PMPs / mL) of the sample. [Figure 9H]1 is a graph showing the stability of grapefruit and lemon DOX-loaded PMPs at 4° C. as determined by PMP concentration (PMP particles / ml) at various time points (days from loading) as measured by NanoFCM. [Figure 10A] Figure 1 shows a schematic diagram of the PMP protocol production from 4 liters of grapefruit juice treated with pectinase and EDTA, concentrated 5x using a 300 kDa TFF, washed with 6 volume changes of PBS, and then concentrated to a final concentration of 20x. Size exclusion chromatography was used to elute the PMP-containing fraction. [Figure 10B] 1 is a graph showing the absorbance at 280 nm (AU) of SEC fractions eluted through nine different SEC columns (SEC columns A to J). PMP was eluted in fractions 3 to 7. [Figure 10C] This graph shows the protein concentration (μg / ml) of SEC fractions eluted through the nine different SEC columns used (SEC columns A-J). PMP eluted in fractions 3-7. Arrows indicate fractions containing contaminants. [Figure 10D] Scatter plot showing purified grapefruit PMPs (combined pelleted PMP SEC fractions) as measured by nanoflow cytometry (NanoFCM). The final grapefruit PMP concentration (7.56 x 10 PMPs / ml) was determined using a bead standard according to the NanoFCM instructions. [Figure 10E]

[0023] Figure 1 shows the particle size (nm) distribution of purified grapefruit PMPs. The median PMP particle size was determined using Exo bead standards according to the NanoFCM instructions. The median grapefruit PMP particle size was 70.3 nm + / - 12.4 nm (SD). [Figure 10F]Figure 1 shows the cytotoxic effect of doxorubicin (DOX)-loaded grapefruit PMPs on P. aeruginosa. Bacteria were treated with PMP-DOX in duplicate to effective DOX concentrations of 0 (negative control), 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM. Kinetic absorbance measurements at 600 nm (SpectraMax® spectrophotometer) were performed to monitor the OD of the cultures at the indicated time points. To normalize for DOX fluorescence bleed-through at 600 nm at higher concentrations, all OD values ​​per treatment dose were first normalized to the OD of the first time point for that dose. To determine the cytotoxic effect of PMP-DOX on bacteria, the relative OD was determined within each treatment group compared to the untreated control (set at 100%). [Figure 10G] Figure 1 shows the cytotoxic effect of doxorubicin (DOX)-loaded grapefruit PMP on Escherichia coli (E. coli). Bacteria were treated with PMP-DOX in duplicate to effective DOX concentrations of 0 (negative control), 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM. Kinetic absorbance measurements at 600 nm (SpectraMax® spectrophotometer) were performed to monitor the OD of the cultures at the indicated time points. To normalize for DOX fluorescence bleed-through at 600 nm at higher concentrations, all OD values ​​per treatment dose were first normalized to the OD of the first time point for that dose. To determine the cytotoxic effect of PMP-DOX on bacteria, the relative OD was determined within each treatment group compared to the untreated control (set at 100%). [Figure 10H]Figure 1 shows the cytotoxic effect of doxorubicin (DOX)-loaded grapefruit PMP on S. cerevisiae. Yeast cells were treated with PMP-DOX in duplicate to effective DOX concentrations of 0 (negative control), 5 μM, 10 μM, 25 μM, 50 μM, and 100 μM. Kinetic absorbance measurements at 600 nm (SpectraMax® spectrophotometer) were performed to monitor the OD of the cultures at the indicated time points. To normalize for DOX fluorescence bleed-through at 600 nm at higher concentrations, all OD values ​​per treatment dose were first normalized to the OD of the first time point for that dose. To determine the cytotoxic effect of PMP-DOX on yeast, the relative OD was determined within each treatment group compared to the untreated control (set at 100%). [Figure 11] 1 shows the luminescence (RLU relative luminescence units) of Pseudomonas aeruginosa bacteria treated with Ultrapure water (negative control), 3 ng of free luciferase protein (protein alone control), or luciferase protein-loaded PMP (PMP-Luc) at an effective luciferase protein dose of 3 ng for 2 hours at room temperature, with duplicate samples. Luciferase protein in the supernatant and pelleted bacteria was measured by luminescence using the ONE-Glo™ Luciferase Assay Kit (Promega) and measured on a SpectraMax® spectrophotometer. DETAILED DESCRIPTION OF THE INVENTION

[0095] Described herein are compositions and related methods for controlling pathogens with pathogen control compositions comprising plant messenger packs (PMPs), i.e., lipid aggregates produced in whole or in part from plant extracellular vesicles (EVs) or fragments, parts, or extracts thereof. PMPs can have antipathogenic activity (e.g., an agent suitable for administration to animals to treat infection, such as an antibacterial agent, a virucide, an antiviral agent, an antiparasitic agent, or a nematicide) or insect repellent activity without containing additional agents, but can optionally be modified to contain additional antipathogenic agents, pesticides, or insect repellents. Also included are formulations in which PMPs are provided in substantially pure or concentrated form. The pathogen control compositions and formulations described herein can be delivered directly to animals to treat or prevent pathogen infection. Additionally or alternatively, the pathogen control compositions can be delivered to various animal pathogens or vectors of animal pathogens to reduce the fitness of the pathogen or its vector, thereby controlling the spread of harmful pathogens.

[0096] I. Pathogen Control Compositions The pathogen control compositions described herein contain multiple plant messenger packs (PMPs). PMPs are lipid (e.g., lipid bilayer, monolayer, or multilayer) structures containing plant EVs or fragments, portions, or extracts thereof (e.g., lipid extracts). Plant EVs refer to endocrine lipid bilayer structures naturally occurring in plants. PMPs can be approximately 5 to 2000 nm in diameter. Plant EVs can originate from a variety of plant biosynthetic pathways. In nature, plant EVs can be found in plant intracellular and extracellular compartments, such as the plant apoplast, a compartment located outside the plasma membrane and formed by a series of cell walls and extracellular spaces. Alternatively, PMPs can be concentrated plant EVs found in the cell culture medium upon secretion from plant cells. Plant EVs can be isolated from plants (e.g., from the apoplastic fluid) by various methods, described in more detail herein, thereby providing PMPs.

[0097] A pathogen control composition may include a PMP that has antipathogenic (e.g., antibacterial, antifungal, antinematic, antiparasitic, or antiviral), pesticidal, or repellent activity against a pathogen without containing an additional antipathogenic, pesticide, or repellent agent. However, a PMP may further contain a heterologous pathogen control agent, such as an antipathogenic (e.g., antibacterial, antifungal, antinematic, antiparasitic, or antiviral) agent, pesticide, or repellent, which may be introduced in vivo or in vitro. Thus, a PMP may contain a substance with antipathogenic or pesticidal activity, which is loaded into or onto the PMP by the plant in which the PMP is produced. For example, a heterologous functional agent loaded into a PMP in vivo may be either a factor endogenous to the plant or a factor exogenous to the plant (e.g., as expressed by a heterologous gene construct in a genetically engineered plant). Alternatively, PMPs can be loaded with heterologous functional agents in vitro (eg, after production by various methods described in more detail herein).

[0098] PMPs may comprise plant EVs or fragments, parts, or extracts thereof, where the plant EVs have a diameter of about 5 to 2000 nm. For example, PMPs may have a diameter of about 5 to 50 nm, about 50 to 100 nm, about 100 to 150 nm, about 150 to 200 nm, about 200 to 250 nm, about 250 to 300 nm, about 300 to 350 nm, about 350 to 400 nm, about 400 to 450 nm, about 450 to 500 nm, about 500 to 550 nm, about 550 to 600 nm, about 600 to 650 nm, about 650 to 700 nm, or about 650 to 700 nm. The present invention may contain plant EVs, or fragments, parts, or extracts thereof, having an average diameter of about 700 to 750 nm, about 750 to 800 nm, about 800 to 850 nm, about 850 to 900 nm, about 900 to 950 nm, about 950 to 1000 nm, about 1000 to 1250 nm, about 1250 to 1500 nm, about 1500 to 1750 nm, or about 1750 to 2000 nm. In some examples, PMPs contain plant EVs, or fragments, parts, or extracts thereof, having an average diameter of about 5 to 950 nm, about 5 to 900 nm, about 5 to 850 nm, about 5 to 800 nm, about 5 to 750 nm, about 5 to 700 nm, about 5 to 650 nm, about 5 to 600 nm, about 5 to 550 nm, about 5 to 500 nm, about 5 to 450 nm, about 5 to 400 nm, about 5 to 350 nm, about 5 to 300 nm, about 5 to 250 nm, about 5 to 200 nm, about 5 to 150 nm, about 5 to 100 nm, about 5 to 50 nm, or about 5 to 25 nm. In certain examples, plant EVs, or fragments, parts, or extracts thereof have an average diameter of about 50 to 200 nm. In certain examples, plant EVs, or fragments, parts, or extracts thereof have an average diameter of about 50 to 300 nm. In certain examples, the plant EVs, or fragments, parts, or extracts thereof, have an average diameter of about 200 to 500 nm. In certain examples, the plant EVs, or fragments, parts, or extracts thereof, have an average diameter of about 30 to 150 nm.

[0099] In some examples, the PMP may comprise a plant EV, or a fragment, portion or extract thereof, having an average diameter of at least 5 nm, at least 50 nm, at least 100 nm, at least 150 nm, at least 200 nm, at least 250 nm, at least 300 nm, at least 350 nm, at least 400 nm, at least 450 nm, at least 500 nm, at least 550 nm, at least 600 nm, at least 650 nm, at least 700 nm, at least 750 nm, at least 800 nm, at least 850 nm, at least 900 nm, at least 950 nm or at least 1000 nm. In some examples, PMPs contain plant EVs, or fragments, portions, or extracts thereof, having an average diameter of less than 1000 nm, less than 950 nm, less than 900 nm, less than 850 nm, less than 800 nm, less than 750 nm, less than 700 nm, less than 650 nm, less than 600 nm, less than 550 nm, less than 500 nm, less than 450 nm, less than 400 nm, less than 350 nm, less than 300 nm, less than 250 nm, less than 200 nm, less than 150 nm, less than 100 nm, or less than 50 nm. Various methods standard in the art (e.g., dynamic light scattering) can be used to measure the particle size of plant EVs, or fragments, portions, or extracts thereof.

[0100] In some cases, the PMP is 77 nm 2 ~3.2×10 6 nm 2 (e.g., 77-100 nm 2 , 100~1000nm 2 , 1000 to 1 × 10 4 nm 2 , 1×10 4 ~1×10 5 nm 2 , 1×10 5 ~1×10 6 nm 2 or 1 x 10 6 ~3.2×10 6 nm 2 In some examples, the PMP may comprise a plant EV or a fragment, part or extract thereof having an average surface area of ​​65 nm 3 ~5.3×10 8 nm3 (e.g., 65 to 100 nm 3 , 100~1000nm 3 , 1000 to 1 × 10 4 nm 3 , 1×10 4 ~1×10 5 nm 3 , 1×10 5 ~1×10 6 nm 2 , 1×10 6 ~1×10 7 nm 3 , 1×10 7 ~1×10 8 nm 3 , 1×10 8 ~5.3×10 8 nm 3 In some instances, the PMP may contain plant EVs, or fragments, parts or extracts thereof, having an average volume of at least 77 nm 2 (e.g., at least 77 nm 2 , at least 100 nm 2 , at least 1000 nm 2 , at least 1 x 10 4 nm 2 , at least 1 x 10 5 nm 2 , at least 1 x 10 6 nm 2 Or at least 2 x 10 6 nm 2 In some examples, the PMP may comprise a plant EV, or a fragment, part, or extract thereof, having an average surface area of ​​at least 65 nm 3 (e.g., at least 65 nm 3 , at least 100 nm 3 , at least 1000 nm 3 , at least 1 x 10 4 nm 3 , at least 1 x 10 5 nm 3 , at least 1 x 10 6 nm 3 , at least 1 x 10 7 nm 3 , at least 1 x 10 8 nm 3, at least 2 × 10 8 nm 3 , at least 3 × 10 8 nm 3 , at least 4 × 10 8 nm 3 Or at least 5 x 10 8 nm 3 The plant EVs may contain plant EVs or fragments, parts or extracts thereof having an average volume of 10 ...

[0101] In some examples, PMPs may have the same size as plant EVs or fragments, extracts, or portions thereof. Alternatively, PMPs may have a different size than the initial plant EVs from which they are produced. For example, PMPs may have a diameter of about 5 to 2000 nm. For example, PMPs may have a diameter of about 5 to 50 nm, about 50 to 100 nm, about 100 to 150 nm, about 150 to 200 nm, about 200 to 250 nm, about 250 to 300 nm, about 300 to 350 nm, about 350 to 400 nm, about 400 to 450 nm, about 450 to 500 nm, about 500 to 550 nm, about 550 to 600 nm, about 600 to 650 nm, about 65 The average diameter may be about 0 to 700 nm, about 700 to 750 nm, about 750 to 800 nm, about 800 to 850 nm, about 850 to 900 nm, about 900 to 950 nm, about 950 to 1000 nm, about 1000 to 1200 nm, about 1200 to 1400 nm, about 1400 to 1600 nm, about 1600 to 1800 nm, or about 1800 to 2000 nm. In some examples, PMPs can have an average diameter of at least 5 nm, at least 50 nm, at least 100 nm, at least 150 nm, at least 200 nm, at least 250 nm, at least 300 nm, at least 350 nm, at least 400 nm, at least 450 nm, at least 500 nm, at least 550 nm, at least 600 nm, at least 650 nm, at least 700 nm, at least 750 nm, at least 800 nm, at least 850 nm, at least 900 nm, at least 950 nm, at least 1000 nm, at least 1200 nm, at least 1400 nm, at least 1600 nm, at least 1800 nm, or at least 2000 nm. Various methods standard in the art (e.g., dynamic light scattering) can be used to measure the particle size of PMPs. In some examples, the size of PMPs is determined after loading with heterologous functional agents or other modifications to the PMPs.

[0102] In some cases, the PMP is 77 nm 2 ~1.3×10 7 nm 2 (e.g., 77-100 nm 2 , 100~1000nm 2 , 1000 to 1 × 10 4nm 2 , 1×10 4 ~1×10 5 nm 2 , 1×10 5 ~1×10 6 nm 2 or 1 x 10 6 ~1.3×10 7 nm 2 In some instances, the PMP may have an average surface area of ​​65 nm 3 ~4.2×10 9 nm 3 (e.g., 65 to 100 nm 3 , 100~1000nm 3 , 1000 to 1 × 10 4 nm 3 , 1×10 4 ~1×10 5 nm 3 , 1×10 5 ~1×10 6 nm 2 , 1×10 6 ~1×10 7 nm 3 , 1×10 7 ~1×10 8 nm 3 , 1×10 8 ~1×10 9 nm 3 or 1 x 10 9 ~4.2×10 9 nm 3 In some instances, the PMP may have an average volume of at least 77 nm 2 (e.g., at least 77 nm 2 , at least 100 nm 2 , at least 1000 nm 2 , at least 1 x 10 4 nm 2 , at least 1 x 10 5 nm 2 , at least 1 x 10 6 nm 2 or 1 x 10 7 nm 3 In some instances, the PMP has an average surface area of ​​at least 65 nm 3 (e.g., at least 65 nm 3 , at least 100 nm3 , at least 1000 nm 3 , at least 1 x 10 4 nm 3 , at least 1 x 10 5 nm 3 , at least 1 x 10 6 nm 3 , at least 1 x 10 7 nm 3 , at least 1 x 10 8 nm 3 , at least 1 x 10 9 nm 3 , at least 2 × 10 9 nm 3 , at least 3 × 10 9 nm 3 Or at least 4 x 10 9 nm 3 ) has an average volume of

[0103] In some examples, a PMP may contain an intact plant EV. Alternatively, a PMP may contain a fragment, portion, or extract of the total surface area of ​​a plant EV vesicle (e.g., a fragment, portion, or extract comprising less than 100% (e.g., less than 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, or 1%) of the total surface area of ​​the vesicle). The fragment, portion, or extract may be of any shape, such as a circumferential fragment, a spherical fragment (e.g., a hemisphere), a curved fragment, a linear fragment, or a flat fragment. When the fragment is a spherical fragment of a vesicle, the spherical fragment may represent a fragment resulting from the division of the spherical vesicle along a pair of parallel lines or a fragment resulting from the division of the spherical vesicle along a pair of non-parallel lines. Thus, a plurality of PMPs may comprise a plurality of intact plant EVs, a plurality of plant EV fragments, portions, or extracts, or a mixture of intact plant EVs and fragments thereof. Those skilled in the art will appreciate that the ratio of intact and fragmented plant EVs will vary depending on the particular isolation method used. For example, grinding or blending plants or parts thereof can produce PMPs that contain a higher proportion of plant EV fragments, parts, or extracts than non-destructive extraction methods such as vacuum infiltration.

[0104] In instances where the PMP contains a fragment, part or extract of a plant EV, the EV fragment, part or extract has an average surface area smaller than that of an intact vesicle, e.g., 77 nm 2 , 100 nm 2 , 1000nm 2 , 1×10 4 nm 2 , 1×10 5 nm 2 , 1×10 6 nm 2 or 3.2 x 10 6 nm 2 In some examples, the EV fragments, portions or extracts may have an average surface area of ​​less than 70 nm 2 , 60nm 2 , 50nm 2 , 40nm 2 , 30nm 2 , 20nm 2 or 10 nm 2 In some instances, the PMPs have an average volume less than that of an intact vesicle, e.g., 65 nm 3 , 100 nm 3 , 1000nm 3 , 1×10 4 nm 3 , 1×10 5 nm 3 , 1×10 6 nm 3 , 1×10 7 nm 3 , 1×10 8 nm 3 or 5.3 x 10 8 nm 3 ) or a fragment, part or extract thereof.

[0105] In instances where PMPs comprise extracts of plant EVs, e.g., PMPs comprising lipids extracted (e.g., with chloroform) from plant EVs, the PMPs may contain at least 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60% or more of lipids extracted (e.g., with chloroform) from plant EVs. Many PMPs may contain plant EV fragments and / or plant EV-extracted lipids or mixtures thereof.

[0106] Further details regarding methods for producing PMPs, plant EV markers that can be conjugated to PMPs, and the formulation of compositions containing PMPs are outlined herein.

[0107] A. Generation method PMPs can be produced from plant EVs or fragments, parts, or extracts (e.g., lipid extracts) thereof that are naturally present in a plant or part thereof, including plant tissues or plant cells. An exemplary method for producing PMPs includes: (a) providing an initial sample from a plant or part thereof, the plant or part thereof containing EVs; and (b) isolating a crude PMP fraction from the initial sample, the crude PMP fraction having a reduced level of at least one contaminant or unwanted component from the plant or part thereof relative to the level in the initial sample. This method may further include the additional step (c) of purifying the crude PMP fraction, thereby producing a plurality of pure PMPs, the plurality of pure PMPs having a reduced level of at least one contaminant or unwanted component from the plant or part thereof relative to the level in the crude PMP fraction. Each production step is discussed in further detail below. Exemplary methods for isolating and purifying PMPs can be found, for example, in Rutter and Innes, Plant Physiol. 173(1):728-741, 2017; Rutter et al., Bio. Protoc. 7(17):e2533, 2017; Regente et al., J of Exp. Biol. 68(20):5485-5496, 2017; Mu et al., Mol. Nutr. Food Res., 58, 1561-1573, 2014, and Regente et al., FEBS Letters. 583:3363-3366, 2009, each of which is incorporated herein by reference.

[0108] For example, a method can be provided that includes (a) providing an initial sample from a plant or part thereof, the plant or part thereof comprising EVs; and (b) isolating a crude PMP fraction from the initial sample, the crude PMP fraction comprising a reduced level (e.g., at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99%, or 100% reduced level) of at least one contaminant or unwanted component from the plant or part thereof relative to the level in the initial sample. (c) purifying the crude PMP fraction, thereby producing a plurality of pure PMPs, wherein the plurality of pure PMPs has a reduced level (e.g., at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 40%, 45%, 50%, 55%, 60%, 70%, 80%, 90%, 95%, 96%, 98%, 99% or 100% reduced level) of at least one contaminant or unwanted component from the plant or part thereof relative to the crude EV fraction.

[0109] The PMPs provided herein may include plant EVs or fragments, parts, or extracts thereof isolated from a variety of plants. PMPs can be isolated from any genus of plant (vascular or non-vascular), including, but not limited to, angiosperms (monocotyledons and dicotyledons), gymnosperms, ferns, selaginella, horsetails, psilophytes, lycophytes, algae (e.g., unicellular or multicellular, e.g., archaeplastida), or mosses. In certain examples, PMPs can be produced from vascular plants, such as monocotyledons or dicotyledons, or gymnosperms. For example, PMPs may be effective against alfalfa, apple, Arabidopsis, banana, barley, canola, castor bean, chicory, chrysanthemum, clover, cocoa, coffee, cotton, cottonseed, corn, crambe, cranberry, cucumber, dendrobium, yam, eucalyptus, fescue, flax, gladiolus, lily, linseed, millet, cantaloupe, mustard, oat, oil palm, rapeseed, papaya, peanut, pineapple, ornamental plants, kidney bean, potato, rapeseed, rice, rye, ryegrass, safflower, sesame, sorghum, soybean, sugar beet, sugarcane, sunflower, strawberry, tobacco, tomato, turfgrass, wheat, or lemon. fruit and nut trees such as apple, pear, peach, orange, grapefruit, lemon, lime, almond, pecan, walnut, hazel, grapes such as grape, kiwi, hops, fruit shrubs and brambles such as raspberry, blackberry, gooseberry, forest trees such as ash, pine, fir, maple, oak, walnut, poplar, alfalfa, canola, castor, corn, cotton, crambe, flax, linseed, mustard, oil palm, rapeseed, peanut, potato, rice, safflower, sesame, soybean, sugar beet, sunflower, tobacco or wheat.

[0110] PMPs can be produced from a whole plant (e.g., a whole rosette or seedling) or, alternatively, one or more plant parts (e.g., leaves, seeds, roots, fruits, vegetables, pollen, phloem sap, or xylem sap). For example, PMPs can be produced from sprout plant organs / structures (e.g., leaves, stems, or tubers), roots, flowers and floral organs / structures (e.g., pollen, bracts, sepals, petals, stamens, carpels, anthers, or ovules), seeds (including embryos, endosperms, or seed coats), fruits (mature ovaries), sap (e.g., phloem or xylem sap), plant tissues (e.g., vascular tissue, ground tissue, tumor tissue, etc.), and cells (e.g., single cells, protoplasts, embryos, callus tissue, guard cells, egg cells, etc.) or their progeny. For example, the isolating step can include (a) providing a plant or part thereof. In some examples, the plant part is an Arabidopsis leaf. The plant can be at any developmental stage. For example, PMPs can be generated from seedlings, such as 1-, 2-, 3-, 4-, 5-, 6-, 7-, or 8-week-old seedlings (e.g., Arabidopsis seedlings). Other exemplary PMPs can include PMPs generated from roots (e.g., ginger root), fruit juice (e.g., grapefruit juice), vegetables (e.g., broccoli), pollen (e.g., olive pollen), phloem sap (e.g., Arabidopsis phloem sap), or xylem sap (e.g., tomato plant xylem sap).

[0111] PMPs can be produced from plants or parts thereof by a variety of methods. Any method that allows for the release of the plant's EV-containing apoplastic fraction or an extracellular fraction (e.g., cell culture medium) containing PMPs, including otherwise secreted EVs, is suitable for the present method. EVs can be released by either disruptive (e.g., grinding or blending the plant or any plant part) or non-disruptive (washing or vacuum infiltration of the plant or any plant part) methods. For example, the plant or part can be subjected to vacuum infiltration, grinding, blending, or a combination thereof to isolate EVs from the plant or plant part, thereby producing PMPs. For example, the isolation step can include (b) isolating a crude PMP fraction from an initial sample (e.g., a plant, plant part, or a sample derived from a plant or plant part), where the isolation step includes vacuum infiltration of the plant (e.g., with a vesicle isolation buffer) to release and collect the apoplastic fraction. Alternatively, the isolating step comprises (b) providing a plant or part thereof, and the releasing step comprises grinding or blending the plant to release the EVs, thereby producing the PMPs.

[0112] Once PMPs have been produced by isolating plant EVs, the PMPs can be separated or collected into a crude PMP fraction (e.g., an apoplastic fraction). For example, the separation step can include separating a plurality of PMPs into a crude PMP fraction using centrifugation (e.g., differential centrifugation or ultracentrifugation) and / or filtration to separate the PMP-containing fraction from larger contaminants, including plant tissue debris, plant cells, or plant cell organelles (e.g., nuclei, mitochondria, or chloroplasts). In this manner, the crude plant EV fraction will have a reduced number of larger contaminants, such as, for example, plant tissue debris, plant cells, or plant cell organelles (e.g., nuclei, mitochondria, or chloroplasts), compared to the initial sample from the source plant or plant part.

[0113] The crude PMP fraction can also be further purified by additional purification methods to produce multiple pure PMPs. For example, the crude PMP fraction can be separated from other plant components by ultracentrifugation, by using density gradients (iodixanol or sucrose), size exclusion, and / or other techniques to remove aggregated components (e.g., precipitation or size exclusion chromatography), for example. The resulting pure PMPs can have reduced levels of contaminants (e.g., one or more non-PMP components, e.g., protein aggregates, nucleic acid aggregates, protein-nucleic acid aggregates, free lipoproteins, lipid-protein structures), nuclei, cell wall components, cell organelles, or combinations thereof) compared to one or more fractions produced during earlier separation steps or compared to a predetermined threshold level, e.g., a published commercial specification. For example, pure PMPs can have reduced levels of plant organelles or cell wall elements (e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100%; or about 2x, 4x, 5x, 10x, 20x, 25x, 50x, 75x, 100x, or more than 100x) relative to the levels in the initial sample. In some examples, pure PMPs are substantially free of (e.g., have undetectable levels of) one or more non-PMP elements, such as protein aggregates, nucleic acid aggregates, protein-nucleic acid aggregates, free lipoproteins, lipid-protein structures), nuclei, cell wall elements, cell organelles, or combinations thereof. Further examples of release and separation steps can be found in Example 1. PMPs can be separated, for example, from 1x10 9 , 5×10 9 , 1×10 10 , 5×10 10 , 5×10 10 , 1×10 11 , 2 × 10 11 , 3×10 11 , 4×10 11 , 5×10 11 , 6×10 11 , 7×10 11 , 8×10 11 , 9×10 11 , 1×10 12 , 2 × 10 12 , 3×1012 , 4×10 12 , 5×10 12 , 6×10 12 , 7×10 12 , 8×10 12 , 9×10 12 , 1×10 13 or 1 x 10 13 The concentration may be greater than PMPs / mL.

[0114] For example, protein aggregates can be removed from isolated PMPs. For example, an isolated PMP solution can be subjected to various pHs (e.g., as measured using a pH probe) to precipitate protein aggregates in the solution. The pH can be adjusted to, for example, pH 3, pH 5, pH 7, pH 9, or pH 11, for example, by adding sodium hydroxide or hydrochloric acid. Once the solution reaches the specified pH, it can be filtered to remove particulates. Alternatively, an isolated PMP solution can be aggregated by adding a charged polymer, such as Polymin-P or Praestol 2640. Briefly, Polymin-P or Praestol 2640 is added to the solution and mixed with an impeller. The solution is then filtered to remove particulates. Alternatively, aggregates can be solubilized by increasing the salt concentration. For example, NaCl can be added to the isolated PMP solution until it reaches, for example, 1 mol / L. The solution is then filtered to isolate the PMPs. Alternatively, aggregates can be solubilized by increasing the temperature. For example, the isolated PMPs can be heated while mixing for 5 minutes until the solution reaches a uniform temperature, e.g., about 50°C. The PMP mixture can then be filtered to isolate the PMPs. Alternatively, soluble contaminants can be separated from the PMP solution by size exclusion chromatography according to standard procedures, eluting the PMPs in the first fraction while proteins and ribonucleoproteins, as well as some lipoproteins, are eluted later. The efficiency of protein aggregate removal can be determined by measuring and comparing the protein concentration before and after removal of protein aggregates using BCA / Bradford protein assay.

[0115] Any quantitative or qualitative method known in the art can be added to any of the production methods described herein to characterize or identify PMPs at any step of the production method. PMPs can be characterized by a variety of analytical methods to estimate PMP yield, PMP concentration, PMP purity, PMP composition, or PMP size. PMPs can be evaluated by several methods known in the art that allow visualization, quantitative, or qualitative characterization (e.g., composition identification) of PMPs, such as microscopy (e.g., transmission electron microscopy), dynamic light scattering, nanoparticle tracking, spectroscopy (e.g., Fourier transform infrared spectroscopy), or mass spectrometry (protein and lipid analysis). In certain examples, methods (e.g., mass spectrometry) can be used to identify plant EV markers present in PMPs, such as those disclosed in the Appendix. PMPs can be further labeled or stained to aid in the analysis and characterization of PMP fractions. For example, PMPs can be stained with 3,3'-dihexyloxacarbocyanine iodide (DIOC6), a fluorescent lipophilic dye, PKH67 (Sigma-Aldrich); Alexa Fluo® 488 (Thermo Fisher Scientific); or DyLight™ 800 (Thermo Fisher). Even in the absence of advanced forms of nanoparticle tracking, this relatively simple technique can be used to indirectly measure PMP concentration by quantifying total membrane content (Rutter and Innes, Plant Physiol. 173(1):728-741, 2017; Rutter et al., Bio. Protoc. 7(17):e2533, 2017). For more accurate measurements and to assess PMP size distribution, nanoparticle tracking or tunable resistive pulse sensing can be used.

[0116] During the production process, the PMPs can optionally be prepared so that they are at an elevated concentration relative to the EV level in the control or initial sample (e.g., about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100%; or about 2-fold, 4-fold, 5-fold, 10-fold, 20-fold, 25-fold, 50-fold, 75-fold, 100-fold, or more than 100-fold). The isolated PMPs can comprise any one of about 0.1% to about 100%, e.g., about 0.01% to about 100%, about 1% to about 99.9%, about 0.1% to about 10%, about 1% to about 25%, about 10% to about 50%, about 50% to about 99%, or about 75 to about 100% of the pathogen control composition. In some examples, the composition comprises at least 0.1%, 0.5%, 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more of any of PMPs, e.g., as measured by wt / vol, percent PMP protein composition, and / or percent lipid composition (e.g., by measuring fluorescently labeled lipids; see, e.g., Example 3). In some examples, a concentrated formulation is used, such as a commercially available product; for example, the end user may use a diluted formulation, which has a substantially low concentration of active ingredient. In some embodiments, the composition is formulated as a pathogen control concentrate, e.g., a highly concentrated, low-volume formulation.

[0117] As described in Example 1, PMPs can be produced from a variety of plants or parts thereof (e.g., leaf apoplast, seed apoplast, roots, fruits, vegetables, pollen, phloem sap, or xylem sap). For example, PMPs can be isolated from a plant apoplastic fraction, such as leaf apoplast (e.g., Arabidopsis thaliana leaf apoplast) or seed apoplast (e.g., sunflower seed apoplast). Other exemplary PMPs are produced from roots (e.g., ginger root), fruit juice (e.g., grapefruit juice), vegetables (e.g., broccoli), pollen (e.g., olive pollen), phloem sap (e.g., Arabidopsis phloem sap), xylem sap (e.g., tomato plant xylem sap), or cell culture supernatant (e.g., BY2 tobacco cell culture supernatant). This example further illustrates the production of PMPs from these various plant sources.

[0118] PMPs can be purified by a variety of methods, such as by using density gradients (iodixanol or sucrose) in conjunction with ultracentrifugation and / or methods to remove aggregated contaminants, such as precipitation or size exclusion chromatography, as described in Example 2. For example, Example 2 describes the purification of PMPs obtained by the separation steps outlined in Example 1. PMPs can be further characterized according to the methods described in Example 3.

[0119] In some instances, the PMPs of the present compositions and methods can be isolated from plants or plant parts and used without further modification of the PMPs, hi other instances, the PMPs can be modified prior to use, as further outlined herein.

[0120] B. Plant EV markers The PMPs of the present compositions and methods can have a variety of markers that identify the PMP as being produced from plant EVs (and / or including fragments, portions, or extracts thereof). As used herein, the term "plant EV marker" refers to an element that is naturally associated with a plant and that is incorporated into or onto a plant EV after implantation, such as a plant protein, a plant nucleic acid, a plant small molecule, a plant lipid, or a combination thereof. Examples of plant EV markers can be found, for example, in Rutter and Innes, Plant Physiol. 173(1):728-741, 2017; Raimondo et al., Oncotarget. 6(23):19514, 2015; Ju et al., Mol. Therapy. 21(7):1345-1357, 2013; Wang et al., Molecular Therapy. 22(3):522-534, 2014; and Regente et al., J of Exp. Biol. 68(20):5485-5496, 2017; each of which is incorporated herein by reference. Further examples of plant EV markers are listed in the appendix and are further outlined herein.

[0121] Plant EV markers can include plant lipids. Examples of plant lipid markers that can be found in PMPs include phytosterols, campesterol, β-sitosterol, sigmasterol, avenasterol, glycosyl inositol phosphorylceramide (GIPC), glycolipids (e.g., monogalactosyldiacylglycerol (MGDG) or digalactosyldiacylglycerol (DGDG)), or combinations thereof. For example, PMPs can contain GIPC, which represents a major sphingolipid class in plants and is one of the most abundant membrane lipids in plants. Other plant EV markers can include lipids that accumulate in plants in response to abiotic or biotic stressors (e.g., bacterial or fungal infection), such as phosphatidic acid (PA) or phosphatidylinositol-4-phosphate (PI4P).

[0122] Alternatively, the plant EV marker may comprise a plant protein. In some examples, the protein plant EV marker may be an antimicrobial protein naturally produced by a plant, such as a defense protein secreted by a plant in response to an abiotic or biotic stressor (e.g., bacterial or fungal infection). Plant pathogen defense proteins include soluble N-ethylmaleimide-sensitive element-binding receptor (SNARE) proteins (e.g., Syntaxin-121 (SYP121; GenBank Accession Nos. NP_187788.1 or NP_974288.1), Penetration 1 (PEN1; GenBank Accession No. NP_567462.1), or the ABC transporter Penetration 3 (PEN3; GenBank Accession No. NP_191283.2). Other examples of plant EV markers include proteins that facilitate long-distance transport of RNA in plants, such as phloem proteins (e.g., phloem protein 2-A1 (PP2-A1), GenBank Accession Number: NP_193719.1), calcium-dependent lipid-binding proteins, or lectins (e.g., Jacalin-related lectins, such as sunflower (Helianthus annuus) Jacalin (Helja; GenBank: AHZ86978.1). For example, an RNA-binding protein can be glycine-rich RNA-binding protein-7 (GRP7; GenBank Accession Number: NP_179760.1). In addition, proteins that regulate plasmodesmata function can, in some instances, be found in plant EVs, such as Synapse-Tag1 (SAT-Tag1), and Synapse-Tag2 (SAT-Tag2). AA (GenBank accession number: NP_565495.1). In some examples, the plant EV marker may include a protein involved in lipid machinery, such as phospholipase C or phospholipase D. In some examples, the plant protein EV marker is a plant cell trafficking protein. In certain examples, where the plant EV marker is a protein, the protein marker may lack a signal peptide typically associated with secreted proteins.Non-classically secreted proteins appear to share several common characteristics, such as (i) the absence of a leader sequence, (ii) the absence of ER- or Golgi-specific PTMs, and / or (iii) secretion that is unaffected by Brefeldin A, which blocks the classical ER / Golgi-dependent secretory pathway. Those skilled in the art can evaluate proteins for signal sequences or their deletions using a variety of publicly available tools (e.g., the SecretomeP Database; SUBA3 (SUBcellular localization database for Arabidopsis proteins)).

[0123] In examples where the plant EV marker is a protein, the protein may have an amino acid sequence that shares at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with a plant EV marker, such as any of the plant EV markers listed in the Appendix. For example, the protein may have an amino acid sequence that shares at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% sequence identity with PEN1 from Arabidopsis thaliana (GenBank Accession Number: NP_567462.1).

[0124] In some examples, the plant EV marker comprises a nucleic acid encoded by the plant, such as plant RNA, plant DNA, or plant PNA. For example, the PMP may comprise a plant-encoded dsRNA, mRNA, viral RNA, microRNA (miRNA), or small interfering RNA (siRNA). In some examples, the nucleic acid may be associated with a protein that facilitates long-distance transport of RNA in plants, as discussed herein. In some examples, the nucleic acid plant EV marker may be involved in host-induced gene silencing (HIGS), a process by which plants suppress foreign transcripts of plant pests (e.g., pathogens such as fungi). For example, the nucleic acid may suppress a bacterial or fungal gene. In some examples, the nucleic acid may be a microRNA, such as miR159 or miR166, that targets a gene in a fungal pathogen (e.g., Verticillium dahliae). In some examples, the protein may be one involved in the transport of plant defense compounds, such as a protein involved in glucosinolate (GSL) transport and metabolism, including glucosinolate transporter-1-1 (GTR1; GenBank Accession Number: NP_566896.2), glucosinolate transporter-2 (GTR2; NP_201074.1), or epithiospecific modifier 1 (ESM1; NP_188037.1).

[0125] In examples where the plant EV marker is a nucleic acid, the nucleic acid may have a nucleotide sequence that has at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to a plant EV marker, such as those encoding a plant EV marker listed in the Appendix. For example, the nucleic acid may have a polynucleotide sequence that has at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to miR159 or miR166.

[0126] In some instances, plant EV markers include compounds produced by plants. For example, the compounds may be defense compounds, such as secondary metabolites, produced in response to abiotic or biotic stressors. One such secondary metabolite that may be found in PMPs is glucosinolate (GSL), which is a nitrogen- and sulfur-containing secondary metabolite found primarily in Brassicaceae plants. Other secondary metabolites may include allelochemicals.

[0127] In some instances, PMPs can also be identified as being produced from plant EVs based on the absence of a particular marker (e.g., a lipid, polypeptide, or polynucleotide) that is not typically produced by plants but is commonly associated with other organisms (e.g., a marker for animal, bacterial, or fungal EVs). For example, in some instances, PMPs lack a lipid typically found in animal, bacterial, or fungal EVs. In some instances, PMPs lack a lipid typical of animal EVs (e.g., sphingomyelin). In some instances, PMPs do not contain lipids typical of bacterial EVs or bacterial membranes (e.g., LPS). In some instances, PMPs lack a lipid typical of fungal membranes (e.g., ergosterol).

[0128] Plant EV markers can be identified using any technique known in the art that allows for the identification of small molecules (e.g., mass spectrometry, mass spectrometry), lipids (e.g., mass spectrometry, mass spectrometry), proteins (e.g., mass spectrometry, immunoblotting), or nucleic acids (e.g., PCR analysis). In some examples, the PMP compositions described herein contain a detectable amount, e.g., a predetermined threshold amount, of a plant EV marker described herein.

[0129] C. Drug Loading PMPs can be modified to contain heterofunctional agents, such as pathogen control or repellent agents, such as those described herein. PMPs can carry or associate with such agents in a variety of ways that allow for delivery of the agent to a target plant or plant pest, for example, by encapsulating the agent, incorporating the component within the lipid bilayer structure, or associating (e.g., conjugating) the component with the surface of the lipid bilayer structure of the PMP.

[0130] Heterologous functional agents can be incorporated into or loaded onto a PMP by any method known in the art that allows for direct or indirect binding between the PMP and the agent. Heterologous functional agents can be incorporated into a PMP by in vivo methods (e.g., by producing the PMP in planta, e.g., from a transgenic plant containing the heterologous agent), or in vitro (e.g., in tissue culture or cell culture), or by both in vivo and in vitro methods.

[0131] In an example of in vivo loading of PMPs with a heterologous functional agent (e.g., a pathogen control agent or repellent), the PMPs can be produced in planta from EVs, or fragments, portions, or extracts thereof, loaded into tissue culture or cell culture. In planta methods involve expression of the heterologous functional agent (e.g., a pathogen control agent or repellent) in a plant that has been genetically modified to express the heterologous functional agent. In some examples, the heterologous functional agent is exogenous to the plant. Alternatively, the heterologous functional agent can be found naturally in the plant, but expressed at levels higher than those found in non-genetically modified plants.

[0132] In some examples, PMPs can be loaded in vitro. Substances can be loaded onto or into PMPs (e.g., encapsulated by PMPs) using, but not limited to, physical, chemical, and / or biological methods. For example, heterologous functional agents can be introduced into PMPs by one or more of electroporation, sonication, passive diffusion, stirring, lipid extraction, or extrusion. To confirm the presence or level of the loaded agent, the loaded PMPs can be evaluated using various methods, such as HPLC (e.g., for small molecule evaluation); immunoblotting (e.g., for protein evaluation); and quantitative PCR (e.g., for nucleotide evaluation). However, those skilled in the art should understand that loading a substance of interest into a PMP is not limited to the methods exemplified above.

[0133] In some cases, heterofunctional agents can be conjugated to PMPs, where the heterofunctional agent is indirectly or directly bound or linked to the PMP. For example, one or more pathogen control agents can be chemically linked to the PMP so that they are directly linked to the lipid bilayer of the PMP (e.g., by covalent or ionic bonds). In some cases, conjugation of various pathogen control agents to PMPs can be achieved by first mixing one or more heterofunctional agents with a suitable cross-linking agent (e.g., N-ethylcarbodiimide ("EDC"), which is commonly used as a carboxyl activating agent for primary amine and amide bonds and also reacts with phosphate groups) in a suitable solvent. After an incubation period sufficient to allow binding of the heterofunctional agent and the crosslinker, the crosslinker / heterofunctional agent mixture can be combined with PMPs and, after a further incubation period, subjected to a sucrose gradient (e.g., 8, 30, 45, and 60% sucrose gradient) to separate the free heterofunctional agent and free PMPs from the pathogen control agent conjugated to the PMPs. As part of combining the mixture with the sucrose gradient and the accompanying centrifugation step, the PMPs conjugated to the pathogen control agent will now appear as a band in the sucrose gradient; therefore, the conjugated PMPs can then be collected, washed, and dissolved in a suitable solution for use as described herein.

[0134] In some instances, the PMP is stably associated with the heterologous functional agent before and after delivery of the PMP, e.g., to a plant or pest. In other instances, the PMP is associated with the heterologous functionality such that the heterologous functional agent dissociates from the PMP after delivery of the PMP, e.g., to a plant or pest.

[0135] PMPs can also be further modified with other elements (e.g., lipids, e.g., sterols, e.g., cholesterol; or small molecules) to further alter the functional and structural characteristics of the PMP. For example, a PMP can be further modified with a stabilizing molecule that enhances the stability of the PMP (e.g., stable for at least 1 day at room temperature and / or at least 1 week at 4°C).

[0136] PMPs can be loaded with various concentrations of heterogeneous functional agents depending on the particular agent or use. For example, in some examples, a PMP is loaded such that a pathogen control composition disclosed herein comprises about 0.001, 0.01, 0.1, 1.0, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 95 (or any range from about 0.001 to 95) or more wt% of a pathogen control agent and / or repellent. In some examples, the PMP is loaded so that the pathogen control composition comprises about 95, 90, 80, 70, 60, 50, 40, 30, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1.0, 0.1, 0.01, 0.001 (or any range from about 95 to 0.001) or less by weight of the pathogen control agent and / or repellent. For example, the pathogen control composition can contain about 0.001 to about 0.01 wt%, about 0.01 to about 0.1 wt%, about 0.1 to about 1 wt%, about 1 to about 5 wt%, or about 5 to about 10 wt%, or about 10 to about 20 wt% of the pathogen control agent and / or repellent. In some examples, PMPs can be loaded with about 1, 5, 10, 50, 200, or 500, 1,000, 2,000 (or any range from about 1 to 2,000) or more μg / ml of pathogen control agent and / or repellent. Liposomes of the present invention can be loaded with about 2,000, 1,000, 500, 200, 100, 50, 10, 5, 1 (or any range from about 2,000 to 1) or less μg / ml of pathogen control agent and / or repellent.

[0137] In some examples, the PMP is loaded with at least 0.001 wt%, at least 0.01 wt%, at least 0.1 wt%, at least 1.0 wt%, at least 2 wt%, at least 3 wt%, at least 4 wt%, at least 5 wt%, at least 6 wt%, at least 7 wt%, at least 8 wt%, at least 9 wt%, at least 10 wt%, at least 15 wt%, at least 20 wt%, at least 30 wt%, at least 40 wt%, at least 50 wt%, at least 60 wt%, at least 70 wt%, at least 80 wt%, at least 90 wt%, or at least 95 wt% of the pathogen control and / or repellent compositions disclosed herein. In some examples, the PMPs can be loaded with at least 1 μg / ml, at least 5 μg / ml, at least 10 μg / ml, at least 50 μg / ml, at least 100 μg / ml, at least 200 μg / ml, at least 500 μg / ml, at least 1,000 μg / ml, or at least 2,000 μg / ml of pathogen control and / or repellent.

[0138] Examples of specific pathogen control or repellent agents that can be loaded into PMPs are further outlined in the section entitled "Heterofunctional Agents."

[0139] D. Pharmaceutical Preparations The present specification includes, for example, pathogen control compositions that can be formulated into pharmaceutical compositions for administration to animals. The pharmaceutical compositions can be administered to animals together with pharmaceutically acceptable diluents, carriers, and / or excipients. Depending on the administration method and dose, the pharmaceutical compositions of the methods described herein can be formulated into suitable pharmaceutical compositions that allow for easy delivery. A single dose can be in the form of a unit dose, if desired.

[0140] The pathogen control composition can be formulated for oral administration, intravenous administration (e.g., injection or infusion), or subcutaneous administration to animals. For injectable formulations, various effective pharmaceutical carriers are known in the art (see, for example, Remington: The Science and Practice of Pharmacy, 22nd ed., (2012) and ASHP Handbook on Injectable Drugs, 18 th ed., (2014).

[0141] Pharmaceutically acceptable carriers and excipients in the compositions are non-toxic to recipients at the dosages and concentrations used. Acceptable carriers and excipients include buffers such as phosphate, citrate, HEPES, and TAE; antioxidants such as ascorbic acid and methionine; preservatives such as hexamethonium chloride, octadecyldimethylbenzyl ammonium chloride, resorcinol, and benzalkonium chloride; proteins such as human serum albumin, gelatin, dextran, and immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, histidine, and lysine; and carbohydrates such as glucose, mannose, sucrose, and sorbitol. The compositions can be formulated according to conventional pharmaceutical practice. The concentration of the compound in the formulation can vary depending on several factors, including the dosage of the active agent (e.g., PMP) to be administered and the route of administration.

[0142] For oral administration to animals, the pathogen control composition can be prepared in the form of an oral formulation, which can include tablets, caplets, capsules, syrups, or oral liquid dosage forms containing the active ingredient in a mixture with non-toxic pharmaceutically acceptable excipients. These excipients may be, for example, inert diluents or fillers (e.g., sucrose, sorbitol, sugars, mannitol, microcrystalline cellulose, starches such as potato starch, calcium carbonate, sodium chloride, lactose, calcium phosphate, calcium sulfate, or sodium phosphate); granulating and disintegrating agents (e.g., cellulose derivatives such as microcrystalline cellulose, starches such as potato starch, croscarmellose sodium, alginates, or alginic acid); binders (e.g., sucrose, glucose, sorbitol, acacia, alginic acid, sodium alginate, gelatin, starch, pregelatinized starch, microcrystalline cellulose, magnesium aluminum silicate, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, ethylcellulose, polyvinylpyrrolidone, or polyethylene glycol); and lubricants, glidants, and anti-adherents (e.g., magnesium stearate, zinc stearate, stearic acid, silica, hydrogenated vegetable oils, or talc). Other pharmaceutically acceptable excipients may be colorants, flavorings, plasticizers, humectants, buffering agents, etc. Oral formulations may also be provided in unit dosage form as chewable tablets, non-chewable tablets, caplets, capsules (as hard gelatin capsules in which the active ingredient is mixed with an inert solid diluent, or as soft gelatin capsules in which the active ingredient is mixed with water or an oil medium). The compositions disclosed herein may further include immediate-release, sustained-release, or delayed-release formulations.

[0143] For parenteral administration to animals, the pathogen control composition can be formulated in the form of a liquid solution or suspension and administered by a parenteral route (e.g., subcutaneous, intravenous, or intramuscular). The pharmaceutical composition can be formulated for injection or infusion. Pharmaceutical compositions for parenteral administration can be formulated using a sterile solution or any pharmaceutically acceptable liquid as a vehicle. Pharmaceutically acceptable vehicles include, but are not limited to, sterile water, physiological saline, or cell culture media (e.g., Dulbecco's Modified Eagle's Medium (DMEM), α-Modified Eagle's Medium (α-MEM), F-12 medium). Formulation methods are known in the art; see, for example, Gibson (ed.) Pharmaceutical Preformulation and Formulation (2nd ed.) Taylor & Francis Group, CRC Press (2009).

[0144] E. Agricultural formulations Included herein are, for example, pathogen control compositions that can be formulated into agricultural compositions for administration to pathogens or pathogen vectors (e.g., insects). Pharmaceutical compositions can be administered to pathogens or pathogen vectors (e.g., insects) together with agriculturally acceptable diluents, carriers, and / or excipients. Further examples of agricultural formulations useful in the present compositions and methods are further outlined herein.

[0145] To facilitate application, handling, transportation, storage, and maximum activity, the active substance, here PMP, can be formulated with other substances. PMP can be formulated, for example, into baits, concentrated emulsions, dusts, emulsifiable concentrates, fumigants, gels, granules, microencapsulated formulations, seed treatments, suspensions, suspoemulsions, tablets, water-soluble liquids, water-dispersible granules or dry flowables, wettable powders, and trace solutions. For more detailed information on formulation types, see "Catalogue of Pesticide Formulation Types and International Coding System," Technical Monograph no. 2, 5th Edition by CropLife International (2002).

[0146] Active ingredients (e.g., PMPs with or without heterofunctional agents, such as antipathogens, pesticides, or repellents) are most commonly applied as aqueous suspensions or emulsions prepared from concentrated formulations of such agents. Such water-soluble, water-suspendable, or emulsifiable formulations can be solids (commonly known as wettable powders), water-dispersible granules, liquids commonly known as emulsifiable concentrates, or aqueous suspensions. Wettable powders, which can be compressed to form water-dispersible granules, contain a homogeneous mixture of pesticide, carrier, and surfactant. The carrier is typically selected from attapulgite clay, montmorillonite clay, diatomaceous earth, or purified silicic acid. Effective surfactants, comprising from about 0.5% to about 10% of the wettable powder, include nonionic surfactants such as sulfonated lignin, condensed naphthalene sulfonates, naphthalene sulfonates, alkyl benzene sulfonates, and ethylene oxide adducts of alkyl phenols and alkyl sulfonates.

[0147] Emulsifiable concentrates can contain a suitable concentration of PMP, such as about 50 to about 500 grams per liter of liquid, dissolved in a carrier, either a water-soluble solvent or a mixture of a water-soluble organic solvent and an emulsifier. Useful organic solvents include aromatic oils, particularly xylene, and petroleum fractions, especially the high-boiling naphthalene and olefinic portions of petroleum, such as heavy aromatic naphtha. Other organic solvents, such as terpene solvents including rosin derivatives, aliphatic ketones such as cyclohexanone, and complex alcohols such as 2-ethoxyethanol, can also be used. Suitable emulsifiers for emulsions can be selected from common anionic and nonionic surfactants.

[0148] Aqueous suspensions include suspensions of water-insoluble pesticides dispersed in an aqueous carrier at concentrations ranging from about 5% to about 50% by weight. The suspensions are prepared by pulverizing the pesticide and vigorously mixing it into a carrier containing water and a surfactant. Materials such as inorganic salts and synthetic or natural gums may also be added to increase the density and viscosity of the aqueous carrier.

[0149] PMPs can be applied as granular compositions, which are particularly useful for soil application. Granular compositions typically contain about 0.5% to about 10% by weight of the pesticide dispersed in a carrier comprising clay or similar material. These compositions are typically prepared by dissolving the formulation in a suitable solvent and then applying it to a granular carrier preformed to the appropriate particle size, ranging from about 0.5 to about 3 mm. These compositions can be formulated by making a dough or paste of the carrier and compound, grinding it, and then drying it to obtain the desired granular particle size.

[0150] Dusts containing the present PMP formulations are prepared by intimately mixing powdered PMP with a suitable powdered carrier, such as kaolin clay, ground volcanic rock, etc. The dust may suitably comprise from about 1% to about 10% of the packet. Dusts can be applied with a dust blower machine as a seed dressing or foliar application.

[0151] It is likewise practical to apply the formulation in the form of a solution in a suitable organic solvent, usually an oil widely used in agricultural chemistry, such as spray oil.

[0152] PMPs can also be applied in the form of an aerosol composition, in which the packet is dissolved or dispersed in a carrier that is a pressure-generating propellant mixture, and the aerosol composition is packaged in a container from which the mixture is administered via an atomizing valve.

[0153] Another embodiment is an oil-in-water emulsion, the emulsion comprising oil droplets, each with a lamellar liquid crystal coating, dispersed in an aqueous phase, each oil droplet comprising at least one agriculturally active compound and individually coated with a monolamellar or oligolamellar layer comprising (1) at least one non-ionic lipophilic surfactant, (2) at least one non-ionic hydrophilic surfactant, and (3) at least one ionic surfactant, wherein the oil droplets have an average particle size of less than 800 nanometers. Further details regarding the above embodiment are disclosed in U.S. Patent Application Publication No. 20070027034, published February 1, 2007. For ease of use, this embodiment will be referred to as an "OIWE."

[0154] Additionally, generally, when the molecules disclosed above are used in formulations, such formulations may also contain other ingredients, including, but not limited to, wetting agents, spreading agents, adhesives, penetrating agents, buffers, sequestering agents, drift control additives, compatibility agents, antifoaming agents, detergents, and emulsifiers (this is a non-exclusive and non-mutually exclusive list). Some ingredients are described below.

[0155] Wetting agents are substances that, when added to a liquid, increase the liquid's spreading or penetration power by reducing the interfacial tension between the liquid and the surface on which it is spread. Wetting agents serve two primary functions in agricultural chemical formulations: to increase the rate of wetting of powders with water during processing and manufacturing processes to produce concentrates or suspensions for soluble liquids, and to shorten the wetting time of wettable powders during the water-product mixing process in the spray tank to improve water penetration into water-dispersible granules. Examples of wetting agents used in wettable powder, suspension, and water-dispersible granule formulations are sodium lauryl sulfate; sodium dioctyl sulfosuccinate; alkylphenol ethoxylates; and fatty alcohol ethoxylates.

[0156] Dispersants are substances that adsorb to particle surfaces, helping to maintain particle dispersion and preventing particle reagglomeration. Dispersants are added to pesticide formulations to facilitate dispersion and suspension during the manufacturing process and to ensure particle redispersion in the water in the spray tank. Dispersants are widely used in wettable powders, suspensions, and water-dispersible granules. Surfactants used as dispersants have the ability to strongly adsorb to particle surfaces and provide charge or steric hindrance to particle reagglomeration. The most commonly used surfactants are anionic, nonionic, or a mixture of the two. For wettable powders, the most common dispersant is sodium lignosulfonate. For suspensions, excellent adsorption and stabilization are achieved using polyelectrolytes, such as sodium naphthalene sulfonate formaldehyde condensates. Tristyrylphenol ethoxylate phosphate esters are also used. Nonionic surfactants, such as alkylarylethylene oxide condensates and EO-PO block copolymers, are sometimes combined with anionic surfactants to form suspension concentrates. In recent years, new types of very high molecular weight polymeric surfactants have been developed as dispersants. They have a very long hydrophobic "backbone" and many ethylene oxide chains that form the "teeth" of a "comb" surfactant. These high molecular weight polymers can impart very good long-term stability to suspensions because the hydrophobic backbone provides many anchoring points on the particle surface. Examples of dispersants used in pesticide formulations are sodium lignosulfonate; sodium naphthalene sulfonate formaldehyde condensate; tristyrylphenol ethoxylate phosphate ester; fatty alcohol ethoxylate; alkyl ethoxylate; EO-PO (ethylene oxide-propylene oxide) block copolymer; and graft copolymer.

[0157] An emulsifier is a substance that stabilizes the suspension of droplets of one liquid phase in another. Without the emulsifier, the two liquids would separate into two immiscible liquid phases. The most commonly used emulsifier blends contain an alkylphenol or aliphatic alcohol with 12 or more ethylene oxide units and an oil-soluble calcium salt of dodecylbenzenesulfonic acid. A hydrophilic-lipophilic balance ("HLB") value ranging from 8 to 18 usually provides an excellent stable emulsion. Emulsion stability can sometimes be improved by the addition of a small amount of an EO-PO block copolymer surfactant.

[0158] Solubilizers are surfactants that form aqueous micellar solutions at concentrations above the critical micelle concentration. Thus, the micelles are capable of dissolving or solubilizing water-insoluble materials within the hydrophobic compartment of the micelles. The types of surfactants commonly used for solubilization are nonionic surfactants, sorbitan monooleate, sorbitan monooleate ethoxylate, and methyl oleate.

[0159] Surfactants may also be used alone or in conjunction with other additives, such as mineral or vegetable oils, as adjuvants to spray tank mixes to improve the biological performance of pesticides on their targets. The type of surfactant used for bioenhancement generally depends on the nature and mode of action of the pesticide. However, they are often nonionic surfactants, such as alkyl ethoxylates; linear fatty alcohol ethoxylates; and fatty amine ethoxylates.

[0160] Carriers or diluents in pesticide formulations are materials added to pesticides to provide the required strength of the formulation. Carriers are usually materials with high absorption capacity, while diluents are usually materials with low absorption capacity. Carriers and diluents are used in the formulation of dusts, wettable powders, granules, and water-dispersible granules.

[0161] Organic solvents are primarily used in the formulation of emulsifiable concentrates, oil-in-water emulsions, suspoemulsions, and microformulations, and to a lesser extent, granules. Mixtures of solvents may also be used. The first major group of solvents are aliphatic paraffin oils, such as kerosene or refined paraffin. The second major group (and most common) includes aromatic solvents, such as xylene and the higher molecular weight fractions of C9 and C10 aromatic solvents. Chlorinated hydrocarbons are useful as cosolvents to prevent crystallization of pesticides when the formulation is emulsified in water. Alcohols may also be used as cosolvents to increase solvency. Other solvents may include vegetable oils, seed oils, and esters of vegetable and seed oils.

[0162] Thickeners or gelling agents are primarily used in the formulation of suspensions, emulsions, and suspoemulsions to alter the rheology or fluidity of liquids and to prevent separation and settling of dispersed particles or droplets. Thickeners, gelling agents, and suspending agents generally fall into two categories: water-insoluble particles and water-soluble polymers. Clays and silicas can be used to prepare suspension formulations. Examples of these types of materials include, but are not limited to, montmorillonite clay, bentonite, magnesium aluminum silicate, and attapulgite. Water-soluble polysaccharides have been used as thickening-gelling agents for many years. The most commonly used types of polysaccharides are natural extracts of seeds and seaweed or synthetic derivatives of cellulose. Examples of these types of materials include, but are not limited to, guar gum, locust bean gum, carrageenan, alginates, methylcellulose, sodium carboxymethylcellulose (SCMC), and hydroxyethylcellulose (HEC). Other types of suspending agents are based on modified starch, polyacrylates, polyvinyl alcohol, and polyethylene oxide. Another good suspending agent is xanthan gum.

[0163] Microorganisms can cause spoilage of formulated products. Therefore, preservatives are used to eliminate or inhibit the action of microorganisms. Examples of such agents include, but are not limited to, propionic acid and its salts; sorbic acid and its sodium or potassium salts; benzoic acid and its salts; p-hydroxybenzoic acid sodium salt; methyl p-hydroxybenzoate; and 1,2-benzisothiazolin-3-one (BIT).

[0164] The presence of surfactants often causes aqueous formulations to foam during the mixing process during production and application from a spray tank. To reduce the tendency to foam, antifoaming agents are often added during the production stage or before bottling. Generally, there are two types of antifoaming agents: silicone and non-silicone. Silicones are usually aqueous emulsions of dimethylpolysiloxane, while non-silicone antifoaming agents are water-insoluble oils, such as octanol and nonanol, or silica. In either case, the function of the antifoaming agent is to remove the surfactant from the air-water interface.

[0165] "Green agents" (e.g., adjuvants, surfactants, solvents) can reduce the overall environmental footprint of crop protection formulations. Green agents are biodegradable and generally derived from natural and / or sustainable sources, such as plant and animal sources. Specific examples are vegetable oils, seed oils and their esters, as well as alkoxylated alkylphenol polyglucosides.

[0166] In some cases, the PMP can be freeze-dried or lyophilized. See U.S. Patent No. 4,311,712. The PMP can then be reconstituted by contacting it with water or another liquid. Other ingredients, such as other pathogen control agents, pesticides, repellents, agriculturally acceptable carriers, or other substances, can be added to the lyophilized or reconstituted liposomes in accordance with the formulations described herein.

[0167] Other optional features of the compositions include a carrier or delivery vehicle that protects the pathogen control composition from UV and / or acidic conditions. In some examples, the delivery vehicle contains a pH buffer. In some examples, the composition is formulated to have a pH within the range of about 4.5 to about 9.0, including any one of a pH range of about 5.0 to about 8.0, about 6.5 to about 7.5, or about 6.5 to about 7.0.

[0168] The composition may further be formulated with an attractant (e.g., a chemical attractant) to attract pests, such as disease vectors (e.g., insects), to the vicinity of the composition. Attractants include pheromones, chemicals secreted by animals, particularly pests, or chemical attractants that affect the behavior or development of other organisms of the same species. Other attractants include sugar and protein hydrolyzate syrups, yeast, and carrion. The attractant may also be combined with the active ingredient and sprayed on whole leaves or other items in the treated area. A variety of attractants are known that affect pest behavior, such as the pest's search for food, egg laying, or mating sites or mates. Attractants useful in the methods and compositions described herein include, for example, eugenol, phenethyl propionate, ethyl dimethyl isobutyl cyclopropane carboxylate, propyl benzodioxane carboxylate, cis-7,8-epoxy-2-methyloctadecane, trans-8,trans-0-dodecadienol, cis-9-tetradecenal (including cis-11-hexadecenal), trans-11-tetradecenal, cis-11-hexadecenal, (Z)-11,12-hexadecadienal, cis-7-dodecenyl acetate, cis-8-dodecenyl acetate, and cis-8-dodecenyl benzoate. Examples of suitable acetic acid derivatives include cis-9-dodecenyl acetate, cis-9-tetradecenyl acetate, cis-11-tetradecenyl acetate, trans-11-tetradecenyl acetate (including cis-11), cis-9,trans-11-tetradecenyl acetate (including cis-9, trans-12), cis-9,trans-12-tetradecenyl acetate, cis-7,trans-11-hexadecadienyl acetate (including cis-7, trans-11), cis-13,cis-13-octadecadienyl acetate, trans-3,cis-13-octadecadienyl acetate, anethole, and isoamyl salicylate.

[0169] For more detailed information on pesticide formulations, see "Chemistry and Technology of Agrochemical Formulations" edited by D.A. Knowles, copyright 1998 by Kluwer Academic Publishers. Also see "Insecticides in Agriculture and Environment - Retrospects and Prospects" by A.S. Perry, I. Yamamoto, I. Ishaaya, and R. Perry, copyright 1998 by Springer-Verlag.

[0170] II. Treatment Method The pathogen control compositions described herein are useful in a variety of treatment methods, particularly for preventing or treating pathogen infections in animals, including delivering a pathogen control composition described herein to an animal.

[0171] Provided herein are methods of administering the pathogen control compositions disclosed herein to plants, which can be useful in preventing or treating pathogen infections in animals.

[0172] For example, provided herein are methods for treating an animal having a fungal infection, the methods comprising administering to the animal an effective amount of a pathogen control composition comprising a plurality of PMPs. In some examples, the methods comprise administering to the animal an effective amount of a pathogen control composition comprising a plurality of PMPs, wherein the plurality of PMPs comprise an antifungal agent. In some examples, the antifungal agent is a nucleic acid that inhibits expression of a fungal gene (e.g., filament growth-promoting protein (EFG1)) that causes the fungal infection. In some examples, the fungal infection is caused by Candida albicans. In some examples, the composition comprises PMPs produced from Arabidopsis apoplastic EVs. In some examples, the methods reduce or substantially eliminate the fungal infection.

[0173] In another aspect, provided herein are methods of treating an animal having a bacterial infection, the methods comprising administering to the animal an effective amount of a pathogen control composition comprising a plurality of PMPs. In some examples, the methods comprise administering to the animal an effective amount of a pathogen control composition comprising a plurality of PMPs, wherein the plurality of PMPs comprise an antibacterial agent (e.g., amphotericin B). In some examples, the bacteria are Streptococcus species, Pneumococcus species, Pseudomonas species, Shigella species, Salmonella species, Campylobacter species, or Escherichia species. In some examples, the composition comprises PMPs produced from Arabidopsis apoplastic EVs. In some examples, the methods reduce or substantially eliminate the bacterial infection. In some examples, the animal is a human, a veterinary subject, or a livestock animal.

[0174] The present methods are useful for treating animal infections (e.g., those caused by animal pathogens), which refers to administering a treatment to an animal already suffering from a disease to improve or stabilize the animal's condition. This can include reducing pathogen colonization by one or more pathogens in, on, or around the animal compared to the initial amount (e.g., by about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%) and / or conferring a benefit to the individual (e.g., a reduction in colonization sufficient to alleviate symptoms). In such instances, the treated infection can manifest as a reduction in symptoms (e.g., by about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100%). In some cases, the compositions and methods are effective in increasing the chances of survival of an individual (e.g., about a 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase) or increasing the overall survival rate of a population (e.g., about a 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% increase). For example, the compositions and methods can be effective in "substantially eliminating" the infection, which refers to a reduction in the infection sufficient to sustainably alleviate symptoms in the animal (e.g., for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months).

[0175] The methods are useful for preventing infection (e.g., caused by animal pathogens), which refers to preventing an increase in colonization by one or more pathogens in, on, or around an animal in an amount sufficient to maintain an initial pathogen population (e.g., roughly the amount present in a healthy individual) (e.g., about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or greater than 100%), preventing the onset of infection, and / or preventing symptoms or conditions associated with infection. For example, individuals can receive prophylactic treatment to prevent fungal infection while preparing for an invasive medical procedure (e.g., preparing for surgery such as receiving a transplant, stem cell therapy, graft, prosthesis, long-term or frequent intravenous catheterization, or treatment in an intensive care unit), in immunocompromised individuals (e.g., individuals with cancer, HIV / AIDS, or taking immunosuppressants) or individuals undergoing long-term antibiotic therapy.

[0176] The pathogen control composition can be formulated for or administered by any suitable method, including, for example, intravenously, intramuscularly, subcutaneously, intradermally, transdermally, intra-arterially, intraperitoneally, intralesionally, intracranially, intra-articularly, prostatically, intrapleurally, intratracheally, intrathecally, intranasally, intravaginally, intrarectally, topically, intratumorally, intraperitoneally, subconjunctivally, intravesically, mucosally, intrapericardially, intraumbilically, intraocularly, intraorbitally, orally, topically, transdermally, intravitreally (e.g., by intravitreal injection), by eye drops, by inhalation, by injection, by implantation, by infusion, by continuous infusion, by direct application of target cells to a localized perfusion bath, by catheter, by lavage, in a cream or lipid composition. The compositions used in the methods described herein can also be administered systemically or locally. The method of administration can vary depending on various factors, such as the compound or composition being administered and the severity of the condition, disease, or disorder being treated. In some examples, the pathogen control composition is administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intracranially, intraventricularly, or intranasally. Administration can be by any suitable route, for example, injection, such as intravenous or subcutaneous injection, depending in part on whether administration is brief or chronic. A variety of administration schedules are contemplated herein, including, but not limited to, a single dose or multiple doses at various time points, a bolus dose, and a pulse infusion.

[0177] The dosage for preventing or treating an infection described herein (when used alone or in combination with one or more other additional therapeutic agents) can vary depending on the type of disease being treated, the severity and course of the disease, whether it is administered for prophylactic or therapeutic purposes, previous treatments, the patient's medical history, and the patient's response to the pathogen control composition. The pathogen control composition can be administered to the patient, for example, once or over a series of treatments. For repeated administration over several days or longer, treatment will generally be sustained until a desired suppression of disease symptoms occurs or infection is no longer detectable, depending on the condition. Such doses can be administered intermittently, for example, weekly or biweekly (e.g., such that the patient receives, for example, about 2 to about 20 doses of the pathogen control composition). An initial, relatively high dose can be followed by one or more lower doses. However, other dosing regimens may also be useful. The progress of this therapy is easily monitored by conventional techniques and assays.

[0178] In some examples, the amount of the pathogen control composition administered to an individual (e.g., a human) can be in the range of about 0.01 mg / kg to about 5 g / kg of the individual's body weight (e.g., about 0.01 mg / kg to 0.1 mg / kg, about 0.1 mg / kg to 1 mg / kg, about 1 mg / kg to 10 mg / kg, about 10 mg / kg to 100 mg / kg, about 100 mg / kg to 1 g / kg, or about 1 g / kg to 5 g / kg). In some examples, the amount of the pathogen control composition administered to an individual (e.g., a human) is at least 0.01 mg / kg of the individual's body weight (e.g., at least 0.01 mg / kg, at least 0.1 mg / kg, at least 1 mg / kg, at least 10 mg / kg, at least 100 mg / kg, at least 1 g / kg, or at least 5 g / kg). The dose can be administered as a single dose or multiple doses (e.g., 2, 3, 4, 5, 6, 7, or 8 or more doses). In some cases, the pathogen control composition administered to the animal can be administered alone or in combination with an additional therapeutic or pathogen control agent. The dose of the antibody administered in combination therapy can be lower compared to monotherapy. The progress of this therapy is easily monitored by conventional techniques.

[0179] III. Agricultural methods The pathogen control compositions described herein are useful in a variety of agricultural methods, particularly for preventing or treating pathogen infections in animals and for inhibiting the spread of such pathogens, for example, by pathogen vectors. The methods include delivering a pathogen control composition described herein to a pathogen or pathogen vector.

[0180] The compositions and related methods can be used to prevent infestation by or reduce the numbers of pathogens or pathogen vectors in any habitat where a pathogen or pathogen vector is normally present, such as external to an animal, for example, on a plant, on a plant part (e.g., roots, fruit, and seeds), in or on the soil, in water, or in another pathogen or pathogen vector habitat. Thus, the compositions and methods can reduce the harmful effects of a pathogen vector by killing, impairing, or slowing the activity of the vector, thereby inhibiting the spread of the pathogen to an animal. The compositions disclosed herein can be used to control, kill, impair, paralyze, or reduce one or more activities of any pathogen or pathogen vector in any developmental stage, such as their egg, nymph, instar, larva, adult, juvenile, or dry form. Details of each of these methods are described further below.

[0181] A. Delivery to Pathogens Provided herein are methods of delivering a pathogen control composition to a pathogen, such as those disclosed herein, by contacting the pathogen with the pathogen control composition. The methods can be useful, for example, in preventing or treating pathogen infection or reducing the fitness of the pathogen to control the spread of the pathogen as a result of delivery of the pathogen control composition. Examples of pathogens that can be targeted in accordance with the methods described herein include bacteria (e.g., Streptococcus spp., Pneumococcus spp., Pseudomonas spp., Shigella spp., Salmonella spp., Campylobacter spp., or Escherichia spp.), fungi (Saccharomyces spp. or Candida spp.), parasitic insects (e.g., Cimex spp.), parasitic nematodes (e.g., Heligmosomoides spp.), or parasitic protozoa (e.g., Trichomonas spp.).

[0182] For example, provided herein are methods of reducing the fitness of a pathogen, the methods comprising delivering any of the compositions described herein to the pathogen, wherein the method reduces the fitness of the pathogen relative to an untreated pathogen. In some embodiments, the methods comprise delivering the composition to at least one habitat where the pathogen grows, lives, reproduces, feeds, or infests. In some examples of the methods described herein, the composition is delivered as a pathogen-edible composition for ingestion by the pathogen. In some examples of the methods described herein, the composition is delivered (e.g., to the pathogen) as a liquid, solid, aerosol, paste, gel, or gas.

[0183] Also provided herein is a method for reducing the fitness of a parasitic insect, the method comprising delivering a pathogen control composition comprising a plurality of PMPs to the parasitic insect. In some examples, the method comprises delivering a pathogen control composition comprising a plurality of PMPs to the parasitic insect, wherein the plurality of PMPs comprises an insecticide. For example, the parasitic insect may be a bedbug. Other non-limiting examples of parasitic insects are described herein. In some examples, the method reduces the fitness of the parasitic insect relative to an untreated parasitic insect.

[0184] Additionally, provided herein is a method for reducing the fitness of a parasitic nematode, the method comprising delivering a pathogen control composition to the parasitic nematode, the pathogen control composition comprising a plurality of PMPs. In some examples, the method comprises delivering a pathogen control composition to the parasitic nematode, the plurality of PMPs comprising a nematicide. For example, the parasitic nematode is Heligmosomoides polygyrus. Other non-limiting examples of parasitic nematodes are described herein. In some examples, the method reduces the fitness of the parasitic nematode relative to an untreated parasitic nematode.

[0185] Also provided herein is a method for reducing the fitness of a parasitic protozoan, the method comprising delivering a pathogen control composition comprising a plurality of PMPs to the parasitic protozoan. In some examples, the method comprises delivering a pathogen control composition comprising a plurality of PMPs to the parasitic nematode, wherein the plurality of PMPs comprises an antiparasitic agent. For example, the parasitic protozoan is Trichomonas vaginalis (T. vaginalis). Other non-limiting examples of parasitic protozoans are described herein. In some examples, the method reduces the fitness of the parasitic protozoan relative to an untreated parasitic protozoan.

[0186] The reduction in the fitness of a pathogen as a result of delivery of a pathogen control composition can manifest in several ways. In some examples, the reduction in the fitness of a pathogen can manifest as a deterioration or decline in the physiological function of the pathogen (e.g., a reduction in health or survival rate) as a result of delivery of the pathogen control composition. In some examples, the fitness of an organism can be measured by one or more parameters, including but not limited to, reproductive rate, fecundity, lifespan, viability, mobility, fecundity, pathogen development, body weight, metabolic rate or activity, or survival rate, compared to a pathogen to which the pathogen control composition has not been administered. For example, the methods or compositions described herein can be effective in reducing the overall health of a pathogen or reducing the overall survival rate of a pathogen. In some examples, the reduction in pathogen viability is about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% compared to a reference level (e.g., a level seen in a pathogen that has not received the pathogen control composition). In some examples, the method or composition is effective to reduce the reproduction (e.g., reproduction rate, fecundity) of the pathogen compared to a pathogen that has not received a pathogen control. In some examples, the method or composition is effective to reduce other physiological parameters such as mobility, body weight, lifespan, fecundity, or metabolic rate by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% compared to a reference level (e.g., a level seen in a pathogen that has not received the pathogen control composition).

[0187] In some examples, the reduction in pest fitness may manifest as increased susceptibility of the pathogen to the antipathogenic agent and / or decreased resistance of the pathogen to the antipathogenic agent compared to a pathogen to which the pathogen control composition has not been delivered. In some examples, the methods or compositions described herein may be effective to increase the susceptibility of a pathogen to a pathogen control agent by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% compared to a reference level (e.g., the level seen in a pathogen that has not received the pathogen control composition).

[0188] In some examples, reduced pathogen fitness may manifest as other fitness disadvantages, such as reduced tolerance to a particular environmental factor (e.g., high or low temperature tolerance), reduced ability to survive in a particular habitat, or reduced ability to persist on a particular diet, compared to a pathogen to which the composition has not been delivered. In some examples, a method or composition described herein may be useful for reducing pathogen fitness in any number of ways described herein. Furthermore, a pathogen control composition may reduce pathogen fitness for any number of pathogen classes, orders, families, genera, or species (e.g., 1 pathogen species, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 200, 250, 500, or more pathogen species). In some examples, the pathogen control composition acts on a single pathogen class, order, family, genus, or species.

[0189] Pathogen fitness can be determined by any standard method in the art.In some cases, pest fitness can be determined by evaluating individual pathogens.Alternatively, pest fitness can be determined by evaluating pathogen populations.For example, a decrease in pathogen fitness can be manifested as a decrease in the success of competition with other pathogens, which can lead to a decrease in pathogen population size.

[0190] B. Delivery to Pathogen Vectors Provided herein are methods for delivering a pathogen control composition to a pathogen vector, such as those disclosed herein, by contacting the pathogen with the pathogen control composition. The methods can be useful, for example, in reducing the fitness of the pathogen vector as a result of delivery of the pathogen control composition, in order to control the spread of the pathogen. Examples of pathogens that can be targeted according to the methods described herein include insects, such as those described in Section IV.G.

[0191] For example, provided herein are methods of reducing the fitness of an animal pathogen vector, the methods comprising delivering an effective amount of any of the compositions described herein to the vector, wherein the method reduces the fitness of the vector relative to an untreated vector. In some examples, the methods comprise delivering the composition to at least one habitat where the vector grows, lives, reproduces, feeds, or infests. In some examples, the composition is delivered as an edible composition for ingestion by the vector. In some examples, the vector is an insect. In some examples, the insect is a mosquito, tick, mite, or louse. In some examples, the composition is delivered as a liquid, solid, aerosol, paste, gel, or gas.

[0192] For example, provided herein are methods for reducing the fitness of an insect vector of an animal pathogen, the methods comprising delivering to the vector a pathogen control composition comprising a plurality of PMPs. In some examples, the methods comprise delivering to the vector a pathogen control composition comprising a plurality of PMPs, wherein the plurality of PMPs comprise an insecticide. For example, the insect vector is a mosquito, tick, mite, or louse. Other non-limiting examples of pathogen vectors are described herein. In some examples, the methods reduce the fitness of the vector compared to an untreated vector.

[0193] In some examples, reduced vector fitness can manifest as a deterioration or decline in the physiological function of the vector (e.g., reduced health or viability) as a result of administration of the composition. In some examples, the fitness of the organism can be measured by one or more parameters, including, but not limited to, reproductive rate, lifespan, mobility, fecundity, body weight, metabolic rate or activity, or survival rate, compared to a vector to which the composition has not been delivered. For example, a method or composition described herein can be effective to reduce the overall health of the vector or reduce the overall viability of the vector. In some examples, the reduction in vector viability is about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than 100% compared to a reference level (e.g., a level observed in a vector not receiving the composition). In some examples, the method or composition is effective to reduce vector reproduction (e.g., reproductive rate) compared to a vector organism to which the composition has not been administered. In some examples, the method or composition is effective to reduce other physiological parameters such as mobility, body weight, lifespan, fecundity or metabolic rate by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or more than 100% compared to a reference level (e.g., a level seen with a vector in which the composition is not delivered).

[0194] In some examples, the reduction in vector fitness may manifest as increased susceptibility of the vector to a pesticide and / or reduced resistance of the vector to a pesticide compared to a vector organism to which the composition has not been delivered. In some examples, the methods or compositions described herein may be effective to increase the susceptibility of the vector to a pesticide by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% compared to a reference level (e.g., the level observed in a vector that has not received the composition). The pesticide may be any pesticide known in the art, including insecticides. In some examples, the methods or compositions described herein may increase the susceptibility of the vector to a pesticide by reducing the vector's ability to metabolize or degrade the pesticide into usable substrates compared to a vector to which the composition has not been delivered.

[0195] In some examples, reduced vector fitness may manifest as other fitness disadvantages, such as reduced tolerance to certain environmental factors (e.g., high or low temperature tolerance), reduced ability to survive in a particular habitat, or reduced ability to sustain a particular diet, compared to a vector organism to which the composition has not been delivered. In some examples, the methods or compositions described herein may be useful for reducing vector fitness in any number of ways described herein. Furthermore, the compositions may reduce vector fitness for any number of vector classes, orders, families, genera, or species (e.g., 1 vector species, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 200, 250, 500, or more vector species). In some examples, the composition acts on a single vector class, order, family, genus, or species.

[0196] Vector fitness can be determined by any standard method in the art. In some cases, vector fitness can be determined by evaluating individual vectors. Alternatively, vector fitness can be determined by evaluating vector populations. For example, a decrease in vector fitness can be manifested as a decrease in success in competing with other vectors, which can lead to a decrease in vector population size.

[0197] By reducing the fitness of vectors carrying animal pathogens, the compositions described herein are effective in reducing the spread of vector-borne diseases. Using any of the formulations and delivery methods described herein, the compositions can be delivered to insects in an amount and for a time effective to reduce disease transmission, e.g., reduce vertical or horizontal transmission between vectors and / or reduce transmission to animals. For example, the compositions described herein may reduce vertical or horizontal transmission of vector-borne pathogens by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% compared to a vector organism to which the composition has not been delivered. As another example, the compositions described herein may reduce vector competition for insect vectors by about 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% compared to a vector organism to which the composition has not been delivered.

[0198] Non-limiting examples of diseases that may be controlled by the compositions and methods described herein include diseases caused by Togaviridae viruses (e.g., chikungunya fever, Ross River fever, Mayaro fever, O'nyong-nyong fever, Sindbis fever, Eastern equine encephalitis, Western equine encephalitis, Venezuelan equine encephalitis, or Barmah Forest virus). diseases caused by Flaviviridae viruses (e.g., dengue fever, yellow fever, Kyasanur Forest disease, Omsk hemorrhagic fever, Japanese encephalitis, Murray Valley encephalitis, Rocio, St. Louis encephalitis, West Nile encephalitis, or tick-borne encephalitis); diseases caused by Bunyaviridae viruses (e.g., sandfly fever, Rift Valley fever, La Crosse encephalitis, California encephalitis, Crimean-Congo hemorrhagic fever, or Oropouche fever); diseases caused by Rhabdoviridae viruses (e.g., vesicular stomatitis); diseases caused by Orbiviridae viruses (e.g., bluetongue); diseases caused by bacteria (e.g., plaque, tularemia, Q fever, Rocky Mountain spotted fever, Murine typhus, Button fever, Queensland tick typhus, Siberian tick typhus, Scrub typhus, Relapsing fever or Lyme disease); or diseases caused by protozoa (e.g., malaria, African trypanosomiasis, Nagana, Chagas disease, leishmaniasis, piroplasmosis, Bancroftian filariasis or Brugia filariasis).

[0199] C. Application method A pathogen or pathogen vector described herein can be exposed to any of the compositions described herein in any suitable manner that allows for delivery or administration of the composition to the pathogen or pathogen vector. The pathogen control composition can be delivered either alone or in combination with other active substances (e.g., pesticides) or inactive substances, and can be applied, for example, by spraying, microinjection, plant-directed injection, pouring, or immersion in the form of a concentrate, gel, solution, suspension, spray, powder, pellet, briquette, brick, or the like formulated to deliver an effective concentration of the pathogen control composition. The application rate and site of application of the compositions described herein are generally determined by the behavior of the pathogen or pathogen vector, the life cycle stage at which the pathogen or pathogen vector can be targeted by the pathogen control composition, the site at which application is to be made, and the physical and functional properties of the pathogen control composition. The pathogen control compositions described herein can be administered to a pathogen or pathogen vector by oral ingestion, but can also be administered by any means that allows penetration through the cuticle or into the respiratory system of the pathogen or pathogen vector.

[0200] In some instances, a pathogen or pathogen vector can be simply "dipped" into a solution containing the pathogen control composition, or the pathogen or pathogen vector can be "sprayed" with the solution. Alternatively, the pathogen control composition can be linked to a feed component (e.g., edible matter) of the pathogen or pathogen vector to facilitate delivery and / or increase uptake of the pathogen control composition by the pest. Oral introduction methods can include, for example, directly mixing the pathogen control composition with the feed of the pathogen or pathogen vector, spraying the pathogen control composition over the habitat or field of the pathogen or pathogen vector, and engineering the seeds used as feed to express the pathogen control composition, which is then fed to the pathogen or pathogen vector to be affected. In some instances, for example, the pathogen control composition can be incorporated into or sprayed on the feed of the pathogen or pathogen vector. For example, the pathogen control composition can be sprayed over a crop field inhabited by a pathogen or pathogen vector.

[0201] In some examples, the composition is sprayed directly onto a plant, e.g., a crop, for example, by backpack application, aerial application, crop spray / dusting, etc. In examples in which the pathogen control composition is delivered to a plant, the plant receiving the pathogen control composition can be at any stage of plant growth. For example, the formulated pathogen control composition can be applied as a seed coating or root treatment early in plant growth, or as a whole plant treatment later in the crop cycle. In some examples, the pathogen control composition can be applied to a plant as a topical agent, allowing pathogens or pathogen vectors to come into contact with the plant when feeding on or otherwise interacting with the plant.

[0202] Additionally, the pathogen control composition can be applied systemically (e.g., in the soil in which the plant grows or in the water used to water the plant) to be absorbed and distributed through the tissues of the plant or animal pathogen or pathogen vector, thereby causing the pathogen or pathogen vector feeding on it to ingest an effective dose of the pathogen control composition. In some instances, the plant or feed organism can be genetically transformed to express the pathogen control composition, thereby causing the pathogen or pathogen vector feeding on the plant or feed organism to ingest the pathogen control composition.

[0203] Delayed or continuous release can also be achieved by coating the pathogen control composition or a composition containing one or more pathogen control compositions with a dissolvable or bioerodible coating layer, such as gelatin, which dissolves or degrades in the environment of use, thereby making the pathogen control composition available, or by dispersing the agent in a dissolvable or degradable matrix. Advantageously, such continuous release and / or dispensing means devices can be used to consistently maintain effective concentrations of one or more pathogen control compositions described herein within a particular pathogen or pathogen vector habitat.

[0204] The pathogen control composition can also be incorporated into a medium in which a pathogen or pathogen vector grows, inhabits, reproduces, feeds, or infests. For example, the pathogen control composition can be incorporated into a feed container, a feeding area, a protective wrapping material, or a nest box. In some applications, the pathogen control composition can be applied in powder form or bound to a solid support for application to a trap or a feeding area. For example, in applications in which the composition is used in a trap or as bait for a specific pathogen or pathogen vector, the composition can be bound to a solid support or encapsulated in a time-release material. For example, the compositions described herein can be administered by delivering the composition to at least one habitat in which an agricultural pathogen or pathogen vector grows, inhabits, reproduces, or feeds.

[0205] Pesticides are often recommended for field applications as the amount of pesticide per hectare (g / ha or kg / ha) or the amount of active ingredient or acid equivalent per hectare (kg ai / ha or ai / ha). In some cases, a lower amount of pesticide may be required to be applied to the soil, plant medium, seed plant tissue, or plant in the present composition to achieve the same results as when the pesticide is applied without a PMP in the composition. For example, the amount of pesticide may be applied at a level about 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 50, or 100 times (or any range from about 2 to about 100 times, e.g., about 2-10 times; about 5-15 times; about 10-20 times; about 10-50 times) lower than the same pesticide applied in a non-PMP composition, for example, a direct application of the same pesticide. The pathogen control compositions disclosed herein can be applied in various amounts per hectare, such as about 0.0001, 0.001, 0.005, 0.01, 0.1, 1, 2, 10, 100, 1,000, 2,000, or 5,000 (or any range from about 0.0001 to 5,000) kg / ha, for example, about 0.0001 to about 0.01, about 0.01 to about 10, about 10 to about 1,000, or about 1,000 to about 5,000 kg / ha.

[0206] IV. Pathogens or their vectors The pathogen control compositions and related methods described herein are useful for reducing the fitness of animal pathogens, thereby treating or preventing infection in animals. Examples of animal pathogens or their vectors that can be treated with the pathogen control compositions or related methods are further described herein.

[0207] A. Fungi The pathogen control compositions and related methods can be useful, for example, in reducing the fitness of fungi to prevent or treat fungal infections in animals. Included are methods of delivering the pathogen control composition to a fungus by contacting the pathogen control composition with the fungus. Additionally or alternatively, the methods include administering the pathogen control composition to the animal to prevent or treat a fungal infection (e.g., caused by a fungus described herein) in an animal at risk of or in need of a fungal infection.

[0208] Pathogen control compositions and related methods include those directed against fungal pathogens from the phylum Ascomycota (Fusarium oxysporum, Pneumocystis jirovecii, Aspergillus spp., Coccidioides immitis / posadasii, Candida albicans), Basidiomycota (Filobasidiella neoformans, Trichosporon), Microsporidia (Encephalitozoon cuniculi, Enterocytozoon bienui), and the phylum Enterocytozoon spp. The present invention is suitable for the treatment or prevention of fungal infections in animals, including infections caused by fungi belonging to the subphylum Mucoromycotina (Mucor circinelloides, Rhizopus oryzae, Lichtheimia corymbifera).

[0209] In some cases, the fungal infection is caused by a fungus belonging to the following phyla: Ascomycota, Basidiomycota, Chytridiomycota, Microsporidia, or Zygomycota. The fungal infection or overgrowth may be caused by one or more fungal species, such as Candida albicans, C. tropicalis, C. parapsilosis, C. glabrata, C. auris, C. krusei, Saccharomyces cerevisiae, Malassezia globose, M. restricta, or Debaryomyces hansenii, Gibberella moniliformis, Alternaria brassicicola, Cryptococcus neoformans, or the like. These fungal species may include Pneumocystis neoformans, Pneumocystis carinii, P. jirovecii, P. murina, P. oryctolagi, P. wakefieldiae, and Aspergillus clavatus. These fungal species may be considered pathogens or opportunistic pathogens.

[0210] In some cases, the fungal infection is caused by the genus Candida (i.e., Candida infection). For example, the Candida infection can be caused by a fungus of the genus Candida selected from the group consisting of C. albicans, C. glabrata, C. dubliniensis, C. krusei, C. auris, C. parapsilosis, C. tropicalis, C. orthopsilosis, C. guilliermondii, C. rugose and C. lusitaniae. Candida infections that can be treated by the methods disclosed herein include, but are not limited to, Candida bacteremia, oropharyngeal candidiasis, esophageal candidiasis, mucosal candidiasis, genital candidiasis, vulvovaginal candidiasis, rectal candidiasis, hepatic candidiasis, renal candidiasis, pulmonary candidiasis, splenic candidiasis, otomycosis, osteomyelitis, septic arthritis, cardiovascular candidiasis (e.g., endocarditis), and invasive candidiasis.

[0211] B. Bacteria The pathogen control compositions and related methods can be useful, for example, in reducing bacterial fitness to prevent or treat bacterial infections in animals. Included are methods of delivering a pathogen control composition to bacteria by contacting the pathogen control composition with the bacteria. Additionally or alternatively, the methods include administering the pathogen control composition to the animal to prevent or treat bacterial infections (e.g., caused by bacteria described herein) in an animal at risk of or in need of bacterial infection.

[0212] The pathogen control compositions and related methods are suitable for preventing or treating bacterial infections in animals caused by any of the bacteria described further below. For example, the bacteria can belong to the following orders: Bacillales (B. anthracis, B. cereus, S. aureus, L. monocytogenes), Lactobacillales (S. pneumoniae, S. pyogenes), Clostridiales (C. botulinum, C. difficile, C. perfringens, C. tetani), Spirochaetales (Borrelia burgdorferi, Treponema pallidum), pallidum), Chlamydiales (Chlamydia trachomatis, Chlamydophila psittaci), Actinomycetales (C. diphtheriae, Mycobacterium tuberculosis, M. avium), Rickettsiales (R. prowazekii, R. rickettsii, R. typhi, A. phagocytophilum, E. chaffeensis), Rhizobiales (Brucella melitensis) melitensis), Burkholderiales (Bordetella pertussis, Burkholderia mallei, B. pseudomallei),pseudomallei), Neisseriales (Neisseria gonorrhoeae, N. meningitidis), Campylobacterales (Campylobacter jejuni, Helicobacter pylori), Legionellales (Legionella pneumophila), Pseudomonadales (A. baumannii, Moraxella catarrhalis, P. aeruginosa), Aeromonadales (Aeromonas species), Vibrionales (Vibrio cholerae) cholerae, V. parahaemolyticus), Thiotrichales, Pasteurellales (Haemophilus influenzae), Enterobacteriales (Klebsiella pneumoniae, Proteus mirabilis, Yersinia pestis, Y. enterocolitica, Shigella flexneri, Salmonella enterica, E. coli).

[0213] In some instances, the bacterium is Pseudomonas aeruginosa or Escherichia coli.

[0214] C. Parasitic insects The pathogen control compositions and related methods may be useful, for example, for reducing the fitness of parasitic insects to prevent or treat parasitic insect infections in animals. The term "insect" includes any organism belonging to the phylum Arthropoda and the class Insecta or class Arachnida, in any developmental stage, i.e., larvae and adults. Included are methods of delivering a pathogen control composition to an insect by contacting the insect with the pathogen control composition. Additionally or alternatively, the method includes administering the pathogen control composition to the animal to prevent or treat parasitic insect infections (caused by the parasitic insects described herein) in an animal at risk or in need thereof.

[0215] The pathogen control compositions and related methods are suitable for preventing or treating infestations of animals by parasitic insects, including infestations by insects belonging to the following orders: Phthiraptera: Anoplura (blood-sucking lice), Ischnocera (chewing lice), Amblycera (chewing lice); Siphonaptera: Pulicidae (Cat fleas); Family: Ceratophyllidae (Chicken-fleas). Family: Diptera: Culicidae (Mosquitoes), Ceratopogonidae (Midges), Family: Psychodidae (Sandflies), Family: Simuliidae (Blackflies), Family: Tabanidae (Horse-flies), Family: Muscidae (House-flies). Family: Calliphoridae (Blowflies), Family: Glossinidae (Tsetse-flies), Family: Oestridae (Bot-flies), Family: Hippoboscidae (Louse-flies). Order: Hemiptera: Reduviidae (Assassin-bugs), Family: Cimicidae (Bed-bugs).Arachnida: Sarcoptidae (Sarcoptic mites), Psoroptidae (Psoroptic mites), Cytoditidae (Air-sac mites), Laminosioptes (Cyst mites), Analgidae (Feather mites), Acaridae (Grain mites), Demodicidae (Hair follicle mites) mites), Cheyletiellidae (Fur-mites, Trombiculidae (Trombiculids), Dermanyssidae (Bird mites), Macronyssidae (Bird mites), Argasidae (Soft-ticks), Ixodidae (Hard-ticks).

[0216] D. Protozoa The pathogen control compositions and related methods can be useful, for example, in reducing the fitness of parasitic protozoa to prevent or treat parasitic protozoan infections in animals. The term "protozoan" includes any organism belonging to the phylum Protozoa. Included are methods of delivering a pathogen control composition to a parasitic protozoan by contacting the pathogen control composition with the parasitic protozoan. Additionally or alternatively, the methods include administering a pathogen control composition to the animal to prevent or treat a protozoan infection (caused by a protozoan as described herein) in an animal at risk or in need thereof.

[0217] The pathogen control compositions and related methods are suitable for preventing or treating infections in animals with protozoan parasites, including protozoa belonging to the following orders: Euglenozoa (Trypanosoma cruzi, Trypanosoma brucei, Leishmania spp.), Heterolobosea (Naegleria fowleri), Diplomonadida (Giardia intestinalis), Amoebozoa (Acanthamoeba castellanii, Balamuthia mandrillaris, Entamoeba histolytica), and the like. histolytica), Blastocystis (Blastocystis hominis), Apicomplexa (Babesia microti, Cryptosporidium parvum, Cyclospora cayetanensis, Plasmodium species, Toxoplasma gondii).

[0218] E. elegans The pathogen control compositions and related methods can be useful, for example, for reducing the fitness of parasitic nematodes to prevent or treat parasitic nematode infections in animals. Included are methods of delivering a pathogen control composition to a parasitic nematode by contacting the parasitic nematode with the pathogen control composition. Additionally or alternatively, the methods include administering a pathogen control composition to the animal to prevent or treat a parasitic nematode infection (caused by a parasitic nematode described herein) in an animal at risk or in need thereof.

[0219] The pathogen control compositions and related methods are suitable for preventing or treating infections in animals with parasitic nematodes, including nematodes belonging to the phylum Nematoda (roundworms): Angiostrongylus cantonensis (rat lungworm), Ascaris lumbricoides (human roundworm), Baylisascaris procyonis (raccoon roundworm), Trichuris trichiura (human whipworm), Trichinella spiralis, Strongyloides stercoralis, Wuchereria bancrofti, Brugia malayi malayi, Ancylostoma duodenale and Necator americanus (human hookworms), Cestoda (tapeworms): Echinococcus granulosus, Echinococcus multilocularis, Taenia solium (pork tapeworm).

[0220] F. Virus The pathogen control compositions and related methods can be useful, for example, in reducing the fitness of viruses to prevent or treat viral infections in animals. Included are methods of delivering a pathogen control composition to a virus by contacting the virus with the pathogen control composition. Additionally or alternatively, the methods include administering a pathogen control composition to the animal to prevent or treat viral infections (caused by the viruses described herein) in an animal at risk or in need thereof.

[0221] The pathogen control compositions and related methods are suitable for preventing or treating viral infections in animals, including infections by viruses belonging to the following families: DNA viruses: Parvoviridae, Papillomaviridae, Polyomaviridae, Poxviridae, Herpesviridae; single-stranded negative strand RNA viruses; Viruses: Arenaviridae, Paramyxoviridae (Rubulavirus, Respirovirus, Pneumovirus, Moribillivirus), Filoviridae (Marburgvirus, Ebolavirus), Bornaoviridae, Rhabdoviridae, Orthomyxoviridae, Bunyaviridae, Nairovirus, Hantavirus, Orthobunyavirus, Phlebovirus.Single-stranded positive strand RNA viruses: Astroviridae, Coronaviridae, Caliciviridae, Togaviridae (Rubivirus, Alphavirus), Flaviviridae (Hepacivirus, Flavivirus), Picornaviridae (Hepatovirus, Rhinovirus, Enterovirus); or dsRNA viruses and retro-transcribed viruses. Virus: Reoviridae (Rotavirus, Coltivirus, Seaadornavirus), Retroviridae (Deltaretrovirus, Lentivirus), Hepadnaviridae (Orthohepadnavirus).

[0222] G. Pathogen Vectors The pathogen control compositions and related methods provided herein may be useful in reducing the fitness of vectors of animal pathogens. In some examples, the vector may be an insect. For example, insect vectors include, but are not limited to, those with piercing and sucking mouthparts such as those found in the orders Hemiptera and some Hymenoptera and Diptera, such as mosquitoes, honeybees, wasps, midges, lice, tsetse flies, fleas, and ants, and members of the class Arachnidae, such as ticks and mites; orders, classes, or families of the order Acarina (ticks and mites), such as: Representatives of the families Argasidae, Dermanyssidae, Ixodidae, Psoroptidae or Sarcoptidae, as well as the following species: Amblyomma spp., Anocenton spp., Argas spp., Boophilus spp., Cheyletiel spp. la spp., Chorioptes spp., Demodex spp., Dermacentor spp., Denmanyssus spp., Haemophysalis spp., Hyalomma spp., Ixodes spp., Lynxacarus spp., Mesostigmata spp., Notoednes spp. ) species, Ornithodoros species, Ornithonyssus species, Otobius species, Otodectes species, Pneumonyssus species, Psoroptes species, Rhipicephalus species, Sancoptes species or representatives of the genus Trombicula;The order Anoplura (sucking and biting lice), for example the following species: Bovicola spp., Haematopinus spp., Linognathus spp., Menopon spp., Pediculus spp., Pemphigus spp., Phylloxera spp. or representatives of the genus Solenopotes; Diptera (Flies), for example the following species: Aedes spp., Anopheles spp., Calliphora spp., Chrysomyia spp., Chrysops spp., Cochliomyia spp., Culex spp. / ex) species, Culicoides spp., Cuterebra spp., Dermatobia spp., Gastrophilus spp., Glossina spp., Haematobia spp., Haematopota spp., Hippobosca spp., Hypod erma species, Lucilia species, Lyperosia species, Melophagus species, Oestrus species, Phaenicia species, Phlebotomus species, Phormia species, Acari (Sarcoptic mange caused by Sarcoptic mite) mange), for example Sarcoptidae species, Sarcophaga species, Simulium species, Stomoxys species, Tabanus species, Tannia species or Zzpu / alpha species; the order Mallophaga (biting lice), for example representatives of the following species: Damalina species, Felicola species, Heterodoxus species or Trichodectes species;or Siphonaptera (wingless insects), for example representatives of the following species: Ceratophyllus spp., Xenopsylla spp.; Cimicidae (hemipteran true bugs), for example representatives of the following species: Cimex spp., Tritominae spp., Rhodinius spp. or Triatoma spp.;

[0223] In some instances, the insect is a blood-sucking insect of the order Diptera (e.g., the suborder Nematocera, e.g., the family Culicidae). In some instances, the insect is of the subfamily Culicinae, Corethrinae, family Ceratopogonidae, or family Simuliidae. In some instances, the insect is of the genus Culex, Theobaldia, Aedes, Anopheles, Aedes, Forciponiyia, Culicoides, or Helea.

[0224] In a particular example, the insect is a mosquito. In a particular example, the insect is a tick. In a particular example, the insect is a mite. In a particular example, the insect is a louse.

[0225] V. Heterofunctional Drugs The pathogen control compositions described herein may further include an additional agent, such as a heterofunctional agent (e.g., an antifungal agent, an antibacterial agent, a virucide, an antivirucide, an insecticide, a nematicide, an antiparasitic agent, or an insect repellent). In some examples, the heterofunctional agent (e.g., an antifungal agent, an antibacterial agent, a virucide, an antivirucide, an insecticide, a nematicide, an antiparasitic agent, or an insect repellent) is contained in a PMP. For example, the PMP may encapsulate the heterofunctional agent (e.g., an antifungal agent, an antibacterial agent, a virucide, an antivirucide, an insecticide, a nematicide, an antiparasitic agent, or an insect repellent). Alternatively, the heterofunctional agent (e.g., an antifungal agent, an antibacterial agent, a virucide, an antivirucide, an insecticide, a nematicide, an antiparasitic agent, or an insect repellent) can be embedded in or conjugated to the surface of the PMP. In some examples, the pathogen control composition includes two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different heterofunctional agents.

[0226] In other examples, pathogen control compositions can be formulated to include heterofunctional agents (e.g., antifungals, antibacterials, virucides, antivirucides, insecticides, nematicides, antiparasitics, or insect repellents), in which case they are not necessarily combined with a PMP. In formulations and use forms prepared from these formulations, pest control compositions can include additional active compounds, such as, for example, antibacterials, insecticides, sterilants, acaricides, nematicides, molluscicides, bactericides, fungicides, virucides, attractants, or repellents.

[0227] The pesticide can be an agent suitable for delivery to a vector of an animal pathogen, such as an agricultural agent, such as an antifungal agent, an antibacterial agent, an insecticide, a molluscicide, a nematicide, a viricide, or a combination thereof. The pesticide can be a chemical, such as those known in the art. The pesticide can be any agent capable of reducing the fitness of various animal pathogens or their vectors, or can target one or more target animal pathogens or their vectors (e.g., a specific species or genus of pathogen or their vectors).

[0228] Alternatively or additionally, the heterofunctional agent (e.g., an antifungal, antibacterial, virucide, antiviral, insecticide, nematicide, antiparasitic, or insect repellent) can be a peptide, polypeptide, nucleic acid, polynucleotide, or small molecule. In some cases, the heterofunctional agent can be modified. For example, the modification can be a chemical modification, such as conjugation to a marker, such as a fluorescent marker or a radioactive marker. In other cases, the modification can include conjugation or functional linkage to a moiety that increases the stability, delivery, targeting, bioavailability, or half-life of the agent, such as a lipid, glycan, polymer (e.g., PEG), cationic moiety, or the like.

[0229] Additional examples of heterofunctional agents (e.g., antifungals, antibacterials, virucides, antivirucides, insecticides, nematicides, antiparasitics, or insect repellents) that can be used in the pathogen control compositions and methods disclosed herein are outlined below.

[0230] A. Antibacterial agents The pathogen control compositions described herein may further comprise an antibacterial agent. For example, a pathogen control composition comprising an antibiotic as described herein can be administered to an animal in an amount and for a time sufficient to achieve a target level (e.g., a predetermined or threshold level) of antibiotic concentration in or on the target animal body; and / or to treat or prevent a bacterial infection in the animal. The antibacterial agent described herein can be incorporated into the pathogen control composition for any of the methods described herein, and in certain instances, can be combined with the PMP thereof. In some examples, the pathogen control composition comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different antibacterial agents.

[0231] As used herein, the term "antimicrobial agent" refers to a substance that kills or inhibits the growth, proliferation, division, reproduction, or spread of bacteria, including plant pathogens, and includes bactericides (e.g., disinfectant compounds, antiseptics, or antibiotics) or bacteriostatic agents (e.g., compounds or antibiotics). Bactericidal antibiotics kill bacteria, while bacteriostatic antibiotics only slow their growth or reproduction.

[0232] The disinfectant may include a disinfectant, an antiseptic, or an antibiotic. The most used disinfectants may include active chlorine (i.e., hypochlorites (e.g., sodium hypochlorite), chloramine, dichloroisocyanurate and trichloroisocyanurate, liquid chlorine, chlorine dioxide, etc.), active oxygen (peroxides, e.g., peracids, potassium persulfate, sodium perborate, sodium percarbonate, and urea perhydrate), iodine (iodine (povidone iodine, Betadine), Lugol's solution, tincture of iodine, iodinated nonionic surfactants), concentrated alcohol (mainly ethanol, 1-propanol (also called n-propanol), and 2-propanol (also called isopropanol) and mixtures thereof; in addition, 2-phenoxyethanol and 1-phenoxypropanol and 2-phenoxypropanol are used), phenolic substances (e.g., phenol (also called carbonate), cresol (liquid potassium These include: halogenated (chlorinated, brominated) phenols such as hexachlorophene, triclosan, trichlorophenol, tribromophenol, pentachlorophenol, dibromol, and their salts; cationic surfactants such as some quaternary ammonium cations (e.g., benzalkonium chloride, cetyltrimethylammonium bromide or chloride, didecyldimethylammonium chloride, cetylpyridinium chloride, benzethonium chloride) and others; non-quaternary compounds such as chlorhexidine, glucoprotamine, octenidine dihydrochloride, etc.; strong oxidizing agents such as ozone and permanganate solution; heavy metals and their salts such as colloidal silver, silver nitrate, mercury chloride, phenylmercury salts, copper sulfate, copper oxide-copper chloride, copper hydroxide, copper octanoate, copper oxychloride sulfate, copper sulfate, copper sulfate pentahydrate, etc. Heavy metals and their salts are the most toxic and environmentally harmful disinfectants, so their use is strongly discouraged or canceled; in addition, suitably concentrated strong acids (phosphoric acid, nitric acid, sulfuric acid, amidosulfonic acid, toluenesulfonic acid) and alkalis (sodium hydroxide, potassium hydroxide, calcium hydroxide).As antiseptics (i.e. antimicrobial agents that can be used on the human or animal body, skin, mucous membranes, wounds, etc.), some of the disinfectants listed above can be used under appropriate conditions (mainly concentration, pH, temperature and toxicity to humans / animals). Among these, the following are important: appropriately diluted chlorine preparations (i.e. Dakin's solution, 0.5% sodium or potassium hypochlorite solution adjusted to pH 7-8 or 0.5-1% solution of sodium benzenesulfochloramide (chloramine B)), some iodine preparations, such as iodopovidone in various galenic preparations (ointments, solutions, wound plasters), previously Lugol's solution, peroxides such as urea perhydrate and pH-buffered 0.1-0.25% peracid solutions, alcohols with or without disinfectant additives, mainly used for skin disinfection, weak organic acids such as sorbic acid, benzoic acid, lactic acid and salicylic acid, some phenolic acid compounds such as hexachlorophene, triclosan and dibromol, and cationically active compounds such as 0.05-0.5% benzalkonium, 0.5-4% chlorhexidine, 0.1-2% octenidine solutions.

[0233] The pathogen control compositions described herein may contain an antibiotic. Any antibiotic known in the art may be used. Antibiotics are generally classified based on their mechanism of action, chemical structure, or spectrum of activity.

[0234] The antibiotics described herein can target any bacterial function or growth process and can be either bacteriostatic (e.g., slow or prevent bacterial growth) or bactericidal (e.g., kill). In some examples, the antibiotic is a bactericidal antibiotic. In some examples, the bactericidal antibiotic targets the bacterial cell wall (e.g., penicillins and cephalosporins); targets the cell membrane (e.g., polymyxins); or inhibits substantial bacterial enzymes (e.g., rifamycins, lipiarmycins, quinolones, and sulfonamides). In some examples, the bactericidal antibiotic is an aminoglycoside (e.g., kasugamycin). In some examples, the antibiotic is a bacteriostatic antibiotic. In some examples, the bacteriostatic antibiotic targets protein synthesis (e.g., macrolides, lincosamides, and tetracyclines). Other classes of antibiotics that can be used herein include cyclic lipopeptides (e.g., daptomycin), glycylcyclines (e.g., tigecycline), oxazolidinones (e.g., linezolid), or lipiarmycins (e.g., fidaxomicin). Examples of antibiotics include rifampicin, ciprofloxacin, doxycycline, ampicillin, and polymyxin B. The antibiotics described herein can have any level of target specificity (e.g., narrow or broad spectrum). In some examples, the antibiotic is a narrow-spectrum antibiotic, thus targeting a specific type of bacteria, such as gram-negative or gram-positive bacteria. Alternatively, the antibiotic is a broad-spectrum antibiotic that targets a variety of bacteria. In some examples, the antibiotic is doxorubicin or vancomycin.

[0235] Examples of antibiotics suitable for treating animals include: penicillins (amoxicillin, ampicillin, bacampicillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, oxacillin, penicillin G, cristicillin 300 A.S., Pentide, Permapen, Pfizerpen, Pfizerpen-AS, wicillin, penicillin V, piperacillin, pivamcillin, pivmecillinam, ticarcillin), cephalosporins (cefacetri Cefacetrile (cephacetrile), Cefadroxil (cefadroxyl), Cephalexin (cephalexin), Cefaloglycin (cephaloglycin), Cephalonium (cephalonium), Cephaloridine (cephalorazine) adine, Cefalotin (cephalothin), Cefapirin (cephapirin), Cefatrizine, Cefazaflour, Cefazedone, Cefazolin (cephazolin), Cephradine (cephradine), Cefroxadine, Ceftezole, Cefaclor, Cefamandole, Cefmetazole, Cefonicid, Cefotetan, Cefoxitin, Cefprozil Cefprozil (cefproxil), cefuroxime, cefzonam, cefcapene, cefdaloxime, cefdinir, cefditoren, cefatamet, cefixime, cefmenoxime, cefodizime, cefotaxime, cefpimizole, cefpodoxime, cefteram, ceftitibuten, ceftiofur, ceftiolene, ceftizoxime, ceftriaxone, cefoperazone, ceftazidime, cefclidin, cefepime, cefluprenam, cefoselis, cefozopran, cefpirome, cefquinome, ceftobiprole, ceftaroline,Cefacromezine, cephaloram, cefaparole, cefcanel, cefedrolol, cefempidone, cefetrizole, cefibitril, cefmatilen, cefmepidium, cefovecin, cefoxazole, cefrotil, cefsumide, cefuracetim, ceftioxid, concomitant medications, ceftazidime / avibactam, ceftolozane / tazobactam, monobactam (aztreonam), carbapenems (imipenem, imipenem / cilastatin, doripenem, ertapenem, meropenem, meropenem / vaborbactam), macrolides (azithromycin), lincosamides (clindamycin, lincomycin), streptogramins (pristinamycin, quinupristin / dalfopristin), aminoglycosides (amikacin, gentamicin, kanamycin, neomycin, netilmicin, paromomycin, streptomycin, tobramycin), quinolones (flumequine, nalidixic acid, oxolinic acid, piromicin, pipemidic acid, rosoxacin, second-generation Generation), ciprofloxacin, enoxacin, lomefloxacin, nadifloxacin, norfloxacin, ofloxacin, pefloxacin, rufloxacin, balofloxacin, gatifloxacin, grepafloxacin, levofloxacin, moxifloxacin, pazufloxacin, sparfloxacin, temafloxacin, tosufloxacin, besifloxacin, delafloxacin, clinafloxacin, gemifloxacin, prulifloxacin, sitafloxacin, trovafloxacin), sulfonamides (sulfamethizole, sulfamethoxacin, Toxazole, sulfisoxazole, trimethoprim-sulfamethoxazole), tetracyclines (demeclocycline, doxycycline, minocycline, oxytetracycline, tetracycline, tigecycline), others (lipopeptides, fluoroquinolones, lipoglycopeptides, cephalosporins, macrocyclics, chloramphenicol, metronidazole, tinidazole, nitrofurantoin, glycopeptides, vancomycin, teicoplanin, lipoglycopeptides, telavancin, oxazolidinone, linezolid, cycloserine-2,Rifamycin, rifampin, rifabutin, rifapentine, rifalazil, polypeptides, bacitracin, polymyxin B, tuberculosis, actinomycin, viomycin, capreomycin).

[0236] Those skilled in the art will understand that the suitable concentration of each antibiotic in the composition will vary depending on factors such as antibiotic efficacy, stability, the number of individual antibiotics, formulation, and method of application of the composition.

[0237] B. Antifungal Agents The pathogen control compositions described herein may further comprise an antifungal agent. For example, a pathogen control composition comprising an antibiotic as described herein can be administered to an animal in an amount and for a time sufficient to achieve a target level (e.g., a predetermined or threshold level) of antifungal agent concentration in or on the target animal body; and / or to treat or prevent fungal infection in the animal. The antifungal agent described herein can be incorporated into a pathogen control composition for any of the methods described herein, and in certain examples, can be combined with a PMP thereof. In some examples, the pathogen control composition comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different antifungal agents.

[0238] As used herein, the term "fungicide" or "antifungal agent" refers to a substance that kills or inhibits the growth, proliferation, division, reproduction, or spread of fungi, including fungi that are pathogenic to animals. Many different types of antifungal agents are commercially produced. Non-limiting examples of antifungal agents include: arylamides (amorolfine, butenafine, naftifine, terbinafine), imidazoles (bifonazole, butoconazole, clotrimazole, econazole, fenticonazole, ketoconazole, isoconazole, luliconazole, miconazole, omoconazole, oxiconazole, sertaconazole, sulconazole, tioconazole, terconazole); triazoles (albaconazole, efinaconazole, fluconazole, isavuconazole, itraconazole, posaconazole, benzocaine ... antifungal agents, such as benzodiazepines, benzocaine, benzophenone, benzocaine, benzoylmethanesulfonate ...

[0239] C. Insecticides The pathogen control compositions described herein may further comprise an insecticide. For example, the insecticide can reduce the fitness (e.g., reduce the growth or kill) of an insect vector of an animal pathogen. A pathogen control composition comprising an insecticide described herein can be contacted with an insect in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of insecticide concentration in or on the insect; and (b) reduce the fitness of the insect. In some examples, the insecticide can reduce the fitness (e.g., reduce the growth or kill) of a parasitic insect. A pathogen control composition comprising an insecticide described herein can be contacted with a parasitic insect or an animal infected therewith in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of insecticide concentration in or on the parasitic insect; and (b) reduce the fitness of the parasitic insect. The insecticides described herein can be formulated into a pathogen control composition for any of the methods described herein, and in certain examples can be combined with a PMP thereof. In some examples, the pathogen control composition includes two or more (eg, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different insecticides.

[0240] As used herein, the term "insecticide" or "insecticidal agent" refers to a substance that kills or inhibits the growth, reproduction, reproduction, or spread of insects, such as insect vectors of animal pathogens or parasitic insects. Non-limiting examples of insecticides are shown in Table 1. Further non-limiting examples of suitable insecticides include biological agents such as azadirachtin, Bacillus spp., Beauveria spp., codlemone, Metarhizium spp., Paecilomyces spp., thuringiensis, and Verticillium spp., hormones or pheromones, and active compounds with unknown or unclear mechanisms of action, such as fumigants (e.g., aluminum phosphide, methyl bromide, and sulfuryl fluoride), and selective antifeedants (e.g., cryolite, flonicamid, and pymetrozine). Those skilled in the art will understand that the suitable concentration of each pesticide in the composition will vary depending on factors such as pesticide efficacy, stability, the number of individual pesticides, and the method of formulation and application of the composition.

[0241] TIFF0007599412000001.tif222170

[0242] TIFF0007599412000002.tif153170

[0243] D. Nematicides The pathogen control compositions described herein may further comprise a nematicide. In some examples, the pathogen control composition comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different nematicides. For example, the nematicide can reduce the fitness of the parasitic nematode (e.g., reduce growth or kill). A pathogen control composition comprising a nematicide described herein can be contacted with a parasitic nematode or an animal infected therewith in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of nematicide concentration in or on the target nematode; and (b) reduce the fitness of the parasitic nematode. The nematicides described herein can be incorporated into a pathogen composition for any of the methods described herein, and in certain examples, can be combined with a PMP thereof.

[0244] As used herein, the term "nematicide" or "nematicidal agent" refers to a substance that kills or inhibits the growth, reproduction, reproduction, or spread of nematodes, such as parasitic nematodes. Non-limiting examples of nematicides are provided in Table 2. One of ordinary skill in the art will understand that the suitable concentration of each nematicide in the composition will vary depending on factors such as nematicide efficacy, stability, number of individual nematicides, formulation, and method of application of the composition.

[0245] TIFF0007599412000003.tif46170

[0246] E. Antiparasitic Agents The pathogen control compositions described herein may further comprise an antiparasitic agent. For example, the antiparasitic agent can reduce the fitness of a parasitic protozoan (e.g., reduce growth or kill it). A pathogen control composition comprising an antiparasitic agent described herein can be contacted with a protozoan in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of antiparasitic agent concentration in or on the protozoan or in an animal infected with it; and (b) reduce the fitness of the protozoan. This can be useful for treating or preventing parasites in animals. For example, a pathogen control composition comprising an antiparasitic agent described herein can be administered to an animal in an amount and for a time sufficient to achieve a target level (e.g., a predetermined or threshold level) of antiparasitic agent concentration in or on the animal's body; and to treat or prevent a parasitic (e.g., parasitic nematode, parasitic insect, or protozoan) infection in the animal. The antiparasitic agents described herein can be formulated into pathogen control compositions, and in certain instances, can be combined with PMPs thereof, for any of the methods described herein. In some instances, the pathogen control composition includes two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different antiparasitic agents.

[0247] As used herein, the term "antiparasitic agent" or "antiparasitic drug" refers to a substance that kills or inhibits the growth, proliferation, reproduction, or spread of parasites, such as parasitic protozoa, parasitic nematodes, or parasitic insects. Examples of antiparasitic agents include: anthelmintics (bephenium, diethylcarbamazine, ivermectin, niclosamide, piperazine, praziquantel, pyrantel, pyrvinium, benzimidazole, albendazole, flubendazole, mebendazole, thiabendazole, levamisole, nitazoxanide, monopantel, emodepside, spiroindole), scabicides (benzyl benzoate, benzyl benzoate / disulfide), and the like. Antiparasitic drugs include ram, ridan, malathion, permethrin), pediculicides (piperonyl butoxide / pyrethrin, spinosad, moxidectin), scabicides (crotamiton), antitaenids (niclosamide, plungequantel, albendazole), antiamoebics (rifampin, amphotericin B); or antiprotozoal drugs (melarsoprol, elflorniline, metronidazole, tinidazole, miltefosine, artemisinin). In certain instances, antiparasitic agents may be used to treat or prevent infection in livestock, such as levamisole, fenbendazole, oxfendazole, albendazole, moxidectin, eprinomectin, doramectin, ivermectin, or closron. Those skilled in the art will understand that the suitable concentration of each antiparasitic agent in the composition will vary depending on factors such as the efficacy of the antiparasitic agents, stability, the number of individual antiparasitic agents, and the formulation and method of application of the composition.

[0248] F. Antiviral Agents The pathogen control compositions described herein may further comprise an antiviral agent. For example, a pathogen control composition comprising an antiviral agent as described herein can be administered to an animal in an amount and for a time sufficient to achieve a target level (e.g., a predetermined or threshold level) of antiviral agent concentration in or on the animal's body; and / or to treat or prevent a viral infection in the animal. The antiviral agents described herein can be incorporated into a pathogen control composition for any of the methods described herein, and in certain examples, can be combined with a PMP thereof. In some examples, the pathogen control composition comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different antiviral agents.

[0249] As used herein, the terms "antiviral agent" or "viricide" refer to a substance that kills or inhibits the growth, proliferation, reproduction, development, or spread of viruses, such as viral pathogens that infect animals. Several agents can be used as antiviral agents, including chemicals or biological agents (e.g., nucleic acids, e.g., dsRNA).Examples of antiviral agents useful herein include: Abacavir, Acyclovir (Aciclovir), Adefovir, Amantadine, Amprenavir (Agenerase), Ampligen, Arbidol, Atazanavir, Atripla, Balavir, Cidofovir, Combivir, Dolutegravir, Darunavir, Delavirdine, Didanosine, Docosanol, Edoxudine , Efavirenz, Emtricitabine, Enfuviritide, Entecavir, Ecoliever, Famciclovir, Fomivirsen, Fosamprenavir, Foscarnet, Phosphonet, Fusion inhibitors, Ganciclovir, Ibacitabine, Imunovir, Idoxuridine, Imiquimod, Indinavir, Inosine, Integrase inhibitors, Type III interferon, Type II interferon, Type I interferon, Interferon, La Mivudine, Lopinavir, Loviride, Maraviroc, Moroxydine, Methisazone, Nelfinavir, Nevirapine, Nexavir, Nitazoxanide, Nucleoside analogues, Novir, Oseltamivir (Tamiflu), Peginterferon alpha-2a, Penciclovir, Peramivir, Pleconaril, Podophyllotoxin, Raltegravir, Ribavirin, Rimantadine, Ritonavir, Pyramidine, Saquinavir, sofosbuvir, stavudine, synergistic potentiator (antiretroviral), telaprevir, tenofovir, tenofovir disoproxil, tipranavir, trifluridine, trizivir, tromantadine, Truvada, valacyclovir (Valtrex), valganciclovir, vicriviroc, vidarabine, viramidine, zalcitabine, zanamivir (Relenza), or zidovudine. One of skill in the art will appreciate that the suitable concentration of each antiviral agent in the composition will vary depending on factors such as the efficacy and stability of the antiviral agents, the number of individual antiviral agents, the formulation, and the method of application of the composition.

[0250] G. Repellents The pathogen control compositions described herein may further comprise a repellent. For example, the repellent may repel vectors of animal pathogens, such as insects. The repellent described herein may be incorporated into the pathogen control composition for any of the methods described herein, and in certain examples, may be combined with the PMP. In some examples, the pathogen control composition comprises two or more (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, or more than 10) different repellents.

[0251] For example, a pathogen control composition comprising a repellent described herein can be contacted with an insect vector or vector habitat in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of repellent concentration; and / or (b) reduce the level of insects near or near the animal compared to a control. Alternatively, a pathogen control composition comprising a repellent described herein can be contacted with an animal in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of repellent concentration; and / or (b) reduce the level of insects near or near the animal compared to an untreated animal.

[0252] Some examples of known insect repellents include: benzyl; benzyl benzoate; 2,3,4,5-bis(butyl-2-ene)tetrahydrofurfural (MGK Relellent 11); butoxypolypropylene glycol; N-butyl acetanilide; normal-butyl-6,6-dimethyl-5,6-dihydro-1,4-pyrone-2-carboxylate (Indalone); dibutyl adipate; dibutyl phthalate; di-normal-butyl succinate (Tabatrex); N,N-dimethyl-meta-toluamide (DEET); dimethyl carbate (endo,endo)-dimethylbicyclo[2.2.1]hept-5-ene-2,3-dicarboxylate; dimethyl phthalate; 2-ethyl-2-butyl-1,3-propanediol; 2-ethyl-1,3-hexanediol (Rutgers 612); di-normal-propyl isocinchomeronate (MGK Relellent 326); 2-phenylcyclohexanol; p-methane-3,8-diol, and normal-propyl N,N-diethylsuccinamate. Other repellents include citronella oil, methyl phthalate, normal-butyl mesityl oxide oxalate, and 2-ethylhexanediol-1,3 (see Kirk-Othmer Encyclopedia of Chemical Technology, 2nd Ed., Vol. 11:724-728; and The Condensed Chemical Dictionary, 8th Ed., p756).

[0253] In some cases, the repellent is an insect repellent, including synthetic or non-synthetic insect repellents. Examples of synthetic insect repellents include methyl anthranilate and other anthranilate-based insect repellents, benzaldehyde, DEET (N,N-diethyl-m-toluamide), dimethylcarbamate, dimethyl phthalate, icaridin (i.e., picaridin, Bayrepel, and KBR3023), indalone (such as used in the "6-2-2" mixture (60% dimethyl phthalate, 20% indalone, 20% ethyl hexanediol)), IR3535 (3-[N-butyl-N-acetyl]-aminopropionic acid, ethyl ester), metofluthrin, permethrin, SS220, or tricyclodecenyl allyl ether. Examples of natural insect repellents include beautyberry (Callicarpa) leaves, birch bark, bog myrtle (Myrica Gale), catnip oil (e.g., nepetalactone), citronella oil, lemon eucalyptus (Corymbia citriodora); essential oil of e.g., p-menthane-3,8-diol (PMD)), neem oil, lemongrass, tea tree oil from tea tree (Melaleuca alternifolia) leaves, tobacco, or extracts thereof.

[0254] H. Biological Agents i. polypeptide The pathogen control compositions (e.g., PMPs) described herein can include polypeptides, such as polypeptides that are antibacterial, antifungal, insecticidal, nematicidal, antiparasitic, or virucidal. In some examples, the pathogen control compositions include a polypeptide or a functional fragment or derivative thereof that targets a pathway in a pathogen. Pathogen control compositions including a polypeptide described herein can be administered to a pathogen or its vector in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of polypeptide concentration; and (b) reduce or eliminate the pathogen. In some examples, pathogen control compositions including a polypeptide described herein can be administered to an animal having or at risk of infection by a pathogen in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of polypeptide concentration in the animal; and (b) reduce or eliminate the pathogen. The polypeptides described herein can be formulated into pathogen control compositions for any of the methods described herein, and in certain examples, can be conjugated to a PMP thereof.

[0255] Examples of polypeptides that can be used in the present invention may include enzymes (e.g., metabolic recombinases, helicases, integrases, RNAses, DNAses, or ubiquitinating proteins), pore-forming proteins, signaling ligands, cell membrane-penetrating peptides, transcription factors, receptors, antibodies, nanobodies, gene editing proteins (e.g., CRISPR-Cas systems, TALENs, or zinc fingers), riboproteins, protein aptamers, or chaperones.

[0256] Polypeptides encompassed by the present invention may include naturally occurring polypeptides or recombinantly produced variants. In some instances, a polypeptide may be a functional fragment or variant thereof (e.g., an enzymatically active fragment or variant thereof). For example, a polypeptide may be a functionally active variant of any of the polypeptides described herein that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity, e.g., over a specific region or over the entire sequence, to a polypeptide described herein or a naturally occurring polypeptide. In some examples, a polypeptide may have at least 50% (e.g., at least 50%, 60%, 70%, 80%, 90%, 95%, 97%, 99% or more) identity to a protein of interest.

[0257] The polypeptides described herein can be formulated into compositions for any of the uses described herein. The compositions disclosed herein can include any number or types (e.g., classes) of polypeptides, such as at least about one polypeptide, 2, 3, 4, 5, 10, 15, 20, or more polypeptides. The suitable concentration of each polypeptide in the composition will vary depending on factors such as polypeptide efficacy, stability, the number of individual polypeptides in the composition, and the formulation and method of application of the composition. In some examples, each polypeptide in a liquid composition is about 0.1 ng / mL to about 100 mg / mL. In some examples, each polypeptide in a solid composition is about 0.1 ng / g to about 100 mg / g.

[0258] Methods for producing polypeptides are routine in the art. See generally, Smales & James (Eds.), Therapeutic Proteins: Methods and Protocols (Methods in Molecular Biology), Humana Press (2005); and Crommelin, Sindelar & Meibohm (Eds.), Pharmaceutical Biotechnology: Fundamentals and Applications, Springer (2013).

[0259] Methods for producing polypeptides include expression in plant cells, but recombinant proteins can also be produced using insect cells, yeast, bacteria, mammalian cells, or other cells under the control of an appropriate promoter. Mammalian expression vectors can include non-transcribed elements such as an origin of replication, suitable promoters and enhancers, as well as other 5' or 3' flanking non-transcribed sequences, including necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and termination sequences. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early promoter, enhancer, splice, and polyadenylation sites, can also be used to provide other genetic elements required for expression of heterologous DNA sequences. Cloning and expression vectors suitable for use with bacterial, fungal, yeast, and mammalian cell hosts are described in Green & Sambrook, Molecular Cloning: A Laboratory Manual (Fourth Edition), Cold Spring Harbor Laboratory Press (2012).

[0260] Various mammalian cell culture systems can be used to express and produce recombinant polypeptide drugs. Examples of mammalian expression systems include CHO cells, COS cells, HeLA, and BHK cell lines. Host cell culture methods for protein therapeutic drug production are described, for example, in Zhou and Kantardjieff (Eds.), Mammalian Cell Cultures for Biologics Manufacturing (Advances in Biochemical Engineering / Biotechnology), Springer (2014). Protein purification is described in Franks, Protein Biotechnology: Isolation, Characterization, and Stabilization, Humana Press (2013); and Cutler, Protein Purification Protocols (Methods in Molecular Biology), Humana Press (2010). Protein therapeutic drug formulation is described in Meyer (Ed.), Therapeutic Protein Drug Products: Practical Approaches to Formulation in the Laboratory, Manufacturing, and the Clinic, Woodhead Publishing Series (2012).

[0261] In some examples, the pathogen control composition comprises an antibody or an antigen-binding fragment thereof. For example, the agent described herein can be an antibody that blocks or enhances the activity and / or function of a pathogen component. The antibody can act as an antagonist or agonist of a polypeptide (e.g., an enzyme or cellular receptor) in the pathogen. The production and use of antibodies against target antigens of pathogens is known in the art. For example, for methods of producing recombinant antibodies, including antibody engineering, the use of degenerate oligonucleotides, 5'-RACE, phage display, and mutagenesis; antibody testing and characterization; antibody pharmacokinetics and pharmacodynamics; antibody purification and storage; and screening and labeling techniques, see Zhiqiang An (Ed.), Therapeutic Monoclonal Antibodies: From Bench to Clinic, 1st Edition, Wiley, 2009; and Greenfield (Ed.), Antibodies: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory Press, 2013.

[0262] The pathogen control compositions described herein can include a bacteriocin, in some examples, that is naturally produced by Gram-positive bacteria, such as Pseudomonas, Streptomyces, Bacillus, Staphylococcus, or lactic acid bacteria (LAB, e.g., Lactococcus lactis). In some instances, bacteriocins are naturally produced by Gram-negative bacteria such as Hafnia alvei, Citrobacter freundii, Klebsiella oxytoca, Klebsiella pneumonia, Enterobacter cloacae, Serratia plymithicum, Xanthomonas campestris, Erwinia carotovora, Ralstonia solanacearum, or Escherichia coli. Exemplary bacteriocins include, but are not limited to, Class I-IV LAB antibiotics (such as lantibiotics), colicins, microcins, and pyocins.

[0263] The pathogen control compositions described herein may include antimicrobial peptides (AMPs). Any AMP suitable for inhibiting microorganisms can be used. AMPs are a diverse group of molecules, divided into subgroups based on their amino acid composition and structure. AMPs can be derived from or produced by any organism that naturally produces AMPs, including plant-derived (e.g., copsin), insect-derived (e.g., mastoparan, poneratoxin, cecropin, moricin, melittin), frog-derived (e.g., magainin, dermaseptin, aurein), and mammal-derived (e.g., cathelicidin, defensin, and protegrin) AMPs.

[0264] ii. Nucleic acid Numerous nucleic acids are useful in the compositions and methods described herein. The compositions disclosed herein can include any number or types (e.g., classes) of nucleic acids (e.g., DNA molecules or RNA molecules, such as mRNA, guide RNA (gRNA), or inhibitory RNA molecules (e.g., siRNA, shRNA, or miRNA), or hybrid DNA-RNA molecules), such as at least about one class or variant of nucleic acids, or two, three, four, five, ten, fifteen, twenty, or more classes or variants of nucleic acids. The appropriate concentration of each nucleic acid in the composition will vary depending on factors such as the efficacy and stability of the nucleic acids, the number of individual nucleic acids, the formulation, and the method of application of the composition. Examples of nucleic acids useful in the present invention include Dicer substrate small interfering RNA (dsiRNA), antisense RNA, small interfering RNA (siRNA), short hairpin (shRNA), microRNA (miRNA), (asymmetric interfering RNA) aiRNA, peptide nucleic acid (PNA), morpholino, locked nucleic acid (LNA), piwi-interfering RNA (piRNA), ribozyme, deoxyribozyme (DNAzyme), aptamer (DNA, RNA), circular RNA (circRNA), guide RNA (gRNA) or DNA molecule.

[0265] A pathogen control composition comprising a nucleic acid described herein can be contacted with a pathogen or its vector in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of nucleic acid concentration; and (b) reduce or eliminate the pathogen. In some examples, a pathogen control composition comprising a nucleic acid described herein can be administered to an animal having or at risk of infection by a pathogen in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of nucleic acid concentration; and (b) reduce or eliminate the pathogen. The nucleic acids described herein can be formulated into a pathogen control composition for any of the methods described herein, and in certain examples, can be combined with a PMP thereof.

[0266] (a) a nucleic acid encoding a polypeptide In some examples, the pathogen control composition includes a nucleic acid encoding a polypeptide, which may be about 10 to about 50,000 nucleotides (nt), about 25 to about 100 nt, about 50 to about 150 nt, about 100 to about 200 nt, about 150 to about 250 nt, about 200 to about 300 nt, about 250 to about 350 nt, about 300 to about 500 nt, about 10 to about 1000 nt, about 50 to about 1000 nt, about 100 to about 1000 nt, about 1000 to about 2000 nt, about 2000 to about 3000 nt, about 3000 to about 4000 nt, about 4000 to about 5000 nt, or about 50 The length may be from about 00 to about 6,000 nt, from about 6,000 to about 7,000 nt, from about 7,000 to about 8,000 nt, from about 8,000 to about 9,000 nt, from about 9,000 to about 10,000 nt, from about 10,000 to about 15,000 nt, from about 10,000 to about 20,000 nt, from about 10,000 to about 25,000 nt, from about 10,000 to about 30,000 nt, from about 10,000 to about 40,000 nt, from about 10,000 to about 45,000 nt, from about 10,000 to about 50,000 nt, or any range therebetween.

[0267] Pathogen control compositions can also include functionally active variants of a nucleic acid sequence of interest. In some examples, the nucleic acid variant has, for example, at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to the sequence of the nucleic acid of interest across a specified region or across the entire sequence. In some examples, the invention includes functionally active polypeptides encoded by nucleic acid variants as described herein. In some examples, a functionally active polypeptide encoded by a nucleic acid variant has, for example, at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity to a polypeptide sequence of interest or a naturally occurring polypeptide sequence over a specified region or over the entire amino acid sequence.

[0268] Some methods for expressing nucleic acids encoding proteins can include expression in cells, including insect, yeast, plant, bacterial, or other cells, under the control of an appropriate promoter. Expression vectors can include non-transcribed elements such as an origin of replication, suitable promoters and enhancers, as well as other 5' or 3' flanking non-transcribed sequences, including necessary ribosome binding sites, polyadenylation sites, splice donor and acceptor sites, and termination sequences. DNA sequences derived from the SV40 viral genome, such as the SV40 origin, early promoter, enhancer, splice, and polyadenylation sites, can also be used to provide other genetic elements required for expression of heterologous DNA sequences. Suitable cloning and expression vectors for use with bacterial, fungal, yeast, and mammalian cell hosts are described in Green et al., Molecular Cloning: A Laboratory Manual, Fourth Edition, Cold Spring Harbor Laboratory Press, 2012.

[0269] Genetic modification using recombinant methods is known in the art. A nucleic acid sequence encoding a desired gene can be obtained using recombinant methods known in the art, for example, by screening a library from cells that express the gene, by introducing the gene from a vector known to contain it, or by directly isolating it from cells and tissues containing it using standard techniques. Alternatively, the gene of interest can be produced synthetically rather than cloned.

[0270] Expression of natural or synthetic nucleic acids is typically achieved by operably linking a nucleic acid encoding a gene of interest to a promoter and incorporating the construct into an expression vector. Expression vectors may be suitable for replication and integration in bacteria. Expression vectors may also be suitable for replication and expression in eukaryotes. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and a promoter useful for expressing the desired nucleic acid sequence.

[0271] Additional promoter elements, such as enhancers, regulate the frequency of transcription initiation. Typically, these are located 30 to 110 base pairs (bp) upstream of the start site, although in recent years, some promoters have been found to contain functional elements downstream of the start site as well. The spacing between promoter elements is often flexible, and promoter function is preserved even when elements are inverted or moved relative to one another. In the case of the thymidine kinase (tk) promoter, the spacing between promoter elements can be increased up to 50 bp before activity begins to decrease. Depending on the promoter, individual elements appear to function either cooperatively or independently to activate transcription.

[0272] One example of a suitable promoter is the immediate-early cytomegalovirus (CMV) promoter sequence. This promoter sequence is a strong constitutive promoter sequence capable of driving high-level expression of any polynucleotide sequence operably linked thereto. Another example of a suitable promoter is elongation growth factor-1α (EF-1α). However, other constitutive promoter sequences can also be used, including, but not limited to, the simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate-early promoter, Rous sarcoma virus promoter, and human gene promoters, such as, but not limited to, the actin promoter, myosin promoter, hemoglobin promoter, and creatine kinase promoter.

[0273] Alternatively, the promoter may be an inducible promoter. Use of an inducible promoter provides a molecular switch that can turn on expression of an operably linked polynucleotide sequence when such expression is desired, or turn off expression when expression is not required. Examples of inducible promoters include, but are not limited to, metallothionine promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0274] The expression vector to be introduced may contain either a selectable marker gene or a reporter gene, or both, to facilitate identification and selection of expressing cells from a population of cells to be transfected or infected via a viral vector. In other embodiments, the selectable marker may be carried on a separate piece of DNA and used in a co-transfection method. Both the selectable marker and the reporter gene may be flanked by appropriate regulatory sequences to enable expression in the host cell. Useful selectable markers include antibiotic resistance genes, such as neo.

[0275] Reporter genes can be used to identify potentially transformed cells and evaluate the functionality of regulatory sequences. Generally, reporter genes are genes absent from or expressed by the recipient source and encode a polypeptide whose expression is manifested by some easily detectable property, such as enzymatic activity. Expression of the reporter gene is assayed at an appropriate time after DNA introduction into the recipient cells. Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secreted alkaline phosphatase, or green fluorescent protein (e.g., Ui-Tei et al., FEBS Letters 479:79-82, 2000). Suitable expression systems are well known and can be prepared using known techniques or obtained commercially. Generally, constructs with minimal 5' flanking regions that exhibit the highest level of expression of the reporter gene are identified as promoters. Such promoter regions can be linked to reporter genes and used to evaluate drugs for their ability to modulate promoter-driven transcription.

[0276] In some examples, an organism can be genetically modified to alter the expression of one or more proteins. The expression of one or more proteins can be altered for a particular time point, such as the developmental or differentiation state of the organism. In one example, the invention includes compositions for altering the expression of one or more proteins, such as proteins that affect the expression of activity, structure, or function. The expression of one or more proteins can be limited to a specific location or can be spread throughout the organism.

[0277] (b) Synthetic mRNA The pathogen control composition may include a synthetic mRNA molecule, such as a synthetic mRNA molecule encoding a polypeptide. The synthetic mRNA molecule may be, for example, chemically modified. The mRNA molecule may be, for example, chemically synthesized or transcribed in vitro. The mRNA molecule may be placed in a plasmid, such as a viral vector, a bacterial vector, or a eukaryotic expression vector. In some examples, the mRNA molecule may be delivered to cells by transfection, electroporation, or transduction (e.g., adenoviral or lentiviral transduction).

[0278] In some examples, the modified RNA agents of interest described herein have modified nucleosides or nucleotides. Such modifications are known and are described, for example, in International Publication No. WO 2012 / 019168. Further modifications are described, for example, in International Publication Nos. WO 2015 / 038892; WO 2015 / 038892; WO 2015 / 089511; WO 2015 / 196130; WO 2015 / 196118 and WO 2015 / 196128 A2.

[0279] In some instances, the modified RNA encoding the polypeptide of interest has one or more terminal modifications, such as a 5' cap structure and / or a poly-A tail (e.g., 100-200 nucleotides in length). The 5' cap structure may be selected from the group consisting of CapO, Capl, ARCA, inosine, Nl-methyl-guanosine, 2'fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine. In some instances, the modified RNA contains a 5' UTR containing at least one Kozak sequence and a 3' UTR. Such modifications are known and are described, for example, in International Publication Nos. 2012 / 135805 and 2013 / 052523. Additional terminal modifications are described, for example, in WO 2014 / 164253 and WO 2016 / 011306, WO 2012 / 045075 and WO 2014 / 093924. Chimeric enzymes for synthesizing capped RNA molecules (e.g., modified mRNAs) that may contain at least one chemical modification are described in WO 2014 / 028429.

[0280] In some instances, modified mRNAs can be circularized or concatemerized to generate translation-competent molecules that support the interaction of polyA-binding proteins with 5'-end binding proteins. The circularization or concatemerization mechanism can occur through at least three different pathways: 1) chemical, 2) enzymatic, and 3) ribozyme catalysis. The newly formed 5'- / 3'-bonds can be either intramolecular or intermolecular. Such modifications are described in WO 2013 / 151736.

[0281] Methods for producing and purifying modified RNA are known in the art. For example, modified RNA is produced using only in vitro transcription (IVT) enzymatic synthesis. Methods for producing IVT polynucleotides are known in the art and are described in International Publication Nos. 2013 / 151666, 2013 / 151668, 2013 / 151663, 2013 / 151669, 2013 / 151670, 2013 / 151664, 2013 / 151665, 2013 / 151671, 2013 / 151672, 2013 / 151667 and 2013 / 151736.S. Purification methods include purifying RNA transcripts containing poly-A tails by contacting a sample with a surface linked to multiple thymidines or their derivatives and / or multiple uracils or their derivatives (polyT / U) under conditions that allow the RNA transcripts to bind to the surface, followed by elution of the purified RNA transcripts from the surface (WO 2014 / 152031); using ion (e.g., anion) exchange chromatography, which allows for the separation of long RNAs up to 10,000 nucleotides in length in a scalable manner (WO 2014 / 144767); and subjecting modified mRNA samples to DNAse treatment (WO 2014 / 152030).

[0282] Formulations of modified RNA are known and are described, for example, in WO 2013 / 090648. For example, formulations may be, but are not limited to, nanoparticles, polylactic-co-glycolic acid (PLGA) microspheres, lipoids, lipoplexes, liposomes, polymers, carbohydrates (including monosaccharides), cationic lipids, fibrin gels, fibrin hydrogels, fibrin glues, fibrin sealants, fibrinogen, thrombin, rapid-release lipid nanoparticles (reLNPs), and combinations thereof.

[0283] Modified RNAs encoding polypeptides in the areas of human diseases, antibodies, viruses, and various in vivo environments are known and are disclosed, for example, in Table 6 of WO 2013 / 151666, WO 2013 / 151668, WO 2013 / 151663, WO 2013 / 151669, WO 2013 / 151670, WO 2013 / 151664, WO 2013 / 151665, WO 2013 / 151736; Tables 6 and 7 of WO 2013 / 151672; Tables 6, 178, and 179 of WO 2013 / 151671; and Tables 6, 185, and 186 of WO 2013 / 151667. Any of the foregoing may be synthesized as an IVT polynucleotide, a chimeric polynucleotide, or a circular polynucleotide, each of which may contain one or more modified nucleotides or terminal modifications.

[0284] (c) inhibitory RNA In some examples, the pathogen control composition includes an inhibitory RNA molecule, for example, an inhibitory RNA molecule that acts via the RNA interference (RNAi) pathway. In some examples, the inhibitory RNA molecule reduces the level of gene expression in a pathogen or its vector. In some examples, the inhibitory RNA molecule reduces the level of a protein in a pathogen or its vector. In some examples, the inhibitory RNA molecule inhibits the expression of a pathogen gene. In some examples, the inhibitory RNA molecule inhibits the expression of a gene in a pathogen vector. For example, the inhibitory RNA molecule may include a small interfering RNA, a small hairpin RNA, and / or a microRNA that targets a pathogen gene. Certain RNA molecules can inhibit gene expression through the biological process of RNA interference (RNAi). RNAi molecules typically include RNA or RNA-like constructs comprising 15 to 50 base pairs (e.g., about 18 to 25 base pairs) and have a nucleotide sequence identical (complementary) or nearly identical (substantially complementary) to a coding sequence in an expressed target gene in a cell. RNAi molecules include, but are not limited to, Dicer substrate small interfering RNA (dsiRNA), small interfering RNA (siRNA), double-stranded RNA (dsRNA), short hairpin RNA (shRNA), partial duplex (meroduplex), Dicer substrate, and multivalent RNA interference (see U.S. Patent Nos. 8,084,599, 8,349,809, 8,513,207, and 9,200,276). shRNA is an RNA molecule containing a hairpin turn that reduces target gene expression via RNAi. shRNA can be delivered to cells in the form of a plasmid, e.g., a viral or bacterial vector, e.g., by transfection, electroporation, or transduction. MicroRNAs are typically non-coding RNA molecules approximately 22 nucleotides in length. miRNAs bind to target sites on mRNA molecules and silence mRNA, for example, by causing mRNA cleavage, mRNA destabilization, or inhibition of mRNA translation. In some instances, the inhibitory RNA molecule reduces the level and / or activity of a negative regulator of function.In other examples, inhibitory RNA molecules reduce the level and / or activity of a positive regulator of function. Inhibitory RNA molecules can be, for example, chemically synthesized or in vitro transcribed.

[0285] In some examples, the nucleic acid is DNA, RNA, or PNA. In some examples, the RNA is an inhibitory RNA. In some examples, the inhibitory RNA inhibits gene expression in a pathogen. In some examples, the nucleic acid is an mRNA, a modified mRNA, or a DNA molecule that increases expression of an enzyme (e.g., a metabolic recombinase, a helicase, an integrase, an RNAse, a DNAse, or a ubiquitinating protein) in a pathogen, a pore-forming protein, a signaling ligand, a cell membrane-permeable peptide, a transcription factor, a receptor, an antibody, a nanobody, a gene-editing protein (e.g., a CRISPR-Cas system, a TALEN, or a zinc finger), a riboprotein, a protein aptamer, or a chaperone. In some examples, the nucleic acid is an mRNA, modified mRNA, or DNA molecule that increases expression of an enzyme (e.g., a metabolic enzyme, a recombinase enzyme, a helicase enzyme, an integrase enzyme, an RNAse enzyme, a DNAse enzyme, or a ubiquitinating protein), a pore-forming protein, a signaling ligand, a cell membrane-permeable peptide, a transcription factor, a receptor, an antibody, a nanobody, a gene editing protein (e.g., a CRISPR-Cas system, a TALEN, or a zinc finger), a riboprotein, a protein aptamer, or a chaperone. In some examples, the increase in expression in the pathogen is about 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or more than 100% increase in expression relative to a reference level (e.g., expression in an untreated pathogen). In some examples, the increase in expression in the pathogen is about 2-fold, about 4-fold, about 5-fold, about 10-fold, about 20-fold, about 25-fold, about 50-fold, about 75-fold, or about 100-fold or more increase in expression relative to the reference level (expression in the untreated pathogen).

[0286] In some examples, the nucleic acid is an antisense RNA, siRNA, shRNA, miRNA, aiRNA, PNA, morpholino, LNA, piRNA, ribozyme, DNAzyme, aptamer (DNA, RNA), circRNA, gRNA, or DNA molecule (e.g., antisense polynucleotide) that reduces expression of an enzyme (metabolic enzyme, recombinase enzyme, helicase enzyme, integrase enzyme, RNAse enzyme, DNAse enzyme, polymerase enzyme, ubiquitinating protein, superoxide management enzyme, or energy-producing enzyme) in a pathogen, a transcription factor, a secreted protein, a structural factor (actin, kinesin, or tubulin), a riboprotein, a protein aptamer, a chaperone, a receptor, a signaling ligand, or a transport factor. In some examples, the reduction in expression in a pathogen is about a 5%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, or greater than a 100% reduction in expression relative to a reference level (e.g., expression in an untreated pathogen). In some examples, the reduction in expression in a pathogen is about a 2-fold, 4-fold, 5-fold, 10-fold, 20-fold, 25-fold, 50-fold, 75-fold, or 100-fold or greater reduction in expression relative to a reference level (e.g., expression in an untreated pathogen).

[0287] RNAi molecules contain sequences that are substantially complementary or completely complementary to all or a fragment of a target gene. RNAi molecules can complement sequences at the boundaries between introns and exons to prevent the maturation of newly generated RNA transcripts of a specific gene into mRNA for transcription. RNAi molecules complementary to a specific gene can hybridize with the mRNA of the target gene and prevent its translation. Antisense molecules can be DNA, RNA, or derivatives or hybrids thereof. Examples of such derivative molecules include, but are not limited to, peptide nucleic acids (PNAs) and phosphorothioate-based molecules such as deoxyribonucleic acid guanidine (DNG) or ribonucleic acid guanidine (RNG).

[0288] RNAi molecules can be provided as ready-to-use RNA synthesized in vitro or as antisense genes transfected into cells that, upon transcription, produce the RNAi molecule. Hybridization with mRNA results in degradation of the hybridized molecule by RNAse H and / or inhibition of translation complex formation, either of which prevents production of the original gene product.

[0289] The length of the RNAi molecule that hybridizes to the transcript of interest can be about 10 nucleotides, about 15-30 nucleotides, or about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides or more in length. The degree of identity of the antisense sequence to the target transcript can be at least 75%, at least 80%, at least 85%, at least 90%, or at least 95%.

[0290] RNAi molecules may also contain overhangs, i.e., protruding nucleotides that are typically unpaired, that are not directly involved in the double helix structure typically formed by the core sequences of the paired sense and antisense strands as defined herein. RNAi molecules may contain 3' and / or 5' overhangs of about 1 to 5 bases, independently of each other, in the sense and antisense strands. In some cases, both the sense and antisense strands contain 3' and 5' overhangs. In some cases, one or more 3' overhanging nucleotides of one strand base are paired with one or more 5' overhanging nucleotides of the other strand. In other cases, one or more 3' overhanging nucleotides of one strand base are not paired with one or more 5' overhanging nucleotides of the other strand. The sense and antisense strands of an RNAi molecule may or may not contain the same number of nucleotide bases. The antisense and sense strands may form a duplex in which only the 5' end is blunt, only the 3' end is blunt, both the 5' and 3' ends are blunt, or neither the 5' nor the 3' end is blunt. In another example, one or more nucleotides in the overhang comprise phosphorothioates, phosphorothioates, deoxynucleotides, inverted (3'-3' linked) nucleotides, or modified ribonucleotides or deoxynucleotides.

[0291] Small interfering RNA (siRNA) molecules contain a nucleotide sequence identical to about 15 to about 25 consecutive nucleotides of a target mRNA. In some cases, the siRNA sequence begins with the dinucleotide AA, contains about 30-70% (about 30-60%, about 40-60%, or about 45-55%) GC content, and does not contain a high percentage of identity to any nucleotide sequences other than the target in the genome into which it is to be introduced, as determined, for example, by a standard BLAST search.

[0292] siRNA and shRNA resemble intermediates in the processing pathway of endogenous microRNA (miRNA) genes (Bartel, Cell 116:281-297, 2004). In some cases, siRNA can function as miRNA, and vice versa (Zeng et al., Mol. Cell 9:1327-1333, 2002; Doench et al., Genes Dev. 17:438-442, 2003). Exogenous siRNA downregulates mRNAs that have seed complementarity to the siRNA (Birmingham et al., Nat. Methods 3:199-204, 2006). Multiple target sites within the 3'UTR result in stronger downregulation (Doench et al., Genes Dev. 17:438-442, 2003).

[0293] Known effective siRNA sequences and cognate binding sites are also described in detail in the relevant literature. RNAi molecules are easily designed and produced by techniques known in the art. Additionally, computational tools exist that increase the chances of finding effective and specific sequence motifs (Pei et al., Nat. Methods 3(9):670-676, 2006; Reynolds et al., Nat. Biotechnol. 22(3):326-330, 2004; Khvorova et al., Nat. Struct. Biol. 10(9):708-712, 2003; Schwarz et al., Cell 115(2):199-208, 2003; Ui-Tei et al., Nucleic Acids Res. 32(3):936-948, 2004; Heale et al., Nucleic Acids Res. 33(3):e30, 2005; Chalk et al. al.,Biochem.Biophys.Res.Commun.319(1):264-274,2004; and Amarzguioui et al.,Biochem.Biophys.Res.Commun.316(4):1050-1058,2004).

[0294] RNAi molecules regulate the expression of RNA encoded by genes. Because multiple genes can share a certain degree of sequence homology with each other, in some cases, RNAi molecules can be designed to target a class of genes that have sufficient sequence homology. In some cases, RNAi molecules can contain sequences that are shared between different gene targets or have complementarity to sequences that are unique to specific gene targets. In some cases, RNAi molecules can be designed to target conserved regions of RNA sequences that are homologous between several genes, thereby targeting several genes within a gene family (for example, different gene isoforms, splice variants, mutant genes, etc.). In some cases, RNAi molecules can be designed to target sequences that are unique to the specific RNA sequence of a single gene.

[0295] Inhibitory RNA molecules can be modified to contain, for example, modified nucleotides, such as 2'-fluoro, 2'-o-methyl, 2'-deoxy, unlocked nucleic acid, 2'-hydroxy, phosphorothioate, 2'-thiouridine, 4'-thiouridine, 2'-deoxyuridine. Without being bound by theory, it is believed that such modifications may increase nuclease resistance and / or serum stability, or reduce immunogenicity.

[0296] In some cases, RNAi molecules are linked to delivery polymers via physiologically labile bonds or linkers. The physiologically labile linkers are selected so that they undergo chemical transformation (e.g., cleavage) when present under certain physiological conditions (e.g., disulfide bonds are cleaved in the reducing environment of the cytoplasm). The release of the molecule from the polymer by cleavage of the physiologically labile bond facilitates the interaction of the molecule with appropriate cellular components for activity.

[0297] An RNAi molecule-polymer conjugate can be formed by covalently linking a polymer to a molecule. The polymer is polymerized or modified so that it contains reactive group A. The RNAi molecule is also polymerized or modified so that it contains reactive group B. Reactive groups A and B are selected so that they can be linked via a reversible covalent bond using methods known in the art.

[0298] The conjugation of RNAi molecules and polymers can be carried out in the presence of excess polymer. Because RNAi molecules and polymers can have opposite charges during conjugation, the presence of excess polymer can reduce or eliminate aggregation of the conjugate. Alternatively, excess carrier polymers such as polycations can be used. Excess polymers can be removed from the conjugated polymer before administering the conjugate. Alternatively, excess polymers can be co-administered with the conjugate.

[0299] Injecting double-stranded RNA (dsRNA) into mother insects effectively silences gene expression in their offspring during embryogenesis. See, e.g., Khila et al., PLoS Genet. 5(7):e1000583, 2009; and Liu et al., Development 131(7):1515-1527, 2004. Matsuura et al. (PNAS 112(30):9376-9381, 2015) demonstrated that suppression of Ubx eliminates bacteriocyte and bacterocyte symbiont localization.

[0300] The production and use of inhibitors based on non-coding RNAs, such as ribozymes, RNAse P, siRNAs, and miRNAs, are also known in the art, as described, for example, in Sioud, RNA Therapeutics: Function, Design, and Delivery (Methods in Molecular Biology). Humana Press (2010).

[0301] (d) Gene editing The pathogen control compositions described herein may include a component of a gene editing system. For example, the agent may introduce a modification (e.g., an insertion, deletion (e.g., knockout), translocation, inversion, single point mutation, or other mutation) into a gene in a pathogen. Exemplary gene editing systems include zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) systems. Methods based on ZFNs, TALENs, and CRISPRs are described, for example, in Gaj et al., Trends Biotechnol. 31(7):397-405, 2013.

[0302] In a typical CRISPR / Cas system, an endonuclease is directed to a target nucleotide sequence (e.g., a site in the genome where sequence editing is desired) by a sequence-specific, non-coding guide RNA that targets a single- or double-stranded DNA sequence. Three classes (I-III) of CRISPR systems have been identified. Class II CRISPR systems use a single Cas endonuclease (rather than multiple Cas proteins). One class II CRISPR system includes a type II Cas endonuclease, such as Cas9, a CRISPR RNA (crRNA), and a trans-activating crRNA (tracrRNA). The crRNA contains a guide RNA, i.e., an approximately 20-nucleotide RNA sequence that typically corresponds to the target DNA sequence. The crRNA also contains a region that binds to the tracrRNA, forming a partially double-stranded structure that is cleaved by RNase III, resulting in a crRNA / tracrRNA hybrid. The RNA acts as a guide, directing the Cas protein to repress a specific DNA / RNA sequence, depending on the spacer sequence. See, e.g., Horvath et al., Science 327:167-170, 2010; Makarova et al., Biology Direct 1:7, 2006; Pennisi, Science 341:833-836, 2013. The target DNA sequence must generally be adjacent to a protospacer adjacent motif (PAM) specific for a given Cas endonuclease; however, PAM sequences occur throughout a given genome.CRISPR endonucleases identified from various prokaryotic species have unique PAM sequence requirements; example PAM sequences include 5'-NGG (SEQ ID NO: 78) (Streptococcus pyogenes), 5'-NNAGAA (SEQ ID NO: 79) (Streptococcus thermophilus CRISPR1), 5'-NGGNG (SEQ ID NO: 80) (Streptococcus thermophilus CRISPR3), and 5'-NNNGATT (SEQ ID NO: 81) (Neisseria meningitidis). Some endonucleases, such as the Cas9 endonuclease, bind to G-rich P (5') AM sites, such as 5'-NGG (SEQ ID NO: 78), to perform blunt-end cleavage of target DNA three nucleotides upstream from the PAM site. Another class II CRISPR system contains the type V endonuclease Cpf1, which is smaller than Cas9; examples include AsCpf1 (from Acidaminococcus sp.) and LbCpf1 (from Lachnospiraceae sp.). The Cpf1-bound CRISPR array is processed into mature crRNA without the requirement for tracrRNA; in other words, the Cpf1 system requires only Cpf1 nuclease and crRNA to cleave the target DNA sequence. The Cpf1 endonuclease binds to T-rich PAM sites, such as 5'-TTN. Cpf1 also recognizes the 5'-CTA PAM motif. Cpf1 cleaves DNA by introducing offset or staggered double-stranded breaks with 4'- or 5-nucleotide 5' overhangs, for example, cleaving target DNA at 5-nucleotide offset or staggered breaks located 18 nucleotides downstream from (the 3' side of) the PAM site on the coding strand and 23 nucleotides downstream from the PAM site on the complementary strand. The 5-nucleotide overhangs resulting from such offset breaks enable DNA insertion via homologous recombination, resulting in more precise genome editing than insertion with blunt-end cut DNA.See, for example, Zetsche et al., Cell 163:759-771, 2015.

[0303] For gene editing purposes, CRISPR arrays can be designed to contain one or more guide RNA sequences corresponding to the desired target DNA sequence; see, e.g., Cong et al., Science 339:819-823, 2013; Ran et al., Nature Protocols 8:2281-2308, 2013. For DNA cleavage by Cas9, at least about 16 or 17 nucleotides of the gRNA sequence are required; for Cpf1, at least about 16 nucleotides of the gRNA sequence are required to achieve detectable DNA cleavage. In practice, guide RNA sequences are generally designed to be 17 to 24 nucleotides (e.g., 19, 20, or 21 nucleotides) in length and complementary to the targeted gene or nucleic acid sequence. Custom gRNA generation devices and algorithms are commercially available for use in designing effective guide RNAs. Gene editing has also been achieved using chimeric single guide RNAs (sgRNAs), i.e., engineered (synthetic) single RNA molecules that mimic the natural crRNA-tracrRNA complex and contain both a tracrRNA (for binding to a nuclease) and at least one crRNA (for directing the nuclease to the sequence targeted for editing). Chemically modified sgRNAs have also been demonstrated to be effective for genome editing; see, e.g., Hendel et al., Nature Biotechnol. 985-991, 2015.

[0304] Wild-type Cas9 generates double-strand breaks (DSBs) at specific DNA sequences targeted by gRNAs, but several CRISPR endonucleases with modified functionality are available, including: nickase versions of Cas9 that generate only single-strand breaks; and catalytically dead Cas9 (dCas9), which does not cleave target DNA but disrupts transcription through steric hindrance. dCas9 can also be fused to effectors to suppress (CRISPRi) or activate (CRISPRa) target gene expression. For example, Cas9 can be fused to a transcriptional repressor (e.g., a KRAB domain) or a transcriptional activator (e.g., a dCas9-VP64 fusion). Catalytically dead Cas9 (dCas9) fused to a Fokl nuclease (dCas9-Fokl) can be used to generate DSBs at target sequences homologous to two gRNAs. See, for example, the numerous CRISPR / Cas9 plasmids disclosed in and publicly available from the Addgene repository (Addgene, 75 Sidney St., Suite 550A, Cambridge, MA 02139; addgene.org / crispr / ). Double-nickase Cas9, which introduces two separate double-strand breaks, each directed by a separate guide RNA, has been described by Ran et al., Cell 154:1380-1389, 2013, to achieve more precise genome editing.

[0305] CRISPR technology for editing eukaryotic genes is disclosed in U.S. Patent Application Publication Nos. 2016 / 0138008 A1 and 2015 / 0344912 A1 and U.S. Patent Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. The Cpf1 endonuclease and corresponding guide RNA and PAM site are disclosed in US Patent Application Publication No. 2016 / 0208243 A1.

[0306] In some cases, the desired genome modification involves homologous recombination, in which an RNA-guided nuclease and a guide RNA generate one or more double-stranded DNA breaks in the target nucleotide sequence, followed by repair of the break using a homologous recombination mechanism (homologous recombination repair). In such cases, a donor template encoding the desired nucleotide sequence to be inserted or knocked in at the double-stranded break is provided to a cell or subject; examples of suitable templates include single-stranded DNA templates and double-stranded DNA templates (e.g., linked to a polypeptide described herein). Generally, donor templates encoding nucleotide changes over a region of less than about 50 nucleotides are provided in the form of single-stranded DNA; larger donor templates (e.g., more than 100 nucleotides) are often provided as double-stranded DNA plasmids. In some cases, the donor template is provided to a cell or subject in an amount sufficient to achieve the desired homologous recombination repair, but does not persist in the cell or subject after a given period of time (e.g., after one or more cell division cycles). In some examples, the donor template has a core nucleotide sequence (e.g., a homologous endogenous genomic region) that differs from the target nucleotide sequence by at least one, at least five, at least 10, at least 20, at least 30, at least 40, at least 50, or more nucleotides. This core sequence is flanked by homology arms or regions of high sequence identity with the target nucleotide sequence; in some examples, the regions of high sequence identity comprise at least 10, at least 50, at least 100, at least 150, at least 200, at least 300, at least 400, at least 500, at least 600, at least 750, or at least 1000 nucleotides on either side of the core sequence. In some examples where the donor template is in the form of single-stranded DNA, the core sequence is flanked by homology arms comprising at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, or at least 100 nucleotides on either side of the core sequence.In some cases where the donor template is in the form of double-stranded DNA, the core sequence is flanked by homology arms comprising at least 500, at least 600, at least 700, at least 800, at least 900, or at least 1000 nucleotides on either side of the core sequence. In one example, double nickase Cas9 is used to introduce two separate double-stranded breaks into the target nucleotide sequence of a cell or subject (see Ran et al., Cell 154:1380-1389, 2013), followed by delivery of the donor template.

[0307] In some examples, the composition comprises a gRNA and a target nuclease, such as Cas9, e.g., wild-type Cas9, nickase Cas9 (e.g., Cas9D10A), inactive Cas9 (dCas9), eSpCas9, Cpf1, C2C1, or C2C3, or a nucleic acid encoding such a nuclease. The choice of nuclease and gRNA is determined by whether the target mutation is a nucleotide deletion, substitution, or addition, e.g., a nucleotide deletion, substitution, or addition to the target sequence. Fusion of a catalytically inactive endonuclease, e.g., inactive Cas9 (dCas9, e.g., D10A; H840A), tethered to all or a portion (e.g., biologically active portion) of one or more effector domains creates a chimeric protein, which can be linked to a polypeptide and targeted to a specific DNA site by one or more RNA sequences (sgRNAs) to modulate the activity and / or expression of one or more target nucleic acid sequences.

[0308] In some examples, the agent comprises a guide RNA (gRNA) used in a CRISPR system for gene editing. In some examples, the agent comprises a zinc finger nuclease (ZFN) or an mRNA encoding a ZFN that targets (e.g., cleaves) a nucleic acid sequence (e.g., a DNA sequence) of a gene in a pathogen. In some examples, the agent comprises a TALEN or an mRNA encoding a TALEN that targets (e.g., cleaves) a nucleic acid sequence (e.g., a DNA sequence) of a gene in a pathogen.

[0309] For example, gRNAs can be used in CRISPR systems to engineer genetic modifications in pathogens. In other examples, ZFNs and / or TALENs can be used to engineer genetic modifications in pathogens. Exemplary modifications include insertions, deletions (e.g., knockouts), translocations, inversions, single point mutations, or other mutations. The modifications can be introduced into a cellular gene, for example, in vitro, ex vivo, or in vivo. In some examples, the modifications increase the level and / or activity of a gene in a pathogen. In other examples, the modifications reduce (e.g., knock down or knock out) the level and / or activity of a gene in a pathogen. In yet another example, the modifications correct a genetic defect (e.g., a mutation causing the defect) in a pathogen.

[0310] In some examples, CRISPR systems are used to edit target genes in pathogens (e.g., add or delete base pairs). In other examples, CRISPR systems are used to introduce premature stop codons, for example, thereby reducing the expression of target genes. In yet other examples, CRISPR systems are used to turn off target genes in a reversible manner, for example, similar to RNA interference. In some examples, CRISPR systems are used to target Cas to the promoter of a gene, thereby sterically blocking RNA polymerase.

[0311] In some examples, CRISPR systems can be generated to edit genes in pathogens using techniques described in, for example, U.S. Patent Application Publication No. 20140068797; Cong, Science 339:819-823, 2013; Tsai, Nature Biotechnol. 32:6 569-576, 2014; U.S. Patent Nos. 8,871,445; 8,865,406; 8,795,965; 8,771,945; and 8,697,359.

[0312] In some cases, CRISPR interference (CRISPRi) technology can be used to suppress the transcription of specific genes in pathogens. In CRISPRi, an engineered Cas9 protein (e.g., a nuclease-null dCas9 or a dCas9 fusion protein, such as a dCas9-KRAB or dCas9-SID4X fusion) can be paired with a sequence-specific guide RNA (sgRNA). The Cas9-gRNA complex can block RNA polymerase, thereby preventing transcription elongation. This complex can also block transcription initiation by interfering with transcription factor binding. CRISPRi methods inherently have minimal off-target effects and are multiplexable, allowing for the simultaneous suppression of two or more genes (e.g., using multiple gRNAs). CRISPRi methods also enable reversible gene suppression.

[0313] In some cases, CRISPR-mediated gene activation (CRISPRa) can be used to activate the transcription of pathogen genes. In CRISPRa technology, a dCas9 fusion protein recruits a transcriptional activator. For example, dCas9 can be fused to a polypeptide (e.g., an activation domain) such as VP64 or the p65 activation domain (p65D) and used with an sgRNA (e.g., a single sgRNA or multiple sgRNAs) to activate one or more genes in a pathogen. Using multiple sgRNAs can recruit multiple activators, which can increase activation efficiency. Various activation domains and single or multiple activation domains can be used. In addition to engineering dCas9 to recruit activators, sgRNAs can also be engineered to recruit activators. For example, an RNA aptamer can be incorporated into the sgRNA to introduce a protein (e.g., an activation domain) such as VP64. In some cases, the synergistic activation mediator (SAM) system can be used for transcriptional activation. In SAM, the MS2 aptamer is attached to the sgRNA, which recruits the MS2 coat protein (MCP) fused to p65AD and heat shock factor 1 (HSF1).

[0314] Further details about CRISPRi and CRISPRa technologies are described in Dominguez et al., Nat. Rev. Mol. Cell Biol. 17:5-15, 2016 (incorporated herein by reference). Additionally, as described in Dominguez et al., dCas9-mediated epigenetic modification and simultaneous activation and repression by the CRISPR system can be used to regulate genes in pathogens.

[0315] iii.Small molecules In some instances, the pathogen control composition comprises a small molecule, e.g., a small biomolecule. Numerous small molecule agents are useful in the methods and compositions described herein.

[0316] Small molecules include, but are not limited to, small peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, synthetic polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic and inorganic compounds (including heteroorganic and organometallic compounds) generally having a molecular weight of less than about 5,000 grams per mole, for example, organic and inorganic compounds having a molecular weight of less than about 2,000 grams per mole, for example, organic and inorganic compounds having a molecular weight of less than about 1,000 grams per mole, for example, organic and inorganic compounds having a molecular weight of less than about 500 grams per mole, and salts, esters and other pharmaceutically acceptable forms of such compounds.

[0317] The small molecules described herein can be incorporated into compositions or combined with PMPs for any of the pathogen control compositions or related methods described herein. The compositions disclosed herein can include any number or types (e.g., classes) of small molecules, such as at least about one, two, three, four, five, ten, fifteen, twenty, or more small molecules. The suitable concentration of each small molecule in the composition will vary depending on factors such as the efficacy and stability of the small molecules, the number of individual small molecules, and the formulation and method of application of the composition. In some examples where the composition contains at least two types of small molecules, the concentrations of the various small molecules can be the same or different.

[0318] Pathogen control compositions comprising the small molecules described herein can be contacted with a pathogen or its vector in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of small molecule concentration within or on the pathogen or its vector; and (b) reduce the fitness of the pathogen.

[0319] In some examples, a pathogen control composition comprising a small molecule described herein can be administered to an animal having or at risk of infection by a pathogen in an amount and for a time sufficient to (a) achieve a target level (e.g., a predetermined or threshold level) of small molecule concentration in the animal; and (b) reduce or eliminate the pathogen.

[0320] In some examples, the pathogen control composition of the compositions and methods described herein comprises a secondary metabolite. Secondary metabolites are derived from organic molecules produced by living organisms. Secondary metabolites can act (i) as competitors for bacteria, fungi, amoeba, plants, insects, and large animals; (ii) as metal transport agents; (iii) as symbiotic substances between microorganisms and plants, insects, and higher animals; (iv) as sex hormones; and (v) as differentiation effectors.

[0321] As used herein, secondary metabolites may include metabolites from any known group of secondary metabolites. For example, secondary metabolites can be classified into the following groups: alkaloids, terpenoids, flavonoids, glycosides, natural phenols (e.g., gossypol acetic acid), enals (e.g., trans-cinnamaldehyde), phenazines, biphenols and dibenzofurans, polyketides, fatty acid synthase peptides, nonribosomal peptides, ribosomally synthesized and post-translationally modified peptides, polyphenols, polysaccharides (e.g., chitosan), and biopolymers. For a detailed review of secondary metabolites, see, for example, Vining, Annu. Rev. Microbiol. 44:395-427, 1990.

[0322] VI. Kit The present invention also provides kits for controlling, preventing, or treating diseases caused by animal pathogens or for controlling vectors of such pathogens, the kits comprising a container with a pathogen control composition described herein. The kits may further comprise instructional materials for applying or delivering the pathogen control composition (e.g., to an animal, an animal pathogen, or a vector of an animal pathogen) to control, prevent, or treat infection according to the methods of the present invention. Those skilled in the art will understand that the instructions for applying the pathogen control composition according to the methods of the present invention can be in any form. Such instructions include, but are not limited to, written instructional materials (e.g., labels, booklets, pamphlets), oral instructional materials (e.g., cassette tapes or CDs), or video instructional materials (e.g., videotapes or DVDs). [Example]

[0323] The following are examples of methods of the present invention: In view of the general description provided above, it will be understood that various other embodiments may be practiced.

[0324] Example 1: Isolation of plant messenger Pak from plants This example describes the isolation of crude plant messenger proteins (PMPs) from various plant sources, including leaf apoplast, seed apoplast, root, fruit, vegetable, pollen, phloem sap, xylem sap, and plant cell culture media.

[0325] Experimental Design: a) PMP isolation from the apoplast of Arabidopsis thaliana leaves Arabidopsis (Arabidopsis thaliana Cl-0) seeds were surface-sterilized with 50% bleach and then plated onto 0.53 Murashige and Skoog medium containing 0.8% agar. These seeds were vernalized at 4°C for 2 days and then grown under short-day conditions (9 h photoperiod, 22°C, 150 μE m -2 After one week, transfer the seedlings to Pro-Mix PGX. Allow the plants to grow for 4-6 weeks before harvesting.

[0326] PMPs were isolated from the apoplastic washings of 4- to 6-week-old Arabidopsis rosettes as described by Rutter and Innes in Plant Physiol. 173(1):728-741, 2017. Briefly, whole rosettes were harvested from the roots and vacuum-infiltrated with vesicle isolation buffer (20 mM MES, 2 mM CaCl2, and 0.1 M NaCl, pH 6). The infiltrated plants were carefully blotted to remove excess liquid, then transferred into a 30 mL syringe and centrifuged in a 50 mL conical tube at 2 °C for 20 min to collect the apoplastic extracellular fluid containing EVs. The apoplastic extracellular fluid was then filtered through a 0.85 μm filter to remove large particles, after which PMPs were purified as described in Example 2.

[0327] b) PMP isolation from the apoplast of sunflower seeds Intact sunflower seeds (Helianthus annuus L.) were imbibed with water for 2 hours, dehulled, and the pericarp removed. The apoplastic extracellular fluid was then extracted using a modified vacuum infiltration-centrifugation procedure adapted from Regente et al., FEBS Letters. 583:3363-3366, 2009. Briefly, seeds were infiltrated in vesicle isolation buffer (20 mM MES, 2 mM CaCl2, and 0.1 M NaCl, pH 6) and then subjected to three 10-second vacuum pulses and a 30-second separation at 45 kPa pressure. The infiltrated seeds were collected, dried on filter paper, placed in a fritted glass filter, and centrifuged at 400 g for 20 minutes at 4°C. The apoplastic extracellular fluid was collected and filtered through a 0.85 μm filter to remove large particles, after which PMPs were purified as described in Example 2.

[0328] c) PMP isolation from ginger root Fresh ginger (Zingiber officinale) rhizome roots were purchased from a local supplier and washed three times with PBS. A total of 200 grams of washed roots were ground in a blender (Osterizer 12-speed blender) at maximum speed for 10 minutes (with a 1-minute pause after each minute of blending), and PMPs were isolated as described in Zhuang et al., J Extracellular Vesicles. 4(1):28713, 2015. Briefly, the ginger juice was centrifuged sequentially at 1,000 g for 10 minutes, 3,000 g for 20 minutes, and 10,000 g for 40 minutes to remove large particles from the PMP-containing supernatant. PMPs were purified as described in Example 2.

[0329] d) PMP isolation from grapefruit juice Fresh grapefruit (Citrus × paradisi) was purchased from a local supplier, the peel removed, and the juice collected by hand-squeezing or grinding the fruit in a blender (Osterizer 12-speed blender) at maximum speed for 10 minutes (with a 1-minute pause after each minute of blending) as described (with minor modifications) in Wang et al., Molecular Therapy. 22(3):522-534, 2014. Briefly, the juice / pulp was centrifuged sequentially at 1,000 g for 10 minutes, 3,000 g for 20 minutes, and 10,000 g for 40 minutes to remove large particles from the PMP-containing supernatant. PMP was purified as described in Example 2.

[0330] e) PMP isolation from broccoli heads Broccoli (Brassica oleracea var. italica) PMPs were isolated as previously described (Deng et al., Molecular Therapy, 25(7):1641-1654, 2017). Briefly, fresh broccoli was purchased from a local supplier, washed three times with PBS, and then ground in a blender (Osterizer 12-speed blender) at maximum speed for 10 minutes (with a 1-minute pause after each minute of blending). The broccoli juice was then centrifuged sequentially at 1,000 g for 10 minutes, 3,000 g for 20 minutes, and 10,000 g for 40 minutes to remove large particles from the PMP-containing supernatant. PMPs were purified as described in Example 2.

[0331] f) PMP isolation from olive pollen Olive (Olea europaea) pollen PMPs were isolated as previously described in Prado et al., Molecular Plant. 7(3):573-577, 2014. Briefly, olive pollen (0.1 g) was hydrated for 30 minutes in a humidified chamber at room temperature and then transferred to a Petri dish (15 cm diameter) containing 20 ml of germination medium: 10% sucrose, 0.03% Ca(NO3)2, 0.01% KNO3, 0.02% MgSO4, and 0.03% H3BO3. The pollen was allowed to germinate for 16 h in the dark at 30°C. Pollen grains were considered germinated only when the tube length exceeded the diameter of the pollen grain. The medium containing PMPs was collected and pollen debris was removed by two successive filtrations through 0.85 μm filters via centrifugation. PMPs were purified as described in Example 2.

[0332] g) PMP isolation from Arabidopsis phloem sap Arabidopsis (Arabidopsis thaliana Col-0) seeds were surface-sterilized with 50% bleach and then plated onto 0.53 Murashige and Skoog medium containing 0.8% agar. These seeds were vernalized at 4°C for 2 days and then grown under short-day conditions (9 h photoperiod, 22°C, 150 μE m -2 After one week, transfer the seedlings to Pro-Mix PGX. Allow the plants to grow for 4-6 weeks before harvesting.

[0333] Phloem sap from 4-6 week-old Arabidopsis rosette leaves was collected as described by Tetyuk et al. in JoVE.80, 2013. Briefly, leaves were cut from the base of the petiole, stacked, and placed in a reaction tube containing 20 mM K2-EDTA in the dark for 1 hour to prevent wound sealing. The leaves were gently removed from the container, thoroughly washed with distilled water to remove all EDTA, and placed in a clean tube. The phloem sap was then collected in the dark for 5-8 hours. The leaves were discarded, and the phloem sap was filtered through a 0.85 μm filter to remove large particles before purifying PMP as described in Example 2.

[0334] h) PMP isolation from xylem sap of tomato plants Tomato (Solanum lycopersicum) seeds are planted in single pots containing organic soil such as Sunshine Mix (Sun Gro Horticulture, Agawam, MA) and maintained in a greenhouse at 22-28°C. Approximately 2 weeks after germination, i.e., at the two-true-leaf stage, seedlings are individually transplanted into pots (10 cm diameter, 17 cm deep) filled with sterilized sandy soil containing 90% sand and 10% organic matter mix. Plants are maintained in the greenhouse at 22-28°C for 4 weeks.

[0335] Xylem sap from 4-week-old tomato plants is collected as described in Kohlen et al., Plant Physiology. 155(2):721-734, 2011. Briefly, tomato plants are cut above the hypocotyl and a plastic ring is placed around the stem. Xylem sap, which accumulates over 90 minutes after cutting, is collected. The xylem sap is filtered through a 0.85 μm filter to remove large particles, and then PMP is purified as described in Example 2.

[0336] i) PMP isolation from tobacco BY-2 cell culture medium Tobacco BY-2 (Nicotiana tabacum L. cv. Bright Yellow 2) cells were cultured in MS (Murashige and Skoog, 1962) BY-2 medium (pH 5.8) containing MS salts (Duchefa, Haarlem, Netherlands, #M0221) supplemented with 30 g / L sucrose, 2.0 mg / L potassium dihydrogen phosphate, 0.1 g / L myo-inositol, 0.2 mg / L 2,4-dichlorophenoxyacetic acid, and 1 mg / L thiamine HCl on a shaker at 180 rpm in the dark at 26 °C. BY-2 cells were subcultured weekly by transferring 5% (v / v) of a 7-day-old cell culture to 100 mL of fresh liquid medium. After 72–96 h, the BY-2 medium was harvested and the cells were removed by centrifugation at 300 xg for 10 min at 4 °C. The supernatant containing the PMPs is collected and filtered through a 0.85 um filter to remove debris. The PMPs are purified as described in Example 2.

[0337] Example 2: Production of Purified Plant Messenger Pak (PMP) This example describes the generation of purified PMP from the crude PMP fraction described in Example 1 using size exclusion chromatography, removal of aggregates by ultrafiltration and precipitation in combination with a density gradient (iodixanol or sucrose) or size exclusion chromatography.

[0338] Experimental Design: a) Purification of grapefruit PMPs using ultrafiltration in combination with size exclusion chromatography The crude grapefruit PMP fraction from Example 1a is concentrated using a 100-kDA molecular weight cutoff (MWCO) Amicon spin filter (Merck Millipore). The concentrated crude PMP solution is then loaded onto a PURE-EV size-exclusion chromatography column (HansaBioMed Life Sciences Ltd) and isolated according to the manufacturer's instructions. The purified PMP-containing fractions are pooled after elution. Optionally, PMP can be further concentrated using a 100-kDA MWCO Amicon spin filter or by tangential flow filtration (TFF). The purified PMP is analyzed as described in Example 3.

[0339] b) Generation of purified Arabidopsis apoplastic PMPs using an iodixanol gradient Crude Arabidopsis leaf apoplastic PMPs were isolated as described in Example 1a and purified using an iodixanol gradient as described by Rutter and Innes, Plant Physiol. 173(1):728-741, 2017. To prepare a discontinuous iodixanol gradient (OptiPrep; Sigma-Aldrich), 40% (v / v), 20% (v / v), and 5% (v / v) iodixanol solutions were created by diluting an aqueous 60% OptiPrep stock solution with vesicle isolation buffer (VIB; 20 mM MES, 2 mM CaCl2, and 0.1 M NaCl, pH 6). The gradient was formed by layering 3 mL of the 40% solution, 3 mL of the 20% solution, 3 mL of the 10% solution, and 2 mL of the 5% solution. The crude apoplastic PMP solution from Example 1a is centrifuged at 40,000 g for 60 minutes at 4°C. The pellet is resuspended in 0.5 ml of VIB and then layered on top of the gradient. Centrifugation is carried out at 100,000 g for 17 hours at 4°C. After discarding the first 4.5 ml of the top of the gradient, three volumes of 0.7 ml containing apoplastic PMP are collected, made up to 3.5 ml with VIB, and centrifuged at 100,000 g for 60 minutes at 4°C. The pellet is washed with 3.5 ml of VIB and then repelleted using the same centrifugation conditions. The purified PMP pellets are combined for subsequent analysis as described in Example 3.

[0340] c) Purification of grapefruit PMPs using a sucrose gradient Crude grapefruit juice PMP was isolated as described in Example 1d and centrifuged at 150,000 g for 90 minutes. The PMP-containing pellet was then resuspended in 1 ml of PBS as described (Mu et al., Molecular Nutrition & Food Research. 58(7):1561-1573, 2014). The resuspended pellet was transferred to a sucrose step gradient (8% / 15% / 30% / 45% / 60%) and centrifuged at 150,000 g for 120 minutes to produce purified PMP. Purified grapefruit PMP was collected from the 30% / 45% interface and subsequently analyzed as described in Example 3.

[0341] d) Removal of aggregates from grapefruit PMP Additional purification steps can be added to remove protein aggregates from grapefruit PMP produced as described in Example 1d or purified PMP from Examples 2a-c. The produced PMP solution is passed through various pH channels to precipitate protein aggregates in the solution. The pH is adjusted to 3, 5, 7, 9, or 11 by adding sodium hydroxide or hydrochloric acid. The pH is measured using a calibrated pH probe. Once the solution reaches the specified pH, it is filtered to remove particles. Alternatively, the isolated PMP solution can be coagulated by adding a charged polymer such as Polymin-P or Praestol 2640. Briefly, 2-5 g of Polymin-P or Praestol 2640 per liter is added to the solution and mixed with an impeller. The solution is then filtered to remove particles. Alternatively, aggregates can be solubilized by increasing the salt concentration. NaCl is added to the PMP solution until 1 mol / L is reached. The solution is then filtered to purify the PMP. Alternatively, the aggregates are solubilized by increasing the temperature. The isolated PMP mixture is heated for 5 minutes with mixing until a homogeneous temperature of 50°C is reached. The PMP mixture is then filtered to isolate the PMPs. Alternatively, soluble contaminants from the PMP solution are separated using a size-exclusion chromatography column according to standard methods, with PMPs eluting in the first fraction, while proteins, ribonucleoproteins, and some lipoproteins are eluted later. The efficiency of protein aggregate removal is determined by measuring and comparing protein concentrations before and after removal of protein aggregates using BCA / Bradford protein assay. The resulting PMPs are analyzed as described in Example 3.

[0342] Example 3: Characterization of plant messenger PAK This example describes the characterization of PMPs produced as described in Example 1 or Example 2.

[0343] Experimental Design: a) Determination of PMP concentration PMP particle concentration is determined by nanoparticle tracking analysis (NTA) using a Malvern NanoSight or tunable resistive pulse sensing (TRPS) using an iZon qNano according to the manufacturer's instructions. The protein concentration of purified PMPs is determined using a DC protein assay (Bio-Rad). The lipid concentration of purified PMPs is determined using a fluorescent lipophilic dye such as DiOC6 (ICN Biomedicals) as described by Rutter and Innes in Plant Physiol. 173(1):728-741, 2017. Briefly, the purified PMP pellet from Example 2 is resuspended in 100 ml of 10 mM DiOC6 (ICN Biomedicals) diluted in MES buffer (20 mM MES, pH 6) plus 1% plant protease inhibitor cocktail (Sigma-Aldrich) and 2 mM 2,29-dipyridyl disulfide. The resuspended PMPs are incubated at 37°C for 10 min, washed with 3 mL of MES buffer, repelleted (400,000g, 60 min at 4°C), and resuspended in fresh MES buffer. DiOC6 fluorescence intensity is measured at 485 nm excitation and 535 nm emission.

[0344] b) Biophysical and molecular characterization of PMPs PMPs are characterized by electron and cryo-electron microscopy on a JEOL 1010 transmission electron microscope according to the protocol of Wu et al., Analyst. 140(2):386-406, 2015. The size and zeta potential of PMPs are also measured using a Malvern Zetasizer or iZon qNano according to the manufacturer's instructions. Lipids are isolated from PMPs using chloroform extraction and characterized by LC-MS / MS as described in Xiao et al., Plant Cell. 22(10):3193-3205, 2010. Glycosyl inositol phosphorylceramide (GIPC) lipids are extracted and purified as described in Cacas et al., Plant Physiology. 170:367-384, 2016, followed by LC-MS / MS analysis as previously described. Total RNA, DNA, and protein are characterized using the Quant-It kit from Thermo Fisher Scientific according to the instructions. PMP proteins were characterized by LC-MS / MS according to the protocol described by Rutter and Innes, Plant Physiol. 173(1):728-741, 2017. RNA and DNA were extracted using Trizol and prepared into TruSeq Total RNA libraries using the Illumina Ribo-Zero Plant Kit and the Nextera Mate Pair Library Prep Kit, followed by sequencing on an Illumina MiSeq according to the manufacturer's instructions.

[0345] Example 4: Characterization of plant messenger pack stability This example demonstrates the measurement of PMP stability under various storage and physiological conditions.

[0346] Experimental Design: PMP prepared as described in Examples 1 and 2 was subjected to various conditions. The PMP was suspended in water, 5% sucrose, or PBS and stored at -20°C, 4°C, 20°C, and 37°C for 1, 7, 30, and 180 days. Alternatively, the PMP was suspended in water, dried using a rotary evaporator, and stored at 4°C, 20°C, and 37°C for 1, 7, 30, and 180 days. Alternatively, the PMP was suspended in water or 5% sucrose solution, flash-frozen in liquid nitrogen, and then freeze-dried. After 1, 7, 30, and 180 days, the dried and freeze-dried PMP was resuspended in water. The three preliminary experiments, including those at temperatures above 0°C, were also exposed to an artificial sunlight simulator to determine satisfactory safety under simulated outdoor UV conditions. Furthermore, PMPs are exposed to temperatures of 37°C, 40°C, 45°C, 50°C and 55°C for 1, 6 and 24 hours in buffer solutions of pH 1, 3, 5, 7 and 9 or other simulated gastric fluids with or without the addition of 1 unit of trypsin.

[0347] After each of these treatments, the PMP is returned to 20° C., neutralized to pH 7.4, and then characterized using some or all of the methods described in Example 3.

[0348] Example 5: Treatment of fungi with plant messenger packs This example demonstrates the ability of PMPs produced from Arabidopsis thaliana rosettes to reduce the fitness of pathogenic fungi. In this example, the yeast Saccharomyces cerevisiae is used as a model pathogenic fungus.

[0349] Pathogenic fungi such as Candida species are a major cause of opportunistic fungal infections worldwide, and Saccharomyces cerevisiae (also known as "baker's yeast") is mostly considered an incidental digestive commensal. However, since the 1990s, there have been increasing reports of its involvement as a pathogenic agent in invasive infections. Infections by pathogenic fungi are generally associated with high morbidity and mortality, primarily due to the limited effectiveness of existing antifungal drugs.

[0350] Treatment plan: Arabidopsis apoplastic PMP solutions were formulated with 0 (negative control), 1, 10 or 50, 100 and 250 μg of PMP protein / ml from Example 1a in 10 ml of PBS.

[0351] Experimental Design: a) Labeling of apoplastic PMPs with lipophilic membrane dyes Arabidopsis thaliana apoplastic PMPs were isolated and purified as described in Examples 1-2 and then labeled with PKH26 (Sigma) according to the manufacturer's instructions (with some modifications). Briefly, 1 mL of diluent C or 50 mg of apoplastic PMPs in the PKH26 kit were mixed with 2 mL of 1 mM PKH26 and incubated at 37°C for 5 minutes. Labeling was stopped by adding 1 mL of 1% BSA. All unlabeled dye was washed away by centrifugation at 150,000 g for 90 minutes, and the labeled PMP pellet was resuspended in sterile water.

[0352] b) Uptake of apoplastic PMP by Saccharomyces cerevisiae Saccharomyces cerevisiae was obtained from ATCC (#9763) and maintained at 30°C in yeast extract peptone dextrose broth (YPD) according to the manufacturer's instructions. To determine PMP uptake by S. cerevisiae, yeast cells were grown to an OD of 0.4–0.6 in selective medium. 600S. cerevisiae cells were grown to 100°C and incubated directly on glass slides with 0 (negative control), 1, 10, 50, 100, or 250 μg / ml PKH26-labeled apoplast-derived PMPs. In addition to the PBS control, S. cerevisiae cells were incubated in the presence of PKH26 dye (final concentration 5 μg / ml). After 5, 30, and 1 hour of incubation at room temperature, images were acquired using a high-resolution fluorescence microscope. Apoplast-derived PMPs were internalized by yeast if red PMPs were observed in the cytoplasm or if the cytoplasm of the yeast cells turned red relative to the exclusive staining of the plasma membrane by the PKH26 dye. To assess PMP internalization, the percentage of yeast cells with red cytoplasm / red PMPs in the cytoplasm, relative to membrane staining alone, was compared between PMP-treated cells and PBS and PKH26 dye-only controls.

[0353] c) Treatment of S. cerevisiae in vitro with Arabidopsis apoplastic PMP solution To determine the effect of Arabidopsis apoplastic PMP treatment on the fitness of yeast cells, a modified drug susceptibility assay was performed. S. cerevisiae cells (10 5 Cells / ml) are mixed with molten YPD agar (approximately 40°C) and poured into Petri dishes. After the agar solidifies, 5 μl of solutions of 0 (PBS, negative control), 1, 10, or 50, 100, and 250 μg PMP protein / ml are spotted onto the plates. Plates are incubated at 30°C and scored for zones of inhibition (dark circles) after 2 and 3 days.

[0354] Furthermore, to evaluate the effect of PMP on yeast growth, a spot test is performed. S. cerevisiae cells are cultured overnight on YPD medium. The cells are then incubated at an OD of 0.1. 600 Suspend in normal saline until 20°C (A 600Five microliters of five-fold serial dilutions of each yeast culture are spotted onto YPD plates in the absence of PMP (PBS control) and in the presence of 1, 10, 50, 100, or 250 μg PMP protein / ml. After incubation of the plates at 30° C. for 48 h, differences in growth are recorded.

[0355] The overall effect of Arabidopsis apoplastic PMPs on fungal fitness is determined by comparing the zone of inhibition and the difference in growth between PBS control and PMP-treated fungal cells.

[0356] Example 6: Treatment of bacteria with plant messenger pak This example demonstrates the ability of purified apoplastic PMP from Arabidopsis thaliana rosettes to be taken up by bacteria and reduce the fitness of the pathogen Escherichia coli, which is used as a model pathogen in this example.

[0357] Human and animal diseases triggered by pathogenic bacteria such as Staphylococcus aureus, Salmonella, and E. coli cause significant morbidity and mortality due to the limited effectiveness of, and growing resistance to, existing antifungal drugs.

[0358] Treatment plan: Arabidopsis apoplastic PMP solutions are formulated with 0 (negative control), 1, 10, 50, 100 or 250 μg of PMP protein / ml in 10 ml of sterile water.

[0359] a) Labeling of apoplastic PMPs with lipophilic membrane dyes Arabidopsis thaliana apoplastic PMPs were generated as described in Examples 1-2 and labeled with PKH26 (Sigma) according to the manufacturer's instructions (with some modifications). Briefly, 50 mg of PMPs were diluted in 1 mL of Diluent C, mixed with 2 mL of 1 mM PKH26, and incubated at 37°C for 5 min. Labeling was stopped by adding 1 mL of 1% BSA. All unlabeled dye was washed away by centrifugation at 150,000 g for 90 min, and the labeled PMP pellet was resuspended in sterile water and analyzed as described in Example 3.

[0360] b) Uptake of apoplastic PMP by E. coli E. coli were obtained from ATCC (#25922) and grown on trypticase soy agar / broth at 37°C according to the manufacturer's instructions. To determine PMP uptake by E. coli, 10 μl of 1 ml of overnight bacterial suspension was incubated directly on a glass slide with 0 (negative control), 1, 10, 50, 100, or 250 μg / ml of PKH26-labeled apoplastic PMP. In addition to the water control, E. coli were incubated in the presence of PKH26 dye (final concentration 5 μg / ml). After 5 min, 30 min, and 1 h of incubation at room temperature, images were captured using a high-resolution fluorescence microscope. Apoplastic PMP was taken up by the bacteria if the bacterial cytoplasm turned red relative to the exclusive staining of the cell membrane by PKH26 dye. To determine PMP uptake, the percentage of PKH26-PMP treated bacteria with red cytoplasm is compared to control treatments with PBS and PKH26 dye alone.

[0361] c) In vitro treatment of E. coli with Arabidopsis apoplastic PMP solution The ability of Arabidopsis apoplastic PMPs to affect the growth of Escherichia coli (E. coli) is determined using a modified standard disk diffusion sensitivity method. Briefly, several morphologically similar colonies are selected from overnight growth (16-24 h incubation) on non-selective medium using a sterile loop or cotton swab, and then the colonies are plated in sterile saline (0.85% NaCl in water w / v) to a density of approximately 1-2 × 10 cells per 1000 cells in a McFarland 0.5 standard. 8 An E. coli inoculum suspension is prepared by suspending bacteria to a concentration of 10 ...

[0362] Example 7: Treatment of parasitic insects with PMP This example demonstrates the ability to kill or reduce the fitness of parasitic insects such as bed bugs by treating them with a solution of PMPs produced from plants such as ginger root. In this example, bed bugs are used as a model organism for parasitic insects.

[0363] Bed bugs (Cimex lectularius), blood-sucking ectoparasites, are emerging public health pests of global importance. The lack of available effective residual insecticides and the growing resistance of bed bug populations to pyrethroid insecticides justify the development of effective and environmentally safe treatment options.

[0364] Treatment plan: Ginger root PMP solutions are formulated at 0 (negative control), 1, 10, 50, 100 and 250 μg PMP protein / ml in 10 ml PBS.

[0365] Experimental Design: a) Cultivation of bed bugs (Cimex lectularius) Cimex lectularius was obtained from Sierra Research Laboratories (Modesto, CA). Bed bug colonies were maintained in glass cages containing cardboard hiding places under a 12:12 photoperiod at 25°C and 40-45% (ambient) humidity. Colonies were blood-fed weekly with parafilm-membrane feeders containing defibrinated rabbit blood (Hemostat Laboratories, Dixon, CA).

[0366] b) Treatment of Cimex lectularius with ginger root PMP solution Ginger root PMPs were isolated as described in Example 1, and the effects of PMP treatment on bed bug survival, fecundity, and development were determined. Prior to treatment, 0- to 2-week-old adult bed bugs that had not been blood-fed for 4 days were isolated and placed in glass jars for 2 days to mate. Males were selected and removed, and female bed bugs were separated into co-housed experimental cohorts of 10-15. Female bed bugs were treated by feeding them defibrinated rabbit blood supplemented with a final concentration of 0 (PBS, negative control), 1, 10, 50, 100, or 250 μg PMP protein / ml until fully expanded. After PMP treatment, cohorts of 10-15 bed bugs were maintained at 25°C and 40-45% (ambient) humidity in Petri dishes containing sterile pads that provided a suitable substrate for oviposition (Advantec MFS, Inc., Dublin, CA). For survival assays, dead bugs are counted and recorded daily for 10 days, then removed from their cages and the average survival rate of PMP-treated bed bugs calculated compared to PBS controls.

[0367] Bed bugs were then fed daily with PMP-spiked blood as described above for 10 days, after which they were transferred to new Petri dishes. The Petri dishes containing the eggs were maintained in a growth chamber for two weeks to allow sufficient time for hatching. The eggs were observed under a 16x magnification binocular stereomicroscope, and the average number of eggs laid by female bed bugs per feeding period was calculated over 30 days. The average number of nymphs emerging from the eggs was assessed, and the average bed bug survival rate was calculated. The effects of ginger root PMP on bed bug survival, fecundity, and development were determined by comparing the ginger root PMP-treated cohort with the PBS-treated control cohort.

[0368] Example 8: Treatment of parasitic nematodes with PMP This example demonstrates the ability to kill or reduce the fitness of parasitic nematodes, such as Heligmosomoides polygyrus, by treating them with a solution of PMPs produced from plants such as ginger root.

[0369] Chronic helminth infections remain a significant global health problem, causing significant morbidity in both humans and livestock. Many of the most prevalent helminth parasites are difficult to study in the laboratory because they have co-evolved and closely adapted to their native host species. In this example, the model pathogen helminth H. polygyrus, a natural murine parasite, is used to demonstrate the effect of ginger root PMP on its fitness.

[0370] Treatment plan: Ginger root PMP solutions are formulated with 0 (negative control), 1, 10, 50, 100 or 250 μg PMP protein / ml (Example 1a) in 10 ml of sterile water.

[0371] Experimental Design: a) Cultivation of the parasitic nematode Heligmosomoides polygyrus H. polygyrus culture is performed as described by Keiser et al., Parasites & Vectors. 9(1):376, 2016. Four-week-old female NMRI mice and H. polygyrus L3 are purchased from a local supplier. Female NMRI mice are orally infected with 80 H. polygyrus L3 nematodes. H. polygyrus eggs are obtained from infected feces.

[0372] b) In vitro treatment of H. polygyrus with ginger root PMP solution To evaluate the nematicidal activity of ginger root PMP solution on egg hatching, H. polygyrus eggs were obtained from infected mouse feces, washed, and then immersed in solutions containing 0 (negative control), 1, 10, 50, 100, or 250 μg ginger root PMP protein / ml for 30 minutes, 1 hour, or 2 hours. The eggs were then placed on agar in the dark at 24°C for 14 days, and the number of L3 larvae that hatched after 6 days was recorded. The effect of ginger root PMP on egg hatching was determined by comparing the percentage of H. polygyrus eggs that hatched with and without PMP treatment.

[0373] c) In vitro treatment of H. polygyrus L3 larvae with ginger root PMP solution To evaluate the nematicidal activity of PMP solution against H. polygyrus L3 larvae, H. polygyrus eggs were obtained from infected mouse feces and placed on agar. L3 larvae hatched after 9 days in the dark at 24°C. For PMP treatment, 40 L3 larvae were placed in each well of a 96-well plate. Worms were incubated in the presence of 100 μl of RPMI 1640 medium supplemented with 0.63 μg / ml amphotericin B, 500 U / ml penicillin, 500 μg / ml streptomycin, and 0 (negative control), 1, 10, 50, 100, or 250 μg PMP protein / ml. Each treatment was tested in duplicate. Worms incubated with 100 μM levamisole (Sigma-Aldrich) served as a positive control. The plates were maintained at room temperature for 72 h. To assess the effect of PMP treatment on L3 fitness, the total number of L3 larvae per well is counted and the number of moving larvae is recorded after stimulation with 100 μl of boiling water (approximately 80°C). The relative percentage of moving L3 larvae is compared between the PMP treatments and the positive and negative controls to determine the larval-nematicidal effect of ginger root PMP.

[0374] d) In vitro treatment of H. polygyrus adults with ginger root PMP solution Female NMRI mice were orally infected with 80 H. polygyrus worms. Two weeks after infection, the mice were dissected, and three adult worms were placed in each well of a 24-well plate. The worms were incubated with medium and 0 (negative control), 1, 10, 50, 100, or 250 μg ginger root PMP protein / ml. Each treatment was tested in triplicate. Adult worms incubated with medium alone and 50 μM levamisole served as negative and positive controls, respectively. The worms were maintained in an incubator at 37°C and 5% CO2 for 72 h and then evaluated microscopically using a viability scale ranging from 3 (active) to 0 (moveless). The adult nematocidal effect of ginger root PMP was determined by comparing the mean viability scores of H. polygyrus adult worms between the PMP treatments and the positive and negative controls.

[0375] e) In vivo treatment of H. polygyrus with ginger root PMP solution in mice To test the in vivo nematicidal effect of ginger root PMP treatment, NMRI mice were orally infected with 80 H. polygyrus L3 strains. 14 days after infection, mice were orally treated with the test agent or levamisole control at doses of 10, 100, 300, or 400 mg PMP protein / kg. Four to six untreated mice served as controls. 10 days after treatment, animals were sacrificed by CO2 and the digestive tracts were harvested. The intestines were dissected, and adult worms were collected and counted. The nematicidal activity of orally administered ginger root PMP was determined by comparing the mean number of adult worms in the PMP-treated cohort to those in the positive and negative control-treated mouse cohorts.

[0376] Example 9: Treatment of protozoan parasites with PMP This example demonstrates the ability to kill or reduce the fitness of a protozoan parasite, such as Trichomonas vaginalis, by treatment with a solution of PMP produced from a plant, such as ginger root. In this example, T. vaginalis is used as a model protozoan parasite.

[0377] Trichomonas vaginalis is one of the most common non-viral sexually transmitted diseases (STDs) worldwide. This anaerobic protozoan, which is motile using a promastigote and undulating membrane, conservatively infects an estimated 180 million women worldwide, representing 6 million infections annually in the United States. Given the increasing resistance of the parasite to classical drugs of the metronidazole family, there is a growing need for novel, unrelated drugs.

[0378] Treatment plan: Ginger root PMP solutions are formulated with 0 (negative control), 1, 10, 50, 100 or 250 μg PMP protein / ml in 10 ml of sterile water.

[0379] Experimental Design: a) Culture of the parasitic protozoan Trichomonas vaginalis (T. vaginalis) Trichomonas vaginalis was obtained from ATCC (#50167) and cultured according to the manufacturer's instructions and as described in Tiwarti et al., Journal of Antimicrobial Chemotherapy, 62(3):526-534, 2008. The parasites were grown in 15 mL screw-top glass tubes at 37°C in standard TYI-S33 medium (pH 6.8) supplemented with 10% FCS, a vitamin mixture, and 100 U / mL penicillin / streptogramin. The medium was routinely grown to a concentration of 2 x 10 for 48 h. 7 Achieve cells / mL. For culture maintenance, 1 x 10 cells / mL per tube. 4 An inoculum of cells is used.

[0380] b) Treatment of Trichomonas vaginalis (T. vaginalis) with ginger root PMP solution Ginger root PMP was produced as described in Example 1. To determine the effect of ginger root PMP on T. vaginalis fitness, a drug susceptibility assay was performed as previously described (Tiwarti et al., Journal of Antimicrobial Chemotherapy, 62(3):526-534, 2008). Briefly, 5 × 10 PMPs per mL were cultured in TYI-S33 medium in a 24-well plate at 37 °C in the presence of 0 (sterile water, negative control), 1, 10, or 50, 100, and 250 μg PMP protein / mL or 1 to 12 mM metronidazole (Sigma-Aldrich) as a positive control. 3Trichomonas trophozoites are incubated. Cells are examined for viability under a 20x microscope at various time intervals between 3 and 48 hours. T. vaginalis viability is determined by trypan blue exclusion assay. Cells are counted using a hemocytometer. The lowest concentration of PMP solution that kills all cells is considered its minimum inhibitory concentration (MIC). Experiments are repeated three times to confirm the MIC. The effect of ginger root PMP on T. vaginalis fitness is determined by comparing the mean MIC of PMP treatments to negative and positive controls.

[0381] Example 10: Treatment of fungi with plant messenger packs loaded with small nucleic acids This example demonstrates the ability of PMPs to deliver small nucleic acids by isolating PMP lipids and synthesizing them into small nucleic acid-containing vesicles. In this example, we use small double-stranded RNA (dsRNA)-loaded PMPs to knock down virulence factors in the pathogenic fungus Candida albicans. We also demonstrate that small nucleic acid-loaded PMPs are stable and retain their activity across a variety of processing and environmental conditions. In this example, dsRNA is used as a model nucleic acid, and Candida albicans is used as a model pathogenic fungus.

[0382] Candida species are the leading cause of opportunistic fungal infections worldwide, and Candida albicans is the most common pathogen of candidiasis, currently the third or fourth most common hospital-acquired infection. These infections are generally associated with high morbidity and mortality, primarily due to the limited efficacy of existing antimicrobial agents. In the case of C. albicans, the morphogenetic transformation from yeast and filament forms to biofilm formation represents two important biological processes that are closely related to the biology of this fungus and play a key role during the pathogenesis of candidiasis.

[0383] Therapeutic dose: The dsRNA-loaded PMPs were formulated in water to a concentration that delivered the equivalent of an effective siRNA dose of 0, 50, 500, or 1000 nM in sterile water.

[0384] Experimental Protocol: a) Synthesis of EFG1 dsRNA-loaded grapefruit PMP from isolated grapefruit PMP lipids Small nucleic acids were loaded into PMPs according to a protocol modified from Wang et al., Nature Comm., 4:1867, 2013. Briefly, purified PMPs were produced from grapefruit as described in Examples 1-2, and grapefruit PMP lipids were isolated as modified from Xiao et al., Plant Cell, 22(10):3193-3205, 2010. Briefly, 3.75 mL of 2:1 (v / v) MeOH:CHCl3 was added to 1 mL of PMPs in PBS and vortexed. CHCl3 (1.25 mL) and ddH2O (1.25 mL) were added sequentially and vortexed. The mixture was then centrifuged in a glass tube at 2,000 rpm at 22°C for 10 minutes to separate the mixture into two phases (aqueous and organic). To collect the organic phase, insert a glass pipette through the aqueous phase with gentle positive pressure, aspirate the bottom (organic) phase, and inject it into a new glass tube. The organic phase sample is divided into aliquots and dried by heating under nitrogen (2 psi).

[0385] The sequences described in Moazeni et al., Mycopathologia. 174(3):177-185, 2012: antisense: 5'ACAUUGAGCAAUUUGGUUC-3' and sense: 5'-GAACCAAAUUGCUCAAUGU-3' and scrambled siRNA control 5'-AUAUGCGCAACAUUGACA-3' are obtained from IDT. Sense / antisense annealing was performed in annealing buffer (30 mM HEPES-KOH pH 7.4, 100 mM KCl, 2 mM MgCl, and 50 mM NH4Ac) as described (Moazeni et al., Mycopathologia. 174(3):177-185, 2012) to achieve siRNA duplexes (dsRNA). dsRNA-loaded PMPs were synthesized from both target and control siRNAs by mixing lipids and small nucleic acids and drying them to form a thin film. This film was dispersed in PBS and sonicated to form the loaded liposome formulation. PMPs were purified using a sucrose gradient as described in Example 2 and washed by ultracentrifugation to remove unbound nucleic acids before use. A small portion of both samples was characterized using the method described in Example 3, and their RNA content was measured using the Quant-It RiboGreen RNA Assay Kit, and their stability was tested as described in Example 4.

[0386] To determine the fungal blocking efficiency of the siRNA-loaded PMPs from Example 10a, Candida albicans were treated with PMP solutions containing 0, 50, 500, and 1000 nM effective siRNA doses in sterile water. C. albicans wild-type strain (ATCC #14053) was cultured on yeast extract peptone / dextrose (YPD) medium plates and incubated at 37°C for 24 h before being maintained at 4°C until use. The efficacy and efficiency of treatment with EFG1 dsRNA-loaded PMPs were compared to scrambled and negative controls.

[0387] b) Treatment of Candida albicans with EFG1 siRNA-loaded grapefruit PMP to reduce fungal biofilms To measure the effect of siRNA-loaded PMPs on C. albicans biofilm formation, 20 mL of yeast peptone dextrose (YPD) (1% [wt / vol] yeast extract, 2% [wt / vol] peptone, 2% [wt / vol] dextrose) liquid medium in a 150 mL flask was inoculated with an overnight culture of C. albicans and incubated in an orbital shaker at 30 °C. Under these conditions, C. albicans grows as a budding yeast. Biofilm formation was performed using a 96-well microtiter plate model as described by Pierce et al., Pathog Dis. Apr;70(3):423-431, 2014. Briefly, cells were harvested from overnight YPD cultures, washed, and resuspended in RPMI-1640 supplemented with L-glutamine (Cellgro) and buffered with 165 mM morpholinepropanesulfonic acid (MOPS) to a final concentration of 1.0 × 10 cells / mL. C. albicans biofilms were grown on commercially available sterile polystyrene flat-bottom 96-well microtiter plates (Corning Incorporated, Corning, NY). 250 μl of 1.0 × 10 cells / mL were cultured per well. 6C. albicans cells were dispensed at 1000 cells / mL, and EFGR1 siRNA-loaded PMP or Scrabble control was added to a final concentration of 0 (water, negative control), 50, 500, or 1000 nM. Treatments were performed in triplicate, and plates were incubated at 37°C for 24 h. After biofilm formation, wells were washed twice to remove nonadherent cells, visualized by light microscopy, and then processed using a semiquantitative colorimetric assay based on the reduction of 2,3-bis(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT, Sigma). The OD of control biofilms formed (in the absence of PMP) was arbitrarily set to 100%, and the inhibitory effect of siRNA-loaded PMP was determined by the percentage decrease in absorbance compared to the control. Data were calculated as the percentage of biofilm inhibition compared to the average of control wells.

[0388] To quantify changes in EFGR1 expression, C. albicans EFG1 mRNA levels were measured by quantitative real-time RT-PCR. Total RNA was extracted using the Fisher BioReagents™ SurePrep™ Plant / Fungi Total RNA Purification Kit (Fisher Scientific, Waltham, MA), and quantitative RT-PCR was performed after cDNA synthesis using SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA). Determine EFG1 (XM_709104.1) and the housekeeping gene β-actin ACT1 (XM_717232.1) in C. albicans after treatment with synthetic EFGR1-dsRNA and a scrambled control using the following primers: EFG1-Fw: TGCCAATAATGTGTCGGTTG, EFG1-Rev: CCCATCTCTTCTACCACGTGTC, ACT1-Fw: ACGGTATTGTTTCCAACTGGGACG, ACT1-Rev: TGGAGCTTCGGTCAACAAAACTGG (Moazeni et al., Mycopathologia. 174(3):177-185, 2012). RT-qPCR is performed using SsoAdvanced™ Universal SYBR® Green Supermix (BioRad) with three technical replicates following the following protocol: denaturation at 95°C for 3 min, 40 repeats of 95°C for 20 s, 61°C for 20 s, and 72°C for 15 s.

[0389] The abundance of EFG1 was normalized to the abundance of ACT1 in the plant-derived PCR products to determine knockdown efficiency, which was determined by calculating ΔΔCt values ​​and comparing the normalized fungal growth of the negative PBS control to the normalized fungal growth of the ds-RNA-loaded PMP-treated sample.

[0390] c) Treatment of Candida albicans with EFG1 siRNA-loaded grapefruit PMP to reduce fungal fitness To evaluate the effect of EFG1 siRNA-loaded PMP on fungal growth, a PMP activity assay was performed using yeast embedded in agar as described by Beaumont et al., Cell Death and Disease. 4(5):e619, 2013. Overnight cultures in minimal medium containing glucose (2%, w / v) were washed twice with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA (TE) and then resuspended in TE. OD was measured and used to culture 5 x 10 cells in 7.5 ml of minimal medium containing galactose. 7 Colony-forming units of yeast were introduced and allowed to equilibrate to 37°C. Each yeast suspension was mixed with 7.5 ml of minimal medium agar containing galactose (2%, w / v) (pre-equilibrated to 50°C), mixed quickly by inversion, and then poured onto a pre-prepared 10 cm plate containing 15 ml of galactose-containing minimal medium agar. The plate was allowed to stand at room temperature for 1 hour. Five microliters of EFGR1 siRNA-loaded PMP or 0 (water, negative control), 50, 500, or 1000 nM Scrabble control was pipetted onto the plate containing the embedded yeast, allowed to dry at room temperature, and incubated at 30°C for 3 days before being photographed. Dark circles reveal PMP-mediated inhibition of yeast growth.

[0391] Example 11: Treatment of insects with peptide nucleic acid-loaded PMPs This example demonstrates the loading of a peptide nucleic acid construct into a PMP for the purpose of reducing insect fitness by knocking down the vATPase-E of the bed bug (Cimex lectularius), which has been demonstrated to affect survival and reproduction via siRNA (Basnet and Kamble, Journal of Medical Entomology, 55(3):540-546, 2018). This example also demonstrates that PNA-loaded PMPs are stable and retain their activity across a variety of treatments and environmental conditions. In this example, PNA is used as a model protein and Cimex lectularius is used as a model pathogenic insect.

[0392] Therapeutic dose: RNA-loaded PMPs were formulated in water to a concentration that delivered the equivalent of an effective PNA dose of 0, 0.1, 1, 5, or 10 μM in sterile water.

[0393] Experimental Protocol: a) Loading of grapefruit PMPs with peptide nucleic acids PNAs against Cimex lectularius vATPase-E (NCBI GenBank accession #LOC106667865) are designed and synthesized by a suitable supplier. PMPs from grapefruit are isolated according to Example 1. The PMPs are introduced into a solution containing PNAs in PBS. The solution is then sonicated according to the protocol from Wang et al., Nature Comm., 4:1867, 2013, to induce poration and diffusion of the PMPs. Alternatively, the solution can be passed through a lipid extruder according to the protocol from Haney et al., J Contr. Rel., 207:18-30, 2015. Alternatively, they can be electroporated according to the protocol from Wahlgren et al., Nucl. Acids. Res. 40(17):e130, 2012. After 1 hour, the PMPs are purified using a sucrose gradient and then washed by ultracentrifugation to remove unbound nucleic acids as described in Example 2 before use.

[0394] Size, zeta potential, and particle counts are measured using the method described in Example 3, and their stability is tested as described in Example 4. PNA in PMPs is quantified using an electrophoretic gel shift assay according to the protocol described by Nikravesh et al., Mol. Ther., 15(8):1537-1542, 2007. Briefly, antisense DNA against PNA is mixed with detergent-treated PNA-PMPs to release the PNA. The PNA-DNA mixture is run on a gel and visualized with a ssDNA dye. The duplex is then quantified by fluorescent imaging. Loaded and unloaded PMPs are compared to determine loading efficiency.

[0395] b) Treatment of Cimex lectularius with vATPase-E PNA-loaded grapefruit PMP to reduce insect fitness. PMPs loaded with the vATPase-E PNA identified above and a scrambled PNA control were loaded into PMPs according to the method described previously. Cimex lectularius were obtained from Sierra Research Laboratories (Modesto, CA). Bed bug colonies were maintained in glass cages containing cardboard hiding places at 25°C and 40-45% (ambient) humidity under a 12:12 photoperiod. Colonies were blood-fed weekly with parafilm-membrane feeders containing defibrinated rabbit blood (Hemostat Laboratories, Dixon, CA).

[0396] Before treatment with PNA-loaded PMPs, 0- to 2-week-old adult bed bugs that had not been blood-fed for 4 days were isolated and placed in glass jars for 2 days to mate. Males were selected and removed, and female bed bugs were separated into experimental cohorts of 10-15 animals housed together. Female bed bugs were treated by feeding them defibrinated rabbit blood supplemented with vATPase-E PNA-loaded PMPs or scrambled PNA-loaded PMPs at final concentrations of 0, 0.1, 1, 5, or 10 μM over 15 minutes until fully expanded. Bed bugs fed only defibrinated rabbit blood served as controls for the feeding experiments. After PNA-loaded PMP treatment, cohorts of 10-15 bed bugs were maintained at 25°C and 40-45% (ambient) humidity in Petri dishes containing sterile pads that provided a suitable substrate for oviposition (Advantec MFS, Inc.,...

Claims

1. A pathogen control composition comprising a plurality of plant messenger packs (PMPs), the PMPs comprising an anthracycline antibiotic, the composition being formulated for delivery to an animal pathogen, the PMPs being lipid structures comprising extracellular vesicles secreted and purified by citrus plants.

2. The pathogen control composition of claim 1 , wherein the multiple PMPs are reconstituted.

3. 2. The pathogen control composition according to claim 1, wherein the anthracycline antibiotic is doxorubicin.

4. The pathogen control composition according to claim 1 , wherein the pathogen is a bacterium.

5. 5. The pathogen control composition of claim 4, wherein the bacterium is a Pseudomonas species.

6. A method for preventing or treating infection or infestation by a pathogen in an animal, the method comprising administering to the animal an effective amount of a pathogen control composition comprising a plurality of PMPs, including an anthracycline antibiotic, and formulated for delivery to a pathogen in the animal, the PMPs being lipid structures secreted by citrus plants and comprising purified extracellular vesicles, wherein the likelihood or severity of infection or infestation by a pathogen is reduced in the treated animal compared to a reference animal not treated with the pathogen control composition, the animal being a veterinary subject or a livestock animal.

7. 7. The method of claim 6, wherein the pathogen control composition is (a) administered topically, orally, intravenously, or subcutaneously to the animal; or (b) delivered to at least one habitat where the pathogen or its vector grows, lives, reproduces, feeds, or infests.

8. 7. The method of claim 6, delivered as an ingestible composition for ingestion by the pathogen.

9. 7. The method of claim 6, wherein the pathogenic infection or infestation is a bacterial infection.

10. 10. The method of claim 9, wherein the bacterium is a Pseudomonas species.

11. 7. The method of claim 6, wherein the anthracycline antibiotic is doxorubicin.

Images