MicroRNA Expression Constructs and Uses Thereof

Abstract

The present disclosure relates to, for example, miRNA expression constructs for expressing multiple miRNAs and their use to knock down target gene expression. In some embodiments, the expression constructs include a promoter element, a spacer sequence, and an miRNA coding sequence. In some embodiments, the constructs provide enhanced immune cell function. [Selection diagram] None

Description

[Technical field]

[0001] This application claims the benefit of U.S. Provisional Patent Application No. 62 / 650,403, filed March 30, 2018, and U.S. Provisional Patent Application No. 62 / 650,387, filed March 30, 2018, the entireties of which are incorporated herein by reference.

[0002] Importing sequence listings The sequence listing, which is 20 KB (measured in Microsoft Windows®) and is contained in the file name “UGEN.P0020WO_ST25.txt”, created on April 1, 2019, was submitted herewith by electronic submission and is hereby incorporated by reference. [Background technology]

[0003] 1. Field of the invention The present invention relates generally to the field of molecular biology. More specifically, it relates to vectors for the expression of miRNA and uses thereof.

[0004] 2. Description of Prior Art The discovery and characterization of miRNA (miRNA) genes and their regulatory mechanisms have not only provided a new understanding of the physiological regulation of gene expression, but also opened new possibilities for miRNA-based therapeutics. The crown jewel of miRNA genes is the hairpin, which ultimately gives rise to a ribonucleoprotein complex that knocks down the expression of target genes through the identification and destruction of their transcripts. The structural elements of the hairpin provide signals for processing by DROSHA and DICER, resulting in the formation of a mature miRNA duplex of approximately 20–23 bp (Winter et al., 2009). The functional strand of the mature miRNA duplex is incorporated into the RISC complex, facilitating recognition of the target mRNA and ultimately gene knockdown. Synthetic miRNAs and by-products of the miRNA pathway, such as short hairpin RNA (shRNA) and small interfering RNA (siRNA), are currently commonly used tools in molecular biology. However, the pathway has not lived up to its therapeutic potential (Sullenger and Nair, 2016). siRNA, although most advanced in the clinic, has a short life span and is not suitable for long-term gene correction. shRNAs that bypass DROSHA processing can cause toxicity by overloading the cytoplasm with double-stranded RNA and disrupting the native miRNA pathway (Boudreau et al., 2009; Grimm, 2011). Synthetic miRNAs should overcome the above limitations since they mimic the native pathway (Maczuga et al., 2013), but their use may be limited by the relatively weak knockdown activity of miRNAs compared to shRNAs (Boudreau et al., 2008).

[0005] Synthetic miRNA genes can be expressed using lentiviral vectors, and thus genomic integration of the transgene and long-term expression in recipient cells have been shown to be safe in patients (Aiuti, et al., 2013; Biffi et al., 2013). However, further studies are required to optimize knockdown by synthetic miRNA genes to a degree that allows efficient therapeutic correction of pathological gene expression.

[0006] The architecture of synthetic miRNA genes, including the three-dimensional structure of the hairpin, is crucial for knockdown efficiency (Myburgh et al., 2014; Fowler et al., 2016). The length of the lower stem is important for efficient processing by DROSHA and the relative abundance of available mature miRNA strands, resulting in increased knockdown of the target gene. However, the architecture of miRNA genes is not limited to the hairpin structure. Other important elements include promoters and nucleotide sequences that are not directly linked to the hairpin, referred to as "spacers." In most cases, miRNA genes are driven by polII-dependent promoters that allow tissue-specific or / and inducible expression (Lee et al., 2004; Giry-Laterriere et al., 2011; Giry-Laterriere et al., 2011; Liu et al., 2013). The presence of a spacer appears to increase knockdown efficiency (Stegmeier et al., 2005), but it is unclear whether the length of the spacer sequence or other biophysical parameters are important.

[0007] Natural miRNA genes occur in linked form, and their architecture consists of an arrangement of several hairpins under the control of a single promoter (Bourhill et al., 2016). Such linkages can be powerful tools for biotechnology (Sun et al., 2006). There can be intervening sequences between the miRNA hairpins that spatially separate them, and they can be any sequence desired.

[0008] Adoptive cell therapy (ACT), particularly the use of chimeric antigen receptor (CAR) T cells engineered with T cell receptors (TCRs), has shown considerable promise for the treatment of various cancers and viral infections. While very high cure rates have been reported for certain cancers, especially hematological malignancies (Jackson et al., 2016), other malignancies, especially solid tumors, have seen limited success (O'Hara, 2016; Han et al., 2017; Irving et al., 2017). Many of these failures are due to the hostile tumor microenvironment, which provides physical, molecular, and immunosuppressive barriers for engineered immune cells to overcome. Similarly, to date, constructs that can be used to stimulate immune cell activity or inhibit immune checkpoints have not been developed. Summary of the Invention [Means for solving the problem]

[0009] In some embodiments, the disclosure provides an miRNA expression construct comprising a promoter element, a spacer at least 50 nucleotides in length, and an miRNA hairpin. In some embodiments, the spacer is 50-1,000 nucleotides in length. In some embodiments, the spacer is 50-900, 50-800, 100-800, 150-800, 150-750, 200-750, 200-700, 250-700, 250-650, 300-600, 300-550, or 300-500 nucleotides in length. In some embodiments, the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 365, 370, or 375 nucleotides in length. In some embodiments, the spacer is heterologous to the promoter element. In some embodiments, the spacer comprises an encoded open reading frame.

[0010] The promoter element according to the embodiment may be a eukaryotic promoter. In some embodiments, the eukaryotic promoter is a Pol II or Pol III promoter. In certain embodiments, the eukaryotic promoter is a Pol II promoter. In some embodiments, the promoter is an inducible, tissue-specific, or cell lineage-specific promoter. In certain embodiments, the promoter element is selected from the promoter elements in Table 1. In some embodiments, the promoter element is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to the EF1α promoter. In some embodiments, the EF1α promoter is a splice variant of the EF1α promoter. In some embodiments, the splice variant of the EF1α promoter is EF1s. In some embodiments, the EF1s promoter has a sequence that is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 45. In some embodiments, the EF1s promoter has a sequence that is 100% identical to SEQ ID NO: 45.

[0011] Spacers according to embodiments can be selected from the spacers in Table 9. In some embodiments, the spacer is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 46. In certain embodiments, the spacer is 100% identical to SEQ ID NO: 46. In some embodiments, the spacer is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 47. In certain embodiments, the spacer is identical to SEQ ID NO: 47. In some embodiments, the spacer is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 48. In certain embodiments, the spacer is identical to SEQ ID NO: 48. In some embodiments, the spacer is at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 49. In certain embodiments, the spacer is identical to SEQ ID NO: 49.

[0012] An miRNA hairpin according to an embodiment may comprise, from 5' to 3' and in the order of (a) to (g), (a) a mir-16 flanking sequence comprising the sequence of SEQ ID NO:25; (b) a first lower stem sequence comprising the mir-16 sequence of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (c) an antisense target sequence 22 nucleotides in length; (d) a mir-30 loop sequence comprising the sequence of SEQ ID NO:31; (e) a sense sequence that is complementary to the sequence of (c) except that it contains one or two mismatches relative to the sequence of (c), wherein the one or two mismatches include i) a mismatch located at positions 8-14 of the sense sequence, or ii) a mismatch at the 3' position (position 22) of the terminus of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b); and (g) a second flanking sequence. In some embodiments, the sense sequence (e) of the miRNA hairpin contains one mismatch to sequence (c) located at nucleotide position 11 of the sense sequence (e). In some embodiments, the sense sequence (e) of the miRNA hairpin contains two mismatches to sequence (c) located at (i) position 11 of the sense sequence (e) and (ii) the 3' nucleotide (position 22) of the end of the sense sequence (e). In some embodiments, the flanking sequence (g) is not complementary to the mir-16 flanking sequence (a). In certain embodiments, the miRNA hairpin sequence is selected from the sequences listed in Table 6. In some embodiments, the antisense target sequence is complementary to a CCR5 mRNA sequence. In some embodiments, the miRNA expression construct contains at least two repeats of the miRNA hairpin. In some embodiments, the at least two repeats are separated by an intervening sequence. In some embodiments, the miRNA expression construct is DNA. In some embodiments, the miRNA expression construct is RNA.

[0013] In some embodiments, the present disclosure provides an expression vector comprising an miRNA expression construct comprising a promoter element, a spacer of at least 50 nucleotides in length, and an miRNA hairpin. In some embodiments, the expression vector comprises two or more copies of the miRNA expression construct. In some embodiments, the two or more copies of the miRNA expression construct form a sequence encoding a polycistronic transcript. In some embodiments, the expression vector is a viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. In further embodiments, the expression vector comprises at least one drug resistance marker.

[0014] In some embodiments, the disclosure provides a host cell comprising an miRNA expression construct, or an expression vector comprising an miRNA expression construct, comprising a promoter element, a spacer at least 50 nucleotides in length, and an miRNA hairpin.

[0015] In some embodiments, the disclosure provides a method for reducing expression of a gene in a cell, comprising expressing an miRNA expression construct comprising a promoter element, a spacer of at least 50 nucleotides in length, and an miRNA hairpin, the miRNA hairpin comprising (a) a mir-16 flanking sequence comprising the sequence of SEQ ID NO:25; (b) a first lower stem sequence comprising the mir-16 sequence of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (c) an antisense target sequence 22 nucleotides in length; (d) a second lower stem sequence comprising the mir-16 sequence of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (e) an antisense target sequence 22 nucleotides in length; (f) a second lower stem sequence comprising the mir-16 sequence of SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (e) a sense sequence that is complementary to the sequence of (c) except that it contains one or two mismatches relative to the sequence of (c), the one or two mismatches being i) a mismatch located at positions 8-14 of the sense sequence, or ii) a mismatch at position 3' (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b); and (g) a second flanking sequence, wherein the antisense target sequence (c) is complementary to the sense strand of the gene. In some embodiments, expressing the miRNA expression construct in the cell comprises transfecting the cell with a nucleic acid that includes the miRNA expression construct. In some embodiments, expressing the miRNA expression construct comprises expressing the miRNA expression construct from an expression vector. In some embodiments, the expression vector is an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, or a lentivirus vector. In some embodiments, the gene to be silenced is CCR5. In some embodiments, the cell is a human cell. In some embodiments, the method is an in vivo method. In other embodiments, the method is an in vitro or ex vivo method. In some embodiments, the method further comprises transplanting the cell expressing the miRNA expression construct into an organism. In some embodiments, the cell is contained within an organism.

[0016] In some embodiments, the present disclosure provides a recombinant nucleic acid molecule comprising a promoter element, a spacer at least 50 nucleotides in length, and at least one miRNA hairpin, the miRNA hairpin comprising, from 5' to 3' and in the order of (a) to (g), (a) a mir-16 flanking sequence, (b) a first lower stem sequence comprising a mir-16 sequence, (c) an antisense target sequence 22 nucleotides in length, (d) a mir-30 loop sequence, (e) one or two nucleotides in length relative to the sequence in (c). The present invention provides a recombinant nucleic acid molecule comprising: a sense sequence that is complementary to the sequence of (c) except for one mismatch, the one or two mismatches including i) a mismatch located at positions 8-14 of the sense sequence, or ii) a mismatch at a 3' position (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b), the lower stem being at least 11 nucleotides in length; and (g) a second flanking sequence. In some embodiments, the lower stem is 11, 12, 13, 14, 15, 16, or 17 nucleotides in length. In some embodiments, the first lower stem (b) comprises a mir-16 sequence of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30. In some embodiments, the mir-16 flanking sequence (a) comprises a sequence of SEQ ID NO:25. In some embodiments, the mir-30 loop sequence comprises a sequence of SEQ ID NO:31. In some embodiments, the sense sequence (e) contains one mismatch to sequence (c) located at nucleotide position 11 of the sense sequence (e). In some embodiments, the sense sequence (e) contains two mismatches to sequence (c) located (i) at position 11 of the sense sequence (e) and (ii) at the 3' nucleotide (position 22) of the end of the sense sequence (e). In some embodiments, the second flanking sequence (g) is not complementary to the mir-16 flanking sequence (a). In some embodiments, the miRNA hairpin sequence is selected from the sequences listed in Table 6. In some embodiments, the recombinant nucleic acid molecule comprises at least two repeats of sequences (a)-(g).In some embodiments, at least two repeats are separated by an intervening sequence. In some embodiments, the antisense target sequence is complementary to a CCR5 mRNA sequence. In some embodiments, the recombinant nucleic acid molecule is RNA. In some embodiments, the recombinant nucleic acid molecule is DNA.

[0017] In some embodiments, the present disclosure provides a recombinant nucleic acid molecule comprising a promoter element, a spacer at least 50 nucleotides in length, and at least one miRNA hairpin, the miRNA hairpin comprising, from 5' to 3' and in the order of (a) to (g), (a) a mir-16 flanking sequence, (b) a first lower stem sequence comprising a mir-16 sequence, (c) an antisense target sequence 22 nucleotides in length, (d) a mir-30 loop sequence, (e) one or two mismatches to the sequence in (c). and (c) a sense sequence that is complementary to the sequence of (c) except that the sense sequence includes a mismatch at position 8-14 of the sense sequence, or a mismatch at position 3' (position 22) of the end of the sense sequence, (f) a second lower stem sequence that is complementary to the sequence of (b), the lower stem being at least 11 nucleotides in length, and (g) a second flanking sequence. In some embodiments, the promoter is a eukaryotic promoter. In certain embodiments, the eukaryotic promoter is a Pol II or Pol III promoter. In certain embodiments, the eukaryotic promoter is a Pol II promoter. In some embodiments, the promoter is an inducible, tissue-specific or cell lineage-specific promoter. In some embodiments, the expression vector includes two or more copies of the recombinant nucleic acid molecule. In some embodiments, the two or more copies of the recombinant nucleic acid molecule form a sequence encoding a polycistronic transcript. In some embodiments, the expression vector is a viral vector. In certain embodiments, the expression vector is an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, or a lentivirus vector. In some embodiments, the expression vector further comprises at least one drug resistance marker.

[0018] In some embodiments, the present disclosure provides a recombinant nucleic acid molecule comprising a promoter element, a spacer at least 50 nucleotides in length, and at least one miRNA hairpin, the miRNA hairpin comprising, from 5' to 3' and in the order of (a) to (g), (a) a mir-16 flanking sequence, (b) a first lower stem sequence comprising a mir-16 sequence, (c) an antisense target sequence 22 nucleotides in length, (d) a mir-30 loop sequence, (e) one or two mismatches to the sequence in (c). and (c) a sense sequence that is complementary to the sequence of (c), where the one or two mismatches include i) a mismatch located at positions 8 to 14 of the sense sequence, or ii) a mismatch at position 3' (position 22) of the terminus of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b), where the lower stem is at least 11 nucleotides in length; and (g) a second flanking sequence.

[0019] In some embodiments, the disclosure provides a method for reducing expression of a gene in a cell, comprising a recombinant nucleic acid molecule comprising a promoter element, a spacer at least 50 nucleotides in length, and at least one miRNA hairpin, the miRNA hairpin comprising, from 5' to 3', and in the order of (a) to (g), (a) a mir-16 flanking sequence, (b) a first lower stem sequence comprising a mir-16 sequence, (c) an antisense target sequence 22 nucleotides in length, (d) a mir-30 loop sequence, and (e) one or two mismatches to the sequence in (c). and (c) a sense sequence that is complementary to the sequence of (b) except for (a) and (b) except for (c), where the one or two mismatches include i) a mismatch located at position 8-14 of the sense sequence, or ii) a mismatch at position 3' (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b), where the lower stem is at least 11 nucleotides in length; and (g) a second flanking sequence in the cell, where the antisense target sequence (c) is complementary to the sense strand of the gene. In some embodiments, expressing the nucleic acid molecule in the cell comprises transfecting the cell with the recombinant nucleic acid. In some embodiments, expressing the recombinant nucleic acid molecule in the cell comprises expressing the nucleic acid molecule from an expression vector. In some embodiments, the expression vector is a viral vector. In certain embodiments, the expression vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. In some embodiments, the gene is CCR5. In some embodiments, the cell is a human cell. In some embodiments, the method is further defined as an in vivo method. In other embodiments, the method is defined as an in vitro or ex vivo method. In some embodiments, the method further comprises implanting the cell expressing the recombinant nucleic acid molecule into an organism. In some embodiments, the cell is contained within an organism.

[0020] In some embodiments, the present disclosure provides an miRNA expression construct comprising a promoter sequence and at least two miRNA hairpins, the at least two miRNA hairpins targeting a transcript of an immune checkpoint gene. In some embodiments, the at least two miRNA hairpins target different sequences. In some embodiments, the at least two miRNA hairpins target different sequences of the transcript of the same gene. In another embodiment, the miRNA hairpins target different transcripts. In some embodiments, the miRNA hairpins target transcripts of different genes. In some embodiments, the at least two miRNA hairpins are selected from the group consisting of PD1, CTLA4, LAG3, TIM3, TIGIT, CD96, BTLA, KIR, adenosine A2a receptor, Vista, IDO, FAS, SIRP alpha, CISH, SHP-1, FOXP3, LAIR1, PVRIG, PPP2CA, PPP2CB, PTPN6, PTPN22, CD160, CRTAM, SIGLEC7, SIGLEC9, CD244, TNFRSF10B, TNFRSF10A, CASP8, CAS The compound targets the transcript of at least one immune checkpoint gene selected from the group consisting of P10, CASP3, CASP6, CASP7, FADD, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, and GUCY1B3.

[0021] The miRNA expression construct according to the embodiment may comprise at least three miRNA hairpins. In some embodiments, the at least three miRNA hairpins are different. In some embodiments, the at least three different miRNA hairpins target the transcript of at least one immune checkpoint gene. In some embodiments, the at least three different miRNA hairpins target three different immune checkpoint genes. In some embodiments, the miRNA expression construct comprises at least four, five, six, seven, eight, nine, or ten miRNA hairpins. In some embodiments, the at least four, five, six, seven, eight, nine, or ten miRNA hairpins are different. In some embodiments, the at least four, five, six, seven, eight, nine, or ten miRNA hairpins target the transcript of two, three, four, or five different immune checkpoint genes.

[0022] In some embodiments, the miRNA expression construct may include a spacer sequence located between the promoter and the at least two miRNA hairpins. In some embodiments, the spacer is 50 to 1,000 nucleotides in length.

[0023] In some embodiments, the promoter sequence of miRNA expression construct is at least 80% identical to EF1s promoter sequence.In some embodiments, the promoter sequence is at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to EF1s promoter sequence.In some embodiments, the promoter sequence is identical to EF1s promoter sequence.

[0024] In some embodiments, the promoter sequence of the miRNA expression construct is at least 80% identical to the UBI promoter sequence.In some embodiments, the promoter sequence is at least 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the UBI promoter sequence.In some embodiments, the promoter sequence is identical to the UBI promoter sequence.

[0025] The miRNA expression construct according to the embodiment may further comprise a receptor sequence. In some embodiments, the receptor sequence is a chimeric antigen receptor. In some embodiments, the receptor sequence is a T cell receptor sequence.

[0026] The miRNA expression construct according to the embodiment may further comprise a selection marker. In some embodiments, the selection marker is a selection gene. In some embodiments, the selection gene is LNGFR or its derivative. In some embodiments, the miRNA expression construct further comprises a suicide gene. For example, the suicide gene can be herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), or thymidylate synthase (TYMS).

[0027] The miRNA expression construct according to the embodiment may comprise a peptide cleavage site. In some aspects, the peptide cleavage site is a 2A peptide. In some aspects, the 2A peptide is selected from the group including 2A, P2A, T2A, E2A, F2A, BmCPV 2A, and BmIFV 2A. In a particular aspect, the 2A peptide is T2A.

[0028] In some embodiments, the present disclosure provides a vector comprising a miRNA expression construct comprising a promoter sequence and at least two miRNA hairpins, the at least two miRNA hairpins targeting the transcript of an immune checkpoint gene. In some embodiments, the vector is a viral vector. In some embodiments, the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector.

[0029] In some embodiments, the present disclosure provides a mammalian cell comprising an miRNA expression construct comprising a promoter sequence and at least two miRNA hairpins, the at least two miRNA hairpins targeting a transcript of an immune checkpoint gene, or a vector comprising the miRNA expression construct. In some embodiments, the mammalian cell is an immune effector cell. In some embodiments, the immune effector cell is selected from the group comprising T cells, TILs, TCR-engineered T cells, CAR T cells, NK cells, NK / T cells, and T regulatory cells.

[0030] In some embodiments, methods are provided for preparing engineered immune effector cells, comprising transfecting or transducing immune effector cells with an miRNA expression construct according to an embodiment, or transducing immune effector cells with a vector comprising an miRNA expression construct according to an embodiment. In some aspects, the methods for preparing engineered immune effector cells comprise transfecting or transducing immune effector cells with a chimeric antigen receptor sequence or a T cell receptor sequence, and then transfecting or transducing the cells with an miRNA expression construct according to an embodiment, or a vector comprising an miRNA expression construct according to an embodiment.

[0031] In some embodiments, a method for preparing engineered immune effector cells from a patient is provided. In some aspects, the method for preparing engineered immune effector cells from a patient includes (a) collecting immune effector cells from the patient, and (b) transfecting the immune effector cells with an miRNA expression construct of the embodiment or transducing the immune effector cells with a vector comprising the miRNA expression construct to generate engineered immune effector cells. In some aspects, the method for preparing engineered immune effector cells from a patient includes (a) collecting immune effector cells from the patient, and (b) transducing or transfecting the immune effector cells with a chimeric antigen receptor or T cell receptor to generate engineered immune effector cells, and (c) transducing or transfecting the engineered immune effector cells with an miRNA expression construct according to the embodiment or a vector comprising the miRNA expression construct according to the embodiment to generate engineered immune effector cells. In yet another aspect, the immune effector cells of the embodiment are T cells, NK cells, or NK / T cells. In some embodiments, the immune effector cells further express a recombinant T cell receptor or a chimeric antigen receptor (CAR).

[0032] In some embodiments, methods are provided for treating a patient in need of treatment, comprising introducing into the patient an engineered immune effector cell according to an embodiment, e.g., in some aspects, the patient has cancer.

[0033] In a further embodiment, immune effector cells are provided that include one or more miRNA expression constructs targeting CCR5 and immune checkpoint inhibitor genes, such as PD1, CTLA4, LAG3, TIM3, TIGIT, CD96, BTLA, KIR, adenosine A2a receptor, ARG2 (arginase 2), Vista, IDO, FAS, SIRP alpha, CISH, SHP-1, FOXP3, LAIR1, PVRIG, PPP2CA, PPP2CB, PTPN6, PTPN22, CD160, CRTAM, SIGLEC7, SIGLEC9, CD244, TNFRSF10B. , TNFRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, or GUCY1B3. In some embodiments, the checkpoint inhibitor gene is PD1. In some embodiments, the PD1 target sequence is SEQ ID NO: 59, 60, or 61, preferably SEQ ID NO: 59. In some embodiments, the immune effector cell is selected from the group consisting of T cells, TILS, TCR engineered T cells, CAR T cells, NK cells, NK / T cells, T regulatory cells, monocytes, and macrophages. For example, the cell can be a T cell, such as a CAR T cell. In some embodiments, the cell comprises a CAR targeted to HIV-infected cells. In further embodiments, the cell comprises one or more miRNA expression constructs targeting CCR5 and at least two immune checkpoint inhibitor genes. Thus, the cell can comprise any of the miRNA expression constructs of the embodiments.

[0034] In yet another embodiment, an expression construct is provided, comprising an miRNA sequence that targets CCR5 and an immune checkpoint inhibitor gene.For example, the miRNA sequence can be a sequence according to any of the embodiments described herein.In some aspects, the construct further comprises a CAR expression sequence, such as a CAR sequence that targets HIV-infected cells.

[0035] As used herein, "essentially free" with respect to a particular component is used herein to mean that the particular component is not intentionally incorporated into the composition and / or is present only as a contaminant or in trace amounts. The total amount of the particular component resulting from any unintentional contaminant of the composition is preferably below 0.01%. Most preferred are compositions in which any amount of the particular component cannot be detected by standard analytical methods.

[0036] As used herein, in the specification and claims, "a" or "an" may mean one or more. As used herein, in the specification and claims, when used in conjunction with the word "comprising," the word "a" or "an" may mean one or more. As used herein, in the specification and claims, "another" or "further" may mean at least a second or more.

[0037] As used herein, in the specification and claims, the term "about" is used to indicate that it includes the inherent variation of error for the device, method being employed to determine the value, or the variation that exists among test subjects.

[0038] Other objects, features, and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating certain particular embodiments of the present invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. In certain embodiments, for example, the following items are provided: (Item 1) An miRNA expression construct comprising a promoter element, a spacer of at least 50 nucleotides in length, and an miRNA hairpin. (Item 2) 2. The miRNA expression construct according to item 1, wherein the spacer is 50 to 1,000 nucleotides in length. (Item 3) 2. The miRNA expression construct according to item 1, wherein the spacer is 50 to 900, 50 to 800, 100 to 800, or 50 to 800 nucleotides in length. (Item 4) 2. The miRNA expression construct of item 1, wherein the spacer is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 200 nucleotides in length. (Item 5) 2. The miRNA expression construct of item 1, wherein the spacer is heterologous to the promoter element. (Item 6) 2. The miRNA expression construct of item 1, wherein the spacer comprises an encoded open reading frame. (Item 7) 2. The miRNA expression construct of item 1, wherein the spacer is at least 375 nucleotides in length. (Item 8) 2. The miRNA expression construct of item 1, wherein the promoter is a eukaryotic promoter. (Item 9) 9. The miRNA expression construct of item 8, wherein the eukaryotic promoter is a Pol II or Pol III promoter. (Item 10) 10. The miRNA expression construct of item 9, wherein the eukaryotic promoter is a Pol II promoter. (Item 11) 2. The miRNA expression construct of item 1, wherein the promoter is an inducible, tissue-specific, or cell lineage-specific promoter. (Item 12) 12. The miRNA expression construct according to any of items 1 to 11, wherein the promoter element is selected from the promoter elements in Table 1. (Item 13) 13. The miRNA expression construct of item 12, wherein the promoter element is at least 80% identical to the EF1α promoter. (Item 14) 14. The miRNA expression construct of item 13, wherein the EF1α promoter is a splice variant of the EF1α promoter. (Item 15) 15. The miRNA expression construct of item 14, wherein the splice variant of the EF1α promoter is EF1s. (Item 16) 16. The miRNA expression construct of item 15, wherein the EF1s promoter has a sequence that is at least 80%, 85%, 90%, or 95% identical to SEQ ID NO:45. (Item 17) 17. The miRNA expression construct according to any of items 1 to 16, wherein the spacer is selected from the spacers in Table 9. (Item 18) 18. The miRNA expression construct of item 17, wherein the spacer is at least 80% identical to SEQ ID NO: 46. (Item 19) 19. The miRNA expression construct of item 18, wherein the sequence of the spacer is SEQ ID NO: 46. (Item 20) 18. The miRNA expression construct of item 17, wherein the spacer is at least 80% identical to SEQ ID NO: 47. (Item 21) 21. The miRNA expression construct of item 20, wherein the sequence of the spacer is SEQ ID NO: 47. (Item 22) 18. The miRNA expression construct of item 17, wherein the spacer is at least 80% identical to SEQ ID NO: 48. (Item 23) 23. The miRNA expression construct of item 22, wherein the sequence of the spacer is SEQ ID NO: 48. (Item 24) 18. The miRNA expression construct of item 17, wherein the spacer is at least 80% identical to SEQ ID NO:49. (Item 25) 25. The miRNA expression construct of item 24, wherein the sequence of the spacer is SEQ ID NO: 49. (Item 26) The miRNA hairpin is arranged from 5' to 3' and in the order of (a) to (g): (a) a mir-16 flanking sequence comprising the sequence of SEQ ID NO: 25; (b) a first lower stem sequence comprising the mir-16 sequence of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (c) an antisense target sequence having a length of 22 nucleotides; (d) a mir-30 loop sequence comprising the sequence of SEQ ID NO: 31; (e) a sense sequence that is complementary to the sequence of (c) except that it contains one or two mismatches relative to the sequence of (c), wherein the one or two mismatches are i) a mismatch located at positions 8 to 14 of the sense sequence; or ii) the sense sequence, comprising a mismatch at the 3' position (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b); and (g) a second flanking sequence. (Item 27) 27. The miRNA expression construct of item 26, wherein the sense sequence (e) of the miRNA hairpin contains one mismatch to sequence (c) located at nucleotide 11 of the sense sequence (e). (Item 28) 27. The miRNA expression construct of item 26, wherein the sense sequence (e) of the miRNA hairpin contains two mismatches to sequence (c) located (i) at position 11 of the sense sequence (e) and (ii) at the 3' nucleotide (position 22) of the terminus of the sense sequence (e). (Item 29) 29. The miRNA expression construct according to any of items 26 to 28, wherein the flanking sequence (g) is not complementary to the mir-16 flanking sequence (a). (Item 30) 30. The miRNA expression construct according to any of items 1 to 29, wherein the miRNA hairpin sequence is selected from the sequences listed in Table 6. (Item 31) 31. The miRNA expression construct according to any one of items 1 to 30, wherein the nucleic acid molecule is RNA. (Item 32) 31. The miRNA expression construct according to any one of items 1 to 30, wherein the nucleic acid molecule is DNA. (Item 33) 33. The miRNA expression construct of any one of items 1 to 32, wherein the nucleic acid molecule comprises at least two repeats of the miRNA hairpin. (Item 34) 34. The miRNA expression construct of claim 33, wherein the at least two repeats are separated by an intervening sequence. (Item 35) 35. The miRNA expression construct of any one of items 26 to 34, wherein the antisense target sequence is complementary to a CCR5 mRNA sequence. (Item 36) 36. An expression vector comprising the miRNA expression construct according to any one of items 1 to 35. (Item 37) 37. The expression vector of item 36, comprising two or more copies of the nucleic acid sequence of item 1. (Item 38) 38. The expression vector according to Item 37, wherein two or more copies of the nucleic acid sequence according to Item 1 form an array encoding a polycistronic transcription product. (Item 39) 37. The expression vector of item 36, wherein the expression vector is an adenovirus vector, an adeno-associated virus vector, a retrovirus vector, or a lentivirus vector. (Item 40) 37. The expression vector of item 36, further comprising at least one drug resistance marker. (Item 41) A host cell comprising the nucleic acid molecule according to any one of items 1 to 35 or the expression vector according to any one of items 36 to 40. (Item 42) 42. The host cell of item 41, wherein the host cell is an immune effector cell. (Item 43) 42. The host cell of claim 41, wherein the host cell is a T cell or a CAR T cell. (Item 44) 36. A method for reducing expression of a gene in a cell, comprising expressing in the cell the nucleic acid molecule according to any one of items 26 to 35, wherein the antisense target sequence (c) is complementary to a sense strand of the gene. (Item 45) 45. The method of claim 44, wherein expressing the nucleic acid molecule in the cell comprises transfecting the cell with a nucleic acid. (Item 46) 45. The method of claim 44, wherein expressing the nucleic acid molecule in the cell comprises inserting the nucleic acid molecule into the genome of the cell by a TALE nuclease, a zinc finger nuclease, or CRISPR / Cas9. (Item 47) 45. The method of claim 44, wherein expressing the nucleic acid molecule in the cell comprises expressing the nucleic acid molecule from an expression vector. (Item 48) 48. The method of claim 47, wherein the expression vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. (Item 49) 45. The method of item 44, wherein the gene is CCR5. (Item 50) 45. The method of claim 44, wherein the cell is a human cell. (Item 51) 45. The method of item 44, further defined as an in vivo method. (Item 52) 45. The method of item 44, further defined as an in vitro or ex vivo method. (Item 53) 53. The method of claim 52, further comprising transplanting cells expressing the nucleic acid molecule into an organism. (Item 54) 45. The method of claim 44, wherein the cell is contained in an organism. (Item 55) 1. A recombinant nucleic acid molecule comprising: a promoter element, a spacer at least 50 nucleotides in length, and at least one miRNA hairpin, the miRNA hairpin comprising, from 5' to 3' and in the order of (a) to (g): (a) mir-16 flanking sequences; (b) the first lower stem sequence containing the mir-16 sequence; (c) an antisense target sequence having a length of 22 nucleotides; (d) mir-30 loop sequence; (e) a sense sequence that is complementary to the sequence of (c) except that it contains one or two mismatches relative to the sequence of (c), wherein the one or two mismatches are i) a mismatch located at positions 8 to 14 of the sense sequence; or ii) the sense sequence, comprising a mismatch at the 3' position (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b), wherein the lower stem is at least 11 nucleotides in length; and (g) a second flanking sequence. (Item 56) 56. The nucleic acid molecule of item 55, wherein the lower stem is 11, 12, 13, 14, 15, 16, or 17 nucleotides in length. (Item 57) 56. The nucleic acid molecule of item 55, wherein the first lower stem (b) comprises the mir-16 sequence of SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, or SEQ ID NO: 30. (Item 58) 56. The nucleic acid molecule of item 55, wherein the mir-16 flanking sequence (a) comprises the sequence of SEQ ID NO: 25. (Item 59) 56. The nucleic acid molecule of item 55, wherein the mir-30 loop sequence comprises the sequence of SEQ ID NO:31. (Item 60) 56. The nucleic acid molecule according to item 55, wherein the sense sequence (e) contains one mismatch with sequence (c) located at nucleotide 11 of the sense sequence (e). (Item 61) 56. The nucleic acid molecule according to item 55, wherein the sense sequence (e) contains two mismatches with respect to sequence (c) located (i) at position 11 of the sense sequence (e) and (ii) at the 3' nucleotide (position 22) of the end of the sense sequence (e). (Item 62) 62. The nucleic acid molecule according to any one of items 55 to 61, comprising a flanking sequence (g), said flanking sequence not complementary to said mir-16 flanking sequence (a). (Item 63) 63. The nucleic acid molecule according to any one of items 55 to 62, wherein the miRNA hairpin sequence is selected from the sequences listed in Table 6 or Table 10. (Item 64) 64. The nucleic acid molecule according to any one of items 55 to 63, wherein the nucleic acid molecule is RNA. (Item 65) 64. The nucleic acid molecule according to any one of items 55 to 63, wherein the nucleic acid molecule is DNA. (Item 66) 66. The nucleic acid molecule according to any one of items 55 to 65, wherein the nucleic acid molecule comprises at least two repeats of sequences (a) to (g). (Item 67) 67. The nucleic acid molecule of claim 66, wherein the at least two repeats are separated by an intervening sequence. (Item 68) 68. The nucleic acid molecule of any one of items 55 to 67, wherein the antisense target sequence is complementary to a CCR5 mRNA sequence. (Item 69) 69. An expression vector comprising the nucleic acid according to any one of Items 55 to 68. (Item 70) 70. The expression vector of item 69, wherein the promoter is a eukaryotic promoter. (Item 71) 71. The expression vector of item 70, wherein the eukaryotic promoter is a Pol II or Pol III promoter. (Item 72) 72. The expression vector of item 71, wherein the eukaryotic promoter is a Pol II promoter. (Item 73) 70. The expression vector of item 69, wherein the promoter is an inducible, tissue-specific or cell lineage-specific promoter. (Item 74) 70. The expression vector of item 69, comprising two or more copies of the nucleic acid sequence of item 55. (Item 75) 75. The expression vector of claim 74, wherein two or more copies of the nucleic acid sequence of claim 55 form a sequence encoding a polycistronic transcription product. (Item 76) 70. The expression vector of item 69, wherein the expression vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. (Item 77) 70. The expression vector of item 69, further comprising at least one drug resistance marker. (Item 78) 78. A host cell comprising the nucleic acid molecule according to any one of items 55 to 68 or the expression vector according to any one of items 69 to 77. (Item 79) 69. A method for reducing expression of a gene in a cell, comprising expressing in said cell the nucleic acid molecule according to any one of items 55 to 68, wherein said antisense target sequence (c) is complementary to a sense strand of said gene. (Item 80) 80. The method of claim 79, wherein expressing the nucleic acid molecule in the cell comprises integrating the nucleic acid molecule into the genome of the cell using a TALE nuclease, a zinc finger nuclease, or CRISPR / Cas9. (Item 81) 80. The method of claim 79, wherein expressing the nucleic acid molecule in the cell comprises transfecting the cell with a nucleic acid. (Item 82) 80. The method of claim 79, wherein expressing the nucleic acid molecule in the cell comprises expressing the nucleic acid molecule from an expression vector. (Item 83) 83. The method of claim 82, wherein the expression vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. (Item 84) 80. The method of claim 79, wherein the gene is CCR5. (Item 85) 80. The method of claim 79, wherein the cell is a human cell. (Item 86) 80. The method of item 79, further defined as an in vivo method. (Item 87) 80. The method of item 79, further defined as an in vitro or ex vivo method. (Item 88) 88. The method of claim 87, further comprising transplanting cells expressing the nucleic acid molecule into an organism. (Item 89) 80. The method of claim 79, wherein the cell is contained in an organism. (Item 90) An miRNA expression construct comprising a promoter sequence and at least two miRNA hairpins, wherein the at least two miRNA hairpins target a transcript of an immune checkpoint gene. (Item 91) 91. The miRNA expression construct of claim 90, wherein the at least two miRNA hairpins are identical. (Item 92) 91. The miRNA expression construct of claim 90, wherein the at least two miRNA hairpins target different sequences. (Item 93) 93. The miRNA expression construct of item 92, wherein the at least two miRNA hairpins target different sequences of the transcript of the same gene. (Item 94) 93. The miRNA expression construct of claim 92, wherein the miRNA hairpins target different transcripts. (Item 95) 95. The miRNA expression construct of item 94, wherein the miRNA hairpins target transcripts of different genes. (Item 96) 91. The miRNA expression construct of item 90, comprising at least three miRNA hairpins. (Item 97) 97. The miRNA expression construct of claim 96, wherein each of the at least three miRNA hairpins is different. (Item 98) 97. The miRNA expression construct of claim 96, wherein at least two of the at least three miRNA hairpins are different. (Item 99) 98. The miRNA expression construct of claim 97, wherein the at least three different miRNA hairpins target transcripts of two or three different immune checkpoint genes. (Item 100) The miRNA expression construct of item 90, comprising at least four, five, six, seven, eight, nine, or ten miRNA hairpins. (Item 101) 101. The miRNA expression construct of claim 100, wherein at least two of the at least four, five, six, seven, eight, nine, or ten miRNA hairpins are different. (Item 102) 101. The miRNA expression construct of claim 100, wherein the at least four, five, six, seven, eight, nine, or ten miRNA hairpins are each different. (Item 103) 103. The miRNA expression construct of claim 102, wherein the at least four, five, six, seven, eight, nine, or ten different miRNA hairpins target transcripts of two, three, four, or five different immune checkpoint genes. (Item 104) 91. The miRNA expression construct of item 90, further comprising a spacer sequence position between the promoter and the at least two miRNA hairpins. (Item 105) 91. The miRNA expression construct according to item 90, wherein the spacer is 50 to 1,000 nucleotides in length. (Item 106) The at least two miRNA hairpins are selected from the group consisting of PD1, CTLA4, LAG3, TIM3, TIGIT, CD96, BTLA, KIR, adenosine A2a receptor, ARG2 (arginase 2), Vista, IDO, FAS, SIRP alpha, CISH, SHP-1, FOXP3, LAIR1, PVRIG, PPP2CA, PPP2CB, PTPN6, PTPN22, CD160, CRTAM, SIGLEC7, SIGLEC9, CD244, TNFRSF10B, TNFRSF10A, CASP8, CASP10, CAS 91. The miRNA expression construct of paragraph 90, which targets a transcript of at least one immune checkpoint gene selected from the group consisting of P3, CASP6, CASP7, FADD, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, and GUCY1B3. (Item 107) 107. The miRNA expression construct according to any of items 90 to 106, wherein the promoter sequence is at least 80% identical to the EF1s promoter sequence. (Item 108) 107. The miRNA expression construct according to any of items 90 to 106, wherein the promoter sequence is at least 80% identical to the UBI promoter sequence. (Item 109) 109. The miRNA expression construct according to any of items 90 to 108, wherein the miRNA expression construct further comprises a chimeric antigen receptor sequence. (Item 110) 109. The miRNA expression construct according to any of items 90 to 108, wherein the miRNA expression construct further comprises a T cell receptor sequence. (Item 111) 111. The miRNA expression construct according to any of items 90 to 110, wherein the miRNA expression construct further comprises a selection gene. (Item 112) 112. The miRNA expression construct of item 111, wherein the selection gene is LNGFR or a derivative thereof. (Item 113) 111. The miRNA expression construct according to any of items 90 to 110, wherein the miRNA expression construct further comprises a suicide gene. (Item 114) 114. The miRNA expression construct of item 113, wherein the suicide gene is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), and thymidylate synthase (TYMS). (Item 115) 114. The miRNA expression construct according to any of items 90 to 113, wherein the miRNA expression construct further comprises a peptide cleavage site. (Item 116) 116. The miRNA expression construct of claim 115, wherein the peptide cleavage site is a 2A peptide. (Item 117) 117. The miRNA expression construct of item 116, wherein the 2A peptide is selected from the group including 2A, P2A, T2A, E2A, F2A, BmCPV 2A, and BmIFV 2A. (Item 118) 118. The miRNA expression construct of claim 117, wherein the 2A peptide is T2A. (Item 119) A vector comprising the miRNA expression construct according to any one of items 90 to 118. (Item 120) Item 120. The vector according to item 119, wherein the vector is a viral vector. (Item 121) Item 121. The vector of item 120, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector. (Item 122) 122. A mammalian cell comprising the miRNA expression construct according to any of items 90 to 118 or the vector according to any of items 119 to 121. (Item 123) 123. The mammalian cell of item 122, wherein the mammalian cell is an immune effector cell. (Item 124) 123. The mammalian cell of item 122, wherein the cell is engineered for reduced expression of CCR5. (Item 125) 124. The immune effector cell of item 123, wherein the immune effector cell is selected from the group comprising T cells, TILs, TCR engineered T cells, CAR T cells, NK cells, NK / T cells, T regulatory cells, monocytes, and macrophages. (Item 126) 122. A method for preparing engineered immune effector cells, comprising transfecting or transducing said immune effector cells with an miRNA expression construct according to any of items 90 to 118, or transducing said immune effector cells with a vector according to any of items 118 to 121. (Item 127) 1. A method for preparing an engineered immune effector cell, comprising transfecting or transducing an immune effector cell with a chimeric antigen receptor sequence or a T cell receptor sequence and then transfecting or transducing the cell with the miRNA expression construct according to any of items 90 to 118 or the vector according to any of items 119 to 121. (Item 128) 13. A method for preparing an engineered immune effector cell, comprising integrating an miRNA expression construct according to any one of items 90 to 118 into the genome of the cell by TALE nuclease, megaTAL, zinc finger nuclease, or CRISPR / Cas9. (Item 129) 1. A method for preparing engineered immune effector cells from a patient, comprising: (a) harvesting immune effector cells from the patient; (b) transfecting the immune effector cells with an miRNA expression construct according to any one of items 90 to 118, or transducing the immune effector cells with a vector according to any one of items 119 to 121, to generate engineered immune effector cells. (Item 130) 1. A method for preparing engineered immune effector cells from a patient, comprising: (a) harvesting immune effector cells from the patient; (b) transducing or transfecting the immune effector cells with a chimeric antigen receptor or a T cell receptor to generate modified immune effector cells; (c) transducing or transfecting the modified immune effector cells with the miRNA expression construct of any of items 90 to 118 or the vector of any of items 119 to 121 to generate engineered immune effector cells. (Item 131) 131. The method of claim 130, wherein the chimeric antigen receptor or T cell receptor is encoded by the miRNA expression construct or vector. (Item 132) 132. The method of any of items 129 to 131, wherein transducing or transfecting the immune effector cells with the miRNA expression construct comprises integrating the miRNA expression construct into the genome by TALE nuclease, megaTAL, zinc finger nuclease, or CRISPR / Cas9. (Item 133) 133. A method for treating a patient in need of treatment, the method comprising introducing into the patient a cell according to any one of items 122 to 132. (Item 134) An immune effector cell comprising one or more miRNA expression constructs targeting CCR5 and an immune checkpoint inhibitor gene. (Item 135) The checkpoint inhibitor gene is PD1, CTLA4, LAG3, TIM3, TIGIT, CD96, BTLA, KIR, adenosine A2a receptor, ARG2 (arginase 2), Vista, IDO, FAS, SIRP alpha, CISH, SHP-1, FOXP3, LAIR1, PVRIG, PPP2CA, PPP2CB, PTPN6, PTPN22, CD160, CRTAM, SIGLEC7, SIGLEC9, CD244, TNFRSF10B, TNFRS 135. The cell of item 134, which is F10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, or GUCY1B3. (Item 136) 135. The cell of item 134, wherein the checkpoint inhibitor gene is PD1. (Item 137) The cell described in item 134, wherein the PD1 target sequence is SEQ ID NO:59. (Item 138) 135. The cell of item 134, wherein the immune effector cell is selected from the group consisting of T cells, TILs, TCR engineered T cells, CAR T cells, NK cells, NK / T cells, T regulatory cells, monocytes, and macrophages. (Item 139) 135. The cell of item 134, wherein the immune effector cell is a T cell. (Item 140) The cell of claim 138, wherein the immune effector cell is a CAR T cell. (Item 141) The cell of item 140, wherein the CAR targets an HIV-infected cell. (Item 142) 135. The cell of item 134, comprising one or more miRNA expression constructs targeting CCR5 and at least two immune checkpoint inhibitor genes. (Item 143) 135. The cell according to item 134, wherein the cell comprises the miRNA expression construct according to any of items 90 to 118 or the vector according to any of items 119 to 121. (Item 144) 135. The cell according to item 134, wherein the miRNA expression construct is according to any one of items 1 to 40. (Item 145) An expression construct comprising an miRNA sequence targeting CCR5 and an immune checkpoint inhibitor gene. (Item 146) 146. The construct according to Item 145, wherein the miRNA sequence is according to any one of Items 1 to 40. (Item 147) The construct of item 145, further comprising a CAR expression sequence. (Item 148) The construct of item 147, wherein the CAR targets HIV-infected cells.

[0039] The following drawings form part of the present specification and are included to further support certain aspects of the invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein. [Brief description of the drawings]

[0040] [Figure 1]The spacer sequence is required for polymerase II promoter-driven miRNA knockdown. (a) Schematic of the miRGE base used in this experiment. All hairpins were designed to target CCR5. Two different pol II-dependent promoters (ubiquitin C and short elongation factor 1) drive miRGE expression (single or triple hairpins) with or without a GFP sequence as a spacer. The location of the spacer at 5' or 3' of the promoter was also investigated. (b) Constructs expressed under the ubiquitin C promoter or short elongation factor 1 promoter were transduced at a multiplicity of infection (MOI) of 0.2 into HeLa cells expressing CCR5. Flow cytometric determination of CCR5 expression in transduced (mCherry+) versus non-transduced (mCherry-) populations: WT HeLa cells (double negative), HeLa R5 cells (CCR5 positive); R5+ control mCherry vector; R5+ single mirGE hairpin with GFP spacer). (b') miRNA-mediated CCR5 knockdown was calculated using the mean APC fluorescence values ​​in the transduced (red) and non-transduced (blue) populations. (c) Bar graph showing relative expression of CCR5 with the UBI promoter construct. (d) Histogram showing relative expression of CCR5 with the EF1 short promoter construct. (e) Ligation efficiency (E) of the different constructs calculated in a bar graph. When E=1, no additive effect is observed with ligated hairpins (efficiency is 0%). When E=3, a completely additive effect of hairpins is observed with ligation (efficiency is 100%). Data represent the mean + / - SEM of three independent experiments. [Diagram 2]The efficiency of miRNA-based knockdown depends on the spacer. (a) Single miRGE hairpin-based constructs targeting CCR5 were designed with different spacers derived from the coding sequences of GFP (green fluorescent protein), MGST-2 (microsomal glutathione S-transferase-2), dNGFR (truncated nerve growth factor receptor), HO-1 (heme oxygenase-1), HO-1, and H2B (histone 2B) or from a non-coding sequence (first intron of the CD4 gene = iCD41) and transduced at an MOI of 0.2 in HeLa R5 cells. Histogram showing the expression of CCR5 in the transduced population compared to the non-transduced population, assessed by FACS immunostaining. miRGE constructs were designed with (b) truncated GFP (GFP1 and GFP2), or (c) CD4 in the first intron (iCD42 and iCD43) and transduced at an MOI of 0.2 in HeLa R5 cells. The histograms show the levels of CCR5 expression in transduced populations compared to non-transduced populations. Data represent the mean + / - SEM of three independent experiments. [Diagram 3]Spacer sequences determine the additive effect of miRNA hairpin ligation. (a) The efficiency of MGST2, H2B, and GFP as spacers was evaluated in miRGE hairpin ligation (three hairpin ligations) in HeLa expressing CCR5 cells. (b) The histogram shows the level of CCR5 expression in the transduced population compared to the non-transduced population with the remaining GFP spacer (black bars), the second part of GFP (GFP2) (hatched), MGST2 spacer (dark grey bars), and H2B spacer (clear grey bars). (c) The bar graph shows the ligation efficiency of the triple hairpin construct, calculated with the formula in Figure 9. The calculation of the ligation efficiency took into account the CCR5 knockdown by single miRGE hairpins (knockdown efficiency (KP)) and the triple miRGE ligation efficiency ((CP)). (d-e) The efficiency of MGST2 and GFP as spacers was also compared in the triple hairpin ligation targeting the NADPH oxidase subunit p22phox. p22phox mRNA levels assessed in the promyelocytic leukemia cell line PLB985 by QPCR (d) and NADPH oxidase activity by Amplex red assay (e). Data represent the mean + / - SEM of three independent experiments. [Figure 4]Translation-independent activity of GFP-spacers in cell lines and tissue explants. (a) Design of the STOP-GFP-spacer, with a STOP codon in all possible reading frames of the GFP cDNA 3' to the start codon (ATG). (b) HeLa R5 cells were transduced with both coding and non-coding forms of GFP at an MOI of >1. FACS histograms show GFP fluorescence in transduced cells. GFP fluorescence of cells transduced with the STOP-GFP construct was comparable to control (untransduced HeLa cells). (c) Spacer activity of the STOP-GFP sequence was also assessed by FACS on CCR5 expression after 0.2 MOI transduction in HeLaR5 cells. Histograms show expression of CCR5 in transduced populations compared to untransduced populations as assessed by FACS immunostaining. Data represent the mean + / - SEM of three independent experiments. (d) Organotypic cultures of neonatal rat cochlear explants transduced with increasing amounts of the stop-GFP triple-miRGE hairpin junction targeting p22phox (106-107 vector particles). Hair cells are stained with myosin 7a (green) and efficiently transduced cells express the marker gene mCherry (red). After 5 days, in vitro expression of the viral genes GAG (e) and p22phox (f) was assessed by qPCR. TU = transformation units. [Diagram 5]The spacer sequence regulates the steady-state levels, but not the half-life, of miRGE. HeLa expressing CCR5 were transduced with single hairpin vectors containing GFP, LNGFR, MGST2, or iCD41 as spacers. (a) Unprocessed (pri-miRGE) or (e) mature miRGE levels were assessed by qPCR using primers matching the flanking regions of pri-miRGE (F1-R1) or the target strand of mature miRGE (F2-R2). (b) Representative qPCR amplification plots of unprocessed miRGE levels using GFP, NGFR, and MGST2 as spacers. It should be noted that miRGE levels were below the detection threshold when no spacer or iCD41 was used as the spacer. GAPDH was used as a housekeeping gene. A ΔRn of 0.2 was defined as the threshold (red line). (c) Bar graphs show the relative levels of unprocessed miRGE as the average from three independent experiments. The maximum of miRGE expression normalized to 1.0 corresponds to a Ct value of 28.1 ± 0.3. BT = below detection threshold. (d) Transcription was blocked with actinomycin D at different time points (0-240 min) and the effect of spacers was evaluated on untreated miRGE half-life. The graph shows the relative miRGE decay over time and the half-life of each spacer is represented in the table. (f and g) Comparison of steady-state levels of mature miRGE assessed by qPCR from HeLa cells transduced with single hairpin (f) or triple hairpin ligation with different spacers (g). Data represent the mean + / - SEM of three independent experiments. [Figure 6]Maximizing ligation and achieving multi-target knockdown. (a) The efficiency of the stop-GFP triple ligation (mirGE 7-7-7) targeting CCR5 was compared to constructs containing a fourth or fifth hairpin targeting CCR5 or a second target, GFP. Bar graphs show the steady-state levels of mature miRGE targeting CCR5 (7) (b) or GFP (G) (d) and the ability of these constructs to knockdown CCR5 expression (c) or GFP expression (e) in HeLa cells as assessed by qPCR. Vectors expressing single miRGE hairpins targeting CCR5 or GFP were used as controls. (f) When stop-GFP was replaced with MGST2 as the spacer, the activity of the fourth and fifth hairpins was reduced compared to the single miRGE hairpin control (miRGFP) or the fifth hairpin of the stop-GFP construct. Data represent the mean + / - SEM of three independent experiments. [Figure 7] Effect of spacer length and biophysical characteristics on knockdown efficiency. Plot showing the correlation between CCR5 knockdown and (a) minimum free energy / length or (b) GC content of the spacers listed in this figure. [Figure 8] Overall strategy for designing efficient miRGE conjugates targeting NOX3 activity. (a) Candidate siRNA sequences are computationally designed and selected for their ability to knockdown target mRNA (NOX3, p22phox, or NOXO1). The most active siRNA sequence is then cloned into the miRGE backbone to construct the SMIG. Validation of SMIG efficiency is verified in the same target-expressing cell line. (b) The potency of eight siRNA candidates targeting mRNAs encoding the NOX3 complex (NOX3, p22phox, and NoxO1) was evaluated with respect to NOX3 activity by the Amplex Red method. (c) The effect of the most efficient sequence (targeting p22phox) on NOX activity was verified by Western blot. (d-e) The efficiency of the triple hairpin conjugate SMIG designed using the most active siRNA sequence was confirmed in NOX3-expressing cell lines by either QPCR (d) or by measuring the generation of ROS (e). [Figure 9] Calculation of ligation efficiency of miRGE hairpins. (a) Table showing the formula allowing the calculation of ligation efficiency (E) of GFP, MGST2 and H2B spacers. For the calculation of ligation efficiency, CCR5 knockdown using single miRGE hairpins (knockdown potency (KP)) and triple miRGE ligation (ligation potency (CP)) was considered. (b) Table summarizing knockdown potency (KP), ligation efficiency (E) and their product, general vector efficiency. (c) The former is also represented in a histogram. [Figure 10] Schematic of a prophetic synthetic minigene for generating redirected immunotherapy cells by endogenous immune checkpoint knockdown. The promoter is selected to allow tissue-specific expression and the spacer sequence and length are optimized to allow expression of all miRNA hairpins. The miRNA hairpins can target a specific gene(s) of interest, while the CAR or TCR sequences can target the immunotherapy cells to a specific antigen. T2A is the cleavage peptide site and LNGFR allows for the selection of engineered cells, while the suicide gene may allow for rapid elimination of cells in case of toxicity. [Figure 11]The optimized minigene architecture allows for sustained in vivo knockdown of CCR5 in circulating cells. (A) Six NGS neonatal mice were engrafted with 260,000 human CD34+ hematopoietic stem cells (HSCs) after transduction with a triple hairpin ligation targeting CCR5. At 28 weeks of age, blood was collected for analysis of CCR5 expression. (B) FACS plots showing CD4+ T cells from mice transplanted with untransduced HSCs (left) or arrested GFP-777-transduced HSCs (middle). The plot on the right shows CD4+ T cells stained with an irrelevant antibody (untransduced HSCs). mCherry+ cells indicate effectively transduced cells. (C) Histograms showing expression levels of CCR5 in transduced (mCherry+) and remaining untransduced (mCherry_) CD4 T cell populations in a single transplanted mouse compared to an irrelevant antibody (isotype). Cells to the right of the dotted line represent high CCR5 expressing CD4 T cells. (D) Comparison of CCR5 expression levels in high CCR5 CD4+ T cell populations in five engrafted mice and non-transduced control groups in mice engrafted with non-transduced human CD34+ cells (n=3). [Figure 12] Engraftment rates of human hematopoietic stem cells in NOD / SCID mice 23 weeks after transplantation. FACS plots showing human circulating leukocytes expressing the human CD45 marker in six mice transplanted with (a) non-transduced HSCs or (b) HSCs transduced with triple hairpin ligation targeting CCR5. Engraftment rates range from 12.4% to 44%. [Figure 13] Identification of human CD4+ T cells from the blood of transplanted mice. Total lymphocytes were selected according to their FSC / SSC coordinates (a). After doublet removal (b), human leukocytes were selected by human CD45 staining (c), and then human lymphocytes were selected with human CD3 antibody (d). Finally, CD4+ T cells were differentiated from CD8+ T cells with human CD4 and human CD8 antibodies (e). [Figure 14]Efficiency of CCR5 downregulation using one to three hairpin mirGE constructs against CCR5. (A) Therapeutic minigene architecture showing one to three hairpins, each identical and targeting CCR5. (B) Aligned flow cytometry histograms showing the decrease in fluorescence intensity in transduced HeLaR5 cells (mCherry positive population). (C) Relative CCR5 expression levels when compared to HeLaR5 cells transduced with mCherry only control vector (n=3). [Figure 15] Identification of optimal target sequences for PD1 downregulation. Three PD1 target sequences identified based on in silico design were used to construct single hairpin mirGE therapeutic minigenes and packaged into lentiviral vectors for transduction of primary T cells according to the experimental design shown in (A). (B-C) Flow cytometry dot plots and histograms showing that the PD1-1A construct was the most effective at reducing PD1 expression in transduced T cell populations (mCherry+); (D-E) Bar graphs showing the relative reduction in PD1 expressing cells and expression levels (n=4). [Figure 16] PD1 downregulation by one- to three-hairpin mirGE therapeutic minigenes. After identifying target sequences accessible for mirGE downregulation of PD1, two- and three-hairpin minigenes (with the same hairpin sequence) were constructed. The constructs were then packaged into lentiviral vectors for transduction of primary T cells from healthy donors (A). (B-C) Flow cytometry dot plots and histograms showing increased knockdown of PD1 by two- and three-hairpin constructs compared to one-hairpin constructs. (D-E) Bar graphs showing the relative reduction in PD1 expressing cells and PD1 expression levels, demonstrating comparable knockdown of PD1 using two- and three-hairpin constructs (n=3). [Figure 17]Efficiency of CCR5 downregulation using a mirGE construct with two CCR5-targeting hairpins at terminal positions. (A) Therapeutic minigene architecture showing the position of the CCR5-targeting hairpin compared to the PD1 and GFP-targeting hairpins. (B) Aligned flow cytometry histograms showing the reduction in fluorescence intensity in transduced HeLaR5 cells (mCherry positive population). (C) Relative CCR5 expression levels compared to HeLaR5 cells transduced with an mCherry-only control vector. [Figure 18] Effect of PD1 knockdown in anti-cKit CAR T cells after 4 days of co-culture with HL-60 target cells. (A) Transduction rate of anti-cKit CART cells with PD1 targeting mirGE (three hairpins) based on mCherry positivity, (B) increase in mirGE expressing CART cells on day 4 based on mCherry expression, (C) absolute cell number of anti-cKit CART cells after 4 days of co-culture with HL-60 target cells, (D) fold increase in CAR T cells over the 4-day co-culture period (starting from 100,000 CAR T cells on day 1), (E-F) flow cytometry dot plots, overlays and histograms of CAR T cells after a 4-day co-culture period, (G) percentage of PD1 expressing CAR T cells. [Figure 19] Knockdown of CCR5 and PD1 in primary T cells. (A-B) Flow cytometry dot plots, overlays, and histograms showing knockdown of both CCR5 and PD1 independently in primary T cells transduced with the four hairpin mirGE construct (two hairpins against PD1 followed by two hairpins against CCR5) and control vector (mCherry only), (C) Overlay dot plots of CCR5 vs. PD1 populations gated on the untransduced (mCherry negative) and four hairpin transduced (mCherry positive) T cell populations. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0041] I. EMBODIMENTS OF THE PRESENTINVENTION The present invention generally relates to miRNA expression constructs. The present invention relates to constructs for the expression of multiple miRNAs. The present invention further relates to the use of spacer sequences between promoters and miRNA sequences. In some embodiments, the spacer sequence can be from GFP.

[0042] II. RNA Inhibition The inhibitory nucleic acid may inhibit transcription of a gene in a cell or prevent translation of a gene transcript. The inhibitory nucleic acid may be 16-1000 nucleotides in length, and in certain embodiments, 18-100 nucleotides in length. In certain embodiments, the inhibitory nucleic acid is an isolated nucleic acid that binds to or hybridizes with a gene of interest.

[0043] Inhibitory nucleic acid is known in the art.For example, siRNA, shRNA and double-stranded RNA are described in U.S. Patent No. 6,506,559 and U.S. Patent No. 6,573,099, and U.S. Patent Publication No. 2003 / 0051263, No. 2003 / 0055020, No. 2004 / 0265839, No. 2002 / 0168707, No. 2003 / 0159161 and No. 2004 / 0064842, all of which are incorporated herein by reference in their entirety.

[0044] Since the discovery of RNAi by Fire and colleagues in 1998, the biochemical mechanisms have been rapidly characterized. Double-stranded RNA (dsRNA) is cleaved by Dicer, an RNAase III family ribonuclease. This process yields miRNAs with a length of about 21 nucleotides. These miRNAs are incorporated into multiprotein RNA-induced silencing complexes (RISCs) that are guided to the target mRNA. RISCs cleave the target mRNA in the middle of the complementary region. In mammalian cells, related miRNAs are found that are short RNA fragments (about 22 nucleotides). After Dicer-mediated cleavage of longer (about 70 nucleotides) precursors with imperfect hairpin RNA structures, miRNAs are generated. The miRNAs are incorporated into miRNA-protein complexes (miRNPs) and cause translational repression of the target mRNA.

[0045] There are several factors to consider in the design of RNAi, including the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the miRNA introduced into an organism usually contains exonic sequences. Furthermore, because the RNAi process depends on homology, the sequence must be carefully selected to maximize gene specificity while minimizing the possibility of mutual interference between homologous sequences rather than gene-specific sequences. In particular, miRNAs exhibit more than 80, 85, 90, 95, 98%, or even 100% identity between the sequence of the miRNA and a portion of the nucleotide sequence of the target gene. Sequences that are less than about 80% identical to the target gene are substantially less effective. Thus, the higher the identity between the miRNA and the target gene it inhibits, the less likely it is that expression of unrelated genes will be affected.

[0046] In addition, the size of the miRNA is an important consideration. In some embodiments, the present invention relates to miRNA molecules that contain at least about 19-25 nucleotides and are capable of regulating target gene expression. In the context of the present invention, the miRNA is, in particular, less than 500, 200, 100, 50, 25, 24, 23, or 22 nucleotides in length. In some embodiments, the miRNA is about 25 nucleotides to about 35 nucleotides in length, or about 19 nucleotides to about 25 nucleotides in length.

[0047] To improve the efficacy of miRNA-mediated gene silencing, guidelines for selecting target sites in mRNA have been developed for optimal miRNA design (Soutschek et al., 2004; Wadhwa et al., 2004). These strategies may allow a rational approach to select siRNA sequences to achieve maximum gene knockdown. To facilitate the entry of miRNA into cells and tissues, various vectors have been used, including plasmids and viral vectors, such as adenoviruses, lentiviruses, and retroviruses (Wadhwa et al., 2004).

[0048] Within an inhibitory nucleic acid, the components of the nucleic acid need not be of the same type or species throughout (e.g., an inhibitory nucleic acid may contain nucleotides and nucleic acids or nucleotide analogs). Generally, an inhibitory nucleic acid forms a double-stranded structure, which may result from two separate nucleic acids that are partially or fully complementary. In certain embodiments of the invention, an inhibitory nucleic acid may contain only a single nucleic acid (polynucleotide) or nucleic acid analog, which may form a double-stranded structure by complementing itself (e.g., forming a hairpin loop). The double-stranded structure of an inhibitory nucleic acid may contain from 16 to 500 or more contiguous nucleobases, including all ranges therein. The inhibitory nucleic acid may comprise 17-35 contiguous nucleobases, more particularly 18-30 contiguous nucleobases, more particularly 19-25 nucleobases, more particularly 20-23 contiguous nucleobases, or 20-22 contiguous nucleobases, or 21 contiguous nucleobases, that hybridize with a complementary nucleic acid (which may be another portion of the same nucleic acid or a separate complementary nucleic acid) to form a double-stranded structure.

[0049] miRNA can be obtained from commercial sources, natural sources, or can be synthesized using any of the many techniques known to those skilled in the art.For example, commercial sources of pre-designed miRNA include Invitrogen's StealthTM Select technology (Carlsbad, CA), Ambion® (Austin, TX), and Qiagen® (Valencia, CA).The inhibitory nucleic acid that can be applied in the compositions and methods of the present invention can be any nucleic acid sequence that is found to be a verified downregulator of target genes by any source.

[0050] In some embodiments, the miRNA molecule is at least 75, 80, 85, or 90% homologous, and in particular at least 95%, 99%, or 100% similar or identical, or any percentage in between (e.g., the invention contemplates 75% or more, 80% or more, 85% or more, etc., and the ranges are intended to include all integers in between) to at least 10 consecutive nucleotides of any of the nucleic acid sequences encoding the full-length protein.

[0051] miRNAs may also include modifications of one or more nucleotides. Such modifications may include, for example, the addition of non-nucleotide material to the end(s) of the 19-25 nucleotide RNA or internally (at one or more nucleotides of the RNA). In certain embodiments, the RNA molecule contains a 3'-hydroxyl group. Nucleotides in the RNA molecules of the invention may also include non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. Double-stranded oligonucleotides may contain modified backbones, such as phosphorothioates, phosphorodithioates, or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNA (e.g., 2'-O-methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, 5-C-methyl nucleotides, one or more phosphorothioate internucleotide linkages, and inverted deoxy abasic residue incorporation) can be found in US Patent Application Publication No. 2004 / 0019001 and US Patent No. 6,673,611, each of which is incorporated by reference in its entirety. Collectively, all such modified nucleic acids or RNAs described above are referred to as modified miRNAs.

[0052] II. Vectors for cloning, gene transfer, and expression In certain embodiments, expression vectors are used to express nucleic acids of interest, such as nucleic acids that inhibit the expression of a particular gene. Expression requires that appropriate signals are provided within the vector, which includes various regulatory elements, such as enhancers / promoters from both viral and mammalian sources, that drive the expression of the gene of interest in the host cell. Elements designed to optimize the stability of RNA in the host cell are also defined. Conditions for the use of multiple dominant drug selection markers to establish permanent stable cell clones that express the product are also provided, as are elements that link the expression of the drug selection markers to the expression of the polypeptide.

[0053] A. Adjustment element Throughout this application, the term "expression construct" or "expression vector" is meant to include any type of genetic construct that contains a nucleic acid encoding a gene product that can be transcribed in part or in full of the nucleic acid encoding sequence. The transcript can be translated into a protein, but need not be. In certain embodiments, expression includes both transcription of the gene and translation of the mRNA into a gene product. In other embodiments, expression includes only transcription of the nucleic acid encoding the gene of interest, i.e., as in the case of the RNA molecules of the embodiments.

[0054] In certain embodiments, the nucleic acid encoding the gene product is under the transcriptional control of a promoter. "Promoter" refers to a DNA sequence that is recognized by the synthetic machinery of a cell or introduced synthetic machinery required to initiate specific transcription of a gene. The phrase "under transcriptional control" means that the promoter is in the correct position and orientation relative to the nucleic acid to control the initiation of RNA polymerase and the expression of the gene.

[0055] The term promoter is used herein to refer to a group of transcriptional control modules clustered around an initiation site for eukaryotic RNA polymerase (Pol) I, II, or III. Most of the thinking about promoter organization comes from the analysis of several viral Pol II promoters, including those for the HSV thymidine kinase (tk) and SV40 early transcription units. These studies, reinforced by more recent studies, have shown that promoters are composed of discontinuous functional modules, each consisting of approximately 7-20 bp of DNA and containing one or more recognition sites for transcriptional activator or repressor proteins.

[0056] At least one module within each promoter functions to position the start site for RNA synthesis. The best known example of this is the TATA box, but in some promoters that lack a TATA box, such as the promoters for the mammalian terminal deoxynucleotidyl transferase genes and the promoters for the SV40 late genes, discrete elements that overlap the start site itself help to fix the location of start.

[0057] Additional promoter elements regulate the frequency of transcription initiation. Typically, these are located in the region 30-110 bp upstream of the start site, but it has recently been shown that many promoters also contain functional elements downstream of the start site. The spacing between promoter elements is often flexible so that promoter function is preserved when elements are inverted or moved relative to one another. In the tk promoter, the spacing between promoter elements can be increased to 50 bp apart, after which activity begins to decline. Depending on the promoter, it appears that individual elements can function cooperatively or independently to activate transcription.

[0058] In some embodiments, the promoter comprises a short elongation factor 1 (EF1s) promoter. In other embodiments, the human cytomegalovirus (CMV) immediate early gene promoter, the SV40 early promoter, the Rous sarcoma virus long terminal repeat, the rat insulin promoter, and glyceraldehyde-3-phosphate dehydrogenase can be used to obtain high levels of expression of the coding sequence of interest. The use of other viral or mammalian cell or bacterial phage promoters well known in the art to achieve expression of the coding sequence of interest is also contemplated, provided that the level of expression is sufficient for a given purpose.

[0059] By using a promoter with well-known properties, the level and pattern of expression of the protein of interest after transfection or transformation can be optimized. Furthermore, the selection of a promoter that is regulated in response to a specific physiological signal can allow for inducible expression of the gene product. Tables 1 and 2 list some regulatory elements that can be used to regulate the expression of a gene of interest in the context of the present invention. This table is not intended to be exhaustive of all possible elements involved in promoting gene expression, but is merely illustrative thereof. In some embodiments, the promoter for use according to this embodiment is a non-tissue specific promoter, such as a constitutive promoter.

[0060] Enhancers are genetic elements that increase transcription from a promoter located at a distant location on the same DNA molecule. Enhancers are structured very similarly to promoters: they are composed of many individual elements, each of which binds to one or more transcriptional proteins.

[0061] The fundamental distinction between enhancers and promoters is operational. The enhancer region as a whole must be capable of stimulating transcription at a distant site. This does not necessarily apply to the promoter region or its constituent elements. On the other hand, a promoter must have one or more elements that direct the initiation of RNA synthesis at a specific site and in a specific orientation, whereas enhancers lack these specificities. Promoters and enhancers are often overlapping and contiguous and are often considered to have a very similar modular organization.

[0062] Below is a list of viral promoters, cellular promoters / enhancers, and inducible promoters / enhancers that can be used in combination with the nucleic acid encoding the gene or miRNA of interest in the expression construct (Tables 1 and 2). In addition, promoter / enhancer combinations (from the Eukaryotic Promoter Database EPDB) can also be used to drive the expression of the gene or miRNA of interest. Truncated promoters can also be used to drive expression. Eukaryotic cells can support cytoplasmic transcription from certain bacterial promoters if the appropriate bacterial polymerase is provided as part of the delivery complex or as an additional gene expression construct. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7] [Table 2-1] [Table 2-2] [Table 2-3]

[0063] When any cDNA insert is used, it typically contains a polyadenylation signal to achieve proper polyadenylation of gene transcript.The nature of the polyadenylation signal is not considered to be critical to the successful implementation of the present invention, and any such sequence, such as human growth hormone and SV40 polyadenylation signals, can be used.However, in some aspects, polyadenylation signal sequences are not included in the vectors of the embodiments.For example, incorporating such signal sequences into lentiviral vectors (before 3'LTR) can reduce the resulting lentiviral titer.

[0064] A spacer sequence can be included in the nucleic acid construct. The presence of a spacer appears to increase the knockdown efficiency of miRNA (Stegmeier et al., 2005). The spacer can be any nucleotide sequence. In some embodiments, the spacer is GFP.

[0065] Terminators are also contemplated as elements of the expression cassette. These elements can serve to enhance message levels and minimize readthrough from the cassette into other sequences.

[0066] B. Selectable markers In certain embodiments of the invention, cells contain the nucleic acid construct of the invention, and the cells can be identified in vitro, ex vivo, or in vivo by including a marker in the expression construct. Such a marker can confer an identifiable change to the cell, allowing easy identification of cells containing the expression construct. Usually, the incorporation of a drug selection marker aids in cloning and selection of transformed cells, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin, and histidinol are useful selectable markers. Alternatively, enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) can also be used. Immunological markers can also be used. The selectable marker used is not believed to be important so long as it can be expressed simultaneously with the nucleic acid encoding the gene product. Further examples of selectable markers are well known to those skilled in the art.

[0067] III. Delivery of Nucleic Acid Molecules and Expression Vectors In certain aspects, vectors for delivery of the nucleic acids of the embodiments may be constructed to express these factors intracellularly. In certain aspects, the following systems and methods may be used in the delivery of the nucleic acids to a desired cell type.

[0068] A. Homologous recombination In certain aspects of the embodiment, the vector encoding the nucleic acid molecule of the embodiment can be introduced into cells in a specific manner, for example, via homologous recombination.Current methods for expressing genes in stem cells involve the use of viral vectors (e.g., lentiviral vectors) or transgenes that are randomly integrated into genomes.These approaches have not been successful, in part because the randomly integrated vectors can activate or suppress the silencing of endogenous gene expression and / or transgene expression.The problems associated with random integration can be partially overcome by homologous recombination into specific loci in target genomes.

[0069] Homologous recombination (HR), also known as general recombination, is a type of genetic recombination used in all forms of life in which nucleotide sequences are exchanged between two similar or identical strands of DNA. This technique has been the standard method for genome manipulation in mammalian cells since the mid-1980s. The process involves several steps by physical cutting and eventual rejoining of DNA. This process is extremely widely used to repair double-strand breaks in DNA that are potentially lethal in nature. In addition, homologous recombination leads to new combinations of DNA sequences during meiosis, the process by which eukaryotic organisms create reproductive cells such as sperm and eggs. These new combinations of DNA represent genetic mutations in the offspring that allow populations to evolutionarily adapt to changing environmental conditions over time. Homologous recombination is also used in horizontal gene transfer, which exchanges genetic material between different strains and species of bacteria and viruses. Homologous recombination is also used as a technique in molecular biology to introduce genetic changes into target organisms.

[0070] Homologous recombination can be used as a targeted genome modification. The efficiency of standard HR in mammalian cells is 10% of the cells treated. -6 ~10 -9(Capecchi, 1990). The use of meganucleases or homing endonucleases such as I-SceI has been used to increase the efficiency of HR. Both natural meganucleases as well as engineered meganucleases with altered target specificity have been exploited to increase the efficiency of HR (Pingoud and Silva, 2007; Chevalier et al., 2002). Another route to increase the efficiency of HR is to engineer chimeric endonucleases with programmable DNA specificity domains (Silva et al., 2011). Zinc finger nucleases (ZFNs) are an example of such chimeric molecules, in which a zinc finger DNA binding domain is fused to the catalytic domain of a type IIS restriction endonuclease such as FokI (Durai et al., 2005; reviewed in PCT / US2004 / 030606). Another class of such specificity molecules contains transcription activator-like effector (TALE) DNA-binding domains fused to the catalytic domain of a type IIS restriction endonuclease such as FokI (Miller et al., 2011: PCT / IB2010 / 000154).

[0071] B. Nucleic acid delivery system Those skilled in the art are well equipped to construct vectors by standard recombinant methods (see, e.g., Sambrook et al., 2001 and Ausubel et al., 1996, both of which are incorporated herein by reference). Vectors include, but are not limited to, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs), such as retroviral vectors (e.g., derived from Moloney murine leukemia virus vectors (MoMLV), MSCV, SFFV, MPSV, SNV, etc.), lentiviral vectors (e.g., derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), adenoviral (Ad) vectors, including replication competent, replication defective, and gutless forms thereof, adeno-associated virus (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus, herpes virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, mouse mammary tumor virus vectors, Rous sarcoma virus vectors.

[0072] 1. Episomal Vectors In certain embodiments of the invention, the use of plasmid or liposome-based extrachromosomal (i.e., episomal) vectors, for example, for reprogramming somatic cells, may also be provided. Such episomal vectors may include, for example, oriP-based vectors and / or vectors encoding derivatives of the EBV protein, EBNA-1. These vectors may allow large fragments of DNA to be introduced into cells, maintained extrachromosomally, replicated once per cell cycle, divided efficiently into daughter cells, and not substantially induce an immune response.

[0073] In particular, EBNA-1, the only viral protein required to replicate oriP-based expression vectors, does not induce cellular immune responses because it generates an efficient mechanism to bypass the processing required to present the antigen on MHC class I molecules (Levitskaya et al., 1997). Furthermore, EBNA-1 can act in trans to enhance the expression of cloned genes in some cell lines, inducing the expression of cloned genes up to 100-fold (Langle-Rouault et al., 1998; Evans et al., 1997). Finally, the production of such oriP-based expression vectors is inexpensive.

[0074] Other extrachromosomal vectors include other lymphotropic herpesvirus-based vectors. Lymphotropic herpesviruses replicate in lymphoblasts (e.g., human B lymphoblasts) and become plasmids for part of their natural life cycle. Herpes simplex virus (HSV) is not a "lymphotropic" herpesvirus. Exemplary lymphotropic herpesviruses include, but are not limited to, EBV, Kaposi's sarcoma herpesvirus (KSHV); herpesvirus saimiri (HS), and Marek's disease virus (MDV). Other sources of episomal-based vectors are also contemplated, such as yeast ARS, adenovirus, SV40, or BPV.

[0075] Those skilled in the art are well equipped to construct vectors by standard recombinant methods (see, e.g., Maniatis et al., 1988 and Ausubel et al., 1994, both of which are incorporated herein by reference).

[0076] Vectors may also contain other components or functionalities that further modulate gene delivery and / or gene expression or otherwise provide beneficial properties to target cells. Such other components include, for example, components that affect cell binding or targeting (including components that mediate cell-type or tissue-specific binding); components that affect cellular uptake of vector nucleic acid; components that affect intracellular localization of polynucleotides following uptake (such as agents that mediate nuclear localization); and components that affect expression of the polynucleotide.

[0077] Such components may also include markers, such as detectable and / or selectable markers that can be used to detect or select cells that have taken up and expressed the nucleic acid delivered by the vector. Such components may be provided as natural features of the vector (such as the use of certain viral vectors that have components or functionality that mediate binding and uptake), or the vector may be modified to provide such functionality. A wide variety of such vectors are known in the art and are generally available. When the vector is maintained in a host cell, it may be stably replicated by the cell as an autonomous structure during mitosis, or it may be integrated into the genome of the host cell, or it may be maintained in the nucleus or cytoplasm of the host cell.

[0078] 2. Transposon-based systems According to certain embodiments, the introduction of nucleic acid can use transposon-transposase system.The transposon-transposase system used can be the well-known Sleeping Beauty, Frog Prince transposon-transposase system (for the latter description, see, for example, EP1507865), or the TTAA-specific transposon piggyback system.

[0079] A transposon is a sequence of DNA that can move from one location to another within the genome of a single cell, a process called transposition. In the process, transposons can cause mutations and change the amount of DNA in the genome. Transposons, also formerly called jumping genes, are examples of mobile genetic elements.

[0080] There are various mobile genetic elements, which can be grouped based on their mechanism of transposition: Class I mobile genetic elements or retrotransposons copy themselves by first being transcribed into RNA, then reverse transcribed again into DNA by reverse transcriptase, and then inserted into another location in the genome; Class II mobile genetic elements are "cut and pasted" in the genome, moving directly from one location to another using transposase.

[0081] 3. Viral Vectors In the construction of recombinant viral vectors, non-essential genes are typically replaced with genes or coding sequences of heterologous (or non-native) proteins or nucleic acids. A viral vector is a type of expression construct that utilizes viral sequences to introduce nucleic acids and possibly proteins into cells. The ability of certain viruses to infect or enter cells via pH-dependent or pH-independent mechanisms, integrate their genetic cargo into the host cell genome, and stably and efficiently express viral genes makes them attractive candidates for transferring foreign nucleic acids into cells (e.g., mammalian cells). Non-limiting examples of viral vectors that can be used to deliver nucleic acids of certain embodiments of the present invention are described below.

[0082] Retroviruses are promising gene delivery vectors due to their ability to integrate genes into the host genome, transfer large amounts of foreign genetic material, infect a broad spectrum of species and cell types, and be packaged in specialized cell lines (Miller, 1992).

[0083] To construct a retroviral vector, a nucleic acid is inserted into the viral genome in place of certain viral sequences to generate a replication-defective virus. To generate virions, packaging cell lines are constructed that contain the gag, pol, and env genes, but without the LTR, and packaging components (Mann et al., 1983). When a recombinant plasmid contains the cDNA along with the retroviral LTR and the packaging sequences are introduced into a particular cell line (e.g., by calcium phosphate precipitation), the packaging sequences allow the RNA transcripts of the recombinant plasmid (i.e., the vector genome) to be packaged into viral particles, which are then secreted into the culture medium (Nicolas and Rubenstein, 1988; Temin, 1986; Mann et al., 1983). The medium containing the recombinant retrovirus is then collected, optionally concentrated, and used for gene transfer. Depending on the tropism of the envelope protein used to coat the vector particle surface, retroviral vectors are capable of infecting a wide variety of cell types. However, integration and stable expression require the division of host cells (Paskind et al., 1975).

[0084] In addition to the common retroviral genes gag, pol, and env, lentiviruses also contain other genes with regulatory or structural functions. Lentiviral vectors are well known in the art (see, for example, Naldini et al., 1996; Zufferey et al., 1997; Blomer et al., 1997; Giry-Laterriere et al., 2011; U.S. Patent Nos. 6,013,516 and 5,994,136).

[0085] Recombinant lentiviral vectors can infect non-dividing cells and can be used for both in vivo and ex vivo gene transfer and expression of nucleic acid sequences. For example, recombinant lentiviruses capable of infecting non-dividing cells and transfecting suitable host cells with two or more vectors carrying packaging functions, namely gag, pol, and env, as well as rev and tat, are described in U.S. Patent No. 5,994,136, which is incorporated herein by reference.

[0086] C. Delivery of Nucleic Acid Introduction of a nucleic acid, such as DNA or RNA, into a cell to be programmed according to the present invention may use any suitable method for delivering a nucleic acid to transform a cell, as described herein or as known to one of skill in the art. Such methods include, for example, ex vivo transfection (Wilson et al., 1989; Nabel et al., 1989), injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466, and 5,580,859, each of which is incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference; Tur-Kaspa et al., 1986; Potter et al., 1989; al., 1984); calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); the use of DEAE-dextran followed by polyethylene glycol (Gopal, 1985); direct ultrasonic loading (Fechheimer et al., 1987); liposome-mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991) and receptor-mediated transfection (Wu and Wu, 1987; Wu and Wu, 1988); microprojectile bombardment (PCT Publication Nos. WO 94 / 09699 and 95 / 06128; U.S. Pat. Nos. 5,610,042, 5,322,783, 5,563,055, 5,550,318, 5,538,877, and 5,538,880, each of which is incorporated herein by reference); agitation with silicon carbide fibers (Kaeppler et al. al., 1990; U.S. Patent Nos. 5,302,523 and 5,464,765, each of which is incorporated herein by reference); Agrobacterium-mediated transformation (U.S. Patent Nos. 5,591,616 and 5,563,055, each of which is incorporated herein by reference); desiccation / inhibition-mediated DNA uptake (Potrykus et al., 1985), and direct delivery of DNA by any combination of such methods. Through the application of techniques such as these techniques, organelle(s), cell(s), tissue(s), or organism(s) can be stably or transiently transformed.

[0087] 1. Liposome-mediated Transfection In certain embodiments of the invention, the nucleic acid can be encapsulated in a lipid complex, such as, for example, a liposome. A liposome is a vesicular structure characterized by a phospholipid bilayer membrane and an internal aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. Liposomes form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components rearrange themselves before forming a closed structure, encapsulating water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, 1991). Nucleic acids complexed with Lipofectamine (Gibco BRL) or Superfect (Qiagen) are also contemplated. The amount of liposomes used can vary depending on the nature of the liposomes as well as the nature of the cells used, for example, about 5 to about 20 μg of vector DNA per 1 to 10 million cells can be contemplated.

[0088] Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been highly successful (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987), and the feasibility of liposome-mediated delivery and expression of foreign DNA in cultured chick embryo cells, HeLa cells, and hepatoma cells has also been demonstrated (Wong et al., 1980).

[0089] In certain embodiments of the invention, the liposome can be complexed with a hemagglutinating virus (HVJ), which has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al., 1989). In other embodiments, the liposome can be complexed or used in conjunction with nuclear non-histone chromosomal proteins (HMG-1) (Kato et al., 1991). In yet further embodiments, the liposome can be complexed or used in conjunction with both HVJ and HMG-1. In other embodiments, the delivery vehicle can include a ligand and a liposome.

[0090] 2. Electroporation In certain embodiments of the invention, nucleic acids are introduced into organelles, cells, tissues, or organisms via electroporation. Electroporation involves exposure of a suspension of cells and DNA to a high voltage electrical discharge. Recipient cells can also be made more susceptible to transformation by mechanical injury. The amount of vector used can also vary depending on the nature of the cells used; for example, about 5 to about 20 μg of vector DNA per 1 to 10 million cells can be contemplated.

[0091] Transfection of eukaryotic cells using electroporation has been very successful: mouse pre-B lymphocytes have been transfected with the human kappa immunoglobulin gene (Potter et al., 1984) and rat hepatocytes with the chloramphenicol acetyltransferase gene (Tur-Kaspa et al., 1986).

[0092] 3. Calcium phosphate In another embodiment of the present invention, nucleic acid is introduced into cells using calcium phosphate precipitation. Using this technique, human KB cells have been transfected with adenovirus 5 DNA (Graham and Van Der Eb, 1973). This method has also been used to transfect mouse L (A9) cells, mouse C127 cells, CHO cells, CV-1 cells, BHK cells, NIH3T3 cells, and HeLa cells with neomycin marker gene (Chen and Okayama, 1987), and rat hepatocytes with various marker genes (Rippe et al., 1990).

[0093] 4.DEAE-Dextran In another embodiment, the nucleic acid is delivered to cells using DEAE-dextran followed by polyethylene glycol. In this manner, reporter plasmids have been introduced into mouse myeloma and erythroleukemia cells (Gopal, 1985).

[0094] D. Cell Culture Generally, the cells of the invention are cultured in a culture medium, which is a nutrient-rich buffered solution capable of sustaining cell growth.

[0095] Suitable culture media for isolating, growing and differentiating stem cells according to the methods described herein include, but are not limited to, high glucose Dulbecco's Modified Eagle Medium (DMEM), DMEM / F-12, Liebovitz L-15, RPMI 1640, Iscove's Modified Dulbecco's Medium (IMDM), and Opti-MEM SFM (Invitrogen Inc.). Chemically defined media include minimal essential medium, such as Iscove's Modified Dulbecco's Medium (IMDM) (Gibco), supplemented with human serum albumin, human Ex Cyte lipoprotein, transferrin, insulin, vitamins, essential and non-essential amino acids, sodium pyruvate, glutamine, and mitogens, which are also suitable. As used herein, mitogen refers to an agent that stimulates cell division. The agent can be some form of chemical, usually a protein, that prompts cells to begin cell division and induces mitosis. In one embodiment, serum-free media, such as those described in U.S. Application No. 08 / 464,599 and WO 96 / 39487, as well as the "complete media" described in U.S. Patent No. 5,486,359, are contemplated for use with the methods described herein. In some embodiments, the culture medium is supplemented with 10% fetal bovine serum (FBS), human autologous serum, human AB serum, or platelet-rich plasma supplemented with heparin (2 U / ml). Cell cultures can be maintained, for example, in a 5%-12% CO2 atmosphere to maintain the pH of the culture, incubated at 37°C in a humidified atmosphere, and subcultured to maintain less than 85% confluency. EXAMPLES

[0096] IV. Working Examples The following examples are included to support preferred embodiments of the invention. It should be understood by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventors to work well in the practice of the invention, and therefore may be considered to constitute preferred modes of practice thereof. However, those of skill in the art should, in light of this disclosure, understand that many changes can be made in the specific embodiments disclosed and still obtain the same or similar results without departing from the spirit and scope of the invention.

[0097] Example 1 - Materials and Methods Construction of miRNA-containing plasmids and lentiviral vectors. Plasmids were constructed using the Gateway system as previously described (Myburgh et al., 2014). Except for MGST2, the spacer sequences were amplified by PCR using Herculase II polymerase (Agilent, Santa Clara, CA), and the forward and reverse primers had EcoRI and XhoI restriction sites, respectively, and were cloned into pENTR vector (Invitrogen) by digestion / ligation steps (Table 3). Most of the primers used for cloning of the spacers were designed with recombination sites of AttB1 (forward primer) and AttB2 (reverse primer) at the 5' end (Table 4).

[0098] The MGST2 spacer was obtained from the pOTB7-MGST2 plasmid (transomic) by EcoRI / XhoI restriction digestion followed by ligation into the pENTR vector. The mirGE hairpin was amplified using the same strategy, with the forward and reverse primers carrying SpeI and BamHI restriction sites, respectively. The elements of the miRGE hairpin can be seen in Table 5. The miRGE hairpin conjugates were generated using different linkages of the restriction enzymes on the miRGE primers or by blunt ligation as in Sun et al., 2006. Each new miRGE addition was verified by sequencing the pENTR vector. The amplicon parts of each clone containing the spacer and the miRGE hairpin were systematically verified by sequencing. The miRGE PCR template and primer oligos were obtained from Microsynth (Balgach, Switzerland). The CCR5, GFP, and P22 oligonucleotides were sequenced using the same sequence. phox The miRGE hairpin template sequences targeting are available in Table 6.

[0099] The final lentivector plasmids were generated by LR Clonase II (Invitrogen, Carlsbad, CA)-mediated recombination between pENTR plasmids containing the human UBI promoter (pENTR-L4-UBI-L1R) or the short elongation factor 1 promoter (pENTR-L4-EFs-L1R) and a lentivector destination cassette (pCWX-R4dEST-R2-PC) containing an additional transcription unit encoding the mCherry marker gene on the human phosphoglycerate kinase 1 (PGK) promoter. The GFP target sequence -AAGAACGGCATCAAGGTGAACT (SEQ ID NO: 57)- was taken from a previous publication (Mottet-Osman et al., 2007). The human CCR5 (Genbank NM_000579.3) target sequence (T7) 5'aAGTGTCAAGTCCAATCTATGA (SEQ ID NO: 58) was used previously (Myburgh et al., 2014). [Table 3-1] [Table 3-2] [Table 3-3] [Table 4-1] [Table 4-2] [Table 4-3] [Table 5-1] [Table 5-2] [Table 6-1] [Table 6-2]

[0100] Generation and titration of lentiviral vectors. Lentiviral vector stocks were generated using transient transfection of HEK 293T cells with specific lentivector transfer plasmids, the gag / pol encoding psPAX2 plasmid, and the pCAG-VSVG envelope plasmid as previously described (Giry-Laterriere et al., 2011a, Giry-Laterriere et al., 2011a). Lentivector titration was performed using transduction of HT-1080 cells followed by flow cytometric quantification of mcherry-positive cells 5 days after transduction (Giry-Laterriere et al., 2011a, Giry-Laterriere et al., 2011a).

[0101] Cell culture and knockdown analysis. All cell lines were cultured in high glucose Dulbecco's modified Eagle's medium (Sigma) supplemented with 10% fetal bovine serum, 1% penicillin, 1% streptomycin, and 1% L-glutamine. For each knockdown assay, cells were analyzed at least 5 days after transduction. For CCR5 knockdown studies, a subclone of HeLa-derived TZMbl cells expressing high levels of human CCR5, designated HeLaR5 herein (AIDS Repository, Germantown, MD), was used. For GFP knockdown, the same cells were used after GFP transduction with one copy of vector and sorting for GFP-positive cells. CCR5 expression was detected using anti-human CCR5-APC antibody (BD Pharmingen Cat. 550856) and flow cytometric analysis using a FACS Cyan (Beckman Coulter). GFP expression was assessed on the same flow cytometer using median GFP fluorescence. Briefly, HeLa cells were transduced with miRGE-based knockdown vectors at an MOI of 0.2 to avoid the presence of high copy numbers of vector per cell and to obtain comparable conditions. GFP or CCR5 expression was compared between the transduced and remaining untransduced cell populations and expressed as a percentage of CCR5 expression relative to the untransduced population.

[0102] Real-time quantitative reverse transcriptase polymerase chain reaction. Cells or organotypic explants of the organ of Corti were harvested and mRNA was extracted using the Qiagen RNeasy mini kit according to the manufacturer's instructions. RNA concentration was determined using Nanodrop. Takara PrimeScript RT reagent kit was used according to the manufacturer's instructions, and 500 ng was used for cDNA synthesis. Real-time PCR was performed using SYBR green assay on a 7900HTSDS system from ABI. The efficiency of each primer was verified using serial dilutions of cDNA. Relative expression levels were calculated by normalization to the geometric mean of two housekeeping genes GAPDH and EF1a, as well as the GAG ​​lentivector gene. The highest normalized relative amount was arbitrarily designated as a value of 1.0. Fold changes were calculated from the quotient of the means of these normalized amounts and reported as ± SEM. The sequences of the qPCR primers used are shown in Table 7. [Table 7-1] [Table 7-2]

[0103] Quantitative reverse transcriptase polymerase chain reaction for mature miRNA detection. HeLa R5 cells were transduced with lentivectors carrying different SMIGs at an MOI of 0.2. The transduced population (expressing mCherry) was sorted by FACS to obtain a homogenous cell population with a single copy of vector / cell. Total RNA was extracted using Trizol reagent (Ambion) according to the manufacturer's instructions. RNA concentration was determined using Nanodrop. 100 ng of RNA was used for reverse transcription (miRCURY LNA™ miRNA PCR, Polyadenylation, and cDNA Synthesis Kit (exiqon)). Reverse transcription was followed by real-time PCR amplification (ExiLENT SYBR® Green Master Mix Kit (exiqon)) with LNA™ enhanced primers. Relative expression levels of mature miRGEs were calculated by normalization to the geometric mean of two housekeeping miRNAs (U6 and RNU5G). Fold changes were calculated from the quotient of the means of these normalized amounts and reported as ±SEM. The sequences of the LNA™-enhanced primers were not provided by the manufacturer.

[0104] Measurement of reactive oxygen species by Amplex Red assay. PLB-985 cells were cultured in RPMI medium (Gibco), transduced as above, and differentiated into neutrophil-like cells in the presence of 1.25% DMSO for 5 days. The levels of H2O2 produced by intact PLB-985 cells after stimulation of NOX2 with 100 nM phorbol myristate acetate (PMA) were then measured using Amplex Red fluorescence as previously described (Jaquet et al., 2011). Fluorescence was measured using a FluoSTAR OPTIMA, BMG labtech instrument at 37 °C.

[0105] Organotypic culture and transduction of rat organ of Corti. Three-day-old postnatal Wistar rats were decapitated, the heads cut in sagittal sections, and the brains removed. The two otic capsules were separated and transferred to ice-cold Hank's Balanced Salt Solution (HBSS) (Invitrogen, USA) using forceps (World Precision Instruments, USA) for sterile dissection under a single-objective binocular microscope (Nikon SMZ800, Japan). After removing the bones, the cochlea was transferred to a Transwell-Clear insert (6-well format, Corning, USA) containing a permeable polyester membrane (pore size 0.4 μm). The membrane was precoated with Celltak (Corning, USA) according to the manufacturer's protocol. The organ of Corti (OC) was then separated from the stria vascularis and modiolus, and hair cells were seeded onto the insert with the upper side facing up. The dissection medium was carefully removed and 1.5 ml of ear culture medium: (DMEM / F12 (Invitrogen, USA), 0.01% ampicillin (Sigma, USA), and 10% fetal bovine serum (Invitrogen, USA) was added to the lower compartment below the insert membrane. The next day, the medium on the inserts was removed and they were transferred to empty wells. For transduction, 200 μl of ear culture medium was added to the explants together with 70 μl of DMEM / F12 (Invitrogen / USA) containing 106, 5 × 106, or 107 particles of the stop-GFP triple-miRGE hairpin lentivector targeting p22phox. The cells were incubated at 37 °C and 5% After 30 min of incubation with CO2, 1.5 ml of otic culture medium was added to the lower compartment. The medium was replaced with fresh otic culture medium the following day 2. Five days after the first transduction, cochlear explants were either detached with trypsin for mRNA isolation or fixed with 4% paraformaldehyde for immunostaining for 10 min.

[0106] Immunostaining and confocal microscopy of rat organotypic cultures of the organ of Corti. Cells were fixed with 4% paraformaldehyde for 10 min at room temperature. Explants were transferred to 24-well plates (by cutting the insert membrane), washed three times with PBS, and permeabilized with 3% Triton-X 100 for 30 min. Cochlear explants were immersed in blocking buffer containing 2% bovine serum albumin (BSA) and 0.01% Triton-X 100 for 1 h at room temperature. Explants were incubated overnight at 4°C with anti-MyoVIIa (1:500, rabbit; Proteus, USA) antibody in blocking buffer. The next day, tissues were rinsed three times with PBS and incubated with secondary antibody anti-rabbit Alexa Fluor488 (1:500; Invitrogen, USA) in blocking buffer for 2 h at room temperature. Explants were washed again three times with PBS and mounted on slides using Fluoroshield containing DAPI (Sigma Aldrich, USA). Labeled cells were visualized with a confocal laser scanning microscope (Zeiss LSM710) equipped with a CCD camera (Leica Microsystems) and a Planapochromat 10x / 0.3 NA objective.

[0107] Knockdown of CCR5 in humanized mouse leukocytes. Human CD34 isolated from umbilical cord blood using magnetic beads (Miltenyi) were cultured in activation medium (Cell Gro medium containing 20 ng / mL recombinant human [rh] stem cell factor (SCF), 20 ng / mL rh Flt3-L, 20 ng / mL rh interleukin-3 [IL-3], 20 ng / mL rh TPO1, 1% v / v penicillin-streptomycin [Penstrep]). Cells were seeded in 24-well plates at 1.0_106 cells / mL in activation medium for pre-stimulation at 37_C for 24 hours. The day after transduction, Lentiblast B was added to the medium in a dilution of 1:1,000. The MOI used for transduction was 50. One well containing 0.1_106 cells was not transduced and served as a negative control. CD34+ cells were harvested after 48 hours of culture, except for transduction controls. Cells designated for transplantation were frozen and stored in liquid N2 until transplantation of neonatal NGS mice. Neonatal NGS mice were then irradiated with 1 Gy and then transplanted with 260,000 CD34+ cells. Engraftment was confirmed by analyzing peripheral blood from mice at 23 weeks of age. CCR5 expression was then investigated at 28 weeks of age using antibodies: huCD45 FITC (304006), CD3 AF700 (300424), CD4 PE-CY7 (300512), CD8 BV421 (301036), and CCR5 APC (359122) (or isocontrol #400611) from BioLegend.

[0108] Prediction of minimum free energy of spacer sequences. The minimum free energy (MFE) of spacers was calculated using the RNAfold web server (Institute for Theoretical Chemistry, University of Vienna, available on the World Wide Web at rna.tbi.univie.ac.at / cgi-bin / RNAWebSuite / RNAfold.cgi). To be able to compare MFE between spacers, the obtained value was divided by the spacer length.

[0109] Calculation of triple hairpin ligation efficiency. The ligation efficiency of triple hairpin construct (E) was calculated according to the formula E=ln(CP) / ln(KP), where KP and CP are the knockdown of CCR5 obtained with single and triple hairpin constructs, respectively. When E=3, a completely additive effect of hairpins is observed in ligation. When E=1, the triple hairpin construct is as efficient as the single hairpin construct, and no additive effect of hairpin ligation is observed.

[0110] Statistical analysis. Statistical analysis was performed using GraphPad Prism 5.04 (GraphPad Software, La Jolla, CA). One-way analysis of variance followed by Bonferroni's multiple comparison test and t-test (nonparametric, Mann-Whitney U test).

[0111] Example 2 - Results Spacer sequences are necessary for polymerase II promoter-driven miRNA-mediated target gene knockdown. To optimize miRGE-based knockdown and better understand the role of the spacer, green fluorescent protein (GFP) sequences were placed at the 5' or 3' end of the miRGE hairpin sequence of the lentiviral vector (Fig. 1a). HeLa cells expressing CCR5 (R5 cells) were transduced at an MOI of 0.2 to reduce the statistical probability of having more than one copy of the transgene / cell (Fig. 1b). Both single and triple hairpins targeting CCR5 were used. Two different polII-dependent promoters were used: the ubiquitin promoter (UBI) and a spliced ​​version of the elongation factor 1 promoter, EF. 25(cgatggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtgtcgtgacgcg; SEQ ID NO: 45) was used. When the UBI promoter was used, the absence of a spacer completely eliminated CCR5 knockdown, even when three hairpins were used (FIG. 1c).

[0112] The effect of the spacer depends on its position. With a spacer between the promoter and the miRNA, efficient CCR5 knockdown was observed with single hairpins, which was significantly enhanced with the concatenated triple hairpin constructs. When the spacer was placed at the 3' position of the miRNA gene, the single hairpins showed a decrease in CCR5 knockdown efficiency, while the increased knockdown effect of the concatenation was completely lost (Figures 1c and 1e). The situation was slightly different with the EF promoter (Figure 1d). The efficacy of the single hairpins did not depend on the presence of a spacer, but in the absence of a spacer, no additive effect of triple ligation was observed (Figure 1e). In contrast, with a spacer between the promoter and the hairpin, the maximum effect of triple ligation was reached, while a less pronounced effect was observed with the 3' spacer.

[0113] Taken together, the data show that a spacer sequence (preferentially located 5' of the miRNA) is required to drive efficient knockdown via the two types of pol II-dependent promoters, and the spacer is also required for the additive effect of hairpin ligation (Figure 1e).

[0114] The efficiency of miRNA-based knockdown depends on the spacer sequence. The potency of several coding and non-coding spacer sequences was evaluated (Figure 2a; Table 8). Five miRGE minigenes with coding sequences were generated as spacers: green fluorescent protein (GFP), microsomal glutathione S-transferase-2 (MGST2), truncated nerve growth factor receptor (dNGFR), heme oxygenase-1 (HO-1), and histone 2B (H2B) cDNA (Table 9). iCD4, the first intron of the CD4 gene, was used as the non-coding spacer sequence. Lentivectors carrying the respective minigenes were used to transduce HeLaR5 cells. Significant knockdown of CCR5 protein was observed in the transduced cell population with all coding sequences (MGST, LNGFR, HO-1, and H2B spacers). The GFP sequence spacer resulted in the highest knockdown of CCR5. The poorest performing spacers were iCD4 and H2B (less than 10% knockdown), while other coding sequences yielded intermediate efficiencies (Figure 2a).

[0115] [Table 8-1] [Table 8-2] [Table 9-1] [Table 9-2] [Table 9-3] [Table 9-4] [Table 9-5] [Table 9-6] [Table 9-7] [Table 9-8] [Table 9-9] [Table 9-10]

[0116] The spacer sequence determines the additive effect of miRNA hairpin ligation. To confirm the role of the spacer sequence in the ligation efficacy of the vector, multi-hairpin constructs were designed with different spacers (GFP, GFP2, MGST2, or H2B) (Figure 3a). When GFP or GFP2 sequences were used as spacers, ligation of three hairpins dramatically improved CCR5 knockdown (60% to 85% CCR5 knockdown) compared to the signal hairpin construct (Figures 3b and 3c). Substantially different results were obtained when MGST2 was used as a spacer. For single hairpins, the MGST2 sequence showed good spacer activity, although not as potent as the GFP sequence (Figure 2). However, when MGST2 was used as a spacer (ligation efficiency is nearly 1), the additive effect of three hairpin ligation was not observed (Figure 3c). Thus, there is a dissociation between spacer efficacy and signal hairpin compared to ligation activity. The former is in a comparable range with GFP and MGST2, whereas the latter is virtually absent with MGST2 as a spacer (Figure 3c). The opposite was observed when using H2B as a spacer, with rather poor knockdown observed when using a single hairpin (approximately 10%), whereas there was an improved ligation effect as judged by CCR5 knockdown (40% knockdown) using a triple hairpin construct (Figures 3b and 3c). To investigate whether this observation also applies to hairpins targeting genes other than CCR5, we used either MGST2 or GFP as the spacer sequence to target the NOX subunit p22 phoxWe constructed triple hairpin SMIGs targeting (CYBA) (Figures 3d and 3e; see also Figure 7). These constructs were used to transduce the promyelocytic leukemia cell line PLB-985, which, upon differentiation into a neutrophil-like phenotype, upregulates all phagocyte NADPH oxidase subunits (NOX2 and p22). phox CYBA mRNA knockdown was reduced by 50% using the MGST2 spacer / triple hairpin construct, whereas GFP-spacer CYBA mRNA knockdown was reduced by >80% (Fig. 3d). The functional activity of phagocyte NADPH oxidase, i.e., ROS generation, was assessed (Fig. 3e). ROS generation is mediated by the p22 phox GFP triple hairpin ligation targeting MGST2 was inhibited by 60%. In contrast, by replacing GFP with MGST2 as the spacer, ROS generation was inhibited by less than 20%. These data confirm that efficient knockdown is seen using single hairpins, but the ligation activity of the MGST2 spacer is low (Figure 3c and Figure 8). These experiments demonstrate that the spacer sequence is not only required for knockdown efficiency using single hairpins, but also for additive ligation effects, i.e., ligation potency.

[0117] Translation-independent activity of the GFP spacer in cell lines and tissue explants. Among the candidates tested, the GFP sequence was the most efficient as a spacer, both in terms of knockdown potency with single hairpins and ligation potency. The CD4 intron was inactive, but other coding sequences also yielded some significant knockdown activity. To test whether protein translation of GFP was required for optimal function of SMIG, constructs containing stop codons in each possible reading frame were generated (Figure 4a). No fluorescence was detected in cells transduced with stop GFP (Figure 4b). CCR5 knockdown achieved by the stop GFP spacer was comparable to that with the standard GFP spacer (approximately 50% using the single hairpin construct). These results indicate that protein translation of the spacer is not critical for the function of SMIG, providing a highly efficient spacer that does not lead to translation of the heterologous gene GFP, thus amenable to future clinical use.

[0118] To demonstrate the therapeutic potential of optimized SMIG containing a stop-GFP spacer, knockdown of the inner ear NADPH oxidase NOX3, which has potential therapeutic applications, was explored. This NADPH oxidase that generates reactive oxygen species (ROS) has been shown to be a relevant source of ROS that lead to inner ear damage and is therefore an attractive knockdown target for inner ear protection. 26 Under the control of the UBI promoter, the NOX3 subunit p22 phox A triple miRGE ligation was designed targeting p22 and using stop-GFP as a spacer. To identify transduced cells, an mCherry coding sequence was also included in the construct, under the control of the PGK promoter. Neonatal rat cochlear explants were transduced with this construct (Fig. 4d). Dose response of vector transduction using RT PCR to detect and quantitate the lentiviral GAG genes (Fig. 4e). Transduced cells could also be identified by mCherry red fluorescence (Fig. 4d; green fluorescence is a marker for hair cells). Although a small number of hair cells were transduced with the vector under the experimental conditions, the results were consistent with p22 phoxWe demonstrated a dose-dependent reduction in mRNA, confirming the efficiency of the miRGE vector carrying a second clinically relevant target gene (Figure 4f).

[0119] Sustained miRNA-mediated knockdown of CCR5 in circulating leukocytes derived from human hematopoietic stem cells: To further demonstrate the in vivo efficacy and therapeutic potential of optimized SMIG containing a stop-GFP spacer, another promising clinical application was investigated, namely the knockdown of the HIV coreceptor CCR5 in vivo (Figure 11). For this purpose, human CD34+ hematopoietic stem cells (HSCs) were transduced with a triple-miRGE conjugate targeting CCR5 under the control of the elongation factor promoter and with stop-GFP as a spacer. To identify transduced cells, an mCherry coding sequence was also included in the construct under the control of the PGK promoter. After transduction, HSCs engrafted in NGS (NOD scid gamma) mice after irradiation (Figure 11A) and achieved engraftment rates that varied between 12.4% and 44% after 23 weeks (Figure 12). 28 weeks after engraftment, CCR5 expression in circulating blood was investigated (Figures 11, 13). Results revealed two types of CD4+ T cells with respect to expression of CCR5 in non-transduced control and mCherry-negative cells (Figures 11B and 11C). The percentage of CD4 T cells expressing high CCR5 varied from less than 10% to more than 50%, averaging almost 25% in five of six engrafted animals (see Figure 11D, mCherry and non-transduced controls). It should be noted that in one of the six engrafted animals, the high CCR5 CD4 T cell population was virtually absent and therefore not considered in Figure 11D. Importantly, a dramatic decrease in CCR5 expression levels was observed in the mCherry+ transduced population (Figure 5D, mCherry+).

[0120] The spacer sequence regulates the steady-state levels, but not the half-life, of miRGE. PCR primers were designed to quantify unprocessed miRGE hairpin (pri-miRGE) (Figure 5a) or mature miRGE (Figure 5e). As seen in Figure 5b and c, the relative expression of miRGE pri-miRNA was significantly stronger in cells transduced with the stop-GFP spacer than in cells transduced with MGST-2 or NGFR-based vectors. It should be noted that the expression of miRGE was below the detection threshold using the first intron of CD4 as the spacer, as also seen in the absence of a spacer. To address whether this increase in the steady-state levels of miRGE was due to an extension of the half-life of the transcript, HeLa R5 cells were treated with actinomycin D for different periods of time to block transcription (Figure 5d). mRNA was harvested and miRGE expression levels were assessed by qPCR of pri-miRGE at different time points. The results showed an estimated mirGE half-life of approximately 30 min using the stop-GFP spacer, similar to that seen with the NGFR and MGST spacers (Fig. 5d). The steady-state levels of mature miRGE demonstrated that the stop-GFP spacer allowed the best expression of mature miRGE (Fig. 5f). This observation was also valid when the stop-GFP spacer and the MGST2 spacer were compared with the triple hairpin ligation (Fig. 5g). Interestingly, the levels of both precursor and mature miRGE were similarly affected by the spacer sequence. These results strongly suggest that the spacer activity is not related to the stability or processing of the miRNA transcript. Rather, these results suggest a mechanism by which the spacer is linked to the transcription of SMIG.

[0121] Maximizing ligation and achieving multi-target gene knockdown. To further explore the potential of a multi-target gene knockdown vector with a single promoter-driven miRNA cluster, a fourth and fifth mirGE hairpin targeting CCR5 or a second target gene (in this case GFP) were added to the triple CCR5 construct (Figure 6a). Ligation of hairpins significantly increased the steady-state levels of mature miRGE as a function of the number of hairpins present in the ligation (Figure 6b). Interestingly, although resulting in the highest mature miRGE levels, the addition of a fourth hairpin targeting CCR5 did not further reduce CCR5 expression compared to the triple hairpin construct arguing for a possible saturation of the CCR5 target site by miRGE (Figure 6c). On the other hand, when the fourth hairpin was replaced with a hairpin targeting GFP, not only did CCR5 knockdown remain at the maximum level (approximately 90%), but GFP fluorescence was also significantly reduced (Figure 6c). Thus, although a hairpin at the fourth position did not further improve CCR5 knockdown, it was clearly processed efficiently, as can be seen from the GFP knockdown (Fig. 6d) and the steady-state levels of mature miRGE-GFP (Fig. 6e). Interestingly, the fifth hairpin targeting GFP still showed similar knockdown efficiency and levels of mature miRGE as the fourth hairpin, without affecting the knockdown of CCR5. More importantly, the steady-state levels of miRGE_GFP, as well as the GFP knockdown mediated by the fourth or fifth miRGE hairpin, were comparable to the knockdown achieved with a single miRGE hairpin targeting GFP. Thus, when using UBI as the promoter and stop-GFP as the spacer, there was no loss of activity when using up to five concatenated hairpins. However, the efficiency of five hairpin concatenation was strongly spacer dependent. Indeed, the use of MGST2 as the spacer dramatically reduced the fourth and fifth hairpin GFP knockdown potency (Fig. 6f). These data demonstrate that the optimized SMIG architecture enables efficient multi-target gene knockdown on a single promoter-driven multi-hairpin construct.

[0122] Example 3 - Hypothetical synthetic minigenes for immune checkpoint knockdown Redirection of immunotherapy cells by knocking down endogenous immune checkpoints. A schematic diagram of a hypothetical synthetic minigene that can be used to knock down immune checkpoints is shown in FIG. 10. The synthetic minigene consists of a promoter sequence, a spacer sequence, at least two miRNA hairpins, and a chimeric antigen receptor sequence or a T cell receptor sequence. The synthetic minigene can optionally contain a selection sequence such as a low affinity nerve growth factor receptor (LNGFR) or a suicide gene sequence. Furthermore, to allow equal expression of the miRNA hairpin, the CAR or TCR sequence, and the selection sequence, the CAR or TCR sequence can be separated from the selection sequence by a "cleavable peptide" such as a 2A sequence or a T2A sequence. These synthetic minigenes can contain miRNA hairpin sequences directed to any immune checkpoint. Specifically, the miRNA hairpin sequences are PD1, CTLA4, LAG3, TIM3, TIGIT, CD96, BTLA, KIR, adenosine A2a receptor, Vista, IDO, FAS, SIRP alpha, CISH, SHP-1, FOXP3, LAIR1, PVRIG, PPP2CA, PPP2CB, PTPN6, PTPN22, CD160, CRTAM, SIGLEC7, SIGLEC9, CD244, TNFRSF10B, TN FRSF10A, CASP8, CASP10, CASP3, CASP6, CASP7, FADD, TGFBRII, TGFRBRI, SMAD2, SMAD3, SMAD4, SMAD10, SKI, SKIL, TGIF1, IL10RA, IL10RB, HMOX2, IL6R, IL6ST, EIF2AK4, CSK, PAG1, SIT1, PRDM1, BATF, GUCY1A2, GUCY1A3, GUCY1B2, and GUCY1B3 mRNA may be targeted. The promoter used may be any mammalian promoter, such as EF1 or UBI, or any promoter listed in Table 1. The spacer sequence may be any length or sequence, particularly one of the spacers listed in Table 9. Any immune effector cell may be targeted with these miRNA expression constructs.Specifically, T cells, tumor infiltrating lymphocytes (TILs), TCR engineered T cells, CAR T cells, NK cells, or T regulatory cells can be engineered with synthetic miRNA constructs.

[0123] The synthetic minigenes provided herein can be used to generate tumor-infiltrating lymphocytes with endogenous immune checkpoint knockdown.To generate these TILs with immune checkpoint knockdown, TILs can be isolated and purified from the patient's tumor tissue.These purified TILs can be transduced with lentiviral vectors that contain therapeutic minigenes that contain miRNA hairpins directed to immune checkpoint mRNAs to knockdown the gene expression of one or more immune checkpoints.The modified TILs can then be expanded ex vivo and finally reintroduced into the patient.

[0124] CAR T cells or TCR engineered T cells with endogenous immune checkpoint knockdown can be generated similarly to TILs. T cells can be harvested from the patient by leukapheresis. The harvested cells can then be transduced with a single vector containing the immune checkpoint mRNA as well as a miRNA hairpin targeting the CAR or engineered TCR sequence. As shown in Figure 10, having these in a single vector allows for a more efficient turnaround time from T cell collection to patient treatment. Alternatively, the harvested T cells can be treated with two separate vectors. The first vector can contain the CAR or engineered TCR sequence and can be transduced or transfected into the cells. The second vector then contains a lentivector containing a miRNA expression construct with a miRNA hairpin targeting the immune checkpoint mRNA. After transduction of the second vector, these modified T cells can be expanded ex vivo and then reintroduced into the patient.

[0125] Example 4 - Synthetic minigene targeted gene knockdown Single and double hairpin mirGE constructs knockdown CCR5 with high efficiency in HeLaR5 cells Single and double CCR5-targeting mirGE hairpins were constructed using an optimized therapeutic minigene architecture (EF1s promoter, GFP2 spacer) to evaluate how efficiently they could downregulate CCR5 compared to the three established hairpin constructs (Figure 14). HeLaR5 cells were transduced with lentiviral vectors carrying the constructs at an MOI of 1.0 and CCR5 downregulation was measured 5-7 days after transduction. All constructs also carried a gene reported with mCherry to identify transduced cells. CCR5 knockdown was measured via flow cytometry by measuring the MFI of transduced cells (mCherry positive) vs. non-transduced cells within the same sample and this ratio was compared against HeLaR5 cells transduced with a control lentiviral vector to express mCherry.

[0126] The results showed highly efficient downregulation of CCR5 by all three constructs, as indicated by a significant decrease in MFI and an overall shift in fluorescence intensity when compared to cells transduced with the control vector (Figure 14B). The relative CCR5 expression levels for the single, double, and triple hairpin constructs were 16.5%, 15%, and 15.7% (average n=6), respectively. Notably, maximal CCR5 knockdown in HeLaR5 cells could be achieved with the signal-mirGE hairpin when using the optimized therapeutic minigene architecture (EF1s promoter, GFP2 spacer).

[0127] Highly efficient knockdown of PD1 in primary T cells Considering the central role that PD1 plays in T depletion and more broadly in the field of engineered T cell therapy, a therapeutic minigene that can maximally downregulate PD1 was developed. Three mirGE constructs for silencing PD1 were designed following a previously described approach (Myburgh et al., 2014, incorporated herein by reference). Target sequences were identified using online software tools including i-Score Designer, BLOCK-iT (ThermoFisher), GeneScript siRNA Target Finder, and siDESIGN Center (Dharmacon). Based on the scoring of these tools, a list of the top 10 target sequences was generated. Then, the target sequences were each screened for homology across the entire human genome using BLAST, and those with more than 70% homology with any other gene were excluded. Finally, three target sequences were selected for cloning into mirGE and the optimized therapeutic minigene architecture (EF1s promoter, GFP2 spacer) (Table 10). Once constructed, the three minigenes were packaged into lentiviral vectors and used to transduce primary T cells from two healthy donors at MOIs of 1.0 and 2.5. All constructs also carried the mCherry-labeled gene to identify transduced cells. PD1 expression levels were measured 5–7 days after transduction using flow cytometry. Because PD1 is not uniformly or constitutively expressed on primary T cells, we first determined the percentage of PD1-expressing T cells and then compared the MFI of PD1-expressing cells to control-transduced (mCherry only) T cells. [Table 10]

[0128] An initial screen of target sequences that may be accessible for mirGE knockdown yielded one of three candidates that showed significant effects (PD1-1A). As seen in the example flow cytometry dot plots and histograms (Figure 15B-C), there was a clear shift in the fluorescence intensity of cells transduced with PD1-1A mirGE, but not T cells transduced with PD1-2A and 3A. T cells transduced with PD1-1A had a mean reduction in cells expressing PD1 of 27% (Figure 15D), whereas T cells transduced with PD1-2A and PD1-3A constructs had a reduction of 12% and 9% (p=0.047, Kruskal-Wallis ANOVA). Furthermore, within the PD1-expressing T cell population, PD1 expression was reduced by 48% in cells transduced with the PD1-1A construct (Figure 15E), whereas T cells transduced with the PD1-2A and 3A constructs had a reduction of 3% and 14% (p<0.001, Kruskal-Wallis ANOVA).

[0129] Therefore, PD1-1A mirGE was applied to further development of two and three hairpin constructs to achieve maximum knockdown of PD1 (Figure 16). T cells from the same donor used previously were transduced and evaluated for PD1 knockdown according to the experimental design shown in Figure 16A. Flow cytometry data (Figure 16B-C) showed that further PD1 downregulation could be achieved with two and three hairpin mirGE constructs, but maximum knockdown was achieved with two hairpins (as there was negligible difference when using the three hairpin construct). Both two and three hairpin constructs reduced the proportion of PD1 expressing cells by 45% and reduced PD1 expression on PD1 expressing cells by almost 40% compared to the control vector (Figure 16D-E).

[0130] PD1 knockdown in CAR T cells protects against T cell exhaustion To evaluate whether PD1-targeting constructs protect against T cell exhaustion, we transduced anti-cKit CAR T cells and co-cultured these cells with HL-60 tumor cells at effector:target (E:T) ratios of 1:15 and 1:30 for 4 days. A pure population of anti-cKit CAR T cells (previously selected) was thawed and transduced 24 hours later with a lentivector carrying a three-hairpin mirGE therapeutic minigene against PD1 at an MOI of 1.0. Co-cultures were initiated with 100,000 CAR T cells (anti-cKit with or without PD1 knockdown) and 1.5 and 3 million HL-60 tumor cells were added, achieving E:T ratios of 1:15 and 1:30, respectively. A negative control group of CAR T cells only (not co-cultured with target cells) was also included. All conditions were cultured in IL-2-free medium and made with Advanced RPMI, 10% FBS, 1% Pen-Strep, and 1x Glutamax. After 4 days of co-culture, cells were harvested for enumeration and flow cytometry analysis of PD1 expression on CD3+ T cells.

[0131] A transduction rate of approximately 20% was achieved with anti-cKit CAR T cells transduced with a therapeutic minigene targeting PD1 (based on mCherry positivity). On day 4, the transduction rate was assessed again in the negative control group and was reported to be 18.6% (Figure 18A). There was a 1.5-fold increase in the percentage of mCherry-positive cells when assessed in the 1:15 and 1:30 E:T ratio groups (compared to the negative control, Figure 18B), indicating that PD1 knockdown CAR T cells proliferated at a higher rate than CAR T cells without PD1 knockdown. Negative control CAR T cells expanded from 100,000 to 4.7 million over 4 days (Figure 18C). In the group without PD1 knockdown, anti-cKit CAR T cells expanded to 2.3 and 1.7 million under the 1:15 and 1:30 E:T ratio conditions, respectively. In the group with approx. 20% PD1 knockdown CAR T cells at accrual, cell counts of 3.2 million and 2.3 million were recorded at E:T ratios of 1:15 and 1:30, respectively. Thus, together with the fact that the percentage of mCherry positive cells increased 1.5-fold, it became clear that CAR T cells without PD1 knockdown were more rapidly exhausted, leading to reduced proliferation and / or cell death. These data were confirmed when evaluating both E:T conditions, specifically the fold increase in the mCherry positive CAR T cell population (based on the 1.5-fold ratio on day 4). When compared to the anti-cKit CAR T cell group (without the approx. 20% PD1 knockdown subpopulation), CAR T cells with PD1 knockdown had more than double the proliferation rate at E:T ratio of 1:15 (23 vs. 48-fold) and approximately double the proliferation rate at 1:30 (17 vs. 33-fold).

[0132] PD1 knockdown of mCherry-transduced CAR T cells was confirmed via flow cytometry analysis (Figure 18E). As seen in the dot plots, the PD1-expressing population of CAR T cells is significantly reduced when compared to the non-transduced CAR T cell population within the same sample (mCherry negative) and when compared to the CAR T cell group that was not transduced with the mirGE therapeutic minigene. This effect was observed in both the 1:15 and 1:30 experimental groups, which is consistent with the PD1 knockdown data previously reported herein. When comparing the 1:15 and 1:30 E:T conditions with overlaid flow cytometry dot plots and aligned histograms (Figure 18F), it was revealed that the 1:30 condition CAR T cells displayed an overall higher frequency of PD1 based on fluorescence intensity and PD1 expressing cells, indicating that these CAR T cells were significantly more depleted than those with PD1 knockdown. Finally, the percentage of PD1-expressing CAR T cells was assessed from the two E:T conditions (Figure 18G). At the 1:15 E:T ratio, both groups of CAR T cells had a median of 20% PD1-expressing cells. Given that PD1 knockdown CAR T cells comprised approximately 28% of this population (with a 1.5-fold increase over 4 days), it is clear that these cells served to rescue the overall CAR T cell population within these samples. This rescue effect was even more evident in the 1:30 condition, where nearly 70% of CAR T cells without PD1 knockdown were PD1 positive, but this decreased to less than 40% in the group that started with approximately 20% CAR T cells with PD1 knockdown.

[0133] Multi-targeting mirGE hairpins maintain the efficiency of CCR5 knockdown To assess whether up to six mirGE hairpins could be expressed in an optimized therapeutic minigene architecture (EF1s promoter, GFP2 spacer), multi-targeting hairpin constructs against PD1, GFP, and CCR5 were constructed (Figure 17A). The potential impact of CCR5 knockdown when CCR5-targeting mirGEs are located at the termini of a therapeutic minigene was evaluated. Studies were performed to determine whether CCR5 knockdown was reduced when CCR5-targeting hairpins were in positions 3 and 4 within the four hairpin constructs. Similarly, we assessed whether placement of these hairpins at positions 5 and 6 affected CCR5 knockdown. To test this, HeLaR5 cells were transduced with these constructs and CCR5 downregulation was assessed compared to the two hairpin CCR5-targeting vector and a control vector (mCherry only). CCR5 knockdown was assessed using flow cytometry. Results showed negligible differences (p=0.135, Kruskal-Wallis ANOVA) in downregulation of CCR5, with 85%, 81%, and 82% for the two hairpin, four hairpin, and six hairpin constructs, respectively (Figure 17B-C). These data, together with data showing high efficiency of single hairpin mirGE against CCR5 and PD1, demonstrate the use of therapeutic minigene technology to target at least two clinically relevant genes for downregulation.

[0134] Four hairpin therapeutic minigenes efficiently downregulate PD1 and CCR5 in primary T cells Primary T cells were transduced as described above with the four hairpin mirGE construct (two hairpins for PD1 and two for CCR5) and assessed for knockdown of these two clinically relevant target genes. Five days after transduction, expression of PD1 and CCR5 was assessed by flow cytometry (Figure 19). Indeed, a significant reduction in cells expressing both PD1 and CCR5 was observed. In overlaid dot plots and histograms, a substantial reduction in CCR5 and PD1 was observed (Figures 19A and 19B). By plotting CCR5 vs. PD1 and overlaying the mCherry positive and mCherry negative populations (Figure 19C), a significant reduction in the CCR5+PD1+ population was observed in T cells transduced with the four hairpin mirGE construct (notably, the dots in the upper right decades of the dot plots significantly exposed the CCR5+PD1+ population of non-transduced T cells). These data demonstrate that the mirGE therapeutic minigene can efficiently knock down the expression of two clinically relevant target genes. ***

[0135] All of the methods disclosed and claimed herein can be made and accomplished without undue experimentation in light of the present disclosure. Although the compositions and methods of the present invention have been described with reference to preferred embodiments, it will be apparent to those skilled in the art that modifications may be applied to the methods and in the steps or in the sequence of steps of the methods described herein without departing from the concept, spirit, or scope of the invention. More specifically, it will be apparent that certain agents that are both chemically and physiologically related may be substituted for the agents described herein so long as the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope, and concept of the invention as defined by the appended claims.

[0136] References The following references, to the extent that they provide exemplary procedural or other detail supplementary to those set forth herein, are specifically incorporated herein by reference. Aiuti et al.,Science,341:1233151,2013. Biffi et al.,Science,341:1233158,2013. Boudreau et al.,RNA,14:1834-1844,2008. Boudreau et al.,Mol Ther,17:169-175,2009 Bourhill et al.,J Virol Methods,235:26-33,2016. Fowler et al., Nucleic Acids Res,44:e48,2016. Giry-Laterriere et al.,Hum Gene Ther,22:1255-1267,2011. Giry-Laterriere et al.,Methods in molecular biology,737: 183-209,2011. Grimm,Silence2:8,2011. Hu et al.,Mol Biotechnol,46:34-40,2010. Jaquet et al.,Br J Pharmacol,164:507-520,2011 Lee et al., Embo J23:4051-4060, 2004. Liu et al., Nucleic Acids Res, 36:2811-2824, 2008. Liu and Berkhout,Methods Mol Biol,942:233-257,2013. Maczuga et al.,Mol.Ther.,21:217-227,2013. Mottet-Osman et al., J Virol, 81:2861-2868, 2007. Myburgh et al.,Molecular Therapy Nucleic Acids,3:e207,2014. Osorio et al.,J Biotechnol,169:71-81,2014. Ruby et al.,Nature,448:83-86,2007. Seyhan,Mol Biosyst,12:295-312,2016. Sibley et al.,Nucleic Acids Res,40:9863-9875,2012. Stegmeier et al.,PNAS,102:13212-13217,2005. Sullenger and Nair,Science,352:1417-1420,2016. Sun,D et al.,Biotechniques,41:59-63,2006. Winter et al.,Nat.Cell.Biol.,11:228-234.,2009. Yang et al.,Mol Ther,21:588-601,2013.

Claims

1. An miRNA expression construct comprising, from 5' to 3', a promoter element, a spacer, and at least one miRNA hairpin, wherein said spacer consists of a sequence at least 90% identical to SEQ ID NO:48 or SEQ ID NO:49, and wherein said miRNA expression construct is a nucleic acid molecule.

2. The miRNA expression construct of claim 1 , wherein the spacer enhances the knockdown efficiency of one or more miRNAs.

3. The miRNA expression construct of claim 1 , wherein the promoter is a eukaryotic promoter.

4. The miRNA expression construct of claim 3 , wherein the eukaryotic promoter is a Pol II or Pol III promoter.

5. The miRNA expression construct of claim 4 , wherein the eukaryotic promoter is a Pol II promoter.

6. The miRNA expression construct of claim 1 , wherein the promoter is an inducible, tissue-specific, or cell lineage-specific promoter.

7. The miRNA expression construct of claim 6 , wherein the promoter element is at least 90% identical to the EF1α promoter and the promoter element initiates specific transcription of the miRNA.

8. The miRNA expression construct of claim 7 , wherein the EF1α promoter is a splice variant of the EF1α promoter.

9. The miRNA expression construct of claim 8 , wherein the splice variant of the EF1α promoter is EF1s.

10. The miRNA expression construct of claim 9 , wherein the EF1s promoter has a sequence that is at least 90% or 95% identical to SEQ ID NO: 45, and wherein the EF1s promoter initiates specific transcription of the miRNA.

11. The miRNA hairpin comprises, from 5' to 3' and in the order of (a) to (g): (a) a mir-16 flanking sequence comprising the sequence of SEQ ID NO: 25; (b) a first lower stem sequence comprising the mir-16 sequence of SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, or SEQ ID NO:30; (c) an antisense target sequence of 22 nucleotides in length; (d) a mir-30 loop sequence comprising the sequence of SEQ ID NO:31; (e) a sense sequence that is complementary to the sequence of (c) except that it contains one or two mismatches relative to the sequence of (c), wherein the one or two mismatches are i) a mismatch located at positions 8 to 14 of the sense sequence, or ii) the sense sequence, which contains a mismatch at the 3' position (position 22) of the end of the sense sequence; (f) a second lower stem sequence that is complementary to the sequence of (b); and (g) a second flanking sequence.

12. The miRNA expression construct of claim 11 , wherein the sense sequence (e) of the miRNA hairpin contains one mismatch to sequence (c) located at nucleotide 11 of the sense sequence (e).

13. The miRNA expression construct of claim 12, wherein the sense sequence (e) of the miRNA hairpin contains two mismatches to sequence (c) located (i) at position 11 of the sense sequence (e) and (ii) at the 3' nucleotide (position 22) of the terminus of the sense sequence (e).

14. The miRNA expression construct of any one of claims 11 to 13, wherein the flanking sequence (g) is not complementary to the mir-16 flanking sequence (a).

15. The miRNA expression construct of any one of claims 1 to 14, wherein the nucleic acid molecule is RNA.

16. The miRNA expression construct of any one of claims 1 to 14, wherein the nucleic acid molecule is DNA.

17. The miRNA expression construct of any one of claims 1 to 16, wherein the nucleic acid molecule comprises at least two repeats of the miRNA hairpin.

18. The miRNA expression construct of claim 17 , wherein the at least two repeats are separated by an intervening sequence.

19. The miRNA expression construct of any one of claims 1 to 18, comprising at least 2, 3, 4, 5, 6, 7, 8, 9 or 10 miRNA hairpins.

20. The miRNA expression construct of claim 19 , wherein at least two of the miRNA hairpins target the same sequence.

21. The miRNA expression construct of claim 19 , wherein at least two of the miRNA hairpins target different sequences.

22. The miRNA expression construct of claim 21 , wherein at least two of the miRNA hairpins target different sequences of the transcript of the same gene.

23. The miRNA expression construct of claim 21 , wherein the miRNA hairpins target different transcripts.

24. The miRNA expression construct of claim 23 , wherein the miRNA hairpins target transcripts of different genes.

25. The miRNA expression construct of any one of claims 1 to 24, wherein the miRNA expression construct further comprises a coding sequence for a heterologous protein.

26. The miRNA expression construct of claim 25, wherein the heterologous protein is a chimeric antigen receptor or a T cell receptor.

27. The miRNA expression construct of any one of claims 1 to 26, wherein the miRNA expression construct further comprises a selection gene.

28. 28. The miRNA expression construct of claim 27, wherein the selected gene is LNGFR.

29. The miRNA expression construct of any one of claims 1 to 28, wherein the miRNA expression construct further comprises a suicide gene.

30. 30. The miRNA expression construct of claim 29, wherein the suicide gene is selected from the group consisting of herpes simplex virus thymidine kinase (HSV-tk), inducible caspase 9 (iCasp9), truncated endothelial growth factor receptor (tEGFR), RQR8, dihydrofolate reductase (DHFR), and thymidylate synthase (TYMS).

31. The miRNA expression construct of any one of claims 1 to 30, wherein the miRNA expression construct further comprises a peptide cleavage site.

32. 32. The miRNA expression construct of claim 31 , wherein the peptide cleavage site is a 2A peptide.

33. 33. The miRNA expression construct of claim 32, wherein the 2A peptide is selected from the group including 2A, P2A, T2A, E2A, F2A, BmCPV 2A, and BmIFV 2A.

34. The miRNA expression construct of claim 33, wherein the 2A peptide is T2A.

35. An expression vector comprising the miRNA expression construct of any one of claims 1 to 34.

36. The expression vector of claim 35 , wherein the vector is a viral vector.

37. 37. The expression vector of claim 36, wherein the viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector, or a lentiviral vector.

38. A mammalian cell comprising the miRNA expression construct of any one of claims 1 to 34 or the expression vector of any one of claims 35 to 37.

39. 39. The mammalian cell of claim 38, wherein the mammalian cell is an immune effector cell.

40. 40. The mammalian cell of claim 39, wherein the immune effector cell is selected from the group comprising T cells, TILS, TCR engineered T cells, CAR T cells, NK cells, NK / T cells, T regulatory cells, monocytes, and macrophages.

41. 38. An in vitro method for preparing engineered immune effector cells, comprising transfecting or transducing said immune effector cells with an miRNA expression construct according to any one of claims 1 to 34, or transducing said immune effector cells with an expression vector according to any one of claims 35 to 37.

42. 38. An in vitro method for preparing an engineered immune effector cell, comprising transfecting or transducing an immune effector cell with a chimeric antigen receptor sequence or a T cell receptor sequence and then transfecting or transducing the cell with the miRNA expression construct of any one of claims 1 to 34 or the vector of any one of claims 35 to 37.

43. 43. The in vitro method of claim 42, wherein the chimeric antigen receptor or T cell receptor is encoded by the miRNA expression construct or vector.

44. 35. An in vitro method for preparing an engineered immune effector cell, comprising integrating an miRNA expression construct according to any one of claims 1 to 34 into the genome of said cell by a TALE nuclease, a megaTAL, a zinc finger nuclease, a transposase, or CRISPR / Cas9.

45. A composition comprising the cells according to any one of claims 38 to 40 for treating a patient in need of treatment.

Images