Nucleic acids, drug compositions and complexes and methods of preparation and use

Abstract

Provided are siRNAs that suppress the expression of the proprotein convertase subtilisin / kexin type 9 (PCSK9) gene, as well as pharmaceutical compositions and complexes containing the siRNAs. Each nucleotide in the siRNA is independently modified or unmodified, and the siRNAs comprise a sense strand and an antisense strand. The sense strand comprises nucleotide sequence I, which is equal in length to the nucleotide sequence shown in SEQ ID NO: 1 and differs by no more than three nucleotides. The antisense strand comprises nucleotide sequence II, which is equal in length to the nucleotide sequence shown in SEQ ID NO: 2 and differs by no more than three nucleotides. The siRNAs, pharmaceutical compositions, and complexes thereof can effectively treat and / or prevent hypercholesterolemia.

Description

[Technical field]

[0001] The present disclosure relates to nucleic acids, pharmaceutical compositions and siRNA complexes capable of suppressing proprotein convertase subtilisin / kexin type 9 (PCSK9) gene expression. The present disclosure further relates to methods for preparing and using the nucleic acids, pharmaceutical compositions and siRNA complexes. [Background technology]

[0002] Dyslipidemia, especially persistent high levels of low-density lipoprotein cholesterol (LDL-c), is an important risk factor that induces and promotes the development and progression of atherosclerosis, is closely related to ischemic cardio-cerebrovascular disease, and poses a serious threat to human health. Conventional drugs for treating dyslipidemia mainly include statins, cholesterol absorption inhibitors, resins, probucol, fibrates, and nicotinic acid and its derivatives. Although the risk of developing cardio-cerebrovascular disease can be reduced by lowering plasma cholesterol levels with lipid-lowering drugs, the proportion of patients who do not achieve ideal lipid levels is quite high.

[0003] Research has shown that proprotein convertase subtilisin / kexin type 9 (PCSK9) gene plays an important role in lipid metabolism, especially cholesterol metabolism. By suppressing PCSK9 gene expression, plasma cholesterol level can be effectively reduced. Small interfering RNA (siRNA) can sequence-specifically suppress or block the expression of any target gene of interest based on the mechanism of RNA interference (RNA interference, RNAi), thereby achieving the purpose of treating diseases. Suppressing PCSK9 gene expression at the mRNA level is undoubtedly the most ideal therapeutic measure.

[0004] In the development of siRNA drugs to suppress PCSK9 gene expression and treat hypercholesterolemia, appropriate siRNA and its modification as well as an effective delivery system are key technologies. Summary of the Invention [Problem to be solved by the invention]

[0005] The inventors of the present disclosure have unexpectedly found that the following siRNA complexes provided by the present disclosure can specifically inhibit the expression of PCSK9 gene, specifically target the liver, inhibit the expression of PCSK9 gene in the liver, and realize the treatment or prevention of hypercholesterolemia. The inventors have also invented highly active siRNAs and drug compositions. [Means for solving the problem]

[0006] In some embodiments, the present disclosure provides a siRNA complex having the structure shown in formula (308):

[0007] [ka] In the formula, n1 is an integer selected from 1 to 3, n3 is an integer selected from 0 to 4, m1, m2, and m3 are independently an integer selected from 2 to 10, and R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H or C-C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10 alkoxy groups; R3 is a group having the structure shown in formula A59.

[0008] [ka] In the formula, E1 is OH, SH or BH2; Nu is an siRNA, the siRNA comprising a sense strand and an antisense strand, each nucleotide of the siRNA being independently modified or unmodified, the sense strand comprising a nucleotide sequence I, the antisense strand comprising a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II at least partially forming a double-stranded region in a reverse complementary manner, and the nucleotide sequence I and the nucleotide sequence II are one selected from the following i) to vi): i) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 are equal in length and have no more than three nucleotide differences; 5'-AAGCAAGCAGACAUUUAUZ1-3' (SEQ ID NO: 1), 5'-Z2AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2) wherein Z1 is C and Z2 is G, nucleotide sequence I comprises nucleotide Z3 at a position corresponding to Z1, and nucleotide sequence II comprises nucleotide Z4 at a position corresponding to Z2, and Z4 is the first nucleotide at the 5' end of the antisense strand; ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 are equal in length and have no more than three nucleotide differences; 5'-UUUGUAGCAUUUUUAUUAZ5-3' (SEQ ID NO:61), 5'-Z6UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:62) wherein Z5 is A and Z6 is U, nucleotide sequence I comprises nucleotide Z7 at a position corresponding to Z5, and nucleotide sequence II comprises nucleotide Z8 at a position corresponding to Z6, and Z8 is the first nucleotide at the 5' end of the antisense strand; iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 are equal in length and have no more than three nucleotide differences; 5'-GCCUGGAGUUUAUUCGGAZ9-3' (SEQ ID NO: 121), 5'-Z 10 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122) However, Z9 is A and Z 10 is U, and in said nucleotide sequence I, the position Z corresponds to the nucleotide Z 11 and in said nucleotide sequence II, position Z 10 Nucleotide Z corresponding to 12 wherein Z 12 is the first nucleotide at the 5' end of the antisense strand, iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 are equal in length and have no more than three nucleotide differences; 5'-CUGUUUUGCUUUUGUAACZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z 13 is U and Z 14 is A, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z 14 Nucleotide Z corresponding to 16 wherein Z 16 is the first nucleotide at the 5' end of the antisense strand, v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 are equal in length and have no more than three nucleotide differences; 5'-GGUUUUGUAGCAUUUUUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z 18 Nucleotide Z corresponding to 20 wherein Z 20 is the first nucleotide at the 5' end of the antisense strand, vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 are equal in length and have no more than three nucleotide differences; 5'-GUGACUUUUUAAAAUAAAZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z 21 is A and Z 22 is U, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 and in said nucleotide sequence II, position Z 22 Nucleotide Z corresponding to 24 wherein Z 24 is the first nucleotide at the 5' end of the antisense strand.

[0009] R2 is a linear alkylene group of 1 to 20 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterocyclylene groups and C5-C 10 heteroarylene groups, R2 being optionally substituted with one or more selected from the group consisting of C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C(O)(C1-C 10alkyl group), -N(C1-C 10 alkyl group)C(O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 alkyl group), -NHSO2 (phenyl group) and -NHSO2 (C1-C 10 halogenated alkyl groups), Each L1 is independently a straight chain alkylene group of 1 to 70 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterocyclylene groups and C5-C 10 heteroarylene groups, and L1 is C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C10 Alkyl-NH2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 alkyl group)C(O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 alkyl group), -NHSO2 (phenyl group) and -NHSO2 (C1-C 10 halogenated alkyl groups), JPEG0007610268000003.jpg6170 represents the site to which the group is covalently attached and M1 represents the targeting group.

[0010] In some embodiments, the present disclosure provides an siRNA capable of suppressing PCSK9 gene expression, the siRNA comprises a sense strand and an antisense strand, each nucleotide in the sense strand and the antisense strand is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide, the sense strand comprises a nucleotide sequence I, the antisense strand comprises a nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse-complementary manner at least in a part, the fluoro-modified nucleotide is located in the nucleotide sequence I and the nucleotide sequence II, from the 5'-end to the 3'-end, the nucleotides at the 7th, 8th, and 9th positions of the nucleotide sequence I in the sense strand are fluoro-modified nucleotides, and the nucleotides at the remaining positions in the sense strand are non-fluoro-modified nucleotides, from the 5'-end to the 3'-end, the nucleotides at the 2nd, 6th, 14th, and 16th positions of the nucleotide sequence II in the antisense strand are fluoro-modified nucleotides, and the nucleotide sequence I and the nucleotide sequence II are one selected from the above i) to vi).

[0011] In some embodiments, the present disclosure provides a pharmaceutical composition comprising a siRNA of the present disclosure and a pharma- ceutically acceptable carrier.

[0012] In some embodiments, the present disclosure provides a siRNA complex comprising an siRNA provided by the present disclosure and a conjugation group conjugated and bound to the siRNA.

[0013] In some embodiments, the present disclosure provides the use of the siRNA, and / or drug composition and / or siRNA complex of the present disclosure in the preparation of a drug for the treatment and / or prevention of a disease or physiological condition caused by abnormal expression of the PCSK9 gene.

[0014] In some embodiments, the present disclosure provides a method for treating and / or preventing a disease or physiological condition caused by abnormal expression of the PCSK9 gene, comprising administering an effective amount of the siRNA, and / or drug composition and / or siRNA complex of the present disclosure to a subject in need thereof.

[0015] In some embodiments, the present disclosure provides a method for suppressing expression of the PCSK9 gene in a hepatocyte, comprising contacting the hepatocyte with an effective amount of an siRNA, and / or drug composition and / or siRNA complex of the present disclosure.

[0016] In some embodiments, the present disclosure provides kits comprising the siRNAs, and / or drug compositions and / or siRNA complexes of the present disclosure. Effect of the Invention

[0017] The siRNA, drug composition and siRNA complex provided by the present disclosure have excellent stability, high PCSK9 mRNA suppression activity, reduced off-target effects and toxicity, and / or can significantly treat or prevent diseases or physiological conditions caused by abnormal expression of the PCSK9 gene, such as hypercholesterolemia.

[0018] In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits excellent target mRNA suppression activity in in vitro cell experiments. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% target mRNA suppression rate in liver cells.

[0019] In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure can have higher stability and / or higher activity in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% target gene expression suppression rate in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% PCSK9 gene expression suppression rate in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% intrahepatic PCSK9 gene expression suppression rate in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% inhibition rate of intrahepatic PCSK9 gene expression in animal models in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 95% inhibition rate of intrahepatic PCSK9 gene expression in human subjects in vivo. In some embodiments, the siRNA, drug composition or siRNA complex provided by the present disclosure does not exhibit significant off-target effects. An off-target effect may be, for example, inhibition of normal expression of a non-target gene. When the binding / inhibition of off-target gene expression is 50%, 40%, 30%, 20% or 10% lower than the on-target gene effect, the off-target effect is considered to be not significant.

[0020] In some embodiments, the siRNA provided by the present disclosure exhibits high inhibitory activity in the psiCHECK system and IC 50is 0.0194-0.0561 nM. In some embodiments, the siRNA complex provided by the present disclosure is administered to cynomolgus monkeys by subcutaneous injection once, and at a dose of 9 mg / kg, the inhibition rate of PCSK9 mRNA in NHP liver tissue is as high as 56-81% on the 15th day after administration compared to the 7th day before administration. In some embodiments, the siRNA complex provided by the present disclosure further suppresses PCSK9 protein expression in serum, and the inhibition rate of PCSK9 protein expression in serum is as high as 90% or more on the 14th day after administration. In some embodiments, the siRNA complex provided by the present disclosure can significantly suppress serum LDL-c and CHO levels, and in particular, the inhibition rate of LDL-c is as high as 30% or more, even reaching 64%, from the 14th day to the 29th day after administration. The inhibition rate of CHO is also high, reaching a high of 35% or more. In some embodiments, the siRNA complex provided by the present disclosure can maintain the LDL-c suppression rate at 50% or more for as long as 11 weeks at a single dose of 9 mg / kg, and the siRNA complex provided by the present disclosure does not show significant toxicity in either rats or mice. As described above, the siRNA complex provided by the present disclosure has a rapid onset of effect, a long duration, significant suppression of target mRNA expression, can effectively reduce the content of PCSK9 protein in serum, has a strong inhibitory effect on LDL-c and CHO in serum, and is excellent in biological safety.

[0021] Thus, the siRNA, pharmaceutical composition and siRNA complex provided by the present disclosure can suppress the expression of the PCSK9 gene and effectively treat and / or prevent diseases or physiological conditions caused by abnormal expression of the PCSK9 gene, and have bright prospects for application. Other features and advantages of the present disclosure are described in detail in the Detailed Description section that follows. [Brief description of the drawings]

[0022] [Fig. 1A-1F]In order, dose-effect curves were fitted according to the relative residual activity of the reporter gene Renilla in the psiCHECK system after transfection with different siRNAs (siRNA 1-6). [Diagram 2] FIG. 1 shows normalized PCSK9 protein levels in serum at different time points after a single dose of 9 mg / kg of conjugates 1, 4 or 7 administered subcutaneously to cynomolgus monkeys. [Diagram 3] FIG. 1 shows normalized LDL-c levels in serum at different time points after a single dose of 9 mg / kg of conjugates 4 or 7, respectively, administered subcutaneously to cynomolgus monkeys. [Figure 4] FIG. 13. Normalized CHO levels in serum at different time points after a single dose of 9 mg / kg of conjugates 4 or 7, respectively, administered subcutaneously to cynomolgus monkeys. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] The following describes in detail the embodiments of the present disclosure. It should be understood that the embodiments of the present disclosure are merely for explaining or interpreting the present disclosure and are not intended to limit the present disclosure.

[0024] In this disclosure, PCSK9 mRNA refers to the mRNA having the sequence set forth in Genbank Accession No. NM_174936.3. Furthermore, unless otherwise specified, the term "target gene" as used in this disclosure refers to a gene capable of transcribing the PCSK9 mRNA, and the term "target mRNA" refers to the PCSK9 mRNA.

[0025] definition Unless otherwise specified in the context, capital letters C, G, U, A, and T represent the base sequence of nucleotides, lower case letter m represents that one nucleotide adjacent to the left side of the letter m is a methoxy-modified nucleotide, lower case letter f represents that one nucleotide adjacent to the left side of the letter f is a fluoro-modified nucleotide, lower case letter s represents that two nucleotides adjacent to the left and right sides of the letter s are bonded by a thiophosphate group, P1 represents that one nucleotide adjacent to the right side of the P1 is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide, the combination letter VP represents that one nucleotide adjacent to the right side of the combination letter VP is a vinyl phosphate-modified nucleotide, the combination letter Ps represents that one nucleotide adjacent to the right side of the combination letter Ps is a thiophosphate-modified nucleotide, and capital letter P represents that one nucleotide adjacent to the right side of the letter P is a 5'-phosphate nucleotide.

[0026] In this context, the "fluoro-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group of the nucleotide is replaced with fluorine, and the "non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the 2'-hydroxyl group of the ribose group of the nucleotide is replaced with a non-fluorine group. The "nucleotide analog" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide or thymine deoxyribonucleotide, such as an isonucleotide, bridged nucleic acid (BNA) or acyclic nucleotide. The "methoxy-modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is replaced with methoxy.

[0027] In the context of this specification, the terms "complementary" or "reverse complementary" may be used interchangeably and have the meaning well known to those skilled in the art, i.e., in a double-stranded nucleic acid molecule, each base of one strand is paired with a base on the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA), and the purine base guanine (C) always pairs with the pyrimidine base cytosine (G). Each base pair contains one purine and one pyrimidine. If adenine on one strand always pairs with thymine (or uracil) on the other strand and guanine always pairs with cytosine, it is considered that both strands are complementary and that the sequence of the strand can be deduced from the sequence of the complementary strand. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, bases at corresponding positions are not paired in a complementary manner.

[0028] Unless otherwise specified in context, "essentially reverse complementary" refers to no more than three base mismatches between two related nucleotide sequences, "substantially reverse complementary" refers to no more than one base mismatch between two nucleotide sequences, and "fully reverse complementary" refers to no base mismatches between two nucleotide sequences.

[0029] In this context, the presence of a "nucleotide difference" between one nucleotide sequence and another nucleotide sequence refers to a change in the base type of the nucleotide at the same position in the former compared to the latter, for example, when one nucleotide base in the latter is A, a nucleotide difference is recognized to exist between two nucleotide sequences at that position if the corresponding nucleotide base at the same position in the former is U, C, G, or T. In some embodiments, a nucleotide difference at a position is also considered to have occurred when an abasic nucleotide or its equivalent is used in place of the nucleotide at the original position.

[0030] In the context, particularly in describing the preparation method of the siRNA, drug composition or siRNA complex of the present disclosure, unless otherwise specified, the nucleoside monomer refers to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, RNA phosphoramidites are sometimes referred to as nucleoside phosphoramidites) used in phosphoramidite solid-phase synthesis according to the type and order of nucleotides in the siRNA or siRNA complex to be prepared. Phosphoramidite solid-phase synthesis is a method used for RNA synthesis known to those skilled in the art. All of the nucleoside monomers used in the present disclosure are commercially available.

[0031] In the context of the present disclosure, unless otherwise specified, "complex" refers to two or more chemical moieties each having a specific function being covalently bonded to each other, and accordingly, "complex" refers to a compound formed by covalently bonding the respective chemical moieties. Furthermore, "siRNA complex" refers to a compound formed by covalently bonding one or more chemical moieties having a specific function to siRNA. In the following text, the siRNA complex of the present disclosure may also be simply referred to as "complex". Depending on the context, the siRNA complex is understood to be a collective term for multiple siRNA complexes, or a siRNA complex represented by a certain chemical formula. In the context of the present disclosure, a "complex molecule" should be understood to be a specific compound that can be reacted to be complexed to siRNA to finally form the siRNA complex of the present disclosure.

[0032] As used herein, "optional" or "optionally" refers to the subsequently described event or circumstance that may or may not occur, and includes the occurrence and non-occurrence of the described event or circumstance. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined in the following sentence. With respect to any groups that contain one or more substituents, it will be understood by those of skill in the art that it is not intended that these groups introduce any substitutions or substitution patterns that are sterically impractical, synthetically impractical, and / or inherently unstable.

[0033] As used herein, "alkyl" refers to straight and branched chains having a specified number of carbon atoms, typically 1 to 20 carbon atoms, e.g., 1 to 10 carbon atoms, 1 to 8, or 1 to 6 carbon atoms. For example, C1-C6 alkyl includes straight and branched chain alkyls of 1 to 6 carbon atoms. When referring to an alkyl residue having a specific number of carbons, it is intended to include all branched and straight chain forms having that number of carbons. Thus, for example, "butyl" is meant to include n-butyl, sec-butyl, isobutyl, and tert-butyl, and "propyl" includes n-propyl and isopropyl. Alkylene is a subset of alkyl and refers to the same residue as alkyl but having two points of attachment.

[0034] As used herein, "alkenyl" refers to an unsaturated branched or straight chain alkyl having at least one carbon-carbon double bond, which is obtained by removing one hydrogen molecule from adjacent carbon atoms of a parent alkyl. The group may be in the cis or trans configuration of the double bond. Exemplary alkenyls include, but are not limited to, vinyl, propenyls such as prop-1-en-1-yl, prop-1-en-2-yl, prop-2-en-1-yl (allyl), prop-2-en-2-yl, and butenyls such as but-1-en-1-yl, but-1-en-2-yl, 2-methylprop-1-en-1-yl, but-2-en-1-yl, but-2-en-2-yl, buta-1,3-dien-1-yl, and buta-1,3-dien-2-yl. In some embodiments, alkenyl has from 2 to 20 carbon atoms, but in other embodiments, from 2 to 10, 2 to 8, or 2 to 6 carbon atoms. Alkenylene is a subset of alkenyl, referring to residues similar to alkenyl, but having two points of attachment.

[0035] As used herein, "alkynyl" refers to an unsaturated branched or straight chain alkyl group having at least one carbon-carbon triple bond, the carbon-carbon triple bond being obtained by removing two hydrogen molecules from adjacent carbon atoms of a parent alkyl. Exemplary alkynyls include, but are not limited to, ethynyl, propynyl, such as prop-1-yn-1-yl, prop-2-yn-1-yl, and butynyl, such as but-1-yn-1-yl, but-1-yn-3-yl, but-3-yn-1-yl. In certain embodiments, alkynyl has 2-20 carbon atoms, while in other embodiments, 2-10, 2-8, or 2-6 carbon atoms. Alkynylene is a subset of alkynyl and refers to a residue similar to alkynyl but having two points of attachment.

[0036] As used herein, "alkoxy" refers to an alkyl of the specified number of carbon atoms attached through an oxygen bridge, for example, methoxy, ethoxy, propoxy, isopropoxy, n-butoxy, sec-butoxy, tert-butoxy, pentyloxy, 2-pentyloxy, isopentyloxy, neopentyloxy, hexyloxy, 2-hexyloxy, 3-hexyloxy, 3-methylpentyloxy, etc. An alkoxy typically has 1 to 10, 1 to 8, 1 to 6, or 1 to 4 carbon atoms attached through an oxygen bridge.

[0037] As used herein, "aryl" refers to a group formed by removing a hydrogen atom from a ring carbon atom derived from an aromatic monocyclic or polycyclic hydrocarbon ring system. The aromatic monocyclic or polycyclic hydrocarbon ring system contains only hydrogen atoms and 6-18 carbon atoms, and at least one of the rings in the ring system is fully unsaturated, i.e., it contains a cyclic, delocalized (4n+2) π-electron system according to the Hückel theory. Aryl includes, but is not limited to, groups such as phenyl, fluorenyl, and naphthyl. Arylene is a subset of aryl and refers to a residue that is the same as aryl but has two points of attachment.

[0038] As used herein, a "halogen substituent" or "halo" refers to fluoro, chloro, bromo, or iodo, and the term "halogen" includes fluorine, chlorine, bromine, or iodine.

[0039] As used herein, "halogenated alkyl" refers to an alkyl group as defined above in which a specified number of carbon atoms are substituted with one or more halogen atoms, up to the maximum permitted number. Illustrative examples of halogenated alkyl include, but are not limited to, trifluoromethyl, difluoromethyl, 2-fluoroethyl, or pentafluoroethyl.

[0040] "Heterocyclic group" refers to a stable 3- to 18-membered non-aromatic cyclic group containing 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, or sulfur. Unless otherwise stated in the specification, a heterocyclic group may be a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, and may include fused or bridged ring systems. The heteroatoms in a heterocyclic group may be optionally oxidized. One or more nitrogen atoms, if present, are optionally quaternized. A heterocyclic group is partially saturated or fully saturated. A heterocyclic group may be attached to the remainder of the molecule through any atom of the ring. Illustrative examples of such heterocyclic groups include dioxanyl, thienyl[1,3]dithianyl, decahydroisoquinolinyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindole, octahydroisoindole, 2-oxapiperazinyl, 2-oxapiperidyl, 2-oxapyrrolidinyl, oxazolidinyl, piperidyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, and the like. These include, but are not limited to, lysinyl, pyrazolidyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl and 1,1-dioxo-thiomorpholinyl.

[0041] "Heteroaryl" refers to a group derived from a 3-18 membered aromatic ring radical containing 2-17 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen and sulfur. As used herein, heteroaryl may be a monocyclic, bicyclic, tricyclic or tetracyclic ring system in which at least one of the rings is fully unsaturated, i.e., it contains a cyclic delocalized (4n+2) π-electron system according to the Huckel theory. Heteroaryl includes fused or bridged ring systems. The heteroatoms in heteroaryl are optionally oxidized. One or more nitrogen atoms (if present) are optionally quaternized. Heteroaryl is bonded to the remainder of the molecule through any atom in the ring. Illustrative examples of heteroaryl include azepinyl, acridinyl, benzimidazolyl, benzoindole, 1,3-benzodioxazolyl, benzofuryl, benzoxazolyl, benzo[d]thiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxepinyl, benzo[b][1,4]oxazinyl, 1,4-benzodioxanyl, benzonaphthofuranyl, benzoxazolyl, benzodioxolyl, benzodioxy, and the like. benzodioxinyl, benzopyranyl, benzopyronyl, benzofuryl, benzofuranonyl, benzothiophenyl, benzothieno[3,2-d]pyrimidinyl, benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazolyl, cinnolinyl, cyclopenta[d]pyrimidinyl, 6,7-dihydro-5H-cyclopenta[4,5]thieno[2,3-d]pyrimidinyl, 5,6-dihydrobenzo[h]quinazolinyl, 5,6-dihydrobenzo[h]cinnolinyl(5,6 dihydrobenzo[h]cinnolinyl), 6,7-dihydro-5H-benzo[6,7]cyclohepta[1,2-c]pyridazinyl, dibenzofuryl, dibenzothiophenyl, furyl, furanonyl, furo[3,2-c]pyridyl, 5,6,7,8,9,10-hexahydrocycloocta[d]pyrimidinyl, 5,6,7,8,9,10-Hexahydrocycloocta[d]pyridazinyl, 5,6,7,8,9,10-Hexahydrocycloocta[d]pyridyl, isothiazolyl, imidazolyl, indazolyl, indole, isoindole, indolinyl, isoindolinyl, isoquinolyl, indolizinyl, isoxazolyl, 5,8-methano-5,6,7,8-tetrahydroquinazolinyl olinyl), naphthyridinyl, 1,6-naphthyridinonyl, oxadiazolyl, 2-oxoazepinyl, oxazolyl, oxiranyl, 5,6,6a,7,8,9,10,10a-octahydrobenzo[H]quinazolinyl, 1-phenyl-1H-pyrrolyl, phenazinyl, phenothiazinyl, phenoxazinyl, phthalazinyl ), pteridinyl, purinyl, pyrrolyl, pyrazolyl, pyrazolo[3,4-d]pyrimidinyl, pyridyl, pyrido[3,2-d]pyrimidinyl, pyrido[3,4-d]pyrimidinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quinolyl, tetrahydroquinolyl, 5,6,7,8-tetrahydroquinazolinyl, 5,6,7,8-tetrahydrobenzo[4,5]thieno[2,3-d]pyrimidinyl, 6,7, These include, but are not limited to, 8,9-tetrahydro-5H-cyclohepta[4,5]thieno[2,3-d]pyrimidinyl, 5,6,7,8-tetrahydropyrido[4,5-c]pyridazinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, thieno[2,3-d]pyrimidinyl, thieno[3,2-d]pyrimidinyl, thieno[2,3-c]pridinyl, and thiophenyl / thienyl.

[0042] A variety of hydroxy protecting groups can be used in the present disclosure. In general, a protecting group can render chemical functionalities inert to certain reaction conditions and can be added and removed from that functional group in a molecule without substantially damaging the remainder of the molecule. Representative hydroxy protecting groups are disclosed in Beaucage et al., Tetrahedron 1992, 48, 2223-2311, and Greene and Wuts, Protective Groups in Organic Synthesis, Chapter 2, 2d ed, John Wiley & Sons, New York, 1991, each of which is incorporated herein by reference in its entirety. In some embodiments, the protecting group is stable under basic conditions but can be removed under acidic conditions. In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include dimethoxytrityl (DMT), monomethoxytrityl, 9-phenylxanthen-9-yl (Pixyl), or 9-(p-methoxyphenyl)xanthen-9-yl (Mox). In some embodiments, non-exclusive examples of hydroxy protecting groups that can be used herein include Tr (trityl), MMTr (4-methoxytrityl), DMTr (4,4'-dimethoxytrityl), or TMTr (4,4',4''-trimethoxytrityl).

[0043] The term "subject" as used herein refers to any animal, e.g., a mammal or marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus monkeys or other types of macaques), mice, pigs, horses, donkeys, cows, sheep, rats, or any type of poultry.

[0044] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including, but not limited to, a therapeutic effect. A "therapeutic effect" refers to eradicating or ameliorating the underlying disorder being treated. A therapeutic effect is also obtained by observing an improvement in a subject by eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, even though the subject may still be afflicted by the underlying disorder.

[0045] As used herein, "prevention" refers to a method of obtaining a beneficial or desired result, including but not limited to a prophylactic effect. To obtain a "prophylactic effect," a siRNA complex or drug composition can be administered to a subject at risk of suffering from a particular disease, although the subject may not have been diagnosed with the disease, or to a subject who has been reported to have one or more pathological symptoms of the disease.

[0046] In one aspect, the disclosure provides six siRNAs capable of suppressing PCSK9 gene expression.

[0047] The siRNA of the present disclosure contains a nucleotide group as a basic structural unit, and the nucleotide group contains a phosphate group, a ribose group, and a base, which is known to those skilled in the art, and therefore will not be described here.

[0048] The siRNA of the present disclosure comprises a sense strand and an antisense strand, the sense strand and the antisense strand having the same or different lengths, the sense strand having a length of 19 to 23 nucleotides, and the antisense strand having a length of 19 to 26 nucleotides. Thus, the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 19, 19 / 20, 19 / 21, 19 / 22, 19 / 23, 19 / 24, 19 / 25, 19 / 26, 20 / 20, 20 / 21, 20 / 22, 20 / 23, 20 / 24, 20 / 25, 20 / 26, 21 / 20, 21 / 21, 21 / 22, 21 / 23, 21 / 24, 21 / 25, 21 / 26, 22 / 20, 22 / 21, 22 / 22, 22 / 23, 22 / 24, 22 / 25, 22 / 26, 23 / 20, 23 / 21, 23 / 22, 23 / 23, 23 / 24, 23 / 25 or 23 / 26. In some embodiments, the length ratio of the sense strand to the antisense strand of the siRNA is 19 / 21, 21 / 23, or 23 / 25.

[0049] <First siRNA> According to the present disclosure, the siRNA may be a first siRNA.

[0050] The first siRNA comprises a sense strand and an antisense strand, each nucleotide of the first siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 1 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 2 are equal in length and have no more than three nucleotide differences. 5'-AAGCAAGCAGACAUUUAUZ1-3' (SEQ ID NO: 1), 5'-Z2AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 2) wherein Z1 is C and Z2 is G, nucleotide sequence I includes nucleotide Z3 whose position corresponds to Z1, and nucleotide sequence II includes nucleotide Z4 whose position corresponds to Z2, and Z4 is the first nucleotide at the 5' end of the antisense strand.

[0051] In this context, "corresponding in position" refers to being at the same position in a nucleotide sequence from the same end of the nucleotide sequence. For example, the first nucleotide at the 3' end of nucleotide sequence I is the nucleotide that corresponds in position to the first nucleotide at the 3' end of SEQ ID NO:1.

[0052] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0053] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:1, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:2.

[0054] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 comprises a difference at position Z4, where Z4 is selected from A, U or C. In some embodiments, the nucleotide difference is a difference at position Z4, where Z4 is selected from A, U or C. In some embodiments, Z3 is a nucleotide complementary to Z4. The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0055] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are basically reverse complementary, substantially reverse complementary, or completely reverse complementary, where basically reverse complementary means that there are no more than three base mismatches between the two nucleotide sequences, substantially reverse complementary means that there are no more than one base mismatch between the two nucleotide sequences, and completely reverse complementary means that there are no base mismatches between the two nucleotide sequences.

[0056] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:3 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:4. 5'-AAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO: 3), 5'-Z4AUAAAUGUCUGCUUGCUU-3' (SEQ ID NO: 4) wherein Z4 is the first nucleotide at the 5' end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3, and in some embodiments, Z3 is C and Z4 is G.

[0057] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, wherein nucleotide sequence III and nucleotide sequence IV each have a length of 1 to 4 nucleotides, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, and the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II. In some embodiments, the nucleotide sequence IV and a second nucleotide sequence are substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 1 in the target mRNA and having a length equal to that of the nucleotide sequence IV.

[0058] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length, the base of the nucleotide sequence III is C and the base of the nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base sequence of the nucleotide sequence III is CC from the 5' end to the 3' end, and the base sequence of the nucleotide sequence IV is GG, and the length ratio of the sense strand to the antisense strand is 21 / 21; or The nucleotide sequences III and IV are each 3 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is CCC and the base sequence of the nucleotide sequence IV is GGG, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are each 4 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is ACCC and the base sequence of the nucleotide sequence IV is GGGU, and the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequences III and IV are each 2 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is CC and the base sequence of the nucleotide sequence IV is GG, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0059] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0060] <Second siRNA> According to the present disclosure, the siRNA may be a second siRNA.

[0061] The second siRNA comprises a sense strand and an antisense strand, each nucleotide of the second siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 are equal in length and have no more than three nucleotide differences. 5'-UUUGUAGCAUUUUUAUUAZ5-3' (SEQ ID NO:61), 5'-Z6UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:62) wherein Z5 is A and Z6 is U, nucleotide sequence I includes nucleotide Z7 whose position corresponds to Z5, and nucleotide sequence II includes nucleotide Z8 whose position corresponds to Z6, and Z8 is the first nucleotide at the 5' end of the antisense strand.

[0062] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0063] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:61, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:62.

[0064] In some embodiments, the nucleotide difference between the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:62 comprises a difference at position Z8, where Z8 is selected from A, C or G. In some embodiments, the nucleotide difference is a difference at position Z8, where Z8 is selected from A, C or G. In some embodiments, Z7 is a nucleotide complementary to Z8. The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs comprising these nucleotide differences are also within the scope of protection of the present disclosure.

[0065] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary.

[0066] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:63 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:64. 5'-UUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:63), 5'-Z8UAAUAAAAAUGCUACAAA-3' (SEQ ID NO:64) wherein Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7, and in some embodiments, Z7 is A and Z8 is U.

[0067] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, each of nucleotide sequence III and nucleotide sequence IV having a length of 1 to 4 nucleotides, the nucleotide sequence III and the nucleotide sequence IV being equal in length and being substantially reverse complementary or completely reverse complementary, the nucleotide sequence III being bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV being bound to the 3' end of the nucleotide sequence II, the nucleotide sequence IV being substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence referring to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 61 in the target mRNA and having a length equal to that of the nucleotide sequence IV.

[0068] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length, the base of the nucleotide sequence III is U and the base of the nucleotide sequence IV is A, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base sequence of the nucleotide sequence III is GU and the base sequence of the nucleotide sequence IV is AC, from the 5' end to the 3' end, and the length ratio of the sense strand to the antisense strand is 21 / 21; or The nucleotide sequences III and IV are each 3 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is GGU and the base sequence of the nucleotide sequence IV is ACC, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are each 4 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is GGGU and the base sequence of the nucleotide sequence IV is ACCC, and the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequences III and IV are each 2 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is GU and the base sequence of the nucleotide sequence IV is AC, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0069] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0070] <Third siRNA> According to the present disclosure, the siRNA may be a third siRNA.

[0071] The third siRNA comprises a sense strand and an antisense strand, each nucleotide of the third siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 are equal in length and have no more than three nucleotide differences. 5'-GCCUGGAGUUUAUUCGGAZ9-3' (SEQ ID NO: 121), 5'-Z 10 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 122) However, Z9 is A and Z 10 is U, and in said nucleotide sequence I, the position Z corresponds to the nucleotide Z 11 and in said nucleotide sequence II, position Z 10 Nucleotide Z corresponding to 12 wherein Z 12 is the first nucleotide at the 5' end of the antisense strand.

[0072] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0073] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:121, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:122.

[0074] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO: 122 is Z 12 including the difference at the position of Z 12is selected from A, C, or G. In some embodiments, the nucleotide difference is 12 is the difference in position, Z 12 is selected from A, C, or G. In some embodiments, Z 11 is Z 12 The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0075] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary. In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:123 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:124. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 123), 5'-Z 12 UCCGAAUAAACUCCAGGC-3' (SEQ ID NO: 124) However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 11 is selected from A, U, G or C; Z 12 is Z 11 and in some embodiments, Z 11 is A and Z 12 is U.

[0076] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, wherein nucleotide sequence III and nucleotide sequence IV are each 1 to 4 nucleotides in length, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II, the nucleotide sequence IV and a second nucleotide sequence are substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 121 in the target mRNA and has a length equal to that of the nucleotide sequence IV.

[0077] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length, the base of the nucleotide sequence III is G and the base of the nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base sequence of the nucleotide sequence III is AG from the 5' end to the 3' end, and the base sequence of the nucleotide sequence IV is CU, and the length ratio of the sense strand to the antisense strand is 21 / 21; or The nucleotide sequences III and IV are each 3 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of nucleotide sequence III is UAG and the base sequence of nucleotide sequence IV is CUA, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are each 4 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of nucleotide sequence III is AUAG and the base sequence of nucleotide sequence IV is CUAU, and the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequences III and IV are each 2 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of nucleotide sequence III is AG and the base sequence of nucleotide sequence IV is CU, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0078] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0079] <The fourth siRNA> According to the present disclosure, the siRNA may be a fourth siRNA.

[0080] The fourth siRNA comprises a sense strand and an antisense strand, each nucleotide of the fourth siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 are equal in length and have no more than three nucleotide differences. 5'-CUGUUUUGCUUUUGUAACZ 13 -3' (SEQ ID NO: 181), 5'-Z 14 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z 13 is U and Z 14 is A, and in said nucleotide sequence I, position Z 13 Nucleotide Z corresponding to 15 and in said nucleotide sequence II, position Z 14 Nucleotide Z corresponding to 16 wherein Z 16 is the first nucleotide at the 5' end of the antisense strand.

[0081] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0082] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:181, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:182.

[0083] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO: 182 is Z16 including the difference at the position of Z 16 is selected from U, C, or G. In some embodiments, the nucleotide difference is 16 is the difference in position, Z 16 is selected from U, C, or G. In some embodiments, Z 15 is Z 16 The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0084] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary.

[0085] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:183 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:184. 5'-CUGUUUUGCUUUUGUAACZ 15 -3' (SEQ ID NO: 183), 5'-Z 16 GUUACAAAAGCAAAACAG-3' (SEQ ID NO: 184) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 15 is selected from A, U, G or C; Z 16 is Z 15 and in some embodiments, Z 15 is U and Z 16 is A.

[0086] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, each of nucleotide sequence III and nucleotide sequence IV having a length of 1 to 4 nucleotides, the nucleotide sequence III and the nucleotide sequence IV being equal in length and being substantially reverse complementary or completely reverse complementary, the nucleotide sequence III being bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV being bound to the 3' end of the nucleotide sequence II, the nucleotide sequence IV being substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence referring to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 181 in the target mRNA and having a length equal to that of the nucleotide sequence IV.

[0087] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length, the base of the nucleotide sequence III is C and the base of the nucleotide sequence IV is G, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base sequence of the nucleotide sequence III is AC from the 5' end to the 3' end, and the base sequence of the nucleotide sequence IV is GU, and the length ratio of the sense strand to the antisense strand is 21 / 21; or The nucleotide sequences III and IV are each 3 nucleotides in length, from the 5' to the 3' end, the base sequence of nucleotide sequence III is GAC and the base sequence of nucleotide sequence IV is GUC, and the length ratio of the sense strand to the antisense strand is 22 / 22, or the nucleotide sequences III and IV are each 4 nucleotides in length, from the 5' to the 3' end, the base sequence of nucleotide sequence III is AGAC and the base sequence of nucleotide sequence IV is GUCU, and the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequences III and IV are each 2 nucleotides in length, from the 5' to the 3' end, the base sequence of nucleotide sequence III is AC and the base sequence of nucleotide sequence IV is GU, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0088] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0089] <The fifth siRNA> According to the present disclosure, the siRNA may be a fifth siRNA.

[0090] The fifth siRNA comprises a sense strand and an antisense strand, each nucleotide of the fifth siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 are equal in length and have no more than three nucleotide differences. 5'-GGUUUUGUAGCAUUUUUAZ 17 -3' (SEQ ID NO: 241), 5'-Z 18 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z 17 is U and Z 18 is A, and in said nucleotide sequence I, position Z 17 Nucleotide Z corresponding to 19 and in said nucleotide sequence II, position Z 18 Nucleotide Z corresponding to 20 wherein Z 20 is the first nucleotide at the 5' end of the antisense strand.

[0091] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0092] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:241, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:242.

[0093] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO: 242 is Z20 including the difference at the position of Z 20 is selected from U, C, or G. In some embodiments, the nucleotide difference is 20 is the difference in position, Z 20 is selected from U, C, or G. In some embodiments, Z 19 is Z 20 The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0094] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary.

[0095] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:243 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:244. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 243), 5'-Z 20 UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 244) However, the above Z 20 is the first nucleotide at the 5' end of the antisense strand, and Z 19 is selected from A, U, G or C; Z 20 is Z 19 and in some embodiments, Z 19 is U and Z 20 is A.

[0096] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, wherein nucleotide sequence III and nucleotide sequence IV are each 1 to 4 nucleotides in length, the nucleotide sequence III and the nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary, the nucleotide sequence III is bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV is bound to the 3' end of the nucleotide sequence II, the nucleotide sequence IV and a second nucleotide sequence are substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence refers to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 241 in the target mRNA and has a length equal to that of the nucleotide sequence IV.

[0097] In some embodiments, the nucleotide sequence III and the nucleotide sequence IV are both 1 nucleotide in length, the base of the nucleotide sequence III is G and the base of the nucleotide sequence IV is C, and the length ratio of the sense strand to the antisense strand is 20 / 20; or the nucleotide sequences III and IV are both 2 nucleotides in length, the base sequence of the nucleotide sequence III is UG from the 5' end to the 3' end, and the base sequence of the nucleotide sequence IV is CA, and the length ratio of the sense strand to the antisense strand is 21 / 21; or The nucleotide sequences III and IV are each 3 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is CUG and the base sequence of the nucleotide sequence IV is CAG, and the length ratio of the sense strand to the antisense strand is 22 / 22; or the nucleotide sequences III and IV are each 4 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is UCUG and the base sequence of the nucleotide sequence IV is CAGA, and the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, the nucleotide sequences III and IV are each 2 nucleotides in length, from the 5'-end to the 3'-end, the base sequence of the nucleotide sequence III is UG and the base sequence of the nucleotide sequence IV is CA, and the length ratio of the sense strand to the antisense strand is 21 / 21.

[0098] In some embodiments, nucleotide sequence III and nucleotide sequence IV are perfectly reverse complementary, such that given a base of nucleotide sequence III, the base of nucleotide sequence IV is also determined.

[0099] <6th siRNA> According to the present disclosure, the siRNA may be a sixth siRNA.

[0100] The sixth siRNA comprises a sense strand and an antisense strand, each nucleotide of the sixth siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 are equal in length and have no more than three nucleotide differences. 5'-GUGACUUUUUAAAAUAAAZ 21 -3' (SEQ ID NO: 301), 5'-Z 22 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z 21 is A and Z 22 is U, and in said nucleotide sequence I, position Z 21 Nucleotide Z corresponding to 23 and in said nucleotide sequence II, position Z 22 Nucleotide Z corresponding to 24 wherein Z 24 is the first nucleotide at the 5' end of the antisense strand.

[0101] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0102] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:301, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:302.

[0103] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO: 302 is Z24 including the difference at the position of Z 24 is selected from A, C, or G. In some embodiments, the nucleotide difference is 24 is the difference in position, Z 24 is selected from A, C, or G. In some embodiments, Z 23 is Z 24 The siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and the siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0104] In some embodiments, the nucleotide sequence I and the nucleotide sequence II are essentially reverse complementary, substantially reverse complementary, or completely reverse complementary.

[0105] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:303 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:304. 5'-GUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 303), 5'-Z 24 UUUAUUUUAAAAAAAGUCAC-3' (SEQ ID NO: 304) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 23 is selected from A, U, G or C; Z 24 is Z 23 and in some embodiments, Z 23 is A and Z 24 is U.

[0106] In some embodiments, the sense strand further comprises nucleotide sequence III, and the antisense strand further comprises nucleotide sequence IV, each of nucleotide sequence III and nucleotide sequence IV having a length of 1 to 4 nucleotides, the nucleotide sequence III and the nucleotide sequence IV being equal in length and being substantially reverse complementary or completely reverse complementary, the nucleotide sequence III being bound to the 5' end of the nucleotide sequence I, the nucleotide sequence IV being bound to the 3' end of the nucleotide sequence II, the nucleotide sequence IV being substantially reverse complementary or completely reverse complementary, and the second nucleotide sequence referring to a nucleotide sequence adjacent to the 5' end of the nucleotide sequence shown in SEQ ID NO: 301 in the target mRNA and having a length equal to that of the nucleotide sequence IV.

[0107] In some embodiments, both the nucleotide sequence III and the nucleotide sequence IV are 1 nucleotide in length, the base of the nucleotide sequence III is G, and the base of the nucleotide sequence IV is C. At this time, the length ratio of the sense strand to the antisense strand is 20 / 20. Alternatively, both the nucleotide sequence III and the nucleotide sequence IV are 2 nucleotides in length. From the 5'-end to the 3'-end, the nucleotide sequence of the nucleotide sequence III is UG, and the nucleotide sequence of the nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the antisense strand is 21 / 21. Alternatively, both the nucleotide sequence III and the nucleotide sequence IV are 3 nucleotides in length. From the 5'-end to the 3'-end, the nucleotide sequence of the nucleotide sequence III is AUG, and the nucleotide sequence of the nucleotide sequence IV is CAU. At this time, the length ratio of the sense strand to the antisense strand is 22 / 22. Alternatively, both the nucleotide sequence III and the nucleotide sequence IV are 4 nucleotides in length. From the 5'-end to the 3'-end, the nucleotide sequence of the nucleotide sequence III is UAUG, and the nucleotide sequence of the nucleotide sequence IV is CAUA. At this time, the length ratio of the sense strand to the antisense strand is 23 / 23. In some embodiments, both the nucleotide sequence III and the nucleotide sequence IV are 2 nucleotides in length. From the 5'-end to the 3'-end, the nucleotide sequence of the nucleotide sequence III is UG, and the nucleotide sequence of the nucleotide sequence IV is CA. At this time, the length ratio of the sense strand to the antisense strand is 21 / 21.

[0108] In some embodiments, since the nucleotide sequence III and the nucleotide sequence IV are completely reverse complementary, when the base of the nucleotide sequence III is given, the base of the nucleotide sequence IV is also determined.

[0109] <Overhang Ends and Modifications of siRNA> The following description of nucleotide sequence V, nucleic acid sequence, nucleotide modification in siRNA, and modified sequence can be applied to any one of the above first to sixth siRNAs. That is, unless otherwise specified, the following description of siRNA should be considered as describing the first siRNA, the second siRNA, the third siRNA, the fourth siRNA, the fifth siRNA, and the sixth siRNA one by one. For example, unless a specific siRNA is specified, "the siRNA further comprises a nucleotide sequence V" means "the first siRNA, the second siRNA, the third siRNA, the fourth siRNA, the fifth siRNA, or the sixth siRNA further comprises a nucleotide sequence V."

[0110] In some embodiments, the sense strand and the antisense strand are different in length, and the antisense strand further comprises a nucleotide sequence V, which is 1-3 nucleotides in length and is bound to the 3' end of the antisense strand, constituting the 3' overhang end of the antisense strand. This allows the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure to be 19 / 20, 19 / 21, 19 / 22, 20 / 21, 20 / 22, 20 / 23, 21 / 22, 21 / 23, 21 / 24, 22 / 23, 22 / 24, 22 / 25, 23 / 24, 23 / 25, or 23 / 26. In some embodiments, the nucleotide sequence V is 2 nucleotides in length, and thus the length ratio of the sense strand to the antisense strand of the siRNA provided by the present disclosure may be 19 / 21, 21 / 23, or 23 / 25.

[0111] Each nucleotide in the nucleotide sequence V can be any nucleotide, and in order to facilitate synthesis and save synthesis cost, the nucleotide sequence V is two consecutive thymine deoxyribonucleotides (dTdT) or two consecutive uracil ribonucleotides (UU); or in order to improve the affinity between the antisense strand of siRNA and target mRNA, the nucleotide sequence V is complementary to the nucleotide at the corresponding position of target mRNA. Thus, in some embodiments, the length ratio of the sense strand and the antisense strand of the siRNA of the present disclosure is 19 / 21 or 21 / 23, and the siRNA of the present disclosure has higher mRNA silencing activity.

[0112] The nucleotide at the corresponding position of the target mRNA refers to a nucleotide or nucleotide sequence adjacent to the third nucleotide sequence of the target mRNA at the 5' end, which is a nucleotide sequence that is substantially reverse complementary or completely reverse complementary to nucleotide sequence II, or a nucleotide sequence that is substantially reverse complementary or completely reverse complementary to a nucleotide sequence composed of nucleotide sequence II and nucleotide sequence IV.

[0113] In some embodiments, for the first siRNA, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:6. 5'-AAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO:5), 5'-Z4AUAAAUGUCUGCUUGCUUGG-3' (SEQ ID NO: 6)

[0114] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:7, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:8. 5'-CCAAGCAAGCAGACAUUUAUZ3-3' (SEQ ID NO: 7), 5'-Z4AUAAAUGUCUGCUUGCUUGGGU-3' (SEQ ID NO: 8) However, Z4 is the first nucleotide at the 5' end of the antisense strand, Z3 is selected from A, U, G or C, and Z4 is a nucleotide complementary to Z3.

[0115] In some embodiments, for the second siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:65, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:66. 5'-UUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:65), 5'-Z8UAAUAAAAAUGCUACAAAAC-3' (SEQ ID NO:66)

[0116] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:67, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:68. 5'-GUUUUGUAGCAUUUUUAUUAZ7-3' (SEQ ID NO:67), 5'-Z8UAAUAAAAAUGCUACAAAACCC-3' (SEQ ID NO: 68) However, Z8 is the first nucleotide at the 5' end of the antisense strand, Z7 is selected from A, U, G or C, and Z8 is a nucleotide complementary to Z7.

[0117] In some embodiments, for the third siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:125, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:126. 5'-GCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 125), 5'-Z 12 UCCGAAUAAACUCCAGGCCU-3' (SEQ ID NO: 126)

[0118] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:127, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:128. 5'-AGGCCUGGAGUUUAUUCGGAZ 11 -3' (SEQ ID NO: 127), 5'-Z 12 UCCGAAUAAACUCCAGGCCUAU-3' (SEQ ID NO: 128) However, the above Z 12 is the first nucleotide at the 5' end of the antisense strand, and Z 11 is selected from A, U, G or C; Z 12 is Z 11 is a nucleotide complementary to

[0119] In some embodiments, for the fourth siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:185, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:186. 5'-CUGUUUUGCUUUUGUAACZ 15 -3' (SEQ ID NO: 185), 5'-Z 16 GUUACAAAAGCAAAACAGGU-3' (SEQ ID NO: 186)

[0120] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:187, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:188. 5'-ACCUGUUUUGCUUUUGUAACZ 15 -3' (SEQ ID NO: 187), 5'-Z 16 GUUACAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 188) However, the above Z 16 is the first nucleotide at the 5' end of the antisense strand, and Z 15 is selected from A, U, G or C; Z 16 is Z 15is a nucleotide complementary to

[0121] In some embodiments, for the fifth siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:245, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:246. 5'-GGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 245), 5'-Z 20 UAAAAAAUGCUACAAAACCCA-3' (SEQ ID NO: 246)

[0122] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:247, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:248. 5'-UGGGUUUUGUAGCAUUUUUAZ 19 -3' (SEQ ID NO: 247), 5'-Z 20 UAAAAAAUGCUACAAAACCCAGA-3' (SEQ ID NO: 248) However, the above Z 20 is the first nucleotide at the 5' end of the antisense strand, and Z 19 is selected from A, U, G or C; Z 20 is Z 19 is a nucleotide complementary to

[0123] In some embodiments, for the sixth siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:305, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:306. 5'-GUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 305), 5'-Z 24 UUUAUUUUAAAAGUCACCA-3' (SEQ ID NO: 306)

[0124] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:307, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:308. 5'-UGGUGACUUUUUAAAAUAAAZ 23 -3' (SEQ ID NO: 307), 5'-Z 24 UUUAUUUUAAAAAAAGUCACCAUA-3' (SEQ ID NO: 308) However, the above Z 24 is the first nucleotide at the 5' end of the antisense strand, and Z 23 is selected from A, U, G or C; Z 24 is Z 23 is a nucleotide complementary to

[0125] In some embodiments, the siRNA described in this disclosure is siPCSKa1, siPCSKa2, siPCSKb1, siPCSKb2, siPCSKc1, siPCSKc2, siPCSKd1, siPCSKd2, siPCSKe1, siPCSKe2, siPCSKf1, or siPCSKf2, as described in Tables 1a-1f.

[0126] As mentioned above, each nucleotide in the siRNA of the present disclosure is independently modified or unmodified nucleotide.In some embodiments, the nucleotide in the siRNA of the present disclosure is unmodified nucleotide, and in some embodiments, some or all of the nucleotide in the siRNA of the present disclosure is modified nucleotide, and these modifications on nucleotide base do not obviously weaken or lose the function of the siRNA of the present disclosure to suppress PCSK9 gene expression.

[0127] In some embodiments, the siRNA of the present disclosure comprises at least one modified nucleotide. In the context of the present disclosure, the term "modified nucleotide" refers to a nucleotide or nucleotide analogue in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced with another group, or a nucleotide having a modified base. The modified nucleotide does not obviously weaken or eliminate the function of siRNA to suppress gene expression. For example, the modified nucleotide disclosed in JK Watts, GF Deleavey, and MJ Damha, Chemically modified siRNA: tools and applications. Drug Discov Today, 2008, 13(19-20): 842-55 may be selected.

[0128] In some embodiments, the sense strand or the antisense strand of the siRNA provided by the present disclosure has at least one nucleotide that is a modified nucleotide and / or at least one phosphate group that is a phosphate group having a modified group. In other words, at least a portion of the phosphate groups and / or ribose groups in the phosphate-sugar backbone of at least one single strand in the sense strand and the antisense strand is a phosphate group having a modified group and / or a ribose group having a modified group.

[0129] In some embodiments, all of the nucleotides in the sense strand and / or the antisense strand are modified nucleotides. In some embodiments, each nucleotide in the sense strand and the antisense strand of the siRNA provided by the present disclosure is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide.

[0130] The inventors of the present disclosure have surprisingly found that the siRNAs described in the present disclosure provide an excellent balance between plasma stability and gene silencing efficiency in animal studies.

[0131] In some embodiments, the fluoro-modified nucleotides are located in nucleotide sequence I and nucleotide sequence II, wherein, from the 5' to the 3' end, at least the 7th, 8th, and 9th nucleotides of nucleotide sequence I are fluoro-modified nucleotides, and from the 5' to the 3' end, at least the 2nd, 6th, 14th, and 16th nucleotides of nucleotide sequence II are fluoro-modified nucleotides.

[0132] In some embodiments, the fluoro-modified nucleotides are located in nucleotide sequence I and nucleotide sequence II, wherein there are no more than 5 fluoro-modified nucleotides in nucleotide sequence I, and from the 5' end to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I are fluoro-modified nucleotides, there are no more than 7 fluoro-modified nucleotides in nucleotide sequence II, and the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II are fluoro-modified nucleotides.

[0133] In some embodiments, from the 5' to the 3' end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of nucleotide sequence I are fluoro-modified nucleotides and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides; and from the 5' to the 3' end, in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of nucleotide sequence II are fluoro-modified nucleotides and the remaining nucleotides in the antisense strand are non-fluoro-modified nucleotides.

[0134] In the context of this disclosure, "fluoro-modified nucleotide" refers to a nucleotide having the structure shown in the following formula (7), in which the hydroxy group at the 2' position of the ribose group of the nucleotide is replaced with fluorine. "Non-fluoro-modified nucleotide" refers to a nucleotide or nucleotide analog in which the hydroxy group at the 2' position of the ribose group of the nucleotide is replaced with a non-fluorine group. In some embodiments, each non-fluoro-modified nucleotide is one independently selected from nucleotides or nucleotide analogs in which the hydroxy group at the 2' position of the ribose group of the nucleotide is replaced with a non-fluorine group.

[0135] These nucleotides in which the hydroxy group at the 2' position of the ribose group is substituted with a non-fluorine group are known to those skilled in the art, and these nucleotides may be one selected from 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.

[0136] In some embodiments, the 2'-alkoxy modified nucleotide is a 2'-methoxy (2'-OMe) modified nucleotide as shown in formula (8). In some embodiments, the 2'-substituted alkoxy modified nucleotide may be a 2'-O-methoxyethyl (2'-MOE) modified nucleotide as shown in formula (9), for example. In some embodiments, the 2'-amino (2'-NH2) modified nucleotide is as shown in formula (10). In some embodiments, the 2'-deoxynucleotide (DNA) is as shown in formula (11).

[0137] [ka]

[0138] A nucleotide analog refers to a group that can substitute for a nucleotide in a nucleic acid, but that differs in structure from adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide, uracil ribonucleotide, or thymine deoxyribonucleotide. In some embodiments, a nucleotide analog may be an isonucleotide, a bridged nucleotide, or an acyclic nucleotide.

[0139] Bridged nucleic acid (BNA) refers to a constrained or inaccessible nucleotide. BNAs may include five-, six-, or seven-membered bridged structures with a "fixed" C3'-endo sugar puckering. Typically, the bridge is introduced at the 2'-, 4'-position of the ribose to provide a 2',4'-BNA nucleotide. In some embodiments, the BNA may be an LNA as shown in formula (12), an ENA as shown in formula (13), a cET BNA as shown in formula (14), or the like.

[0140] [ka]

[0141] An acyclic nucleotide is a nucleotide in which the sugar ring of the nucleotide is opened. In some embodiments, the acyclic nucleotide may be an unlocked nucleic acid (UNA) as shown in formula (15) or a glycerol nucleic acid (GNA) as shown in formula (16).

[0142] [ka]

[0143] In the above formula (15) and formula (16), R is selected from H, OH, or alkoxy (O-alkyl).

[0144] An isonucleotide refers to a compound in which the position of the base in the ribose ring in a nucleotide is changed. In some embodiments, an isonucleotide may be a compound in which the base is shifted from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (17) or (18).

[0145] [ka]

[0146] In the compounds of the above formulae (17) and (18), Base represents a base such as A, U, G, C or T, and R is selected from H, OH, F or the above-mentioned non-fluorine groups.

[0147] In some embodiments, the nucleotide analog is any one selected from an isonucleotide, an LNA, an ENA, a cET, an UNA, and a GNA. In some embodiments, each non-fluoro modified nucleotide is a methoxy modified nucleotide, which in this context refers to a nucleotide in which the 2'-hydroxy group of the ribose group is replaced with methoxy.

[0148] In this context, the terms "fluoro-modified nucleotide", "2'-fluoro-modified nucleotide", "nucleotide in which the 2'-hydroxy group of the ribose group is replaced with fluorine" and "nucleotide having a 2'-fluoro ribose group" have the same meaning and all refer to a compound having the structure shown in formula (7) in which the 2'-hydroxy group of the nucleotide is replaced with fluorine, and the terms "methoxy-modified nucleotide", "2'-methoxy-modified nucleotide", "nucleotide in which the 2'-hydroxy group of the ribose group is replaced with methoxy" and "nucleotide having a 2'-methoxy ribose group" have the same meaning and all refer to a compound having the structure shown in formula (8) in which the 2'-hydroxy group of the ribose group of the nucleotide is replaced with methoxy.

[0149] In some embodiments, the siRNA of the present disclosure is an siRNA having the following modifications: from the 5' end to the 3' end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of the nucleotide sequence I are fluoro-modified nucleotides, and in the sense strand, the nucleotides at the remaining positions are methoxy-modified nucleotides, and in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of the nucleotide sequence II are fluoro-modified nucleotides, and in the antisense strand, the nucleotides at the remaining positions are methoxy-modified nucleotides.

[0150] In some embodiments, the siRNA of the present disclosure is an siRNA having the following modifications: from the 5' to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides, and the remaining nucleotides in the sense strand of the siRNA are methoxy-modified nucleotides; from the 5' to the 3' end, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides, and the remaining nucleotides in the antisense strand of the siRNA are methoxy-modified nucleotides; Alternatively, from the 5' to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides; from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides; Alternatively, from the 5' to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides; and, from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides.

[0151] In some embodiments, the siRNA provided by the present disclosure is selected from the group consisting of siPCSKa1-M1, siPCSKa1-M2, siPCSKa1-M3, siPCSKa2-M1, siPCSKa2-M2, siPCSKa2-M3, siPCSKb1-M1, siPCSKb1-M2, siPCSKb1-M3, siPCSKb2-M1, siPCSKb2-M2, siPCSKb2-M3, siPCSKc1-M1, siPCSKc1-M2, siPCSKc1-M3, siPCSKc2-M1, siPCSK any one of siPCSKc2-M2, siPCSKc2-M3, siPCSKd1-M1, siPCSKd1-M2, siPCSKd1-M3, siPCSKd2-M1, siPCSKd2-M2, siPCSKd2-M3, siPCSKe1-M1, siPCSKe1-M2, siPCSKe1-M3, siPCSKe2-M1, siPCSKe2-M2, siPCSKe2-M3, siPCSKf1-M1, siPCSKf1-M2, siPCSKf1-M3, siPCSKf2-M1, siPCSKf2-M2 or siPCSKf2-M3.

[0152] The siRNA with the above modification is not only low-cost, but also can make nucleic acid difficult to be cut by ribonuclease in blood, thereby improving the stability of nucleic acid, and making nucleic acid have the characteristic of stronger resistance to nuclease hydrolysis.Then, the above modified siRNA also has high target mRNA suppression activity.

[0153] In some embodiments, in the sense strand and antisense strand of the siRNA provided by the present disclosure, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand is a phosphate ester group having a modified group.In some embodiments, the phosphate ester group having a modified group is a thiophosphate ester group in which at least one oxygen atom of the phosphodiester bond in the phosphate ester group is replaced with a sulfur atom.In some embodiments, the phosphate ester group having a modified group is a thiophosphate ester group having the structure shown in formula (1).

[0154] [ka]

[0155] Such modifications stabilize the double-stranded structure of siRNA and enable high specificity and high affinity base pairing to be maintained.

[0156] In some embodiments, in the siRNA provided by the present disclosure, the thiophosphate group is present at least one of the following positions: between the first and second nucleotides at any one end of the sense strand or antisense strand, between the second and third nucleotides at any one end of the sense strand or antisense strand, or any combination thereof. In some embodiments, the thiophosphate group is present at all of the above positions except the 5' end of the sense strand. In some embodiments, the thiophosphate group is present at all of the above positions except the 3' end of the sense strand. In some embodiments, the thiophosphate group is present at at least one of the following positions: Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second nucleotide and the third nucleotide from the 3' end of the sense strand, Between the first and second nucleotides from the 5' end of the antisense strand, Between the second and third nucleotides from the 5' end of the antisense strand, Between the first and second nucleotides from the 3' end of the antisense strand, and Between the second and third nucleotides from the 3' end of the antisense strand.

[0157] In some embodiments, the siRNA provided by the present disclosure is selected from the group consisting of siPCSKa1-M1S, siPCSKa1-M2S, siPCSKa1-M3S, siPCSKa2-M1S, siPCSKa2-M2S, siPCSKa2-M3S, siPCSKb1-M1S, siPCSKb1-M2S, siPCSKb1-M3S, siPCSKb2-M1S, siPCSKb2-M2S, siPCSKb2-M3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2-M1S, siPCSKc2-M3S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2-M1S, siPCSKc2-M3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2-M3S, siPCSKc2-M3S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2-M3S, siPCSKc2-M3S, siPCSKc1-M1S, siPCSKc1-M2S, siPCSKc1-M3S, siPCSKc2 ... -M2S, siPCSKc2-M3S, siPCSKd1-M1S, siPCSKd1-M2S, siPCSKd1-M3S, siPCSKd2-M1S, siPCSKd2-M2S, siPCSKd2-M3S, siPCSKe1-M1S, siPCSKe1-M2S, siPCSKe1-M3S, siPCSKe2-M1S, siPCSKe2-M2S, siPCSKe2-M3S, siPCSKf1-M1S, siPCSKf1-M2S, siPCSKf1-M3S, siPCSKf2-M1S, siPCSKf2-M2S or siPCSKf2-M3S.

[0158] In some embodiments, the 5'-terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog modified nucleotide.

[0159] The conventional 5'-phosphate nucleotides or 5'-phosphate analogue modified nucleotides are known to those skilled in the art. For example, the 5'-phosphate nucleotide may have the following structure:

[0160] [ka]

[0161] Furthermore, for example, Anastasia Khvorova and Jonathan K. Watts, The chemical evolution of oligonucleotide therapies of clinical utility. Nature Biotechnology, 2017, 35(3): 238-48 disclose the following four types of 5'-phosphate analog modified nucleotides:

[0162] [ka] In the formula, R is selected from H, OH, methoxy, and fluorine, and Base represents a base and is selected from A, U, C, G, or T.

[0163] In some embodiments, the 5'-phosphate nucleotide is a nucleotide containing a 5'-phosphate as shown in formula (2), and the 5'-phosphate analog modified nucleotide is a nucleotide containing a vinyl phosphate (5'-(E)-vinylphosphonate (E-VP)) modification as shown in formula (3), or a thiophosphate modified nucleotide as shown in formula (5).

[0164] In some embodiments, the siRNA provided by the present disclosure is selected from the group consisting of siPCSKa1-M1P1, siPCSKa1-M2P1, siPCSKa1-M3P1, siPCSKa2-M1P1, siPCSKa2-M2P1, siPCSKa2-M3P1, siPCSKb1-M1P1, siPCSKb1-M2P1, siPCSKb1-M3P1, siPCSKb2-M1P1, siPCSKb2-M2P1, siPCSKb2-M3P1, siPCSKc1-M1P1, siPCSKc1-M2P1, siPCSKc1 ... -M3P1, siPCSKc2-M1P1, siPCSKc2-M2P1, siPCSKc2-M3P1, siPCSKd1-M1P1, siPCSKd1-M2P1, siPCSKd1-M3P1, siPCSKd2-M1P1, siPCSKd2-M2P1, siPCSKd 2-M3P1, siPCSKe1-M1P1, siPCSKe1-M2P1, siPCSKe1-M3P1, siPCSKe2-M1P1, siPCSKe2-M2P1, siPCSKe2-M3P1, siPCSKf1-M1P1, siPCSKf1-M2P1, siPCSK f1-M3P1, siPCSKf2-M1P1, siPCSKf2-M2P1, siPCSKf2-M3P1, siPCSKa1-M1SP1, siPCSKa1-M2SP1, siPCSKa1-M3SP1, siPCSKa2-M1SP1, siPCSKa2-M2SP1, siPCSKa2-M3SP1, siPCSKb1-M1SP1, siPCSKb1-M2SP1, siPCSKb1-M3SP1, siPCSKb2-M1SP1, siPCSKb2-M2SP1, siPCSKb2-M3SP1, siPCSKc1-M1SP1, siPCS Kc1-M2SP1, siPCSKc1-M3SP1, siPCSKc2-M1SP1, siPCSKc2-M2SP1, siPCSKc2-M3SP1, siPCSKd1-M1SP1, siPCSKd1-M2SP1, siPCSKd1-M3SP1, siPCSKd2-M 1SP1, siPCSKd2-M2SP1, siPCSKd2-M3SP1, siPCSKe1-M1SP1, siPCSKe1-M2SP1, siPCSKe1-M3SP1, siPCSKe2-M1SP1, siPCSKe2-M2SP1, siPCSKe2-M3SP1,The gene is selected from the group consisting of siPCSKf1-M1SP1, siPCSKf1-M2SP1, siPCSKf1-M3SP1, siPCSKf2-M1SP1, siPCSKf2-M2SP1, and siPCSKf2-M3SP1.

[0165] <7th siRNA> According to the present disclosure, the siRNA may be a seventh siRNA.

[0166] The seventh siRNA comprises a sense strand and an antisense strand, each nucleotide of the seventh siRNA is independently modified or unmodified, the sense strand comprises nucleotide sequence I, and the antisense strand comprises nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II form a double-stranded region in a reverse complementary manner at least in part, the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 399 are equal in length and have no more than three nucleotide differences, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 400 are equal in length and have no more than three nucleotide differences. 5'-AGACCUGUUUUGCUUUUGZ 25 -3' (SEQ ID NO: 399), 5'-Z 26 CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 400) However, Z 25 is U and Z 26 is A, and in said nucleotide sequence I, position Z 25 Nucleotide Z corresponding to 27 and in said nucleotide sequence II, position Z 26 Nucleotide Z corresponding to 28 wherein Z 28 is the first nucleotide at the 5' end of the antisense strand.

[0167] In some embodiments, the sense strand comprises only nucleotide sequence I and the antisense strand comprises only nucleotide sequence II.

[0168] In some embodiments, there is no more than one nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:399, and / or there is no more than one nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:400.

[0169] In some embodiments, the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO: 400 is Z 28 including the difference at the position of Z 28 is selected from G, U or C. In some embodiments, the nucleotide difference is 28 is the difference in position, Z 28 is selected from G, U, or C. In some embodiments, Z 27 is Z 28 is a nucleotide complementary to

[0170] In some embodiments, the nucleotide difference between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO:399 comprises a difference in nucleotide Z, the ninth nucleotide from the 5' end of nucleotide sequence I, where Z is dT.

[0171] In some embodiments, the nucleotide difference between the nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO: 399 is Z 27 including the difference at the position of Z 27 is selected from A, G or C.

[0172] In some embodiments, there are two nucleotide differences between nucleotide sequence I and the nucleotide sequence set forth in SEQ ID NO: 399, and nucleotide sequence I and nucleotide sequence II are completely reverse complementary, and the two nucleotide differences are Z and Z. 27 is the difference at position , Z is dT, and Z 27 is selected from A, G or C.

[0173] siRNAs having the above nucleotide differences have high siRNA-mediated target mRNA suppression ability, and siRNAs containing these nucleotide differences are also within the scope of protection of the present disclosure.

[0174] In some embodiments, nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:401 and nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:402. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 401), 5'-Z 28 CAAAAGCAAAACAGGUCU-3' (SEQ ID NO: 402) where dT is thymine deoxyribonucleotide, and 28 is the first nucleotide at the 5' end of the antisense strand, and Z 27 is selected from A, U, G or C; Z 28 is Z 27 and in some embodiments, Z 27 is U and Z 28 is A.

[0175] In some embodiments, for the seventh siRNA, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:403, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:404. 5'-AGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 403), 5'-Z 28 CAAAAGCAAAACAGGUCUAG-3' (SEQ ID NO: 404)

[0176] Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:405, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:406. 5'-CUAGACCUGUdTUUGCUUUUGZ 27 -3' (SEQ ID NO: 405), 5'-Z 28 CAAAAGCAAAACAGGUCUAGAA-3' (SEQ ID NO: 406)

[0177] In some embodiments, the siRNA described in this disclosure is siPCSKg3 or siPCSKg4, as described in Table 1g.

[0178] In some embodiments, the Z and / or Z 27 In an siRNA having a nucleotide difference at a position, at least some of the nucleotides are modified nucleotides, the modified nucleotides are fluoro-modified nucleotides or non-fluoro-modified nucleotides, the fluoro-modified nucleotides are located in nucleotide sequence I and nucleotide sequence II, and from the 5' end to the 3' end, at least the 2nd, 6th, 14th, and 16th nucleotides of nucleotide sequence II are fluoro-modified nucleotides.

[0179] In some embodiments, the siRNA provided by the disclosure is any one of siPCSKg3-M4, siPCSKg4-M5, siPCSKg3-M4S, siPCSKg4-M5S, siPCSKg3-M4P1, siPCSKg4-M5P1, siPCSKg3-M4SP1, or siPCSKg4-M5SP1 listed in Table 1g.

[0180] The inventors of the present disclosure have unexpectedly found that the siRNAs provided by the present disclosure not only have significantly improved plasma and lysosomal stability, but also have high target mRNA silencing activity.

[0181] The siRNA provided by the present disclosure can be obtained by the usual siRNA preparation methods in the field (for example, solid-phase synthesis method and liquid-phase synthesis method).Here, solid-phase synthesis has already been commercialized as a customization service.The modified nucleotide group can be introduced into the siRNA described in the present disclosure by using the nucleoside monomer having the corresponding modification, and the method of preparing the nucleoside monomer having the corresponding modification and the method of introducing the modified nucleotide group into the siRNA are also well known to those skilled in the art.

[0182] <Drug Composition> The present disclosure provides a pharmaceutical composition comprising the above-mentioned siRNA as an active ingredient and a pharma- ceutically acceptable carrier.

[0183] The pharma- ceutically acceptable carrier may be a carrier commonly used in the field of siRNA administration, such as magnetic nanoparticles (e.g., nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate ester), poly( ... and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof.

[0184] There is no particular requirement for the content of siRNA and pharma- ceutically acceptable carrier in the drug composition, but each component may have a normal content. In some embodiments, the weight ratio of siRNA to pharma-ceutically acceptable carrier may be 1:(1-500). In some embodiments, the weight ratio is 1:(1-50).

[0185] In some embodiments, the drug composition may include other pharma- ceutically acceptable additives, which may be one or more of various preparations or compounds commonly used in the art. For example, the other pharma-ceutically acceptable additives may include at least one of a pH buffer, a protective agent, and an osmolality adjusting agent.

[0186] The pH buffer solution may be a tris(hydroxymethyl) aminomethane hydrochloride buffer having a pH of 7.5 to 8.5 and / or a phosphate buffer solution having a pH of 5.5 to 8.5, for example, a phosphate buffer solution having a pH of 5.5 to 8.5.

[0187] The protective agent may be at least one of inositol, sorbitol, sucrose, trehalose, mannose, maltose, lactose, and glucose. Based on the total weight of the drug composition, the content of the protective agent may be 0.01 to 30% by weight.

[0188] The osmotic pressure regulator may be sodium chloride and / or potassium chloride. The content of the osmotic pressure regulator is determined so that the osmotic pressure of the drug composition is 200-700 milliosmoles / kilogram (mOsm / kg). Depending on the desired osmotic pressure, a person skilled in the art can easily determine the content of the osmotic pressure regulator.

[0189] In some embodiments, the pharmaceutical composition may be a liquid formulation such as an injection solution, or may be a lyophilized powder injection that is mixed with a liquid additive at the time of administration to form a liquid formulation. The liquid formulation may be used for, but is not limited to, subcutaneous, intramuscular, or intravenous administration, and may also be administered to the lungs by aerosolization, or to other organ tissues (e.g., the liver) through the lungs by aerosolization. In some embodiments, the pharmaceutical composition is used for intravenous administration.

[0190] In some embodiments, the drug composition may be in the form of a liposome formulation. In some embodiments, the pharma- ceutically acceptable carrier used in the liposome formulation comprises an amine-containing transfection compound (hereinafter also referred to as organic amine), an auxiliary lipid, and / or a PEGylated (PEGylated) lipid. Here, the organic amine, the auxiliary lipid, and the PEGylated lipid may be one or more selected from the amine-containing transfection compound or its pharma- ceutically acceptable salt or derivative, the auxiliary lipid, and the PEGylated lipid described in CN103380113A (incorporated herein in its entirety by reference).

[0191] In some embodiments, the organic amine may be a compound represented by formula (201) described in CN103380113A or a pharma- ceutically acceptable salt thereof.

[0192] [ka] During the ceremony, each X 101 Or X 102 are each independently O, S, NA, or CA, and A is hydrogen or C1-C 20 is a hydrocarbon chain, Each Y 101 or Z 101 are each independently C=O, C=S, S=O, CH-OH or SO2; Each R 101 , R 102 , R 103 , R 104 , R 105 , R 106 or R 107 each independently represents hydrogen, a cyclic or acyclic, substituted or unsubstituted, branched or straight-chain aliphatic group, a cyclic or acyclic, substituted or unsubstituted, branched or straight-chain heteroaliphatic group, a substituted or unsubstituted, branched or straight-chain acyl group, a substituted or unsubstituted, branched or straight-chain aryl group, or a substituted or unsubstituted, branched or straight-chain heteroaryl group; x is an integer from 1 to 10; When n is an integer of 1 to 3, m is an integer of 0 to 20, and p is 0 or 1, where m=p=0, R 102 is hydrogen, When at least one of n or m is 2, R 103 and the nitrogen in formula (201) form a structure shown in formula (202) or formula (203).

[0193] [ka] In the formula, g, e, and f each independently represent an integer of 1 to 6, "HCC" represents a hydrocarbon chain, and each * N represents a nitrogen atom in formula (201).

[0194] In some embodiments, R 103 is a polyamine. In another embodiment, R 103 is a ketal. In some embodiments, R in formula (201) 101 and R 102 each is independently an optionally substituted or unsubstituted, branched or straight chain alkyl or alkenyl, said alkyl or alkenyl having 3 to about 20 carbon atoms, e.g., 8 to about 18 carbon atoms, and 0 to 4 double bonds, e.g., 0 to 2 double bonds.

[0195] In some embodiments, when n and m each independently have a value of 1 or 3, R 103 may be any one of the following formulas (204) to (213).

[0196] [ka]

[0197] In formulae (204) to (213), g, e, and f each independently represent an integer of 1 to 6, each "HCC" represents a hydrocarbon chain, * is R 103 and the nitrogen atom in formula (201), and *Each H on position may be substituted to bond with a nitrogen atom in formula (201).

[0198] Compounds of formula (201) may be prepared as described in CN103380113A.

[0199] In some embodiments, the organic amine is an organic amine represented by formula (214) and / or an organic amine represented by formula (215).

[0200] [ka]

[0201] the co-lipid is cholesterol, a cholesterol analogue and / or a cholesterol derivative; The PEGylated lipid is 1,2-dipalmitoyl-sn-glycero-3-phosphatidylethanolamine-N-[methoxy(polyethylene glycol)]-2000.

[0202] In some embodiments, in the drug composition, the molar ratio of the organic amine, the co-lipid, and the PEGylated lipid is (19.7-80):(19.7-80):(0.3-50), and may be, for example, (50-70):(20-40):(3-20).

[0203] In some embodiments, the drug composition particles formed by the siRNA of the present disclosure and the amine-containing transfection reagent have an average diameter of about 30 nm to about 200 nm, typically about 40 nm to about 135 nm, and more typically, the average diameter of the liposome particles is about 50 nm to about 120 nm, about 50 nm to about 100 nm, about 60 nm to about 90 nm, or about 70 nm to about 90 nm, e.g., the average diameter of the liposome particles is about 30, 40, 50, 60, 70, 75, 80, 85, 90, 100, 110, 120, 130, 140, 150, or 160 nm.

[0204] In some embodiments, in the drug composition formed by the siRNA of the present disclosure and the amine-containing transfection reagent, the weight ratio (weight / weight ratio) of the siRNA to the total lipid (e.g., organic amine, auxiliary lipid, and / or PEGylated lipid) is within the range of about 1:1 to about 1:50, about 1:1 to about 1:30, about 1:3 to about 1:20, about 1:4 to about 1:18, about 1:5 to about 1:17, about 1:5 to about 1:15, about 1:5 to about 1:12, about 1:6 to about 1:12, or about 1:6 to about 1:10, for example, the weight ratio of the siRNA of the present disclosure to the total lipid is about 1:5, 1:6, 1:7, 1:8, 1:9, 1:10, 1:11, 1:12, 1:13, 1:14, 1:15, 1:16, 1:17, or 1:18.

[0205] In some embodiments, the pharmaceutical composition may be marketed with each component being independent, or may be used as a liquid formulation.In some embodiments, the pharmaceutical composition formed by the siRNA provided by the present disclosure and the above-mentioned pharmaceutical acceptable carrier may be prepared according to various known methods, and the siRNA provided by the present disclosure may be used instead of conventional siRNA.In some embodiments, the pharmaceutical composition may be prepared according to the following method.

[0206] The organic amine, auxiliary lipid and PEGylated lipid are suspended in alcohol in the above molar ratio and mixed uniformly to obtain a lipid solution. The amount of alcohol is determined so that the total mass concentration of the obtained lipid solution is 2 to 25 mg / mL, for example, 8 to 18 mg / mL. The alcohol is one or more selected from pharma- ceutically acceptable alcohols, such as ethanol, propylene glycol, benzyl alcohol, glycerin, polyethylene glycol 200, polyethylene glycol 300, polyethylene glycol 400, and other alcohols that are liquid at around room temperature, and may be, for example, ethanol.

[0207] The siRNA provided by the present disclosure is dissolved in a buffer salt solution to obtain an siRNA aqueous solution. The concentration of the buffer salt solution is 0.05 to 0.5 M, and may be, for example, 0.1 to 0.2 M. The pH of the buffer salt solution is adjusted to 4.0 to 5.5, and may be, for example, 5.0 to 5.2. The amount of the buffer salt solution is determined so that the concentration of the siRNA is 0.6 mg / mL or less, and may be, for example, 0.2 to 0.4 mg / mL. The buffer salt is one or more selected from soluble acetates and soluble citrates, and may be, for example, sodium acetate and / or potassium acetate.

[0208] After mixing the lipid solution and the siRNA aqueous solution, the resulting product is incubated at 40-60°C for at least 2 minutes, e.g., 5-30 minutes, to obtain an incubated liposome preparation. The volume ratio of the lipid solution to the siRNA aqueous solution is 1:(2-5).

[0209] The cultured liposome preparation is concentrated or diluted, impurities are removed, and bacteria are sterilized to obtain a drug composition provided by the present disclosure, whose physicochemical parameters are pH 6.5-8, encapsulation efficiency 80% or more, particle size 40-200 nm, polydispersity index 0.30 or less, and osmotic pressure 250-400 mOsm / kg, and for example, the physicochemical parameters may be pH 7.2-7.6, encapsulation efficiency 90% or more, particle size 60-100 nm, polydispersity index 0.20 or less, and osmotic pressure 300-400 mOsm / kg.

[0210] Here, concentration or dilution may be performed before removing impurities, after removing impurities, or simultaneously. As a method for removing impurities, various conventional methods may be employed. For example, a tangential flow system or a hollow fiber column may be used, and ultrafiltration may be performed under the condition of 100 KDa. The ultrafiltration exchange solution may be a phosphate buffer (PBS) with a pH of 7.4. As a sterilization method, various conventional methods may be employed. For example, filtration through a 0.22 μm filter for sterilization may be performed.

[0211] <siRNA complex> The present disclosure provides an siRNA complex comprising the above siRNA and a complexing group complexed and bound to the siRNA.

[0212] Generally, the complexing group includes at least one targeting group and an optional linker that are pharmaceutically acceptable, and the siRNA, the linker, and the targeting group are sequentially bound. In some embodiments, the number of the targeting groups is 1 to 6. In some embodiments, the number of the targeting groups is 2 to 4. The siRNA molecule may be complexed with the complexing group non-covalently or covalently. For example, it may be covalently complexed with the complexing group. The complexing site between the siRNA and the complexing group may be at the 3'-end or 5'-end of the sense strand of the siRNA, at the 5'-end of the antisense strand, or in the internal sequence of the siRNA. In some embodiments, the complexing site between the siRNA and the complexing group is at the 3'-terminal of the sense strand of the siRNA.

[0213] In some embodiments, the conjugated group may be bound to the phosphate group, 2'-hydroxy group, or base of the nucleotide. In some embodiments, the conjugated group may be bound to the 3'-hydroxy group, in which case the nucleotides are bound by a 2'-5' phosphodiester bond. When the conjugated group is bound to the end of the siRNA chain, it is usually bound to the phosphate group of the nucleotide, and when it is bound to the internal sequence of the siRNA, it is usually bound to the ribose sugar ring or base. For various binding methods, see Muthiah Manoharan et.al. siRNA conjugates carrying sequentially assembled trivalent N-acetylgalactosamine linked through nucleosides elicit robust gene silencing in vivo in hepatocytes. ACS Chemical biology,2015,10 (5): 1181-7.

[0214] In some embodiments, the siRNA and the conjugation group can be linked by acid-labile or reducible chemical bonds, and these chemical bonds can be degraded in the acidic environment of cell endosome, and the siRNA can be released.For non-degradable conjugation methods, the conjugation group is bound to the sense strand of siRNA, so that the influence of conjugation on siRNA activity can be minimized.

[0215] In some embodiments, the pharma- ceutically acceptable targeting group may be a ligand commonly used in the field of siRNA administration, such as various ligands described in WO2009082607A2, the disclosure of which is incorporated herein by reference in its entirety.

[0216] In some embodiments, the pharma- ceutically acceptable targeting group may be one or more selected from lipophilic molecules such as cholesterol, bile acids, vitamins (e.g., tocopherol), lipid molecules of different chain lengths, polymers such as polyethylene glycol, polypeptides such as membrane-permeable peptides, aptamers, antibodies, quantum dots, sugars such as lactose, polylactose, mannose, galactose, and N-acetylgalactosamine (GalNAc), folate, and ligands formed by targeting molecules or derivatives thereof, such as asialoglycoproteins, asialoglycoresidues, lipoproteins (e.g., high density lipoproteins, low density lipoproteins, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, and receptor ligands expressed in hepatic parenchymal cells, such as transferrin.

[0217] In some embodiments, each of the ligands is independently selected from ligands that can bind to cell surface receptors. In some embodiments, at least one ligand is a ligand that can bind to a receptor on the surface of hepatocytes. In some embodiments, at least one ligand is a ligand that can bind to a receptor on the surface of mammalian hepatocytes. In some embodiments, at least one ligand is a ligand that can bind to a receptor on the surface of human hepatocytes. In some embodiments, at least one ligand is a ligand that can bind to asialoglycoprotein receptor (ASGPR) on the surface of liver. These types of ligands are known to those skilled in the art, and their function is generally to bind to a specific receptor on the surface of target cells and mediate the delivery of siRNA bound to the ligand to the target cells.

[0218] In some embodiments, the pharma- ceutically acceptable targeting group may be any one of the ligands that bind to the asialoglycoprotein receptor (ASGPR) on the surface of mammalian hepatocytes. In some embodiments, each ligand is independently an asialoglycoprotein, such as asialoorosomucoid (ASOR) or asialofetuin (ASF). In some embodiments, the ligand is a sugar or a sugar derivative.

[0219] In some embodiments, at least one ligand is a sugar. In some embodiments, each of the ligands is a sugar. In some embodiments, at least one of the ligands is a monosaccharide, a polysaccharide, a modified monosaccharide, a modified polysaccharide, or a sugar derivative. In some embodiments, at least one of the ligands may be a monosaccharide, a disaccharide, or a trisaccharide. In some embodiments, at least one of the ligands is a modified sugar. In some embodiments, each of the ligands is independently selected from a polysaccharide, a modified polysaccharide, a monosaccharide, a modified monosaccharide, a polysaccharide derivative, or a monosaccharide derivative. In some embodiments, each or at least one of the ligands is selected from the group consisting of glucose and derivatives thereof, mannan and derivatives thereof, galactose and derivatives thereof, xylose and derivatives thereof, ribose and derivatives thereof, fucose and derivatives thereof, lactose and derivatives thereof, maltose and derivatives thereof, arabinose and derivatives thereof, fructose and derivatives thereof, and sialic acid.

[0220] In some embodiments, each of the ligands is D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, Nn-butyrylgalactosamine, N- Isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl The ligands may be independently selected from ethyl 2,3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-alonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, or L-4-thioribose. Other options for the ligands may be found, for example, in CN105378082A, the disclosure of which is incorporated herein by reference in its entirety.

[0221] In some embodiments, the pharma- ceutically acceptable targeting group in the siRNA complex may be galactose or N-acetylgalactosamine, and the galactose or N-acetylgalactosamine molecule may be monovalent, divalent, trivalent, or tetravalent. It should be understood that monovalent, divalent, trivalent, and tetravalent herein refer to the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA complex formed from the siRNA molecule and the conjugated group comprising the galactose or N-acetylgalactosamine molecule as the targeting group being 1:1, 1:2, 1:3, or 1:4, respectively. In some embodiments, the pharma- ceutically acceptable targeting group is N-acetylgalactosamine. In some embodiments, when the siRNA described in the present disclosure is conjugated to the conjugated group comprising N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent or tetravalent. In some embodiments, when the siRNA described in the present disclosure is conjugated to the conjugated group comprising N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0222] Targeting group can be linked to siRNA molecule via suitable linker, and those skilled in the art can select suitable linker according to the specific type of targeting group.For these linkers, types of targeting group and methods of linking to siRNA, reference can be made to the disclosure of WO2015006740A2, the contents of which are incorporated herein by reference in their entirety.

[0223] In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may be the structure shown in formula (301):

[0224] [ka] During the ceremony, k is an integer from 1 to 3; L A is a chain portion having an amide bond and having a structure represented by formula (302), Ahas one of the target groups and one of the L C It is bonded to the moiety via an ether bond.

[0225] [ka]

[0226] L B is a chain portion containing an N-acylpyrrolidine having a structure represented by formula (303), the chain portion having a carbonyl group at one end thereof, C It has an oxygen group at its other end and is bonded to the siRNA via a phosphate bond.

[0227] [ka]

[0228] L C is a divalent to tetravalent linker group based on hydroxymethylaminomethane, dihydroxymethylaminomethane or trihydroxymethylaminomethane, C Each of the L's is bonded to an oxygen atom via an ether bond. A and is bonded to the L moiety via an amide bond via a nitrogen atom. B The part is connected to the

[0229] In some embodiments, n=3 and L C When -(L) is a tetravalent linker group based on trihydroxymethylaminomethane, -(L) A ) 3 Trihydroxymethylaminomethane-L B The structure of the siRNA complex formed by binding an N-acetylgalactosamine molecule to an siRNA molecule by - is shown in formula (304) below.

[0230] [ka] In the formula, the double helix structure represents the siRNA.

[0231] Similarly, the conjugation site between the siRNA and the conjugation group may be at the 3' or 5' end of the sense strand of the siRNA, or at the 5' end of the antisense strand, or in an internal sequence of the siRNA.

[0232] In some embodiments, the 3' end of the sense strand of the siRNA described in the present disclosure is linked to a linker-(L A ) 3 Trihydroxymethylaminomethane-L B - is covalently conjugated to three N-acetylgalactosamine (GalNAc) molecules by the siRNA molecule to GalNAc molecule molar ratio of 1:3 to obtain an siRNA complex having the structure shown in the following formula (305) (hereinafter, also referred to as (GalNAc)3-siRNA).

[0233] [ka] wherein the double helix structure represents the siRNA, and the linker is attached to the 3' end of the sense strand of the siRNA.

[0234] In some embodiments, when the targeting group is N-acetylgalactosamine, a suitable linker may be the structure shown in formula (306):

[0235] [ka] During the ceremony, l is an integer from 0 to 3; * represents the site on the linker that is attached to the targeting group via an ether bond, # represents the site in the linker that is bound to the siRNA via a phosphate bond.

[0236] In some embodiments, when l=2, the siRNA complex has the structure shown in formula (307).

[0237] [ka] wherein the double helix structure represents the siRNA, and the linker is attached to the 3' end of the sense strand of the siRNA.

[0238] The above complex may be synthesized by a method already described in detail in the prior art. For example, WO2015006740A2 describes in detail the preparation method of multiple types of complex. The siRNA complex of the present disclosure is obtained by a method well known to those skilled in the art. For example, WO2014025805A1 describes the preparation method of the structure shown in formula (305), and Rajeev et al. described the preparation method of the structure shown in formula (307) in ChemBioChem 2015,16,903-908.

[0239] In some embodiments, the siRNA complex has the structure shown in formula (308):

[0240] [ka] During the ceremony, n1 is an integer selected from 1 to 3, and n3 is an integer selected from 0 to 4, Each m1, m2, or m3 is independently an integer selected from 2 to 10; R 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently H or C-C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10 alkoxy groups; R3 is a group having the structure shown in formula A59.

[0241] [ka] wherein E1 is OH, SH, or BH2, and Nu is an siRNA of the disclosure.

[0242] R2 is a linear alkylene group of 1 to 20 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterocyclylene groups and C5-C 10 heteroarylene groups, R2 being optionally substituted with one or more selected from the group consisting of C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 alkyl group)C(O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 alkyl group), -NHSO2 (phenyl group) and -NHSO2 (C1-C 10 halogenated alkyl groups), Each L1 is independently a straight chain alkylene group of 1 to 70 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O)2, C2-C 10 Alkenylene group, C2-C 10 Alkynylene group, C6-C 10 Arylene group, C3-C 18 Heterocyclylene groups and C5-C 10 heteroarylene groups, and L1 is C1-C 10 Alkyl groups, C6-C 10 Aryl groups, C5-C 10 Heteroaryl groups, C1-C 10 Halogenated alkyl groups, -OC1-C 10 Alkyl group, -OC1-C 10 Alkylphenyl group, -C1-C 10 Alkyl-OH, -OC1-C 10 Halogenated alkyl groups, -SC1-C 10 Alkyl group, -SC1-C 10 Alkylphenyl group, -C1-C 10Alkyl-SH, -SC1-C 10 Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH2, -C1-C 10 Alkyl-NH2, -N(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -NH(C1-C 10 Alkyl group), N(C1-C 10 Alkyl group)(C1-C 10 alkylphenyl group), NH(C1-C 10 alkylphenyl group), cyano group, nitro group, -CO2H, -C(O)O(C1-C 10 alkyl group), -CON(C1-C 10 Alkyl group)(C1-C 10 alkyl group), -CONH(C1-C 10 alkyl group), -CONH2, -NHC(O)(C1-C 10 alkyl group), -NHC(O)(phenyl group), -N(C1-C 10 Alkyl group)C(O)(C1-C 10 alkyl group), -N(C1-C 10 alkyl group)C(O)(phenyl group), -C(O)C1-C 10 Alkyl group, -C(O)C1-C 10 Alkylphenyl group, -C(O)C1-C 10 Haloalkyl group, -OC(O)C1-C 10 Alkyl group, -SO2(C1-C 10 alkyl group), -SO2(phenyl group), -SO2(C1-C 10 Halogenated alkyl group), -SO2NH2, -SO2NH(C1-C 10 alkyl group), -SO2NH (phenyl group), -NHSO2 (C1-C 10 alkyl group), -NHSO2 (phenyl group) and -NHSO2 (C1-C 10 The alkyl group may optionally have one or more substituents selected from the group consisting of halogenated alkyl groups.

[0243] In some embodiments, L1 may be selected from the group consisting of groups A1 through A26 or any combination thereof, where the structures and definitions of A1 through A26 are as follows:

[0244] [ka] In the formula, each j1 is independently an integer from 1 to 20, and each j2 is independently an integer from 1 to 20; Each R' is independently C1-C 10 is an alkyl group, Each Ra is independently selected from the group consisting of groups represented by formulas (A27)-(A45) or any combination thereof.

[0245] [ka] Each Rb is independently C1-C 10 is an alkyl group, JPEG0007610268000026.jpg6170 represents the site to which the group is covalently attached.

[0246] For convenience, L1 is defined as a linear alkylene group, although one of skill in the art will appreciate that amines and alkenyl groups resulting from the above replacement and / or substitution may not be linear or may have different names. For purposes of this disclosure, the length of L1 is the number of atoms in the chain connecting the two attachment points. For this purpose, the ring (e.g., heterocyclylene or heteroarylene) obtained by substituting the carbon atoms of the linear alkylene is considered to be one atom.

[0247] M1 represents a targeting group, and its definition and selectable range are the same as the targeting group described above. In some embodiments, each M1 is an independently selected one from ligands having affinity for the asialoglycoprotein receptor on the surface of mammalian hepatocytes.

[0248] When M1 is a ligand having affinity for the asialoglycoprotein receptor on the surface of mammalian liver cells, in some embodiments, n1 may be an integer of 1-3, and n3 may be an integer of 0-4, ensuring that the number of M1 targeting groups in the complex is at least 2. In some embodiments, n1+n3≧2, so that the number of M1 targeting groups is at least 3, which can facilitate the binding of the M1 targeting groups to the asialoglycoprotein receptor on the surface of the liver, and further promote the incorporation of the complex into cells by endocytosis (intracellular uptake). As can be seen from experiments, when the number of M1 targeting groups is 3 or more, the ease of binding of the M1 targeting groups to the asialoglycoprotein receptor on the surface of the liver is not clearly improved, so considering various aspects such as ease of synthesis, structure / process cost, and delivery efficiency, in some embodiments, n1 is an integer of 1-2, n3 is an integer of 0-1, and n1+n3=2-3.

[0249] In some embodiments, the spatial location between the M1 targeting groups can be adapted for binding of the M1 targeting group to an asialoglycoprotein receptor on the liver surface when each m1, m2, or m3 is independently selected from an integer from 2 to 10. To simplify, synthesize, and / or reduce the cost of the siRNA complexes provided by the present disclosure, in some embodiments, each m1, m2, or m3 is independently an integer from 2 to 5, and in some embodiments, m1=m2=m3.

[0250] R 10 , R 11 , R 12 , R 13 , R 14 or R 15 But, H, C1-C 10 Alkyl groups, C1-C 10 Halogenated alkyl groups and C1-C 10It will be understood by those skilled in the art that when R is one independently selected from the group consisting of alkoxy groups, the objectives of the present disclosure can be achieved without changing the properties of the siRNA complex of the present disclosure. 10 , R 11 , R 12 , R 13 , R 14 or R 15 are each independently selected from H, a methyl group, or an ethyl group. 10 , R 11 , R 12 , R 13 , R 14 and R 15 are both H.

[0251] R3 is a group having the structure shown in formula A59, where E1 is OH, SH, or BH2, and in some embodiments, E1 is OH or SH, taking into consideration the availability of preparation raw materials.

[0252] R2 is selected to achieve a bond between the N atom on the nitrogen-containing backbone and A59. In the context of this disclosure, a "nitrogen-containing backbone" is R 10 , R 11 , R 12 , R 13 , R 14 and R 15 A59 refers to a chain structure in which the carbon atom to which A59 is bonded and the N atom are bonded to each other. Thus, R2 may be any linker group capable of bonding the A59 group to the N atom on the nitrogen-containing backbone in an appropriate manner. In some embodiments, when preparing the siRNA complex shown in formula (308) by a solid phase synthesis process, the R2 group must include both a site bonded to the N atom on the nitrogen-containing backbone and a site bonded to the P atom in R3. In some embodiments, the site bonded to the N atom on the nitrogen-containing backbone in R2 forms an amide bond with the N atom, and the site bonded to the P atom on R3 forms a phosphate ester bond with the P atom, and in some embodiments, R2 may be B5, B6, B5', or B6'.

[0253] [ka] During the ceremony, JPEG0007610268000028.jpg6170 represents the site to which the group is covalently attached.

[0254] The value of q2 may range from 1-10, and in some embodiments, q2 is an integer from 1-5.

[0255] L1 serves to link the M1 targeting group to the N on the nitrogen-containing backbone and provide liver targeting function to the siRNA complex shown in formula (308). In some embodiments, L1 is a combination of one or more bonds selected from the groups of formulas A1-A26. In some embodiments, L1 is a combination of one or more bonds selected from A1, A4, A5, A6, A8, A10, A11, and A13. In some embodiments, L1 is a combination of at least two bonds selected from A1, A4, A8, A10, and A11. In some embodiments, L1 is a combination of at least two bonds selected from A1, A8, and A10.

[0256] In some embodiments, the length of L1 can be 3 to 25 atoms, 3 to 20 atoms, 4 to 15 atoms, or 5 to 12 atoms. In some embodiments, the length of L1 is 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60 atoms.

[0257] In some embodiments, j1 is an integer between 2 and 10, and in some embodiments, j1 is an integer between 3 and 5. In some embodiments, j2 is an integer between 2 and 10, and in some embodiments, j2 is an integer between 3 and 5. R' is a C1-C4 alkyl group, and in some embodiments, R' is one of methyl, ethyl, and isopropyl. Ra is one of A27, A28, A29, A30, and A31, and in some embodiments, Ra is A27 or A28. Rb is a C1-C5 alkyl group, and in some embodiments, Rb is one of methyl, ethyl, isopropyl, and butyl. In some embodiments, j1, j2, R', Ra, and Rb are selected in formulas A1-A26, respectively, to realize binding of the M1 targeting group to an N atom on the nitrogen-containing backbone, and to further suit the spatial position between the M1 targeting groups for binding of the M1 targeting group to an asialoglycoprotein receptor on the liver surface.

[0258] In some embodiments, the complex has a structure as shown in formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422).

[0259] [ka] JPEG0007610268000030.jpg218170JPEG0007610268000031.jpg214170JPEG0007610268000032.jpg209170 JPEG0007610268000033.jpg228170JPEG0007610268000034.jpg216170JPEG0007610268000035.jpg155170

[0260] In some embodiments, the P atom in formula A59 may be attached to any possible position in the siRNA sequence, for example, the P atom in formula A59 may be attached to any one nucleotide of the sense strand or antisense strand of the siRNA, and in some embodiments, the P atom in formula A59 is attached to any one nucleotide of the sense strand of the siRNA. In some embodiments, the P atom in formula A59 is attached to the end of the sense strand or antisense strand of the siRNA, and in some embodiments, the P atom in formula A59 is attached to the end of the sense strand of the siRNA. The end refers to the previous 4 nucleotides from one end of the sense strand or the antisense strand. In some embodiments, the P atom in formula A59 is attached to the end of the sense strand or the antisense strand of the siRNA, and in some embodiments, the P atom in formula A59 is attached to the 3' end of the sense strand of the siRNA. When bound to the above-mentioned position of the sense strand of the siRNA, the siRNA complex shown in formula (308) can release the single siRNA antisense strand when unwound after entering a cell, blocking the process of PCSK9 mRNA translating into protein and suppressing PCSK9 gene expression.

[0261] In some embodiments, P in formula A59 may be bound to any possible position on a nucleotide in siRNA, such as the 5' position of a nucleotide, the 2' position of a nucleotide, the 3' position of a nucleotide, or the base of a nucleotide. In some embodiments, P atom in formula A59 may be bound to the 2', 3' or 5' position of a nucleotide in said siRNA by forming a phosphodiester bond. In some embodiments, P atom in formula A59 is bound to the oxygen atom obtained by dehydrogenating the 3' hydroxyl group of the 3'-terminal nucleotide of the sense strand of siRNA (in this case, P atom in A59 can also be regarded as the P atom of the phosphate group contained in siRNA), or P atom in formula A59 is bound to a nucleotide by replacing hydrogen in the 2'-hydroxyl group of one nucleotide in the sense strand of siRNA, or P atom in formula A59 is bound to a nucleotide by replacing hydrogen in the 5' hydroxyl group of the 5'-terminal nucleotide of the sense strand of siRNA.

[0262] The inventors of the present disclosure have unexpectedly found that the siRNA complex of the present disclosure has significantly improved plasma stability, reduced off-target effects, and further exhibits high PCSK9 mRNA silencing activity, and has high lipid suppression effect.In some embodiments, the siRNA of the present disclosure may be one of the siRNAs shown in Tables 1a to 1g.The complexes containing these siRNAs exhibit higher PCSK9 mRNA silencing activity.

[0263] [Table 1a] JPEG0007610268000037.jpg255163JPEG0007610268000038.jpg47170 [Table 1b] JPEG0007610268000040.jpg255164JPEG0007610268000041.jpg41170 [Table 1c] JPEG0007610268000043.jpg255166JPEG0007610268000044.jpg41170 [Table 1d] JPEG0007610268000046.jpg255167JPEG0007610268000047.jpg42170 [Table 1e] JPEG0007610268000049.jpg255166JPEG0007610268000050.jpg42170 [Table 1f] JPEG0007610268000052.jpg255168JPEG0007610268000053.jpg42170 [Table 1g]

[0264] In the siRNA or siRNA complex described in the present disclosure, adjacent nucleotides are linked by a phosphodiester bond or a thiophosphodiester bond, and the non-bridging oxygen or sulfur atom in the phosphodiester or thiophosphodiester bond may be negatively charged and exist as a hydroxyl group or a sulfhydryl group, and the hydrogen ions in the hydroxyl or sulfhydryl group may be partially or completely replaced by a cation. The cation may be any cation, for example, a metal cation, an ammonium ion NH4 + In one embodiment, the cation is one or more selected from an alkali metal ion, an ammonium cation formed by a tertiary amine, and a quaternary ammonium cation, in consideration of improving solubility. The alkali metal ion is K + And / or Na +and the cation formed by the tertiary amine may be an ammonium ion formed by triethylamine and / or an ammonium ion formed by N,N-diisopropylethylamine. Thus, the siRNA or siRNA complex described in the present disclosure may exist at least partially as a salt. In one embodiment, the non-bridging oxygen or sulfur atom in the phosphodiester bond or thiophosphodiester bond is at least partially bound to a sodium ion, and the siRNA or siRNA complex described in the present disclosure exists as a sodium salt or partial sodium salt.

[0265] As those skilled in the art are clearly aware, modified nucleotide groups can be introduced into the siRNA described in the present disclosure by using nucleoside monomers with corresponding modifications.The method of preparing nucleoside monomers with corresponding modifications and the method of introducing modified nucleotide groups into siRNA are also well known to those skilled in the art.All modified nucleoside monomers can be purchased commercially or prepared by known methods.

[0266] <Preparation of siRNA complex represented by formula (308)> The siRNA conjugate of formula (308) may be prepared by any reasonable synthetic route.

[0267] In some embodiments, the siRNA complex shown in formula (308) can be prepared by the following method, which includes sequentially binding nucleoside monomers from 3' to 5' according to the nucleotide types and order of the sense and antisense strands of the siRNA under phosphoramidite solid-phase synthesis conditions, the binding of each nucleoside monomer includes four reactions of deprotection, coupling, capping, oxidation or sulfurization, and isolating and annealing the sense and antisense strands of the siRNA, wherein the siRNA is the siRNA of the present disclosure.

[0268] The method further includes contacting the compound of formula (321) with a nucleoside monomer or a nucleotide sequence bound to a solid support under coupling reaction conditions and in the presence of a coupling reagent to couple the compound of formula (321) to the nucleotide sequence. Hereinafter, the compound of formula (321) is also referred to as a conjugated molecule.

[0269] [ka] During the ceremony, R4 is a group capable of binding to the siRNA represented by Nu in the compound represented by formula (308). In some embodiments, R4 is a group capable of binding to the siRNA represented by Nu by a covalent bond. In some embodiments, R4 is a group capable of conjugating to any functional group of the siRNA represented by Nu by a phosphodiester bond through a reaction; Each S1 is independently a group in which all active hydroxy groups in M1 have been replaced with YCOO- groups, and each Y is independently selected from a methyl group, a trifluoromethyl group, a difluoromethyl group, a fluoromethyl group, a trichloromethyl group, a dichloromethyl group, a chloromethyl group, an ethyl group, a n-propyl group, an isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group, and in some embodiments, Y is a methyl group.

[0270] n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 The definitions and selectable ranges of L1 and M1 are as described above.

[0271] R4 is selected to provide a bond with the N atom on the nitrogen-containing backbone and provide a suitable reactive site for the synthesis of the siRNA conjugate shown in formula (308). In some embodiments, R4 includes an R2 linker group or a protected R2 linker group and a functional group that can be reacted with the siRNA to form the structure shown in A59.

[0272] In some embodiments, R4 comprises a first functional group capable of forming a phosphite with a group on the siRNA or nucleoside monomer represented by Nu, and a second functional group capable of reacting with a hydroxyl group or an amino group to form a covalent bond or a solid support bound by said covalent bond. In some embodiments, the first functional group is a phosphoramidite, a hydroxyl group or a protected hydroxyl group. In some embodiments, the second functional group is a phosphoramidite, a carboxyl group or a carboxylate. In some embodiments, the second functional group is a solid support bound to another part of the molecule via a covalent bond, the covalent bond being formed by a hydroxyl group or an amino group. In some embodiments, the solid support is bound via a phosphate bond, a carboxyl ester bond or an amide bond. In some embodiments, the solid support is a resin.

[0273] In some embodiments, the first functional group is a hydroxy group, -OR k or a group represented by formula (C3), and the second functional group comprises a structure represented by formula (C1), (C2), (C3), (C1') or (C3').

[0274] [ka] In the formula, q1 is an integer of 1 to 4, X is O or NH, and M + is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG0007610268000057.jpg6170 represents the site to which the group is covalently attached.

[0275] In some embodiments, the first functional group comprises a phosphoramidite group as shown in formula (C3), which can be coupled with a hydroxy group at any position on a nucleotide, for example, a hydroxy group at the 2' position or a hydroxy group at the 3' position, to form a phosphite ester, which can be oxidized or sulfurized to form a phosphodiester bond or a thiophosphate bond as shown in formula A59, and the conjugated molecule can be conjugated to an siRNA. In this case, even if the second functional group is not present, the compound of formula (321) can be conjugated to a nucleotide, and does not affect the acquisition of the siRNA conjugate as shown in formula (308). In this case, after obtaining the sense strand or antisense strand of an siRNA by a method such as phosphoramidite solid-phase synthesis, the compound of formula (321) is reacted with a hydroxy group on the terminal nucleotide in the nucleotide sequence, and a phosphodiester bond or a thiophosphate bond is formed in a subsequent oxidation or sulfurization process, and the compound of formula (321) is conjugated to an siRNA.

[0276] In some embodiments, the first functional group comprises a protected hydroxy group. In some embodiments, the second functional group comprises a group capable of reacting with a solid phase support, and the reaction provides a conjugated molecule comprising a solid phase support. In some embodiments, the second functional group comprises a carboxy group, a carboxylate, or a phosphoramidite, as shown in formula (C1), (C2), or (C3). When the second functional group comprises a carboxy group or a carboxylate, the compound of formula (321) is esterified or amidated with a hydroxy group or an amino group on a solid phase support, e.g., a resin, to form a conjugated molecule comprising a solid phase support linked by a carboxylate bond. When the second functional group comprises a phosphoramidite functional group, the compound of formula (321) is coupled with a hydroxy group on a general-purpose solid phase support, e.g., a resin, to form a conjugated molecule comprising a solid phase support linked by a phosphodiester bond, by oxidizing the hydroxy group. Then, starting from the solid support-bound product, nucleoside monomers are sequentially bound according to phosphoramidite solid-phase synthesis to obtain the sense strand or antisense strand of siRNA bound with a conjugated group. In the phosphoramidite solid-phase synthesis process, the first functional group is deprotected and then coupled with the phosphoramidite group in the nucleoside monomer under coupling reaction conditions.

[0277] In some embodiments, the first functional group comprises a hydroxy group or a protected hydroxy group, and the second functional group comprises a solid-phase support bound by a carboxylic acid ester bond, or a solid-phase support bound by an amide bond, or a solid-phase support bound by a phosphate ester bond, as shown in formula (C1') or (C3').In this case, use the compound of formula (321) as starting material instead of a solid-phase support, and sequentially bind nucleoside monomers according to phosphoramidite solid-phase synthesis method to obtain the sense strand or antisense strand of siRNA bound with a conjugated group.

[0278] In some embodiments, the carboxylate is -COO - M + where M +is a cation, e.g., a metal cation, the ammonium cation NH + In one embodiment, the metal ion is an alkali metal ion, such as K + Or Na + In consideration of improving solubility and smooth reaction, in some embodiments, the organic ammonium ion is an ammonium cation formed by a tertiary amine or a quaternary ammonium cation, for example, an ammonium ion formed by triethylamine or an ammonium ion formed by N,N-diisopropylethylamine. In some embodiments, the carboxylate is a triethylamine carboxylate or an N,N-diisopropylethylamine carboxylate.

[0279] In some embodiments, R4 comprises a structure shown in formula (B9), (B10), (B9'), (B10'), (B11), (B12), (B11') or (B12').

[0280] [ka] In the formula, q1 is an integer of 1 to 4, q2 is an integer of 1 to 10, X is O or NH, and M + is a cation and R k is a hydroxy protecting group, SPS represents a solid phase support, JPEG0007610268000059.jpg6170 represents the site to which the group is covalently bonded. In some embodiments, q1 is 1 or 2. In some embodiments, q2 is an integer from 1 to 5. In some embodiments, R4 comprises a structure represented by formula (B9) or (B10). In some embodiments, R4 comprises a structure represented by formula (B11) or (B12).

[0281] In some embodiments, R kis one or more of Tr (trityl group), MMTr (4-methoxytrityl group), DMTr (4,4'-bismethoxytrityl group), TMTr (4,4',4''-trimethoxytrityl group). In some embodiments, R k may be DMTr, ie, 4,4'-dimethoxytrityl.

[0282] The definition of L1 is as described above.

[0283] In some embodiments, L1 is used to attach the M1 targeting group to an N atom on the nitrogen-containing backbone and provide liver targeting functionality to the siRNA complex shown in formula (308). In some embodiments, L1 comprises any one or combination of A1-A26.

[0284] From the above description, as can be easily understood by those skilled in the art, compared to the phosphoramidite solid phase synthesis method known in the art, the above first functional group and any second functional group can provide the siRNA complex shown in formula (308), in which the conjugate molecule is bound to any possible position of the nucleotide sequence, for example, the end of the nucleotide sequence, the terminus of the nucleotide sequence. Accordingly, unless otherwise specified, in the following description of the preparation of the conjugate and / or conjugate molecule, when reactions such as "deprotection", "coupling", "capping", "oxidation", "sulfurization" are mentioned, it should be understood that the reaction conditions and reagents related to the phosphoramidite nucleic acid solid phase synthesis method known in the art also apply to these reactions. Exemplary reaction conditions and reagents are described in detail below.

[0285] In some embodiments, each S1 is independently M1. In some embodiments, each S1 is independently a group in which at least one active hydroxy group in M1 is protected with a hydroxy protecting group. In some embodiments, each S1 is independently a group in which all active hydroxy groups present in M1 are protected with hydroxy protecting groups. In some embodiments, any hydroxy protecting group known to those skilled in the art can be used to protect the active hydroxy group in M1. In some embodiments, the protected hydroxy group may be represented by the formula YCOO-, where each Y is independently C1-C 10 Alkyl groups and C6-C 10 aryl groups, wherein the C1-C 10 Alkyl groups and C6-C 10 The aryl group is optionally substituted with one or more substituents selected from the group consisting of halogen and C1-C6 alkyl groups. In some embodiments, each Y is independently selected from the group consisting of methyl, trifluoromethyl, difluoromethyl, monofluoromethyl, trichloromethyl, dichloromethyl, chloromethyl, ethyl, n-propyl, isopropyl, phenyl, halophenyl, and C1-C6 alkylphenyl groups.

[0286] In some embodiments, each S1 is independently selected from the group consisting of formulas A46-A54.

[0287] [ka]

[0288] In some embodiments, S1 is of formula A49 or A50.

[0289] In some embodiments, each Y is independently selected from a methyl group, a trifluoromethyl group, a difluoromethyl group, a fluoromethyl group, a trichloromethyl group, a dichloromethyl group, a chloromethyl group, an ethyl group, a n-propyl group, a isopropyl group, a phenyl group, a halophenyl group, and an alkylphenyl group, and in some embodiments, Y is a methyl group.

[0290] As described above, the method for preparing the siRNA complex represented by formula (308) further includes the steps of synthesizing the other strand of the siRNA (for example, when the sense strand of the siRNA bound to the complex molecule is synthesized in the above step, the antisense strand of the siRNA is further synthesized according to a solid phase synthesis method, and vice versa), isolating the sense strand and the antisense strand, and annealing the sense strand and the antisense strand. Specifically, in the isolation step, the solid phase support bound to the nucleotide sequence and / or the complex molecule is cleaved, and the necessary protecting groups are removed (in this case, each S1 group in the compound of formula (321) is converted to the corresponding M1 targeting group), to obtain the sense strand (or antisense strand) of the siRNA bound to the complex molecule and the corresponding antisense strand (or sense strand), and the sense strand and the antisense strand are annealed to form a double-stranded RNA structure, thereby obtaining the siRNA complex represented by formula (308).

[0291] In some embodiments, a method for preparing an siRNA complex represented by formula (308) includes contacting a compound represented by formula (321) with a first nucleoside monomer at the 3' end of a sense strand or an antisense strand under coupling reaction conditions and in the presence of a coupling reagent, binding the compound represented by formula (321) to the first nucleotide in the sequence, and sequentially binding nucleoside monomers from 3' to 5' according to the type and order of nucleotides in the desired sense strand or antisense strand under phosphoramidite solid phase synthesis conditions to synthesize an siRNA sense strand or antisense strand, wherein the compound of formula (321) has a first functional group containing a protected hydroxy group at R4, and a second functional group having the structure represented by formula (C1') or (C3'). a step of deprotecting the compound of formula (321) before binding with a first nucleoside monomer, the binding of each nucleoside monomer comprising four reactions, namely, deprotection, coupling, capping, oxidation or sulfurization, to obtain a sense strand or antisense strand of a nucleic acid bound with a composite group; a step of sequentially binding nucleoside monomers from 3' to 5' under phosphoramidite solid-phase synthesis conditions according to the type and order of nucleotides in the antisense strand or sense strand, synthesizing an antisense strand or sense strand of a nucleic acid, the binding of each nucleoside monomer comprising four reactions, namely, deprotection, coupling, capping, oxidation or sulfurization, removing the protecting group, cleaving from the solid-phase support, isolating and purifying to obtain a sense strand and an antisense strand, and annealing the resulting mixture.

[0292] In some embodiments, the method for preparing the siRNA complex represented by formula (308) includes the steps of: synthesizing a sense strand and an antisense strand by sequentially binding nucleoside monomers from 3' to 5' according to the type and order of nucleotides of the sense strand or antisense strand in the double-stranded siRNA, and the binding of each nucleoside monomer includes four reactions, namely, deprotection, coupling, capping, oxidation or sulfurization, to obtain a sense strand bound to a solid support and an antisense strand bound to a solid support; contacting a compound represented by formula (321) with a sense strand bound to a solid support or an antisense strand bound to a solid support under coupling reaction conditions and in the presence of a coupling reagent, binding a compound represented by formula (321) containing a first functional group that is a phosphoramidite group in R4 to the sense strand or the antisense strand, removing the protecting group, cleaving from the solid support, isolating and purifying the compound, respectively, to obtain a sense strand or an antisense strand of siRNA bound to a conjugated group, and annealing the compound.

[0293] In some embodiments, the P atom in formula A59 is bound to the 3' end of the sense strand in the siRNA, and the method for preparing the siRNA complex represented by formula (308) includes the steps of: (1) Compound of formula (321) (Compound of formula (321) is a compound having a protected hydroxy group OR k and a second functional group having a structure represented by formula (C1') or (C3'). k and contacting the deprotected product with a nucleoside monomer under coupling reaction conditions and in the presence of a coupling reagent to obtain a nucleoside monomer attached to the solid support by a conjugate molecule. (2) synthesizing the sense strand of siRNA in the 3'-5' direction by phosphoramidite solid-phase synthesis starting from the nucleoside monomer bound to the solid support by the conjugate molecule; (3) synthesizing the antisense strand of the siRNA by phosphoramidite solid phase synthesis; (4) isolating and annealing the sense and antisense strands of the siRNA to obtain a siRNA complex represented by formula (308).

[0294] In step (1), the protecting group R in the compound of the above formula (321) k The method of removing includes contacting the compound of Formula (321) with a deprotection reagent under deprotection conditions. The deprotection conditions include a temperature of 0 to 50° C., in some embodiments 15 to 35° C., a reaction time of 30 to 300 seconds, in some embodiments 50 to 150 seconds, and the deprotection reagent may be one or more selected from trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid, in some embodiments dichloroacetic acid. The molar ratio of the deprotection reagent to the compound of Formula (321) is 10:1 to 1000:1, in some embodiments 50:1 to 500:1.

[0295] The coupling reaction conditions and coupling reagents may be any conditions and reagents suitable for the coupling reaction, and in some embodiments may be the same as those for the coupling reaction in the solid phase synthesis method employed.

[0296] In some embodiments, the coupling reaction conditions include a reaction temperature of 0 to 50° C., and in some embodiments, 15 to 35° C. The molar ratio of the compound of formula (321) to the nucleoside monomer is 1:1 to 1:50, and in some embodiments, 1:2 to 1:5. The molar ratio of the compound of formula (321) to the coupling reagent may be 1:1 to 1:50, and in some embodiments, 1:3 to 1:10, and the reaction time is 200 to 3000 seconds, and in some embodiments, 500 to 1500 seconds. The coupling reagent is one or more selected from 1H-tetrazole, 5-ethylthio 1H-tetrazole, and 5-benzylthio 1H-tetrazole, and in some embodiments, 5-ethylthio 1H-tetrazole. The coupling reaction may be carried out in an organic solvent, and the organic solvent is one or more selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane, and in some embodiments, anhydrous acetonitrile. For the compound of formula (321), the dosage of the organic solvent is 3-50 L / mol, in some embodiments 5-20 L / mol.

[0297] In step (2), starting from the nucleoside monomer bound to the solid support by the conjugate molecule prepared in the above step, synthesize the sense strand SS of the siRNA conjugate in the 3'-5' direction by phosphoramidite nucleic acid solid phase synthesis method, in which the conjugate group is bound to the 3' end of the obtained sense strand.

[0298] Other conditions for the solid phase synthesis in steps (2) and (3) include deprotection conditions for nucleoside monomers, the type and dosage of deprotection reagent, coupling reaction conditions, the type and dosage of coupling reagent, capping reaction conditions, the type and dosage of capping reagent, oxidation reaction conditions, the type and dosage of oxidation reagent, sulfurization reaction conditions, and the type and dosage of sulfurization reagent, and various reagents, dosages and conditions commonly used in this field are adopted.

[0299] For example, in some embodiments, in steps (2) and (3), the solid phase synthesis may use the following conditions:

[0300] The deprotection conditions for the nucleoside monomer are as follows: temperature is 0 to 50°C, in some embodiments 15 to 35°C, reaction time is 30 to 300 seconds, in some embodiments 50 to 150 seconds, the deprotection reagent may be one or more selected from trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid, in some embodiments dichloroacetic acid, and the molar ratio of the deprotection reagent to the 4,4'-dimethoxytrityl protecting group on the solid support may be 2:1 to 100:1, in some embodiments 3:1 to 50:1.

[0301] The coupling reaction conditions are as follows: temperature is 0 to 50°C, and in some embodiments 15 to 35°C; the molar ratio of the nucleic acid sequence bound to the solid phase carrier to the nucleoside monomer may be 1:1 to 1:50, and in some embodiments 1:5 to 1:15; the molar ratio of the nucleic acid sequence bound to the solid phase carrier to the coupling reagent is 1:1 to 1:100, and in some embodiments 1:50 to 1:80; and the reaction time and selection of the coupling reagent are the same as above.

[0302] The capping reaction conditions are as follows: temperature is 0 to 50°C, in some embodiments 15 to 35°C, reaction time is 5 to 500 seconds, in some embodiments 10 to 100 seconds, and the selection of the capping reagent is the same as above. The molar ratio of the total amount of the capping reagent to the nucleic acid sequence bound to the solid phase carrier is 1:100 to 100:1, in some embodiments 1:10 to 10:1. When equimolar amounts of acetic anhydride and N-methylimidazole are used as the capping reagent, the molar ratio of acetic anhydride, N-methylimidazole, and the nucleic acid sequence bound to the solid phase carrier may be 1:1:10 to 10:10:1, in some embodiments 1:1:2 to 2:2:1.

[0303] The oxidation reaction conditions are a temperature of 0 to 50°C, in some embodiments 15 to 35°C, a reaction time of 1 to 100 seconds, in some embodiments 5 to 50 seconds, and the oxidation reagent is iodine in some embodiments (provided as iodine water in some embodiments). The molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid phase support in the coupling step may be 1:1 to 100:1, in some embodiments 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1 to 1:1:3. The sulfurization reaction conditions are a temperature of 0 to 50°C, in some embodiments 15 to 35°C, a reaction time of 50 to 2000 seconds, in some embodiments 100 to 1000 seconds, and the sulfurization reagent is xanthan hydride in some embodiments. The molar ratio of the sulfurization reagent to the nucleic acid sequence bound to the solid phase carrier in the coupling step is 10:1 to 1000:1, and in some embodiments, 10:1 to 500:1. In some embodiments, the sulfurization reaction is carried out in a mixed solvent of acetonitrile:pyridine=1:3 to 3:1.

[0304] After all nucleoside monomers are linked and before annealing, the method further includes isolating the sense and antisense strands of the siRNA. Isolation methods are known to those skilled in the art and generally include cleaving the synthesized nucleotide sequence from the solid support, removing the protecting groups on the bases, phosphate groups and ligands, purifying and desalting.

[0305] The synthesized nucleotide sequence is cleaved from the solid support and the protecting groups on the base, phosphate group and ligand are removed by a usual cleavage and deprotection method in siRNA synthesis. For example, the obtained nucleotide sequence bound to the solid support is contacted with concentrated aqueous ammonia, and in the deprotection process, the protecting group YCOO- of A46 to A54 is converted to a hydroxyl group, and the S1 group is converted to the corresponding M1 group, to generate the siRNA complex shown in formula (308). Here, the concentrated aqueous ammonia may be 25 to 30% by weight aqueous ammonia, and the dosage of the concentrated aqueous ammonia may be 0.2 ml / μmol to 0.8 ml / μmol with respect to the target siRNA sequence.

[0306] If the synthesized nucleotide sequence has at least one 2'-TBDMS protection, the method further comprises removing the 2'-TBDMS protection by contacting the nucleotide sequence from which the solid support has been removed with triethylamine trihydrofluoride. In this case, the corresponding nucleotide in the obtained target siRNA sequence has a free 2'-hydroxy group. The dosage of pure triethylamine trihydrofluoride may be 0.4ml / μmol to 1.0ml / μmol relative to the target siRNA sequence. In this way, the siRNA complex shown in formula (308) can be obtained.

[0307] Methods of purification and desalting are well known to those skilled in the art. For example, purification of nucleic acids can be completed using a preparative ion chromatography purification column with gradient elution of NaBr or NaCl, and the products can be collected and combined before being desalted using a reverse phase chromatography purification column.

[0308] In the siRNA complex thus obtained, the non-bridging oxygen or sulfur atom in the internucleotide phosphodiester or thiophosphodiester bond is essentially bound to a sodium ion, and the siRNA complex of formula (308) is essentially present as a sodium salt. The sodium ion can be replaced with hydrogen ions and / or other cations by well-known ion exchange methods to obtain other forms of the siRNA complex of formula (308). The cations are as described above.

[0309] In the synthesis process, the purity and molecular weight of the nucleic acid sequence can be constantly detected to better control the synthesis quality. Such detection methods are known to those skilled in the art. For example, the purity of the nucleic acid can be detected by ion exchange chromatography, and the molecular weight can be measured by liquid chromatography tandem mass spectrometry (LC-MS).

[0310] The annealing method is also well known to those skilled in the art. For example, a sense strand (SS strand) and an antisense strand (AS strand) that are simply synthesized can be mixed in an equimolar ratio in water for injection, heated to 70-95°C, and then cooled at room temperature to form a double-stranded structure by hydrogen bonding. In this way, the siRNA complex shown in formula (308) can be obtained.

[0311] After obtaining the complex, in some embodiments, the synthesized siRNA complex represented by formula (308) can be characterized by molecular weight detection or the like using a method such as liquid chromatography tandem mass spectrometry, and it can be confirmed that the synthesized siRNA complex is the intended siRNA complex represented by formula (308) and that the sequence of the synthesized siRNA is the desired siRNA sequence, for example, one of the sequences shown in Tables 1a to 1g.

[0312] The compound of formula (321) can be prepared by a process which comprises contacting a compound of formula (313) with a cyclic acid anhydride in an organic solvent under esterification conditions and in the presence of a base and an esterification catalyst, followed by ion exchange and isolation to obtain a compound of formula (321).

[0313] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L 1、 The definition and selectable range of each S1 are as described above. R6 is a group that provides R4 in formula (321). In some embodiments, R6 has the structure shown in formula (A61).

[0314] [ka] In the formula, R i can achieve bonding with the N atom on the nitrogen-containing backbone, R k Any group having one free hydroxyl group bonded to O, R k is a hydroxy-protecting group. In this case, R4 contains a first functional group as a hydroxy-protecting group and a second functional group, and the second functional group contains a structure represented by formula (C1) or (C2), to obtain a compound of formula (321).

[0315] The esterification reaction conditions are a reaction temperature of 0 to 100° C. and a reaction time of 8 to 48 hours, and in some embodiments, the esterification reaction conditions are a reaction temperature of 10 to 40° C. and a reaction time of 20 to 30 hours.

[0316] In some embodiments, the organic solvent includes one or more of an epoxy solvent, an ether solvent, a halogenated alkyl solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and / or tetrahydrofuran, the ether solvent is ethyl ether and / or methyl tert-butyl ether, and the halogenated alkyl solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The dosage of the organic solvent is 3 to 50 L / mol, and in some embodiments, 5 to 20 L / mol, relative to the compound represented by formula (313).

[0317] In some embodiments, the cyclic acid anhydride is one of succinic anhydride, glutaric anhydride, adipic anhydride, or pimelic anhydride, and in some embodiments, succinic anhydride. The molar ratio of the cyclic acid anhydride to the compound represented by formula (313) is 1:1 to 10:1, and in some embodiments, 2:1 to 5:1.

[0318] The esterification catalyst may be any catalyst that catalyzes the esterification reaction, for example, the catalyst may be 4-dimethylaminopyridine. The molar ratio of the catalyst to the compound represented by formula (313) is 1:1 to 10:1, and in some embodiments, is 2:1 to 5:1.

[0319] In some embodiments, the base may be any inorganic base, organic base, or a combination thereof. In consideration of solubility and product stability, the base may be, for example, a tertiary amine. In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by formula (313) is 1:1 to 20:1, and in some embodiments, is 3:1 to 10:1.

[0320] The ion exchange action is to convert the compound of formula (321) into the desired carboxylic acid or carboxylate form, and the ion exchange method is known to those skilled in the art, and can be carried out by using appropriate ion exchange solutions and exchange conditions, such as M + A complex molecule having a cation can be obtained, and detailed description is omitted here. In some embodiments, the ion exchange reaction is carried out using a triethylamine phosphate solution, and the concentration of the triethylamine phosphate solution is 0.2-0.8 M, in some embodiments, the concentration of the triethylamine phosphate solution is 0.4-0.6 M, and the dosage of the triethylamine phosphate solution is 3-6 L / mol, and in further embodiments, 4-5 L / mol, relative to the compound of formula (313).

[0321] The compound of formula (321) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the compound of formula (321) can be isolated by a chromatography method, for example, by two chromatographic conditions: (1) normal phase purification silica gel: 200-300 mesh silica gel packing material is gradient eluted with dichloromethane:methanol=100:18-100:20 containing 1wt‰ triethylamine, or (2) reverse phase purification: C18, C8 reverse phase packing material is gradient eluted with methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (321), which can be used directly in the subsequent reaction.

[0322] In some embodiments, the method for preparing a compound of formula (321) further comprises contacting the product obtained by the ion exchange reaction with a solid support further comprising an amino group or a hydroxy group in the presence of a condensation agent, a condensation catalyst and a tertiary amine in an organic solvent under condensation reaction conditions, to obtain a compound of formula (321) in which R4 comprises a first functional group and a second functional group, the first functional group comprises a hydroxy protecting group, and the second functional group comprises a structure shown in formula (C1').

[0323] The solid phase carrier is one of the carriers used in solid phase synthesis of siRNA, some of which are known to those skilled in the art. For example, the solid phase carrier may be selected from solid phase carriers containing active hydroxyl or amino functional groups, and in some embodiments, the solid phase carrier is an amino resin or a hydroxy resin. In some embodiments, the amino resin or the hydroxy resin has parameters of a particle size of 100 to 400 mesh and a surface loading of amino or hydroxyl groups of 0.2 to 0.5 mmol / g. The dosage ratio of the compound represented by formula (321) to the solid phase carrier is 10 to 400 μmol compound / gram of solid phase carrier (μmol / g). In some embodiments, the dosage ratio of the compound represented by formula (321) to the solid phase carrier is 50 to 200 μmol / g.

[0324] The organic solvent may be any suitable solvent or mixture of solvents known to those skilled in the art. In some embodiments, the organic solvent is one or more of acetonitrile, epoxy solvent, ether solvent, halogenated alkyl solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the epoxy solvent is dioxane and / or tetrahydrofuran, the ether solvent is ethyl ether and / or methyl tert-butyl ether, and the halogenated alkyl solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is acetonitrile. For the compound of formula (321), the dosage of the organic solvent is 20-200 L / mol, and in some embodiments, 50-100 L / mol.

[0325] In some embodiments, the condensing agent may be benzotriazol-1-yl-oxytripyrrolidino phosphonium hexafluorophosphate (PyBop), 3-(Diethoxyphosphoryloxy)-1,2,3-benzotriazin-4(3H)-one (DEPBT) and / or O-benzotriazol-1-yl-tetramethyluronium hexafluorophosphate (O-benzotriazol-1-yl-tetramethyluronium hexafluorophosphate), and in some embodiments, the condensing agent is O-benzotriazol-tetramethyluronium hexafluorophosphate. The molar ratio of the condensing agent to the compound represented by formula (321) is 1:1 to 20:1, and in other embodiments, is 1:1 to 5:1.

[0326] In some embodiments, the tertiary amine is triethylamine and / or N,N-diisopropylethylamine, and in some embodiments, N,N-diisopropylethylamine, and the molar ratio of the tertiary amine to the compound represented by Formula (321) is 1:1 to 20:1, and in some embodiments, 1:1 to 5:1.

[0327] In some embodiments, the method for preparing the compound of formula (321) may further include contacting the resulting condensation product with a capping reagent and an acylation catalyst in an organic solvent under capping reaction conditions, and isolating to obtain the compound represented by formula (321). The function of the capping reaction is to remove any active reactive functional groups that have not yet fully reacted to avoid the generation of unwanted by-products in subsequent reactions. The conditions of the capping reaction are a reaction temperature of 0 to 50°C, in some embodiments 15 to 35°C, and a reaction time of 1 to 10 h, in some embodiments 3 to 6 h. As the capping reagent, a capping reagent used in siRNA solid-phase synthesis known to those skilled in the art may be used.

[0328] In some embodiments, the capping reagent comprises capping reagent 1 (cap1) and capping reagent 2 (cap2), where capping reagent 1 is N-methylimidazole, and in some embodiments, N-methylimidazole is provided as a pyridine / acetonitrile mixed solution, where the volume ratio of pyridine to acetonitrile is 1:10 to 1:1, and in some embodiments, 1:3 to 1:1, and the volume ratio of the total volume of pyridine and acetonitrile to N-methylimidazole is 1:1 to 10:1, and in some embodiments, 3:1 to 7:1. The capping reagent 2 is acetic anhydride. In some embodiments, the capping reagent 2 is provided as an acetonitrile solution of acetic anhydride, where the volume ratio of acetic anhydride to acetonitrile is 1:1 to 1:10, and in further embodiments, 1:2 to 1:6.

[0329] In some embodiments, the ratio of the volume of the pyridine / acetonitrile solution of N-methylimidazole to the mass of the compound of formula (321) is 5 ml / g to 50 ml / g, and in some embodiments, 15 ml / g to 30 ml / g. The ratio of the volume of the acetonitrile solution of acetic anhydride to the mass of the compound of formula (321) is 0.5 ml / g to 10 ml / g, and in some embodiments, 1 ml / g to 5 ml / g.

[0330] In some embodiments, the capping reagent is an equimolar mixture of acetic anhydride and N-methylimidazole. In some embodiments, the organic solvent is one or more of acetonitrile, epoxy solvents, ether solvents, halogenated alkyl solvents, dimethylsulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the organic solvent is acetonitrile. The dosage of the organic solvent relative to the compound of formula (321) is 10 to 50 L / mol, and in some embodiments, 5 to 30 L / mol.

[0331] In some embodiments, the acylation catalyst may be selected from any catalyst that can be used in esterification condensation or amidation condensation, such as an alkali heterocyclic compound. In some embodiments, the acylation catalyst is 4-dimethylaminopyridine. The mass ratio of the catalyst to the compound represented by formula (321) is 0.001:1 to 1:1, and in some embodiments, is 0.01:1 to 0.1:1.

[0332] In some embodiments, the compound of formula (321) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, the compound of formula (321) can be obtained by thorough washing with an organic solvent and filtration to remove unreacted reactants, excess capping reagent, and other impurities. The organic solvent is selected from acetonitrile, dichloromethane, methanol, and in some embodiments, acetonitrile.

[0333] In some embodiments, a method for preparing a conjugated molecule of formula (321) includes contacting a compound of formula (313) with a phosphorodiamidite in an organic solvent under coupling reaction conditions and in the presence of a coupling reagent, and isolating to obtain a compound of formula (321), where R4 includes a first functional group and a second functional group, the first functional group includes a hydroxy protecting group, and the second functional group includes a structure according to formula (C3).

[0334] In some embodiments, the coupling reaction conditions may be a temperature of 0 to 50°C, for example 15 to 35°C. The molar ratio of the compound of formula (313) to the phosphorodiamidite may be 1:1 to 1:50, for example 1:5 to 1:15, and the molar ratio of the compound of formula (313) to the coupling reagent may be 1:1 to 1:100, for example 1:50 to 1:80. The reaction time may be 200 to 3000 seconds, for example 500 to 1500 seconds. The phosphorodiamidite may be, for example, bis(diisopropylamino)(2-cyanoethoxy)phosphine, may be commercially available, or may be synthesized by a method known in the art. The coupling reagent may be one or more selected from 1H-tetrazole, 5-ethylthio 1H-tetrazole, and 5-benzylthio 1H-tetrazole, for example 5-ethylthio 1H-tetrazole. The coupling reaction may be carried out in an organic solvent, and the organic solvent may be one or more selected from anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane, for example, anhydrous acetonitrile. In some embodiments, the amount of the organic solvent may be 3 to 50 L / mol, for example, 5 to 20 L / mol, relative to the compound of formula (313). By carrying out the coupling reaction, a hydroxy group in the compound of formula (313) is reacted with a phosphoramidite to form a phosphoramidite group. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (321), which can be used in the subsequent reaction as it is.

[0335] In some embodiments, the method for preparing the compound of formula (321) further comprises contacting the isolated product with a hydroxyl-containing solid support in the presence of a coupling reagent in an organic solvent under coupling reaction conditions, followed by capping, oxidation, and isolation to obtain the compound of formula (321). In this case, the compound of formula (321) is obtained, in which R4 includes a first functional group and a second functional group, the first functional group includes a hydroxyl protecting group, and the second functional group has the structure shown in formula (C3').

[0336] In some embodiments, the solid support is a solid support that can be used for solid-phase synthesis of nucleic acids known in the art, for example, a commercially available, general-purpose solid support that has been deprotected (NittoPhase® HL UnyLinker TM 300 Oligonucleotide Synthesis Support, Kinovate Life Sciences, the structure of which is shown in formula B80).

[0337] [ka]

[0338] The deprotection reaction is known to those skilled in the art. In some embodiments, the deprotection conditions are a temperature of 0 to 50°C, for example 15 to 35°C, and a reaction time of 30 to 300 seconds, for example 50 to 150 seconds. The deprotection reagent may be one or more selected from trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and chloroacetic acid, and in some embodiments, the deprotection reagent is dichloroacetic acid. The molar ratio of the deprotection reagent to the -DMTr (4,4'-dimethoxytrityl) protecting group in the stationary phase is 2:1 to 100:1, for example 3:1 to 50:1. By carrying out the deprotection, a free hydroxyl group having a reaction activity is obtained on the surface of the solid phase support, which makes it easier to carry out the next coupling reaction.

[0339] The coupling reaction conditions and the selection of the coupling reagent are as described above. By carrying out the coupling reaction, the free hydroxyl group formed in the deprotection reaction reacts with the phosphoramidite group to form a phosphite bond.

[0340] In some embodiments, the capping reaction conditions are a temperature of 0 to 50° C., for example, 15 to 35° C., a reaction time of 5 to 500 seconds, for example, 10 to 100 seconds, and the capping reaction is carried out in the presence of a capping reagent. The selection and dosage of the capping reagent are as described above.

[0341] The conditions for the oxidation reaction may be a temperature of 0 to 50°C, for example 15 to 35°C, a reaction time of 1 to 100 seconds, for example 5 to 50 seconds, and the oxidation reagent may be, for example, iodine (provided as iodine water in some embodiments). In some embodiments, the molar ratio of the oxidation reagent to the nucleic acid sequence bound to the solid phase carrier may be 1:1 to 100:1, for example 5:1 to 50:1. In some embodiments, the oxidation reaction is carried out in a mixed solvent of tetrahydrofuran:water:pyridine=3:1:1 to 1:1:3.

[0342] In some embodiments, R6 is one of the groups of formula B7 or B8.

[0343] [ka] In the formula, q2, R k The definition is as described above.

[0344] In this case, the compound represented by formula (313) can be obtained by a preparation method in which the compound represented by formula (314) is contacted with the compound represented by formula (A-1) or the compound represented by formula (A-2) in an organic solvent under amidation reaction conditions and in the presence of an amidation reaction condensing agent and a tertiary amine, and then isolated.

[0345] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 , L1, S1, q2 and R k The definitions and selectable ranges of each are as described above.

[0346] The amidation reaction conditions may be a reaction temperature of 0 to 100° C. and a reaction time of 1 to 48 hours, and in some embodiments, the amidation reaction conditions are a reaction temperature of 10 to 40° C. and a reaction time of 2 to 16 hours.

[0347] In some embodiments, the organic solvent is one or more of an alcohol solvent, an epoxy solvent, an ether solvent, a halogenated alkyl solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine. In some embodiments, the alcohol solvent is one or more of methanol, ethanol, and propanol, and in some embodiments, is ethanol. In some embodiments, the epoxy solvent is dioxane and / or tetrahydrofuran. In some embodiments, the ether solvent is ethyl ether and / or methyl tert-butyl ether. In some embodiments, the halogenated alkyl solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane. In some embodiments, the organic solvent is dichloromethane. The amount of the organic solvent is 3 to 50 L / mol relative to the compound of formula (314), and 3 to 20 L / mol in further embodiments.

[0348] In some embodiments, the amidation reaction condensing agent is benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3-diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, 2-ethoxy-1-ethoxycarbonyl-1,2-dihydroquinoline (EEDQ) or O-benzotriazole-tetramethyluronium hexafluorophosphate / ester, and in further embodiments, 3-diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one. The molar ratio of the amidation reaction condensing agent to the compound represented by formula (314) may be 1:1 to 10:1, and in some embodiments, is 2.5:1 to 5:1.

[0349] In some embodiments, the tertiary amine is triethylamine or N,N-diisopropylethylamine, and in further embodiments, N,N-diisopropylethylamine. The molar ratio of the tertiary amine to the compound represented by Formula (314) is 3:1 to 20:1, and in some embodiments, 5:1 to 10:1.

[0350] In some embodiments, the compounds of formula (A-1) and formula (A-2) may be prepared by any suitable method. For example, R kis a DMTr group, a compound of formula (A-1) can be prepared by reacting calcium glycerate with DMTrCl. Similarly, a compound of formula (A-2) can be prepared by contacting 3-amino-1,2-propanediol with a cyclic acid anhydride, which may be a cyclic acid anhydride having 4 to 13 carbon atoms, and in some embodiments 4 to 8 carbon atoms. As can be easily understood by those skilled in the art, the selection of the cyclic acid anhydride corresponds to different values ​​of q2 in the compound of (A-2), for example, when the cyclic acid anhydride is succinic anhydride, q2=1, and when the cyclic acid anhydride is glutaric anhydride, q2=2, which may be inferred.

[0351] In some modifications, the compound of formula (313) can be prepared by reacting the compound of formula (314) with the cyclic acid anhydride, 3-amino-1,2-propanediol, and DMTrCl in sequence. As can be easily understood by those skilled in the art, these modifications do not affect the structure and function of the compound of formula (313), and can be easily realized by those skilled in the art by the above method.

[0352] Similarly, the compound of formula (313) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is removed by evaporation, the compound of formula (313) can be isolated by a chromatography method, for example, by two chromatography conditions: (1) normal phase purification silica gel: 200-300 mesh silica gel packing is gradient eluted with petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide = 1: 1: 1: 0.5-1: 1: 1: 0.6, and (2) reverse phase purification: C18, C8 reverse phase packing is gradient eluted with methanol: acetonitrile = 0.1: 1-1: 0.1. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (313), which can be used directly in the subsequent reaction.

[0353] In some embodiments, the compound of formula (314) can be obtained by a preparation process comprising contacting a compound of formula (320) with a compound of formula (316) in the presence of an amidation reaction condensing agent and a tertiary amine under condensation reaction conditions in an organic solvent, followed by isolation.

[0354] [ka] In the formula, n1, n3, m1, m2, m3, R 10 , R 11 , R 12 , R 13 , R 14 , R 15 The definitions and selectable ranges of each are as described above.

[0355] As the compound of formula (316), for example, the compound disclosed in J. Am. Chem. Soc. 2014, 136, 16958-16961 may be used. Alternatively, the compound of formula (316) can be prepared by a person skilled in the art by various methods. For example, some compounds of formula (316) can be prepared by referring to the method disclosed in Example 1 of U.S. Patent US 8,106,022 B2, the entire contents of which are incorporated herein by reference.

[0356] In some embodiments, the condensation reaction conditions include a reaction temperature of 0 to 100° C. and a reaction time of 0.1 to 24 hours, and in some embodiments, a reaction temperature of 10 to 40° C. and a reaction time of 0.5 to 16 hours.

[0357] Considering the structure of the compound of formula (314), which is the desired product, the molar ratio of the compound of formula (316) to the compound of formula (320) should be determined based on the sum of n1 and n3 in formula (320). In some embodiments, for example, when n1+n3=3, in order to ensure that the reaction is complete and not excessive, the molar ratio of the compound of formula (316) to the compound of formula (320) may be 3:1 to 3.5:1, and in some embodiments, is 3.01:1 to 3.15:1.

[0358] In some embodiments, the organic solvent is one or more of acetonitrile, epoxy solvent, ether solvent, halogenated alkyl solvent, dimethyl sulfoxide, N,N-dimethylformamide, and N,N-diisopropylethylamine, the epoxy solvent is dioxane and / or tetrahydrofuran, the ether solvent is ethyl ether and / or methyl tert-butyl ether, the halogenated alkyl solvent is one or more of dichloromethane, trichloromethane, and 1,2-dichloroethane, and the organic solvent is dichloromethane. For the compound of formula (320), the dosage of the organic solvent is 3 to 50 L / mol, and in some embodiments, 5 to 20 L / mol.

[0359] In some embodiments, the amidation reaction condensing agent is one or more of benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ester, 3-diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPBT), O-benzotriazole-tetramethyluronium hexafluorophosphate / ester, 4-(4,6-dimethoxytriazin-2-yl)-4-methylmorpholine hydrochloride, or 1-hydroxybenzotriazole, and in further embodiments, a mixture of benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ester and 1-hydroxybenzotriazole, where benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / ester and 1-hydroxybenzotriazole are used in equimolar amounts. The molar ratio of the total amidation reaction condensing agent to the compound represented by formula (316) may be 1:1 to 3:1, and in some embodiments, is 1.05:1 to 1.5:1.

[0360] The tertiary amine can be N-methylmorpholine, triethylamine, or N,N-diisopropylethylamine, and in some embodiments is N-methylmorpholine, and the molar ratio of the tertiary amine to the compound represented by Formula (316) can be from 2:1 to 10:1, and in some embodiments, is from 2:1 to 5:1.

[0361] Similarly, the compound of formula (314) can be isolated from the reaction mixture by any suitable isolation method. In some embodiments, after the solvent is evaporated, the compound of formula (314) can be isolated by a chromatography method, for example, by two chromatography conditions: (1) normal phase purification silica gel: 200-300 mesh silica gel packing material, gradient elution with dichloromethane:methanol=100:5-100:7, and (2) reverse phase purification: C18, C8 reverse phase packing material, gradient elution with methanol:acetonitrile=0.1:1-1:0.1. In some embodiments, the solvent can be directly removed to obtain a crude product of the compound of formula (314), which can be used directly in the subsequent reaction.

[0362] Compounds of formula (320) can be purchased commercially or obtained by methods known to those skilled in the art. For example, m1=m2=m3=3, n1=1, n3=2, and each R 10 , R 11 , R 12 , R 13 , R 14 , R 15 When both are H, the compound of formula (320) can be purchased commercially from Alfa Aesar.

[0363] The siRNA complex of the present disclosure may be used in combination with other pharma- ceutically acceptable additives, which may be one or more of various preparations or compounds commonly used in the art; for details, see the description of the pharmaceutical composition of the present disclosure above.

[0364] Uses of the siRNA, drug composition, and complex of the present disclosure In some embodiments, the present disclosure provides the use of the siRNA, and / or drug composition and / or siRNA complex of the present disclosure in the preparation of a drug for the treatment and / or prevention of a disease or physiological condition caused by abnormal expression of the PCSK9 gene.

[0365] In some embodiments, the present disclosure provides a method for preventing and / or treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene, comprising administering an effective amount of the siRNA, and / or drug composition and / or siRNA complex of the present disclosure to a subject in need thereof.

[0366] By administering the siRNA active ingredient of the present disclosure to a subject in need thereof, the purpose of preventing and / or treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene can be achieved by the RNA interference mechanism. Therefore, the siRNA and / or drug composition and / or siRNA complex of the present disclosure can be used for preventing and / or treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene, or can be used for preparing a drug for preventing and / or treating a disease or physiological condition caused by abnormal expression of the PCSK9 gene.

[0367] In some embodiments, the disease or physiological condition caused by abnormal expression of the PCSK9 gene refers to hypercholesterolemia and resulting cardiovascular diseases such as atherosclerosis, coronary heart disease, and hypertension.

[0368] The term "pharmaceutical administration / administration" as used herein refers to the introduction of the siRNA, drug composition and / or siRNA complex of the present disclosure into the body of a subject by a method or route that allows at least a portion of the siRNA, drug composition and / or siRNA complex of the present disclosure to be localized at a desired site to produce a desired effect. Suitable administration routes for the method of the present disclosure include local administration and systemic administration. Generally, local administration delivers more siRNA complex to a specific site than to the subject's systemic circulation, while systemic administration delivers the siRNA, drug composition and / or siRNA complex of the present disclosure to the subject's basic systemic circulation. Considering that the present disclosure can provide a means for preventing and / or treating hypercholesterolemia, in some embodiments, an administration method that can deliver the drug to the liver is adopted.

[0369] Administration to a subject may be by any suitable route known in the art, including, but not limited to, oral or parenteral routes, such as intravenous, intramuscular, subcutaneous, transdermal, intratracheal (aerosol), pulmonary, nasal, rectal, and topical (including buccal and sublingual) administration. The frequency of administration may be once or more daily, weekly, biweekly, triweekly, monthly, bimonthly, trimonthly, semi-annually, or yearly.

[0370] The dose of the siRNA, drug composition or siRNA complex described in this disclosure may be a dose that is conventional in the art, and the dose may be determined according to various parameters, particularly the age, weight and sex of the subject. Toxicity and therapeutic efficacy are measured in cell cultures or experimental animals by standard pharmaceutical procedures, for example, LD 50 (the dose that kills 50% of the colony), ED 50 (In quantitative reactions, it refers to the dose that can induce 50% of the maximum reaction strength, and in qualitative reactions, it refers to the dose at which a positive reaction occurs in 50% of experimental subjects) or IC 50 (the concentration of inhibitor / drug at which the quantitative response is half-inhibited) may be determined. A range of human dosage can be derived based on the data obtained from cell culture assays and animal studies.

[0371] When the siRNA, drug composition and / or siRNA complex described in the present disclosure is administered to, for example, male or female cynomolgus monkeys aged 3 to 5 years and weighing 2 to 6 kg, the amount of siRNA is as follows: (i) for the siRNA complex, the siRNA dose may be 0.001 to 100 mg / kg body weight, in some embodiments, 0.01 to 50 mg / kg body weight, in some embodiments, 0.05 to 20 mg / kg body weight, in some embodiments, 0.1 to 15 mg / kg body weight, and in some embodiments, 0.1 to 10 mg / kg body weight; and (ii) for the drug composition formed from the siRNA and a pharma- ceutically acceptable carrier, the siRNA dose may be 0.001 to 50 mg / kg body weight, in some embodiments, 0.01 to 10 mg / kg body weight, in some embodiments, 0.05 to 5 mg / kg body weight, and in some embodiments, 0.1 to 3 mg / kg body weight.

[0372] In some embodiments, the present disclosure provides a method for suppressing expression of PCSK9 gene in hepatocytes, comprising contacting hepatocytes with an effective amount of siRNA and / or drug composition and / or siRNA complex of the present disclosure, and introducing the siRNA and / or drug composition and / or siRNA complex of the present disclosure into the hepatocytes to achieve the purpose of suppressing expression of PCSK9 gene in the hepatocytes by RNA interference mechanism. The hepatocytes may be selected from hepatoma cell lines such as SMMC-7721, HepG2, Huh7, or isolated primary hepatocytes. In some embodiments, the cells are HepG2 hepatoma cells.

[0373] The method provided by the present disclosure suppresses expression of the PCSK9 gene in cells. The siRNA dose in the provided modified siRNA, drug composition and / or siRNA complex is generally an amount that can reduce expression of the target gene and results in an extracellular concentration at the surface of the target cell of 1 pM to 1 μM, or 0.01 nM to 100 nM, or 0.05 nM to 50 nM, or 0.05 nM to about 5 nM. The amount required to achieve the local concentration varies depending on various factors, including the delivery method, the delivery site, the number of cell layers between the delivery site and the target cell or tissue, the delivery route (local or systemic), etc. The concentration at the delivery site may be significantly higher than the concentration at the surface of the target cell or tissue.

[0374] <Kit> The present disclosure provides kits comprising an effective amount of at least one of the modified siRNAs, drug compositions, and siRNA complexes of the present disclosure.

[0375] In some embodiments, the kits described herein may provide the modified siRNA in a container. In some embodiments, the kits described herein may include a container providing a pharma- ceutically acceptable excipient. In some embodiments, the kits may include other components, such as stabilizers or preservatives. In some embodiments, the kits described herein may include at least one other therapeutic agent in a container separate from the container providing the modified siRNA described herein. In some embodiments, the kits may include instructions for mixing the modified siRNA with a pharma- ceutical acceptable carrier and / or additives or other components, if present.

[0376] In the kit of the present disclosure, the modified siRNA and pharma- ceutically acceptable carrier and / or additive, and the modified siRNA, drug composition and / or siRNA complex and / or complex, and / or pharma- ceutically acceptable additive may be provided in any form, for example, liquid form, dry form, or lyophilized form. In some embodiments, the modified siRNA and pharma- ceutically acceptable carrier and / or additive, and the drug composition and / or complex and any pharma- ceutically acceptable additive are essentially clean and / or sterile. In some embodiments, sterile water can be provided in the kit of the present disclosure.

[0377] The present disclosure will be further described below with reference to examples, but the present disclosure is not limited thereto in any way. EXAMPLES

[0378] Unless otherwise specified, all reagents and media used in the following examples are commercially available products, and all operations such as nucleic acid electrophoresis and real-time PCR are performed with reference to the methods described in Molecular Cloning (Cold Spring Harbor Laboratory Press (1989)).

[0379] When cells were transfected with the siRNA or siRNA complex against the PCSK9 gene synthesized according to the present disclosure, or the negative control siRNA or siRNA complex, Lipofectamine was used as a transfection reagent. TM 2000 (Invitrogen), and for specific operations, refer to the instructions provided by the manufacturer.

[0380] Unless otherwise stated, all reagent proportions provided below are calculated as volume ratios (v / v).

[0381] All experimental data

number

[0382] (Preparation Example 1) Preparation of Complex 1 In this preparation example, complex 1 was synthesized, designated by the number L10-siPCSKa1M1S, as shown in Table 3. The siRNA conjugated to this complex has sense and antisense strand sequences corresponding to complex 1 in Table 3.

[0383] (1-1) Synthesis of Compound L-10 Compound L-10 was synthesized according to the following method.

[0384] [ka]

[0385] (1-1-1) Synthesis of Complex Terminal Segment GAL-5 [ka]

[0386] (1-1-1a) Synthesis of GAL-2 100.0g of GAL-1 (N-acetyl-D-galactosamine hydrochloride, CAS number: 1772-03-8, purchased from Ningbo Hongxiang Biochemical Co., Ltd., 463.8mmol) was dissolved in 1000ml of anhydrous pyridine, and 540ml of acetic anhydride (purchased from Enox, 5565.6mmol) was added under ice water bath, and the mixture was stirred at room temperature for 1.5 hours. The reaction liquid was poured into 10L of ice water, filtered by suction under reduced pressure, and the cake was washed with 2L of ice water. Then, acetonitrile / toluene mixed solvent (acetonitrile:toluene volume ratio = 1:1) was added until it was completely dissolved, and the solvent was evaporated to dryness to obtain 130.0g of white solid product GAL-2.

[0387] (1-1-1b) Synthesis of GAL-3 GAL-2 (35.1 g, 90.0 mmol) obtained in step (1-1-1a) was dissolved in 213 ml of anhydrous 1,2-dichloroethane, and 24.0 g of trimethylsilyl trifluoromethanesulfonate (TMSOTf, CAS number: 27607-77-8, purchased from Macklin, Inc., 108.0 mmol) was added under ice-water bath and nitrogen protection conditions, and the reaction was allowed to proceed at room temperature overnight.

[0388] The reaction liquid was diluted with 400 ml of dichloromethane, filtered through diatomaceous earth, 1 L of saturated aqueous sodium bicarbonate solution was added, and the mixture was stirred uniformly. The organic phase was separated, and the aqueous phase was extracted twice with dichloroethane, each time with 300 ml of dichloroethane. The organic phases were combined and washed with 300 ml of saturated aqueous sodium bicarbonate solution and 300 ml of saturated saline solution, respectively. The organic phase was separated and dried over anhydrous sodium sulfate. The solvent was evaporated to dryness under reduced pressure to obtain 26.9 g of a pale yellow, viscous starch syrup-like product GAL-3.

[0389] (1-1-1c) Synthesis of GAL-4 GAL-3 (26.9 g, 81.7 mmol) obtained in step (1-1-1b) was dissolved in 136 ml of anhydrous 1,2-dichloroethane, 30 g of dried 4 Å molecular sieve powder was added, and 9.0 g of 5-hexen-1-ol (CAS number: 821-41-0, purchased from Adamas-beta, 89.9 mmol) was added and stirred at room temperature for 30 minutes. 9.08 g of TMSOTf (40.9 mmol) was added under an ice bath and nitrogen protection, and the reaction was allowed to proceed with stirring at room temperature overnight. The 4Å molecular sieve powder was removed by filtration, the filtrate was diluted with 300ml of dichloromethane, filtered through diatomaceous earth, 500ml of saturated aqueous sodium bicarbonate was added, and the mixture was stirred and washed for 10 minutes. The organic phase was separated, and the aqueous phase was extracted once with 300ml of dichloroethane. The organic phases were combined and washed with 300ml of saturated aqueous sodium bicarbonate and 300ml of saturated saline, respectively. The organic phase was separated and dried over anhydrous sodium sulfate, and the solvent was evaporated to dryness under reduced pressure to obtain 41.3g of yellow starch syrup-like product GAL-4, which was directly used for the next oxidation reaction without purification.

[0390] (1-1-1d) Synthesis of GAL-5 GAL-4 (14.9 g, 34.7 mmol) obtained by the method described in step (1-1-1c) was dissolved in a mixed solvent of 77 ml of dichloromethane and 77 ml of acetonitrile, and 103 ml of deionized water and 29.7 g of sodium periodate (CAS number: 7790-28-5, purchased from Aladdin, 138.8 mmol) were added, and the mixture was stirred for 10 minutes in an ice-water bath, and ruthenium (III) chloride (CAS number: 14898-67-0, purchased from Energy, 238 mg, 1.145 mmol) was added, and the mixture was reacted at room temperature overnight. The reaction solution was diluted with 300 ml of water and stirred, and the pH was adjusted to about 7.5 by adding saturated sodium bicarbonate, and the organic phase was separated and discarded, and the aqueous phase was extracted with dichloromethane three times, 200 ml each time, and the organic phase was discarded. The pH of the aqueous phase was adjusted to about 3 with solid citric acid, extracted three times with dichloromethane, each time with 200 ml, the organic phases were combined, dried over anhydrous sodium sulfate, and the solvent was evaporated to dryness under reduced pressure to obtain 6.85 g of a white foamy solid product, GAL-5. 1H NMR (400 MHz,DMSO) δ 12.01 (br,1H),7.83 (d,J = 9.2 Hz,1H),5.21 (d,J = 3.2 Hz,1H),4.96 (dd,J = 11.2,3.2 Hz,1H),4.49 (d,J = 8.4 Hz,1H),4.07-3.95 (m,3H),3.92-3.85 (m,1H),3.74-3.67 (m,1H),3.48-3.39 (m,1H),2.20 (t,J = 6.8 Hz,2H),2.11 (s,3H),2.00 (s,3H),1.90 (s,3H),1.77 (s,3H),1.55-1.45 (m,4H).

[0391] (1-1-2) Synthesis of L-8 [ka]

[0392] J-0 (9.886 g, 52.5 mmol, purchased from Alfa Acer Inc.) and GAL-5 (72.819 g, 162.75 mmol, a combination of products from multiple lots) obtained in step (1-1-1) were dissolved in 525 ml of dichloromethane, and diisopropylethylamine (DIEA, 44.782 g, 346.50 mmol), benzotriazol-1-yl-oxytripyrrolidino-phosphonium hexafluorophosphate / The ester (PyBOP, 90.158 g, 173.25 mmol) and hydroxybenzotriazole (HOBt, 23.410 g, 173.25 mmol) were added, and the mixture was reacted at room temperature for 4 h. 20 ml of saturated sodium bicarbonate and 200 ml of saturated saline were added to wash the mixture. The aqueous phase was extracted twice with dichloromethane, 100 ml each time. The organic phases were combined, dried over anhydrous sodium sulfate, and filtered. The solvent was evaporated to dryness under reduced pressure to obtain the crude product. For purification, 200-300 mesh normal phase silica gel was used, the acidity of the silica gel was neutralized with 10 wt% triethylamine, the column was equilibrated with 1 wt‰ triethylamine, and gradient elution was performed with dichloromethane:methanol = 100:25-100:40. The product eluate was collected, and the solvent was evaporated to dryness under reduced pressure to obtain 38.8 g of pure L-8.1 H NMR (400 MHz, DMSO) δ 7.84 (d,J = 9.0 Hz,3H),7.27-7.23 (m,1H),7.13-7.18 (m,1H),5.22 (d,J = 3.1 Hz,3H),4.97 (dd,J = 11.3,3.1 Hz,3H),4.48 (d,J = 8.4 Hz,3H),4.09-3.98 (m,9H),3.88 (dd,J = 19.3,9.3 Hz,3H),3.75-3.66 (m,3H),3.44-3.38 (m,3H),3.17-3.30 (m,4H),3.10-2.97 (m,4H),2.35-2.20 (m,6H),2.15-2.08 (m,9H),2.07-1.98 (m,13H),1.94-1.87 (m,9H),1.81-1.74 (m,9H),1.65-1.42 (m,18H). MS m / z:C 85 H 119 N7O 30 、[M+H] + , Theoretical value: 1477.59, Experimental value: 1477.23.

[0393] (1-1-3a)Synthesis of A-1

change

[0394] Dissolve DMTrCl (4,4'-bismethoxytrityl chloride, 101.65g, 300mmol) in 1000ml of anhydrous pyridine, add DL-calcium glycerate hydrate (28.63g, 100mmol), react at 45℃ for 20h, filter the reaction solution, rinse the cake with 200ml of DCM, evaporate the filtrate under reduced pressure to dryness, dissolve the residue in 500ml of dichloromethane again, wash with 0.5M triethylamine phosphate (pH=7~8) twice with 200ml each time, extract the aqueous phase with dichloromethane twice with 200ml each time, combine the organic phases, and wash with anhydrous sodium sulfate. The mixture was dried, filtered, and the solvent was evaporated to dryness under reduced pressure. The mixture was purified on a 200-300 mesh normal phase silica gel column, and gradient eluted with petroleum ether:ethyl acetate:dichloromethane:methanol=1:1:1:0.35-1:1:1:0.55. The product eluate was collected, and the solvent was evaporated to dryness under reduced pressure. The product was dissolved again in 600ml of dichloromethane, and washed once with 200ml of 0.5M triethylamine phosphate. The aqueous phase was extracted once with 200ml of dichloromethane. The organic phases were combined, dried over anhydrous sodium sulfate, filtered, and the solvent was evaporated to dryness under reduced pressure. The mixture was vacuumed overnight with a vacuum oil pump to obtain 50.7g of white solid product A-1. 1 H NMR (400 MHz,DMSO-d6) δ 7.46 (ddd,J = 6.5,2.3,1.1 Hz,1H),7.40-7.28 (m,7H),6.89-6.81 (m,4H),4.84 (d,J = 5.0 Hz,1H),4.36-4.24 MS m / z:C 24 H 23 O6, [MH] - , theoretical value: 407.15, measured value: 406.92.

[0395] (1-1-3b) Synthesis of L-7 [ka]

[0396] L-8 (40 g, 27.09 mmol, a combination of products from multiple lots) obtained in step (1-1-2) and A-1 (41.418 g, 81.27 mmol) obtained in step (1-1-3a) were mixed and dissolved in 271 ml of dichloromethane, and 3-diethoxyphosphoryl-1,2,3-benzoxazol-4(3H)-one (DEPBT) (24.318 g, 81.37 mmol) was added, and diisopropylethylamine (2 The organic phase was washed with 800ml of saturated sodium bicarbonate, the aqueous phase was extracted with dichloromethane three times, each time with 50ml, the organic phase was washed with 150ml of saturated saline, the aqueous phase was extracted once with 50ml of dichloromethane, the organic phase was combined, dried with anhydrous sodium sulfate, filtered, the solvent was evaporated to dryness under reduced pressure, and the crude product was obtained by foaming and drying overnight with a vacuum oil pump. For column purification, 2 kg of 200-300 mesh normal phase silica gel was used, the acidity of the silica gel was neutralized with 200 ml of triethylamine, the column was equilibrated with petroleum ether containing 1 wt% triethylamine, and gradient elution was performed with petroleum ether: ethyl acetate: dichloromethane: N,N-dimethylformamide = 1:1:1:0.5 to 1:1:1:0.6, the product eluate was collected, and the solvent was evaporated to dryness under reduced pressure to obtain 40.4 g of pure L-7. 1 H NMR (400 MHz,DMSO) δ7.90-7.78 (m,4H),7.75-7.64 (m,1H),7.38-7.18 (m,9H),6.91-6.83 (m,4H),5.25-5.10 (m,4H),4.97 (dd,J = 11.2,3.2 Hz,3H),4.48-4.30 (m,4H),4.02 (s,9H),3.93-3.84 (m,3H),3.76-3.66 (m,9H),3.45-3.35 (m,3H),3.24-2.98 (m,10H),2.30-2.20 (m,2H),2.11-1.88 (m,31H),1.80-1.40 (m, 28H). MS m / z: C 90 H 128 N7O 35 , [M-DMTr] +, theoretical value: 1564.65, actual value: 1564.88.

[0397] Synthesis of (1-1-4)L-9 [ka]

[0398] L-7 (40 g, 21.4247 mmol) obtained in step (1-1-3b), succinic anhydride (4.288 g, 42.8494 mmol) and 4-dimethylaminopyridine (DMAP, 5.235 g, 42.8494 mmol) were mixed and dissolved in 215 ml of dichloromethane, diisopropylethylamine (DIEA, 13.845 g, 107.1235 mmol) was further added, and the mixture was stirred at 25°C for 24 hours. The reaction solution was washed with 800 ml of 0.5 M triethylamine phosphate, and the aqueous phase was extracted three times with dichloromethane, 5 ml each time. The organic phases were combined and evaporated to dryness under reduced pressure to obtain a crude product. For column purification, 1 kg of 200-300 mesh normal phase silica gel was used, the acidity of the silica gel was neutralized with 1 wt% triethylamine, the column was equilibrated with dichloromethane, and gradient elution was performed with dichloromethane:methanol = 100:18-100:20 containing 1 wt% triethylamine. The product eluate was collected, and the solvent was evaporated to dryness under reduced pressure to obtain 31.0 g of pure L-9 complex molecule. 1H NMR (400 MHz,DMSO) δ 8.58 (d,J = 4.2 Hz,1H),7.94-7.82 (m,3H),7.41-7.29 (m,5H),7.22 (d,J = 8.1 Hz,5H),6.89 (d,J = 8.3 Hz,4H),5.49-5.37 (m,1H),5.21 (d,J = 3.0 Hz,3H),4.97 (d,J = 11.1 Hz,3H),4.49 (d,J = 8.2 Hz,3H),4.02 (s,9H),3.88 (dd,J = 19.4,9.4 Hz,3H),3.77-3.65 (m,9H),3.50-3.39 (m,6H),3.11-2.90 (m,5H),2.61-2.54 (m,4H),2.47-2.41 (m,2H),2.26-2.17 (m,2H),2.15-1.95 (m,22H),1.92-1.84 (m,9H),1.80-1.70 (m,10H),1.65-1.35 (m,17H),1.31-1.19 (m,4H),0.96 (t,J = 7.1 Hz,9H). MS m / z:C 94 H 132 N7O 38 , [M-DMTr] + , theoretical value: 1664.72, actual value: 1665.03.

[0399] (1-1-5) Synthesis of Compound L-10 [ka]

[0400] In this process, the L-10 compound was prepared by binding the L-9 conjugate molecule to a solid support.

[0401] The L-9 complex molecule (22.751 g, 11 mmol) obtained in step (1-1-4), O-benzotriazole-tetramethyluronium hexafluorophosphate / ester (HBTU, 6.257 g, 16.5 mmol) and diisopropylethylamine (DIEA, 2.843 g, 22 mmol) were mixed and dissolved in 900 ml of acetonitrile. The mixture was stirred at room temperature for 5 minutes, and the reaction solution was added with aminomethyl resin (88 g, 100-200 mesh, amino group loading amount 40 0μmol / g, purchased from Nankaiwasei Co., Ltd.) was added, and the reaction was carried out on a shaker at 25°C, at a rotation speed of 150 rpm for 18 h, followed by filtration, the cake was rinsed twice with 300 ml each time with DCM, rinsed three times with 300 ml each time with acetonitrile, and dried with a vacuum oil pump for 18 h, and then the raw materials (CapA, CapB, 4-dimethylaminopyridine (DMAP) and acetonitrile) were added according to the blending ratio shown in Table 2 to carry out the capping reaction. The mixture was placed on a shaker at 25°C, and reacted for 5 h at a rotation speed of 150 rpm, filtered, the cake was rinsed three times with 300 ml each time with acetonitrile, evaporated under reduced pressure until the solvent was dried, and dried under reduced pressure overnight with a vacuum oil pump to obtain 102 g of L-10 compound (i.e., L-9 complex molecule bound to a solid phase support) with a loading of 90.8μmol / g.

[0402] [Table 2]

[0403] Here, CapA and CapB are capping reagent solutions, CapA is a 20% by volume solution of N-methylimidazole in a pyridine / acetonitrile mixture with a volume ratio of pyridine to acetonitrile of 3:5, and CapB is a 20% by volume solution of acetic anhydride in acetonitrile.

[0404] (1-2) Synthesis of the sense strand of complex 1 The L-10 compound prepared in the above step was circulated as a starting material by the solid-phase phosphoramidite method, and nucleoside monomers were bound one by one in the 3'-5' direction according to the order of nucleotides in the sense strand to synthesize the sense strand of siRNA complex 1 in Table 3. Each time a nucleoside monomer was bound, four reactions were carried out: deprotection, coupling, capping, oxidation, or sulfurization. When two nucleotides were bound by a phosphate ester, four reactions were carried out when the next nucleoside monomer was bound: deprotection, coupling, capping, and oxidation. When two nucleotides were bound by a thiophosphate ester, four reactions were carried out when the next nucleoside monomer was bound: protection, coupling, capping, and sulfurization. The synthesis conditions were specified as follows.

[0405] The nucleoside monomers were provided in a 0.1 M solution in acetonitrile, and the conditions for each deprotection reaction were the same, i.e., the temperature was 25° C., the reaction time was 70 seconds, the deprotection reagent was a solution of dichloroacetic acid in dichloromethane (3% v / v), and the molar ratio of dichloroacetic acid to the 4,4′-dimethoxytrityl protecting group on the solid support was 5:1.

[0406] The coupling reaction conditions were all the same: temperature 25°C, molar ratio of the nucleic acid sequence to be bound to the solid phase carrier to the nucleoside monomer was 1:10, molar ratio of the nucleic acid sequence to be bound to the solid phase carrier to the coupling reagent was 1:65, reaction time was 600 seconds, and the coupling reagent was a 0.5 M acetonitrile solution of 5-(Ethylthio)-1H-tetrazole (ETT).

[0407] The capping conditions were the same for all of them, with a temperature of 25° C. and a reaction time of 15 seconds. The capping reagent solution was a mixed solution of CapA and CapB with a molar ratio of 1:1, and the molar ratio of the capping reagent to the nucleic acid sequence to be bound to the solid phase carrier was acetic anhydride:N-methylimidazole:nucleic acid sequence to be bound to the solid phase carrier=1:1:1.

[0408] The conditions for each oxidation reaction were the same: temperature 25°C, reaction time 15 seconds, and oxidation reagent 0.05M iodine water. The molar ratio of iodine to the nucleic acid sequence bound to the solid support in the coupling step was 30:1. The reaction was carried out in a mixed solvent of tetrahydrofuran:water:pyridine = 3:1:1.

[0409] The conditions for each sulfurization reaction were the same: temperature 25°C, reaction time 300 seconds, and sulfurization reagent xanthan hydride. The molar ratio of sulfurization reagent to the nucleic acid sequence to be bound to the solid support in the coupling step was 120:1. The reactions were carried out in a mixed solvent of acetonitrile:pyridine = 1:1.

[0410] After the binding of the last nucleoside monomer was completed, the nucleic acid sequence bound to the solid support was cleaved, deprotected, purified, desalted, and then lyophilized to obtain the sense strand.

[0411] The cleavage and deprotection conditions were as follows: the synthesized carrier-bound nucleotide sequence was added to ammonia water with a concentration of 25 wt%, the dosage of the ammonia water was 0.5 ml / μmol, and reacted at 55°C for 16 h, the remaining carrier was filtered off, and the supernatant was vacuum concentrated to dryness.

[0412] The conditions for purification and desalting are as follows. The purification of nucleic acids was completed by gradient elution with NaCl using a preparative ion chromatography purification column (Source 15Q). Specifically, eluent A: 20 mM sodium phosphate (pH 8.1), solvent water / acetonitrile = 9: 1 (volume ratio), eluent B: 1.5 M sodium chloride, 20 mM sodium phosphate (pH 8.1), solvent water / acetonitrile = 9: 1 (volume ratio), elution gradient: eluent A: eluent B = 100: 0 to 50: 50 gradient elution. The product eluate was collected and then combined, and desalted using a reverse phase chromatography purification column. The specific conditions were desalted using a dextran gel column, the packing material was dextran gel G25 (Sephadex G25), and eluted with deionized water.

[0413] The detection method is as follows. The purity of the sense strand was detected using ion exchange chromatography (IEX-HPLC), and the molecular weight was analyzed by liquid chromatography mass spectrometry (LC-MS). The measured value was consistent with the theoretical value, indicating that the sense strand SS with the L-9 conjugate molecule conjugated to the 3' end was synthesized.

[0414] (1-3) Synthesis of antisense strand of complex 1 The solid-phase phosphoramidite method was used to prepare a standard solid-phase support (UnyLinker TM The antisense strand of complex 1 in Table 3 was synthesized by circulating loaded NittoPhase® HL Solid Supports (Kinovate Life Sciences) as a starting material. The deprotection, coupling, capping, oxidation or sulfurization reaction conditions, cleavage and deprotection, purification and desalting conditions in the solid-phase synthesis method were the same as those for the synthesis of the sense strand. The antisense strand was then obtained by lyophilization. The purity of the antisense strand was detected by ion exchange chromatography (IEX-HPLC), and the molecular weight was analyzed by liquid chromatography mass spectrometry (LC-MS). As a result, the actual measured value was consistent with the theoretical value, indicating that the antisense strand AS having the target sequence was synthesized.

[0415] (1-4) Synthesis of Complex 1 For complex 1, the sense strand and the antisense strand were dissolved in water for injection, respectively, to obtain a 40 mg / mL solution, mixed in an equimolar ratio, heated at 50°C for 15 min, cooled at room temperature, and then annealed to obtain a product, which was freeze-dried to obtain a freeze-dried powder. The complex was diluted with ultrapure water (Milli-Q ultrapure water device, resistivity 18.2 MΩ*cm (25°C)) to a concentration of 0.2 mg / mL, and then the molecular weight was detected by a liquid chromatography mass spectrometer (LC-MS, Liquid Chromatography-Mass Spectrometry, purchased from Waters, model number: LCT Premier). The actual measured value was consistent with the theoretical value, indicating that the synthesized siRNA complex 1 was a double-stranded nucleic acid sequence of the intended design containing the L-9 complex molecule. Its structure is shown in formula (403), and the complexed siRNA sequence was a sequence corresponding to complex 1 (also called L10-siPCSKa1M1S) shown in Table 3.

[0416] (Preparation Example 2) Preparation of Complexes 2 to 7 Conjugates 2 to 7 shown in Table 3 were synthesized and molecular weight detection was performed in the same manner as in Preparation Example 1, except that the sense and antisense strand sequences were synthesized to be the sequences of the sense and antisense strands of the siRNA conjugated to Conjugate 2, Conjugate 3, Conjugate 4, Conjugate 5, Conjugate 6, or Conjugate 7 shown in Table 3. As a result, Conjugates 2 to 7 were obtained, respectively.

[0417] Table 3 shows the complex numbers and siRNA sequence compositions.

[0418] [Table 3]

[0419] (Preparation Example 3) Synthesis of siRNA sequence 1) For the sense strand, a general-purpose solid support (UnyLinker TM NittoPhase® HL Solid Supports (Kinovate Life Sciences) was used as the starting material. 2) For the antisense strand, the antisense strand of siRNA 1 has a 5'-phosphate at the first nucleotide of the 5'-end, compared with the antisense strand sequence of siRNA in which the sequence of siRNA 1 is conjugated to Conjugate 1. Therefore, in the process of preparing the antisense strand by the solid-phase phosphoramidite method, after the last nucleoside monomer of the antisense strand is bound, four reactions of deprotection, coupling, capping, and oxidation are carried out to bind the CPR-I monomer (Suzhou Jima, Cat#13-2601-XX) to the 5'-end of the antisense strand to form a 5'-phosphate ester modification, except that the siRNA 1 shown in Table 4 was synthesized by the same method as in Preparation Example 1.

[0420] [ka]

[0421] The conditions of deprotection, coupling, capping, oxidation reaction, cleavage and deprotection, purification and desalting used in the conjugation were the same as those used in the synthesis of the sense strand.

[0422] siRNA 2 was prepared in the same manner as siRNA 1, except that the nucleic acid sequences of the sense and antisense strands of siRNA were synthesized to be the sense and antisense strand sequences for siRNA 2 shown in Table 4, respectively, to obtain siRNA 2.

[0423] The nucleic acid sequences of the sense strand and antisense strand of siRNA were synthesized to be the sense strand and antisense strand sequences corresponding to siRNA 3, siRNA 4, siRNA 5, or siRNA 6 shown in Table 4, respectively. Since the first nucleotide at the 5'-end of the antisense strand of these siRNAs has a 5'-thiophosphate modification, when a CPR-I monomer is bound, the conditions of the sulfurization reaction were used instead of the above-mentioned oxidation reaction conditions, and siRNAs 3 to 6 were prepared by the same method as that for preparing siRNA 1, except that an antisense strand having a 5'-thiophosphate modification was obtained. As a result, siRNA 3, siRNA 4, siRNA 5, or siRNA 6, respectively, were obtained.

[0424] Table 4 shows the siRNA numbers and siRNA sequence compositions.

[0425] [Table 4]

[0426] (Experimental Example 1) Detection of siRNA suppression activity and off-target effects in the in vitro psiCHECK system

[0427] In this experimental example, the on-target activity and off-target effects of the siRNAs disclosed herein were evaluated by detecting the inhibition of expression of the target plasmid by the antisense strands of each of siRNAs 1 to 6, and the inhibition of expression of off-target plasmids by the sense strand, the seed region of the antisense strand, or the seed region of the sense strand of each siRNA in an in vitro psiCHECK system.

[0428] According to the method described in Kumico Ui-Tei et.al.,Functional dissection of siRNA sequence by systematic DNA substitution: modified siRNA with a DNA seed arm is a powerful tool for mammalian gene silencing with significantly reduced off-target effect. Nucleic Acids Research, 2008.36(7), 2136-2151, a test plasmid was constructed, and the test plasmid and test siRNA were co-transfected into HEK293A cells, and the expression level of the dual luciferase reporter gene reflected the on-target activity and off-target effect of siRNA. The specific steps are as follows.

[0429] [1] Construction of test plasmids

[0430] psiCHECK TM -2(Promega TM ) plasmid was used to construct four test plasmids, among which GSCM represented the on-target plasmid, and PSCM, GSSM, and PSSM represented the off-target plasmids.

[0431] (1) GSCM is used to detect the on-target activity of the antisense strand of siRNA, and contains a target sequence that includes a region that is completely complementary to the antisense strand sequence of the test siRNA, and the target sequences in GSCM corresponding to siRNAs 1, 2, 4, 5 and 6 are shown in SEQ ID NO: 373. 5'-GGCGTGCCTGCCAAGCTCACACAGCAGGAACTGAGCCAGAAACGCAGATTGGGCTGGCTCTGAAGCCAAGCCTCTTCTTACTTCACCCGGCTGGGCTCCTCATTTTTACGGGTAACAGTGAGG CTGGGAAGGGGAACACAGACCAGGAAGCTCGGTGAGTGATGGCAGAACGATGCCTGCAGGCATGGAACTTTTTCCGTTATCACCCAGGCCTGATTCACTGGCCTGGCGGAGATGCTTCTAAGGCATG GTCGGGGGAGAGGGCCAACAACTGTCCCTCCTTGAGCACCAGCCCCACCCAAGCAAGCAGACATTTATCTTTTGGGTCTGTCCTCTCTGTTGCCTTTTTACAGCCAACTTTTCTAGACCTGTTTTG CTTTTGTAACTTGAAGATATTTATTCTGGGTTTTGTAGCATTTTTATTAATATGGTGACTTTTTAAAATAAAAACAAACAAACGTTGTCCTAACAAAAAAAAAAAAAAAAAAAAA-3' (SEQ ID NO: 373)

[0432] The target sequence in GSCM corresponding to siRNA 3 is shown in SEQ ID NO:374. 5'--3' (SEQ ID NO:374)

[0433] (2) PSCM was used to detect off-target effects of the sense strand and contained target sequences that perfectly matched the antisense strand sequences of the test siRNAs. The target sequences in the PSCM corresponding to each siRNA are shown in Table 5a.

[0434] [Table 5a]

[0435] (3) GSSM was used to detect off-target effects of the seed region of the antisense strand, and the target sequences in the GSSM corresponding to each siRNA are shown in Table 5b.

[0436] [Table 5b]

[0437] (4) PSSMs were used to detect off-target effects in the seed region of the sense strand, and the target sequences in the PSSMs corresponding to each siRNA are shown in Table 5c.

[0438] [Table 5c]

[0439] psiCHECK each single copy of the above target sequence TM The fragment was cloned into the Xho I / Not I sites of the -2 plasmid.

[0440] [2] Cell culture and transfection (1) Cotransfection of GSCM and siRNA 1 HEK293A cells (purchased from Nanjing Kebai Biotechnology Co., Ltd.) were cultured in H-DMEM complete medium (HyClone) containing 10% fetal bovine serum (FBS, HyClone) and 0.2% by volume of penicillin-streptomycin (HyClone) at 37°C in an incubator containing 5% CO2 / 95% air.

[0441] 8 × 10 HEK293A cells 3 Cells were seeded into a 96-well plate at 100 cells / well. After 16 h, when the cell growth density reached 70-80%, the complete H-DMEM medium in the culture wells was aspirated off, and 80 μl of Opti-MEM medium (GIBCO) was added per well. Culture was continued for 1.5 h.

[0442] The GSCM test plasmid was diluted with DEPC-treated water to prepare a 200ng / μl test plasmid working solution. Using DEPC-treated water, 11 types of siRNA working solutions with concentrations of 1000nM, 333nM, 111nM, 37.0nM, 12.3nM, 4.12nM, 1.37nM, 0.46nM, 0.15nM, 0.05nM, and 0.017nM were prepared from siRNA 1.

[0443] Solutions A1 to A11 were prepared, each of which contained 1 μl of the 11 concentrations of siRNA diluted standard solution, 0.05 μl of the test plasmid diluted standard solution (containing 10 ng of the test plasmid), and 10 μl of Opti-MEM medium, respectively.

[0444] Prepare solution B. Add 0.2 μl of Lipofectamine to each solution B. TM 2000 and 10 μl of Opti-MEM medium.

[0445] Solution C was prepared, and each solution C contained 0.05 μl of the test plasmid dilution standard solution (containing 10 ng of the test plasmid) and 10 μl of Opti-MEM medium.

[0446] One solution B was mixed with each of solutions A1 to A11 and one solution C in order, and incubated at room temperature for 20 minutes to obtain 12 transfection complexes X1 to X12. Each transfection complex was prepared in triplicate.

[0447] The transfection complexes X1 to X11 were added to the culture wells at a volume of 20 μl / well, respectively, and mixed uniformly. The three transfection complexes with the same siRNA concentration were added to three different culture wells, respectively, to obtain co-transfection mixtures with final siRNA concentrations of 10 nM, 3.33 nM, 1.11 nM, 0.37 nM, 0.123 nM, 0.0412 nM, 0.0137 nM, 0.0046 nM, 0.0015 nM, 0.0005 nM, and 0.00017 nM, respectively, which were designated as test groups 1 to 11.

[0448] To another three culture wells, transfection complex X12 was added at a dosage of 20 μl / well, respectively, to obtain a transfection mixture without siRNA, which served as a control group.

[0449] After the co-transfection mixture with siRNA and the transfection mixture without siRNA were transfected into the culture wells for 4 h, 100 μl of H-DMEM complete medium containing 20% ​​FBS was added per well. The 96-well plate was placed in a CO2 incubator and cultured for 24 h.

[0450] (2) Cotransfection of other siRNAs and plasmids GSCM and siRNAs 2 to 6 were cotransfected in the same manner as GSCM and siRNA 1, except that siRNAs 2 to 6 were used in sequence instead of siRNA 1.

[0451] PSCM and siRNA 1 to 6 were cotransfected in the same manner as for cotransfection of GSCM and siRNA 1 to 6, except that PSCM was used instead of GSCM.

[0452] GSSM and siRNA 1 to 6 were cotransfected in the same manner as for cotransfection of GSCM and siRNA 1 to 6, except that GSSM was used instead of GSCM.

[0453] PSSM and siRNA 1 to 6 were cotransfected in the same manner as for cotransfection of GSCM and siRNA 1 to 6, except that PSSM was used instead of GSCM.

[0454] [3] Detection The medium in the culture wells was removed by suction, and 150 μl of a mixture of Dual-Glo® Luciferase Reagent and H-DMEM (volume ratio 1:1) was added to each well, mixed thoroughly until homogenous, and incubated at room temperature for 10 minutes. Then, 120 μl of the mixture was transferred to a 96-well ELISA plate, and the Firefly chemiluminescence value (Fir) in each well of the ELISA plate was read using a Synergy II multifunction microplate reader (BioTek). Stop & Glo (registered trademark) reagent was added, mixed thoroughly until homogenous, and incubated at room temperature for 10 minutes. The chemiluminescence value (Ren) of Renilla in each well of the ELISA plate was then read using a microplate reader according to the arrangement of the Fir readings.

[0455] The emission ratio Ratio = Ren / Fir of each well of the ELISA plate is calculated, and the emission ratio Ratio (test) or Ratio (control) of each test group or control group is the average of the Ratios of three culture wells. The emission ratio of each test group is normalized based on the emission ratio of the control group to obtain the ratio Ratio (test) / Ratio (control), which represents the expression level of the Renilla reporter gene, i.e., the relative residual activity. The inhibition rate of siRNA is (1-R) ​​x 100%.

[0456] After transfection with different siRNAs (siRNA 1, siRNA 2, siRNA 3, siRNA 4, siRNA 5, or siRNA 6), the relative remaining activity of the reporter gene Renilla in the psiCHECK system was fitted with the nonlinear regression analysis function of Graphpad 5.0 software to obtain a dose-effect curve of log(inhibitor) vs. response-variable slope (four parameters). Figures 1A-1F show the dose-effect curves of siRNAs 1-6, respectively. Here, the logarithmic value of the siRNA concentration (lg nM) is the abscissa, the relative remaining activity of Renilla (%) is the ordinate, and each black circle represents the average of the relative remaining activity of Renilla in three culture wells of the test group compared to the control group.

[0457] From the fitted dose-effect curve, the IC 50 The value was calculated.

[0458]

number

[0459] From the dose-effect curve and the corresponding function, the corresponding X when Y=50% is 50 Determine IC values ​​for each siRNA 50 Value=10^X 50 (nM) was calculated and IC 50 Value and R 2 The values ​​are summarized in Table 6.

[0460] [Table 6]

[0461] As can be seen from Table 6 and Figures 1A to 1F, the siRNAs provided by the present disclosure have high inhibitory activity in HEK293A cells in vitro and IC 50 was 0.0194-0.0561 nM.

[0462] Except for using PSCM, GSSM, and PSSM instead of GSCM, dose-effect curves for PSCM, GSSM, and PSSM corresponding to siRNAs 1 to 6 were obtained in sequence by the same method as above. As can be seen from the results, each siRNA had no inhibitory effect on the corresponding off-target plasmids PSCM, GSSM, and PSSM at each concentration.

[0463] The above results demonstrate that the siRNAs of the present disclosure have high target specificity, and that the sense strand, the seed region of the antisense strand, and the seed region of the sense strand all had no significant off-target effects.

[0464] (Experimental Example 2) Efficacy evaluation of siRNA complex in non-human primates (NHP) Three to four year old normal cynomolgus monkeys (body weight 2.4-3.1 kg) were divided into two groups of four monkeys based on body weight, half of which were female and half were male. Each group was administered a single dose of Complex 4 or 5 by subcutaneous injection.

[0465] Normal cynomolgus monkeys aged 4 to 5 years (body weight: 4.0 to 5.5 kg) were divided into three groups (3 animals per group) based on body weight, and all males in each group were administered a single dose of Complex 1, 2 or 7 by subcutaneous injection.

[0466] Each complex was dissolved in sterile sodium chloride injection at 9 mg / ml (as siRNA, the same applies below) and administered to each animal at a volume of 1 ml / kg and a dose of 9 mg / kg. The n days before administration were defined as Dn, the day of administration was defined as D1, and the nth day after administration was defined as Dn.

[0467] (2-1) Detection of PCSK9 mRNA in liver tissue On D-7 and D15, liver puncture was performed on the cynomolgus monkeys administered Complex 1, Complex 2, Complex 4, Complex 5, or Complex 7 in each group, and liver tissue was removed in a size of approximately 2 × 2 × 8 mm each time. 3 The tissue was collected, stored in a 1.5 mL sterile EP tube containing 1 mL of RNAlater storage solution (Sigma Aldrich), and allowed to stand in a refrigerator at 4°C for 24 hours, after which it was transferred to -80°C for storage.

[0468] Thereafter, the liver tissue was homogenized using a tissue homogenizer, and further extracted using Trizol (Thermo Fisher) according to the total RNA extraction operating steps described in the manufacturer's instructions, to obtain total RNA from the liver tissue.

[0469] For each animal, 1 μg of total RNA was used as a template for reverse transcription using the Goldenstar Reverse Transcription Kit. TM The reagents provided by the RT6 cDNA Synthesis Kit (purchased from Beijing Chinke New Biotechnology Co., Ltd., No. TSK301M) were used. TM Oligo (dT) 17 was selected as a primer, and 20 μl of the reverse transcription reaction system was prepared according to the reverse transcription operation procedure in the kit instruction manual, and reverse transcription was performed on the total RNA of each liver. As the reverse transcription conditions, each reverse transcription reaction system was incubated at 50°C for 50 min, then at 85°C for 5 min, and finally at 4°C for 30 s. After the reaction was completed, 80 μl of DEPC-treated water was added to each reverse transcription reaction system to obtain a solution containing cDNA.

[0470] For each reverse transcription reaction system, 5 μl of the solution containing the above cDNA was used as a template for qPCR, and 20 μl of qPCR reaction system was arranged using the reagents provided by NovoStart® SYBR qPCR SuperMix Plus kit (purchased from Kinki Protein Technology Co., Ltd., No. E096-01B). Here, the PCR primer sequences for amplifying the target gene PCSK9 and the endogenous reference gene GAPDH are shown in Table 7. The final concentration of each primer was 0.25 μM. Each qPCR reaction system was placed in an ABI StepOnePlus Real-Time PCR device and amplification was performed in a three-step method, and the amplification procedure was performed by pre-denaturing at 95 ° C for 10 min, denaturing at 95 ° C for 30 s, annealing at 60 ° C for 30 s, and elongating at 72 ° C for 30 s. After repeating the above denaturation, annealing, and elongation processes a total of 40 times, a product W containing the amplified target gene PCSK9 and the endogenous reference gene GAPDH was obtained. Immediately after that, product W was incubated at 95°C for 15 s, 60°C for 1 min, and 95°C for 15 s, and the melting curves of the target gene PCSK9 and the endogenous reference gene GAPDH in product W were obtained using a real-time fluorescent quantitative PCR device, and the Ct values ​​of the target gene PCSK9 and the endogenous reference gene GAPDH were obtained.

[0471] [Table 7]

[0472] Using the comparative Ct (ΔΔCt) method, relative quantitative calculation was performed for the expression levels of the target gene PCSK9 in D15 and D-7, and the calculation method is as follows: ΔCt(D15)=Ct(D15 gene of interest)-Ct(D15 endogenous reference gene) ΔCt(D-7)=Ct(D-7 gene of interest)-Ct(D-7 endogenous reference gene) ΔΔCt(D15)=ΔCt(D15)-ΔCt(D-7 average) ΔΔCt(D-7)=ΔCt(D-7)-ΔCt(D-7 average)

[0473] Here, ΔCt(D-7 mean) is the arithmetic mean of ΔCt(D-7) for each animal before administration. Therefore, each animal corresponds to one ΔΔCt(D15) and ΔΔCt(D-7).

[0474] D-7 of an animal was used as the reference and the D15 PCSK9 mRNA expression level of that animal was normalized, with the D-7 PCSK9 mRNA expression level defined as 100%.

[0475] Relative expression level of PCSK9 mRNA = 2^(-ΔΔCt(D15)) × 100% Inhibition rate of PCSK9 mRNA by the complex = (1-2^(-ΔΔCt(D15))) × 100%

[0476] For groups administered the same complex, the inhibition rate of PCSK9 mRNA by the complex is the arithmetic mean of the corresponding inhibition rates for each animal in the group.

[0477] The inhibition rate of hepatic PCSK9 mRNA by each complex is shown in Table 8.

[0478] [Table 8]

[0479] As can be seen from Table 8, after a single administration of 9 mg / kg, the inhibition rates of PCSK9 mRNA by the siRNA complexes were higher than 56% on the 15th day after administration compared to the 7th day before administration, and in particular, the inhibition rates of PCSK9 mRNA in NHP liver tissue by complex 1 and complex 4 reached 79% and 81%, respectively.

[0480] (2-2) Detection of PCSK9 protein content in serum For NHPs administered Complex 4, venous blood was collected once on D-15, D-9, and D1 before administration, and once on D3, D8, D14, D22, and D29 after administration, and then once a week for 18 weeks until D127.

[0481] For NHPs administered with Complex 1 or 7, venous blood was collected once on D-14, D-7, and D1 before administration, and once on D4, D8, D15, D22, and D29 after administration, and then once a week for 12 weeks until D85.

[0482] For each sample obtained, serum was isolated at room temperature.

[0483] (2-2-1) Detection of PCSK9 protein content in serum of cynomolgus monkeys administered Complex 4 Sera were selected from the mice on D-9, D8, D14, D85, D92, D99, D106, and D120 after administration of Complex 4. The serum obtained at each of the above time points was diluted 25-fold using Calibrator Diluent RD5P (1:5 dilution) reagent in the Human Proprotein Convertase 9 / PCSK9 Quantikine ELISA Kit (R&D Systems, USA, No. DPC900). The serum was then read using a fully automated microplate reader (SYNERGY ELISA Kit) according to the operating steps in the kit manual. TM The absorbance value of each diluted serum was detected at 450 nm using a 300 nm chromatograph (MX, Biotek). A standard curve was constructed from each dilution concentration of the standard in the kit and the corresponding absorbance value by the linear regression function of Graphpad 5.0 software, and the corresponding linear equation: Y = aX + b was obtained, where a is the slope of the fitted line, and b is the Y value (intercept) corresponding to when X = 0. The absorbance value of each diluted serum measured was substituted into the above equation, and the PCSK9 protein content in the diluted serum was calculated, and the PCSK9 protein content in the serum at each time point was obtained from the dilution factor. Normalized PCSK9 protein level = (Post-treatment PCSK9 protein content / Pre-treatment PCSK9 protein content) Inhibition rate of PCSK9 protein expression = (1-PCSK9 protein content after administration / PCSK9 protein content before administration) x 100%

[0484] Here, the pre-administration PCSK9 protein content is the PCSK9 protein content of D-9.

[0485] The PCSK9 protein content at each time point after administration was normalized based on pre-administration, and the pre-administration PCSK9 protein level was defined as 100% and represented as D0 in Figure 2. The normalized PCSK9 protein levels in serum at different time points after a single subcutaneous injection of 9 mg / kg of conjugate 4 in cynomolgus monkeys are shown in Figure 2.

[0486] (2-2-2) Detection of PCSK9 protein content in serum of cynomolgus monkeys administered Complex 1 or 7 The PCSK9 protein content in serum of cynomolgus monkeys administered with conjugate 1 or 7 was detected by the same method as in (2-2-1), except that (1) serum on D-14, D-7, D8, D15, D22, D29, D36, D43, D50, D57, D64 and D85 were selected, and (2) the PCSK9 protein content before administration was the arithmetic mean of the two PCSK9 protein contents on D-14 and D-7. After a single dose of 9 mg / kg of conjugate 1 or 7 was administered subcutaneously to cynomolgus monkeys, the normalized PCSK9 protein levels in serum at different time points were shown in Figure 2.

[0487] As can be seen from FIG. 2, on day 14 after a single administration, the inhibition rate of PCSK9 protein expression in NHP serum by complex 4 was higher than 90%, and up to 12 weeks after administration, the inhibition rate of PCSK9 protein expression by complex 4 was always maintained at 50% or higher.

[0488] After a single dose of complex 7, the inhibition rate of PCSK9 protein expression in NHP serum was 82% on day 22, and the inhibition rate of PCSK9 protein expression by complex 7 was maintained at 66% or higher up to 9 weeks after administration.

[0489] For complex 1, the inhibition rate of PCSK9 protein expression in NHP serum was 83% on day 15 after a single administration, and the inhibition rate of PCSK9 protein expression by complex 7 was always maintained at 65% or higher up to 7 weeks after administration.

[0490] (2-3) Detection of serum lipid (LDL-c and CHO) content (2-3-1) Detection of serum lipid (LDL-c and CHO) content in cynomolgus monkeys administered Complex 4 In (2-2), serum obtained at each time point after administration of Complex 4 was selected, and the serum lipid (LDL-c or CHO) content at each time point was detected using an LDL-C measurement kit (DENUO CH7538, Shanghai Zheng Biotechnology Co., Ltd.) or a CHOL measurement kit (DENUO CH7532, Shanghai Zheng Biotechnology Co., Ltd.) according to the operating instructions in the manual, using a fully automated biochemical analyzer (Hitachi 7060). Standardized lipid level = (post-treatment lipid content / pre-treatment lipid content) x 100% Lipid suppression rate = (1-lipid content after administration / lipid content before administration) x 100%

[0491] Here, the lipid content before administration is the arithmetic mean of the three lipids on D-15, D-9 and D1 before administration, and lipid refers to LDL-c or CHO.

[0492] The lipid content at each time point after administration was normalized based on the value before administration, and the lipid level before administration was defined as 100% and represented as D0 in Figures 3 and 4.

[0493] After a single subcutaneous injection of 9 mg / kg of Complex 4 to cynomolgus monkeys, the normalized LDL-c and normalized CHO levels in serum at different time points are shown in Figures 3 and 4, respectively.

[0494] (2-3-2) Detection of serum lipid (LDL-c and CHO) content in cynomolgus monkeys administered Complex 7 (1) In (2-2), serum obtained at each time point after administration of Complex 7 was selected and lipid detection was performed, and (2) lipid content (LDL-c and CHO) in serum of cynomolgus monkeys administered Complex 7 was detected by the same method as in (2-3-1), except that the lipid content before administration was the arithmetic mean of the three lipids on D-14, D-7, and D1 before administration. After a single administration of 9 mg / kg Complex 7 to cynomolgus monkeys by subcutaneous injection, the normalized LDL-c level and normalized CHO level in serum at different time points are shown in Figure 3 and Figure 4, respectively.

[0495] As can be seen from FIG. 3, from the 14th day after a single administration, complex 4 showed a significant suppression of LDL-c. In particular, on the 22nd day after administration, the suppression rate of LDL-c by complex 4 was as high as 64%, and from the 2nd week to the 11th week after administration, the suppression rate of LDL-c by complex 4 was always maintained at 50% or more. Over a long observation period of 127 days, the serum LDL-c level of NHPs administered complex 4 was always lower than before administration.

[0496] For complex 7, the LDL-c suppression rate was 36% on the 22nd day after a single dose. From the 2nd to 4th week after administration, the LDL-c suppression rate was maintained at about 30%. Over a long observation period of 11 weeks, the serum LDL-c levels of NHPs administered complex 7 were always lower than those before administration.

[0497] As can be seen from FIG. 4, from the 14th day after a single administration, complex 4 also showed significant inhibition of CHO. In particular, on the 22nd day after administration, the CHO inhibition rate by complex 4 was 38%, and from the 2nd week to the 8th week after administration, the CHO inhibition rate by complex 4 was always maintained at 30% or more. During the long observation period of 127 days, the serum CHO level of NHPs administered complex 4 was always lower than before administration.

[0498] For complex 7, on the 22nd day after a single administration, the inhibition rate of CHO was 38%. From the second week to the eighth week after administration, the inhibition rate of CHO was basically maintained at 30% or more. During the long observation period of 11 weeks, the serum CHO level of the NHP administered with complex 7 was always lower than that before administration.

[0499] (2-4) Detection of blood routine and coagulation function before and after liver puncture Before and after liver puncture, venous blood sampling was performed on the animals administered with complex 4 or 5. Blood routine and coagulation function were detected using a fully automatic five-category blood analyzer (ADVIA 2120 / ADVIA 2120i, Siemens, Germany) and a fully automatic blood coagulation analyzer (CA-7000 / CS-2000i, Sysmex Corporation), respectively. As can be seen from the results, after administration, there was no significant difference in the effects of each complex on blood routine and coagulation function compared with before administration, indicating the high biological safety of the siRNA complex provided by the present disclosure.

[0500] (Experimental Example 3) Evaluation of the toxicity of siRNA complex in rats / mice In this experimental example, the clinical toxic reactions of rats or mice administered with complex 1, 4, or 7 were observed, and indicators such as liver weight, blood routine, blood biochemistry, and lipids were detected. Gross dissection and histopathological examinations were performed to evaluate the toxic reactions of the siRNA complex of the present disclosure in small animals in vivo.

[0501] (3-1) Evaluation of rat toxicity (3-1-1) Detection of the toxicity of SD rats administered with complex 1 or 4 SPF-level SD rats aged 6-9 weeks and weighing 210-250 g (purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd., license number: SCXK (Jing) 2016-0011 or SCXK (Jing) 2016-0006, both males) were selected, divided into 3 groups of 5 animals per group according to body weight, and subcutaneously injected with complex 1, complex 4, or 1×PBS (pH 7.4) control, respectively. The dosage was calculated based on body weight. Each complex was made into a 60 mg / ml solution with 1×PBS (pH 7.4), the administration volume was 5 ml / kg, and the dosage was 300 mg / kg.

[0502] After a single subcutaneous administration, the following indicators were detected: (1) Routine observation: Routine observation was conducted twice a day. (2) Body weight: Body weight was measured on D1 before administration, on D3, D6, D10, D14 after administration, and on D15, the day of dissection. (3) Food intake: Food intake was measured on D2-3, D6-7, and D12-13. (4) Hematology: On Day 15 before dissection, 1.9 mL of blood was collected from the abdominal artery of each rat. 1.0 mL of the blood sample was treated with EDTA-K2 to prevent coagulation. The whole blood was directly sampled to detect the following blood cytological indices, including red blood cell count (RBC), white blood cell count (WBC), platelet count (PLT), hemoglobin (HGB), hematocrit value (HCT), mean corpuscular volume (MCV), mean corpuscular hemoglobin (MCH), mean corpuscular hemoglobin concentration (MCHC), reticulocyte count (RET), reticulocyte ratio (RET%), neutrophil (NEU) number and ratio, lymphocyte (LYM) number and ratio, monocyte (MONO) number and ratio, eosinophil (EOS) number and ratio, and basophil (BASO) number and ratio. The remaining 0.9 mL of blood sample was treated with sodium citrate to prevent coagulation, and centrifuged at 15 to 25°C and 1,800 x g for 10 minutes to isolate plasma, which was then used to detect clotting times (prothrombin time (PT) and activated partial thrombin time (APTT)). (5) Blood biochemistry: 0.6 ml of blood was collected from the jugular vein of the rats on D2 after administration, and 3 ml was collected from the abdominal main artery of the rats before dissection on D15. Neither sample was used to prevent coagulation. The samples were centrifuged at 15-25°C and 1800×g for 10 minutes, and serum was isolated and analyzed for alkaline phosphatase (ALP), alanine aminotransferase (ALT), aspartate aminotransferase (AST), creatine kinase (CK), lactate dehydrogenase (LDH), gamma-glutamyltransferase (GGT), urea, creatinine, sodium ion concentration (Na + ), potassium ion concentration (K + ), chloride ion (Cl -The blood biochemistry indices were detected, including blood glucose (GLU), total bilirubin (TBIL), total protein (TP), albumin (ALB) and albumin / globulin ratio (A / G). (6) Gross dissection and histopathological examination: On D15, the animals were dissected, each organ was weighed, and a histopathological examination was performed.

[0503] (3-1-2) Detection of toxicity in SD rats administered complex 7 The toxicity of SD rats administered with complex 7 was detected by the same method as in (3-1-1), except that complex 7 was used instead of complex 4, complex 7 was dissolved in 1xPBS (pH 7.4) at 20mg / ml and 6mg / ml, respectively, the administration volume was 5ml / kg, and the administration amount was 100mg / kg and 30mg / kg, respectively. Regarding the index (5) blood biochemistry, blood was collected before dissection on D8 and D15 after administration, respectively.

[0504] As can be seen from the results, none of the complexes showed any significant toxicity in rats.

[0505] (3-2) Evaluation of toxicity in mice Five to six week old SPF level ICR mice (purchased from Sibaifu (Beijing) Biotechnology Co., Ltd.) were selected, half female and half male, 10 mice per group, and Complex 1, Complex 4 or Complex 7 were subcutaneously injected. The administration frequency was once a week for two consecutive weeks, a total of three times, on D1, D8 and D15, respectively. The dosage was calculated from the body weight, and each complex was dissolved in 1xPBS (pH 7.4) at 30mg / ml, the administration volume was 10ml / kg, and the dosage was 300mg / kg.

[0506] After three doses, the following indicators were detected: (1) Routine observation: Routine observation was performed once a day. (2) Body weight: Body weight was measured on D1, D8, and D15 before administration and on the day of dissection, D16. (3) Food intake: Measured once a week. (4) Blood biochemistry: On the day of dissection, the eyeballs were removed and 1 ml of blood was collected without preventing coagulation. The blood was first incubated at 37°C for 60 min, and then centrifuged at 4°C and 3000 rpm for 15 min to obtain serum. Blood biochemistry was then performed, and the detection indexes were the same as those in the blood biochemistry indexes used in the detection of toxicity in rats. (5) Gross dissection and histopathological examination: On D16, the animals were dissected, each organ was weighed, and a histopathological examination was performed.

[0507] As can be seen from the results, none of the complexes showed any significant toxicity in mice.

[0508] The above results demonstrated that the complex of the present disclosure has high biological safety.

[0509] Although several embodiments of the present disclosure have been described in detail above, the present disclosure is not limited to the specific details of the above embodiments. Within the scope of the technical idea of ​​the present disclosure, several simple modifications may be made to the technical solutions of the present disclosure, and all of these simple modifications fall within the protection scope of the present disclosure.

[0510] It should also be noted that the specific technical features described in the above embodiments may be combined in any suitable manner if there is no contradiction, and in order to avoid unnecessary duplication, the present disclosure does not separately describe various possible combination methods.

[0511] Furthermore, various different embodiments of the present disclosure can be arbitrarily combined, and such combinations should also be considered as being disclosed in the present disclosure, unless they deviate from the spirit of the present disclosure.

Claims

1. An siRNA complex that suppresses expression of the PCSK9 gene in hepatocytes, The siRNA conjugate has the structure shown in formula (308): 【Chemistry 1】 During the ceremony, n1 is an integer selected from 1 to 2, n3 is an integer selected from 0 to 1, and n1+n3=2 to 3; Each m1, m2, or m3 is independently an integer selected from 2 to 10; R １０ , R １１ , R １２ , R １３ , R １４ Or R １５ are each independently H and are selected from the group consisting of a methyl group or an ethyl group; R ３ is a group having the structure shown in formula A59, 【Chemistry 2】 In the formula, E １ is OH, SH or BH ２ and Nu is an siRNA, the siRNA comprising a sense strand and an antisense strand, each nucleotide of the siRNA being independently modified or unmodified; the sense strand and the antisense strand have the same or different lengths; the sense strand has a length of 19-23 nucleotides and the antisense strand has a length of 19-26 nucleotides; The sense strand comprises a nucleotide sequence I, and the antisense strand comprises a nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II form a double-stranded region that is substantially reverse-complementary or completely reverse-complementary, and the nucleotide sequence I and the nucleotide sequence II are one selected from the sequences shown in i) to vi) below: i) said nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO:1 are equal in length and have no more than one nucleotide difference, and said nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 are equal in length and have no more than one nucleotide difference; 5'-AAGCAAGCAGACAUUUAUZ １ -3' (SEQ ID NO:1), 5'-Z ２ AUAAAUGUCUGCUUGCUUGCUU-3' (SEQ ID NO: 2) However, Z １ is C, and Z ２ is G, and in said nucleotide sequence I, position Z １ Nucleotide Z corresponding to ３ and in said nucleotide sequence II, position Z ２ Nucleotide Z corresponding to ４ and Z ４ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:2 is at position Z 4 , where Z 4 is selected from A, U, or C; ii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 61 are equal in length and have no more than one nucleotide difference, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 62 are equal in length and have no more than one nucleotide difference; 5'-UUUGUAGCAUUUUUAUUAZ ５ -3' (SEQ ID NO:61), 5'-Z ６ UAAUAAAAAAUGCUACAAA-3' (SEQ ID NO:62) However, Z ５ is A and Z ６ is U, and in said nucleotide sequence I, position Z ５ Nucleotide Z corresponding to ７ and in said nucleotide sequence II, position Z ６ Nucleotide Z corresponding to ８ and Z ８ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:62 is at position Z 8 , where Z 8 is selected from A, C, or G; iii) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 121 are equal in length and have no more than one nucleotide difference, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 122 are equal in length and have no more than one nucleotide difference; 5'-GCCUGGAGGUUUAUUCGGAZ ９ -3' (SEQ ID NO: 121), 5'-Z １０ UCCGAAUAAACUCCAGGC-3 '(SEQ ID NO: 122) However, Z ９ is A and Z １０ is U, and in said nucleotide sequence I, position Z ９ Nucleotide Z corresponding to １１ and in said nucleotide sequence II, position Z １０ Nucleotide Z corresponding to １２ and Z １２ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:122 is at position Z 12 , where Z 12 is selected from A, C, or G; iv) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 181 are equal in length and have no more than one nucleotide difference, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 182 are equal in length and have no more than one nucleotide difference; 5'-CUGUUUUGCUUUUGUAACZ １３ -3' (SEQ ID NO: 181), 5'-Z １４ GUUACAAAGCAAAACAG-3' (SEQ ID NO: 182) However, Z １３ is U and Z １４ is A, and in said nucleotide sequence I, position Z １３ Nucleotide Z corresponding to １５ and in said nucleotide sequence II, position Z １４ Nucleotide Z corresponding to １６ and Z １６ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO:182 is at position Z 16 , where Z 16 is selected from U, C, or G; v) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 241 are equal in length and have no more than one nucleotide difference, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 242 are equal in length and have no more than one nucleotide difference; 5'-GGUUUUGUAGCAUUUUAZ １７ -3' (SEQ ID NO: 241), 5'-Z １８ UAAAAAAUGCUACAAAACC-3' (SEQ ID NO: 242) However, Z １７ is U and Z １８ is A, and in said nucleotide sequence I, position Z １７ Nucleotide Z corresponding to １９ and in said nucleotide sequence II, position Z １８ Nucleotide Z corresponding to ２０ and Z ２０ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:242 is at position Z20, where Z20 is selected from U, C, or G; vi) the nucleotide sequence I and the nucleotide sequence shown in SEQ ID NO: 301 are equal in length and have no more than one nucleotide difference, and the nucleotide sequence II and the nucleotide sequence shown in SEQ ID NO: 302 are equal in length and have no more than one nucleotide difference; 5'-GUGACUUUUUAAAAAAAZ ２１ -3' (SEQ ID NO: 301), 5'-Z ２２ UUUAUUUUAAAAAAGUCAC-3' (SEQ ID NO: 302) However, Z ２１ is A and Z ２２ is U, and in said nucleotide sequence I, position Z ２１ Nucleotide Z corresponding to ２３ and in said nucleotide sequence II, position Z ２２ Nucleotide Z corresponding to ２４ and Z ２４ is the first nucleotide at the 5' end of the antisense strand, and the nucleotide difference between nucleotide sequence II and the nucleotide sequence set forth in SEQ ID NO:302 is at position Z24, where Z24 is selected from A, C, or G; R ２ is a straight chain alkylene group of 1 to 20 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenylene group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １８ Heterocyclylene group and C ５ -C １０ heteroarylene groups; R ２ is C １ -C １０ Alkyl group, C ６ -C １０ Aryl group, C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, —OC １ -C １０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-OH, -OC １ -C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alkyl-NH ２ , -N(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ alkylphenyl group), -NH(C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C(O)O(C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -CONH(C １ -C １０ alkyl group), -CONH ２ , -NHC(O)(C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ alkyl group)C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ alkyl group)C(O)(phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ -C １０ Alkylphenyl group, —C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group, -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ alkyl group), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ alkyl group), -NHSO ２ (phenyl group) and -NHSO ２ (C １ -C １０ halogenated alkyl groups), Each L １ are each independently a straight chain alkylene group of 1 to 70 carbon atoms in length, one or more of which is selected from the group consisting of C(O), NH, O, S, CH=N, S(O) ２ , C ２ -C １０ Alkenylene group, C ２ -C １０ Alkynylene group, C ６ -C １０ Arylene group, C ３ -C １８ Heterocyclylene group and C ５ -C １０ heteroarylene groups; L １ is C １ -C １０ Alkyl group, C ６ -C １０ Aryl group, C ５ -C １０ Heteroaryl group, C １ -C １０ Halogenated alkyl group, -OC １ -C １０ Alkyl group, -OC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-OH, -OC １ -C １０ Halogenated alkyl group, -SC １ -C １０ Alkyl group, -SC １ -C １０ Alkylphenyl group, -C １ -C １０ Alkyl-SH, -SC １ -C １０ Halogenated alkyl groups, halogen substituents, -OH, -SH, -NH ２ , -C １ -C １０ Alkyl-NH ２ , -N(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -NH(C １ -C １０ alkyl group), -N(C １ -C １０ Alkyl group) (C １ -C １０ alkylphenyl group), -NH(C １ -C １０ alkylphenyl group), cyano group, nitro group, -CO ２ H, -C(O)O(C １ -C １０ alkyl group), -CON(C １ -C １０ Alkyl group) (C １ -C １０ alkyl group), -CONH(C １ -C １０ alkyl group), -CONH ２ , -NHC(O)(C １ -C １０ -NHC(O) (phenyl group), -N(C １ -C １０ alkyl group)C(O)(C １ -C １０ alkyl group), -N(C １ -C １０ alkyl group)C(O)(phenyl group), -C(O)C １ -C １０ Alkyl group, -C(O)C １ -C １０ Alkylphenyl group, —C(O)C １ -C １０ Haloalkyl groups, —OC(O)C １ -C １０ Alkyl group, -SO ２ (C １ -C １０ alkyl group), -SO ２ (phenyl group), -SO ２ (C １ -C １０ halogenated alkyl group), -SO ２ N.H. ２ , -SO ２ NH (C １ -C １０ alkyl group), -SO ２ NH (phenyl group), -NHSO ２ (C １ -C １０ alkyl group), -NHSO ２ (phenyl group) and -NHSO ２ (C １ -C １０ halogenated alkyl groups), 【change】 represents the site at which a group is covalently attached, M １ represents the targeting group, siRNA conjugate.

2. Each L １ is independently selected from the group consisting of groups (A1) to (A26), and any combination thereof; 【Chemistry 3】 wherein each j1 is independently an integer from 1 to 20, and each j2 is independently an integer from 1 to 20; Each R' is independently C １ -C １０ is an alkyl group, Each Ra is independently selected from the group consisting of groups represented by formulas (A27) to (A45) or any combination thereof; 【Chemistry 4】 Each Rb is independently C １ -C １０ is an alkyl group, Or, L １ is one or a combination of multiple bonds selected from A1, A4, A5, A6, A8, A10, A11, and A13; Or, L １ is a combination of at least two bonds selected from A1, A4, A8, A10, and A11; Or, L １ is a combination of at least two bonds selected from A1, A8, and A10; Or, L １ is 3 to 25 atoms in length, Or, L １ is 4 to 15 atoms in length, 【change】 The siRNA conjugate of claim 1 , wherein represents the site to which the group is covalently attached.

3. The siRNA complex of claim 1, wherein each m1, m2 or m3 is independently an integer from 2 to 5, and / or m1 = m2 = m3.

4. each said targeting group is independently a ligand having affinity for an asialoglycoprotein receptor on the surface of a mammalian hepatocyte; Alternatively, each said targeting group is independently an asialoglycoprotein or a sugar; Alternatively, each of the targeting groups is selected from the group consisting of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, α-D-mannofuranose, β-D-mannofuranose, α-D-mannopyranose, β-D-mannopyranose, α-D-glucopyranose, β-D-glucopyranose, α-D-glucofuranose, β-D-glucofuranose, α-D-fructofuranose, α-D-fructopyranose, α-D-galactopyranose, β-D-galactopyranose, α-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyryl Galactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-glucopyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose, N-glycolyl-α-neuraminic acid, 5-thio-β-D-glucopyranose, methyl 2 , 3,4-tris-O-acetyl-1-thio-6-O-trityl-α-D-glucopyranoside, 4-thio-β-D-galactopyranose, ethyl 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-α-D-glucoheptopyranoside, 2,5-anhydro-D-allonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose; Alternatively, the siRNA conjugate of claim 1, wherein at least one or each of the targeting groups is galactose or N-acetylgalactosamine.

5. The siRNA conjugate of claim 1, having a structure as shown in formula (403), (404), (405), (406), (407), (408), (409), (410), (411), (412), (413), (414), (415), (416), (417), (418), (419), (420), (421) or (422). 【Chemistry 5】 【change】 【change】 【change】 【change】 【change】 【change】

6. The P atom in formula A59 is attached to the end of the sense strand or antisense strand of the siRNA, and the end refers to the previous 4 nucleotides from one end of the sense strand or antisense strand; Alternatively, the P atom in formula A59 is attached to the end of the sense strand or antisense strand of the siRNA, or the P atom in formula A59 is attached to the 3' end of the sense strand of the siRNA; Alternatively, the siRNA conjugate of claim 1, wherein the P atom in formula A59 is linked to the 2', 3' or 5' position of a nucleotide in the siRNA via a phosphodiester bond.

7. 2. The siRNA complex of claim 1, wherein the sense strand further comprises nucleotide sequence III and the antisense strand further comprises nucleotide sequence IV, wherein nucleotide sequence III and nucleotide sequence IV are each independently 1 to 4 nucleotides in length, wherein nucleotide sequence III is linked to the 5' end of nucleotide sequence I and nucleotide sequence IV is linked to the 3' end of nucleotide sequence II, wherein nucleotide sequence III and nucleotide sequence IV are equal in length and are substantially reverse complementary or completely reverse complementary, wherein substantially reverse complementary refers to the presence of no more than one base mismatch between the two nucleotide sequences and completely reverse complementary refers to the absence of mismatch between the two nucleotide sequences.

8. i) the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:3, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:4, the nucleotide sequences III and IV are each 1 nucleotide in length and the base of the nucleotide sequence III is C, or the nucleotide sequences III and IV are each 2 nucleotides in length and the base sequence of the nucleotide sequence III is CC from the 5' to the 3' end, or the nucleotide sequences III and IV are each 3 nucleotides in length and the base sequence of the nucleotide sequence III is CCC from the 5' to the 3' end, or the nucleotide sequences III and IV are each 4 nucleotides in length and the base sequence of the nucleotide sequence III is ACCC from the 5' to the 3' end, or ii) the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:63, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:64, the nucleotide sequences III and IV are each 1 nucleotide in length and the base of the nucleotide sequence III is U, or the nucleotide sequences III and IV are each 2 nucleotides in length and the base sequence of the nucleotide sequence III is GU from the 5' to the 3' end, or the nucleotide sequences III and IV are each 3 nucleotides in length and the base sequence of the nucleotide sequence III is GGU from the 5' to the 3' end, or the nucleotide sequences III and IV are each 4 nucleotides in length and the base sequence of the nucleotide sequence III is GGGU from the 5' to the 3' end, or iii) the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 123, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 124, the nucleotide sequences III and IV are each 1 nucleotide in length, and the base of the nucleotide sequence III is G, or the nucleotide sequences III and IV are each 2 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is AG, or the nucleotide sequences III and IV are each 3 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is UAG, or the nucleotide sequences III and IV are each 4 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is AUAG, or iv) the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 183, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 184, the nucleotide sequences III and IV are each 1 nucleotide in length, and the base of the nucleotide sequence III is C, or the nucleotide sequences III and IV are each 2 nucleotides in length, and from the 5' to the 3' end, the base sequence of the nucleotide sequence III is AC, or the nucleotide sequences III and IV are each 3 nucleotides in length, and from the 5' to the 3' end, the base sequence of the nucleotide sequence III is GAC, or the nucleotide sequences III and IV are each 4 nucleotides in length, and from the 5' to the 3' end, the base sequence of the nucleotide sequence III is AGAC, or v) the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO:243, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO:244, the nucleotide sequences III and IV are each 1 nucleotide in length, and the base of the nucleotide sequence III is G, or the nucleotide sequences III and IV are each 2 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is UG, or the nucleotide sequences III and IV are each 3 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is CUG, or the nucleotide sequences III and IV are each 4 nucleotides in length, and the base sequence of the nucleotide sequence III from the 5' to the 3' end is UCUG, or vi) The siRNA complex according to claim 7, wherein the nucleotide sequence I is the nucleotide sequence set forth in SEQ ID NO: 303, the nucleotide sequence II is the nucleotide sequence set forth in SEQ ID NO: 304, and the nucleotide sequences III and IV are each 1 nucleotide in length and the base of the nucleotide sequence III is G; or the nucleotide sequences III and IV are each 2 nucleotides in length and the base sequence of the nucleotide sequence III is UG from the 5' to the 3' end; or the nucleotide sequences III and IV are each 3 nucleotides in length and the base sequence of the nucleotide sequence III is AUG from the 5' to the 3' end; or the nucleotide sequences III and IV are each 4 nucleotides in length and the base sequence of the nucleotide sequence III is UAUG from the 5' to the 3' end.

9. 2. The siRNA complex of claim 1, wherein the antisense strand further comprises a nucleotide sequence V, the nucleotide sequence V being 1-3 nucleotides in length and attached to the 3' end of the antisense strand and constituting a 3' overhanging end of the antisense strand; or the nucleotide sequence V being 2 nucleotides in length; or the nucleotide sequence V being two consecutive thymine deoxyribonucleotides or two consecutive uracil ribonucleotides; or the nucleotide sequence V being complementary to a nucleotide at a corresponding position of a target mRNA.

10. Z 3 is a nucleotide complementary to Z 4 , or Z 7 is a nucleotide complementary to Z 8 ; or Z 11 is a nucleotide complementary to Z 12 , or Z 15 is a nucleotide complementary to Z 16 , or Z 19 is the complementary nucleotide to Z 20 ; or The siRNA conjugate of claim 1, wherein Z 23 is a nucleotide complementary to Z 24 .

11. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:6; or the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:7, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:8; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 65, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 66; or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 67, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 68; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 125, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 126; or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 127, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 128; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 185, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 186; or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 187, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 188; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 245, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 246; or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 247, and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 248; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 305 and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 306; or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 307 and the antisense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:

308. The siRNA complex of claim 1.

12. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:9, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:10; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 11, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 12; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 69, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 70; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 71, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 72; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 129, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 130; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 131, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 132; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 189, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 190; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 191, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 192; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 249, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 250; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 251, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 252; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 309, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 310; Alternatively, the siRNA complex of claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:311 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:

312.

13. each nucleotide in the sense strand and the antisense strand is independently a fluoro-modified nucleotide or a non-fluoro-modified nucleotide; Alternatively, the fluoro-modified nucleotides are located in nucleotide sequence I and nucleotide sequence II, and from the 5' to the 3' end, at least the 7th, 8th, and 9th nucleotides of nucleotide sequence I are fluoro-modified nucleotides, and from the 5' to the 3' end, at least the 2nd, 6th, 14th, and 16th nucleotides of nucleotide sequence II are fluoro-modified nucleotides; Alternatively, from the 5'-end to the 3'-end, in the sense strand, the nucleotides at positions 7, 8, 9 or 5, 7, 8, 9 of nucleotide sequence I are fluoro-modified nucleotides, and the remaining nucleotides in the sense strand are non-fluoro-modified nucleotides; and from the 5'-end to the 3'-end, in the antisense strand, the nucleotides at positions 2, 6, 14, 16 or 2, 6, 8, 9, 14, 16 of nucleotide sequence II are fluoro-modified nucleotides, and the remaining nucleotides in the antisense strand are non-fluoro-modified nucleotides.

14. each non-fluoro modified nucleotide is one independently selected from a nucleotide or nucleotide analog in which the hydroxy group at the 2' position of the ribose group of the nucleotide is replaced with a non-fluorine group; Alternatively, the nucleotide in which the hydroxy group at the 2' position of the ribose group of the nucleotide is substituted with a non-fluorine group is one selected from a 2'-alkoxy modified nucleotide, a 2'-substituted alkoxy modified nucleotide, a 2'-alkyl modified nucleotide, a 2'-substituted alkyl modified nucleotide, a 2'-amino modified nucleotide, a 2'-substituted amino modified nucleotide, and a 2'-deoxynucleotide, and the nucleotide analog is one selected from an isonucleotide, an LNA, an ENA, a cET, a UNA, and a GNA; Alternatively, the siRNA complex of claim 13, wherein each of the non-fluoro-modified nucleotides is a methoxy-modified nucleotide, and the methoxy-modified nucleotide refers to a nucleotide in which the 2'-hydroxy group of the ribose group is substituted with methoxy.

15. From the 5' to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides; from the 5' to the 3' end, the nucleotides at positions 2, 6, 8, 9, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides; Alternatively, from the 5' to the 3' end, the nucleotides at positions 5, 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides; and from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides; Alternatively, from the 5' to the 3' end, the nucleotides at positions 7, 8, and 9 of nucleotide sequence I in the sense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the sense strand of the siRNA are methoxy-modified nucleotides, and from the 5' to the 3' end, the nucleotides at positions 2, 6, 14, and 16 of nucleotide sequence II in the antisense strand of the siRNA are fluoro-modified nucleotides, and the nucleotides at the remaining positions of the antisense strand of the siRNA are methoxy-modified nucleotides. The siRNA complex of claim 1.

16. In the siRNA, at least one phosphate group is a thiophosphate group, the thiophosphate group being Between the first and second nucleotides from the 5' end of the sense strand, Between the second and third nucleotides from the 5' end of the sense strand, Between the first and second nucleotides from the 3' end of the sense strand, Between the second and third nucleotides from the 3' end of the sense strand, Between the first and second nucleotides from the 5' end of the antisense strand, Between the second and third nucleotides from the 5' end of the antisense strand, Between the first and second nucleotides from the 3' end of the antisense strand, and The siRNA complex according to claim 1, which is bound to at least one nucleotide selected from the group consisting of the second nucleotide and the third nucleotide from the 3' end of the antisense strand.

17. the 5'-terminal nucleotide of the antisense strand of the siRNA is a 5'-phosphate nucleotide or a 5'-phosphate analog-modified nucleotide; Alternatively, the 5'-phosphate nucleotide is a nucleotide having a structure represented by formula (2), and the 5'-phosphate analog modified nucleotide is selected from nucleotides having a structure represented by any one of formulas (3) to (6), 【Chemistry 6】 The siRNA complex of claim 1, wherein R is selected from H, OH, a methoxy group or fluorine, and Base represents a base and is selected from A, U, C, G or T.

18. The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 13, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 14; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 15, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 16; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 17, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 18; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 19, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 20; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 21, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 22; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 23, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 24; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 73, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 74; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 75, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 76; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 77, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 78; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 79, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 80; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 81, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 82; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 83, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 84; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 133, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 134; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 135, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 136; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 137, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 138; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 139, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 140; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 141, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 142; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 143, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 144; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 193, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 194; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 195, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 196; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 197, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 198; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 199, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 200; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 201, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 202; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 203, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:

204. Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 253, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 254; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 255, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 256; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 257, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 258; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 259, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 260; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 261, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 262; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 263, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 264; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 313, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 314; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 315, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 316; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 317, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 318; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 319, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 320; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 321, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 322; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 323 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 324; or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:25, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:26; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 27, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 28; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 29, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 30; Alternatively, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 31, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 32; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 33, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 34; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 35, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 36; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 85, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 86; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 87, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 88; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 89, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 90; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 91, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 92; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 93, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 94; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 95, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 96; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 145, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 146; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 147, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 148; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 149, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 150; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 151, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 152; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 153, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 154; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 155, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 156; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 205, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 206; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 207, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 208; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 209, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 210; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 211, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 212; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 213, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 214; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 215, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 216; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 265, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 266; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 267, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 268; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 269, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 270; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 271, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 272; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 273, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 274; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 275, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 276; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 325, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 326; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 327, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 328; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 329, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 330; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 331, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 332; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 333, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 334; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 335, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 336; or The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 37, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 38; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 39, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 40; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 41, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 42; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 43, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 44; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 45, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 46; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 47, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 48; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO: 49, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO: 50; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:51, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:53, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:54; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:55, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:56; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:57, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:58; Or, the sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:59, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:60; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 97, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 98; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 99, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 100; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 101, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 102; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 103, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 104; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 105, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 106; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 107, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 108; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 109, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 110; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 111, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 112; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 113, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 114; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 115, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 116; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 117, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 118; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 119, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 120; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 157, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 158; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 159, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 160; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 161, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 162; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 163, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 164; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 165, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 166; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 167, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 168; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 169, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 170; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 171, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 172; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 173, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 174; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 175, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 176; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 177, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 178; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 179, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 180; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 217, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 218; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 219, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 220; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 221, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 222; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 223, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 224; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 225, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 226; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 227, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 228; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 229, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 230; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 231, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 232; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 233, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 234; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 235, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 236; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 237, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 238; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 239, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 240; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 277, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 278; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 279, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 280; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 281, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 282; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 283, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 284; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 285, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 286; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 287, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 288; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 289, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 290; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:291, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:292; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 293, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 294; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:295, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:296; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO:297, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:298; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 299, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 300; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 337, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 338; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 339, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 340; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 341, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 342; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 343, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 344; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 345, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 346; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 347, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 348; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 349, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 350; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 351, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 352; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 353, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 354; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 355, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 356; Or, the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 357, and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO: 358; Or, the siRNA complex of claim 1, wherein the sense strand of the siRNA comprises the nucleotide sequence set forth in SEQ ID NO: 359 and the antisense strand comprises the nucleotide sequence set forth in SEQ ID NO:

360.

19. A composition for treating and / or preventing a disease or physiological condition caused by abnormal expression of the PCSK9 gene, comprising the siRNA complex according to any one of claims 1 to 18.

20. A composition for suppressing expression of the PCSK9 gene in liver cells, comprising the siRNA complex according to any one of claims 1 to 18.

Images