PAPD5 inhibitors and methods of use thereof

Abstract

The present application provides compounds that are PAPD5 inhibitors and are useful in the treatment of a variety of conditions, such as cancer, telomere diseases, and age-related and other degenerative disorders.

Description

[Technical Field]

[0001] Priority claims This application claims priority to U.S. Provisional Patent Application No. 62 / 952,775, filed December 23, 2019, and U.S. Provisional Patent Application No. 62 / 838,221, filed April 24, 2019, the entire contents of which are incorporated herein by reference.

[0002] Federally Sponsored Research and Development This invention was made with government support under Grant No. DK107716 awarded by the National Institutes of Health (NIH). The government has certain rights in this invention.

[0003] The present disclosure relates to compounds that inhibit PAP-association domain-containing 5 (PAPD5) and methods of using these compounds to treat conditions such as telomere diseases and age-related and other degenerative disorders. [Background technology]

[0004] Telomeres are regions of repeated nucleotide sequences at each end of chromosomes that protect the ends of chromosomes from degeneration or fusion with adjacent chromosomes. Telomere length is an important determinant of cellular self-renewal capacity. The telomerase ribonucleoprotein maintains telomere length in tissue stem cells, and its function is essential for human health and longevity.

[0005] Short telomeres, due to genetic or acquired insults, cause a loss of cellular self-renewal, resulting in life-threatening diseases for which there are few, if any, effective medical therapies. There is an unmet clinical need for new therapies in these diseases associated with short telomeres, such as aplastic anemia, pulmonary fibrosis, liver cirrhosis, and bone marrow failure. Summary of the Invention

[0006] Mutations in poly(A) ribonuclease (PARN) result in the accumulation of 3' oligoadenylated forms of nascent telomerase RNA component (TERC) RNA transcripts, which are targeted for destruction, and can therefore cause telomerase deficiency and telomere disease. Disruption of the non-canonical poly(A) polymerase PAP-associated domain-containing 5 (PAPD5; also known as topoisomerase-related function protein 4-2 (TRF4-2)) can restore TERC levels, telomerase activity, and telomere elongation in PARN-mutated patient cells. The present disclosure relates, at least in part, to PAPD5 inhibitors and methods of using such inhibitors.

[0007] In one general aspect, the disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof (wherein X 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R 8 is as described herein).

[0008] In another general aspect, the disclosure provides a compound of formula (II): [ka] or a pharmaceutically acceptable salt thereof (wherein X 1 , R 2 , R 3 , R 4 , R 5 , R 6 , R 7 , and R Cy is as described herein and W is, for example, a carboxylic acid bioisostere as described herein.

[0009] In yet another general aspect, the disclosure provides a compound of formula (III): [ka] or a pharmaceutically acceptable salt thereof (wherein X 1 , R 2 , R 3 , R 4 , R 6 , R 7 , W, and R Cy is as described herein, and R 5 is C(O)NR c1 R d1 , S(O)NR c1 R d1 , and Cy 1 Selected from R c1 , R d1 , and Cy 1 is as described herein).

[0010] In yet another general aspect, the disclosure provides a compound of formula (IV): [ka] or a pharmaceutically acceptable salt thereof (wherein X 1 , R 2 , R 3 , R 4 , R 6 , R 7 , W., R. a1 , and R Cy is as described herein).

[0011] In yet another general aspect, the disclosure provides a compound of formula (V): [ka] or a pharmaceutically acceptable salt thereof (wherein X 1 , R 2 , R 3 , R 4 , R 6 , R7 , W, and R Cy ) is provided.

[0012] In yet another general aspect, the disclosure provides a pharmaceutical composition comprising a compound of Formula (I), Formula (II), Formula (III), Formula (IV), or Formula (V), as described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

[0013] In yet another general aspect, the present disclosure provides a method for manufacturing a semiconductor device comprising: (a) treating a disorder associated with telomere or telomerase dysfunction in a subject; (b) treating an age-related disorder in a subject; (c) treating a pre-leukemia or pre-cancerous condition in a subject; (d) treating or preventing HBV infection in a subject; (e) treating or preventing a neurodevelopmental disorder in a subject; (f) treating an acquired or genetic disease or condition associated with an alteration of RNA in a subject; (g) decreasing PAPD5 activity in a subject; (h) inhibiting the production or secretion of HBsAg in a subject; (i) inhibiting HBV DNA production in a subject; (j) decreasing PAPD5 activity in cells; (k) inhibiting the production or secretion of HBsAg in cells; (l) inhibiting HBV DNA production in cells; (m) regulating non-coding RNA in cells; and (n) modulating ex vivo proliferation of stem cells; The method includes contacting the cell with an effective amount of a compound of Formula (I), Formula (II), Formula (III), Formula (IV), or Formula (V), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same, or administering a therapeutically effective amount of a compound of Formula (I), Formula (II), Formula (III), Formula (IV), or Formula (V), or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising same to a subject in need thereof.

[0014] In yet another general aspect, the disclosure provides a method of growing a cell, the method comprising culturing the cell in the presence of an effective amount of a compound described herein (e.g., a compound of Formula (I), (II), (III), (IV), or (V)), or a pharmaceutically acceptable salt thereof.

[0015] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this application belongs.Methods and materials for use in this application are described herein, and other suitable methods and materials known in the art can also be used.Materials, methods, and examples are merely illustrative and are not intended to be limiting.All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety.In case of conflict, the present specification, including definitions, will control.

[0016] Other features and advantages of the present application will be apparent from the following detailed description and drawings, and from the claims. [Brief explanation of the drawings]

[0017] [Figure 1] FIG. 1 is a schematic diagram showing an exemplary model for TERC 3′-end maturation by PARN. [Figure 2] FIG. 1 is a schematic diagram showing an exemplary model of the reciprocal regulation of TERC maturation by PARN and PAPD5. [Figure 3]1 includes the results of an RNA oligoadenylation assay for compounds 15A, 13A, 12A, 10A, and 1A. [Figure 4] 1 includes the results of an RNA oligoadenylation assay for compounds 26A, 29A, 18A, and 27A. [Figure 5] 1 includes the results of an RNA oligoadenylation assay for compounds 25A, 14A, 23A, and 28A. [Figure 6] 1 includes the results of an RNA oligoadenylation assay for compounds 33A, 17A, 30A, and 31A. [Figure 7] 1 includes images showing the results of an RNA oligoadenylation assay for compounds 1 and 34A. [Figure 8] 1 includes images showing the results of an RNA oligoadenylation assay for compounds 1 and 16A. [Figure 9] 1 includes images showing the results of an RNA oligoadenylation assay for compounds 1 and 19A. [Figure 10] 1 includes images showing the results of RNA oligoadenylation assays for compounds 1, 5A, 57A, and 51A. [Figure 11] 1 includes images showing the results of RNA oligoadenylation assays for compounds 1, 53A, 56A, and 54A. [Figure 12] 1 includes images showing the results of RNA oligoadenylation assays for compounds 1, 26A, 16A, 61A, 63A, and 70A. [Figure 13] 1 includes images showing the results of RNA oligoadenylation assays for compounds 1, 17A, 16A, 58A, 15A, 55A, and 51A. [Figure 14] 1 includes images showing the results of RNA oligoadenylation assays for compounds 1, 78A, 78A-INT, and 82A. [Figure 15] Images showing the effect of compounds 1, 26A, 16A, 61A, 63A, 64A, 70A, 57A, 17A, 58A, 15A, 55A, and 54A on rapid amplification of TERC cDNA ends are included. [Figure 16]Included are images showing the effects of compounds 1, 78A, 80A, 82A, and 85A-BP on the rapid amplification of TERC cDNA ends. [Figure 17] 1 includes images of Northern blots showing the effects of compounds 1, 26A, 16A, and 61A on TERC RNA steady-state levels. [Figure 18] 1 includes images of Northern blots showing the effects of compounds 1, 26A, 70A, 63A, 64A, 15A, 55A, 17A, 58A, and 57A on TERC RNA steady-state levels. [Figure 19] Included are images showing the results of the effects of compounds 1, 26A, 70A, 61A, 16A, 63A, 64A, 15A, 54A, 55A, 17A, 58A, and 57A on telomere length. [Figure 20] Included are images showing the results of the effects of compounds 1, 78A, 80A, 82A, 85A-BP, 79A, and 93A on telomere length. DETAILED DESCRIPTION OF THE INVENTION

[0018] Telomeres are regions of repeated nucleotide sequences at each end of chromosomes. In vertebrates, the nucleotide sequence in telomeres is TTAGGG. In humans, this TTAGGG sequence is repeated approximately hundreds to thousands of times. Telomerase is a ribonucleoprotein that adds telomere repeat sequences to the 3' end of telomeres. Cells with impaired telomerase function often have limited capacity for self-renewal, i.e., an abnormal state or condition characterized by the inability of cells (e.g., stem cells) to divide efficiently. This cellular defect can lead to, for example, various diseases and disorders.

[0019] The telomerase RNA component (TERC) has at least two functions: (1) it encodes the template sequence used by telomerase reverse transcriptase (TERT) for the addition of hexanucleotide repeats to telomeres, and (2) it is a scaffold that nucleates multiple proteins that target telomerase to Cajal bodies where telomeres are elongated.

[0020] The present disclosure provides compounds and methods for modulating TERC levels, for example, by using compounds that target TERC or that modulate the level or activity of PAP-associated domain-containing 5 (PAPD5) and / or poly(A)-specific ribonuclease (PARN), both of which are involved in the 3'-end maturation of TERC. Various implementations of these compounds and methods are described herein.

[0021] therapeutic compounds In some embodiments, the present disclosure provides a compound of formula (I): [ka] or a pharmaceutically acceptable salt thereof, X 1 are N and CR 1 is selected from R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from Each Cy 1 independently, C 6-10 aryl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 is H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 , S(O)NR c1 R d1 and phenyl, wherein the phenyl is optionally selected from R Cy , Halo, CN, OR a1 , S.R. a1 , or NR c1 R d1 is replaced by R 8 is a 4- to 7-membered heterocycloalkyl, C 3-10 cycloalkyl, and 5- to 10-membered heteroaryl, which are substituted with W and optionally independently R Cy and is substituted with 1, 2, or 3 substituents selected from W is C(O)OR a2 and carboxylic acid bioisosteres, RCy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 or substituted with 1, 2, or 3 substituents selected from or R 5 and R 8 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy1 or substituted with 1, 2, 3, 4, or 5 substituents selected from or R 4 and R 8together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 10-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R Cy1 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , N.R. c3 R d3 , N.R. c3 C(O)R b3 , N.R. c3 C(O)OR a3 , N.R. c3 S(O)2R b3 , S(O)2R b3 , and S(O)NR c3 R d3 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , N.R. c3 R d3 , N.R. c3 C(O)R b3 , N.R. c3 C(O)OR a3 , N.R. c3 S(O)2R b3 , S(O)2R b3 , and S(O)NR c3 R d3 or substituted with 1, 2, or 3 substituents selected from or any two R Cy1together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy2 or substituted with 1, 2, 3, 4, or 5 substituents selected from or R 7 and R Cy1 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy2 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R Cy2 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)OR a4 , N.R. c4 R d4 , N.R. c4 C(O)R b4 , N.R. c4 C(O)OR a4 , N.R. c4 S(O)2R b4 , S(O)2R b4 , and S(O)NR c4 R d4 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)OR a4 , N.R. c4 R d4 , N.R. c4 C(O)R b4 , N.R. c4 C(O)OR a4 , N.R. c4 S(O)2R b4, S(O)2R b4 , and S(O)NR c4 R d4 and is substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , R d2 , R a3 , R b3 , R c3 , R d3 , R a4 , R b4 , R c4 , and R d4 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R gor substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c3 and R d3 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c4 and R d4 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g and is substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino).

[0022] In some embodiments, X 1 are N and CR 1 is selected from R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 Rd1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from Each Cy 1 independently, C 6-10 aryl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 is H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 , S(O)NR c1 R d1 and phenyl, wherein the phenyl is optionally selected from halo, CN, OR a1 , S.R. a1 , or NR c1 R d1 is replaced by R 8 is selected from 4- to 7-membered heterocycloalkyl and 5- to 10-membered heteroaryl, which is substituted with W and optionally, independently, R Cy and is substituted with 1, 2, or 3 substituents selected from W is C(O)OR a2 and carboxylic acid bioisosteres, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 or substituted with 1, 2, or 3 substituents selected from or R 5 and R8 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy1 or substituted with 1, 2, 3, 4, or 5 substituents selected from R Cy1 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , N.R. c3 R d3 , N.R. c3 C(O)R b3 , N.R. c3 C(O)OR a3 , N.R. c3 S(O)2R b3 , S(O)2R b3 , and S(O)NR c3 R d3 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , N.R. c3 R d3 , N.R. c3 C(O)R b3 , N.R. c3 C(O)OR a3 , N.R. c3 S(O)2R b3 , S(O)2R b3 , and S(O)NR c3 R d3 or substituted with 1, 2, or 3 substituents selected from or any two R Cy1together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy2 or substituted with 1, 2, 3, 4, or 5 substituents selected from or R 7 and R Cy1 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from R Cy2 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R Cy2 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)OR a4 , N.R. c4 R d4 , N.R. c4 C(O)R b4 , N.R. c4 C(O)OR a4 , N.R. c4 S(O)2R b4 , S(O)2R b4 , and S(O)NR c4 R d4 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a4 , C(O)R b4 , C(O)NR c4 R d4 , C(O)OR a4 , N.R. c4 R d4 , N.R. c4 C(O)R b4 , N.R. c4 C(O)OR a4 , N.R. c4 S(O)2R b4, S(O)2R b4 , and S(O)NR c4 R d4 and is substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , R d2 , R a3 , R b3 , R c3 , R d3 , R a4 , R b4 , R c4 , and R d4 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R gor substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c3 and R d3 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c4 and R d4 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g and is substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino.

[0023] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1, N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R 7 H and C 1-3 alkyl.

[0024] In some embodiments, X 1 is N.

[0025] In some embodiments, X 1 is CR 1 is.

[0026] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1, and S(O)NR c1 R d1 is selected from.

[0027] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one, at least two, or at least three of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the 1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the following is true: OR a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the c1 R d1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6At least one of the a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the c1 R d1 is.

[0028] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 and R 5 are each independently 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0029] In some embodiments, R 1 , R 4 , and R 6 are H, respectively, R 2 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo, R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo; R 5 Cy 1 , C(O)OR a1 , C(O)NR c1 R d1 , S(O)NR c1 R d1 , and CN.

[0030] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo; R 5 Cy 1 , C(O)OR a1 , C(O)NR c1 R d1 , S(O)NR c1 R d1 , and CN.

[0031] In some embodiments, R 3 is halo. In some embodiments, R 3 Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 is C(O)NR c1 R d1 In some embodiments, R 5 Cy 1 In some embodiments, R 5 is C(O)OR a1 In some embodiments, R 5 is C(O)NR c1 R d1 In some embodiments, R 5 is S(O)NR c1 R d1 In some embodiments, R 5 is CN.

[0032] In some embodiments, R 3 is OR a1 and R 5 is C(O)OR a1In some embodiments, R 3 is OR a1 and R 5 is C(O)NR c1 R d1 In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)OR a1 In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)NR c1 R d1 is.

[0033] In some embodiments, R 2 H and OR a1 is selected from R 3 is C 1-6 Alkoxy and C 1-6 haloalkoxy; R 5 is C(O)OR a1 is.

[0034] In some embodiments, Cy 1 is C 6-10 aryl and 5- to 10-membered heteroaryl, each of which is optionally independently selected from R Cy is substituted with one or two substituents selected from:

[0035] In some embodiments, Cy 1 optionally R Cy C replaced with 6-10 In some embodiments, Cy is selected from aryl. 1 optionally R Cy In some embodiments, Cy is a 5- to 10-membered heteroaryl substituted with 1 is selected from indolyl and isoxazolyl, each of which is optionally R Cy is replaced by .

[0036] In some embodiments, R a1 is H, C 1-6 Alkyl, C 1-4 It is selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl.

[0037] In some embodiments, R a1 is H. In some embodiments, R a1 is C 1-6 In some embodiments, R a1 is C 1-4 In some embodiments, R a1 is a 5- to 10-membered heteroaryl (e.g., indolyl, such as indol-5-yl or indol-4-yl). a1 is a 4-10 membered heterocycloalkyl (eg, piperidinyl).

[0038] In some embodiments, R c1 and R d1 are each independently H and C 1-6 In some embodiments, R c1 and R d1 are both H. In some embodiments, R c1 and R d1 At least one of R is not H. In some embodiments, R c1 is H and R d1 is C 1-6 In some embodiments, R c1 and R d1 are both C 1-6 It is alkyl.

[0039] In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g In some embodiments, R c1 and Rd1 together with the N atom to which they are attached form piperazinyl or morpholinyl, each of which may optionally be R g is replaced by .

[0040] In some embodiments, R 7 is H. In some embodiments, R 7 is C 1-3 It is alkyl.

[0041] In some embodiments, R 8 optionally R Cy In some embodiments, R is a 4- to 7-membered heterocycloalkyl substituted with 8 optionally R Cy In some embodiments, R is a 5- to 10-membered heteroaryl substituted with 8 is selected from pyridinyl, imidazolyl, thiazolyl, pyrazinyl, pyrimidinyl, oxazolyl, isoxazolyl, isothiazolyl, and pyrazolyl, each of which is optionally selected from R Cy In some embodiments, R 8 is selected from thiophenyl, pyrrolidinyl, and pyrrolyl. 8 is not thiophenyl, pyrrolidinyl, or pyrrolyl.

[0042] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from Cy 1 is C 6-10aryl and 5- to 10-membered heteroaryl, each of which is optionally independently selected from R Cy and is substituted with one or two substituents selected from R a1 is H, C 1-6 Alkyl, C 1-4 selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl; R c1 and R d1 are each independently H and C 1-6 alkyl; or R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally g is replaced by R 7 is H, R 8 is a 4- to 7-membered heterocycloalkyl or a 5- to 10-membered heteroaryl, each of which is optionally R Cy is replaced by .

[0043] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 and R 5 are each independently 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from Cy 1 optionally R Cy is a 5- to 10-membered heteroaryl substituted with R a1 is H, C 1-6 Alkyl, C 1-4selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl; R c1 and R d1 are each independently H and C 1-6 alkyl; or R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally g is replaced by R 7 is H, R 8 optionally R Cy is a 5- to 10-membered heteroaryl substituted with

[0044] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 is C 1-6 haloalkoxy, R 5 is C(O)OR a1 and R a1 H and C 1-6 alkyl, R 7 is H, R 8 is selected from pyridinyl, imidazolyl, thiazolyl, pyrazinyl, pyrimidinyl, oxazolyl, isoxazolyl, isothiazolyl, and pyrazolyl, each of which is optionally selected from R Cy is replaced by .

[0045] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0046] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0047] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0048] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0049] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0050] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0051] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0052] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0053] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0054] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0055] In some embodiments, R 3 and R 5 are each independently 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from Cy 1 optionally R Cy is a 5- to 10-membered heteroaryl substituted with R a1 is H, C 1-6 Alkyl, C 1-4 selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl; R c1 and R d1 are each independently H and C 1-6alkyl; or R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally g is replaced by .

[0056] In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)OR a1 and R a1 H and C 1-6 alkyl.

[0057] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 and is substituted with 1, 2, or 3 substituents selected from:

[0058] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, and C 1-6 haloalkoxy.

[0059] In some embodiments, R a2 is H, C 1-6 Alkyl, and C 1-4 haloalkyl.

[0060] In some embodiments, W is C(O)OR a2 is.

[0061] In some embodiments, W is C(O)OH.

[0062] In some embodiments, W is C(O)OR a2 and R a2 is C 1-6 It is alkyl.

[0063] In some embodiments, W is a carboxylic acid bioisostere.

[0064] In some embodiments, the carboxylic acid bioisostere is selected from a moiety of any one of the following formulas: [ka]

[0065] In some embodiments, the carboxylic acid bioisostere is C(O)NHC 6-10 Aryl, NHC(O)C 1-3 Hydroxyalkyl, CH2CN, CH2C 6-10 Aryl, C(O)CHCN, NHS(O)C 6-10 Aryl, S(O)C 1-6 Alkyl, C(O)C 1-3 Alkyl, CH2C(O)NH2, OCH2C 6-10 Aryl, NHC(O)C 6-10 Aryl, and NHC(O)OC 1-6 In some embodiments, the carboxylic acid bioisostere is not one of the following groups: C(O)NHC. 6-10 Aryl, NHC(O)C 1-3 Hydroxyalkyl, CH2CN, CH2C6-10 Aryl, C(O)CHCN, NHS(O)C 6-10 Aryl, S(O)C 1-6 Alkyl, C(O)C 1-3 Alkyl, CH2C(O)NH2, OCH2C 6-10 Aryl, NHC(O)C 6-10 Aryl, and NHC(O)OC 1-6 Alkyl.

[0066] In some embodiments, the compound of formula (I) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0067] In some embodiments, the compound of formula (I) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0068] In some embodiments, the compound of formula (I) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0069] In some embodiments, R 5 and R 8 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring, which may be independently selected from R Cy1 and is substituted with 1, 2, or 3 substituents selected from:

[0070] In some embodiments, R 5 and R 8together with the atoms to which they are attached form a 4- to 7-membered heterocycloalkyl ring, which may be independently selected from R Cy1 and is substituted with 1, 2, or 3 substituents selected from:

[0071] In some embodiments, R Cy1 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , and N.R. c3 R d3 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a3 , C(O)R b3 , C(O)NR c3 R d3 , C(O)OR a3 , and N.R. c3 R d3 and is substituted with 1, 2, or 3 substituents selected from:

[0072] In some embodiments, R Cy1 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, C 1-6 haloalkoxy, and C(O)OH.

[0073] In some embodiments, any two R Cy1 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring, which may be independently selected from R Cy2 and is substituted with 1, 2, or 3 substituents selected from:

[0074] In some embodiments, any two R Cy1 together with the atoms to which they are attached form a 4- to 7-membered heterocycloalkyl ring, which may optionally be independently selected from R Cy2and is substituted with 1, 2, or 3 substituents selected from:

[0075] In some embodiments, R 7 and R Cy1 together with the atoms to which they are attached form a 5- to 10-membered heteroaryl ring, which may optionally be independently selected from R Cy2 and is substituted with 1, 2, or 3 substituents selected from:

[0076] In some embodiments, R 7 and R Cy1 together with the atoms to which they are attached form a 4- to 7-membered heterocycloalkyl ring, which may optionally be independently selected from R Cy2 and is substituted with 1, 2, or 3 substituents selected from:

[0077] In some embodiments, R Cy2 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a4 , C(O)NR c4 R d4 , C(O)OR a4 , and N.R. c4 R d4 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a4 , C(O)NR c4 R d4 , C(O)OR a4 , and N.R. c4 R d4 and is substituted with 1, 2, or 3 substituents selected from:

[0078] In some embodiments, R Cy2 is C(O)OR a4 In some embodiments, R a4 is H, C 1-6 Alkyl, and C 1-4 In some embodiments, R is selected from haloalkyl. a4 H and C 1-6In some embodiments, R Cy2 is C(O)OH.

[0079] In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0080] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 In some embodiments, R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 In some embodiments, R 3 is C 1-6 It is haloalkoxy.

[0081] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0082] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0083] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0084] In some embodiments, the compound of formula (I) has the formula: [ka] or a pharmaceutically acceptable salt thereof.

[0085] In some embodiments, R 3 Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 Selected from, R Cy2 Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a4 , C(O)NR c4 R d4 , C(O)OR a4 , and N.R. c4 R d4 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a4 , C(O)NR c4 R d4 , C(O)OR a4 , and N.R. c4R d4 and is substituted with 1, 2, or 3 substituents selected from R a4 H and C 1-6 alkyl.

[0086] In some embodiments, R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo; R Cy2 is C(O)OR a4 and R a4 H and C 1-6 alkyl.

[0087] In some embodiments, R 3 is C 1-6 haloalkoxy, R Cy2 is C(O)OR a4 and R a4 H and C 1-6 alkyl.

[0088] In some embodiments, the compound of formula (I) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0089] In some embodiments, the compound of formula (I) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0090] In some embodiments, the present disclosure provides a compound of formula (II): [ka] or a pharmaceutically acceptable salt thereof, X 1 are N and CR 1 is selected from R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1, S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from Each Cy 1 independently, C 6-10 aryl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 is H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 , S(O)NR c1 R d1 and phenyl, wherein the phenyl is optionally selected from halo, CN, OR a1 , S.R. a1 , or NR c1 R d1 is replaced by W is a carboxylic acid bioisostere; R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2, C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 or substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , and R d2 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R g or substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g and is substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino).

[0091] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R 7 H and C 1-3 alkyl.

[0092] In some embodiments, X 1 is N.

[0093] In some embodiments, X 1 is CR 1 is.

[0094] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0095] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6At least one, at least two, or at least three of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the 1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the following is true: OR a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the c1 R d1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 At least one of the c1 R d1is.

[0096] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 and R 5 are each independently 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0097] In some embodiments, R 1 , R 4 , and R 6 are H, respectively, R 2 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo; R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 , and halo; R 5 Cy 1 , C(O)OR a1 , C(O)NR c1 R d1 , S(O)NR c1 R d1 , and CN.

[0098] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 Cy 1 , ORa1 , C(O)NR c1 R d1 , and halo; R 5 Cy 1 , C(O)OR a1 , C(O)NR c1 R d1 , S(O)NR c1 R d1 , and CN.

[0099] In some embodiments, R 3 is halo. In some embodiments, R 3 Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 is C(O)NR c1 R d1 In some embodiments, R 5 Cy 1 In some embodiments, R 5 is C(O)OR a1 In some embodiments, R 5 is C(O)NR c1 R d1 In some embodiments, R 5 is S(O)NR c1 R d1 In some embodiments, R 5 is CN.

[0100] In some embodiments, R 3 is OR a1 and R 5 is C(O)OR a1 In some embodiments, R 3 is OR a1 and R 5 is C(O)NR c1 R d1 In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)ORa1 In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)NR c1 R d1 is.

[0101] In some embodiments, R 2 H and OR a1 is selected from R 3 is C 1-6 Alkoxy and C 1-6 haloalkoxy; R 5 is C(O)OR a1 is.

[0102] In some embodiments, Cy 1 is C 6-10 aryl and 5- to 10-membered heteroaryl, each of which is optionally independently selected from R Cy is substituted with one or two substituents selected from:

[0103] In some embodiments, Cy 1 optionally R Cy C replaced with 6-10 In some embodiments, Cy is aryl. 1 optionally R Cy In some embodiments, Cy is a 5- to 10-membered heteroaryl substituted with 1 is selected from indolyl and isoxazolyl, each of which is optionally R Cy is replaced by .

[0104] In some embodiments, R a1 is H, C 1-6 Alkyl, C 1-4 It is selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl.

[0105] In some embodiments, Ra1 is H. In some embodiments, R a1 is C 1-6 In some embodiments, R a1 is C 1-4 In some embodiments, R a1 is a 5- to 10-membered heteroaryl (e.g., indolyl, such as indol-5-yl or indol-4-yl). a1 is a 4-10 membered heterocycloalkyl (eg, piperidinyl).

[0106] In some embodiments, R c1 and R d1 are each independently H and C 1-6 In some embodiments, R c1 and R d1 are both H. In some embodiments, R c1 and R d1 At least one of R is not H. In some embodiments, R c1 is H and R d1 is C 1-6 In some embodiments, R c1 and R d1 are both C 1-6 It is alkyl.

[0107] In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g In some embodiments, R c1 and R d1 together with the N atom to which they are attached form piperazinyl or morpholinyl, each of which may optionally be R g is replaced by .

[0108] In some embodiments, R 7 is H. In some embodiments, R 7is C 1-3 It is alkyl.

[0109] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 and is substituted with 1, 2, or 3 substituents selected from:

[0110] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, and C 1-6 haloalkoxy.

[0111] In some embodiments, R a2 is H, C 1-6 Alkyl, and C 1-4 haloalkyl.

[0112] In some embodiments, R 1 , R 2 , R 3 , R 4 , R 5 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)ORa1 , and S(O)NR c1 R d1 is selected from Cy 1 is C 6-10 aryl and 5- to 10-membered heteroaryl, each of which is optionally independently selected from R Cy and is substituted with one or two substituents selected from R a1 is H, C 1-6 Alkyl, C 1-4 selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl; R c1 and R d1 are each independently H and C 1-6 alkyl; or R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g is replaced by R 7 is H.

[0113] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 and R 5 are each independently 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from Cy 1 optionally R Cy is a 5- to 10-membered heteroaryl substituted with R a1 is H, C 1-6 Alkyl, C 1-4selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl; R c1 and R d1 are each independently H and C 1-6 alkyl; or R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g is replaced by R 7 is H.

[0114] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 is C 1-6 haloalkoxy, R 5 is C(O)OR a1 and R a1 H and C 1-6 alkyl, R 7 is H.

[0115] In some embodiments, W is selected from any one of the following moieties: [ka]

[0116] In some embodiments, the compound of formula (II) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0117] In some embodiments, the compound of formula (II) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0118] In some embodiments, the present disclosure provides a compound of formula (III): [ka] or a pharmaceutically acceptable salt thereof, X 1 are N and CR 1 is selected from R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1, C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R 5 is C(O)NR c1 R d1 , S(O)NR c1 R d1 , and Cy 1 is selected from Each Cy 1 independently, C 6-10 Aryl, C 3-10 cycloalkyl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 is H, C 1-3 Alkyl, C(O)C 1-6 Alkyl, C(O)OR a1 , S(O)NR c1 R d1 and phenyl, wherein the phenyl is optionally selected from halo, CN, OR a1 , S.R. a1 , or NR c1 R d1 is replaced by W is C(O)OR a2 and carboxylic acid bioisosteres, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-10Cycloalkyl, 5-10 membered heteroaryl, 4-6 membered heterocycloalkyl, OR a2 , C(O)R b2 , C(O)OR a2 , C(O)NR c2 R d2 , C(O)NR c1 S(O)2R b2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 ,OC(O)R b1 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 3-10 cycloalkyl, and 4- to 6-membered heterocycloalkyl are each optionally independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 and is substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , and R d2 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R g or substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 10-membered heterocycloalkyl or a 5- to 10-membered heteroaryl, each of which is optionally independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g and is substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 6-10 Aryl-C 1-6 Alkoxycarbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino).

[0119] In some embodiments, Each Cy 1 independently, C 6-10 aryl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)OR a2 , C(O)NR c2 R d2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 or substituted with 1, 2, or 3 substituents selected from or any R c1 and Rd1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g and is substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino.

[0120] In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1and is substituted with 1, 2, 3, 4, or 5 substituents selected from R 7 H and C 1-3 alkyl.

[0121] In some embodiments, X 1 is N.

[0122] In some embodiments, X 1 is CR 1 is.

[0123] In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0124] In some embodiments, R 1 , R 4 , and R 6 are H, respectively, R 2 H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from R 3 Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0125] In some embodiments, R 1 , R 4 , and R 6 are H, respectively, R 2 H and OR a1 is selected from R 3 Cy 1 , OR a1 and halo.

[0126] In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 At least one, at least two, or at least three of R 1 , R 2 , R 3 , R 4 , and R 6 At least one of the 1 In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 3 , R 4 , and R 6 At least one of the following is true: OR a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 At least one of the c1 R d1In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 At least one of the a1 In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 At least one of the c1 R d1 is.

[0127] In some embodiments, R 1 , R 2 , R 4 , and R 6 are H, respectively, R 3 Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0128] In some embodiments, R 3 Cy 1 , OR a1 , C(O)NR c1 R d1 and halo.

[0129] In some embodiments, R 2 H and OR a1 is selected from R 3 is C 1-6 Alkoxy and C 1-6 haloalkoxy.

[0130] In some embodiments, R 3 is C 1-6In some embodiments, R 3 is halo. In some embodiments, R 3 Cy 1 In some embodiments, R 3 is OR a1 In some embodiments, R 3 is C(O)NR c1 R d1 is.

[0131] In some embodiments, R 5 Cy 1 In some embodiments, R 5 is C(O)NR c1 R d1 In some embodiments, R 5 is S(O)NR c1 R d1 is.

[0132] In some embodiments, R 3 is OR a1 and R 5 is C(O)NR c1 R d1 In some embodiments, R 3 is OR a1 and R 5 Cy 1 In some embodiments, R 3 is OR a1 and R 5 is S(O)NR c1 R d1 is.

[0133] In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 is C(O)NR c1 R d1 In some embodiments, R 3 is C 1-6 haloalkoxy, R 5 Cy 1 In some embodiments, R 3 is C1-6 haloalkoxy, R 5 is S(O)NR c1 R d1 is.

[0134] In some embodiments, Cy 1 is C 6-10 aryl and 5- to 10-membered heteroaryl, each of which is optionally independently selected from R Cy is substituted with one or two substituents selected from:

[0135] In some embodiments, Cy 1 optionally R Cy C replaced with 6-10 In some embodiments, Cy is selected from aryl. 1 optionally R Cy In some embodiments, Cy is a 5- to 10-membered heteroaryl substituted with 1 is selected from indolyl and isoxazolyl, each of which is optionally R Cy is replaced by .

[0136] In some embodiments, R a1 is H, C 1-6 Alkyl, C 1-4 It is selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl.

[0137] In some embodiments, R a1 is H. In some embodiments, R a1 is C 1-6 In some embodiments, R a1 is C 1-4 In some embodiments, R a1 is a 5- to 10-membered heteroaryl (e.g., indolyl, such as indol-5-yl or indol-4-yl). a1 is a 4-10 membered heterocycloalkyl (eg, piperidinyl).

[0138] In some embodiments, R c1 and R d1 are each independently H and C 1-6 In some embodiments, R c1 and R d1 are both H. In some embodiments, R c1 and R d1 At least one of R is not H. In some embodiments, R c1 is H and R d1 is C 1-6 In some embodiments, R c1 and R d1 are both C 1-6 It is alkyl.

[0139] In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g In some embodiments, R c1 and R d1 together with the N atom to which they are attached form piperazinyl or morpholinyl, each of which may optionally be R g is replaced by .

[0140] In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 4- to 10-membered heterocycloalkyl. In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 5-10 membered heteroaryl.

[0141] In some embodiments, R 7 is H. In some embodiments, R 7 is C 1-3 It is alkyl.

[0142] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 and is substituted with 1, 2, or 3 substituents selected from:

[0143] In some embodiments, R Cy , Halo, CN, C 1-6 Alkyl, C 1-6 haloalkyl, 5-10 membered heteroaryl, 4-6 membered heterocycloalkyl, OR a2 , C(O)OR a2 , C(O)NR c2 R d2 , C(O)NR c1 S(O)2R b2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 ,OC(O)R b1 , and S(O)2R b2 wherein C is selected from 1-6 Alkyl is optionally represented by OR a2 or NR c2 R d2 is replaced by .

[0144] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, and C 1-6haloalkoxy.

[0145] In some embodiments, R a2 is H, C 1-6 Alkyl, and C 1-4 haloalkyl.

[0146] In some embodiments, R a2 H and C 1-6 alkyl.

[0147] In some embodiments, W is C(O)OR a2 is.

[0148] In some embodiments, W is selected from any one of the following moieties: [ka]

[0149] In some embodiments, the compound of formula (III) is selected from any one of the following compounds: [ka] [ka] [ka]

[0150] In some embodiments, the compound of formula (III) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0151] In some embodiments, the compound of formula (III) is selected from any one of the following compounds: [ka] [ka] [ka] or a pharmaceutically acceptable salt thereof.

[0152] In some embodiments, the present disclosure provides a compound of formula (IV): [ka] or a pharmaceutically acceptable salt thereof, X 1 are N and CR 1 is selected from R 1 , R 2 , R 4 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C 2-6Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from R 3 is C(O)Cy 1 ,OCy 1 , and Cy 1 is selected from Each Cy 1 are independently selected from 5- to 10-membered heteroaryl and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 H and C 1-3 alkyl, W is C(O)OR a2 and carboxylic acid bioisosteres, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)OR a2 , C(O)NR c2 R d2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)ORa2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 and is substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , and R d2 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R g or substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino).

[0153] In some embodiments, X 1 is N.

[0154] In some embodiments, X 1 is CR 1 is.

[0155] In some embodiments, R 1 , R 2 , R 4 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 Rd1 is selected from.

[0156] In some embodiments, R 1 , R 2 , R 4 , and R 6 At least one, at least two, or at least three of R 1 , R 2 , R 4 , and R 6 At least one of the 1 In some embodiments, R 1 , R 2 , R 4 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 4 , and R 6 In some embodiments, at least one of R 1 , R 2 , R 4 , and R 6 At least one of the following is true: OR a1 In some embodiments, R 1 , R 2 , R 4 , and R 6 At least one of the c1 R d1 In some embodiments, R 1 , R 2 , R 4 , and R 6 At least one of the a1 In some embodiments, R 1 , R 2 , R 4 , and R 6 At least one of the c1 R d1 In some embodiments, R 1 , R 2 , R 4 , and R 6are each H.

[0157] In some embodiments, R 3 is C(O)Cy 1 In some embodiments, R 3 OCy 1 In some embodiments, R 3 Cy 1 is.

[0158] In some embodiments, Cy 1 optionally R Cy In some embodiments, Cy is a 5- to 10-membered heteroaryl substituted with 1 optionally R Cy is an indolyl substituted with

[0159] In some embodiments, Cy 1 optionally R Cy In some embodiments, Cy is a 4- to 7-membered heterocycloalkyl substituted with 1 is selected from piperidine and piperazine, each of which is optionally R Cy is replaced by .

[0160] In some embodiments, R a1 is H, C 1-6 Alkyl, C 1-4 In some embodiments, R is selected from haloalkyl, 5- to 10-membered heteroaryl, and 4- to 10-membered heterocycloalkyl. a1 H and C 1-6 In some embodiments, R a1 is H. In some embodiments, R a1 is C 1-6 In some embodiments, R a1 is C 1-4 In some embodiments, R a1 is a 5- to 10-membered heteroaryl (e.g., indolyl, such as indol-5-yl or indol-4-yl).a1 is a 4-10 membered heterocycloalkyl (eg, piperidinyl).

[0161] In some embodiments, R c1 and R d1 are each independently H and C 1-6 In some embodiments, R c1 and R d1 are both H. In some embodiments, R c1 and R d1 At least one of R is not H. In some embodiments, R c1 is H and R d1 is C 1-6 In some embodiments, R c1 and R d1 are both C 1-6 It is alkyl.

[0162] In some embodiments, R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which optionally includes R g In some embodiments, R c1 and R d1 together with the N atom to which they are attached form piperazinyl or morpholinyl, each of which may optionally be R g is replaced by .

[0163] In some embodiments, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 wherein C is selected from 1-6 Alkyl is optionally independently selected from halo, CN, NO, OR a2 , C(O)Rb2 , C(O)NR c2 R d2 , C(O)OR a2 , and N.R. c2 R d2 In some embodiments, R Cy Halo, OH, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 1-6 Alkoxy, and C 1-6 In some embodiments, R is selected from haloalkoxy. Cy is OR a2 In some embodiments, R Cy is OH.

[0164] In some embodiments, R 7 is H. In some embodiments, R 7 is C 1-3 In some embodiments, W is C(O)OR a2 In some embodiments, R a2 H and C 1-6 In some embodiments, W is selected from alkyl. In some embodiments, W is C(O)OH. In some embodiments, W is selected from any one of the following moieties: [ka]

[0165] In some embodiments, the compound of formula (IV) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0166] In some embodiments, the present disclosure provides a compound selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0167] In some embodiments, the present disclosure provides a compound selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0168] In some embodiments, the present disclosure provides a compound of formula (V): [ka] or a pharmaceutically acceptable salt thereof, X 1 are N and CR 1 is selected from R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C(O)Cy 1 ,OCy 1 , Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , S(O)NR c1 R d1 wherein C is selected from 1-6 Alkyl, C2-6 Alkenyl, and C 2-6 Each alkynyl is optionally independently selected from Cy 1 , Halo, CN, NO2, OR a1 , S.R. a1 , C(O)R b1 , C(O)NR c1 R d1 , C(O)OR a1 , N.R. c1 R d1 , N.R. c1 C(O)R b1 , N.R. c1 S(O)2R b1 , S(O)2R b1 , and S(O)NR c1 R d1 and is substituted with 1, 2, 3, 4, or 5 substituents selected from Each Cy 1 are independently selected from 5- to 10-membered heteroaryl and 4- to 7-membered heterocycloalkyl, each of which is optionally independently selected from R Cy and is substituted with 1, 2, or 3 substituents selected from R 7 H and C 1-3 alkyl, or R 7 and phenyl groups, together with the N atom to which they are attached, form a 5- to 10-membered heteroaryl ring or a 4- to 7-membered heterocycloalkyl ring, each of which is optionally independently selected from W and R Cy and is substituted with 1, 2, or 3 substituents selected from W is C(O)OR a2 and carboxylic acid bioisosteres, R Cy Halo, CN, NO2, C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, OR a2 , C(O)R b2 , C(O)OR a2 , C(O)NR c2 R d2 , N.R. c2R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 wherein C is selected from 1-6 Alkyl, C 2-6 Alkenyl, and C 2-6 Each alkynyl is optionally and independently selected from halo, CN, NO, OR a2 , C(O)R b2 , C(O)NR c2 R d2 , C(O)OR a2 , N.R. c2 R d2 , N.R. c2 C(O)R b2 , N.R. c2 C(O)OR a2 , N.R. c2 S(O)2R b2 , S(O)2R b2 , and S(O)NR c2 R d2 and is substituted with 1, 2, or 3 substituents selected from Each R a1 , R b1 , R c1 , R d1 , R a2 , R b2 , R c2 , and R d2 are independently H, C 1-6 Alkyl, C 1-4 Haloalkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 alkylene, 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 6-10 Aryl, C 3-10 Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, and (4- to 10-membered heterocycloalkyl)-C 1-4 Each alkylene is optionally independently R g or substituted with 1, 2, 3, 4, or 5 substituents selected from or any R c1 and R d1 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from or any R c2 and R d2 together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which may optionally be independently selected from R g or substituted with 1, 2, or 3 substituents selected from Each R g are independently OH, NO2, CN, halo, C 1-6 Alkyl, C 2-6 Alkenyl, C 2-6 Alkynyl, C 1-4 Haloalkyl, C 1-6 Alkoxy, C 1-6 Haloalkoxy, Cyano-C 1-3 Alkylene, HO-C 1-3 Alkylene, C 6-10 Aryl, C 6-10 Aryloxy, C 3-10Cycloalkyl, 5-10 membered heteroaryl, 4-10 membered heterocycloalkyl, C 6-10 Aryl-C 1-4 Alkylene, C 3-10 Cycloalkyl-C 1-4 Alkylene, (5-10 membered heteroaryl)-C 1-4 Alkylene, (4-10 membered heterocycloalkyl)-C 1-4 Alkylene, Amino, C 1-6 Alkylamino, di(C 1-6 Alkyl)amino, thio, C 1-6 Alkylthio, C 1-6 Alkylsulfinyl, C 1-6 Alkyl sulfonyl, carbamyl, C 1-6 Alkylcarbamyl, di(C 1-6 Alkyl) carbamyl, carboxy, C 1-6 Alkyl carbonyl, C 1-6 Alkoxycarbonyl, C 1-6 Alkylcarbonylamino, C 1-6 Alkyl sulfonyl amino, amino sulfonyl, C 1-6 Alkylaminosulfonyl, di(C 1-6 Alkyl)aminosulfonyl, aminosulfonylamino, C 1-6 Alkylaminosulfonylamino, di(C 1-6 Alkyl)aminosulfonylamino, aminocarbonylamino, C 1-6 Alkylaminocarbonylamino, and di(C 1-6 alkyl)aminocarbonylamino).

[0169] In some embodiments, R 1 , R 2 , R 3 , R 4 , and R 6 are each independently H, Cy 1 , Halo, CN, OR a1 , C(O)NR c1 R d1 , C(O)OR a1 , and S(O)NR c1 R d1 is selected from.

[0170] In some embodiments, R 1 , R 4 , and R 6 are H, respectively, R 2 H and OR a1 is selected from R 3 Cy 1 and OR a1 is selected from.

[0171] In some embodiments, R a1 is C 1-6 Alkyl and C 1-6 haloalkyl.

[0172] In some embodiments, R 7 is H.

[0173] In some embodiments, W is C(O)OR a2 is.

[0174] In some embodiments, R a2 H and C 1-6 alkyl.

[0175] In some embodiments, W is a carboxylic acid bioisostere selected from any one of the following moieties: [ka] or a pharmaceutically acceptable salt thereof.

[0176] In some embodiments, the compound of formula (V) is selected from any one of the following compounds: [ka] or a pharmaceutically acceptable salt thereof.

[0177] As used herein, the term "pharmaceutically acceptable salt" refers to a salt formed between an acid and a base of a compound, such as an amino functional group, or between a base and an acidic group of a compound, such as a carboxyl functional group. In some embodiments, the compound is a pharmaceutically acceptable acid addition salt. In some embodiments, acids commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include inorganic acids, such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid, and phosphoric acid, and organic acids, such as para-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, besylic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, para-bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid, and acetic acid, and related inorganic and organic acids. Accordingly, such pharmaceutically acceptable salts include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogen phosphate, dihydrogen phosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-1,4-dioate, These include hexyne-1,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylenesulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, β-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene-1-sulfonate, naphthalene-2-sulfonate, mandelate, and other salts.In one embodiment, pharmaceutically acceptable acid addition salts include those formed with mineral acids such as hydrochloric acid and hydrobromic acid, and particularly those formed with organic acids such as maleic acid.

[0178] In some embodiments, bases commonly used to form pharmaceutically acceptable salts of the therapeutic compounds described herein include hydroxides of alkali metals, including sodium, potassium, and lithium; hydroxides of alkaline earth metals, such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia; unsubstituted or hydroxyl-substituted mono-, di-, or tri-alkylamines, organic amines such as dicyclohexylamine; tributylamine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris-(2-OH-(C1-C6)-alkylamines), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri-(2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids, such as arginine, lysine, and the like.

[0179] In some embodiments, the compound of Formula (I)-(IV), or a pharmaceutically acceptable salt thereof, is substantially isolated.

[0180] Production method Compounds of any one of the formulas disclosed herein, including salts thereof, can be prepared using known organic synthesis techniques and can be synthesized by any of a number of possible synthetic routes. Those skilled in the art know how to select and carry out appropriate synthetic protocols and understand that a wide repertoire of synthetic organic reactions is available that may be used to synthesize the compounds provided herein.

[0181] Suitable synthetic methods for starting materials, intermediates, and products can be identified by reference to the literature, and reference sources include: Advances in Heterocyclic Chemistry, Vols. 1-107 (Elsevier, 1963-2012), Journal of Heterocyclic Chemistry Vols. 1-49 (Journal of Heterocyclic Chemistry, 1964-2012), Carreira, et al. (Ed.) Science of Synthesis, Vols. 1-48 (2001-2010) and Knowledge Updates KU2010 / 1-4; 2011 / 1-4; 2012 / 1-2 (Thieme, 2001-2012), Katritzky, et al. (Ed.) Comprehensive Organic Functional Group Transformations, (Pergamon Press, 1996), Katritzky et al. (Ed.); Comprehensive Organic Functional Group Transformations II(Elsevier,2 nd Edition, 2004), Katritzky et al. (Ed.), Comprehensive Heterocyclic Chemistry (Pergamon Press, 1984), Katritzky et al., Comprehensive Heterocyclic Chemistry II, (Pergamon Press, 1996), Smith et al., March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6 th Ed. (Wiley, 2007), Trost et al. (Ed.), Comprehensive Organic Synthesis (Pergamon Press, 1991).

[0182] The reaction for preparing the compounds provided herein can be carried out in a suitable solvent that can be easily selected by those skilled in the art of organic synthesis.A suitable solvent can be substantially non-reactive with the starting material (reactant), intermediate, or product at the temperature at which the reaction is carried out, for example, a temperature that can range from the freezing temperature of the solvent to the boiling temperature of the solvent.A given reaction can be carried out in one solvent or a mixture of two or more solvents.Depending on the specific reaction step, a suitable solvent for a specific reaction step can be selected by those skilled in the art.

[0183] The preparation of the compounds provided herein may involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups, can be readily determined by one skilled in the art. Protecting group chemistries are described, for example, in P.G.W. Buts and T.W. Greene, Protective Groups in Organic Synthesis, 4 th Ed., Wiley & Sons, Inc., New York (2006).

[0184] How to use Regulation of the telomerase RNA component (TERC) Telomerase has been a therapeutic target of great interest for over 20 years due to its activity in numerous cancers. The telomerase RNA component (TERC) contains a box H / ACA domain at its 3' end, which is functionally separable from the template domain and is a motif responsible for telomerase activity in vitro. In vivo, the H / ACA motif is also bound by a heterotrimer of dyskerin, NOP10, and NHP2, which stabilizes TERC, as well as TCAB1, which is involved in localizing the telomerase complex to Cajal bodies (I-Venteicher, A. et al. A human telomerase holoenzyme protein required for Cajal body localization and telomere synthesis. Science 323, 644-8 (2009)).Disruption of any of these interactions can also impair telomere maintenance and cause telomere disorders (Mitchell, JR, Wood, E. & Collins, K. A telomerase component is defective in the human disease dyskeratosis congenita. Nature 402, 551-5 (1999); Vulliamy, T. et al. Mutations in the telomerase component NHP2 cause the premature aging syndrome dyskeratosis congenita. Proceedings of the National Academy of Sciences of the United States of America 105, 8073-8 (2008); Walne, A. J. et al. Genetic heterogeneity in autosomal recessive dyskeratosis congenita with one subtype due to mutations in the telomerase-associated protein NOP10. Human molecular genetics 16, 1619-29 (2007)). The H / ACA motif helps direct the pseudouridylation of other RNAs by dyskerin (Kiss, T., Fayet-Lebaron, E. & Jady, BEBox H / ACA small ribonucleoproteins. Molecular cell 37, 597-606 (2010)).

[0185] Increasing telomerase activity may be beneficial in several degenerative and age-related disorders. Conversely, inhibiting telomerase activity would be of significant utility in the treatment of cancer and disorders in which hyperproliferative cells depend on telomerase for self-renewal.

[0186] Regulation of poly(A)-specific ribonuclease (PARN) PARN is known as a 3'-5' exoribonuclease involved in the degradation of the poly(A) tail of eukaryotic mRNAs, the rate-limiting step in mRNA turnover (Korner, C.G. & Wahle, E. Poly(A) tail shortening by a mammalian poly(A)-specific 3'-exoribonuclease. The Journal of Biological Chemistry 272, 10448-56 (1997)). PARN is stimulated by the presence of the m7G cap and requires a minimal substrate of adenosine di- or trinucleotides (i.e., oligo(A)), rather than strictly poly(A). PARN is a ubiquitously expressed cap-dependent poly(A) deadenylase that has a canonical role in regulating global mRNA levels during development, as well as additional, more specialized functions, including Dicer-independent end trimming of microRNA (miR)-451 and deadenylation of small nucleolar (sno)RNAs. PARN loss-of-function mutations are involved in idiopathic pulmonary fibrosis and dyskeratosis congenita. The present disclosure provides methods and agents for regulating the level or activity of human PARN. The nucleotide sequence of human PARN is NM_002582, and the amino acid sequence of PARN is O95453 (Table 1). The variants of the nucleotide sequence and amino acid sequence are also shown in Table 1. [Table 1] PAP-associated domain-containing 5 (PAPD5) PAPD5, also known as topoisomerase-related function protein 4-2 (TRF4-2), also known as TUT3, also known as GLD4, and also known as TENT4B, is one of seven members of a family of non-canonical poly(A) polymerases in human cells. PAPD5 has been shown to act as a polyadenylases on aberrant pre-ribosomal RNA in vivo in a manner similar to the degradation-mediated polyadenylation by the non-canonical poly(A) polymerase Trf4p in yeast. PAPD5 is also involved in the uridine-dependent degradation of histone mRNAs.

[0187] Both PARN and PAPD5 are involved in the 3' end maturation of the telomerase RNA component (TERC). Patient cells, fibroblasts, and transformed fibroblasts in which PARN is disrupted (I-IPS cells) show reduced levels of TERC, which can be restored by reducing PAPD5 levels or activity. Deep sequencing of the TERC RNA 3' terminus reveals that PARN and PAPD5 are crucial for processing the post-transcriptionally acquired oligo(A) tail, which targets nuclear RNA for degradation. The reduced TERC levels and increased oligo(A) form of TERC are normalized by restoring PARN or inhibiting PAPD5. This disclosure reveals PARN and PAPD5 as key players in the regulation and biogenesis of TERC (Figure 1). Figure 1 shows that the 3' end of nascent TERC RNA undergoes PAPD5-mediated oligoadenylation, which targets the transcript for exosome-mediated degradation. PARN counteracts degradation pathways by removing the oligo(A) tail and / or trimming the genome-encoded bases (green) of nascent TERC, resulting in the mature 3' end. Mature TERC is protected from further oligoadenylation and exonucleolytic processing, likely by the dyskerin / NOP10 / NHP2 / GAR1 complex, and assembled into the telomerase holoenzyme to maintain telomeres. PARN deficiency favors degradation, leading to reduced TERC levels and telomere dysfunction. Therefore, the present disclosure also provides compounds and methods for modulating the level or activity of human PAPD5. The nucleotide sequence of the human PAPD5 used is FR872509.1, and the amino acid sequence is CCB84642.1 (Table 1). Variants of the nucleotide and amino acid sequences are also listed in Table 1. The amino acid sequence of the PAPD5 used is shown below. PAPD5 (TRF4-2) (CCB84642.1) (SEQ ID NO: 1) MYRSGERLLG SHALPAEQRD FLPLETTNNN NNHHQPGAWA RRAGSSASSP PSASSSPHPS AAVPAADPAD SASGSSNKRK RDNKASTYGL NYSLLQPSGG RAAGGGRADG GGVVYSGTPW KRRNYNQGVV GLHEEISDFY EYMSPRPEEE KMRMEVVNRI ESVIKELWPS ADVQIFGSFK TGLYLPTSDI DLVVFGKWEN LPLWTLEEAL RKHKVADEDS VKVLDKATVP IIKLTDSFTE VKVDISFNVQ NGVRAADLIK DFTKKYPVLP YLVLVLKQFL LQRDLNEVFT GGIGSYSLFL MAVSFLQLHP REDACIPNTN YGVLLIEFFE LYGRHFNYLK TGIRIKDGGS YVAKDEVQKN MLDGYRPSML YIEDPLQPGN DVGRSSYGAM QVKQAFDYAY VVLSHAVSPI AKYYPNNETE SILGRIIRVT DEVATYRDWI SKQWGLKNRP EPSCNGNGVT LIVDTQQLDK CNNNLSEENE ALGKCRSKTS ESLSKHSSNS SSGPVSSSSA TQSSSSDVDS DATPCKTPKQ LLCRPSTGNR VGSQDVSLES SQAVGKMQST QTTNTSNSTN KSQHGSARLF RSSSKGFQGT TQTSHGSLMT NKQHQGKSNN QYYHGKKRKH KRDAPLSDLC R

[0188] Figure 2 illustrates the reciprocal regulation of TERC levels by PAPD5 and PARN and the potential for therapeutic manipulation of telomerase in degenerative or malignant disorders. As shown in Figure 2, PAPD5 inhibitors can inhibit PAPD5-mediated oligoadenylation, which targets nascent TERC RNA for exosomal degradation, thus increasing TERC levels or activity. In contrast, PARN inhibitors decrease TERC levels or activity because PARN counteracts the degradation pathway by removing the oligo(A) tail and / or trimming the genomic encoded bases of nascent TERC to obtain the mature 3' end. Additionally, increased PARN levels or activity can increase TERC levels or activity, and increased PAPD5 levels or activity can decrease TERC levels or activity.

[0189] In one aspect, the present disclosure provides compounds and related methods for modulating TERC levels in cells. The cells can be, for example, primary human cells, stem cells, induced pluripotent cells, fibroblasts, etc. In some embodiments, the cells are within a subject (e.g., a human subject). Accordingly, the present disclosure provides methods for modulating TERC levels in cells in vivo. In some embodiments, the cells can be isolated from a sample obtained from a subject; for example, the cells can be derived from any part of the body, including, but not limited to, skin, blood, and bone marrow. The cells can also be cultured in vitro using routine methods using commercially available cell reagents (e.g., cell culture media). In some embodiments, the cells are obtained from a subject who has, is at risk for, or is suspected of having a telomere disorder. In some embodiments, the subject has no apparent symptoms.

[0190] TERC levels or activity can be determined by various means, such as determining telomere size in cells, determining TERC stability, determining RNA levels, measuring telomerase activity, and / or measuring the oligoadenylated (oligo(A)) form of TERC. TERC stability can be assessed, for example, by measuring the TERC decay rate. The oligoadenylated (oligo(A)) form of TERC can be measured, for example, using rapid amplification of cDNA ends (RACE) in addition to targeted deep sequencing (e.g., at the TERC 3' end) to detect the oligoadenylated (oligo(A)) form of TERC. Telomere size can be measured, for example, using flow fluorescence in situ hybridization (Flow-FISH) techniques.

[0191] In some embodiments, endogenous TERC is regulated. Such methods can include, for example, altering telomerase activity, for example, increasing or decreasing telomerase activity. The methods can involve reducing RNA expression in cells, for example, non-coding RNA in TERC. Telomerase activity can be regulated by regulating TERC levels, for example, by contacting cells with a test compound known to regulate protein synthesis. The methods can include targeting post-processing activity of the endogenous TERC locus. These methods involve manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN), isolating cells (e.g., fibroblasts), and treating the cells with an agent that regulates TERC levels. The methods can also involve manipulating TERC, including identifying a subject with a genetic mutation (e.g., a mutation in PARN) and treating the subject with an agent that regulates TERC levels. Subjects with genetic mutations (e.g., PARN mutations) can be identified by any diagnostic means commonly known in the art for this purpose.

[0192] The present disclosure shows that TERC levels are regulated at the post-transcriptional level. Thus, in one aspect, a method for regulating the level or activity of TERC involves regulating the level or activity of PARN and PAPD5.

[0193] In some embodiments, the method involves an agent that modulates the level or activity of PARN, thereby changing the level or activity of TERC. In some cases, the agent increases the level or activity of PARN. Alternatively, the agent decreases the level or activity of PARN. In some embodiments, the method involves an agent that modulates the level or activity of PAPD5, thereby changing the level or activity of TERC. In some embodiments, the agent increases the level or activity of PAPD5. Alternatively, the agent decreases the level or activity of PAPD5 (e.g., a PAPD5 inhibitor). In some embodiments, the agent is any one of the compounds described herein.

[0194] Thus, the present application provides compounds that modulate TERC levels and are therefore useful in treating a wide range of telomere diseases or disorders associated with telomerase dysfunction, such as dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, idiopathic pulmonary fibrosis, blood diseases, liver diseases (e.g., chronic liver disease), and cancers, such as blood cancers and liver cancers.

[0195] In some embodiments, to successfully treat telomere diseases, a therapeutic agent must selectively inhibit PAPD5 while not inhibiting PARN or other polynucleotide polymerases. PAPD5 inhibitors that are not selective and simultaneously inhibit other polymerases may not be useful in treating telomere diseases; that is, the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not indicate its usefulness in preventing and treating telomere diseases. Selectivity for PAPD5 as opposed to other polymerases is necessary for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not inhibit PARN or other polymerases.

[0196] In some embodiments, it has been surprisingly discovered that to successfully treat telomere diseases, a therapeutic agent must be a selective inhibitor of PAPD5. In other words, a successful therapeutic agent must inhibit PAPD5 while not substantially inhibiting PARN and / or other polynucleotide polymerases. In some embodiments, PAPD5 inhibitors that are not selective for PAPD5 but simultaneously inhibit other polymerases may not be useful in treating telomere diseases; i.e., the fact that a compound is a PAPD5 inhibitor (e.g., a non-selective inhibitor) does not indicate its usefulness in preventing and treating telomere diseases. Selectivity for PAPD5 as opposed to other polymerases is necessary for efficacy. In some embodiments, the compounds of the present application are selective and specific inhibitors of PAPD5 and do not substantially inhibit PARN or other polymerases.

[0197] Telomere disorders Telomere diseases or disorders associated with telomerase dysfunction are typically associated with changes in telomere size. Many proteins and RNA components, including TERC, PARN, and PAPD5 (also known as TRF4-2), are involved in the telomere regulatory pathway. Figures 1 and 2 show how these proteins or RNA components function in the regulatory pathway and how they are related to telomere diseases.

[0198] Among these telomere disorders is dyskeratosis congenita (DC), a rare progressive bone marrow failure syndrome characterized by the triad of reticular skin hyperpigmentation, nail dystrophy, and oral leukoplakia. Early death is often associated with bone marrow failure, infection, fatal pulmonary complications, or malignancy. Short-term treatment options for bone marrow failure in patients include anabolic steroids (e.g., oxymetholone), granulocyte-macrophage colony-stimulating factor, granulocyte colony-stimulating factor, and erythropoietin. Other treatments include hematopoietic stem cell transplantation (SCT).

[0199] Idiopathic pulmonary fibrosis (I-IPF) is a chronic, ultimately fatal disease characterized by a progressive decline in lung function. In some appropriate cases, the following drugs are used to treat I-IPF: nintedanib, a tyrosine kinase inhibitor that targets multiple tyrosine kinases, including vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), and PDGF receptors; and pirfenidone. Other treatments include lung transplantation. In some cases, lung transplantation for I-IPF (I-IPF) has been shown to provide a survival benefit over medical therapy.

[0200] Generally, methods for treating a telomere disease involve administering to a subject in need of, or determined to be in need of, such treatment a therapeutically effective amount of a compound described herein.

[0201] cancer The present disclosure also provides compounds, compositions, and methods for treating pre-leukemia, pre-cancerous conditions, dysplasia, and / or cancer. Pre-leukemia includes, for example, myelodysplastic syndrome and smoldering leukemia. Dysplasia refers to developmental abnormalities or epithelial abnormalities of growth and differentiation, including, for example, hip dysplasia, fibrous dysplasia, and renal dysplasia, myelodysplastic syndrome, and dysplasia of blood-forming cells.

[0202] Precancerous or premalignant conditions are conditions of cellular morphological disorder associated with an increased risk of cancer. If left untreated, these conditions can lead to cancer. Such conditions can be dysplasia or benign neoplasms.

[0203] As used herein, the term "cancer" refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapid proliferation of cell growth. The term is meant to include all types of cancerous growth or oncogenic processes, metastatic tissues, or malignantly transformed cells, tissues, or organs, regardless of histopathological type or stage of invasiveness. The term "tumor," as used herein, refers to cancerous cells, e.g., a mass of cancerous cells.

[0204] Many cancer cells have abnormal telomeres. Therefore, the treatments described herein (e.g., PAPD5 inhibitors) can also be used to treat cancer. Cancers that can be treated or diagnosed using the methods described herein include malignant tumors of various organ systems, such as those affecting the lung, breast, thyroid, lymphatic system, gastrointestinal, and genitourinary tract, as well as adenocarcinomas, including most colon cancers, renal cell carcinomas, prostate cancers, and / or testicular cancers, non-small cell lung cancers, small intestine cancers, and esophageal cancers.

[0205] In some embodiments, the methods described herein are used to treat or diagnose cancer in a subject. The term "cancer" is art-recognized and refers to malignant tumors of epithelial or endocrine tissues, including respiratory system cancer, digestive system cancer, genitourinary system cancer, testicular cancer, breast cancer, prostate cancer, endocrine system cancer, and melanoma. In some embodiments, the cancer is renal cancer or melanoma. Exemplary carcinomas include those forming from tissues of the cervix, lung, prostate, breast, head and neck, colon, and ovary. The term also includes carcinosarcomas, including malignant tumors composed of carcinomatous and sarcomatous tissues. "Adenocarcinoma" refers to carcinomas derived from glandular tissue or in which tumor cells form recognizable glandular structures. The term "sarcoma" is art-recognized and refers to malignant tumors of mesenchymal origin. Cancers treatable using the methods described herein are cancers that have increased levels of TERC, increased expression of genes such as TERC and / or TERT, or increased telomerase activity compared to normal tissue or other cancers of the same tissue.

[0206] In some embodiments, tumor cells isolated from a subject diagnosed with cancer can be used to screen for compounds that alter TERC levels. In some embodiments, tumor cells can be used to screen for test compounds that alter the expression or activity of PARN or PAPD5. The cancer cells used in this method can be, for example, cancer stem cells. Such methods can be used to screen a library of test compounds, for example, compounds that alter or modify the protein or RNA expression of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5).

[0207] In some embodiments, agents that decrease the level or activity of TERC (e.g., PANR inhibitors) are used to treat cancer. In some embodiments, these agents are used in combination with other cancer treatments, such as chemotherapy, surgery, or radiation therapy.

[0208] Aging Telomeres shorten throughout the human lifespan. In large-scale population-based studies, short or shortened telomeres have been associated with numerous diseases. Therefore, telomeres play an important role in the aging process and may contribute to various diseases. The role of telomeres as contributory and interactive factors in aging, disease risk, and protection is described, for example, in Blackburn, Elizabeth H., Elissa S. Epel, and Jue Lin. "Human telomere biology: A contributory and interactive factor in aging, disease risks, and protection," Science 350.6265(2015):1193-1198 (incorporated by reference in its entirety).

[0209] Telomere attrition is also a major driving force behind aging-related responses. In proliferating human cells, progressive telomere erosion eventually exposes uncapped, free, double-stranded chromosome ends, triggering a persistent DNA damage response (DDR). A persistent DNA damage response severely impacts cellular function. For example, the damage sensor ataxia telangiectasia mutated (ATM) is recruited to uncapped telomeres, leading to the stabilization of tumor suppressor protein 53 (p53) and the upregulation of the p53 transcriptional target p21. p21 then prevents cyclin-dependent kinase 2 (CDK2)-mediated inactivation of RB, subsequently preventing entry into the S phase of the cell cycle. Cellular senescence contributes to various age-related diseases, such as glaucoma, cataracts, diabetic pancreas, type 2 diabetes, atherosclerosis, osteoarthritis, inflammation, atherosclerosis, diabetic adiposity, cancer, pulmonary fibrosis, and liver fibrosis. The persistent DNA damage response and age-related diseases are described, for example, in Childs, Bennett G., et al. "Cellular senescence in aging and age-related disease: from mechanisms to therapy." Nature medicine 21.12 (2015):1424 (incorporated herein by reference in its entirety).

[0210] As used herein, the term "aging" refers to the degeneration of organs and tissues over time, resulting in part from insufficient replicative capacity in stem cells that regenerate tissues over time. Aging can result from natural disease processes that occur over time, or from pressures driven by endogenous or exogenous factors that accelerate cellular replication and repair. Such pressures include natural chemical, mechanical, and radiation exposure; biological agents such as bacteria, viruses, fungi, and toxins; autoimmunity, medications, chemotherapy, therapeutic radiation, and cell therapy. Because telomeres are an important factor in aging and disease development, the methods described herein can be used to treat, alleviate, or minimize the risk of an age-related disorder (and / or one or more symptoms of an age-related disorder) in a subject. The methods include identifying a subject as having or at risk of an age-related disorder and administering a pharmaceutical composition to the subject. In some embodiments, the pharmaceutical composition includes an agent that alters the level or activity of TERC, e.g., increases the level or activity of TERC.

[0211] As used herein, the term " age-related disorder " or " age-related disease " refers to the disorder associated with the aging process. Exemplary disorders include, for example, macular degeneration, diabetes mellitus (e.g., type 2 diabetes), osteoarthritis, rheumatoid arthritis, sarcopenia, hypertension, atherosclerosis, coronary artery disease, cardiovascular disease such as ischemia / reperfusion injury, cancer, premature death, and age-related cognitive function, cardiopulmonary function, muscle strength, vision and hearing decline.

[0212] The age-related disorder may also be a degenerative disorder, e.g., a neurodegenerative disorder. Degenerative disorders that can be treated or diagnosed using the methods described herein include those affecting various organ systems, such as the brain, heart, lungs, liver, muscle, bone, blood vessels, gastrointestinal, and genitourinary systems. In some embodiments, the degenerative disorder has telomere shortening, reduced levels of TERC, and / or reduced levels of telomerase compared to normal tissue. In some embodiments, the degenerative disorder is a neurodegenerative disorder. Exemplary neurodegenerative disorders include motor neuron disease, Creutzfeldt-Jakob disease, Machado-Joseph disease, spinocerebellar ataxia, multiple sclerosis (MS), Parkinson's disease, Alzheimer's disease, Huntington's disease, hearing and balance disorders, ataxia, epilepsy, schizophrenia, mood disorders such as bipolar disorder, and neurological injuries such as depression, dementia, Pick's disease, stroke, CNS hypoxia, brain aging, and head trauma. Recent studies have shown an association between short telomeres and Alzheimer's disease. The relationship between telomere shortening and Alzheimer's disease is described, for example, in Zhan, Yiqiang, et al. "Telomere length shortening and Alzheimer's disease—a Mendelian Randomization Study," JAMA neurology 72.10(2015):1202-1203 (incorporated by reference in its entirety). In some embodiments, the neurodegenerative disorder is dementia, e.g., Alzheimer's disease.

[0213] An inverse association between leukocyte telomere length and the risk of coronary heart disease has also been found. This relationship is described, for example, in Haycock, Philip C., et al. "Leucocyte telomere length and risk of cardiovascular disease: systematic review and meta-analysis." (2014): g4227 and Codd, Veryan, et al. "Identification of seven loci affecting mean telomere length and their association with disease." Nature Genetics 45.4 (2013): 422-427, each of which is incorporated by reference in its entirety. Thus, there is strong evidence for the causal role of telomere length changes in cardiovascular disease (CVD) or coronary artery disease (CAD). In some embodiments, the disorder is cardiovascular disease (CVD) and / or coronary artery disease (CAD), and the present disclosure provides methods for treating, alleviating, or minimizing the risk of these disorders. In some cases, the disorder is atherosclerotic cardiovascular disease.

[0214] Furthermore, a meta-analysis of 5,759 cases and 6,518 controls showed that shortened telomere length is significantly associated with the risk of type 2 diabetes. The relationship between telomere length and type 2 diabetes is described, for example, in Zhao, Jinzhao, et al. "Association between telomere length and type 2 diabetes mellitus: a meta-analysis." PLoS One 8.11 (2013): e79993 (incorporated by reference in its entirety). In some embodiments, the disorder is a metabolic disorder, e.g., type 2 diabetes.

[0215] In some embodiments, senescent cells can be used to screen test compounds that change the expression or activity of PARN or PAPD5.The senescent cells used in this method can be, for example, those with genetic lesions in telomere biological genes, those isolated from elderly subjects, or those that undergo multiple rounds of replication in the laboratory.Such methods can be used to screen libraries of test compounds, for example, compounds that change or alter the protein or RNA expression of telomere-related genes (e.g., TERC, PARN, PAPD5 / PAPD5).Exemplary screening methods and screening techniques are described herein.

[0216] In some embodiments, agents that increase the level or activity of TERC (e.g., PAPD5 / PAPD5 inhibitors) are used to treat age-related degenerative disorders due to natural or environmental causes. In some embodiments, these agents are used in combination with other treatments.

[0217] Viral infection Hepatitis B virus (HBV) is an enveloped, partially double-stranded DA virus. The compact 3.2 kb HBV genome consists of four overlapping open reading frames (ORFs) encoding the core, polymerase (Pol), envelope, and X proteins. The Pol ORF is the longest, and the envelope ORF is located within it, while the X and core ORFs overlap with the Pol ORF. The HBV life cycle involves two major events: 1) the generation of closed circular DNA (cccDNA) from relaxed circular (RC DNA) and 2) reverse transcription of pregenomic RNA (pgRNA) to produce RC DNA. Prior to infection of host cells, the HBV genome resides within virions as RC DNA. HBV virions have been shown to gain entry into host cells by nonspecifically binding to negatively charged proteoglycans present on the surface of human hepatocytes (Schulze, A., P. Gripon & S. Urban. Hepatology, 46, (2007), 1759-68) and through specific binding of the HBV surface antigen (HBsAg) to the hepatocyte sodium-taurocholate cotransporter polypeptide (NTCP) receptor (Yan, H. et al. J Virol, 87, (2013), 7977-91). Once the virion enters the cell, the viral core and enclosed RC DNA are transported into the nucleus via the Impβ / Impα nuclear transport receptors by host factors via nuclear localization signals. Within the nucleus, host DNA repair enzymes convert the RC DNA into cccDNA. This cccDNA serves as a template for all viral mRNAs, thereby contributing to HBV persistence in infected individuals. Transcripts produced from cccDNA are divided into two categories: pregenomic RNA (pgRNA) and subgenomic RNA. Subgenomic transcripts encode the three envelope (L, M, and S) and X proteins, while pgRNA encodes the precore, core, and Pol proteins (Quasdorff, M. & U. Protzcr. J Viral Hepat, 1 7, (2010), 527-36).Inhibition of HBV gene expression or HBV RNA synthesis results in the inhibition of HBV viral replication and antigen production (Mao, R. et al. PLoS Pathog, 9, (2013), e1003494; Mao, R. et al. J Virol, 85, (2011), 1048-57). For example, IFN-α has been shown to inhibit HBV replication and viral HBsAg production by reducing the transcription of pgRNA and subgenomic RNA from the HBV covalently closed circular DNA (cccDNA) minichromosome (Belloni, L. et al. J Clin Invest, 122, (2012), 529-37; Mao, R. et al. J Virol, 85, (2011), 1048-57). All HBV viral mRNAs are capped, polyadenylated, and then exported to the cytoplasm for translation. In the cytoplasm, assembly of a new virion begins, packaging the nascent pgRNA with viral Pol, allowing reverse transcription of the pgRNA into RC DNA via a single-stranded DNA intermediate. The mature nucleocapsid containing the RC DNA is then enveloped by cellular lipids and viral L, M, and S proteins, and infectious HBV particles are then released by budding at intracellular membranes (Locarnini, S. Semin Liver Dis, (2005), 25 Suppl 1, 9-19). Interestingly, non-infectious particles are also produced, far exceeding infectious virions. These empty enveloped particles (L, M, and S) are referred to as subviral particles. Importantly, because subviral particles share the same envelope proteins and infectious properties as the viral particles, they have been speculated to function as decoys for the host immune system and are used in HBV vaccines. The S, M, and L envelope proteins are expressed from a single ORF containing three different initiation codons. All three proteins share a 226-aa sequence, the S domain, at their C-terminus. M and L have additional pre-S domains, pre-S2 and pre-S2 and pre-S1, respectively. However, it is the S domain that contains the HBsAg epitope (Lambert, C. & R. Prangc. Virol J, (2007), 4, 45).

[0218] Controlling viral infection requires strict surveillance of the host innate immune system, which may respond within minutes to hours after infection to influence the initial growth of the virus and limit the development of chronic and persistent infection. Despite currently available treatments based on IFNs and nucleoside(t)ide analogues, hepatitis B virus (HBV) infection remains a major health problem worldwide, involving an estimated 350 million chronic carriers who are at high risk of liver cirrhosis and hepatocellular carcinoma.

[0219] The secretion of antiviral cytokines by hepatocytes and / or intrahepatic immune cells in response to HBV infection plays a central role in viral clearance from the infected liver.

[0220] However, chronically infected patients only exhibit weak immune responses due to various evasion strategies employed by the virus to counter the host cell recognition system and subsequent antiviral responses.

[0221] Numerous findings have demonstrated that several HBV viral proteins can counteract the initial host cell response by interfering with the virus recognition signaling pathway and subsequent interferon (IFN) antiviral activity. Among these, excessive secretion of HBV empty subviral particles (SVPs, HBsAg) may be involved in maintaining the immune tolerance state observed in chronically infected (CHB) patients. Persistent exposure to HBsAg and other viral antigens may result in the absence or progressive dysfunction of HBV-specific T cells (Kondo et al. Journal of Immunology (1993), 150, 4659-4671; Kondo et al. Journal of Medical Virology (2004), 74, 425-433; Fisicaro et al. Gastroenterology (2010), 138, 682-93). Furthermore, HBsAg has been reported to suppress the function of immune cells such as monocytes, dendritic cells (DCs), and natural killer (NK) cells through direct interaction (Op den Brouw et al. Immunology, (2009b), 1 26, 280-9; Woltman et al. PLoS One, (2011), 6, e15324; Shi et al. J Viral Hepat. (2012). 19, c26-33; Kondo et al. ISRN Gastroenterology, (2013), Article ID 935295).

[0222] HBsAg quantification is a significant biomarker for prognosis and treatment response in chronic hepatitis B. However, HBsAg loss and seroconversion, while rarely observed in chronically infected patients, remain the ultimate goal of therapy. Current therapies, such as nucleoside(t)ide analogs, inhibit HBV DA synthesis but are not directed at reducing HBsAg levels. Even with long-term therapy, nucleoside(t)ide analogs have demonstrated HBsAg clearance rates (-1% to 2%) comparable to those observed naturally (Janssen et al., Lancet, (2005), 365, 123-9; Marcellin et al., N. Engl. J. Med., (2004), 351, 1206-17; Buster et al., Hepatology, (2007), 46, 388-94). Therefore, targeting HBsAg along with HBV DNA levels in CHB patients may significantly improve immune reactivation and remission in CHB patients (Wieland, S.F. & F.V. Hikari. J Virol, (2005), 79, 9369-80; Kumar et al. J Virol, (2011), 85, 987-95; Woltman et al. PLoS One, (2011), 6, e15324; Opden Brouw et al. Immunology, (2009b), 126, 280-9).

[0223] The compounds of the present disclosure are inhibitors of virion production and the production and secretion of the surface proteins HBsAg and HBeAg. The compounds reduce effective HBV RNA production at the transcriptional or post-transcriptional level, such as the result of accelerated viral RNA degradation in cells. Alternatively, the compounds of the present disclosure inhibit the initiation of viral transcription. In essence, the compounds reduce the overall levels of HBV RNA, particularly HBsAg mRNA, and viral surface proteins. HBsAg may suppress immune responses to viruses or virus-infected cells, and high levels of HBsAg are thought to cause T cell exhaustion and depletion. The disappearance of HBsAg, followed by the appearance of anti-HBsAg antibodies, leads to a sustained virological response to HBV, which is considered a sign of functional cure.

[0224] In some embodiments, the compounds may modulate any of the molecular mechanisms described, for example, in Zhou et al., Antiviral Research 149 (2018) 191-201 (incorporated herein by reference in its entirety). In some embodiments, the compounds may modulate any of the physiological or molecular mechanisms described, for example, in Mueller et al., Journal of Hepatology 68 (2018) 412-420 (incorporated herein by reference in its entirety). For example, compounds of the present disclosure induce HBV RNA degradation (degradation of HBV pgRNA and HBsAg mRNA occurs in the hepatocyte nucleus and requires de novo synthesis of host proteins).

[0225] In some embodiments, compounds of the present disclosure are useful for inhibiting HBsAg production or secretion, inhibiting HBV DNA production, and / or treating or preventing hepatitis B virus (HBV) infection (acute, fulminant, or chronic) in a subject. In some embodiments, the subject is in need of such treatment or prevention (e.g., prior to administration of a compound of the present disclosure, the subject is diagnosed by a treating physician as having an HBV infection).

[0226] Other uses In some embodiments, the compounds of the present disclosure regulate RNAs whose transcription, post-transcriptional processing, stability, steady-state levels, or function are altered due to acquired or genetic defects in one or more of any cellular pathway. In some embodiments, these include small nucleolar RNAs (snoRNAs), small Cajal body RNAs (scaRNAs), small nuclear RNAs (snRNAs), ribosomal RNAs (rRNAs), Y RNAs, transfer RNAs (tRNAs), microRNAs (miRNAs), PIWI-interacting RNAs (piRNAs), or non-coding RNAs (ncRNAs) that are members of the long non-coding RNA (lncRNA) family. The compounds may also be useful for regulating cellular non-coding RNAs (e.g., scaRNA13, scaRNA8) and simultaneously preventing and treating associated diseases and conditions. In some embodiments, these include those ncRNAs affected by any of the molecular mechanisms described, for example, in Lardelli et al., Nature Genetics, 49(3), 2017, 457-464, and Son et al., 2018, Cell Reports 23, 888-898, including those affected by disruption of PARN or TOE1 deadenylase. Thus, the compounds are useful in treating or preventing genetic and other disorders, including neurodevelopmental disorders such as pontocerebellar hypoplasia. Neurodevelopmental disorders are a group of disorders in which the development of the central nervous system is disrupted. This can include developmental brain dysfunction, which can manifest as neuropsychiatric problems or impairments in motor function, learning, language, or nonverbal communication. In some embodiments, the neurodevelopmental disorder is selected from attention deficit hyperactivity disorder (ADHD), reading disorder (dyslexia), writing disorder (agraphia), calculation disorder (dyscalculia), expressive disorder (oral expression skills substantially below an appropriate level for the child's mental age), comprehension disorder (comprehension skills significantly below an appropriate level for the child's mental age), mixed receptive-expressive language disorder, speech disorder (dysarticulation) (inability to use developmentally appropriate speech sounds), stuttering (disturbances in the normal fluency and temporal structure of speech), and autism spectrum disorder (persistent difficulties in social communication).In some embodiments, the present disclosure provides a method for treating an acquired or genetic disease or condition associated with RNA alterations, the method comprising administering to a subject in need thereof a therapeutically effective amount of any one of the compounds described herein or a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable composition comprising the same. In some embodiments, the RNA comprises ncRNA (e.g., snRNA, scaRNA, snoRNA, rRNA, and miRNA). In some embodiments, the RNA is destroyed by the destruction of PARN or TOE1 deadenylase. In some embodiments, the acquired or genetic disease or condition associated with RNA alterations comprises a neurodevelopmental disorder such as pontocerebellar hypoplasia.

[0227] Because the compounds are PAPD5 inhibitors and affect TERC, telomerase, telomere maintenance, and stem cell self-renewal, the compounds are useful for regulating the ex vivo proliferation of stem cells and are also useful for allograft wasting in hematopoietic tissues or other tissues. For example, PAPD5 inhibitors can be useful for the ex vivo proliferation of hematopoietic stem cells, as described in Fares, et al., 2015, Science 345, 1590-1512 and Boitano, et al., 2010 329, 1345-1348 (both of which are incorporated herein by reference in their entirety).

[0228] CRISPR / Cas9 (CRISPR-related 9) Genome manipulation and gene regulation by controlling the expression of individual genes can also be used in therapeutics. CRISPR (clustered regularly interspaced short palindromic repeats) is a family of DNA sequences found in the genomes of prokaryotes such as bacteria and archaea. CRISPR / Cas RNA-guided genome targeting and gene regulation in mammalian cells (e.g., using modified bacterial CRISPR / Cas components) can be used to inhibit the expression and / or activity of genes (e.g., PAPD5).

[0229] In some embodiments, catalytically silent Cas-9 mutants (null nucleases) can be tethered to specific gene promoter regions, with the effect of reducing expression of those genes. In some embodiments, the Cas-9 mutants are linked to transcription factors.

[0230] In some embodiments, CRISPR / Cas9 genome targeting can create biallelic null mutations, thus inhibiting the expression and activity of a gene (e.g., PAPD5). Thus, in some embodiments, the PAPD5 inhibitor may be a vector encoding a guide RNA (gRNA) that targets PAPD5 for CRISPR / Cas9, which creates a null mutation in PAPD5, thereby reducing the level and activity of PAPD5. In some embodiments, the PAPD5 inhibitor comprises a CRISPR / Cas9 system and a guide RNA. In some embodiments, the guide RNA may have the following sequence: CCUCUUGUUGCUGCUGCCCG (SEQ ID NO: 2), CGGAGCGAUACAUGCCGGCC (SEQ ID NO: 3), or CCUCUUGUUGCUGCUGCCCG (SEQ ID NO: 4).

[0231] CRISPR / Cas9 targeting can be used in various methods described herein, such as screening for, diagnosing, treating, or preventing a disease or condition selected from the group consisting of modulation of telomerase RNA components, disorders associated with telomere or telomerase dysfunction, age-related disorders, pre-leukemia or pre-cancerous conditions, viral infections (e.g., HBV infection), neurodevelopmental disorders, and acquired or inherited diseases or conditions associated with alterations in RNA.

[0232] Diagnosis of subjects requiring treatment This document provides a method for diagnosing the subject who needs treatment (for example, has any one of the telomere diseases described herein).For example, if the level or activity of TERC, PARN, and / or PAPD5 in the subject is similar to the level or activity of TERC, PARN, and / or PAPD5 in the subject who has telomere disease, and optionally, if the subject has one or more symptoms related to telomere disease (for example, aplastic anemia, pulmonary fibrosis, liver cirrhosis), the subject can be diagnosed as having telomere disease or at risk of developing telomere disease.

[0233] In some embodiments, if the level or activity of TERC, PARN, and / or PAPD5 in a subject is similar to the level or activity of TERC, PARN, and / or PAPD5 in a control subject who does not have a telomere disease, the subject can be diagnosed as not having or not at risk of developing a telomere disease.

[0234] In some embodiments, if there is a mutation in PARN, the subject is judged to have or be at risk of developing telomere disease.The mutation can be missense mutation, deletion or truncation mutation, the omission of a single nucleotide or a group thereof that codes for one or several amino acids, non-coding mutation such as promoter, enhancer or splicing mutation, or other mutation. (See, e.g., Nagpal, et al., Cell Stem Cell, 2020. The mutation may be a deletion containing a portion of the PARN gene or the entire PARN gene. The mutation may also be at position 7 and / or 87 of PARN, e.g., the amino acid residue at position 7 is not asparagine and / or the amino acid residue at position 87 of PARN is not serine. For example, the mutation may be the missense mutation c.19A>C, resulting in a substitution of the highly conserved amino acid p.Asn7His. In some cases, the mutation is the missense mutation c.260C>T, encoding a substitution of the highly conserved amino acid p.Ser87Leu. In some embodiments, a subject is determined to have or be at risk of developing a telomere disease if they have a mutation in DKC1. The mutation may be a missense mutation, deletion, or truncation mutation, an omission of a single nucleotide or groups thereof encoding one or several amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation. (See, e.g., Fok, et al., Cell Stem Cell, 2020. (See, e.g., Wang et al., Blood, 2019 and Nagpal et al., Cell Stem Cell, 2020). In some embodiments, a subject is determined to have or be at risk of developing a telomere disease if there is a mutation in any factor that regulates TERC, including NOP10, NHP2, NAF1, GAR1, TCAB1 / WRAP53, ZCCHC8, and TERC itself. The mutation may be a missense mutation, deletion, or truncation mutation of the entire or partial gene, or an omission of a single amino acid or group thereof.In some embodiments, a subject is determined to have or be at risk of developing a telomere disease if they have a mutation in any factor that regulates telomere biology, such as TERT, TINF2, ACD / TPP1, STN1, CTC1, or POT1. The mutation can be a missense mutation, a deletion, or a truncation mutation, an omission of a single nucleotide or groups thereof that encode one or several amino acids, a non-coding mutation such as a promoter, enhancer, or splicing mutation, or other mutation.

[0235] In some embodiments, the subject does not have overt signs or symptoms of a telomere disease, but the level or activity of TERC, PARN, or PAPD5 may be associated with the presence of a telomere disease, such that the subject is at increased risk for developing a telomere disease. In some embodiments, once an individual is determined to have a telomere disease or at increased risk for developing a telomere disease, they may be administered treatment, for example, with a small molecule (e.g., a PAPD5 inhibitor) or nucleic acid encoded by a construct known in the art or described herein.

[0236] Suitable reference value can be determined using methods known in the art, for example, by using standard clinical test methods and statistical analysis.Reference value can have any relevant form.In some cases, the reference comprises a disease reference that represents a meaningful level of PAPD5 protein, for example, a control reference level that represents the normal level of PAPD5 protein, for example, a default value of the level in unaffected subjects or subjects who are not at risk of developing the diseases described herein, and / or a level of a protein associated with a condition related to telomere disease, for example, a level in subjects with telomere disease (for example, pulmonary fibrosis, cirrhosis, or aplastic anemia).In another embodiment, the reference comprises a disease reference that represents a meaningful level of PARN protein, for example, a control reference level that represents the normal level of PARN protein, for example, a default value of the level in unaffected subjects or subjects who are not at risk of developing the diseases described herein, and / or a level of a protein associated with a condition related to telomere disease, for example, a level in subjects with telomere disease (for example, pulmonary fibrosis, cirrhosis, or aplastic anemia).

[0237] The predetermined level can be a single cutoff (threshold) value, such as the median or mean value, or a level that defines the upper or lower quartile, tertile, or other segment of the clinical trial population that is determined to be statistically different from other segments.It can be a range of cutoff (or threshold) values, such as a confidence interval.It can be established based on a comparison group, such as the association between the risk of developing disease or the presence of disease in one defined group being several times higher or lower (for example, about 2 times, 4 times, 8 times, 16 times or more) than the risk or presence of disease in another defined group.For example, it can be a range in which a population of subjects (e.g., control subjects) is divided equally (or unequal) into groups, such as a low-risk group, a medium-risk group, and a high-risk group, or into quartiles (the lowest quartile is the subject with the lowest risk, and the highest quartile is the subject with the highest risk), or into n quartiles (i.e., n intervals are regular) (the lowest of the n quartiles is the subject with the lowest risk, and the highest of the n quartiles is the subject with the highest risk).

[0238] In some embodiments, the predetermined level is a level or occurrence in the same subject, eg, at a different time point, eg, an earlier time point.

[0239] A subject related to a predetermined value is typically referred to as a reference subject. For example, in some embodiments, the control reference subject does not have the disorder described herein. In some embodiments, the control subject may be deficient in the PARN gene (e.g., dyskeratosis congenita), while in other embodiments, the control subject may be deficient in cancer. In some cases, the control subject may be deficient in high telomerase activity, while in other cases, the control subject may be deficient in no substantial telomerase activity.

[0240] In some embodiments, the level of TERC or PARN in the subject is equal to or less than the reference level of TERC or PARN, indicating a clinical condition (e.g., a disorder described herein, such as a telomere disease). In some embodiments, the activity of TERC or PARN in the subject is equal to or greater than the reference activity level of TERC or PARN, indicating the absence of the disease.

[0241] The default value may depend on the specific population of the selected subject (e.g., human subject or animal model). For example, an apparently healthy population will have a different "normal" range of TERC levels than a population of subjects who have, may have, or are at high risk of having the disorders described herein. Therefore, the default value selected may take into account the category (e.g., gender, age, health, risk, presence of other diseases) that the subject (e.g., human subject) falls into. Appropriate ranges and categories can be selected by those skilled in the art through simple routine experimentation. Numerous default values ​​can be established for likelihood or risk characterization.

[0242] In some embodiments, the method described in the present disclosure involves identifying a subject who has, is at risk of developing, or is suspected of having a disorder associated with telomerase dysfunction. The method includes determining the level or activity of TERC, PARN, or PAPD5 in cells from the subject, comparing the level or activity of TERC, PARN, or PAPD5 with a reference level or activity of TERC, PARN, or PAPD5, and identifying the subject as having, is at risk of developing, or is suspected of having a disorder associated with telomerase dysfunction if the level or activity of TERC, PARN, or PAPD5 is significantly different from the reference level or activity of TERC, PARN, or PAPD5. In some embodiments, the reference level or activity of TERC, PARN, or PAPD5 is determined from cells obtained from a subject who does not have a disorder associated with telomerase dysfunction.

[0243] The level or activity of TERC, PARN, or PAPD5 can be determined in various cell types from a subject. The method can include obtaining cells from a subject and transforming these cells into induced pluripotent stem cell (I-IPS) cells, and these iPS cells can be used to determine the level or activity of TERC, PARN, or PAPD5. These cells can be, for example, primary human cells or tumor cells. Pluripotent stem cell (I-IPS) cells can be generated from somatic cells by methods known in the art (e.g., somatic cells can be genetically reprogrammed to an embryonic stem cell-like state by forcing them to express genes and factors important for maintaining the defining characteristics of embryonic stem cells). In some embodiments, the method for diagnosing a subject includes analyzing a blood sample from the subject, or a sample from the subject's hair, urine, saliva, or feces (e.g., a subject can be diagnosed without any cell culture surgically obtained from the subject).

[0244] The subject may have a mutation in PARN, for example, a deletion that includes a part of the PARN gene or the entire PARN gene.For example, the mutation may be a mutation in which the amino acid residue at position 7 of PARN is not asparagine or serine.For example, the subject may have a missense mutation c.19A>C, which causes the highly conserved amino acid p.Asn7His to be replaced.The subject may have a missense mutation c.260C>T, which encodes the highly conserved amino acid p.Ser87Leu to be replaced.

[0245] induced pluripotent stem cells Induced pluripotent stem cells (i-IPSCs or iPSCs) are somatic cells (e.g., derived from a patient's skin or other cells) that have been genetically reprogrammed into an embryonic stem cell-like state by forcing them to express genes and factors important for maintaining the defining characteristics of embryonic stem cells. These cells can be generated by methods known in the art.

[0246] Mouse iPSCs are known to exhibit key characteristics of pluripotent stem cells, including expressing stem cell markers, forming tumors containing cells from all three germ layers, and being able to contribute to many different tissues when injected into mouse embryos at a very early stage of development.

[0247] Human iPSCs also express stem cell markers and can generate cells characteristic of all three germ layers. iPSCs can be generated from human fibroblasts and are already useful tools for drug development and disease modeling. Viruses are currently used to introduce reprogramming factors into adult cells (e.g., the lentiviral vectors disclosed herein), a process that is carefully controlled and tested first in cultured, isolated cells, before the cells can be treated (e.g., by contacting them with test compounds) to express altered markers. For example, iPSCs from tumor cells can be engineered to differentiate, or iPSCs from cardiomyocytes can be engineered to dedifferentiate.

[0248] The iPSC manipulation strategy can be applied to any cells obtained from a subject to test whether a compound can alter the level or activity of TERC, PARN, or PAPD5. The cells are contacted with a test compound (e.g., a small molecule). In some embodiments, these iPSC cells can be used to screen for compounds that modulate TERC. In some embodiments, iPSC cells can be converted from patient skin fibroblasts.

[0249] Cell proliferation The present disclosure provides methods for expanding a cell population by culturing one or more cells in the presence of a compound disclosed herein (e.g., a compound of Formula (I), (II), (III), or (IV)). In some embodiments, expanding the cells can involve contacting the cells with an effective amount of a compound of the present disclosure (e.g., a PAPD5 inhibitor of Formula (I), (II), (III), or (IV)). PAPD5 inhibitors can reduce PAPD5 levels and activity, thereby increasing or maintaining telomere length. Telomerase activity and telomere length maintenance are related to cell proliferation. As cells divide, telomere length gradually shortens, eventually leading to cellular senescence. Based on the telomere theory, cellular senescence is irreversible. Programmed cell cycle arrest occurs in response to telomerase activity, and the total number of cell divisions cannot exceed a certain limit, called the Hayflick limit. Maintaining telomere length during cell replication has been determined to be important for cell proliferation (e.g., stem cell proliferation). The present disclosure provides methods for promoting cell proliferation and for inhibiting, slowing, or preventing cellular senescence.

[0250] In some embodiments, the cells are stem cells. Stem cells include, but are not limited to, pluripotent stem cells, embryonic stem cells, hematopoietic stem cells, adipose-derived stem cells, mesenchymal stem cells, umbilical cord blood stem cells, placenta-derived stem cells, exfoliated tooth-derived stem cells, hair follicle stem cells, or neural stem cells. In some embodiments, the cells are peripheral blood mononuclear (PBMC) cells.

[0251] The cell can be derived from a subject with any of the disorders described herein, such as cancer, telomere or telomerase dysfunction, age-related disorders, pre-leukemia or pre-cancerous conditions, and diseases or conditions associated with neurodevelopmental disorders.The cell can be isolated or derived from tissues such as pancreatic tissue, liver tissue, smooth muscle tissue, striated muscle tissue, cardiac muscle tissue, bone tissue, bone marrow tissue, bone cancellous tissue, cartilage tissue, liver tissue, pancreatic tissue, pancreatic duct tissue, spleen tissue, thymus tissue, lymph node tissue, thyroid tissue, epidermal tissue, dermal tissue, subcutaneous tissue, cardiac tissue, lung tissue, vascular tissue, endothelial tissue, blood cells, bladder tissue, kidney tissue, gastrointestinal tissue, esophageal tissue, stomach tissue, small intestinal tissue, large intestinal tissue, adipose tissue, uterine tissue, eye tissue, lung tissue, testicular tissue, ovarian tissue, prostate tissue, connective tissue, endocrine tissue, or mesenteric tissue.

[0252] Cells can be isolated from any mammalian organism, such as a human, mouse, rat, dog, or cat, by any means known to those skilled in the art. Those skilled in the art can isolate embryonic or adult tissue and obtain various cells (e.g., stem cells).

[0253] The expanded cell population can be further enriched by using appropriate cell markers.For example, stem cells can be enriched by using specific stem cell markers, such as FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4, and Sox-2.Those skilled in the art can enrich specific cell populations by using antibodies known in the art against any of these cell markers.In some embodiments, the expanded stem cells can be purified based on the desired stem cell marker by fluorescence-activated cell sorting (FACS) or magnetic-activated cell sorting (MACS).

[0254] Cells (eg, stem cells) can be cultured and expanded in a suitable growth medium. Commonly used growth media include Iscove's Modified Dulbecco's Medium (IMDM), McCoy's 5A Medium, Dulbecco's Modified Eagle's Medium (DMEM), KnockOut™ Dulbecco's Modified Eagle's Medium (KO-DMEM), Dulbecco's Modified Eagle's Medium / Nutrient Mixture F-12 (DMEM / F12), Roswell Park Memorial Institute (RPMI) medium, Minimum Essential Medium Alpha Medium (α-MEM), F-12K Nutrient Mixture Medium (Kaighn's Modification, F-12K), X-vivo™ 20 Medium, Stemline™ Medium, StemSpan™ CC100 Medium, StemSpan™ H2000 Medium, MCDB131 Medium, Basal Medium Eagle (BME), Glasgow Minimum Essential Medium (GMEM), Modified Eagle's Medium (MEM), Opti-MEM I Serum-Reduced Medium, Weymouth MB 752 / 1 Medium, Williams' Medium E, NCTC-109 Medium, and Neuroplasma These include, but are not limited to, BGJb medium, Brinstar BMOC-3 medium, Connaught Medical Research Laboratories (CMRL) medium, CO2-independent medium, and Leibovitz's L-15 medium.

[0255] The compounds of the present disclosure (e.g., compounds of Formula (I), (II), or (III)) can be used to grow various cell populations, for example, by adding the compound to cell culture medium in tubes or plates. The concentration of the compound can be determined by, but is not limited to, the time of cell growth. For example, cells can be cultured with a high concentration of the compound for a short period of time, for example, at least or about 1, 2, 3, 4, or 5 days. In some embodiments, cells can be cultured with a low concentration of the compound for a long period of time, for example, at least or about 3, 4, 5, 6 days, 1 week, 2 weeks, 3 weeks, or 4 weeks.

[0256] In some embodiments, growth factors are also added to the growth medium to allow cells to proliferate.Examples of suitable growth factors include, but are not limited to, thrombopoietin, stem cell factor, IL-1, IL-3, IL-7, flt-3 ligand, G-CSF, GM-CSF, Epo, FGF-1, FGF-2, FGF-4, FGF-20, IGF, EGF, NGF, LIF, PDGF, bone morphogenetic protein, activin-A, VEGF, forskolin, and glucocorticoid.In addition, those skilled in the art can add a feeder layer to the culture medium using methods known in the art.The feeder layer can include cells such as placental tissue or cells thereof.

[0257] The methods described herein can also be used to generate and expand chimeric antigen receptor (CAR) T cells. CAR-T cell therapy involves genetic modification of a patient's autologous T cells to express a CAR specific for a tumor antigen, followed by ex vivo cell expansion and reinfusion into the patient. PBMCs can be collected from the patient and cultured in the presence of a compound described herein (e.g., a compound of Formula (I), (II), (III), or (IV)) with an appropriate medium (e.g., complete medium containing 30 U / mL interleukin-2 and anti-CD3 / CD28 beads). Cells can be expanded for approximately 3 to 14 days (e.g., approximately 3 to 7 days). T cell subsets can be sorted by FACS. Gating strategies for cell sorting can exclude other blood cells, including granulocytes, monocytes, natural killer cells, dendritic cells, and B cells. Primary T cells are then transduced by incubating the cells with a CAR-expressing lentiviral vector in culture medium. In some embodiments, the culture medium may be supplemented with a compound described herein. The transduced cells are then cultured for at least several days (e.g., 3 days) before being used for CAR-T cell therapy.

[0258] In some embodiments, the disclosure provides a method of growing a cell, the method comprising culturing the cell in the presence of an effective amount of a compound described herein (e.g., a compound of Formula (I), (II), (III), or (IV)), or a pharmaceutically acceptable salt thereof.

[0259] In some embodiments, the cells are selected from the group consisting of stem cells, pluripotent stem cells, hematopoietic stem cells, and embryonic stem cells.

[0260] In some embodiments, the cells are pluripotent stem cells.

[0261] In some embodiments, the cells are hematopoietic stem cells.

[0262] In some embodiments, the cells are embryonic stem cells.

[0263] In some embodiments, the cells are collected from a subject having a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction, an aging-related disorder, a pre-leukemia or pre-cancerous condition, and a neurodevelopmental disorder.

[0264] In some embodiments, the method further comprises culturing the cells with a feeder layer in the medium.

[0265] In some embodiments, the cells have at least one stem cell marker selected from the group consisting of FLK-1, AC133, CD34, c-kit, CXCR-4, Oct-4, Rex-1, CD9, CD13, CD29, CD34, CD44, CD166, CD90, CD105, SH-3, SH-4, TRA-1-60, TRA-1-81, SSEA-4, and Sox-2.

[0266] In some embodiments, the stem cell marker is CD34.

[0267] In some embodiments, the method further comprises enriching for stem cells by isolating CD34+ cells.

[0268] In some embodiments, the subject is a mammal.

[0269] In some embodiments, the subject is a human.

[0270] In some embodiments, the method comprises culturing the cells in a medium selected from the group consisting of Iscove's Modified Dulbecco's Medium (IMDM) medium, Dulbecco's Modified Eagle's Medium (DMEM), Roswell Park Memorial Institute (RPMI) medium, Minimum Essential Medium Alpha Medium (α-MEM), Basal Medium Eagle's (BME) medium, Glasgow Minimum Essential Medium (GMEM), Modified Eagle's Medium (MEM), Opti-MEM I Serum-Reduced Medium, Neurotrophic Medium, CO2-Independent Medium, and Leibovitz's L-15 medium.

[0271] In some embodiments, the cells are chimeric antigen receptor (CAR) T cells.

[0272] In some embodiments, the cells are lymphocytes.

[0273] In some embodiments, the cells are T cells, engineered T cells, or natural killer cells (NK).

[0274] Pharmaceutical Compositions and Formulations The present application also provides a pharmaceutical composition comprising an effective amount of any one of the compounds disclosed herein or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable carrier. The pharmaceutical composition may also include at least one of any one of the additional therapeutic agents described herein. In certain embodiments, the present application also provides pharmaceutical compositions and dosage forms comprising any one of the additional therapeutic agents described herein (e.g., in a kit). A carrier is "acceptable" in the sense of being compatible with the other ingredients of the formulation and, in the case of a pharmaceutically acceptable carrier, not harmful to the recipient thereof in the amounts used in the pharmaceutical.

[0275] Pharmaceutically acceptable carriers, adjuvants, and vehicles that can be used in the pharmaceutical compositions of the present application include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, saturated vegetable fatty acids, water, salts, or partial glyceride mixtures of electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinylpyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.

[0276] A composition or dosage form can contain any one of the compounds and therapeutic agents described herein in the range of 0.005%-100%, with the remainder consisting of suitable pharmaceutically acceptable excipients. Contemplated compositions can contain 0.001%-100% of any one of the compounds provided herein and a therapeutic agent, in one embodiment 0.1-95%, in another embodiment 75-85%, and in a further embodiment 20-80%, with the remainder consisting of any pharmaceutically acceptable excipient described herein or any combination of these excipients.

[0277] Route of administration and dosage form Pharmaceutical compositions of the present application include those suitable for any accepted route of administration. Acceptable routes of administration include buccal, cutaneous, intracervical, endosinusial, intratracheal, enteral, epidural, intrainterstitial, intraabdominal, intraarterial, intrabronchial, intravesical, intracerebral, intracisternal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intranasal sinus, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumor, intrauterine, intravascular, intravenous, intranasal, nasogastric, oral, parenteral, percutaneous, epidural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral, ​​and vaginal.

[0278] The compositions and formulations described herein can be conveniently presented in unit dosage form, for example, tablets, capsules (e.g., hard or soft gelatin capsules), sustained-release capsules, and liposomes, and can be prepared by any method well known in the art of pharmacy.See, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore, MD (20th ed. 2000).Such preparation methods include bringing into association with the molecule to be administered ingredients, such as carriers, which constitute one or more accessory ingredients.In general, the compositions are prepared by uniformly and intimately associating the active ingredient with liquid carriers, liposomes, or finely divided solid carriers, or both, and then, if necessary, shaping the product.

[0279] In some embodiments, any one of the compounds and therapeutic agents disclosed herein is orally administered.The compositions of the present application suitable for oral administration can be presented as separate units such as capsules, sachets, granules, or tablets, each containing a predetermined amount (e.g., effective amount) of active ingredient; powder or granules; solution or suspension in aqueous or non-aqueous liquid; oil-in-water liquid emulsion; water-in-oil liquid emulsion; filled in liposome; or bolus.Soft gelatin capsules can be useful for containing such suspensions, which can beneficially increase the absorption rate of the compound.For oral tablets, commonly used carriers include lactose, sucrose, glucose, mannitol, and silicic acid and starch. Other acceptable excipients include: a) fillers or extenders such as starch, lactose, sucrose, glucose, mannitol, and silicic acid; b) binders such as carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia; c) humectants such as glycerol; d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; e) solution retardants such as paraffin; f) absorption accelerators such as quaternary ammonium compounds; g) wetting agents such as cetyl alcohol and glycerol monostearate; h) absorbents such as kaolin and bentonite clay; and i) talc, calcium stearate, magnesium stearate, solid polyethylene glycol, sodium lauryl sulfate, and mixtures thereof. For oral administration in capsule form, useful diluents include lactose and dried corn starch. When aqueous suspension is administered orally, active ingredient is combined with emulsifier and suspending agent.If desired, certain sweetener and / or flavoring agent and / or coloring agent can be added.The composition suitable for oral administration includes the lozenge that contains ingredients in flavor base, usually sucrose and acacia or tragacanth, and the troche that contains active ingredient in inactive base such as gelatin and glycerin, or sucrose and acacia.

[0280] Compositions suitable for parenteral administration include aqueous and non-aqueous sterile injection or infusion solutions that may contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, as well as aqueous and non-aqueous sterile suspensions that may contain suspending agents and thickening agents. The formulations may be presented in unit-dose or multi-dose containers, such as sealed ampoules and vials, and may be stored in a lyophilized (lyophilized) state, requiring only the addition of a sterile liquid carrier, such as water for injection, saline (e.g., 0.9% saline), or 5% dextrose solution, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets. Injectable solutions may be in the form of, for example, sterile injectable aqueous or oleaginous suspensions. The suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparations can also be sterile injectable solutions or suspensions in non-toxic parenterally acceptable diluents or solvents, for example, as solutions in 1,3-butanediol. Acceptable vehicles and solvents that can be used include mannitol, water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally used as solvents or suspending media. For this purpose, any bland fixed oil can be used, including synthetic mono- or diglycerides. Fatty acids such as oleic acid and its glyceride derivatives, especially in polyoxyethylated forms, are useful in the preparation of injectables, as are natural pharmaceutically acceptable oils such as olive oil or castor oil. These oil solutions or suspensions can also contain long-chain alcohol diluents or dispersants.

[0281] The pharmaceutical composition of the present application can be administered in the form of suppositories for rectal administration.These compositions can be prepared by mixing the compound of the present application with a suitable non-irritating excipient that is solid at room temperature but liquid at rectal temperature, and therefore melts in the rectum to release the active ingredient.Such materials include cocoa butter, beeswax, and polyethylene glycol.

[0282] The pharmaceutical compositions of the present application can be administered by nasal aerosol or inhalation. Such compositions can be prepared by techniques well known in the field of pharmaceutical formulation, and can be prepared as a solution in saline using benzyl alcohol or other suitable preservatives, absorption enhancers to increase bioavailability, fluorocarbons, and / or other solubilizers or dispersants known in the art. See, for example, U.S. Patent No. 6,803,031. Further formulations and methods for intranasal administration can be found in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci 11:1-18, 2000.

[0283] The topical compositions of the present disclosure can be prepared and used in the form of an aerosol spray, cream, emulsion, solid, liquid, dispersion, foam, oil, gel, hydrogel, lotion, mousse, ointment, powder, patch, pomade, solution, pump spray, stick, wet wipe, soap, or other forms commonly used in topical administration and / or cosmetic and skin care formulations. The topical composition can also be in emulsion form. Topical administration of the pharmaceutical compositions of the present application is particularly useful when the desired treatment involves areas or organs easily accessible by topical application. In some embodiments, the topical composition comprises any one of the compounds disclosed herein and a therapeutic agent in combination with one or more additional ingredients, carriers, excipients, or diluents including absorbents, anti-irritants, anti-acne agents, preservatives, antioxidants, colorants / pigments, emollients (moisturizers), emulsifiers, film formers / retentive agents, fragrances, leave-on exfoliants, prescription medications, preservatives, scrubbing agents, silicones, skin homogenizers / repair agents, slip agents, sunscreen actives, surfactants / detergent cleansers, penetration enhancers, and thickeners.

[0284] The compounds and therapeutic agents of the present application can be incorporated into compositions for coating implantable medical devices, such as prostheses, artificial valves, vascular grafts, stents, or catheters. Suitable coatings and the general preparation of coated implantable devices are known in the art and are exemplified in U.S. Patent Nos. 6,099,562, 5,886,026, and 5,304,121. The coating is typically a biocompatible polymeric material, such as a hydrogel polymer, polydimethylsiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate, and mixtures thereof. The coating can optionally be further covered with a suitable topcoat of fluorosilicone, polysaccharides, polyethylene glycol, phospholipids, or combinations thereof to impart controlled release properties to the composition. Coatings for invasive devices are included within the definition of pharmaceutically acceptable carrier, adjuvant, or vehicle, as these terms are used herein.

[0285] According to another embodiment, the present application provides an implantable drug-releasing device impregnated with or containing a compound or therapeutic agent, or a composition comprising a compound or therapeutic agent of the present application, such that the compound or therapeutic agent is released from the device and is therapeutically active.

[0286] Dosage and Regimen In the pharmaceutical compositions of the present application, the therapeutic compound is present in an effective amount (eg, a therapeutically effective amount).

[0287] The effective dose may vary depending on the condition being treated, the severity of the condition, the route of administration, the sex, age, and general health of the subject, the use of excipients, the possibility of co-administration with other therapeutic treatments such as the use of other drugs, and the judgment of the treating physician.

[0288] In some embodiments, an effective amount of a therapeutic compound can be, for example, about 0.001 mg / kg to about 500 mg / kg (e.g., about 0.001 mg / kg to about 200 mg / kg, about 0.01 mg / kg to about 200 mg / kg, about 0.01 mg / kg to about 150 mg / kg, about 0.01 mg / kg to about 100 mg / kg, about 0.01 mg / kg to about 50 mg / kg, about 0.01 mg / kg to about 10 mg / kg, about 0.01 mg / kg to about 5 mg / kg, about 0.01 mg / kg to about 1 mg / kg, about 0.0 The dose may be in the range of 1 mg / kg to about 0.5 mg / kg, about 0.01 mg / kg to about 0.1 mg / kg, about 0.1 mg / kg to about 200 mg / kg, about 0.1 mg / kg to about 150 mg / kg, about 0.1 mg / kg to about 100 mg / kg, about 0.1 mg / kg to about 50 mg / kg, about 0.1 mg / kg to about 10 mg / kg, about 0.1 mg / kg to about 5 mg / kg, about 0.1 mg / kg to about 2 mg / kg, about 0.1 mg / kg to about 1 mg / kg, or about 0.1 mg / kg to about 0.5 mg / kg.

[0289] In some embodiments, the effective amount of the therapeutic compound is about 0.1 mg / kg, about 0.5 mg / kg, about 1 mg / kg, about 2 mg / kg, or about 5 mg / kg.

[0290] The aforementioned dosages can be administered routinely (e.g., as a single dose or as two or more divided doses, e.g., once a day, twice a day, three times a day) or non-routinely (e.g., every other day, every two days, every three days, once a week, twice a week, every two weeks, once a month). The compounds and compositions described herein can be administered to a subject in any order. A first therapeutic agent, such as a compound of any one of the formulas disclosed herein, can be administered to a subject in need of treatment before or after (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 ​​hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before or after), or simultaneously with, the administration of a second therapeutic agent, such as an anticancer therapy described herein. Thus, a compound of any one of the formulas disclosed herein, or a composition containing the compound, can be administered separately, sequentially, or simultaneously with a second therapeutic agent, such as a chemotherapeutic agent described herein. When a compound of any one of the formulas disclosed herein, or a pharmaceutically acceptable salt thereof, and a second or third therapeutic agent are administered simultaneously to a subject, the therapeutic agents can be administered in a single dosage form (e.g., a tablet, capsule, or solution for injection or infusion).

[0291] Combination therapy In some embodiments, the compounds described herein can be administered to subjects in any combination with the treatment of telomere disease known in the art.The combination treatment can be administered to subjects sequentially or simultaneously with the compound of any one of the formulas disclosed herein.When the combination treatment includes an alternative therapeutic agent, the therapeutic agent can be administered to subjects in any one of the pharmaceutical compositions described herein.

[0292] In some embodiments, the compounds of the present disclosure may be used in combination with a therapeutic agent useful for treating telomere diseases (e.g., a therapeutic agent that modulates the level or activity of TERC). In some embodiments, the agent useful for treating telomere diseases is a nucleic acid comprising a nucleotide sequence encoding PARN. The agent may also be an anti-PARN antibody or an anti-PARN antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid specific to a nucleic acid encoding PARN. In some embodiments, the agent is a nucleic acid comprising a nucleotide sequence encoding PAPD5. The agent may also be an anti-PAPD5 antibody or an anti-PAPD5 antibody fragment. In some embodiments, the agent is an antisense molecule or a small interfering nucleic acid specific to a nucleic acid encoding PAPD5. The antisense molecules described herein may be oligonucleotides. In some cases, the agent binds to PARN or PAPD5.

[0293] In some embodiments, the therapeutic agent useful for treating telomere diseases is selected from adenosine analogs, aminoglycosides, purine nucleotides, and the like. In some cases, the aminoglycoside can be a member of the neomycin and kanamycin families. The aminoglycoside can be, for example, kanamycin B sulfate, puramycin sulfate, spectinomycin dihydrochloride pentahydrate, ribostamycin sulfate, sisomicin sulfate, amikacin disulfide, dihydrostreptomycin sesquisulfate, hygromycin B, netilmicin sulfate, paromomycin sulfate, kasugamycin, neomycin, gentamicin, tobramycin sulfate, streptomycin sulfate, or neomycin B, or a derivative thereof.

[0294] In some embodiments, therapeutic agents useful for treating telomere diseases are nucleoside analogs, such as adenosine analogs, 8-chloroadenosine (8-Cl-Ado) and 8-aminoadenosine (8-amino-Ado), or their triphosphate derivatives, synthetic nucleoside analogs having a fluoroglucopyranosyl sugar moiety, benzoyl-modified cytosine or adenine, adenosine and cytosine-based glucopyranosyl nucleoside analogs, or glucopyranosyl analogs having uracil, 5-fluorouracil, or thymine.

[0295] Adenosine analogs, aminoglycosides, and purine nucleotides are known in the art, and are described, for example, in Kim, Kyumin, et al., "Exosome Cofactors Connect Transcription Termination to RNA Processing by Guiding Terminated Transcripts to the Appropriate Exonuclease within the Nuclear Exosome," Journal of Biological Chemistry (2016): jbc-M116; Chen, Lisa S., et al., "Chain termination and inhibition of mammalian poly(A) polymerase by modified ATP analogues," Biochemical pharmacology 79.5 (2010): 669-677; Ren, Yan-Guo, et al., "Inhibition of Klenow DNA polymerase and poly(A)-specific ribonuclease by aminoglycosides," RNA 8.11 (2002): 1393-1400; Thuresson, Ann-Charlotte, Leif A. Kirsebom, and Anders Virtanen. “Inhibition of poly(A) polymerase by aminoglycosides.” Biochimie 89.10(2007):1221-1227, AA Balatsos, N., et al. “Modulation of poly(A)-specific ribonuclease (PARN): current knowledge and perspectives.” Current medicinal chemistry 19.28(2012):4838-4849, Balatsos, Nikolaos AA, Dimitrios Anastasakis, and Constantinos Stathopoulos."Inhibition of human poly(A)-specific ribonuclease (PARN) by purine nucleotides: kinetic analysis." Journal of enzyme inhibition and medicinal chemistry 24.2 (2009): 516-523; Balatsos, Nikolaos AA, et al. "Competitive inhibition of human poly(A)-specific ribonuclease (PARN) by synthetic fluoro-pyranosyl nucleosides." Biochemistry 48.26 (2009): 6044-6051; and Balatsos, Nikolaos, et al. "Kinetic and in silico analysis of the slow-binding inhibition of human poly(A)-specific ribonuclease (PARN) by novel nucleoside analogues." Biochimie 94.1 (2012): 214-221, each of which is incorporated herein by reference in its entirety. Numerous therapeutic agents capable of modulating the level or activity of PARN and / or PAPD5 are described, for example, in WO2017 / 066796, which is incorporated herein by reference in its entirety.

[0296] In some embodiments, the compounds of the present disclosure are used in combination with anti-cancer therapy. In some embodiments, the anti-cancer therapy is selected from the group consisting of surgery, radiation therapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, adjuvant therapy, and immunotherapy. In some embodiments, the anti-cancer therapy is selected from the group consisting of platinum agents, mitomycin C, poly(ADP-ribose) polymerase (PARP) inhibitors, radioisotopes, vinca alkaloids, anti-tumor alkylating agents, monoclonal antibodies, and antimetabolites. In some embodiments, the anti-cancer therapy is an ataxia telangiectasia mutated (ATM) kinase inhibitor. Suitable examples of platinum agents include cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin. Suitable examples of cytotoxic radioisotopes include: 67 Cu, 67 Ga, 90 Y, 131 I, 177 Lu, 186 Re, 188 Re, alpha particle emitter, 211 At, 213 Bi, 225 Ac, Auger electron emitter; 125 I, 212 Pb, and 111 Suitable examples of antitumor alkylating agents include nitrogen mustard, cyclophosphamide, mechlorethamine or mustine (HN2), uramustine or uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, nitrosoureas, carmustine, lomustine, streptozocin, alkyl sulfonates, busulfan, thiotepa, procarbazine, altretamine, triazenes, dacarbazine, mitozolomide, and temozolomide. Suitable examples of anti-cancer monoclonal antibodies include necitumumab, dinutuximab, nivolumab, blinatumomab, pembrolizumab, ramucirumab, obinutuzumab, adotrastuzumab emtansine, pertuzumab, brentuximab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, and tositumomab-I. 131Suitable examples of vinca alkaloids include vinblastine, vincristine, vindesine, vinorelbine, desoxyvincaminol, vincaminol, vinbrunin, vincamazine, vineridine, vinbrunin, and vinpocetine. Suitable examples of antimetabolites include fluorouracil, cladribine, capecitabine, mercaptopurine, pemetrexed, fludarabine, gemcitabine, hydroxyurea, methotrexate, neralbine, clofarabine, cytarabine, decitabine, pralatrexate, floxuridine, and thioguanine.

[0297] kit The present disclosure also includes pharmaceutical kits useful, for example, for treating the disorders, diseases, and conditions mentioned herein, which include one or more containers housing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. Such kits may further include one or more of various conventional pharmaceutical kit components, such as, for example, a container with one or more pharmaceutically acceptable carriers, additional containers, etc. Instructions indicating the amounts of components to be administered, administration guidelines, and / or guidelines for mixing the components, either as an insert or label, may also be included in the kit. The kit may optionally include instructions for conducting a test to determine whether a subject requires treatment with a compound of any one of Formulas (I)-(IV) described herein, and / or reagents and equipment for conducting such a test. The kit may also optionally include an additional therapeutic agent (e.g., a nucleic acid comprising a nucleotide sequence encoding PARN or PAPD5).

[0298] definition As used herein, the term "about" means "approximately" (eg, plus or minus about 10% of the indicated value).

[0299] At various places in the present specification, substituents of compounds of the invention are disclosed in groups or in ranges. It is specifically intended that the invention include any and all individual subcombinations of the members of such groups and ranges. For example, the term "C 1-6 "Alkyl" is specifically intended to individually disclose methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and C6 alkyl.

[0300] Various aryl, heteroaryl, cycloalkyl, and heterocycloalkyl rings are described in various places herein. Unless otherwise specified, these rings can be attached to the rest of the molecule at any ring member allowed by valence. For example, the term "pyridine ring" or "pyridinyl" can refer to a pyridin-2-yl, pyridin-3-yl, or pyridin-4-yl ring.

[0301] It will be further understood that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination.

[0302] The term "aromatic" refers to a carbocyclic or heterocyclic ring having one or more polyunsaturated rings that have aromatic character (i.e., have (4n+2) delocalized π (pi) electrons, where n is an integer).

[0303] The term "n-membered," where n is an integer, typically describes the number of ring-forming atoms in a moiety where n is the number of ring-forming atoms. For example, piperidinyl is an example of a 6-membered heterocycloalkyl ring, pyrazolyl is an example of a 5-membered heteroaryl ring, pyridyl is an example of a 6-membered heteroaryl ring, and 1,2,3,4-tetrahydro-naphthalene is an example of a 10-membered cycloalkyl group.

[0304] As used herein, the phrase "optionally substituted" means unsubstituted or substituted. The substituents are independently selected, and the substitution can be at any chemically accessible position. As used herein, the term "substituted" means that a hydrogen atom has been removed and replaced with a substituent. A single divalent substituent, for example, oxo, can replace two hydrogen atoms. It should be understood that substitution at a given atom is limited by the valence of the atom.

[0305] Through definition, the term "C n-m " indicates a range inclusive of the endpoints, and n and m are integers indicating the number of carbons. Examples include C 1-4 , C 1-6 These include:

[0306] As used herein, the term "C" when used alone or in combination with other terms n-m "Alkyl" refers to a saturated hydrocarbon group having n to m carbons, which may be straight-chained or branched. Examples of alkyl moieties include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl; and higher homologs such as 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl, and the like. In some embodiments, alkyl groups contain 1 to 6 carbon atoms, 1 to 4 carbon atoms, 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

[0307] As used herein, the term "C" when used alone or in combination with other terms n-m "Haloalkyl" refers to an alkyl group having 1 halogen atom to 2s+1 halogen atoms (which may be the same or different), where "s" is the number of carbon atoms in the alkyl group, and the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is exclusively fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0308] As used herein, "C n-m "Alkenyl" refers to an alkyl group having one or more double carbon-carbon bonds and having n to m carbons. Examples of alkenyl groups include, but are not limited to, ethenyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl, and the like. In some embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0309] As used herein, "C n-m "Alkynyl" refers to an alkyl group having one or more triple carbon-carbon bonds and having n to m carbons. Examples of alkynyl groups include, but are not limited to, ethynyl, propyn-1-yl, propyn-2-yl, and the like. In some embodiments, the alkynyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

[0310] As used herein, the term "C" when used alone or in combination with other terms n-m "Alkylene" refers to a divalent alkyl linking group having n to m carbons. Examples of alkylene groups include, but are not limited to, ethane-1,1-diyl, ethane-1,2-diyl, propane-1,1-diyl, propane-1,3-diyl, propane-1,2-diyl, butane-1,4-diyl, butane-1,3-diyl, butane-1,2-diyl, 2-methyl-propane-1,3-diyl, and the like. In some embodiments, the alkylene moiety contains 2 to 6, 2 to 4, 2 to 3, 1 to 6, 1 to 4, or 1 to 2 carbon atoms.

[0311] As used herein, the term "C" when used alone or in combination with other terms n-m"Alkoxy" refers to an alkyl group of formula -O-, where the alkyl group has n to m carbons. Examples of alkoxy groups include, but are not limited to, methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), butoxy (e.g., n-butoxy and tert-butoxy), and the like. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0312] As used herein, "C n-m "Haloalkoxy" refers to a group of the formula -O-haloalkyl having n to m carbon atoms. An example of a haloalkoxy group is OCF. In some embodiments, the haloalkoxy group is only fluorinated. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0313] As used herein, the term "amino" refers to a group of formula -NH2.

[0314] As used herein, the term "C n-m "Alkylamino" refers to a group of formula -NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylamino groups include, but are not limited to, N-methylamino, N-ethylamino, N-propylamino (e.g., N-(n-propyl)amino and N-isopropylamino), N-butylamino (e.g., N-(n-butyl)amino and N-(tert-butyl)amino), and the like.

[0315] As used herein, the term "di(C n-m "-N(alkyl)amino" refers to a group of formula -N(alkyl)2, where the two alkyl groups each independently have n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0316] As used herein, the term "C n-m "Alkoxycarbonyl" refers to a group of formula -C(O)O-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkoxycarbonyl groups include, but are not limited to, methoxycarbonyl, ethoxycarbonyl, propoxycarbonyl (e.g., n-propoxycarbonyl and isopropoxycarbonyl), butoxycarbonyl (e.g., n-butoxycarbonyl and tert-butoxycarbonyl), and the like.

[0317] As used herein, the term "C n-m "Alkylcarbonyl" refers to a group of formula -C(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of alkylcarbonyl groups include, but are not limited to, methylcarbonyl, ethylcarbonyl, propylcarbonyl (e.g., n-propylcarbonyl and isopropylcarbonyl), butylcarbonyl (e.g., n-butylcarbonyl and tert-butylcarbonyl), and the like.

[0318] As used herein, the term "C n-m "Alkylcarbonylamino" refers to a group of formula -NHC(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0319] As used herein, the term "C n-m "Alkylsulfonylamino" refers to an alkyl group of the formula -NHS(O)-, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0320] As used herein, the term "aminosulfonyl" refers to a group of formula -S(O)2NH2.

[0321] As used herein, the term "C n-m "Alkylaminosulfonyl" refers to a group of formula -S(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0322] As used herein, the term "di(C n-m "(Alkyl)aminosulfonyl" refers to a group of formula -S(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0323] As used herein, the term "aminosulfonylamino" refers to a group of formula -NHS(O)2NH2.

[0324] As used herein, the term "C n-m "Alkylaminosulfonylamino" refers to a group of formula -NHS(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0325] As used herein, the term "di(C n-m "NHS(O)N(alkyl)aminosulfonylamino" refers to a group of formula -NHS(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0326] As used herein, the term "aminocarbonylamino," employed alone or in combination with other terms, refers to a group of formula -NHC(O)NH2.

[0327] As used herein, the term "C n-m"Alkylaminocarbonylamino" refers to a group of formula -NHC(O)NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0328] As used herein, the term "di(C n-m "NHC(O)N(alkyl)aminocarbonylamino" refers to a group of formula -NHC(O)N(alkyl), where each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0329] As used herein, the term "carbamyl" refers to a group of formula -C(O)NH2.

[0330] As used herein, the term "C n-m "Alkylcarbamyl" refers to a group of formula -C(O)-NH(alkyl), where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0331] As used herein, the term "di(C n-m "-C(O)N(alkyl)carbamyl" refers to a group of formula -C(O)N(alkyl), where the two alkyl groups each independently have n to m carbon atoms. In some embodiments, each alkyl group independently has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0332] As used herein, the term "thio" refers to a group of formula -SH.

[0333] As used herein, the term "C n-m "Alkylthio" refers to a group of formula -S-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0334] As used herein, the term "C n-m "Alkylsulfinyl" refers to a group of formula -S(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0335] As used herein, the term "C n-m "Alkylsulfonyl" refers to a group of formula -S(O)-alkyl, where the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

[0336] As used herein, the term "carbonyl," employed alone or in combination with other terms, refers to a -C(=O)- group, which may also be written as C(O).

[0337] As used herein, the term "carboxy" refers to the group --C(O)OH.

[0338] As used herein, the term "cyano-C 1-3 "Alkyl" means a group of the formula -(C 1-3 refers to the group alkylene-CN.

[0339] As used herein, the term "HO-C 1-3 "Alkyl" means a group of the formula -(C 1-3 refers to the group alkylene-OH.

[0340] As used herein, "halo" refers to F, Cl, Br, or I. In some embodiments, halo is F, Cl, or Br.

[0341] As used herein, the term "aryl," used alone or in combination with other terms, refers to an aromatic hydrocarbon group that can be monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings). n-m"Aryl" refers to an aryl group having n to m ring carbon atoms. Examples of aryl groups include phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl, and the like. In some embodiments, an aryl group has 6 to 10 carbon atoms. In some embodiments, an aryl group is phenyl or naphthyl.

[0342] As used herein, "cycloalkyl" refers to a non-aromatic cyclic hydrocarbon, including cyclized alkyl and / or alkenyl groups. Cycloalkyl groups can include monocyclic or polycyclic (e.g., having 2, 3, or 4 fused rings) groups and spirocycles. The ring-forming carbon atoms of a cycloalkyl group can be optionally substituted by one or two independently selected oxo or sulfido groups (e.g., C(O) or C(S)). The definition of cycloalkyl also includes moieties having one or more aromatic rings fused to (i.e., having a common bond with) the cycloalkyl ring, e.g., benzo or thienyl derivatives such as cyclopentane, cyclohexane, etc. Cycloalkyl groups containing fused aromatic rings can be bonded through any ring-forming atom, including the ring-forming atoms of the fused aromatic ring. Cycloalkyl groups can have 3, 4, 5, 6, 7, 8, 9, or 10 ring-forming carbon atoms (C 3-10 In some embodiments, cycloalkyl can have C 3-10 In some embodiments, the cycloalkyl is a monocyclic or bicyclic cycloalkyl. 3-7 Monocyclic cycloalkyl. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopentenyl, cyclohexenyl, cyclohexadienyl, cycloheptatrienyl, norbornyl, norpinyl, norcarnyl, adamantyl, and the like. In some embodiments, the cycloalkyl is cyclopropyl, cyclobutyl, cyclopentyl, or cyclohexyl.

[0343] As used herein, "heteroaryl" refers to a monocyclic or polycyclic aromatic heterocycle having at least one heteroatom ring member selected from sulfur, oxygen, and nitrogen. In some embodiments, the heteroaryl ring has 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, any ring-forming N in the heteroaryl moiety can be an N-oxide. In some embodiments, the heteroaryl is a 5-10-membered monocyclic or bicyclic heteroaryl having 1, 2, 3, or 4 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5-6 monocyclic heteroaryl having 1 or 2 heteroatom ring members independently selected from nitrogen, sulfur, and oxygen. In some embodiments, the heteroaryl is a 5- or 6-membered heteroaryl ring. A 5-membered heteroaryl ring is a heteroaryl having a ring with 5 ring atoms, where one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary 5-membered heteroaryls are thienyl, furyl, pyrrolyl, imidazolyl, thiazolyl, oxazolyl, pyrazolyl, isothiazolyl, isoxazolyl, 1,2,3-triazolyl, tetrazolyl, 1,2,3-thiadiazolyl, 1,2,3-oxadiazolyl, 1,2,4-triazolyl, 1,2,4-thiadiazolyl, 1,2,4-oxadiazolyl, 1,3,4-triazolyl, 1,3,4-thiadiazolyl, and 1,3,4-oxadiazolyl. A 6-membered heteroaryl ring is a heteroaryl having a ring with 6 ring atoms, wherein one or more (e.g., 1, 2, or 3) ring atoms are independently selected from N, O, and S. Exemplary 6-membered heteroaryls are pyridyl, pyrazinyl, pyrimidinyl, triazinyl, and pyridazinyl.

[0344] As used herein, "heterocycloalkyl" refers to a non-aromatic monocyclic or polycyclic heterocycle having one or more ring-forming heteroatoms selected from O, N, or S. Heterocycloalkyl includes monocyclic 4-, 5-, 6-, 7-, 8-, 9-, or 10-membered heterocycloalkyl groups. Heterocycloalkyl groups can also include spirocycles. Examples of heterocycloalkyl groups include pyrrolidin-2-one, 1,3-isoxazolidin-2-one, pyranyl, tetrahydropyran, oxetanyl, azetidinyl, morpholino, thiomorpholino, piperazinyl, tetrahydrofuranyl, tetrahydrothienyl, piperidinyl, pyrrolidinyl, isoxazolidinyl, isothiazolidinyl, pyrazolidinyl, oxazolidinyl, thiazolidinyl, imidazolidinyl, azepanyl, benzazapene, and the like. The ring-forming carbon atoms and heteroatoms of a heterocycloalkyl group can be optionally substituted with one or two independently selected oxo or sulfido groups (e.g., C(O), S(O), C(S), or S(O)). A heterocycloalkyl group can be bonded through a ring-forming carbon atom or ring-forming heteroatom. In some embodiments, a heterocycloalkyl group contains zero to three double bonds. In some embodiments, a heterocycloalkyl group contains zero to two double bonds. Also included within the definition of heterocycloalkyl are moieties having one or more aromatic rings fused to (i.e., sharing a bond with) a cycloalkyl ring, e.g., benzo or thienyl derivatives such as piperidine, morpholine, azepine, and the like. Heterocycloalkyl groups containing fused aromatic rings can be bonded through any ring-forming atom, including a ring-forming atom of the fused aromatic ring. In some embodiments, a heterocycloalkyl is a monocyclic 4- to 6-membered heterocycloalkyl having one or two heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members. In some embodiments, the heterocycloalkyl is a monocyclic or bicyclic 4-10 membered heterocycloalkyl having 1, 2, 3, or 4 heteroatoms independently selected from nitrogen, oxygen, or sulfur and having one or more oxidized ring members.

[0345] In certain places, definitions or embodiments refer to specific rings (e.g., azetidine rings, pyridine rings, etc.). Unless otherwise specified, these rings can be attached to any ring member, provided that the valence of the atom is not exceeded. For example, an azetidine ring can be attached at any position on the ring, while a pyridin-3-yl ring is attached at the 3-position.

[0346] As used herein, the term "oxo" refers to an oxygen atom as a divalent substituent, which forms a carbonyl group when attached to carbon (e.g., C=O) or a sulfoxide or sulfone group when attached to a heteroatom.

[0347] The term "compound," as used herein, is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures depicted. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise specified.

[0348] The compounds described herein may be asymmetric (e.g., have one or more stereocenters). Unless otherwise specified, all stereoisomers, such as enantiomers and diastereomers, are intended. Compounds of the present invention containing asymmetrically substituted carbon atoms can be isolated in optically active or racemic forms. Methods on how to prepare optically active forms from optically inactive starting materials are known in the art, such as by resolution of racemic mixtures or stereoselective synthesis. Many geometric isomers of olefins, C=N double bonds, N=N double bonds, and the like may also be present in the compounds described herein, and all such stable isomers are contemplated in the present invention. Cis and trans geometric isomers of the compounds of the present invention are described and can be isolated as a mixture of isomers or as separated isomeric forms. In some embodiments, the compounds have the (R)-configuration. In some embodiments, the compounds have the (S)-configuration.

[0349] The compounds provided herein also include tautomeric forms. Tautomeric forms result from the exchange of a single bond with an adjacent double bond, along with the simultaneous migration of a proton. Tautomeric forms include prototropic tautomers, which are isomeric protonation states with the same empirical formula and total charge. Examples of prototropic tautomers include ketone-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs, and cyclic forms in which protons can occupy more than one position in the heterocyclic ring system, such as 1H- and 3H-imidazole, 1H-, 2H-, and 4H-1,2,4-triazole, 1H- and 2H-isoindole, and 1H- and 2H-pyrazole. Tautomeric forms can be in equilibrium or can be sterically fixed into one form by appropriate substitution.

[0350] As used herein, the term "cell" is meant to refer to a cell that is in vitro, ex vivo, or in vivo. In some embodiments, an ex vivo cell may be part of a tissue sample excised from an organism, such as a mammal. In some embodiments, an in vitro cell may be a cell in cell culture. In some embodiments, an in vivo cell is a cell that is present in an organism, such as a mammal.

[0351] As used herein, the term "contacting" refers to bringing the indicated moieties together in an in vitro system or in vivo system. For example, "contacting" PAPD5 with a compound of the present invention includes administering the compound of the present invention to an individual or patient, such as a human, having PAPD5, and also includes, for example, introducing the compound of the present invention into a sample containing cells or purified preparations containing PAPD5.

[0352] As used herein, the terms "individual," "patient," or "subject," used interchangeably, refer to any animal, including a mammal, preferably a mouse, rat, other rodent, rabbit, dog, cat, pig, cow, sheep, horse, or primate, most preferably a human.

[0353] As used herein, the phrase "effective amount" or "therapeutically effective amount" refers to the amount of an active compound or agent that elicits the biological or medicinal response in a tissue, system, animal, individual, or human that is desired by a researcher, veterinarian, physician, or other clinician.

[0354] As used herein, the term "treating" or "treatment" refers to 1) inhibiting a disease, e.g., inhibiting a disease, condition, or disorder in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder (i.e., halting further development of the pathology and / or symptomology), or 2) ameliorating a disease, e.g., ameliorating a disease, condition, or disorder in an individual experiencing or exhibiting the pathology or symptomology of the disease, condition, or disorder (i.e., reversing the pathology and / or symptomology).

[0355] As used herein, the term "preventing" or "prevention" of a disease, condition, or disorder refers to reducing the risk of development of the disease, condition, or disorder in a subject or group of subjects (e.g., a subject or group of subjects predisposed to or susceptible to the disease, condition, or disorder). In some embodiments, preventing a disease, condition, or disorder refers to reducing the likelihood of acquiring the disease, condition, or disorder, and / or its associated symptoms. In some embodiments, preventing a disease, condition, or disorder refers to completely or nearly completely halting the development of the disease, condition, or disorder. [Example]

[0356] Example 1 - Inhibition of recombinant PAPD5 Recombinant PAPD5 and catalytically inactive mutant PAPD5 (D189A, D191A) were purified for in vitro assays. The in vitro RNA polyadenylation assay using recombinant PAPD5, ATP, and oligonucleotide substrates utilized the following phenomenon: ATP utilization by PAPD5 was read out as a decrease in the luminescence signal produced by luciferase (KinaseGlo, Promega, Madison, WI).

[0357] 0.25 μl of PAPD5 in a buffer composition at a concentration of 50 nM was added to wells of a microtiter plate (e.g., Product No. 3820; non-binding surface; Corning Incorporated, Corning, NY) using a Thermo MultiDrop Combi (Thermo Fisher Scientific, Waltham, MA). For the positive control (e.g., wells A24:P24 in the multiwell plate), 0.5 μl of mutant PAPD5 was added at a concentration of 50 nM.

[0358] 100 nl of compound dissolved in DMSO was transferred to each well of the assay plate via pin transfer. For negative control wells, DMSO alone was added. The plate was gently vortexed for 5 seconds and then incubated at room temperature for 2 hours.

[0359] After 2 hours, 5 μl of luciferase (Promega KinaseGlo, Madison, WI) was added using a MultiDrop Combi (Thermo Fisher Scientific, Waltham, MA). The mixture was gently vortexed for 5 seconds and incubated at room temperature for 10 minutes. The plate was rotated for 1 minute before luminescence measurements. Luminescence measurements were quantified using a PerkinElmer EnVision™ plate reader.

[0360] The fold change was calculated for 100 μM and 33 μM compounds. For a particular compound, the fold change was also determined at concentrations of 10 μM, 3.3 μM, and 1 μM. The fold change is the ratio of luminescence from samples with inhibitor compared to samples with DMSO (higher numbers indicate greater inhibition).

[0361] Referring to Figures 3-6, compound 1 (also referred to as 32A) is a compound having the following formula: [ka]

[0362] Example 2 A qualitative measure of RNA oligo elongation inhibition for the tested compounds, expressed as a range from minimal activity (0) to compound 1 (+++), and the results of the DSF binding assay (shown as temperature shift at 100 μM compound) are shown in Table 2 below. [Table 2]

[0363] Example 3 - Preparation of Compound 1A [ka] Synthesis of 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]pyridine-3-carboxylic acid: To a sealed tube was added ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 equiv.), AcOH (4.70 mg, 78.21 μmol, 4.47 μL, 0.25 equiv.), 2-aminopyridine-3-carboxylic acid (129.63 mg, 938.49 μmol, 3 equiv.), and DMF (4 mL). The sealed tube was then stirred at 130° C. for 0.5 h under microwave heating. LCMS indicated that starting material remained and the desired product had formed. The mixture was filtered, and the filtrate was directly purified. The filtrate was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 m MNH4HCO3)-ACN]; B%: 20% to 70%, 8 min. 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]pyridine-3-carboxylic acid (2.24 mg, 5.10 μmol, 1.63% yield, 95.96% purity) was obtained as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=9.38(s, 1H), 8.49(d, J=1.6Hz, 1H), 8.38(d, J=1.6Hz, 1H), 8.36(d, J=10.8Hz, 1H), 8.35(s, 1H), 8. 32-8.01(m, 1H), 7.48-7.23(m, 2H), 6.81-6.78(m, 1H), 4.23(1, J=6.8Hz, 2H), 1.07(t, J=7.2Hz, 1H). MS(M+H) + =422.0.

[0364] Example 4 - Preparation of Compound 5A [ka] Step 1—Synthesis of 5-bromothiazole-4-carboxylic acid: To a stirred solution of ethyl 5-bromothiazole-4-carboxylate (3.7 g, 15.67 mmol, 1 equiv.) in MeOH (20 mL), THF (20 mL), and HO (20 mL) was added NaOH (2 M, 23.51 mL, 3 equiv.). The mixture was then stirred at 20 °C for 1 h. TLC (petroleum ether:ethyl acetate (=20 / 1)) showed that the starting material was completely consumed. 6 N HCl was added to adjust the mixture to pH = 3, then filtered. The filter cake was dried in vacuo. 5-bromothiazole-4-carboxylic acid (2.8 g, 13.46 mmol, 85.88% yield) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=13.38(brs, 1H), 9.14(s, 1H).

[0365] [ka] Step 2 - Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: To a solution of 5-bromothiazole-4-carboxylic acid (1.7 g, 8.17 mmol, 1 equiv.) in dioxane (20 mL), 1,1-ditertbutoxy-N,N-dimethyl-methanamine (1.66 g, 8.17 mmol, 1.96 mL, 1 equiv.) was added dropwise and then stirred at 100 °C for 2 h. TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.43) indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-10% ethyl acetate in petroleum ether, gradient over 30 min). TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.43). tert-Butyl 5-bromothiazole-4-carboxylate (1.6 g, 6.06 mmol, 74.14% yield) was obtained as a yellow oil. 1 H NMR (400MHz, DMSO-d6) δ=8.76(s, 1H), 1.64(s, 9H).

[0366] [ka] Step 3—Synthesis of tert-butyl 5-(benzhydrylideneamino)thiazole-4-carboxylate: To a stirred solution of tert-butyl 5-bromothiazole-4-carboxylate (2 g, 7.57 mmol, 1 equiv.) in toluene (20 mL), CsCO (4.93 g, 15.14 mmol, 2 equiv.), Xantphos (788.61 mg, 1.36 mmol, 0.18 equiv.), Pd(dba) (346.68 mg, 378.59 μmol, 0.05 equiv.), and diphenylmethanimine (2.06 g, 11.36 mmol, 1.91 mL, 1.5 equiv.) were added. The mixture was then stirred at 80 °C for 16 h. TLC (petroleum ether:ethyl acetate (=3 / 1)) showed that the starting material was completely consumed and a new spot was formed. The solvent was removed in vacuo to give a residue. The residue was dissolved in ethyl acetate (30 mL), washed with water (20 mL), dried over anhydrous sodium sulfate, and concentrated to give the crude product. The crude product was purified by column chromatography (SiO, petroleum ether / ethyl acetate = 1 / 0 to 10 / 1). tert-Butyl 5-(benzhydrylideneamino)thiazole-4-carboxylate (2.3 g, 6.31 mmol, 83.35% yield) was obtained as a yellow solid. 1 H NMR (400 MHz, chloroform-d) δ = 8.29 (s, 1H), 7.88-7.81 (m, 2H), 7.51-7.40 (m, 6H), 7.26-7.15 (m, 2H), 1.55 (s, 9H).

[0367] [ka] Step 4—Synthesis of tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylate: To a stirred solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (400 mg, 1.25 mmol, 1 equiv.) in DMF (5 mL), tert-butyl 5-aminothiazole-4-carboxylate (375.88 mg, 1.88 mmol, 1.5 equiv.) and Na2CO3 (265.25 mg, 2.50 mmol, 2 equiv.) were added. The mixture was then stirred at 110 °C for 5 hours. LCMS showed that the desired product had formed. The mixture was poured into water (20 mL) and extracted with ethyl acetate (20 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. The residue was purified by flash column (ISCO 10 g silica, 0 to 30% ethyl acetate in petroleum ether, gradient over 20 min) to give tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylate (370 mg, 765.32 μmol, 61.16% yield) as a yellow solid. 1 H NMR (400 MHz, chloroform-d) δ = 11.24 (s, 1H), 9.37 (s, 1H), 8.18 (d, J = 9.2 Hz, 1H), 8.10 (s, 1H), 7.77 (s, 1H), 7.66 (br d, J = 8.0 Hz, 1H), 4.51 (q, J = 7.2 Hz, 2H), 1.71 (s, 9H), 1.46 (t, J = 7.2 Hz, 3H).

[0368] [ka] Step 5—Synthesis of 5-((3-(ethoxycarbonyl)-6-(trifluoromethoxy)quinolin-4-yl)amino)thiazole-4-carboxylic acid: To a stirred solution of tert-butyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolinyl]amino]thiazole-4-carboxylate (140 mg, 289.58 μmol, 1 equiv.) in DCM (1 mL) was added TFA (1 mL). The mixture was then stirred at 25 °C for 1 h. LCMS showed that the starting material was completely consumed and the desired product was formed. DMF (3 mL) was added to the mixture. A portion of the TFA was removed in vacuo. The solution was purified by preparative HPLC: Column: Phenomenex Luna C18 100 × 30 mm × 5 μm; Mobile phase: [water (0.1% TFA)-ACN], B%: 10% to 45%, 12 min. 5-[[3-Ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylic acid (25 mg, 38.35 μmol, 13.24% yield, 83.04% purity, TFA) was obtained as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=8.92(br s, 1H), 8.45(s, 1H), 8.20-7.97(m, 2H), 7.86(br d, J=8.0Hz, 1H), 4.24-4.05(m, 2H), 1.21(br t, J=6.9Hz, 3H). MS(M+H) + =428.0.

[0369] Example 5 - Preparation of Compound 10A [ka] Step 1—Synthesis of ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (0.2 mg, 625.66 μmol, 1 equiv.) and 2-aminobenzonitrile (147.83 mg, 1.25 mmol, 2.0 equiv.) in ACN (3 mL) was stirred at 90 °C for 16 h. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by flash column (ISCO 12 g silica, 0–50% ethyl acetate in petroleum ether, gradient over 20 min, 1 / 400 TEA) to give ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate (0.2 g, 498.33 μmol, 79.65% yield) as a yellow solid. MS(M+H) + =402.0

[0370] [ka] Step 2—Synthesis of ethyl 4-[2-(2H-tetrazol-5-yl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate: To a stirred solution of ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate (150 mg, 373.75 μmol, 1 equiv.) and NH₄Cl (199.92 mg, 3.74 mmol, 10 equiv.) in DMF (2 mL), NaN₃ (121.49 mg, 1.87 mmol, 5 equiv.) was added and stirred at 100° C. for 14 hours. LCMS showed approximately 65% ​​of the desired product, with approximately 25% of the starting material detected. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column: 10% to 40% acetonitrile in 0.04% ammonia solution and 10 mM NH4HCO3 in water, 10 min gradient) to give ethyl 4-[2-(2H-tetrazol-5-yl)anilino]-6-(trifluoromethoxy)quinoline-3-carboxylate (34.27 mg, 75.27 μmol, 20.14% yield, 97.6% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=10.83(br s, 1H), 9.07(s, 1H), 8.22-8.00(m, 2H), 7.87-7.65(m, 2H), 7.38-7.24(m, 2H), 6.94(d, J=8.1Hz, 1H), 4.15(br s, 2H), 1.18(t, J=7.1Hz, 3H). MS(M+H) + =445.0.

[0371] Example 6 - Preparation of Compound 12A [ka] Step 1—Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A stirred solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (300 mg, 1.10 mmol, 1 equiv.) in POCl3 (3 mL) was heated to 100 °C and stirred for 1 h. LCMS showed no starting material remained. The mixture was cooled to room temperature and concentrated in vacuo. The residue was dissolved in toluene (3 mL × 2) and concentrated in vacuo to dryness to give 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (335.2 mg, crude) as a brown gum.

[0372] [ka] Step 2 - Synthesis of methyl 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide: To a solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (330 mg, 1.06 mmol, 1 equiv.) in DCM (3 mL), TEA (429.05 mg, 4.24 mmol, 590.16 μL, 4 equiv.) and N-methylmethanamine (77.79 mg, 954.00 μmol, 87.41 μL, 0.9 equiv., HCl) were added at 0 °C, followed by stirring at 0 °C for 0.5 h. LCMS showed the reaction was complete. Water (3 mL) was added to the above solution, separated, and extracted with DCM (5 mL × 2). The combined organic layers were washed with water (3 mL), dried over NaSO, and concentrated in vacuo to give 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide (230.2 mg, crude) as a brown oil. MS (M+H) + =319.1.

[0373] [ka] Step 3—Synthesis of 2-[[3-(dimethylcarbamoyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: A solution of 4-chloro-N,N-dimethyl-6-(trifluoromethoxy)quinoline-3-carboxamide (110 mg, 345.18 μmol, 1 equiv.) and 2-aminobenzoic acid (56.80 mg, 414.21 μmol, 1.2 equiv.) in ACN (4 mL) was stirred at 90° C. for 14 hours. LCMS showed the reaction was complete and the desired product was detected. The mixture was concentrated in vacuo and dissolved in MeOH (2 mL). The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column, 1% to 30% acetonitrile in 0.04% ammonia solution and 10 mM NH4HCO3 in water, 10 min gradient) to give 2-[[3-(dimethylcarbamoyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (67.29 mg, 152.20 μmol, 44.09% yield, 94.85% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=12.00(br s, 1H), 8.68(s, 1H), 8.13(d, J=9.0Hz, 1H), 8.00-7.91(m, 2H), 7.79(br d, J=8.8Hz, 1H), 7.38(br s, 1H), 7.23(t, J=7.6Hz, 1H), 6.90(t, J=7.4Hz, 1H), 6.72(d, J=8.2Hz, 1H), 2.72(s, 3H), 2.56(s, 3H). MS(M+H) + =420.0

[0374] Example 7 - Preparation of Compound 13A [ka] Step 1—Synthesis of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid: A suspension of ethyl 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylate (500 mg, 1.66 mmol, 1 equiv.) in NaOH (2 M, 12.50 mL, 15.06 equiv.) was stirred at 90 °C for 1 h. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was cooled to 0 °C, and 4 N HCl was added to adjust the pH to 6–7, then filtered. The filter cake was dried in vacuo. 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (450 mg, 1.65 mmol, 99.24% yield) was obtained as a white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.81(s, 1H), 8.01(s, 1H), 7.84(d, J=9.2Hz, 1H), 7.64(d, J=8.0Hz, 1H). MS(MH)-=271.9.

[0375] [ka] Step 2—Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (200 mg, 732.16 μmol, 1 equiv.) in POCl3 (2 mL) was stirred at 100 °C for 1 h. LCMS (sample quenched with MeOH at low temperature) showed complete consumption of the starting material and formation of the desired product. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (3 mL × 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (200 mg, crude) was obtained as a brown solid.

[0376] [ka] Step 3—Synthesis of [4-chloro-6-(trifluoromethoxy)-3-quinolyl]-morpholino-methanone: To a stirred solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (100 mg, 322.52 μmol, 1 equiv.) in DCM (3 mL), TEA (97.91 mg, 967.57 μmol, 134.67 μL, 3.0 equiv.) and morpholine (25.29 mg, 290.27 μmol, 25.54 μL, 0.9 equiv.) were added at 0° C. The mixture was then stirred at 0° C. for 0.5 h. LCMS indicated that the starting material was completely consumed and the desired product was formed. The mixture was quenched with water (5 mL) at 0° C. and extracted with DCM (5 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. [4-Chloro-6-(trifluoromethoxy)-3-quinolyl]-morpholino-methanone (90 mg, crude) was obtained as a yellow solid. MS (M+H) + =361.1.

[0377] [ka] Step 4—Synthesis of 2-[[3-(morpholine-4-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: To a stirred solution of [4-chloro-6-(trifluoromethoxy)-3-quinolyl]-morpholino-methanone (90 mg, 249.50 μmol, 1 equiv.) in CH3CN (3 mL), 2-aminobenzoic acid (47.90 mg, 349.31 μmol, 1.4 equiv.) was added. The mixture was then stirred at 90 °C for 12 h. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: Column: Welch Xtimate C18 150 × 30 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 10% to 50%, 8 min. Obtained 2-[[3-(morpholine-4-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (51.07 mg, 110.69 μmol, 44.36% yield, 100.00% purity) as a yellow solid.1 H NMR (400MHz, DMSO-d6) δ=13.20(brs, 1H), 10.74(brs, 1H), 8.78(s, 1H), 8.19(d, J=9.2Hz, 1H), 8.96(d, J=7.2Hz, 1H), 7.93(s, 1H), 7 .83(d, J=8.8Hz, 1H), 7.32(t, J=8.0Hz, 1H), 6.95(t, J=7.6Hz, 1H), 6.72(d, J=8.4Hz, 1H), 3.85-3.23(m, 8H). MS(M+H) + =428.0.

[0378] Example 8 - Preparation of Compound 14A [ka] Step 1—Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (500 mg, 1.83 mmol, 1 equiv.) in POCl3 (2 mL) was stirred at 100 °C for 1 h. LCMS (sample quenched with MeOH at low temperature) showed complete consumption of the starting material and formation of the desired product. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (5 mL × 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (500 mg, crude) was obtained as a brown gum.

[0379] [ka] Step 2—Synthesis of tert-butyl 4-(4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl)piperazine-1-carboxylate: To a stirred solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (500 mg, 1.61 mmol, 1 equiv.) in DCM (7 mL), TEA (489.54 mg, 4.84 mmol, 673.37 μL, 3.0 equiv.) and tert-butyl piperazine-1-carboxylate (270.32 mg, 1.45 mmol, 0.9 equiv.) were added at 0–5 °C. The mixture was then stirred at 0–5 °C for 0.5 h. LCMS indicated that the starting material was completely consumed and the desired product was formed. The mixture was quenched with water (6 mL) at 0 °C and extracted with DCM (5 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product: tert-butyl 4-[4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl]piperazine-1-carboxylate (630 mg, crude) as a brown solid. MS (M+H) + =460.1.

[0380] [ka] Step 3—Synthesis of 2-[[3-(4-tert-butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: A solution of tert-butyl 4-[4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl]piperazine-1-carboxylate (300 mg, 652.39 μmol, 1 equiv.) and 2-aminobenzoic acid (107.36 mg, 782.87 μmol, 1.2 equiv.) in CH3CN (5 mL) was stirred at 90 °C for 40 h. LCMS showed the desired product was formed. The mixture was concentrated to give the crude product. 2-[[3-(4-tert-butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (450 mg, crude) was obtained as a brown solid. MS (M+H) + =561.2.

[0381] [ka] Step 4—Synthesis of 2-[[3-((piperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: To a stirred solution of 2-[[3-(4-tert-butoxycarbonylpiperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (170 mg, 303.29 μmol, 1 equiv.) in ethyl acetate (2 mL) was added 4N HCl / EtOAc (2 mL). The mixture was then stirred at 20° C. for 3 h. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: Column: Phenomenex Luna C18 Purification was performed using a 150 x 30 mm x 5 μm column; mobile phase: [water (0.04% HCl)-ACN], B%: 15%-40%, over 10 min. 2-[[3-(piperazine-1-carbonyl)-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (63.81 mg, 138.30 μmol, 45.60% yield, 99.79% purity) was obtained as a yellow solid. 1 H NMR (400MHz, Methol-d4) δ=8.76(s, 1H), 8.52(s, 1H), 8.21(d, J=6.4Hz, 1H), 8.16(d, J=9.2Hz, 1H), 8.01(d, J=8.8Hz, 1H), 7.67 (t, J=8.0Hz, 1H), 7.50(t, J=9.2Hz, 1H), 7.39(d, J=8.0Hz, 1H), 3.56-3.32(m, 4H), 3.30-3.01(m, 4H). MS(M+H) + =461.1.

[0382] Example 9 - Preparation of Compound 15A [ka] Step 1 - Synthesis of ethyl-2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate: To a stirred solution of 4-(trifluoromethoxy)aniline (2 g, 11.29 mmol, 1.53 mL, 1 equiv.) in toluene (50 mL), ethyl-2-cyano-3-ethoxyprop-2-enoate (2.10 g, 12.42 mmol, 1.1 equiv.) was added. The mixture was then stirred at 110 °C for 14 h. TLC (petroleum ether:ethyl acetate (=2 / 1)) showed that the starting material was completely consumed and a new spot was observed. The mixture was concentrated to give the crude product. The crude product was triturated with MTBE (30 mL) at 20 °C for 15 min. Ethyl 2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate (1.7 g, 5.66 mmol, 50.15% yield) was obtained as a pale yellow solid. 1 H NMR (400MHz, DMSO) δ=8.51-8.32(m, 1H), 7.70-7.51(m, 2H), 7.48-7.32(m, 2H), 4.26-4.15(m, 2H), 1.28-1.10(m, 3H).

[0383] [ka] Step 2 - Synthesis of 6-(trifluoromethoxy)quinolin-4-ol: A solution of ethyl 2-cyano-3-[4-(trifluoromethoxy)anilino]prop-2-enoate (500 mg, 1.67 mmol, 1 equiv.) in PhO (3 mL) was stirred at 250 °C for 12 h. TLC (petroleum ether:ethyl acetate = 5 / 1) showed that the starting material was completely consumed and a new spot was observed. The mixture (2 batches) was cooled to room temperature (approximately 20 °C), and MTBE (20 mL) was added and stirred for 5 min. It was then filtered, the filter was washed with MTBE (3 mL × 2), and dried in vacuo. 4-Hydroxy-6-(trifluoromethoxy)quinoline-3-carbonitrile (0.6 g, crude) was obtained as a brown solid.

[0384] [ka] Step 3—Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile: To a suspension of 4-hydroxy-6-(trifluoromethoxy)quinoline-3-carbonitrile (200 mg, 786.89 μmol, 1 equiv.) in SOCl (1 mL) was added DMF (5.75 mg, 78.69 μmol, 6.05 μL, 0.1 equiv.) at 0 °C. The mixture was then stirred at 20 °C for 13 h. LCMS (quenched with MeOH at low temperature) indicated complete consumption of the starting material and formation of the desired product. The resulting solution was evaporated to dryness, and the residue was azeotroped with toluene (3 mL × 2). 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile (160 mg, crude) was obtained as a brown solid.

[0385] [ka] Step 4 - Synthesis of 2-[[3-cyano-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: A suspension of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonitrile (80 mg, 293.46 μmol, 1 equiv.) and 2-aminobenzoic acid (48.29 mg, 352.15 μmol, 1.2 equiv.) in CH3CN (3 mL) was stirred at 90 °C for 12 h. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: Column: Phenomenex Luna C18 150 × 30 mm × 5 μm; Mobile phase: [water (0.04% HCl)-ACN]; B%: 30% to 60%, 10 min. 2-[[3-cyano-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (19.62 mg, 51.29 μmol, 17.48% yield, 97.59% purity) was obtained as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=8.94(s, 1H), 8.72(s, 1H), 8.18(d, J=8.8Hz, 1H), 8.02(t, J=6.4Hz, 2H), 7.69(t, J=7.2Hz, 1H), 7.55-7.51(m, 2H). MS(M+H) + =428.0.

[0386] Example 10 - Preparation of Compound 16A [ka] Step 1—A solution of 2,2-dimethyl-1,3-dioxane-4,6-dione (4.48 g, 31.05 mmol, 1.1 equiv) and trimethoxymethane (13.30 g, 125.34 mmol, 13.74 mL, 4.44 equiv) was stirred at 100° C. for 1 h, then 4-(trifluoromethoxy)aniline (5 g, 28.23 mmol, 3.82 mL, 1 equiv) was added dropwise over 0.5 h at 100° C. and stirred for an additional 1 h at 100° C. TLC (petroleum ether:ethyl acetate (=2 / 1)) showed that the starting material was completely consumed and a new spot was observed. The mixture was diluted with MTBE (30 mL) and then filtered. The filter cake was dried in vacuo to give 2,2-dimethyl-5-[[4-(trifluoromethoxy)anilino]methylene]-1,3-dioxane-4,6-dione (8 g, 24.15 mmol, 85.56% yield) as a yellow solid. 1 H NMR (400MHz, DMSO) δ=11.29(brs, 1H), 8.64(s, 1H), 7.70(d, J=9.2Hz, 2H), 7.42(d, J=8.8Hz, 2H), 1.67(s, 6H).

[0387] [ka] Step 2—2,2-Dimethyl-5-[[4-(trifluoromethoxy)anilino]methylene]-1,3-dioxane-4,6-dione (4 g, 12.08 mmol, 1 equiv.) was added to PhO (10 mL) at 240 °C and then stirred at 240 °C for 0.5 h. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.04) showed the reaction was complete. The mixture was cooled to 20 °C, followed by MTBE (10 mL), and then filtered to obtain the crude product. 6-(trifluoromethoxy)quinolin-4-ol (870 mg, crude) was obtained as a brown solid. 1 H NMR (400MHz, METHANOL-d4) δ=8.07(br s, 1H), 7.97(d, J=7.3Hz, 1H), 7.70-7.61(m, 1H), 7.61-7.54(m, 1H), 6.32(d, J=7.3Hz, 1H), 4.89(s, 1H).

[0388] [ka] Step 3 - To a stirred solution of chlorosulfonic acid (10 mL) was added 6-(trifluoromethoxy)quinolin-4-ol (1 g, 4.36 mmol, 1 equiv.) at 20 °C. The mixture was then heated to 100 °C and stirred at 100 °C for 16 h. LCMS showed complete consumption of the starting material and a new peak at the MS of the sulfonic acid. The mixture was poured onto ice (approximately 8 g) and extracted with ethyl acetate (8 mL × 3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated to give the crude product. 4-Hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonyl chloride (1 g, 3.05 mmol, 69.94% yield) was obtained as a brown solid.

[0389] [ka] Step 4 - A stirred solution of THF (5 mL) was aerated with NH3 at 0 °C to pH 14, and then 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonyl chloride (1 g, 3.05 mmol, 1 equiv.) dissolved in THF (1 mL) was added at 0 °C. The mixture was then stirred at 20 °C for 2 h. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was concentrated to give the crude product. 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonamide (1.1 g, crude) was obtained as a yellow solid.

[0390] [ka] Step 5—A stirred solution of 4-hydroxy-6-(trifluoromethoxy)quinoline-3-sulfonamide (200 mg, 648.86 μmol, 1 equiv.) in POCl3 (2 mL) was stirred at 110 °C for 0.5 h. LCMS showed complete consumption of the starting material. POCl3 was removed in vacuo to give a residue. The residue was dissolved in ethyl acetate (5 mL), poured into ice water (5 mL), and separated. The organic layer was dried over anhydrous sodium sulfate and concentrated to give the crude product. 4-chloro-6-(trifluoromethoxy)quinoline-3-sulfonamide (160 mg, crude) was obtained as a brown gum. MS (MH)- = 324.8.

[0391] [ka] Step 6—A solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-sulfonamide (200 mg, 612.22 μmol, 1 equiv.) and 2-aminobenzoic acid (83.96 mg, 612.22 μmol, 1 equiv.) in CH3CN (3 mL) was stirred at 90 °C for 3 h. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 15% to 45%, 8 min. 2-[[3-Sulfamoyl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (69.01 mg, 155.36 μmol, 25.38% yield, 96.21% purity) was obtained as a yellow solid. 1 H NMR (400MHz, MeOH-d4) δ=9.21(s, 1H), 8.11(d, J=9.2Hz, 1H), 8.06(dd, J=2.0, 8.0Hz, 1H), 7.69(d, J=2.0Hz, 1H), 7.53(s, 1H), 7.19(t, J=2.0Hz, 1H), 7.05(t, J=2.0Hz, 1H), 6.55(d, J=7.6Hz, 1H). MS(M+H) + =428.0.

[0392] Example 11 - Preparation of Compound 17A [ka] Step 1—Synthesis of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride: A stirred solution of 4-oxo-6-(trifluoromethoxy)-1H-quinoline-3-carboxylic acid (500 mg, 1.83 mmol, 1 equiv.) in POCl3 (5 mL) was heated to 100 °C and stirred for 1 h. LCMS showed no starting material remained. The mixture was cooled to room temperature and concentrated in vacuo. The residue was dissolved in toluene (3 mL × 2) and concentrated in vacuo to give 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (550.6 mg, crude) as a brown gum.

[0393] [ka] Step 2—Synthesis of 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide: A solution of 4-chloro-6-(trifluoromethoxy)quinoline-3-carbonyl chloride (550 mg, 1.77 mmol, 1 equiv.) in DCM (6 mL) was added with TEA (538.49 mg, 5.32 mmol, 740.71 μL, 3 equiv.) and 2,2-dimethoxyethanamine (167.85 mg, 1.60 mmol, 173.93 μL, 0.9 equiv.) at 0 °C, followed by stirring at 0 °C for 0.5 h. LCMS showed the reaction was complete. Water (6 mL) was added to the above solution, separated, and extracted with DCM (3 mL × 2). The combined organic layers were dried over sodium sulfate and concentrated in vacuo to give 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide (420.3 mg, crude) as a brown solid. 1 H NMR (400MHz, DMSO-d6) δ=8.99-8.84(m, 2H), 8.30(d, J=9.3Hz, 1H), 8.16(s, 1H), 7.95(dd, J=1.9, 9.2Hz, 1H), 4.55(t, J=5.5Hz, 1H), 3.43(t, J=5.7Hz, 2H), 3.34(s, 6H). MS(M+H) + =379.0

[0394] [ka] Step 3—Synthesis of 2-[4-chloro-6-(trifluoromethoxy)-3-quinolyl]oxazole: A solution of 4-chloro-N-(2,2-dimethoxyethyl)-6-(trifluoromethoxy)quinoline-3-carboxamide (350 mg, 924.14 μmol, 1 equiv.) in Eaton's reagent (6.08 g, 25.54 mmol, 4 mL, 27.64 equiv.) was stirred at 120° C. for 3 h. LCMS showed the reaction was complete. The mixture was added to ice water (5 mL) and stirred for 5 min. Ethyl acetate (5 mL) was added to the above solution and separated. The aqueous layer was extracted with ethyl acetate (5 mL × 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate in petroleum ether, gradient over 30 min) to give 2-[4-chloro-6-(trifluoromethoxy)-3-quinolyl]oxazole (55.3 mg, 175.75 μmol, 19.02% yield) as an off-white solid. MS (M+H) + =315.0

[0395] [ka] Step 4—Synthesis of 2-[[3-oxazol-2-yl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: 2-Aminobenzoic acid (19.18 mg, 139.84 μmol, 1.1 equiv.) and 2-[4-chloro-6-(trifluoromethoxy)-3-quinolyl]oxazole (40 mg, 127.13 μmol, 1 equiv.) were added to ACN (1 mL) and stirred at 90° C. for 5 hours. LCMS showed that the starting material was completely consumed and the desired product was detected. The mixture was filtered to obtain a filter cake. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 30 mm × 10 μm column; 5% to 35% acetonitrile in 10 mM NH4HCO3 in water, 10 min gradient) to give 2-[[3-oxazol-2-yl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (10.3 mg, 24.55 μmol, 19.31% yield, 99.00% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.40(br s, 1H), 9.34(s, 1H), 8.29(s, 1H), 8.16(d, J=9.0Hz, 1H), 7.96(dd, J=1.4, 7.8Hz, 1H), 7.75(br d, J=9.2Hz, 1H), 7.56-7.47(m, 2H), 7.20(t, J=7.7Hz, 1H), 7.01(t, J=7.5Hz, 1H), 6.58(d, J=8.2Hz, 1H). MS(MH) + =414.0.

[0396] Example 12 - Preparation of Compounds 26A and 18A [ka] Step 1—Synthesis of ethyl 6-bromo-4-chloro-quinoline-3-carboxylate: Ethyl 6-bromo-4-oxo-1H-quinoline-3-carboxylate (1.5 g, 5.07 mmol, 1.0 equiv.) was added to POCl3 (15 mL) at 0 °C, then stirred at 110 °C for 3 h. LCMS showed that approximately 2% of the starting material remained. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. The residue was added dropwise to a mixture of ice water (10 mL) and ethyl acetate (10 mL), separated, and extracted with ethyl acetate (10 mL × 2). The combined organic layers were washed with 10% NaHCO3 and concentrated in vacuo. Ethyl 6-bromo-4-chloro-quinoline-3-carboxylate (1.41 g, 4.48 mmol, 88.49% yield) was obtained as an off-white solid. 1 H NMR (400MHz, chloroform-d) δ=9.20(s, 1H), 8.56(d, J=2.0Hz, 1H), 8.03(d, J=8.8Hz, 1H), 7.91(dd, J=2.1, 8.9Hz, 1H), 4.51(q, J=7.1Hz, 2H), 1.47(t, J=7.1Hz, 3H).

[0397] [ka] Step 2 - Synthesis of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid: A solution of ethyl 6-bromo-4-chloroquinoline-3-carboxylate (200 mg, 635.80 μmol, 1 equiv.) and 2-aminobenzoic acid (95.91 mg, 699.39 μmol, 1.1 equiv.) in CH3CN (3 mL) was stirred at 90 °C for 16 h. TLC (petroleum ether:ethyl acetate (=3 / 1)) showed complete consumption of the starting material. The mixture was filtered, and the filter cake was dried in vacuo. 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (220 mg, 529.82 μmol, 83.33% yield) was obtained as a yellow solid. 1H NMR(400MHz,DMSO-d6) δ=11.56(brs, 1H), 9.07(s, 1H), 8.27(s, 1H), 8.13-8.10(m, 2H), 8.06(d, J=7.6Hz, 1H), 7.56(t, J =7.2Hz, 1H), 7.41(t, J=7.6Hz, 1H), 7.25(d, J=8.0Hz, 1H), 4.20(brs, 2H), 1.20(d, J=7.2Hz, 3H).

[0398] [ka] Step 3—Synthesis of 2-[[3-ethoxycarbonyl-6-(piperazine-1-carbonyl)-4-quinolyl]amino]benzoic acid: In a sealed tube, add 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 equiv.), piperazine (31.12 mg, 361.24 μmol, 1.5 equiv.), carbon monoxide, molybdenum (127.16 mg, 481.65 μmol, 6 equiv.), and 2-bromo-3-ethoxycarbonyl-4-quinolylamino]benzoic acid (100 mg, 240.83 μmol, 1 equiv.). To the reaction mixture was added 1 mL of 1,000 sulphite (1.04 mg, 4.88 μL, 2.0 equiv), DBU (109.99 mg, 722.48 μmol, 108.90 μL, 3.0 equiv), tritert-butylphosphonium tetrafluoroborate (13.97 mg, 48.17 μmol, 0.2 equiv), acetoxy-[[2-(bis-o-tolylphosphanyl)phenyl]methyl]palladium (11.29 mg, 12.04 μmol, 0.05 equiv), and THF (4 mL). The sealed tube was then purged with nitrogen for 30 seconds and heated to 120 °C. The mixture was then stirred at 120 °C for 5 minutes. LCMS indicated that the starting material had been completely consumed and the desired product had formed. The mixture was concentrated to give the crude product. The crude product was purified by preparative HPLC: Column: Phenomenex Luna C18 100 × 30 mm × 5 μm; Mobile phase: [water (0.04% HCl)-ACN]; B%: 10% to 40%, 10 min. 2-[[3-ethoxycarbonyl-6-(piperazine-1-carbonyl)-4-quinolyl]amino]benzoic acid (19.93 mg, 43.92 μmol, 18.24% yield, 98.84% purity) was obtained as a yellow solid. 1H NMR (400MHz, MeOD-d4) δ=9.26(s, 1H), 8.22(d, J=6.4Hz, 1H), 8.07(s, 2H), 7.27(s, 1H), 7.59(t, J=3.6Hz, 1H), 7.57(d, J=7.6Hz, 1 H), 7.40(d, J=8.0Hz, 2H), 4.48-4.43(m, 2H), 3.90-3.48(m, 4H), 3.30-3.10(m, 4H), 1.39(t, J=7.2Hz, 3H). MS(M+H) + =449.2.

[0399] Example 13 - Preparation of Compound 19A [ka] Step 1—Synthesis of 4-(4-nitrophenoxy)piperidine: A solution of benzyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.8 g, 5.05 mmol, 1 equiv.) in HBr (30% in AcOH) (5 mL) was stirred at 15° C. for 1 h. LCMS showed the desired MS was formed. MTBE (20 mL) was added to the mixture, stirred for 5 min, and filtered to give 4-(4-nitrophenoxy)piperidine (1.3 g, 4.29 mmol, 84.90% yield, HBr) as a pink solid. 1 H NMR (400MHz, chloroform-d) δ=8.55(br s, 2H), 8.26-8.11(m, 2H), 7.29-7.08(m, 2H), 4.87(tt, J=3.6, 7.6Hz, 1H), 3.51(br s, 1H), 3.26(br s, 2H), 3.15-3.00(m, 2H), 2.14(ddd, J=3.4, 7.0, 10.3Hz, 2H), 1.93-1.74(m, 2H). MS(M+H) + =223.1.

[0400] [ka] Step 2—Synthesis of 9H-fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate: To a solution of 4-(4-nitrophenoxy)piperidine (1.3 g, 4.29 mmol, 1 equiv., HBr) and NaHCO (1.44 g, 17.15 mmol, 667.15 μL, 4 equiv.) in a mixture of THF (12 mL) and HO (3 mL), Fmoc-Cl (1.66 g, 6.43 mmol, 1.5 equiv.) was added dropwise at 0° C., followed by stirring at 15° C. for 3 h. TLC (petroleum ether:ethyl acetate=3:1, R f =0.69) indicated the reaction was complete. The mixture was separated. The aqueous layer was extracted with ethyl acetate (20 mL). The combined organic phases were dried over anhydrous Na2SO4 and concentrated in vacuo to dryness. The crude product was purified by flash column (ISCO 20 g silica, 0-8% ethyl acetate in petroleum ether, gradient over 30 min) to give 9H-fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.8 g, 4.05 mmol, 94.44% yield) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=7.40-7.34(m, 2H), 7.07(d, J=7.5Hz, 2H), 6.81(d, J=7.3Hz, 2H), 6.62-6. 56(m, 2H), 6.54-6.49(m, 2H), 6.39-6.34(m, 2H), 3.97-3.90(m, 1H), 3.59(br s, 2H), 3.48-3.43(m, 1H), 2.43-2.33(m, 2H), 1.68(td, J=1.7, 3.6Hz, 2H), 1.05(br s, 2H), 0.65(br s, 2H).

[0401] [ka] Step 3 - Synthesis of 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate: 9H-Fluoren-9-ylmethyl 4-(4-nitrophenoxy)piperidine-1-carboxylate (1.6 g, 3.60 mmol, 1 equiv.) was dissolved in THF (20 mL) and acetic acid (2.16 g, 36.00 mmol, 2.06 mL, 10 equiv.) was added. The mixture was cooled to 0 °C, followed by the addition of Zn (4.71 g, 71.99 mmol, 20 equiv.) in portions. The reaction was brought to 15 °C and held for 1 h. TLC (petroleum ether:ethyl acetate = 3:1, R f =0.10) indicated the reaction was complete. The mixture was filtered through Celite to obtain the filtrate. The filtrate was washed with 10% NaHCO3 solution (20 mL) and brine (20 mL), dried over Na2SO4, and concentrated in vacuo to obtain 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate (1.7 g, crude) as a yellow gum. 1 H NMR (400MHz, DMSO-d6) δ=7.89(d, J=7.5Hz, 2H), 7.63(d, J=7.3Hz, 2H), 7.47-7.38(m, 2H), 7.37-7.28(m, 2H), 6.72-6.62(m, 2H), 6.53-6.46(m, 2H), 4.64(br s, 2H), 4.39(br d, J=5.9Hz, 2H), 4.30-4.25(m, 1H), 4.21(tt, J=3.6, 7.7Hz, 1H), 3.57(br s, 2H), 3.22-3.08(m, 2H), 1.83-1.65(m, 2H), 1.38(br d, J = 15.8 Hz, 2H).

[0402] [ka] Step 4—Synthesis of diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]anilino]methylene]propanedioate: A solution of diethyl 2-(ethoxymethylene)propanedioate (1.57 g, 7.24 mmol, 1.46 mL, 2 equiv.) and 9H-fluoren-9-ylmethyl 4-(4-aminophenoxy)piperidine-1-carboxylate (1.5 g, 3.62 mmol, 1 equiv.) in EtOH (20 mL) was stirred at 80° C. for 14 hours. TLC (petroleum ether:ethyl acetate=2:1, R f =0.43) indicated the reaction was complete. The mixture was concentrated in vacuo to give diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]anilino]methylene]propanedioate (3.4 g, crude) as a yellow gum.

[0403] [ka] Step 5—Synthesis of ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-hydroxy-quinoline-3-carboxylate: Diethyl 2-[[4-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]anilino]methylene]propanedioate (300 mg, 513.12 μmol, 1 equiv.) in POCl3 (3 mL) and PPA (150 mg) was stirred at 75 °C for 2 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo and dissolved in ethyl acetate (2 mL). The solution was added dropwise to ice water (5 mL), stirred for 5 min, and separated. The aqueous solution was extracted with ethyl acetate (5 mL × 2). The combined organic phase was dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-100% ethyl acetate in petroleum ether, gradient over 30 min) to give ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-hydroxy-quinoline-3-carboxylate (170 mg, 315.64 μmol, 61.51% yield) as a yellow gum. MS (M+H)+ =539.2

[0404] [ka] Step 6—Synthesis of ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]quinoline-3-carboxylate: Synthesis of 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-quinolyl]amino]benzoic acid: Ethyl 6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-hydroxy-quinoline-3-carboxylate (170 mg, 315.64 μmol, 1 equiv.) in POCl3 (2 mL) was stirred at 110 °C for 3 h. LCMS showed that the desired ms was detected. The mixture was concentrated in vacuo and dissolved in ethyl acetate (3 mL). The solution was added dropwise with ice water (4 mL), separated, and extracted with ethyl acetate (5 mL × 2). The combined organic layers were washed with 10% NaHCO (3 mL), dried over NaSO, and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate in petroleum ether, gradient over 30 min) to give ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]quinoline-3-carboxylate (70 mg, 125.67 μmol, 39.81% yield) as a yellow solid. MS (M+H) + =557.1

[0405] [ka] Step 7—Synthesis of 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-quinolyl]amino]benzoic acid: A solution of ethyl 4-chloro-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]quinoline-3-carboxylate (58 mg, 104.12 μmol, 1 equiv.) and 2-aminobenzoic acid (14.56 mg, 106.21 μmol, 1.02 equiv.) in ACN (1 mL) was stirred at 90° C. for 2 h. LCMS showed that the desired product was obtained. The mixture was filtered to give 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-quinolyl]amino]benzoic acid (50 mg, 76.02 μmol, 73.01% yield) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.55(br s, 1H), 9.07(s, 1H), 8.11(d, J=9.3Hz, 1H), 8.05(br d, J=7.5Hz, 1H), 7.90(d, J=7.7Hz, 2H), 7.67-7.60(m, 3H), 7.56-7.50(m, 1H), 7.46-7.39(m, 2H), 7.35(br t, J=7.4Hz, 3H), 7.19-7.12(m, 2H), 4.43(br s, 2H), 4.28(br t, J=6.0Hz, 1H), 4.20(br s, 3H), 3.72-3.50(m, 2H), 3.04-2.84(m, 2H), 1.59(br s, 2H), 1.29(t, J=7.1Hz, 5H). MS(M+H) + =658.2.

[0406] [ka] Step 8—Synthesis of 2-[[3-ethoxycarbonyl-6-(4-piperidyloxy)-4-quinolyl]amino]benzoic acid: 2-[[3-ethoxycarbonyl-6-[[1-(9H-fluoren-9-ylmethoxycarbonyl)-4-piperidyl]oxy]-4-quinolyl]amino]benzoic acid (45 mg, 68.42 μmol, 1 equiv.) and DBU (11.46 mg, 75.26 μmol, 11.34 μL, 1.1 equiv.) in DCM (1 mL) were stirred at 15° C. for 4 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo and dissolved in DMF (3 mL). The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 15% to 45% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[[3-ethoxycarbonyl-6-(4-piperidyloxy)-4-quinolyl]amino]benzoic acid (5.45 mg, 12.17 μmol, 17.78% yield, 97.22% purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.71(s, 1H), 9.22(br s, 2H), 8.99(s, 1H), 8.19(d, J=9.0Hz, 1H), 8.05(d, J=7.9Hz, 1H), 7.75(dd, J=2.3, 9.2Hz, 1H), 7.61-7.55(m, 1H), 7.49(br s, 1H), 7.45-7.39(m, 1H), 7.29(d, J=7.7Hz, 1H), 5.75(s, 1H), 4.53(br s, 1H), 3.92(br s, 2H), 3.14(br s, 2H), 2.94(br s, 2H), 1.98(br s, 2H), 1.78(br s, 2H), 1.22(t, J=7.1Hz, 3H). MS(M / 2+H) + =218.7

[0407] Example 14 - Preparation of Compound 23A [ka] To a solution of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 equiv.), Pd(OAc) (5.41 mg, 24.08 μmol, 0.1 equiv.), PPh (12.63 mg, 48.17 μmol, 0.2 equiv.), and KPO (204.48 mg, 963.31 μmol, 4 equiv.) in DMF (1 mL) and HO (0.1 mL) was added 1H-indol-4-ylboronic acid (77.53 mg, 481.65 μmol, 2 equiv.). The mixture was degassed and purged with N five times, then stirred under N at 80 °C for 14 h. LCMS indicated the reaction was complete. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Phenomenex Luna C18 150 × 30 mm × 5 μm column; 20% to 50% acetonitrile in 0.04% HCl solution in water, 10 min gradient) to give 2-[[3-ethoxycarbonyl-6-(1H-indol-4-yl)-4-quinolyl]amino]benzoic acid (63.1 mg, 134.83 μmol, 55.99% yield, 96.47% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.69(br s, 1H), 11.40(br s, 1H), 9.17(s, 1H), 8.37-8.30(m, 1H), 8.29-8.24(m, 1H), 8.18(s, 1H), 8.05(d, J=7.7Hz, 1H), 7.65-7.57(m, 1H), 7.49-7.36(m, 3H), 7.33(br d, J=7.9Hz, 1H), 7.13(t, J=7.7Hz, 1H), 6.86(d, J=7.2Hz, 1H), 6.28(br s, 1H), 4.19(br s, 2H), 1.28(t, J=7.1Hz, 3H). MS(M+H) + =452.0.

[0408] Example 15 - Preparation of Compound 25A [ka] Synthesis of ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate: Ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (50 mg, 156.41 μmol, 1 equivalent) and 2-aminobenzonitrile (20.33 mg, 172.06 μmol, 1.1 equivalent) were added to ACN (2 mL) and stirred at 90° C. for 12 hours. LCMS showed the reaction was complete. The mixture was filtered to obtain a filter cake. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column; 25% to 55% acetonitrile in 0.04% ammonia solution and 10 mM NH4HCO3 in water, 10 min gradient) to give ethyl 4-(2-cyanoanilino)-6-(trifluoromethoxy)quinoline-3-carboxylate (17.5 mg, 43.39 μmol, 27.74% yield, 99.5% purity) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=9.88(br s, 1H), 8.98(br s, 1H), 8.13(br s, 2H), 7.82(br s, 2H), 7.54(br s, 1H), 7.34-6.99(m, 2H), 3.98(br s, 2H), 1.14(br s, 3H). MS(M+H) + =402.0.

[0409] Example 16 - Preparation of Compound 26A [ka] Step 1—Synthesis of ethyl 6-bromo-4-chloro-quinoline-3-carboxylate: Ethyl 6-bromo-4-oxo-1H-quinoline-3-carboxylate (1.5 g, 5.07 mmol, 1.0 equiv.) was added to POCl3 (15 mL) at 0 °C, then stirred at 110 °C for 3 h. LCMS showed approximately 2% starting material remained. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. The residue was added dropwise to a mixture of ice water (10 mL) and ethyl acetate (10 mL), separated, and extracted with ethyl acetate (10 mL × 2). The combined organic layers were washed with 10% NaHCO3 and concentrated in vacuo to give ethyl 6-bromo-4-chloro-quinoline-3-carboxylate (1.41 g, 4.48 mmol, 88.49% yield) as an off-white solid. 1 H NMR (400MHz, chloroform-d) δ=9.20(s, 1H), 8.56(d, J=2.0Hz, 1H), 8.03(d, J=8.8Hz, 1H), 7.91(dd, J=2.1, 8.9Hz, 1H), 4.51(q, J=7.1Hz, 2H), 1.47(t, J=7.1Hz, 3H). MS(M+H)+=315.9.

[0410] [ka] Step 2—Synthesis of 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid: 2-Aminobenzoic acid (191.82 mg, 1.40 mmol, 1.1 equiv.) and ethyl 6-bromo-4-chloro-quinoline-3-carboxylate (400 mg, 1.27 mmol, 1 equiv.) were added to ACN (2 mL) and then stirred at 90° C. for 12 hours. LCMS showed the reaction was complete. The mixture was filtered to give the crude product (503.5 mg). 50 mg of the crude product was purified by preparative HPLC (Phenomenex Luna C18 150 × 30 mm × 5 μm column; 15% to 50% acetonitrile in 0.04% HCl solution in water, 10 min gradient) to give 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (39.14 mg) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=11.57(br s, 1H), 9.05(s, 1H), 8.26(s, 1H), 8.17-8.11(m, 2H), 8.09-8.03(m, 1H), 7.59-7.51(m, 1H), 7.39(t, J=7.5Hz, 1H), 7.24(d, J=8.1Hz, 1H), 4.04(br s, 2H), 1.20(t, J=7.1Hz, 3H). MS(M+H) + =415.0.

[0411] Example 17 - Preparation of Compound 27A [ka] Synthesis of 14-oxo-7-(trifluoromethoxy)-17,18,19-triazatetracyclooctadeca-(4),1(8),2(7),3(9),5(10),6(17),11,13(18)-octaene-8-carboxylic acid: To a stirred solution of 2-aminopyridine-3-carboxylic acid (64.81 mg, 469.24 μmol, 3 equiv.) in DMF (2 mL) was added NaH (50.05 mg, 1.25 mmol, 60% purity, 8.0 equiv.) at 0 °C. After stirring the suspension at 0 °C for 20 min, ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (50 mg, 156.41 μmol, 1 equiv.) dissolved in DMF (0.5 mL) was added dropwise. The mixture was then heated to 100 °C and stirred at 100 °C for 12 h. LCMS showed that the starting material had been completely consumed and the desired product had formed. The crude product was purified by preparative HPLC: Column: Phenomenex Luna C18 100 x 30 mm x 5 μm; Mobile phase: [water (0.04% HCl)-ACN]; B%: 10% to 40%, 10 min. 14-Oxo-7-(trifluoromethoxy)-17,18,19-triazatetracyclooctadeca-(4),1(8),2(7),3(9),5(10),6(17),11,13(18)-octaene-8-carboxylic acid (2.75 mg, 6.60 μmol, 4.22% yield, 98.82% purity, HCl) was obtained as a yellow solid. 1H NMR (400MHz, CDCl3) δ=9.59(s, 1H), 9.27(d, J=5.6Hz, 1H), 8.65(d, J=5.6Hz, 1H), 8.49(s, 1H), 8.31(d, J=9 .2Hz, 1H), 8.03(dd, J=2.4, 9.2Hz, 1H), 7.53(s, J=7.2Hz, 1H), 7.17(t, J=10.8Hz, 1H). MS(MH) + =376.1.

[0412] Example 18 - Preparation of Compound 28A [ka] Synthesis of 4-[(3-carboxy-2-pyridyl)amino]-6-(trifluoromethoxy)quinoline-3-carboxylic acid: To a stirred solution of 2-aminopyridine-3-carboxylic acid (129.63 mg, 938.49 μmol, 3 equiv.) in DMF (4 mL) was added NaH (100.10 mg, 2.50 mmol, 60% purity, 8.0 equiv.) at 0° C. After stirring the suspension at 0° C. for 20 minutes, ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 equiv.) dissolved in DMF (0.5 mL) was added dropwise. The mixture was then heated to 100° C. and stirred at 100° C. for 12 hours. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was quenched with saturated NH4Cl (8 mL), the pH was adjusted to approximately 7 by adding 12 N HCl, and then concentrated to remove the solvent. The crude product was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 5% to 35%, 8 min. 4-[(3-carboxy-2-pyridyl)amino]-6-(trifluoromethoxy)quinoline-3-carboxylic acid (6.72 mg, 14.20 μmol, 4.54% yield, 83.11% purity) was obtained as a yellow solid. 1H NMR (400MHz, CDCl3) δ=9.12(s, 1H), 8.25(d, J=6.0Hz, 1H), 8.12(d, J=12.0Hz, 1H), 8.05(d, J=2.8Hz, 1H), 7.78-7.60(m, 2H), 7.19(brs, 2H), 6.95-6.92(m, 1H). MS(MH) + =391.9.

[0413] Example 19 - Preparation of Compound 29A [ka] Synthesis of 2-[[3-ethoxycarbonyl-6-(5-hydroxyindol-1-yl)-4-quinolyl]amino]benzoic acid: 2-[(6-bromo-3-ethoxycarbonyl-4-quinolyl)amino]benzoic acid (100 mg, 240.83 μmol, 1 equiv.), Pd(dba) (29.99 mg, 32.75 μmol, 0.1 A solution of 1H-indol-5-ol (48.10 mg, 361.24 μmol, 1.5 equiv.), t-BuOK (81.07 mg, 722.48 μmol, 3 equiv.), and Xantphos (29.96 mg, 51.78 μmol, 0.215 equiv.) was added, degassed, purged with N2 three times, and then stirred under N2 at 110 °C for 14 h. LCMS showed the reaction was complete. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Welch Xtimate C18 150 × 25 mm × 5 μm column; 5% to 35% acetonitrile in 0.05% HCl in water, 10 min gradient) to give 2-[[3-ethoxycarbonyl-6-(5-hydroxyindol-1-yl)-4-quinolyl]amino]benzoic acid (6.11 mg, 13.00 μmol, 5.40% yield, 99.49% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=13.76(br s, 1H), 8.92(s, 1H), 8.18-8.07(m, 2H), 8.02-7.98(m, 1H), 7.93(d, J=7.5Hz, 1H), 7.56(d, J=3.2Hz, 1H), 7.29-7.14(m, 3H), 6.97-6 .86(m, 2H), 6.75(d, J=8.1Hz, 1H), 6.63(dd, J=1.9, 8.9Hz, 1H), 6.54(d, J=3.2Hz, 1H), 3.99(q, J=6.9Hz, 2H), 1.04(t, J=7.1Hz, 3H). MS(MH) + =466.0.

[0414] Example 20 - Preparation of Compound 30A [ka] Synthesis of 6-(trifluoromethoxy)-14,15,16,17-tetrazatetracycloheptadeca-(6),1(7),2(8),3(15),4(9),5(16),10-heptaen-12-one: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 equiv.) and 5-amino-1H-pyrazole-4-carboxylic acid (119.28 mg, 938.49 μmol, 3 equiv.) in DMF (1 mL) was stirred at 110° C. for 14 hours. LCMS indicated the reaction was complete and the desired product was detected. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 20% to 50% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give (trifluoromethoxy)-14,15,16,17-tetrazatetracycloheptadeca-(6),1(7),2(8),3(15),4(9),5(16),10-heptaen-12-one (6.80 mg, 21.00 μmol, 6.71% yield, 98.89% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=13.95-13.35(m, 1H), 9.31(s, 1H), 8.56(br s, 1H), 8.08(d, J=1.8Hz, 1H), 8.05(br d, J=9.0Hz, 1H), 7.94-7.79(m, 1H), 6.48(d, J=1.8Hz, 1H). MS(M+H) + =321.0.

[0415] Example 21 - Preparation of Compound 31A [ka] Synthesis of ethyl 14-oxo-7-(trifluoromethoxy)-17,18,19,20-tetrazatetracycloheptadeca-1(7),2(8),3(9),4(18),5(19),10,12-heptaene-12-carboxylate: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 equiv.) and ethyl 5-amino-1H-imidazole-4-carboxylate (145.61 mg, 938.49 μmol, 3 equiv.) in DMF (1 mL) was stirred at 110° C. for 14 hours. LCMS indicated the reaction was complete. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 25% to 45% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give ethyl 14-oxo-7-(trifluoromethoxy)-17,18,19,20-tetrazatetracycloheptadeca-1(7),2(8),3(9),4(18),5(19),10,12-heptaene-12-carboxylate (1.56 mg, 3.78 μmol, 1.21% yield, 95.02% purity). 1 H NMR (400MHz, DMSO-d6) δ=9.54(s, 1H), 9.05(s, 1H), 8.81-8.74(m, 1H), 8.40(d, J=9.2Hz, 1H), 8.08(br d, J=8.9Hz, 1H), 4.35(q, J=7.1Hz, 2H), 1.33(t, J=7.0Hz, 3H). MS(M+H) +=393.1.

[0416] Example 22 - Preparation of Compound 32A [ka] Step 1—Synthesis of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate: Ethyl 4-hydroxy-6-(trifluoromethoxy)quinoline-3-carboxylate (3.00 g, 9.96 mmol, 1 equiv.) was added to POCl3 (20 mL) at 0 °C, followed by stirring at 110 °C for 2 h. LCMS showed that the starting material was completely consumed and the reaction was complete. The mixture was cooled to room temperature and concentrated in vacuo to remove excess solvent. The residue was added dropwise to a mixture of ice water (10 mL) and ethyl acetate (20 ml), separated, and extracted with ethyl acetate (20 ml × 2). The combined organic layer was washed with 10% NaHCO3, dried over anhydrous sodium sulfate, and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-6% ethyl acetate in petroleum ether, gradient over 30 min) to give ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (2.6 g, 8.13 mmol, 81.67% yield, purity) as a white solid. MS (M+H) + =320.0.

[0417] [ka] Step 2—Synthesis of 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid: 2-Aminobenzoic acid (707.85 mg, 5.16 mmol, 1.1 equiv.) and ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (1.5 g, 4.69 mmol, 1 equiv.) were added to ACN (15 mL) and then stirred at 90° C. for 14 hours. LCMS showed the reaction was complete. The mixture was filtered to obtain a filter cake. The crude product was purified by recrystallization from methanol (5 mL) at 65° C., cooled to room temperature, stirred for 0.5 h, and filtered to give 2-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]benzoic acid (1610.97 mg, 3.83 mmol, 81.78% yield, 98.63% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.84(br s, 1H), 9.09(s, 1H), 8.41(d, J=9.3Hz, 1H), 8.15-7.99(m, 2H), 7.89(s, 1 H), 7.59-7.51(m, 1H), 7.47-7.40(m, 1H), 7.33(d, J=7.9Hz, 1H), 4.13(br s, 2H), 1.25(t, J=7.2Hz, 3H). MS(M+H) + =421.0.

[0418] Example 23 - Preparation of Compound 33A [ka] Synthesis of ethyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylate: A solution of ethyl 4-chloro-6-(trifluoromethoxy)quinoline-3-carboxylate (100 mg, 312.83 μmol, 1 equiv.) and ethyl 5-aminothiazole-4-carboxylate (161.61 mg, 938.49 μmol, 3.0 equiv.) in DMF (4 mL) was stirred at 110 °C for 12 h. LCMS indicated complete consumption of the starting material and formation of the desired product. The mixture was purified by preparative HPLC: Column: Waters Xbridge BEH C18 100 × 25 mm × 5 μm; Mobile phase: [water (10 mM NH4HCO3)-ACN]; B%: 35%-65%, 8 min. Ethyl 5-[[3-ethoxycarbonyl-6-(trifluoromethoxy)-4-quinolyl]amino]thiazole-4-carboxylate (5.51 mg, 12.08 μmol, 2.75% yield, 99.86% purity) was obtained as a pale yellow solid. 1 H NMR (400 MHz, chloroform-d) δ = 9.38 (s, 1H), 8.19 (d, J = 9.2 Hz, 1H), 8.09 (s, 1H), 7.77 (s, 1H), 7.67 (d, J = 9.2 Hz, 1H), 4.59-4.49 (m, 4H), 1.52-1.34 (m, 6H). MS (M+H) + =456.1.

[0419] Example 24 - Preparation of Compound 34A [ka] Step 1—Synthesis of 2-nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide: To a solution of 2-nitrobenzenesulfonyl chloride (1 g, 4.51 mmol, 1 equiv.) in dioxane (10 mL), 2,2,2-trifluoroethanamine (491.66 mg, 4.96 mmol, 390.21 μL, 1.1 equiv.) and TEA (502.26 mg, 4.96 mmol, 690.86 μL, 1.1 equiv.) were added at 0 °C and then stirred at 15 °C for 14 h. TLC (petroleum ether:ethyl acetate = 5:1, Rf = 0.28) indicated the reaction was complete and no starting material remained. The mixture was poured into ice water (5 mL) and stirred for 5 min. Ethyl acetate (10 mL) was added to the above solution, separated, and extracted with ethyl acetate (5 mL × 2). The combined organic layers were dried over anhydrous Na2SO4, filtered and concentrated in vacuo to give 2-nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide (1 g, crude) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=9.16(t, J=6.5Hz, 1H), 8.07-8.03(m, 1H), 8.03-7.98(m, 1H), 7.91-7.86(m, 2H), 3.96-3.80(m, 2H).

[0420] [ka] Step 2—Synthesis of 2-amino-N-(2,2,2-trifluoroethyl)benzenesulfonamide: A solution of 2-nitro-N-(2,2,2-trifluoroethyl)benzenesulfonamide (500 mg, 1.76 mmol, 1 equiv.), Fe (491.23 mg, 8.80 mmol, 5 equiv.), and NHCl (282.31 mg, 5.28 mmol, 3 equiv.) in a mixture of methanol (4 mL) and HO (2 mL) was stirred at 80 °C for 14 h. LCMS showed that the desired product was obtained. The mixture was filtered to obtain the filtrate, which was concentrated in vacuo to give 2-amino-N-(2,2,2-trifluoroethyl)benzenesulfonamide (350.2 mg, 1.38 mmol, 78.30% yield) as a pale yellow solid. 11H NMR (400 MHz, DMSO-d6) δ = 8.48 (br t, J = 6.5 Hz, 1H), 7.51 (dd, J = 1.0, 8.0 Hz, 1H), 7.33 - 7.20 (m, 1H), 6.86 - 6.80 (m, 1H), 6.62 (t, J = 7.4 Hz, 1H), 5.97 - 5.89 (m, 2H), 3.75 - 3.52 (m, 2H).

[0421]

Chem.

[0422] Example 25 - Preparation of Compound 51A [ka] Step 1—Synthesis of 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene: To a solution of 2-methoxy-5-nitro-phenol (25 g, 147.81 mmol, 1 equiv.), NaI (33.23 g, 221.72 mmol, 1.5 equiv.), and CsCO (96.32 g, 295.62 mmol, 2 equiv.) in DMF (250 mL), 1-bromo-3-methoxy-propane (22.62 g, 147.81 mmol, 1 equiv.) was added dropwise and stirred at 100 °C for 2 h. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.43) indicated the reaction was complete. The suspension was filtered to obtain the filtrate. The filtrate was dissolved in ethyl acetate (100 mL) and water (30 mL), separated, and extracted with ethyl acetate (50 × 2 mL). The combined organic layers were washed with water (20 mL × 3), dried over NaSO, filtered, and concentrated in vacuo to give 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene (20.4 g, 84.56 mmol, 57.21% yield, purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=7.89(dd, J=2.7, 8.9Hz, 1H), 7.71(d, J=2.7Hz, 1H), 7.16(d, J=8.9Hz, 1H), 4.11(t, J=6. 4Hz, 2H), 3.90(s, 3H), 3.47(t, J=6.3Hz, 2H), 3.28-3.23(m, 3H), 1.97(quintet, J=6.4Hz, 2H).

[0423] [ka] Step 2—Synthesis of 4-methoxy-3-(3-methoxypropoxy)aniline: A solution of 1-methoxy-2-(3-methoxypropoxy)-4-nitro-benzene (20.4 g, 84.56 mmol, 1 equiv.), Fe (40.14 g, 718.79 mmol, 8.5 equiv.), and NHCl (40.71 g, 761.07 mmol, 9 equiv.) in a mixture of methanol (160 mL) and HO (80 mL) was stirred at 80 °C for 4 h. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.24) showed that the starting material was completely consumed. The mixture was filtered to obtain the filtrate, which was then concentrated in vacuo. The residue was dissolved in ethyl acetate (100 mL), separated, and extracted with ethyl acetate (100 mL × 3). The combined organic layers were dried over Na2SO4 and concentrated in vacuo to give 4-methoxy-3-(3-methoxypropoxy)aniline (19 g, crude) as a brown oil.

[0424] [ka] Step 3 - Synthesis of ethyl (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoate: A solution of 4-methoxy-3-(3-methoxypropoxy)aniline (19 g, 89.94 mmol, 1 equiv.) and ethyl (E)-2-cyano-3-ethoxyprop-2-enoate (15.22 g, 89.94 mmol, 1 equiv.) in toluene (200 mL) was stirred at 110 °C for 14 h. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.43) showed complete consumption of the reactants. The mixture was concentrated in vacuo to give ethyl (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoate (29.3 g, crude) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=10.74-10.57(m, 1H), 8.51-8.40(m, 0.5H), 8.25(br s, 0.5H), 7.21(d, J=1.8Hz, 0.5H), 7.07(d, J=1.5Hz, 0.5H), 6.96-6.83(m, 2H), 4.30-4.10(m, 2H), 4.06-3.95(m, 2H), 3.74(s, 3H), 3.47(t, J=6.1Hz, 2H), 3.25(s, 3H), 2.02-1.91(m, 2H), 1.32-1.21(m, 1H), 1.25(td, J=7.0, 11.8Hz, 2H).

[0425] [ka] Step 4—Synthesis of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile: A solution of ethyl (E)-2-cyano-3-[4-methoxy-3-(3-methoxypropoxy)anilino]prop-2-enoate (400 mg, 1.20 mmol, 1 equiv.) in PhO (10 mL) was stirred at 270 °C for 5 h. TLC (petroleum ether:ethyl acetate = 2:1, Rf = 0.00) showed that a new spot was found. The mixture was cooled to room temperature, followed by petroleum ether (10 mL), filtered to obtain a filter cake, which was dried in vacuo to give 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (100 mg, 346.86 μmol, 28.99% yield) as a pale solid. 1 H NMR (400MHz, DMSO-d6) δ=12.51(br s, 1H), 8.59(s, 1H), 7.44(s, 1H), 7.13-7.01(m, 1H), 4.11(t, J=6.4Hz, 2H), 3. 86(s, 3H), 3.49(t, J=6.2Hz, 2H), 3.33(s, 5H), 3.25(s, 3H), 2.08-1.97(m, 2H). MS(M+H) + =289.1.

[0426] [ka] Step 5—Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile: To a solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (80 mg, 277.49 μmol, 1 equiv.) in SOCl (1 mL) was added DMF (2.03 mg, 27.75 μmol, 2.14 μL, 0.1 equiv.), followed by stirring at 25 °C for 14 h. LCMS showed no reaction product and the desired MS was detected. The mixture was concentrated in vacuo to give 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (90 mg, crude) as a brown gum. MS (M+H) = 307.1.

[0427] [ka] Step 6—Synthesis of 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]amino]benzoic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (80 mg, 260.80 μmol, 1 equiv.) and 2-aminobenzoic acid (35.77 mg, 260.80 μmol, 1 equiv.) in ACN (1 mL) was stirred at 90° C. for 3 h. LCMS showed that approximately 70% of the desired product was detected. The suspension was concentrated in vacuo. The crude product was purified by preparative HPLC (Kromasil 150 × 25 mm × 10 μm column, 35% to 55% acetonitrile in 0.04% ammonia solution and 10 mM NH4HCO3 in water, 10 min gradient) to give 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]amino]benzoic acid (20.23 mg, 49.65 μmol, 19.04% yield, 100% purity) as a pale yellow solid. 1H NMR (400MHz, DMSO-d6) δ=10.36(br s, 1H), 8.60(s, 1H), 7.97(d, J=7.7Hz, 1H), 7.54-7.46(m, 2H), 7.39(s, 1H), 7.17(t, J=7.5Hz, 1H), 7.11(d, J= 8.2Hz, 1H), 4.23(t, J=6.3Hz, 2H), 3.85(s, 3H), 3.51(t, J=6.2Hz, 2H), 3.27(s, 3H), 2.04(quintet, J=6.2Hz, 2H). MS(M+H) + =408.2.

[0428] Example 26 - Preparation of Compound 53A [ka] Step 1—Synthesis of diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]propanedioate: A solution of 4-methoxy-3-(3-methoxypropoxy)aniline (3 g, 14.20 mmol, 1 equiv.) and diethyl 2-(ethoxymethylene)propanedioate (3.07 g, 14.20 mmol, 2.87 mL, 1 equiv.) in toluene (30 mL) was stirred at 110° C. for 14 hours. TLC (petroleum ether:ethyl acetate=3:1, R f =0.43) indicated complete consumption of the reactants. The mixture was concentrated in vacuo to give diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]propanedioate (5.8 g, crude) as a yellow solid.

[0429] [ka] Step 2 - Synthesis of ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate: A solution of diethyl 2-[[4-methoxy-3-(3-methoxypropoxy)anilino]methylene]propanedioate (5.3 g, 13.90 mmol, 1 equiv.) in PhO (100 mL) was stirred at 260 °C for 1 h. TLC (petroleum ether:ethyl acetate = 2:1, R f=0.00) indicated the reaction was complete. The mixture was cooled to room temperature, followed by petroleum ether (100 mL), stirred for 10 minutes, and filtered to give ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (2.88 g, 8.59 mmol, 61.80% yield) as a brown solid. MS (M+H) + =336.1

[0430] [ka] Step 3—Synthesis of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid: A solution of ethyl 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (2.8 g, 8.35 mmol, 1 equiv.) in MeOH (30 mL) was added NaOH (2 M, 41.75 mL, 10 equiv.) and then stirred at 60° C. for 14 hours. LCMS showed no remaining reactant and the desired product was obtained. The mixture was concentrated in vacuo, dissolved in ethyl acetate (30 mL), and separated to obtain the aqueous layer. The layer was acidified to pH=5 with 1N HCl solution and filtered to obtain 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (2.2 g, 7.16 mmol, 85.74% yield) as a pale solid. 1 H NMR (400MHz, DMSO-d6) δ=15.86(br s, 1H), 8.73(s, 1H), 7.54(s, 1H), 7.24(s, 1H), 4.15(br t, J=6.2Hz, 2H), 3.90(s, 3H), 3.50(br t, J=6.1Hz, 2H), 3.26(s, 3H), 2.10-2.00(m, 2H).

[0431] [ka] Step 4—Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (500 mg, 1.63 mmol, 1 equiv.) in POCl (5 mL) was stirred at 100° C. for 1 h. LCMS (sample quenched with 1 mL of ice-MeOH) showed the reaction was complete. The mixture was concentrated in vacuo to give 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (580 mg, crude) as a brown oil.

[0432] [ka] Step 5—Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: To a solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (560 mg, 1.63 mmol, 1 equiv.) in DCM (6 mL), TEA (658.55 mg, 6.51 mmol, 905.84 μL, 4 equiv.) and morpholine (141.75 mg, 1.63 mmol, 143.18 μL, 1 equiv.) were added at 0 °C, followed by stirring at 25 °C for 14 h. LCMS showed the reactant was consumed and the desired MS was detected. The mixture was dissolved in water (5 mL), separated, and extracted with ethyl acetate (5 mL × 3). The combined organic layers were dried over Na SO , filtered, and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0-100% ethyl acetate in petroleum ether, gradient over 30 min) to give [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]-morpholino-methanone (310 mg, 785.11 μmol, 48.25% yield) as a white solid. MS (M+H) + =395.1.

[0433] [ka] Step 6 - Synthesis of [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]-morpholino-methanone: A solution of [4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]-morpholino-methanone (150 mg, 379.89 μmol, 1 equiv.) and 2-aminobenzoic acid (62.52 mg, 455.87 μmol, 1.2 equiv.) in ACN (2 mL) was stirred at 90 °C for 14 h. LCMS showed that approximately 50% of the desired product and approximately 20% of the reactants were detected. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 15% to 45% acetonitrile in a 10 mM solution of NH4HCO3 in water, 8 min gradient) to give 2-[[6-methoxy-7-(3-methoxypropoxy)-3-(morpholine-4-carbonyl)-4-quinolyl]amino]benzoic acid (91.92 mg, 185.50 μmol, 48.83% yield, 100% purity) as a yellow solid. 1 H NMR (400 MHz, DMSO-d 6、 T=273+80K) δ=8.50(s, 1H), 7.99-7.93(m, 1H), 7.40(s, 1H), 7.27(s, 1H), 7.24-7.17(m, 1H), 6.82(t, J=7.5H z, 1H), 6.60(d, J=8.2Hz, 1H), 4.24(t, J=6.4Hz, 2H), 3.76(s, 3H), 3.54(t, J=6.3Hz, 2H), 3.37(br d, J=4.5Hz, 4H), 3.29(s, 3H), 3.27(br d, J=8.2Hz, 4H), 2.06(quintet, J=6.4Hz, 2H). MS(M+H) + =496.3.

[0434] Example 27 - Preparation of Compound 54A [ka] Step 1—Synthesis of 6-bromo-4-chloro-quinoline-3-carbonitrile: To a suspension of 6-bromo-4-hydroxy-quinoline-3-carbonitrile (0.23 g, 923.46 μmol, 1 eq.) in SOCl (4.92 g, 41.35 mmol, 3 mL, 44.78 eq.), DMF (6.75 mg, 92.35 μmol, 7.11 μL, 0.1 eq.) was added at 0 °C, and the mixture was stirred at 25 °C for 24 h. TLC (petroleum ether:ethyl acetate = 0:1) showed the reactant was consumed and one new spot was formed. The mixture was concentrated, dissolved in toluene (5 mL × 2), and concentrated in vacuo to give 6-bromo-4-chloro-quinoline-3-carbonitrile (0.25 g, crude) as a pale yellow solid.

[0435] [ka] Step 2—Synthesis of 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid: A suspension of 6-bromo-4-chloro-quinoline-3-carbonitrile (0.15 g, 560.73 μmol, 1 equiv.) and 2-aminobenzoic acid (92.28 mg, 672.87 μmol, 1.2 equiv.) in ACN (7 mL) was stirred at 90 °C for 12 h. TLC (petroleum ether:ethyl acetate = 0:1) showed the reactant was consumed and one new spot had formed. The mixture was concentrated in vacuo to give 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid (0.2 g, crude) as a pale yellow solid. Note: Using the same synthetic method, another 0.1 g of the desired product was obtained.

[0436] [ka] Step 3—Synthesis of 2-[[3-cyano-6-(5-quinolyl)-4-quinolyl]amino]benzoic acid: To a solution of 2-[(6-bromo-3-cyano-4-quinolyl)amino]benzoic acid (220 mg, 597.53 μmol, 1 equiv.), Pd(OAc) (13.42 mg, 59.75 μmol, 0.1 equiv.), PPh (31.35 mg, 119.51 μmol, 0.2 equiv.), and KPO (507.35 mg, 2.39 mmol, 4 equiv.) in DMF (4 mL) and HO (1 mL) was added 5-quinolylboronic acid (206.72 mg, 1.20 mmol, 2 equiv.). The reaction mixture was degassed and purged with N2 five times, then stirred under N2 at 80 °C for 14 h. LCMS indicated the reactant was consumed and the desired MS was detected. The mixture was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 15% to 45% acetonitrile in a 10 mM solution of NH4HCO3 in water, 8 min gradient) to give 2-[[3-cyano-6-(5-quinolyl)-4-quinolyl]amino]benzoic acid (136.08 mg, 320.24 μmol, 53.59% yield, 98.00% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=10.96-10.41(m, 1H), 9.02(d, J=2.9Hz, 1H), 8.76(s, 1H), 8.58(s, 1H), 8.28(d, J=8.4Hz, 1H), 8.17(dd, J=5.3, 8.4Hz, 2H), 8.05(br d, J=8.6Hz, 1H), 8.00-7.90(m, 2H), 7.74(d, J=7.1Hz, 1H), 7.66-7.57(m, 2H), 7.41(d, J=7.9Hz, 1H), 7.34(t, J=7.5Hz, 1H). MS(M+H) + =417.2.

[0437] Example 28 - Preparation of Compound 55A [ka] Synthesis of 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]amino]-6-hydroxybenzoic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (150 mg, 489.01 μmol, 1 equiv.) and 2-amino-6-hydroxybenzoic acid (89.86 mg, 586.81 μmol, 1.2 equiv.) in ACN (0.5 mL) was stirred at 90° C. for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column; 10% to 40% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]amino]-6-hydroxy-benzoic acid (13.96 mg, 32.43 μmol, 6.63% yield, 98.35% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=8.67(s, 1H), 7.54(s, 1H), 7.35(s, 1H), 7.17(t, J=8.0Hz, 1H), 6.52(dd, J=2.5, 8.0Hz, 2H), 4.21(br t, J=6.3Hz, 2H), 3.87(s, 3H), 3.48-3.45(m, 2H), 3.26(s, 3H), 2.10-1.98(m, 2H). MS(M+H) + =424.0.

[0438] Example 29 - Preparation of Compound 56A [ka] Synthesis of 1-[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]-4-oxo-pyridine-3-carboxylic acid: A solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonitrile (150 mg, 489.01 μmol, 1 equiv.) and 4-oxo-1H-pyridine-3-carboxylic acid (95.24 mg, 684.61 μmol, 1.4 equiv.) in ACN (2 mL) was stirred at 90° C. for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 5% to 35% acetonitrile in a 10 mM solution of NH4HCO3 in water, 8 min gradient) to give 1-[3-cyano-6-methoxy-7-(3-methoxypropoxy)-4-quinolyl]-4-oxo-pyridine-3-carboxylic acid (14.55 mg, 35.54 μmol, 7.27% yield, 100% purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=9.19(s, 1H), 9.07(d, J=2.2Hz, 1H), 8.42(dd, J=2.3, 7.6Hz, 1H), 7.66(s, 1H), 7.03(d, J=7.5Hz, 1H), 6.9 3(s, 1H), 4.32(t, J=6.4Hz, 2H), 3.87(s, 3H), 3.50(t, J=6.2Hz, 2H), 3.26(s, 3H), 2.06(quintet, J=6.3Hz, 2H). MS(M+H) + =410.2.

[0439] Example 30 - Preparation of Compound 57A [ka] Step 1—Synthesis of 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene: A solution of 2-bromo-5-nitro-phenol (5 g, 22.94 mmol, 1 equiv.), 1-bromo-3-methoxy-propane (3.51 g, 22.94 mmol, 1 equiv.), NaI (5.16 g, 34.40 mmol, 1.5 equiv.), and CsCO (14.95 g, 45.87 mmol, 2 equiv.) in DMF (10 mL) was stirred at 100 °C for 2 h. TLC (petroleum ether:ethyl acetate = 3:1, R f =0.43) indicated the reaction was complete. The suspension was filtered to obtain the filtrate. The filtrate was dissolved in ethyl acetate (20 mL) and water (30 mL), separated, and extracted with ethyl acetate (10 mL). The combined organic layers were washed with water (5 mL × 3), dried over Na2SO4, filtered, and concentrated to obtain 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene (6.3 g, 21.72 mmol, 94.68% yield) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=7.88(dd, J=1.5, 8.6Hz, 1H), 7.81(s, 1H), 7.77-7.72(m, 1H), 4.25(t, J=6. 2Hz, 2H), 3.51(t, J=6.3Hz, 2H), 3.28-3.24(m, 3H), 2.01(quintet, J=6.0Hz, 2H).

[0440] [ka] Step 2—Synthesis of 4-bromo-3-(3-methoxypropoxy)aniline: A solution of 1-bromo-2-(3-methoxypropoxy)-4-nitro-benzene (5.3 g, 18.27 mmol, 1 equiv.), Fe (8.67 g, 155.29 mmol, 8.5 equiv.), and NHCl (8.80 g, 164.42 mmol, 9 equiv.) in a mixture of methanol (40 mL) and HO (20 mL) was stirred at 80 °C for 4 h. TLC (petroleum ether:ethyl acetate = 3:1, Rf = 0.24) indicated the reaction was complete. The mixture was filtered to obtain the filtrate, which was then concentrated in vacuo. The residue was dissolved in ethyl acetate (20 mL) and water (10 mL), separated, and extracted with ethyl acetate (20 mL × 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo to give 4-bromo-3-(3-methoxypropoxy)aniline (4.0 g, 15.38 mmol, 84.17% yield) as a pale yellow oil. 1 H NMR (400MHz, DMSO-d6) δ=7.10(d, J=8.4Hz, 1H), 6.31(d, J=2.3Hz, 1H), 6.10(dd, J=2.4, 8.5Hz, 1H), 5.25(br s, 2H), 3.96 (t, J=6.3Hz, 2H), 3.50 (t, J=6.3Hz, 2H), 3.25 (s, 3H), 1.94 (quintet, J=6.3Hz, 2H).

[0441] [ka] Step 3—Synthesis of diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]propanedioate: A solution of 4-bromo-3-(3-methoxypropoxy)aniline (4.0 g, 15.38 mmol, 1 equiv.) and diethyl 2-(ethoxymethylene)propanedioate (3.32 g, 15.38 mmol, 3.11 mL, 1 equiv.) in toluene (40 mL) was stirred at 110 °C for 4 h. LCMS showed the reaction was complete. The reaction mixture was concentrated in vacuo to give diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]propanedioate (6.8 g, crude) as a brown gum. 1H NMR (400MHz, DMSO-d6) δ=10.63(br d, J=13.9Hz, 1H), 8.36(d, J=13.7Hz, 1H), 7.51(d, J=8.6Hz, 1H), 7.21(d, J=1.8Hz, 1H), 6.89(dd, J=1.9, 8.5Hz, 1H), 4.19 (q, J=7.1Hz, 2H), 4.14-4.04(m, 4H), 3.49(t, J=6.2Hz, 2H), 3.24(s, 3H), 1.96 (quintet, J=6.2Hz, 2H), 1.23(q, J=7.7Hz, 6H).

[0442] [ka] Step 4—Synthesis of ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate: A solution of diethyl 2-[[4-bromo-3-(3-methoxypropoxy)anilino]methylene]propanedioate (2 g, 4.65 mmol, 1 equiv.) in PhO (20 mL) was stirred at 260 °C for 0.5 h. LCMS (added to petroleum ether and dissolved the solid in MeOH) showed that the desired MS was detected. The mixture was cooled to room temperature, followed by the addition of petroleum ether (20 mL) and filtration to give ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (1.2 g, crude) as a pale solid. MS (M+H) + =384.0.

[0443] [ka] Step 5—Synthesis of 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid: To a solution of ethyl 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylate (800 mg, 2.08 mmol, 1 equiv.) in MeOH (10 mL), NaOH (2 M, 10.41 mL, 10 equiv.) was added and stirred at 50 °C for 14 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo, acidified to pH = 4 with 1 N HCl solution, and filtered to give 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (760 mg, crude) as a pale solid. 1 H NMR (400MHz, DMSO-d6) δ=13.82(br s, 1H), 8.75(br d. MS(M+H) + =356.0

[0444] [ka] Step 6—Synthesis of 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 6-bromo-4-hydroxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (400 mg, 1.12 mmol, 1 equiv.) in POCl (4 mL) was stirred at 100° C. for 1 h. LCMS (sample quenched with 1 mL of ice-EtOH) showed the reaction was complete. The mixture was concentrated in vacuo to give 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (520 mg, crude) as a brown oil.

[0445] [ka] Step 7—Synthesis of 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide: To a solution of 6-bromo-4-chloro-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (440 mg, 1.12 mmol, 1 equiv.) in DCM (5 mL), TEA (339.82 mg, 3.36 mmol, 467.43 μL, 3 equiv.) and N-methylmethanamine (82.15 mg, 1.01 mmol, 92.31 μL, 0.9 equiv., HCl) were added at 0° C., followed by stirring at 25° C. for 14 h. LCMS showed the reaction was complete. Water (5 mL) was added to DCM (5 mL × 3), separated, and extracted. The combined organic layers were dried over NaSO and concentrated in vacuo to give 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide (490 mg, crude) as a yellow gum. MS (M+H) + =401.0

[0446] [ka] Step 8—Synthesis of 2-[[6-bromo-3-(dimethylcarbamoyl)-7-(3-methoxypropoxy)-4-quinolyl]amino]benzoic acid: A solution of 6-bromo-4-chloro-7-(3-methoxypropoxy)-N,N-dimethyl-quinoline-3-carboxamide (160 mg, 398.33 μmol, 1 equiv.) and 2-aminobenzoic acid (65.55 mg, 477.99 μmol, 1.2 equiv.) in ACN (2 mL) was stirred at 90° C. for 14 hours. LCMS showed the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 25% to 55% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[[6-bromo-3-(dimethylcarbamoyl)-7-(3-methoxypropoxy)-4-quinolyl]amino]benzoic acid (33.45 mg, 65.15 μmol, 16.36% yield, 97.85% purity) as a yellow solid. 1H NMR (400MHz, DMSO-d6) δ=11.78(br d. 69(d, J=8.1Hz, 1H), 4.29(t, J=6.2Hz, 2H), 3.57(t, J=6.2Hz, 2H), 3.28(s, 3H), 2.71(s, 3H), 2.54(s, 3H), 2.07(quintet, J=6.2Hz, 2H). MS(M+H) + =502.0.

[0447] Example 31 - Preparation of Compound 58A [ka] Step 1—Synthesis of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride: A solution of 4-hydroxy-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxylic acid (900 mg, 2.93 mmol, 1 equiv.) in POCl (8 mL) was stirred at 100° C. for 1 h. LCMS (sample quenched with 1 mL of ice-MeOH) showed the reaction was complete. The mixture was concentrated in vacuo to give 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (1 g, crude) as a brown oil.

[0448] [ka] Step 2—Synthesis of 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide: To a solution of 4-chloro-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carbonyl chloride (1 g, 2.91 mmol, 1 equiv.) in DCM (10 mL), TEA (1.18 g, 11.62 mmol, 1.62 mL, 4 equiv.) and 2,2-dimethoxyethanamine (305.46 mg, 2.91 mmol, 316.54 μL, 1 equiv.) were added at 0° C., followed by stirring at 25° C. for 14 h. LCMS showed the reaction was complete. The mixture was dissolved in water (10 mL), separated, and extracted with DCM (20 mL × 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0 to 100% ethyl acetate in petroleum ether, gradient over 30 min) to give 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide (500 mg, 1.21 mmol, 41.68% yield) as a white solid.

[0449] [ka] Step 3—Synthesis of 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]oxazole: A solution of 4-chloro-N-(2,2-dimethoxyethyl)-6-methoxy-7-(3-methoxypropoxy)quinoline-3-carboxamide (105 mg, 254.32 μmol, 1 equiv.) in PPA (2 g) was stirred at 90° C. for 4 hours. LCMS showed the reaction was complete. The two batches of reaction mixture were combined and subsequently added to ice water (10 mL), dissolved in ethyl acetate (20 mL), separated, and extracted with ethyl acetate (20 mL × 3). The combined organic layer was dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate in petroleum ether, gradient over 30 min) to give 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]oxazole (36 mg, 103.22 μmol, 20.29% yield) as a pale yellow solid. MS (M+H) + =349.2

[0450] [ka] Step 4—Synthesis of 2-[[6-methoxy-7-(3-methoxypropoxy)-3-oxazol-2-yl-4-quinolyl]amino]benzoic acid: A solution of 2-[4-chloro-6-methoxy-7-(3-methoxypropoxy)-3-quinolyl]oxazole (20 mg, 57.34 μmol, 1 equiv.), 2-aminobenzoic acid (19.97 mg, 145.65 μmol, 2.54 equiv.), and HCl (12 M, 23.89 μL, 5.0 equiv.) in ACN (0.6 mL) was stirred at 90° C. for 14 hours. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 30 mm × 10 μm column; 5% to 25% acetonitrile in 10 mM NH4HCO3 in water, 10 min gradient) to give 2-[[6-methoxy-7-(3-methoxypropoxy)-3-oxazol-2-yl-4-quinolyl]amino]benzoic acid (12.64 mg, 27.76 μmol, 48.41% yield, 98.71% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.40(br s, 1H), 9.10(s, 1H), 8.19(s, 1H), 7.95(dd, J=1.5, 7.9Hz, 1H), 7.45-7.37(m, 2H), 7.26-7.15(m, 1H), 6.97(s, 1H), 6.89( t, J=7.6Hz, 1H), 6.43(d, J=7.9Hz, 1H), 4.21(t, J=6.4Hz, 2H), 3.53-3.49(m, 5H), 3.27(s, 3H), 2.04(quintet, J=6.3Hz, 2H).

[0451] Example 32 - Preparation of Compound 61A [ka] Step 1—Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-bromoquinolin-4-ol (1 g, 4.46 mmol, 1 equiv) in sulfurchloridic acid (13 mL) was stirred at 100° C. for 10 hours under N. LCMS showed that no reactant 1 remained. The mixture was added to ice water (10 mL), filtered to obtain a filter cake that was dried in vacuo to give 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (1.7 g, crude) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.83(s, 1H), 8.36(d, J=2.2Hz, 1H), 8.01(dd, J=2.2, 8.8Hz, 1H), 7.85(d, J=9.0Hz, 1H).

[0452] [ka] Step 2—Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonamide: A stirred solution of THF (4 mL) was bubbled with NH3 at 0° C. to pH 14, and then 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (1.0 g, 3.10 mmol, 1 equiv.) was added at 0° C. The mixture was then stirred at 25° C. for 2 hours. LCMS showed the reaction was complete. The mixture was concentrated in vacuo, triturated with MTBE (5 ml) at room temperature, filtered to obtain a filter cake, and dried in vacuo to give 6-bromo-4-hydroxy-quinoline-3-sulfonamide (1 g, crude) as a pale solid. 1 H NMR (400MHz, DMSO-d6) δ=8.52(s, 1H), 8.26(d, J=2.2Hz, 1H), 7.92(dd, J=2.2, 8.8Hz, 1H), 7.72(d, J=8.8Hz, 1H), 6.86(br s, 2H).

[0453] [ka] Step 3—Synthesis of 6-bromo-4-chloro-quinoline-3-sulfonamide: A solution of 6-bromo-4-hydroxy-quinoline-3-sulfonamide (200 mg, 659.78 μmol, 1 equiv.) and DMF (4.82 mg, 65.98 μmol, 5.08 μL, 0.1 equiv.) in SOCl (3 mL) was stirred at 25° C. for 14 h. LCMS showed no reactant 1 remained. The mixture was concentrated in vacuo to give 6-bromo-4-chloro-quinoline-3-sulfonamide (190 mg, crude) as an off-white solid.

[0454] [ka] Step 4—Synthesis of 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid: A solution of 6-bromo-4-chloro-quinoline-3-sulfonamide (150 mg, 466.45 μmol, 1 equiv.), HCl (236.21 mg, 2.33 mmol, 231.58 μL, 36% purity, 5 equiv.), and 2-aminobenzoic acid (70.36 mg, 513.09 μmol, 1.1 equiv.) in ACN (1 mL) was stirred at 90° C. for 14 h. LCMS showed the desired product was detected. The reaction solution was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 15% to 35% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid (16.76 mg, 37.74 μmol, 8.09% yield, 95.09% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=11.28(br s, 1H), 9.15(s, 1H), 8.01-7.94(m, 2H), 7.93-7.89(m, 1H), 7.79(d, J=2.0 Hz, 1H), 7.23-7.16(m, 1H), 6.95(t, J=7.5Hz, 1H), 6.43(d, J=8.2Hz, 1H). MS(MH) - =419.9.

[0455] Example 33 - Preparation of Compound 63A [ka] Step 1—Synthesis of 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-chloroquinolin-4-ol (1.5 g, 8.35 mmol, 1 equiv.) in chlorosulfonic acid (15 mL) was stirred at 100°C for 14 hours. LCMS showed the reaction was complete. The mixture was added dropwise with ice water (50 mL) at 0-5°C, filtered to obtain a filter cake, which was dried in vacuo to give 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride (1.9 g, 6.83 mmol, 81.80% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.90(s, 1H), 8.23(d, J=2.2Hz, 1H), 8.00-7.97(m, 1H), 7.95-7.91(m, 1H).

[0456] [ka] Step 2—Synthesis of 6-chloro-4-hydroxy-quinoline-3-sulfonamide: NH3 (36.74 mg, 2.16 mmol, 1 equiv.) was bubbled into THF (10 mL) at 0 °C until pH = 14, followed by 6-chloro-4-hydroxyquinoline-3-sulfonyl chloride (600 mg, 2.16 mmol, 1 equiv.). The mixture was stirred at 25 °C for 2 h. LCMS showed the reactant was consumed and a new major peak was detected. The mixture was concentrated in vacuo, triturated with MTBE (5 mL), and filtered to give 6-chloro-4-hydroxy-quinoline-3-sulfonamide (600 mg, crude) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.52(s, 1H), 8.11(s, 1H), 7.84-7.76(m, 2H), 6.84(br s, 2H).

[0457] [ka] Step 3—Synthesis of 4,6-dichloroquinoline-3-sulfonamide: A solution of 6-chloro-4-hydroxy-quinoline-3-sulfonamide (50 mg, 193.29 μmol, 1 equiv.) in POCl (2 mL) was stirred at 110° C. for 2 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo to give 4,6-dichloroquinoline-3-sulfonamide (52 mg, crude) as a yellow gum.

[0458] [ka] Step 4 - Synthesis of 2-[(6-chloro-3-sulfamoyl-4-quinolyl)amino]benzoic acid: To a stirred solution of 4,6-dichloroquinoline-3-sulfonamide (50 mg, 180.42 μmol, 1 equiv.) in CH3CN (2 mL) was added 2-aminobenzoic acid (24.74 mg, 180.42 μmol, 1 equiv.). The mixture was then stirred at 90 °C for 2 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo. The crude residue was purified by preparative HPLC (Nano-micro Kromasil C18 80 × 25 mm μm column; 22–42% acetonitrile in 0.04% HCl acid solution in water, 7 min gradient) to give 2-[(6-chloro-3-sulfamoyl-4-quinolyl)amino]benzoic acid (17.70 mg, 46.49 μmol, 25.77% yield, 99.24% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=10.39(br s, 1H), 9.18(s, 1H), 8.14(d, J=8.8Hz, 1H), 8.07-7.98(m, 3H), 7.91(dd, J=2.2, 9. 0Hz, 1H), 7.51(d, J=2.2Hz, 1H), 7.41-7.33(m, 1H), 7.17(t, J=7.5Hz, 1H), 6.71(br d, J=7.9Hz, 1H). MS(M+H) + =377.9.

[0459] Example 34 - Preparation of Compound 64A [ka] Step 1—Synthesis of 6-bromo-4-chloro-quinoline-3-sulfonamide: A suspension of 6-bromo-4-hydroxy-quinoline-3-sulfonamide (300 mg, 989.67 μmol, 1 equiv.) in POCl3 (1 mL) was stirred at 110 °C for 2 h. LCMS showed complete consumption of the starting material and formation of the desired product. The mixture was concentrated in vacuo, and the residue was azeotroped with toluene (3 mL × 2) to give 6-bromo-4-chloro-quinoline-3-sulfonamide (300 mg, crude) as a yellow gum.

[0460] [ka] Step 2—Synthesis of 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid: To a stirred solution of 6-bromo-4-chloro-quinoline-3-sulfonamide (300 mg, 932.90 μmol, 1 equiv.) in CH3CN (8 mL) was added 2-aminobenzoic acid (127.93 mg, 932.90 μmol, 1 equiv.). The mixture was then stirred at 90°C for 3 hours. LCMS showed that the starting material was completely consumed and the desired product was formed. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC: Column: Nano-micro Kromasil C18 80 × 25 mm μm; Mobile phase: [water (0.04% HCl)-ACN]; B%: 15% to 45%, 7 min to give 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid (170 mg, 402.60 μmol, 43.16% yield) as a yellow solid. MS (M+H)+ = 422.0.

[0461] [ka] Step 3—Synthesis of 2-[[6-(1,3-benzoxazol-7-yl)-3-sulfamoyl-4-quinolyl]amino]benzoic acid: 2-[(6-bromo-3-sulfamoyl-4-quinolyl)amino]benzoic acid (80 mg, 189.46 μmol, 1 equiv.), KPO (0.4 M, 947.30 μL, 2 equiv.) in THF (2 mL) and HO (0.5 mL). To a solution of [2-(2-aminophenyl)phenyl]-chloro-palladium; bis(1-adamantyl)-butyl-phosphane (12.67 mg, 18.95 μmol, 0.1 equiv.), 7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1,3-benzoxazole (55.72 mg, 227.35 μmol, 1.2 equiv.) was added. The mixture was further degassed and purged with N2 five times, then stirred under N2 at 80 °C for 14 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column; 15% to 45% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[[6-(1,3-benzoxazol-7-yl)-3-sulfamoyl-4-quinolyl]amino]benzoic acid (24.45 mg, 52.50 μmol, 27.71% yield, 98.88% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6+D2O) δ=9.13(s, 1H), 8.55(s, 1H), 8.31(qd, J=2.2, 4.6Hz, 2H), 8.19-8.16(m, 1H), 7.97(dd, J=1.6, 7.8Hz, 1H), 7.77(dd, J =1.0, 7.7Hz, 1H), 7.53-7.47(m, 1H), 7.45-7.40(m, 1H), 7.18-7.11(m, 1H), 7.00-6.91(m, 1H), 6.56(d, J=7.7Hz, 1H). 1H NMR (400MHz, DMSO-d6) δ=9.15(s, 1H), 8.58(s, 1H), 8.34-8.27(m, 2H), 8.18(d, J=9.3Hz, 1H), 7.98(dd, J=1.5, 7.7Hz, 1H), 7.78( dd, J=1.1, 7.7Hz, 1H), 7.51-7.40(m, 3H), 7.20-7.11(m, 1H), 6.94(t, J=7.5Hz, 1H), 6.56(d, J=7.7Hz, 1H). MS(M+H)+=461.1.

[0462] Example 35 - Preparation of Compound 70A [ka] Step 1—Synthesis of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride: A solution of 6-bromoquinolin-4-ol (3.5 g, 15.62 mmol, 1 equiv.) in chlorosulfonic acid (30 mL) was stirred at 100° C. for 14 hours. LCMS showed that no reactant remained and two new spots had formed. The mixture was added to ice water (100 mL) and filtered to give 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (4.2 g, 13.02 mmol, 83.35% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.89(s, 1H), 8.38(d, J=2.0Hz, 1H), 8.04(dd, J=2.2, 8.8Hz, 1H), 7.90(d, J=8.8Hz, 1H).

[0463] [ka] Step 2—Synthesis of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (700 mg, 2.17 mmol, 1 equiv.) in chloroform (0.5 mL) and TEA (658.78 mg, 6.51 mmol, 906.17 μL, 3 equiv.), morpholine (378.12 mg, 4.34 mmol, 381.94 μL, 2 equiv.) was added at 0° C. The resulting solution was stirred at 0° C. for 1 h and at 25° C. for 3 h. LCMS showed the reaction was complete. The suspension was filtered to obtain a filter cake, which was dried in vacuo to give 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (460 mg, 1.23 mmol, 56.79% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=8.54(s, 1H), 8.24(d, J=2.2Hz, 1H), 7.93(dd, J=2.4, 8.8Hz, 1H), 7.68(d, J=8.8H z, 1H), 3.81-3.75(m, 2H), 3.62-3.56(m, 2H), 3.20-3.16(m, 2H), 3.14-3.10(m, 2H). MS(M+H)+=372.9.

[0464] [ka] Step 3—Synthesis of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine: A solution of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (330 mg, 884.19 μmol, 1 equiv.) in POCl (15 mL) was stirred at 110° C. for 6 hours. LCMS indicated that approximately 30% of the reactant remained. The mixture was stirred at 110° C. for an additional 4 hours. LCMS indicated that the reaction was complete. The solution was concentrated in vacuo, diluted with toluene (2 mL), concentrated in vacuo, and dissolved in ethyl acetate (5 mL). The solution was added dropwise to ice-water (5 mL), separated, and extracted with ethyl acetate (5 mL × 2). The combined organic layers were washed with brine (2 mL), dried over NaSO, filtered, and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0 to 30% ethyl acetate in petroleum ether, gradient over 30 min) to give 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (190 mg, 485.11 μmol, 54.86% yield) as an off-white solid. 1 H NMR (400MHz, DMSO-d6) δ=9.24(s, 1H), 8.60(d, J=1.8Hz, 1H), 8.22-8.17(m, 1H), 8.16-8.12(m, 1H), 3.67-3.57(m, 4H), 3.31-3.25(m, 4H). MS(M+H)+=390.9.

[0465] [ka] Step 4—Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (180 mg, 459.57 μmol, 1 equiv.) and 2-aminobenzoic acid (75.63 mg, 551.49 μmol, 1.2 equiv.) in ACN (5 mL) was stirred at 90° C. for 14 hours. LCMS showed the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Nano-micro Kromasil C18 80 × 25 mm μm column; 35% to 60% acetonitrile in 0.04% HCl solution in water, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (114.5 mg, 232.56 μmol, 50.60% yield, 100% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ=10.45(br s, 1H), 9.10(s, 1H), 8.12-7.97(m, 3H), 7.74(d, J=2.0Hz, 1H), 7.42-7.31(m, 1H), 7 .10(t, J=7.5Hz, 1H), 6.73(d, J=8.2Hz, 1H), 3.54-3.31(m, 4H), 3.14-2.97(m, 4H). MS(M+H) + =491.9.

[0466] Example 36 - Preparation of Compound 78A [ka] Step 1—Synthesis of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-bromo-4-hydroxy-quinoline-3-sulfonyl chloride (2 g, 6.20 mmol, 1 equiv.) in CHCl3 (20 mL) was added morpholine (1.08 g, 12.40 mmol, 1.09 mL, 2 equiv.) at 0 °C, and TEA (1.88 g, 18.60 mmol, 2.59 mL, 3 equiv.) was added dropwise. The mixture was stirred at 20 °C for 1 h. LCMS showed the reaction was complete. The suspension was filtered to obtain a filter cake, which was dried in vacuo. 6-Bromo-3-morpholinosulfonyl-quinolin-4-ol (2.7 g, crude) was obtained as an off-white solid. MS (M+H) + =372.9.

[0467] [ka] Step 2 - Synthesis of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine: A solution of 6-bromo-3-morpholinosulfonyl-quinolin-4-ol (2.5 g, 6.70 mmol, 1 equiv.) in POCl3 (25 mL) was stirred at 110 °C for 12 hours. LCMS showed that the desired ms was detected. The reaction mixture was concentrated in vacuo to remove POCl3. Ethyl acetate (20 mL) was added dropwise to the residue. The above solution was added dropwise, separated, and extracted with ethyl acetate (20 mL × 2). The combined organic layer was dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 20 g silica, 0 to 20% ethyl acetate in petroleum ether, gradient over 30 min) to give 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (1.2 g, 3.06 mmol, 45.74% yield) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ 9.20(s, 1H), 8.57(s, 1H), 8.25-8.09(m, 2H), 3.59(br s, 4H), 3.25(br s, 4H).

[0468] [ka] Step 3—Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-6-hydroxybenzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (100 mg, 255.32 μmol, 1 equiv.) and 2-amino-6-hydroxybenzoic acid (46.92 mg, 306.38 μmol, 1.2 equiv.) in EtOH (5 mL) and CHCl3 (1 mL) was stirred at 70° C. for 0.5 h. LCMS showed the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Phenomenex luna C18 80 × 40 mm × 3 μm column; 27% to 55% acetonitrile in 0.04% HCl in water, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-6-hydroxybenzoic acid (9.4 mg, 17.38 μmol, 6.81% yield, 94.00% purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ 10.48-10.05(m, 1H), 9.04(s, 1H), 8.03(s, 2H), 7.70(s, 1H), 7.21(t, J=8.1Hz, 1H), 6.74(d, J=8.0Hz, 1H), 6.38(d, J=8.0Hz, 1H), 3.60-3.46(m, 4H), 3.19-3.07(m, 4H). MS(M+H) + =508.0.

[0469] Example 37 - Preparation of Compounds 78A-INT and 78A-BR [ka] Step 1—Synthesis of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxy-benzoic acid: A solution of 4-[(6-bromo-4-chloro-3-quinolyl)sulfonyl]morpholine (100 mg, 255.32 μmol, 1 equiv.), HCl (5.17 mg, 51.06 μmol, 5.07 μL, 36% purity, 0.2 equiv.), and 2-amino-6-methoxy-benzoic acid (51.22 mg, 306.38 μmol, 1.2 equiv.) in EtOH (5 mL) and CHCl (1 mL) was stirred at 70 °C for 0.5 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo and dissolved in DMSO (1 mL). The crude product was purified by preparative HPLC (Phenomenex luna C18 80 × 40 mm × 3 μm column; 28% to 55% acetonitrile in 0.04% HCl in water, 7 min gradient) to give 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxybenzoic acid (60 mg, 114.86 μmol, 44.99% yield, 100% purity) as a yellow solid. 1 H NMR (400MHz, DMSO-d6) δ 8.98(s, 1H), 8.02-7.98(m, 1H), 7.96-7.91(m, 1H), 7.73(s, 1H), 7.27(t, J=8 .3Hz, 1H), 6.94(d, J=8.2Hz, 1H), 6.43(d, J=8.2Hz, 1H), 3.89(s, 3H), 3.54(br s, 4H), 3.14(br s, 4H). MS(M+H) + =522.0.

[0470] [ka] Step 2—Synthesis of 3-bromo-6-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-2-hydroxy-benzoic acid: To a solution of 2-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxy-benzoic acid (60 mg, 114.86 μmol, 1 equiv.) in DCM (0.5 mL) at −78 °C, BBr3 (86.33 mg, 344.58 μmol, 33.20 μL, 3 equiv.) was added dropwise. The reaction mixture was stirred under N2 at 20 °C for 3 h. LCMS showed that the desired product was detected. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge Prep OBD C18 150 × 40 mm × 10 μm column, 15% to 45% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 3-bromo-6-[(6-bromo-3-morpholinosulfonyl-4-quinolyl)amino]-2-hydroxy-benzoic acid (5.7 mg, 9.59 μmol, 8.35% yield, 98.76% purity) as a reddish-brown solid. 1 H NMR (400MHz, DMSO-d6) δ 11.37(br s, 1H), 9.12(s, 1H), 8.06(d, J=0.9Hz, 2H), 7.89(s, 1H), 7.42(d, J=8.9Hz, 1H), 6.09(d, J=8.8Hz, 1H), 3.62-3.54(m, 2H), 3.53-3.46(m, 2H), 3.22-3.08(m, 4H). MS(M+H) + =585.9.

[0471] Example 38 - Preparation of Compound 79A-INT and 79A [ka] Step 1—Synthesis of 6-chloro-3-morpholinosulfonyl-quinolin-4-ol: To a solution of 6-chloro-4-hydroxy-quinoline-3-sulfonyl chloride (650 mg, 2.34 mmol, 1 equiv.) in CHCl3 (7 mL), morpholine (407.23 mg, 4.67 mmol, 411.35 μL, 2 equiv.) and TEA (709.50 mg, 7.01 mmol, 975.93 μL, 3 equiv.) were added at 0 °C. The mixture was stirred at 20 °C for 1 h. LCMS showed the reaction was complete. The suspension was filtered to obtain a filter cake, which was dried in vacuo to give 6-chloro-3-morpholinosulfonyl-quinolin-4-ol (930 mg, crude) as an off-white solid, which was used directly in the next step. 1 H NMR (400MHz, DMSO-d6) δ 8.52(s, 1H), 8.16-8.05(m, 1H), 7.86-7.76(m, 2H), 3.19(brs, 4H), 3.11-3.02(m, 4H).

[0472] [ka] Step 2 - Synthesis of 4-[(4,6-dichloro-3-quinolyl)sulfonyl]morpholine: A solution of 6-chloro-3-morpholinosulfonyl-quinolin-4-ol (800 mg, 2.43 mmol, 1 equiv.) in POCl3 (8 mL) was stirred at 110 °C for 14 hours. LCMS showed that the desired ms was detected. The reaction mixture was concentrated in vacuo to remove excess POCl3. Ethyl acetate (10 mL) was added dropwise to the residue. The solution was added to ice water (10 mL), separated, and extracted with ethyl acetate (10 mL × 2). The combined organic layers were dried over Na2SO4 and concentrated in vacuo. The crude product was purified by flash column (ISCO 10 g silica, 0-30% ethyl acetate in petroleum ether, gradient over 30 min) to give 4-[(4,6-dichloro-3-quinolyl)sulfonyl]morpholine (380 mg, 1.09 mmol, 44.98% yield) as an off-white solid. MS (M+H) + =347.0.

[0473] [ka] Step 3—Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxy-benzoic acid: A solution of 4-[(4,6-dichloro-3-quinolyl)sulfonyl]morpholine (120 mg, 345.61 μmol, 1 equiv.), HCl (7.00 mg, 69.12 μmol, 6.86 μL, 36% purity, 0.2 equiv.), and 2-amino-6-methoxy-benzoic acid (69.33 mg, 414.73 μmol, 1.2 equiv.) in EtOH (7.5 mL) and CHCl (1.5 mL) was stirred at 70° C. for 0.5 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Phenomenex Luna C18 80 x 40 mm x 3 µm column; 30% to 55% acetonitrile in 0.04% HCl in water, 7 min gradient) to afford 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxybenzoic acid (50.6 mg, 98.11 µmol, 28.39% yield, 99.73% purity, HCl) as a yellow solid. 5.6 mg of the desired product was shipped. 1 H NMR (400MHz, DMSO-d6) δ 9.16-8.89(m, 2H), 8.14-8.01(m, 1H), 7.85(br d, J=8.6Hz, 1H), 7.53(s, 1H), 7.24(t, J=8.2Hz, 1H), 6.89(br d, J=8.6Hz, 1H), 6.39(d, J=8.1Hz, 1H), 3.86(s, 3H), 3.59-3.42(m, 4H), 3.20-2.95(m, 4H). MS(M+H) + =478.0.

[0474] [ka] Step 4—Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]-6-hydroxybenzoic acid: To a solution of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]-6-methoxybenzoic acid (50 mg, 104.62 μmol, 1 equiv.) in DCM (1 mL) at 0 °C, BCl (1 M, 418.48 μL, 4 equiv.) was added dropwise. The reaction mixture was stirred under N at 25 °C for 2 h. LCMS indicated the reaction was complete. The mixture was concentrated in vacuo. The crude product was purified by preparative HPLC (Waters Xbridge BEH C18 100 × 25 mm × 5 μm column; 20% to 44% acetonitrile in 10 mM NHHCO in water, 10 min gradient). Twice purified: The crude product was purified by preparative HPLC (Phenomenex luna C18 80 × 40 mm × 3 μm column; 10% to 70% acetonitrile in 0.04% HCl in water, 7 min gradient) to give 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]-6-hydroxybenzoic acid (12.9 mg, 27.45 μmol, 26.24% yield, 98.71% purity) as a brown solid. 1 H NMR (400MHz, DMSO-d6) δ 10.23-10.07(m, 1H), 9.03(s, 1H), 8.08(d, J=9.0Hz, 1H), 7.89(dd, J=2.2, 9.0Hz, 1H), 7.58(d, J=2.2Hz, 1H), 7.17(t, J=8.2Hz, 1H), 6.64(d, J=8.6Hz, 1H), 6.22(d, J=7.9Hz, 1H), 3.62-3.50(m, 2H), 3.48-3.38(m, 2H), 3.18-2.99(m, 4H). MS(M+H) + =464.1.

[0475] Example 39 - Preparation of Compound 80A [ka] Synthesis of 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid: A solution of 4-[(4,6-dichloro-3-quinolyl)sulfonyl]morpholine (100 mg, 288.00 μmol, 1 equiv.) and 2-aminobenzoic acid (47.39 mg, 345.61 μmol, 1.2 equiv.) in ACN (1 mL) was stirred at 90° C. for 4 hours. LCMS showed the reaction was complete. TEA (0.1 mL) was added to the mixture, and it was filtered to obtain the filtrate. The crude product was purified by preparative HPLC (Phenomenex Gemini-NX C18 75 × 30 mm × μm column; 10% to 40% acetonitrile in 10 mM NH4HCO3 in water, 8 min gradient) to give 2-[(6-chloro-3-morpholinosulfonyl-4-quinolyl)amino]benzoic acid (38.3 mg, 84.67 μmol, 29.40% yield, 99.01% purity) as a pale yellow solid. 1 H NMR (400MHz, DMSO-d6) δ 10.55(br s, 1H), 9.11(s, 1H), 8.17(d, J=9.0Hz, 1H), 8.02(dd, J=1.4, 7.9Hz, 1H), 7.94(dd, J=2.3, 9.1Hz, 1H), 7.57(d, J=2.3Hz, 1H) , 7.45-7.31(m, 1H), 7.14(t, J=7.4Hz, 1H), 6.81(d, J=8.3Hz, 1H), 3.54-3.47(m, 2H), 3.44-3.34(m, 2H), 3.15-3.01(m, 4H). MS(M+H) + =448.1.

[0476] Example 40 - Preparation of Compound 81A - INT and 81A [ka] Step 1—Synthesis of 6-bromo-4-hydroxy-quinoline-3-carboxylic acid: A solution of ethyl 6-bromo-4-hydroxy-quinoline-3-carboxylate (3 g, 10.13 mmol, 1 equiv.) in 2N NaOH (30 mL) was stirred at 100° C. for 3 hours. LCMS showed that the starting material was completely consumed and the desired MS was detected. The mixture was acidified to pH=3 with 1 M HCl and filtered to give 6-br...

Claims

1. A compound of formula (III), 【Chemistry 1】 or a pharma- ceutically acceptable salt thereof, X １ N and CR １ is selected from the group consisting of R １ , R ２ , R ３ , R ４ , and R ６ are each independently H, C １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C １－４ Haloalkyl, Cy １ , Haro, CN, NO ２ , OR ａ１ , S.R. ａ１ , C(O)R ｂ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , N.R. ｃ１ R ｄ１ , N.R. ｃ１ C(O)R ｂ１ , N.R. ｃ１ S (O) ２ R ｂ１ , S(O)R ｂ１ , S(O) ２ R ｂ１ , and S(O) ２ N.R. ｃ１ R ｄ１ wherein C is selected from the group consisting of １－６ Alkyl, C ２－６ Alkenyl, and C ２－６ Each alkynyl is optionally independently selected from Cy １ , Haro, CN, NO ２ , OR ａ１ , S.R. ａ１ , C(O)R ｂ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , N.R. ｃ１ R ｄ１ , N.R. ｃ１ C(O)R ｂ１ , N.R. ｃ１ S (O) ２ R ｂ１ , S(O) ２ R ｂ１ , and S(O) ２ N.R. ｃ１ R ｄ１ and is substituted with 1, 2, 3, 4, or 5 substituents selected from the group consisting of: R ５ is C(O)NR ｃ１ R ｄ１ , S(O) ２ N.R. ｃ１ R ｄ１ , and Cy １ is selected from the group consisting of Each Cy １ is independent, C ６－１０ Aryl, C ３－１０ cycloalkyl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally and independently selected from the group consisting of R Ｃｙ and is substituted with 1, 2, or 3 substituents selected from R ７ is H, C １－３ Alkyl, C(O)C １－６ Alkyl, C(O)OR ａ１ , S(O) ２ N.R. ｃ１ R ｄ１ and phenyl, said phenyl optionally being selected from the group consisting of halo, CN, OR ａ１ , S.R. ａ１ , or N.R. ｃ１ R ｄ１ is replaced by W is selected from the group consisting of C(O)OH and a carboxylic acid bioisostere, where the carboxylic acid bioisostere is selected from any one of the moieties shown in the table below: 【Chemistry 2】 R Ｃｙ , Haro, CN, NO ２ , C １－６ Alkyl, C １－６ Haloalkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C ３－１０ Cycloalkyl, 5- to 10-membered heteroaryl, 4- to 6-membered heterocycloalkyl, OR ａ２ , C(O)R ｂ２ , C(O)OR ａ２ , C(O)NR ｃ２ R ｄ２ , C(O)NR ｃ１ S (O) ２ R ｂ２ , N.R. ｃ２ R ｄ２ , N.R. ｃ２ C(O)R ｂ２ , N.R. ｃ２ C(O)OR ａ２ , N.R. ｃ２ S (O) ２ R ｂ２ , O.C.(O)R ｂ１ , S(O) ２ R ｂ２ , and S(O) ２ N.R. ｃ２ R ｄ２ wherein C is selected from the group consisting of １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C ３－１０ Cycloalkyl, and 4- to 6-membered heterocycloalkyl are each optionally independently selected from halo, CN, NO ２ , OR ａ２ , C(O)R ｂ２ , C(O)NR ｃ２ R ｄ２ , C(O)OR ａ２ , N.R. ｃ２ R ｄ２ , N.R. ｃ２ C(O)R ｂ２ , N.R. ｃ２ C(O)OR ａ２ , N.R. ｃ２ S (O) ２ R ｂ２ , S(O) ２ R ｂ２ , and S(O) ２ N.R. ｃ２ R ｄ２ and is substituted with 1, 2, or 3 substituents selected from the group consisting of: Each R ａ１ , R ｂ１ , R ｃ１ , R ｄ１ , R ａ２ , R ｂ２ , R ｃ２ , and R ｄ２ are independently H, C １－６ Alkyl, C １－４ Haloalkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C ６－１０ Aryl, C ３－１０ Cycloalkyl, 5- to 10-membered heteroaryl, 4- to 10-membered heterocycloalkyl, C ６－１０ Aryl-C １－４ Alkylene, C ３－１０ Cycloalkyl-C １－４ alkylene, (5- to 10-membered heteroaryl)-C １－４ alkylene, and (4- to 10-membered heterocycloalkyl)-C １－４ alkylene, １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C ６－１０ Aryl, C ３－１０ Cycloalkyl, 5- to 10-membered heteroaryl, 4- to 10-membered heterocycloalkyl, C ６－１０ Aryl-C １－４ Alkylene, C ３－１０ Cycloalkyl-C １－４ alkylene, (5- to 10-membered heteroaryl)-C １－４ alkylene, and (4- to 10-membered heterocycloalkyl)-C １－４ Each alkylene is optionally and independently selected from R ｇ or is substituted with 1, 2, 3, 4, or 5 substituents selected from or any R ｃ１ and R ｄ１ together with the N atom to which they are attached form a 4- to 10-membered heterocycloalkyl or a 5- to 10-membered heteroaryl, each of which is optionally independently selected from R ｇ or is substituted with one, two or three substituents selected from or any R ｃ２ and R ｄ２ together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally independently ｇ and is substituted with 1, 2, or 3 substituents selected from Each R ｇ are independently OH, NO ２ , C.N., Halo, C. １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C １－４ Haloalkyl, C １－６ Alkoxy, C １－６ Haloalkoxy, Cyano-C １－３ Alkylene, HO-C １－３ Alkylene, C ６－１０ Aryl, C ６－１０ Aryloxy, C ３－１０ Cycloalkyl, 5- to 10-membered heteroaryl, 4- to 10-membered heterocycloalkyl, C ６－１０ Aryl-C １－４ Alkylene, C ３－１０ Cycloalkyl-C １－４ alkylene, (5- to 10-membered heteroaryl)-C １－４ alkylene, (4- to 10-membered heterocycloalkyl)-C １－４ Alkylene, Amino, C １－６ Alkylamino, di(C １－６ Alkyl)amino, thio, C １－６ Alkylthio, C １－６ Alkylsulfinyl, C １－６ Alkyl sulfonyl, carbamyl, C １－６ Alkylcarbamyl, di(C １－６ Alkyl) carbamyl, carboxy, C １－６ Alkylcarbonyl, C ６－１０ Aryl-C １－６ Alkoxycarbonyl, C １－６ Alkoxycarbonyl, C １－６ Alkylcarbonylamino, C １－６ Alkyl sulfonylamino, aminosulfonyl, C １－６ Alkylaminosulfonyl, di(C １－６ alkyl)aminosulfonyl, aminosulfonylamino, C １－６ Alkylaminosulfonylamino, di(C １－６ alkyl)aminosulfonylamino, aminocarbonylamino, C １－６ Alkylaminocarbonylamino, and di(C １－６ a compound selected from the group consisting of 78A-INT, 78A-C-amino, 78A-D-amino, 78A-H-amino, 78A-N ... 【Chemistry 3】

2. Each Cy １ became independent and C ６－１０ aryl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally and independently selected from the group consisting of R Ｃｙ and is substituted with 1, 2, or 3 substituents selected from R Ｃｙ But, Hello, CN, NO ２ , C １－６ Alkyl, C １－６ Haloalkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, OR ａ２ , C(O)R ｂ２ , C(O)OR ａ２ , C(O)NR ｃ２ R ｄ２ , N.R. ｃ２ R ｄ２ , N.R. ｃ２ C(O)R ｂ２ , N.R. ｃ２ C(O)OR ａ２ , N.R. ｃ２ S (O) ２ R ｂ２ , S(O) ２ R ｂ２ , and S(O) ２ N.R. ｃ２ R ｄ２ wherein C is selected from the group consisting of １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Each alkynyl is optionally independently selected from halo, CN, NO ２ , OR ａ２ , C(O)R ｂ２ , C(O)NR ｃ２ R ｄ２ , C(O)OR ａ２ , N.R. ｃ２ R ｄ２ , N.R. ｃ２ C(O)R ｂ２ , N.R. ｃ２ C(O)OR ａ２ , N.R. ｃ２ S (O) ２ R ｂ２ , S(O) ２ R ｂ２ , and S(O) ２ N.R. ｃ２ R ｄ２ or substituted with one, two, or three substituents selected from the group consisting of or any R ｃ１ and R ｄ１ together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally independently ｇ and is substituted with 1, 2, or 3 substituents selected from Each R ｇ are independent, OH, NO ２ , C.N., Halo, C. １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C １－４ Haloalkyl, C １－６ Alkoxy, C １－６ Haloalkoxy, Cyano-C １－３ Alkylene, HO-C １－３ Alkylene, C ６－１０ Aryl, C ６－１０ Aryloxy, C ３－１０ Cycloalkyl, 5- to 10-membered heteroaryl, 4- to 10-membered heterocycloalkyl, C ６－１０ Aryl-C １－４ Alkylene, C ３－１０ Cycloalkyl-C １－４ alkylene, (5- to 10-membered heteroaryl)-C １－４ alkylene, (4- to 10-membered heterocycloalkyl)-C １－４ Alkylene, Amino, C １－６ Alkylamino, di(C １－６ Alkyl)amino, thio, C １－６ Alkylthio, C １－６ Alkylsulfinyl, C １－６ Alkyl sulfonyl, carbamyl, C １－６ Alkylcarbamyl, di(C １－６ Alkyl) carbamyl, carboxy, C １－６ Alkylcarbonyl, C １－６ Alkoxycarbonyl, C １－６ Alkylcarbonylamino, C １－６ Alkyl sulfonylamino, aminosulfonyl, C １－６ Alkylaminosulfonyl, di(C １－６ alkyl)aminosulfonyl, aminosulfonylamino, C １－６ Alkylaminosulfonylamino, di(C １－６ alkyl)aminosulfonylamino, aminocarbonylamino, C １－６ Alkylaminocarbonylamino, and di(C １－６ 2. The compound of claim 1, wherein the compound is selected from the group consisting of: alkylaminocarbonylamino.

3. R １ , R ２ , R ３ , R ４ , and R ６ are each independently H, C １－６ Alkyl, C ２－６ Alkenyl, C ２－６ Alkynyl, C １－４ Haloalkyl, Cy １ , Haro, CN, NO ２ , OR ａ１ , S.R. ａ１ , C(O)R ｂ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , N.R. ｃ１ R ｄ１ , N.R. ｃ１ C(O)R ｂ１ , N.R. ｃ１ S (O) ２ R ｂ１ , S(O) ２ R ｂ１ , and S(O) ２ N.R. ｃ１ R ｄ１ wherein C is selected from the group consisting of １－６ Alkyl, C ２－６ Alkenyl, and C ２－６ Each alkynyl is optionally independently selected from Cy １ , Haro, CN, NO ２ , OR ａ１ , S.R. ａ１ , C(O)R ｂ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , N.R. ｃ１ R ｄ１ , N.R. ｃ１ C(O)R ｂ１ , N.R. ｃ１ S (O) ２ R ｂ１ , S(O) ２ R ｂ１ , and S(O) ２ N.R. ｃ１ R ｄ１ and is substituted with 1, 2, 3, 4, or 5 substituents selected from the group consisting of R ７ H and C １－３ 2. The compound of claim 1, wherein the compound is selected from the group consisting of alkyl.

4. R １ , R ２ , R ３ , R ４ , and R ６ are each independently H, Cy １ , Haro, CN, OR ａ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , and S(O) ２ N.R. ｃ１ R ｄ１ 2. The compound of claim 1 selected from the group consisting of:

5. R １ , R ４ , and R ６ are each H, R ２ But, H, Cy １ , Haro, CN, OR ａ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , and S(O) ２ N.R. ｃ１ R ｄ１ and R ３ But Cy １ , Haro, CN, OR ａ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , and S(O) ２ N.R. ｃ１ R ｄ１ 5. The compound of claim 4 selected from the group consisting of:

6. R １ , R ４ , and R ６ are each H, R ２ H and OR ａ１ and R ３ But Cy １ , OR ａ１ 6. The compound of claim 5, wherein the aryl group is selected from the group consisting of:

7. R １ , R ２ , R ４ , and R ６ are each H, and R ３ But Cy １ , Haro, CN, OR ａ１ , C(O)NR ｃ１ R ｄ１ , C(O)OR ａ１ , and S(O) ２ N.R. ｃ１ R ｄ１ 6. The compound of claim 5 selected from the group consisting of:

8. R ３ But Cy １ , OR ａ１ , C(O)NR ｃ１ R ｄ１ 8. The compound of claim 7, wherein the aryl group is selected from the group consisting of:

9. R ２ H and OR ａ１ and R ３ But, C １－６ Alkoxy and C １－６ The compound of claim 5 selected from the group consisting of haloalkoxy.

10. R ５ But C(O)NR ｃ１ R ｄ１ , S(O) ２ N.R. ｃ１ R ｄ１ , and Cy １ 2. The compound of claim 1 selected from the group consisting of:

11. Cy １ But, C ３－１０ cycloalkyl, 5- to 10-membered heteroaryl, and 4- to 7-membered heterocycloalkyl, each of which is optionally selected from the group consisting of R Ｃｙ 11. The compound of claim 10 , substituted with:

12. R ｃ１ and R ｄ１ are each independently H and C １－６ 11. The compound of claim 10, wherein the compound is selected from the group consisting of alkyl.

13. R ｃ１ and R ｄ１ together with the N atom to which they are attached form a 4- to 7-membered heterocycloalkyl, which is optionally ｇ 11. The compound of claim 10 , substituted with:

14. R ７ H and C １－３ 2. The compound of claim 1, wherein the compound is selected from the group consisting of alkyl.

15. R Ｃｙ But, Haro, CN, C １－６ Alkyl, C １－６ haloalkyl, 5-10 membered heteroaryl, 4-6 membered heterocycloalkyl, OR ａ２ , C(O)OR ａ２ , C(O)NR ｃ２ R ｄ２ , C(O)NR ｃ１ S (O) ２ R ｂ２ , N.R. ｃ２ R ｄ２ , N.R. ｃ２ C(O)R ｂ２ , O.C.(O)R ｂ１ , and S(O) ２ R ｂ２ wherein C is selected from the group consisting of １－６ Alkyl is optionally OR ａ２ Or N.R. ｃ２ R ｄ２ 2. The compound of claim 1 , substituted with:

16. A compound selected from any one of the following compounds 12A, 13A, 14A, 16A, 17A, 53A, 57A, 58A, 61A, 63A, 64A, 70A, 78A, 78A-BR, 79A, 79A-INT, 80A, 81A, 81A-INT, 82A, 85A, 85A-BP, 86A, 93A, and 93A-INT, 【Chemistry 4-1】 【Chemistry 4-2】 or a pharma- ceutically acceptable salt thereof.

17. A compound selected from any one of the following compounds 12A, 13A, 14A, 16A and 17A, 【Chemistry 5】 or a pharma- ceutically acceptable salt thereof.

18. A compound selected from any one of the group consisting of the following compounds 87A, 96A, 97A, 88A, 89A, 90A, 91A, 94A, 95A, 92A, 98A, 99A, 100A, 101A, 102A, 103A, 107A, 108A, 109A, 110A, 111A, 112A, 114A, 115A, 118A, 119A, 120A, 121A, 122A, and 123A, 【Chemistry 6-1】 【Chemistry 6-2】 【Chemistry 6-3】 or a pharma- ceutically acceptable salt thereof.

19. 20. A pharmaceutical composition comprising a therapeutically effective amount of a compound according to any one of claims 1 to 18, or a pharma- ceutically acceptable salt thereof, and a pharma- ceutically acceptable carrier.

20. The pharmaceutical composition of claim 19 for treating or preventing a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction selected from dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, myelodysplastic syndrome, idiopathic pulmonary fibrosis, blood disease, or hepatic fibrosis; an age-related disorder selected from macular degeneration, diabetes mellitus, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing; a pre-leukemia or precancerous condition; HBV infection; neurodevelopmental disorder; and an acquired or genetic disease or condition associated with alterations in RNA.

21. 21. The pharmaceutical composition of claim 20, wherein the neurodevelopmental disorder is pontocerebellar hypoplasia.

22. 20. A method of expanding cells ex vivo or in vitro, said method comprising culturing said cells in the presence of an effective amount of a compound according to any one of claims 1 to 18 or a pharma- ceutically acceptable salt thereof, and wherein the expanded cells are used in cell therapy.

23. 23. The method of claim 22, wherein the cells are selected from the group consisting of stem cells, pluripotent stem cells, hematopoietic stem cells, and embryonic stem cells.

24. 23. The method of claim 22, wherein the cells are collected from a subject having a disease or condition selected from the group consisting of a disorder associated with telomere or telomerase dysfunction selected from dyskeratosis congenita, aplastic anemia, pulmonary fibrosis, myelodysplastic syndrome, idiopathic pulmonary fibrosis, blood disease, or hepatic fibrosis; an age-related disorder selected from macular degeneration, diabetes mellitus, osteoarthritis, rheumatoid arthritis, sarcopenia, cardiovascular disease, hypertension, atherosclerosis, coronary artery disease, ischemia / reperfusion injury, cancer, premature death, or age-related decline in cognitive function, cardiopulmonary function, muscle strength, vision, or hearing; a pre-leukemia or precancerous condition; and a neurodevelopmental disorder.

25. 23. The method of claim 22, wherein the cell is a chimeric antigen receptor (CAR) T cell.

26. 23. The method of claim 22, wherein the cell is a T cell, an engineered T cell, or a natural killer cell (NK).

Images