Method for preparing lipid nanoparticles

Abstract

The present disclosure provides methods for producing lipid nanoparticle (LNP) formulations and the LNP formulations produced. The present disclosure also provides therapeutic and diagnostic applications related to the LNP formulations produced.

Description

[Technical Field]

[0001] Related Applications This application claims priority to and the benefit of U.S. Provisional Application No. 62 / 799,620, filed January 31, 2019, the contents of which are incorporated herein by reference in their entirety.

[0002] The present disclosure provides novel methods of making nucleic acid-lipid nanoparticle (LNP) formulations, the made formulations, and methods comprising the nucleic acid-lipid nanoparticles for delivering one or more therapeutic and / or prophylactic agents, e.g., nucleic acids, to mammalian cells or organs and / or producing polypeptides in mammalian cells or organs. [Background technology]

[0003] Effective targeted delivery of biologically active agents, such as small molecule drugs, proteins, and nucleic acids, represents a continuing medical challenge. In particular, delivery of nucleic acids into cells is made difficult by the relative instability and poor cell permeability of such species. Thus, there is a need to develop methods and compositions for facilitating the delivery of therapeutic and prophylactic agents, such as nucleic acids, into cells.

[0004] Lipid-containing nanoparticles or lipid nanoparticles, liposomes, and lipoplexes have proven effective as delivery vehicles for bioactive agents, such as small molecule drugs, proteins, and nucleic acids, into cells and / or intracellular compartments. Although various such lipid-containing nanoparticles have been demonstrated, improvements in safety, efficacy, and specificity remain lacking.

[0005] Sequence Listing Statement The sequence listing associated with this application is provided in text format in lieu of a paper reproduction and is hereby incorporated by reference. The text file containing the sequence listing is named MRNA_062_001WO_ST25.txt. The text file is 614 bytes, was created on January 30, 2020, and has been submitted electronically. Summary of the Invention

[0006] In some aspects, the present disclosure provides methods of making a lipid nanoparticle (LNP) formulation, the method comprising: i) mixing a lipid solution comprising an ionizable lipid with an aqueous buffer solution comprising a first buffering agent, thereby forming a lipid nanoparticle solution comprising lipid nanoparticles; and ii) adding a nucleic acid solution comprising a nucleic acid to the lipid nanoparticle solution, thereby forming a lipid nanoparticle (LNP) formulation comprising lipid nanoparticles associated with the nucleic acid.

[0007] In some aspects, the disclosure provides methods for administering a lipid nanoparticle (LNP) formulation to a patient, the method comprising: i) providing an active agent solution having a pH in the range of about 4.5 to about 8.0, the active agent solution comprising a therapeutic and / or prophylactic agent; and a lipid nanoparticle solution having a pH in the range of about 4.5 to about 6.5, the lipid nanoparticle solution comprising lipid nanoparticles comprising ionizable lipids; ii) mixing the lipid nanoparticle solution with the active agent solution such that the lipid nanoparticle formulation has a pH in the range of about 4.5 to less than about 8.0, thereby forming a lipid nanoparticle formulation comprising lipid nanoparticles associated with the therapeutic and / or prophylactic agent; and iii) administering the lipid nanoparticle formulation to a patient after mixing.

[0008] According to another aspect, the present disclosure relates to a lipid nanoparticle (LNP) formulation prepared by the method of any one of the embodiments described herein. According to another aspect, the present disclosure relates to a method for treating or preventing a disease or disorder, the method comprising administering to a subject in need thereof a lipid nanoparticle (LNP) formulation according to any one of the methods of the embodiments described herein.

[0009] According to another aspect, the present disclosure relates to a method for treating or preventing a disease or disorder, the method comprising administering to a subject in need thereof a lipid nanoparticle (LNP) formulation prepared by the method of any one of the embodiments described herein.

[0010] According to another aspect, the present disclosure relates to an active agent solution according to any of the embodiments described herein, a lipid nanoparticle solution according to any of the embodiments described herein, and kits including the active agent solution, the lipid nanoparticle solution, and / or a mixing and administration device according to any of the embodiments described herein.

[0011] In some aspects, the present disclosure provides lipid nanoparticles prepared by the methods disclosed herein. In some aspects, the present disclosure provides a lipid nanoparticle solution prepared by the methods disclosed herein.

[0012] In some aspects, the present disclosure provides lipid nanoparticle (LNP) formulations prepared by the methods disclosed herein. In some aspects, the present disclosure provides methods for treating or preventing a disease or disorder, the methods comprising administering to a subject in need thereof a lipid nanoparticle described herein.

[0013] In some aspects, the present disclosure provides methods for treating or preventing a disease or disorder, the methods comprising administering to a subject in need thereof a lipid nanoparticle solution nanoparticle described herein.

[0014] In some aspects, the present disclosure provides methods for treating or preventing a disease or disorder, the methods comprising administering to a subject in need thereof a lipid nanoparticle formulation nanoparticle described herein.

[0015] In some aspects, the present disclosure provides a lipid nanoparticle as described herein for treating or preventing a disease or disorder in a subject. In some aspects, the present disclosure provides a lipid nanoparticle solution described herein for treating or preventing a disease or disorder in a subject.

[0016] In some aspects, the present disclosure provides a lipid nanoparticle formulation described herein for treating or preventing a disease or disorder in a subject. In some aspects, the present disclosure provides for the use of a lipid nanoparticle described herein in the manufacture of a medicament for treating or preventing a disease or disorder in a subject.

[0017] In some aspects, the present disclosure provides for the use of a lipid nanoparticle solution described herein in the manufacture of a medicament for treating or preventing a disease or disorder in a subject. In some aspects, the present disclosure provides for the use of a lipid nanoparticle formulation described herein in the manufacture of a medicament for treating or preventing a disease or disorder in a subject.

[0018] Unless otherwise explained, technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. Furthermore, the materials, methods, and examples are illustrative only and are not intended to be limiting.

[0019] Other features and advantages of the present disclosure will be apparent from the following detailed description, and from the claims. [Brief explanation of the drawings]

[0020] [Figure 1] 10 is a graph showing that similar or increased mRNA encapsulation is observed when mRNA is introduced over a longer time scale (i.e., increased residence time) after LNP production. Encapsulation was assessed via a RiboGreen fluorescence assay. [Figure 2]Graph showing that similar or increased mRNA encapsulation is observed when mRNA is introduced at longer time scales (i.e., increased residence times) after LNP fabrication compared to the control (dotted line). Encapsulation was assessed via ion exchange (AEX) assay. [Figure 3] 10 is a cryo-EM image showing that comparable particle morphology is observed in post-loading ("PHL") process mode compared to standard process ("Standard") where mRNA is included during initial particle formation. [Figure 4] Small angle X-ray scattering (SAXS) analysis showing an increase in structural features (q = approximately 1.3 nm-1, calculated lattice spacing 5-6 nm) in the post-loaded process batch compared to the standard lot process. [Figure 5] 1 is a plot showing the in vivo performance of the PHL process versus the standard process, demonstrating an increased initial dose response (3 weeks after prime) of PHL in the context of a prophylactic vaccine, and similar total IgG observed 2 weeks after boost. Entries A-D reflect alternative versions of the standard process as a comparison. [Figure 6] 1 is a graph showing the effect of initial diameter of LNP dispersion on mRNA encapsulation, and demonstrating that LNP batches with reduced diameter resulted in increased mRNA encapsulation. [Figure 7] Model fitting showed through dynamic light scattering (DLS) characterization that ethanol content and temperature are crucial parameters affecting LNP polydispersity index (PDI), allowing for the calculation of an advantageous range of process conditions (e.g., 30% ethanol, 40°C) suitable for low PDI, resulting in small, uniform particles and favorable composition. [Figure 8]Model fitting showed through DLS characterization that ethanol content and temperature are crucial parameters affecting LNP diameter, allowing for the calculation of an advantageous range of process conditions suitable for controlling particle size in the preferred range (less than 100 nm) for mRNA encapsulation by the process described herein, enabling small, uniform particles and a preferred composition. [Figure 9] The impact of the empty LNP fabrication process on structural features was demonstrated by small-angle X-ray scattering (SAXS) analysis, showing that all process conditions resulted in particles with a prominent feature at q = 1.4 nm (calculated lattice spacing: approximately 4 nm). Process A, without aging, produced an additional feature at q = 0.45 (calculated lattice spacing: approximately 14 nm). This feature was associated with a population of small liposomal or micelle structures in the sample via cryo-TEM analysis. Processes B and C, which incorporated aging time, showed improved polydispersity (via DLS analysis) and structural uniformity (via cryo-TEM analysis) compared to Process A. [Figure 10] 1 is a graph showing that mRNA loaded via the processes described herein produced particles exhibiting a high degree of structure, with a prominent feature at q=1.3 nm (calculated lattice spacing: approximately 5 nm). Processes B and C, which utilize optimal process conditions favoring aging time and low PDI, showed reduced polydispersity and improved structural uniformity compared to Process A. [Figure 11] 10 is a cryo-EM image showing the improved particle uniformity observed with Process B (increased maturity) compared to Process A (standard) for batches produced with the procedures described herein. [Figure 12] FIG. 1 is an exemplary process flow diagram showing a continuous nanoprecipitation process for LNP formation. [Figure 13] FIG. 1 is a graph showing that sucrose exhibits a cryoprotective effect on LNP dispersions and can preserve particle diameter after freeze / thaw stress, and an advantageous sucrose concentration was determined to be less than 15% by weight. [Figure 14]1 is a graph showing that the inclusion of the cryoprotectant excipient sucrose enabled complete mRNA encapsulation via the process described herein in lipid nanoparticles that undergo freeze / thaw stress prior to addition of mRNA (Ribogreen assay). [Figure 15A] 1 is a graph showing the normal primary population of LNPs characterized by nanoparticle tracking analysis (NTA) in the liquid state (approximately 50 nm). [Figure 15B] 1 is a graph showing the preservation of primary nanoparticle populations after lyophilization of the formulation (acetate-sucrose) and reconstitution in distilled deionized water. [Figure 16] 1 is a graph showing overlapping particle distributions of LNP formulations of liquid and lyophilized / reconstituted products. [Figure 17] 1 is a graph showing that increased in vitro expression was observed in lyophilized formulations at pH 5.0 compared to pH 5.75. [Figure 18] 1 is a graph showing that advantageous pH was determined by varying the pH values ​​of the mRNA and LNP solutions prior to combination in an in situ mixing process. Particle size control was advantageously achieved at a pH below 6.0. [Figure 19] 1 is a graph showing that a favorable pH was determined by varying the pH values ​​of the mRNA and LNP solutions prior to combination in the process described herein, and increased encapsulation was achieved below pH 6.0 (Ribogreen assay). [Figure 20] 1 is a graph showing that a favorable pH was determined by varying the pH values ​​of the mRNA and LNP solutions prior to combination in the process described herein, and increased encapsulation was achieved below pH 6.0 (AEX assay). [Figure 21] FIG. 10 is a graph showing that in the process described herein, ionic strength sensitivity was assessed by varying the molar concentrations of NaCl in the LNP and mRNA solutions together, and that the favorable concentration for mRNA encapsulation was less than 200 mM. [Figure 22]FIG. 10 is a graph showing that low batch-to-batch variability in mRNA encapsulation was observed with the process described herein, with mRNA-loaded LNPs demonstrating consistent mRNA encapsulation after 24 hours of aging. [Figure 23] FIG. 12 is a graph showing the effect of injection flow rate on particle size via DLS measurements. A solution of mRNA was injected directly into a vial containing LNP buffer, and the resulting particle diameter was sensitive to the injection rate. [Figure 24] FIG. 10 is a graph showing the effect of injection flow rate on mRNA encapsulation (Ribogreen assay), where a solution of mRNA was injected directly into a vial containing LNP buffer. [Figure 25] 10 is a graph showing that mRNA-lipid nanoparticle formulations loaded via the process described herein contain particles exhibiting a high degree of structure with a prominent feature at q=1.3 nm (calculated lattice spacing: approximately 5 nm), and similar structural features were observed at various flow rates (samples 9-14). [Figure 26] 1 is a graph showing that adding increasing levels of PEG-lipid conjugates to an LNP solution reduced particle size after mixing with mRNA. [Figure 27] 1 is a graph showing that adding increasing levels of PEG-lipid conjugates to the LNP solution did not affect mRNA encapsulation. [Figure 28] FIG. 10 is a graph showing that mRNA-lipid nanoparticle formulations loaded via the process described herein contain particles exhibiting a high degree of structure with a prominent feature at q=1.3 nm (calculated lattice spacing: approximately 5 nm), and that a similar degree of structural features was observed at the mole % PEG-lipid included in the mixing step. [Figure 29A] 1 is a graph showing that the addition of increasing levels of PEG-lipid conjugates into the LNP solution reduced the sensitivity to injection flow rate in the mixing process described herein. [Figure 29B] 1 is a graph showing that the addition of increasing levels of PEG-lipid conjugates into the LNP solution reduced the sensitivity to injection flow rate in the mixing process described herein. [Figure 30] 1 is a graph showing that adding increasing levels of PEG-lipid conjugates to the LNP solution increased encapsulation (Ribostar assay). [Figure 31] 1 is a graph showing that neutralization of the mixed product results in increased mRNA encapsulation (AEX assay) and that neutralization can be achieved to a target pH value via the addition of concentrated sodium phosphate solution. [Figure 32] 1 is a graph showing that the Ribogreen assay was unable to detect the sensitivity of the mixed product to pH neutralization, and neutralization was achieved to the target pH value via the addition of concentrated sodium phosphate solution. [Figure 33] 1 is a graph showing that neutralization of the mixed product resulted in an increased LNP diameter (approximately 10 nm), and neutralization was achieved to a target pH value via the addition of concentrated sodium phosphate solution. [Figure 34] 10 is a graph showing that mRNA-lipid nanoparticle formulations loaded via the process described herein contain particles exhibiting a high degree of structure with a prominent feature at q=1.3 nm (calculated lattice spacing: approximately 5 nm), with a slight decrease of 1.3 nm observed upon neutralization, and further neutralization of the mixed product resulted in a decrease in the structural feature at 0.3 nm (lattice spacing: approximately 21 nm). [Figure 35] 1 is a graph showing the increase in efficacy of the mixed formulation process described herein ("PHL process") over a control ("benchmark process") and showing the increase in antigen-specific T cell responses with the mixed process described herein compared to the standard process mode. DETAILED DESCRIPTION OF THE INVENTION

[0021] The present disclosure is based, in part, on the discovery that methods of making the lipid nanoparticles (LNPs) or lipid nanoparticle (LNP) formulations disclosed herein can influence and / or determine the distribution of certain components within the lipid nanoparticles, and that this distribution can influence and / or determine the physical (e.g., stability) and / or biological (e.g., efficacy, intracellular delivery, immunogenicity) properties of the lipid nanoparticles.

[0022] In some embodiments, the disclosed methods mitigate undesirable property changes from the produced lipid nanoparticles (LNPs) or lipid nanoparticle (LNP) formulations. In some embodiments, the disclosed methods mitigate undesirable property changes from the produced lipid nanoparticles (LNPs) or lipid nanoparticle (LNP) formulations compared to LNPs or LNP formulations produced by a comparable method (e.g., a method that does not have one or more steps disclosed herein).

[0023] In some embodiments, the undesirable property change is caused by stress to the lipid nanoparticle formulation or lipid nanoparticles. In some embodiments, the stress is induced during production, purification, packaging, storage, transportation, and / or use of the lipid nanoparticle formulation or lipid nanoparticles. In some embodiments, the stress is heat, shear, excessive agitation, membrane concentration polarization (change in charge state), dehydration, freezing stress, desiccation stress, freeze / thaw stress, and / or spray stress. In some embodiments, the stress is induced during storage of the lipid nanoparticle formulation or lipid nanoparticles.

[0024] In some embodiments, the undesirable property change is a decrease in the physical stability of the LNP formulation, hi some embodiments, the undesirable property change is an increase in the amount of impurities and / or subvisible particles, or an increase in the average size of the LNPs in the LNP formulation.

[0025] In some embodiments, the methods of the present disclosure mitigate a decrease in physical stability (e.g., an increase in the average size of the LNPs) of the produced LNP formulations compared to LNP formulations produced by equivalent methods disclosed herein.

[0026] In some embodiments, LNP formulations made by the methods of the present disclosure have an average LNP diameter that is about 99% or less, about 98% or less, about 97% or less, about 96% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less compared to the average LNP diameter of LNP formulations made by comparable methods disclosed herein.

[0027] In some embodiments, the undesirable property change is a decrease in the chemical stability of the LNP formulation. In some embodiments, the undesirable property change is a decrease in the integrity of nucleic acids (e.g., RNA (e.g., mRNA)) in the LNP formulation.

[0028] In some embodiments, the undesirable property change is a decrease in the biological properties of the LNP formulation, hi some embodiments, the undesirable property change is a decrease in the efficacy, intracellular delivery, and / or immunogenicity of the LNP formulation.

[0029] In some embodiments, LNP formulations produced by the methods of the present disclosure have greater efficacy, intracellular delivery, and / or immunogenicity than the efficacy, intracellular delivery, and / or immunogenicity of LNP formulations produced by comparable methods disclosed herein.

[0030] In some embodiments, an LNP formulation produced by a method of the present disclosure has efficacy, intracellular delivery, and / or immunogenicity that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, or greater than that of an LNP formulation produced by a comparable method. The antibody has about 4 times or more, about 5 times or more, about 10 times or more, about 20 times or more, about 30 times or more, about 40 times or more, about 50 times or more, about 100 times or more, about 200 times or more, about 300 times or more, about 400 times or more, about 500 times or more, about 1000 times or more, about 2000 times or more, about 3000 times or more, about 4000 times or more, about 5000 times or more, or about 10000 times or more greater efficacy, intracellular delivery, and / or immunogenicity.

[0031] In some embodiments, LNP formulations produced by the methods of the present disclosure exhibit higher nucleic acid expression (e.g., mRNA expression) than the nucleic acid expression (e.g., mRNA expression) of LNP formulations produced by comparable methods.

[0032] In some embodiments, an LNP formulation produced by a method of the present disclosure exhibits nucleic acid expression (e.g., mRNA expression) that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, or greater than that of an LNP formulation produced by a comparable method. The nucleic acid expression (e.g., mRNA expression) is about 4-fold or more, about 5-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 100-fold or more, about 200-fold or more, about 300-fold or more, about 400-fold or more, about 500-fold or more, about 1000-fold or more, about 2000-fold or more, about 3000-fold or more, about 4000-fold or more, about 5000-fold or more, or about 10000-fold or more higher.

[0033] Traditionally, messenger RNA-loaded lipid nanoparticles (mRNA-LNPs) have been prepared via high-energy mixing of an aqueous mRNA solution with a lipid solution in ethanol. The aqueous solution is a poor solvent for the lipids used in the process, and is most often a mixture of cationic lipids, phospholipids, structural lipids, and PEG-lipids. Thus, the lipid mixing results in the self-assembly of the lipids into nanoparticles, e.g., with diameters of less than 100 nm.

[0034] Furthermore, recent efforts toward "bedside" and / or "point-of-care" formulations have fostered advances, whereby mRNA can be encapsulated in preformed vesicles prepared at an earlier time point. This mode of production offers advantages in clinical supply settings, as empty LNP vesicles can be produced and stored separately prior to recombination with mRNA in the clinical compound setting. Specifically, bedside formulations can promote increased stability, as mRNA and empty raw materials can be stored in individually optimized conditions. LNP preparation is cargo-independent, enabling a platform approach for multiple mRNA or active agent constructs, thereby reducing process complexity and commercial cost. The empty LNP+mRNA modality may also be referred to as "post-loading" (PHL), "post-addition," or "post-treatment."

[0035] This disclosure is based, in part, on efforts to explore the fundamental principles of postloading and to investigate the effects and conditions of mRNA addition on multiple time scales following empty LNP production. The time of mRNA addition after lipid precipitation was varied over more than seven orders of magnitude (e.g., from 1 ms to 10,000,000 ms) without adversely affecting the formulation's physicochemical properties (e.g., particle size, encapsulation, morphology, and / or structural integrity). Given that mRNA is traditionally included as an essential component in the inlet water stream of lipid precipitation reactions, the similarity in physicochemical properties was surprising and counterintuitive. Furthermore, oligonucleotides are often described as being involved in the initial particle assembly step. Results from demonstration experiments suggest that mRNA encapsulation can occur on significantly longer time scales than lipid precipitation / particle formation without adversely affecting the physicochemical properties of the LNP. These experiments demonstrated that lipid particle formation and subsequent mRNA encapsulation can be separated into two reaction steps. The postloading concept described herein may enable separate control and / or optimization of each step. Furthermore, postloading may allow for mRNA addition on a timescale that makes point-of-care formulation possible (e.g., months or years after empty LNP creation).

[0036] Historically, no process has been developed for making preformed empty lipid nanoparticles (LNPs) at a scale suitable for clinical supply. The present disclosure is based, in part, on efforts to identify a number of process parameters that favor scalable production, including, but not limited to, lipid concentration, temperature, buffer composition (e.g., ionic strength, pH, counterions), and ethanol content to consider during particle size control.

[0037] The present disclosure is based, in part, on the discovery that methods of making the lipid nanoparticles (LNPs) or lipid nanoparticle (LNP) formulations disclosed herein can influence and / or determine the distribution of certain components within the lipid nanoparticles, and that this distribution can influence and / or determine the physical (e.g., stability) and / or biological (e.g., efficacy, intracellular delivery, immunogenicity) properties of the lipid nanoparticles.

[0038] In some embodiments, the present disclosure provides compositions comprising lipid nanoparticles having an advantageous distribution of components. In some embodiments, LNP formulations produced by the methods of the present disclosure exhibit higher nucleic acid expression (e.g., mRNA expression) than the nucleic acid expression (e.g., mRNA expression) of LNP formulations produced by comparable methods.

[0039] In some embodiments, LNP formulations produced by the methods of the present disclosure exhibit desirable structural characteristics by small-angle X-ray scattering analysis of in vitro / in vivo activity compared to LNP formulations produced by comparable methods.

[0040] In some embodiments, LNP formulations produced by the methods of the present disclosure exhibit desirable structural characteristics by small-angle X-ray scattering analysis of in vitro / in vivo activity compared to LNP formulations produced by comparable methods.

[0041] In some embodiments, LNP formulations produced by the methods of the present disclosure exhibit more homogeneous structural characteristics by Cryo-TEM analysis compared to LNP formulations produced by comparable methods.

[0042] In some embodiments, an LNP formulation produced by a method of the present disclosure exhibits nucleic acid expression (e.g., mRNA expression) that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, or about 5-fold or more, or about 6-fold or more, or about 7-fold or more, or about 8-fold or more, or about 9-fold or more, or about 1-fold or more, or about 2-fold or more, or about 3-fold or more, of an LNP formulation produced by a comparable method. or about 4-fold or more, about 5-fold or more, about 10-fold or more, about 20-fold or more, about 30-fold or more, about 40-fold or more, about 50-fold or more, about 100-fold or more, about 200-fold or more, about 300-fold or more, about 400-fold or more, about 500-fold or more, about 1000-fold or more, about 2000-fold or more, about 3000-fold or more, about 4000-fold or more, about 5000-fold or more, or about 10000-fold or more higher nucleic acid expression (e.g., mRNA expression).

[0043] Methods for preparing lipid nanoparticle (LNP) compositions and prepared LNP compositions In contrast to other fabrication techniques (e.g., thin film rehydration / extrusion), ethanol droplet precipitation has become the industry standard for generating stable nucleic acid-lipid nanoparticles (SNALP). Precipitation reactions are favored due to their continuous nature, scalability, and ease of application. These processes typically involve the use of high-energy mixers (e.g., T-shaped, confined impinging jet, vortex mixers) to controllably introduce lipids (in ethanol) into a suitable antisolvent (i.e., water), promoting liquid supersaturation and spontaneous precipitation into lipid particles.

[0044] The present disclosure provides methods for making lipid nanoparticle compositions, the methods comprising: i) mixing a lipid solution comprising an ionizable lipid with an aqueous buffer solution comprising a first buffering agent, thereby forming empty lipid nanoparticles; and ii) adding a nucleic acid solution comprising a nucleic acid to the lipid nanoparticle solution, thereby forming a lipid nanoparticle (LNP) formulation comprising lipid nanoparticles encapsulating nucleic acids.

[0045] lipid solution In some embodiments, the methods of the present disclosure provide a lipid solution. In some embodiments, the lipid solution may include an ionizable lipid. In some embodiments, the lipid solution may include an ionizable lipid at a concentration greater than about 0.01 mg / mL, 0.05 mg / mL, 0.06 mg / mL, 0.07 mg / mL, 0.08 mg / mL, 0.09 mg / mL, 0.1 mg / mL, 0.15 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, or 1.0 mg / mL. In some embodiments, the lipid solution comprises about 0.01-1.0 mg / mL, 0.01-0.9 mg / mL, 0.01-0.8 mg / mL, 0.01-0.7 mg / mL, 0.01-0.6 mg / mL, 0.01-0.5 mg / mL, 0.01-0.4 mg / mL, 0.01-0.3 mg / mL, 0.01-0.2 mg / mL, 0.01-0.1 mg / mL, 0.05-1.0 mg / mL, 0.05-0.9 mg / mL, 0.05 ...9 mg / mL, 0.05-0.8 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0.9 mg / mL, 0.01-0. The solution may contain ionizable lipids at a concentration ranging from 0.8 mg / mL, 0.05-0.7 mg / mL, 0.05-0.6 mg / mL, 0.05-0.5 mg / mL, 0.05-0.4 mg / mL, 0.05-0.3 mg / mL, 0.05-0.2 mg / mL, 0.05-0.1 mg / mL, 0.1-1.0 mg / mL, 0.2-0.9 mg / mL, 0.3-0.8 mg / mL, 0.4-0.7 mg / mL, or 0.5-0.6 mg / mL. In some embodiments, the lipid solution may contain ionizable lipids at a concentration of up to about 5.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.09 mg / mL, 0.08 mg / mL, 0.07 mg / mL, 0.06 mg / mL, or 0.05 mg / mL.

[0046] In some embodiments, the lipid solution may include an ionizable lipid. In some embodiments, the lipid solution may include an ionizable lipid at a concentration greater than about 0.1 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, 1.0 mg / mL, 1.5 mg / mL, 2.0 mg / mL, 3.0 mg / mL, 4.0 mg / mL, 5.0 mg / mL, 6.0 mg / mL, 7.0 mg / mL, 8.0 mg / mL, 9.0 mg / mL, 10 mg / mL, 11 mg / mL, 12 mg / mL, 13 mg / mL, 14 mg / mL, 15 mg / mL, 20 mg / mL, 25 mg / mL, or 30 mg / mL. In some embodiments, the lipid solution comprises about 0.1 to 20.0 mg / mL, 0.1 to 19 mg / mL, 0.1 to 18 mg / mL, 0.1 to 17 mg / mL, 0.1 to 16 mg / mL, 0.1 to 15 mg / mL, 0.1 to 14 mg / mL, 0.1 to 13 mg / mL, 0.1 to 12 mg / mL, 0.1 to 11 mg / mL, 0.5 to 10.0 mg / mL, 0.5 to 9 mg / mL L, 0.5-8 mg / mL, 0.5-7 mg / mL, 0.5-6 mg / mL, 0.5-5.0 mg / mL, 0.5-4 mg / mL, 0.5-3 mg / mL, 0.5-2 mg / mL, 0.5-1 mg / mL, 1-20 mg / mL, 1-15 mg / mL, 1-12 mg / mL, 1-10 mg / mL, or 1-8 mg / mL. In some embodiments, the lipid solution may contain ionizable lipids at a concentration of up to about 30 mg / mL, 25 mg / mL, 20 mg / mL, 18 mg / mL, 16 mg / mL, 15 mg / mL, 14 mg / mL, 12 mg / mL, 10 mg / mL, 8 mg / mL, 6 mg / mL, 5.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.09 mg / mL, 0.08 mg / mL, 0.07 mg / mL, 0.06 mg / mL, or 0.05 mg / mL.

[0047] In some embodiments, the lipid solution comprises an ionizable lipid in an aqueous buffer and / or organic solution. In some embodiments, the lipid nanoparticle solution may further comprise a buffering agent and / or salt. Examples of suitable buffering agents include, but are not limited to, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, HEPES, and the like. In some embodiments, the lipid solution comprises a buffering agent at a concentration ranging from about 0.1 to 100 mM, about 0.5 to 90 mM, about 1.0 to 80 mM, about 2 to 70 mM, about 3 to 60 mM, about 4 to 50 mM, about 5 to 40 mM, about 6 to 30 mM, about 7 to 20 mM, about 8 to 15 mM, or about 9 to 12 mM. In some embodiments, the lipid solution comprises a buffer at a concentration of about or greater than 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM. Examples of suitable salts include, but are not limited to, potassium chloride, magnesium chloride, sodium chloride, and the like. In some embodiments, the lipid solution contains salt at a concentration ranging from about 1 to 500 mM, about 5 to 400 mM, about 10 to 350 mM, about 15 to 300 mM, about 20 to 250 mM, about 30 to 200 mM, about 40 to 190 mM, about 50 to 180 mM, about 50 to 170 mM, about 50 to 160 mM, about 50 to 150 mM, or about 50 to 100 mM. In some embodiments, the lipid nanoparticle solution contains salt at a concentration of about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or greater.

[0048] In some embodiments, the lipid solution may have a pH ranging from about 4.5 to about 7.0, about 4.6 to about 7.0, about 4.8 to about 7.0, about 5.0 to about 7.0, about 5.5 to about 7.0, about 6.0 to about 7.0, about 6.0 to about 6.9, about 6.0 to about 6.8, about 6.0 to about 6.7, about 6.0 to about 6.6, or about 6.0 to about 6.5. In some embodiments, suitable lipid solutions may have a pH of 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 or less.

[0049] aqueous buffer solution In some embodiments, the aqueous buffer solution comprises an aqueous buffering agent. In some embodiments, a suitable solution may further comprise one or more buffering agents and / or salts. Examples of suitable buffering agents include, but are not limited to, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, HEPES, and the like. In some embodiments, the aqueous buffer solution comprises a buffering agent at a concentration ranging from about 0.1 to 100 mM, about 0.5 to 90 mM, about 1.0 to 80 mM, about 2 to 70 mM, about 3 to 60 mM, about 4 to 50 mM, about 5 to 40 mM, about 6 to 30 mM, about 7 to 20 mM, about 8 to 15 mM, or about 9 to 12 mM. In some embodiments, the aqueous buffer solution comprises a buffering agent at a concentration of about or greater than 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM. Examples of suitable salts include, but are not limited to, potassium chloride, magnesium chloride, sodium chloride, and the like. In some embodiments, the aqueous buffer solution contains salt at a concentration ranging from about 1 to 500 mM, about 5 to 400 mM, about 10 to 350 mM, about 15 to 300 mM, about 20 to 250 mM, about 30 to 200 mM, about 40 to 190 mM, about 50 to 180 mM, about 50 to 170 mM, about 50 to 160 mM, about 50 to 150 mM, or about 50 to 100 mM. In some embodiments, the nucleic acid solution contains salt at a concentration of about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or greater.

[0050] In some embodiments, the aqueous buffer solution may have a pH ranging from about 4.5 to about 7.0, about 4.6 to about 7.0, about 4.8 to about 7.0, about 5.0 to about 7.0, about 5.5 to about 7.0, about 6.0 to about 7.0, about 6.0 to about 6.9, about 6.0 to about 6.8, about 6.0 to about 6.7, about 6.0 to about 6.6, or about 6.0 to about 6.5. In some embodiments, suitable aqueous buffer solutions may have a pH of 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 or less.

[0051] Nucleic acid or activator solution In some embodiments, the methods of the present disclosure provide an active agent solution comprising a therapeutic and / or prophylactic agent. The therapeutic and / or prophylactic agent may be provided in a solution that is mixed with or added to the lipid nanoparticles or lipid nanoparticle solution such that the therapeutic and / or prophylactic agent may be encapsulated in the lipid nanoparticles.

[0052] In some embodiments, the therapeutic and / or prophylactic agent is a vaccine or a compound capable of eliciting an immune response. In some embodiments, the therapeutic and / or prophylactic agent is a nucleic acid.

[0053] In some embodiments, the methods of the present disclosure provide a nucleic acid solution comprising nucleic acid. The nucleic acid may be provided in a solution that is mixed with or added to lipid nanoparticles or a lipid nanoparticle solution such that the nucleic acid can be encapsulated in the lipid nanoparticles.

[0054] In some embodiments, the nucleic acid solution may contain encapsulated nucleic acids at various concentrations. In some embodiments, the nucleic acid solution may contain nucleic acids at concentrations greater than about 0.01 mg / mL, 0.05 mg / mL, 0.06 mg / mL, 0.07 mg / mL, 0.08 mg / mL, 0.09 mg / mL, 0.1 mg / mL, 0.15 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, or 1.0 mg / mL. In some embodiments, the nucleic acid solution comprises about 0.01-1.0 mg / mL, 0.01-0.9 mg / mL, 0.01-0.8 mg / mL, 0.01-0.7 mg / mL, 0.01-0.6 mg / mL, 0.01-0.5 mg / mL, 0.01-0.4 mg / mL, 0.01-0.3 mg / mL, 0.01-0.2 mg / mL, 0.01-0.1 mg / mL, 0.05-1.0 mg / mL, 0.05-0.9 mg / mL, 0.0 The nucleic acid may be present at a concentration in the range of 5-0.8 mg / mL, 0.05-0.7 mg / mL, 0.05-0.6 mg / mL, 0.05-0.5 mg / mL, 0.05-0.4 mg / mL, 0.05-0.3 mg / mL, 0.05-0.2 mg / mL, 0.05-0.1 mg / mL, 0.1-1.0 mg / mL, 0.2-0.9 mg / mL, 0.3-0.8 mg / mL, 0.4-0.7 mg / mL, or 0.5-0.6 mg / mL. In some embodiments, the nucleic acid solution may contain nucleic acid at a concentration of up to about 5.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.09 mg / mL, 0.08 mg / mL, 0.07 mg / mL, 0.06 mg / mL, or 0.05 mg / mL.

[0055] In some embodiments, the nucleic acid solution comprises nucleic acids in an aqueous buffer. In some embodiments, a suitable nucleic acid solution may further comprise a buffering agent and / or salt. Examples of suitable buffering agents include, but are not limited to, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, HEPES, etc. In some embodiments, the nucleic acid solution comprises a buffering agent at a concentration ranging from about 0.1 to 100 mM, about 0.5 to 90 mM, about 1.0 to 80 mM, about 2 to 70 mM, about 3 to 60 mM, about 4 to 50 mM, about 5 to 40 mM, about 6 to 30 mM, about 7 to 20 mM, about 8 to 15 mM, or about 9 to 12 mM. In some embodiments, the nucleic acid solution comprises a buffer at a concentration of about or greater than 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM. Examples of suitable salts include, but are not limited to, potassium chloride, magnesium chloride, sodium chloride, and the like. In some embodiments, the nucleic acid solution contains a salt at a concentration ranging from about 1 to 500 mM, about 5 to 400 mM, about 10 to 350 mM, about 15 to 300 mM, about 20 to 250 mM, about 30 to 200 mM, about 40 to 190 mM, about 50 to 180 mM, about 50 to 170 mM, about 50 to 160 mM, about 50 to 150 mM, or about 50 to 100 mM. In some embodiments, the nucleic acid solution contains a salt at a concentration of about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or greater.

[0056] In some embodiments, the nucleic acid solution may have a pH ranging from about 4.5 to about 7.0, about 4.6 to about 7.0, about 4.8 to about 7.0, about 5.0 to about 7.0, about 5.5 to about 7.0, about 6.0 to about 7.0, about 6.0 to about 6.9, about 6.0 to about 6.8, about 6.0 to about 6.7, about 6.0 to about 6.6, or about 6.0 to about 6.5. In some embodiments, suitable nucleic acid solutions may have a pH of 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 or lower.

[0057] Lipid nanoparticle solution In some embodiments, the methods of the present disclosure provide a lipid nanoparticle solution comprising a therapeutic and / or prophylactic agent. The therapeutic and / or prophylactic agent may be provided in a solution that is mixed with or added to the lipid nanoparticles or lipid nanoparticle solution such that the therapeutic and / or prophylactic agent may be encapsulated in the lipid nanoparticles.

[0058] In some embodiments, the methods of the present disclosure provide a lipid nanoparticle solution comprising empty lipid nanoparticles, which may be provided in a solution that is mixed with or added to the lipid nanoparticles or lipid nanoparticle solution such that nucleic acids can be encapsulated in the lipid nanoparticles.

[0059] In some embodiments, the lipid nanoparticle solution may contain empty lipid nanoparticles. In some embodiments, the lipid nanoparticle solution may contain lipid nanoparticles at a concentration greater than about 0.01 mg / mL, 0.05 mg / mL, 0.06 mg / mL, 0.07 mg / mL, 0.08 mg / mL, 0.09 mg / mL, 0.1 mg / mL, 0.15 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, 0.5 mg / mL, 0.6 mg / mL, 0.7 mg / mL, 0.8 mg / mL, 0.9 mg / mL, or 1.0 mg / mL. In some embodiments, the lipid nanoparticle solution comprises about 0.01-1.0 mg / mL, 0.01-0.9 mg / mL, 0.01-0.8 mg / mL, 0.01-0.7 mg / mL, 0.01-0.6 mg / mL, 0.01-0.5 mg / mL, 0.01-0.4 mg / mL, 0.01-0.3 mg / mL, 0.01-0.2 mg / mL, 0.01-0.1 mg / mL, 0.05-1.0 mg / mL, 0.05-0.9 mg / mL, 0.0 The lipid nanoparticles may be present at a concentration ranging from 5-0.8 mg / mL, 0.05-0.7 mg / mL, 0.05-0.6 mg / mL, 0.05-0.5 mg / mL, 0.05-0.4 mg / mL, 0.05-0.3 mg / mL, 0.05-0.2 mg / mL, 0.05-0.1 mg / mL, 0.1-1.0 mg / mL, 0.2-0.9 mg / mL, 0.3-0.8 mg / mL, 0.4-0.7 mg / mL, or 0.5-0.6 mg / mL. In some embodiments, the lipid nanoparticle solution may contain empty lipid nanoparticles at a concentration of up to about 5.0 mg / mL, 4.0 mg / mL, 3.0 mg / mL, 2.0 mg / mL, 1.0 mg / mL, 0.09 mg / mL, 0.08 mg / mL, 0.07 mg / mL, 0.06 mg / mL, or 0.05 mg / mL.

[0060] In some embodiments, the lipid nanoparticle solution comprises lipid nanoparticles in an aqueous buffer. In some embodiments, the lipid nanoparticle solution may further comprise a buffering agent and / or salt. Examples of suitable buffering agents include, but are not limited to, ammonium sulfate, sodium bicarbonate, sodium citrate, sodium acetate, potassium phosphate, sodium phosphate, HEPES, and the like. In some embodiments, the lipid nanoparticle solution comprises a buffering agent at a concentration ranging from about 0.1 to 100 mM, about 0.5 to 90 mM, about 1.0 to 80 mM, about 2 to 70 mM, about 3 to 60 mM, about 4 to 50 mM, about 5 to 40 mM, about 6 to 30 mM, about 7 to 20 mM, about 8 to 15 mM, or about 9 to 12 mM. In some embodiments, the lipid nanoparticle solution comprises a buffer at a concentration of about 0.1 mM, 0.5 mM, 1 mM, 2 mM, 4 mM, 6 mM, 8 mM, 10 mM, 15 mM, 20 mM, 25 mM, 30 mM, 35 mM, 40 mM, 45 mM, or 50 mM or greater. Examples of suitable salts include, but are not limited to, potassium chloride, magnesium chloride, sodium chloride, and the like. In some embodiments, the lipid nanoparticle solution comprises a salt at a concentration ranging from about 1 to 500 mM, about 5 to 400 mM, about 10 to 350 mM, about 15 to 300 mM, about 20 to 250 mM, about 30 to 200 mM, about 40 to 190 mM, about 50 to 180 mM, about 50 to 170 mM, about 50 to 160 mM, about 50 to 150 mM, or about 50 to 100 mM. In some embodiments, the lipid nanoparticle solution comprises a salt at a concentration of about 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 40 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, or 100 mM or greater.

[0061] In some embodiments, the lipid nanoparticle solution may have a pH ranging from about 4.5 to about 7.0, about 4.6 to about 7.0, about 4.8 to about 7.0, about 5.0 to about 7.0, about 5.5 to about 7.0, about 6.0 to about 7.0, about 6.0 to about 6.9, about 6.0 to about 6.8, about 6.0 to about 6.7, about 6.0 to about 6.6, or about 6.0 to about 6.5. In some embodiments, suitable lipid nanoparticle solutions may have a pH of 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.2, 5.4, 5.6, 5.8, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 or less.

[0062] Provision of LNP solution In some aspects, the present disclosure provides methods of making a lipid nanoparticle (LNP) formulation, the method comprising: (i) mixing a lipid solution comprising an ionizable lipid with an aqueous buffer solution comprising a first buffering agent, thereby forming a lipid nanoparticle solution comprising lipid nanoparticles; and (ii) adding a nucleic acid solution comprising a nucleic acid to the lipid nanoparticle solution, thereby forming a lipid nanoparticle (LNP) formulation comprising lipid nanoparticles encapsulating the nucleic acid.

[0063] Further disclosed herein are nucleic acids suitable for the methods of the present disclosure. In some embodiments, the nucleic acid is RNA (e.g., mRNA). Further disclosed herein are ionizable lipids suitable for the methods of the present disclosure.

[0064] In some embodiments, the LNP further comprises a phospholipid, a PEG lipid, a structured lipid, or any combination thereof. Phospholipids, PEG lipids, and structured lipids suitable for the methods of the present disclosure are further disclosed herein.

[0065] In some embodiments, the step of providing an LNP solution comprises mixing an aqueous buffer solution with a lipid solution, the lipid solution comprising an ionizable lipid in an organic solvent. Processing of LNP solutions The term "processing," as used herein, includes one or more steps to purify, adjust pH, buffer exchange, and / or concentrate the LNPs.

[0066] In some embodiments, the step of treating the LNP solution comprises iia) filtering the LNP solution. In some embodiments, filtration removes organic solvents (e.g., alcohol or ethanol) from the LNP solution. In some embodiments, the process includes tangential flow filtration (TFF). In some embodiments, removal of the organic solvent (e.g., alcohol or ethanol) converts the LNP solution to a solution buffered at a neutral pH, pH 6.5-7.8, pH 6.8-7.5, e.g., pH 7.0-7.2 (e.g., phosphate or HEPES buffer). In some embodiments, the resulting LNP solution is sterilized, e.g., by filtration (e.g., through a 0.1-0.5 μm filter), prior to storage or use.

[0067] In some embodiments, the step of processing the LNP solution further comprises packaging the LNP solution. As used herein, "packing" can refer to storage of a formulation in its final state or storage during manufacturing of an LNP prior to placing the final product in final packaging. Modes of storage and / or packing include, but are not limited to, refrigeration in sterile bags, refrigerated or frozen formulations in vials, lyophilized formulations in vials and syringes, etc.

[0068] In some embodiments, the step of packing the LNP solution comprises one or more of the following steps: iib) adding a cryoprotectant to the LNP solution; iic) lyophilizing the LNP solution, thereby forming a lyophilized LNP composition; iid) storing the LNP solution of the lyophilized LNP composition; and iie) adding a buffer to the LNP solution or lyophilized LNP composition, thereby forming an LNP formulation.

[0069] In some embodiments, a cryoprotectant is added to the LNP solution prior to lyophilization. In some embodiments, the cryoprotectant comprises one or more cryoprotectants, each of which independently is selected from the group consisting of a polyol (e.g., a diol or triol such as propylene glycol (i.e., 1,2-propanediol), 1,3-propanediol, glycerol, (+ / -)-2-methyl-2,4-pentanediol, 1,6-hexanediol, 1,2-butanediol, 2,3-butanediol, ethylene glycol, or diethylene glycol), a non-surfactant sulfonate, a sorbitan, a sorbitol, a sorbent, a sorbent-like compound ... tines (e.g., NDSB-201 (3-(1-pyridino)-1-propanesulfonate)), osmolytes (e.g., L-proline or trimethylamine N-oxide dihydrate), polymers (e.g., polyethylene glycol 200 (PEG200), PEG400, PEG600, PEG1000, PEG3350, PEG4000, PEG8000, PEG10000, PEG20000, polyethylene glycol monomethyl ether 550 (mPEG550), mPEG600, mPEG2000, mPEG3350, mPEG4000, mPEG5000, polyvinylpyrrolidone (e.g., polyvinylpyrrolidone K15), pentaerythritol propoxylate, or polypropylene glycol P400), organic solvent (e.g., dimethyl sulfoxide (DMSO) or ethanol), sugar (e.g., D-(+)-sucrose, D-sorbitol, trehalose, D-(+)-maltose monohydrate, mesoerythritol, xylitol, myo-inositol, D-(+)-raffinose pentahydrate, D- In some embodiments, the cryoprotectant is selected from the group consisting of (+)-trehalose dihydrate, (+)-trehalose dihydrate, and (+)-glucose monohydrate), or a salt (e.g., lithium acetate, lithium chloride, lithium formate, lithium nitrate, lithium sulfate, magnesium acetate, sodium chloride, sodium formate, sodium malonate, sodium nitrate, sodium sulfate, or hydrates thereof), or any combination thereof. In some embodiments, the cryoprotectant comprises sucrose. In some embodiments, the cryoprotectant and / or excipient is sucrose.

[0070] In some embodiments, lyophilization is performed in suitable glass containers (e.g., 10 ml cylindrical glass vials). In some embodiments, the glass containers can withstand extreme changes in temperature between below -40°C and above room temperature in a short period of time and / or are cut to a uniform shape. In some embodiments, the lyophilization step comprises freezing the LNP solution at a temperature above about -40°C, e.g., below about -30°C, thereby forming a frozen LNP solution, and drying the frozen LNP solution to form the lyophilized LNP composition. In some embodiments, the freezing step results in a linear decrease in temperature from 20°C to -40°C, e.g., at 1°C / min, over a period of about 6 minutes, to the final temperature. In some embodiments, 12-15% sucrose can be used, and the drying step is carried out in a vacuum ranging from about 50 mTorr to about 150 mTorr, e.g., first at a low temperature ranging from about -35°C to about -15°C, and then at a higher temperature ranging from room temperature to about 25°C, and the drying step is completed in, e.g., 3-7 days. In some embodiments, the drying step is carried out in a vacuum ranging from about 50 mTorr to about 100 mTorr, e.g., first at a low temperature ranging from about -15°C to about 0°C, and then at a higher temperature.

[0071] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature of about -80°C, about -78°C, about -76°C, about -74°C, about -72°C, about -70°C, about -65°C, about -60°C, about -55°C, about -50°C, about -45°C, about -40°C, about -35°C, or about -30°C prior to the addition of the buffer.

[0072] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature of about -40°C, about -35°C, about -30°C, about -25°C, about -20°C, about -15°C, about -10°C, about -5°C, about 0°C, about 5°C, about 10°C, about 15°C, about 20°C, or about 25°C prior to the addition of the buffer.

[0073] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature ranging from about −40° C. to about 0° C., about −35° C. to about −5° C., about −30° C. to about −10° C., about −25° C. to about −15° C., about −22° C. to about −18° C., or about −21° C. to about −19° C. prior to addition of the buffer.

[0074] In some embodiments, the LNP solution or lyophilized LNP composition is stored at a temperature of about −20° C. prior to the addition of the buffer. Administration of LNP formulations In some aspects, the present disclosure relates to a method of administering a lipid nanoparticle (LNP) formulation to a patient, comprising: (i) providing an active agent solution having a pH ranging from about 4.5 to about 8.0, comprising a therapeutic and / or prophylactic agent; and a lipid nanoparticle solution having a pH ranging from about 4.5 to about 6.5, comprising lipid nanoparticles comprising ionizable lipids; (ii) forming a lipid nanoparticle formulation comprising lipid nanoparticles associated with the therapeutic and / or prophylactic agent by mixing the lipid nanoparticle solution with the active agent solution such that the lipid nanoparticle formulation has a pH ranging from about 4.5 to less than about 8.0; and (iii) administering the lipid nanoparticle formulation to a patient less than about 72 hours after mixing.

[0075] In some embodiments, the first pH and the second pH range from about 7.0 to about 8.1, or from about 7.1 to about 7.8, or from about 7.2 to about 7.7, or from about 7.3 to about 7.6, or from about 7.4 to about 7.5.

[0076] In some embodiments, the first pH and the second pH range from about 4.5 to about 6.5, or from about 4.6 to about 6.0, or from about 4.8 to about 5.5. In some embodiments, the administration occurs less than about 72 hours after mixing, such as less than about 60 hours after mixing, for example, less than about 48 hours after mixing, for example, less than about 36 hours after mixing, for example, less than about 24 hours after mixing, for example, less than about 20 hours after mixing, for example, less than about 16 hours after mixing, for example, less than about 12 hours after mixing, for example, less than about 8 hours after mixing.

[0077] In some embodiments, the administration occurs less than about 120 minutes after mixing, such as less than about 100 minutes after mixing, for example, less than about 90 minutes after mixing, for example, less than about 80 minutes after mixing, for example, less than about 70 minutes after mixing, for example, less than about 60 minutes after mixing, for example, less than about 50 minutes after mixing, for example, less than about 40 minutes after mixing, for example, less than about 30 minutes after mixing, for example, less than about 20 minutes after mixing, for example, less than about 15 minutes after mixing, for example, less than about 10 minutes after mixing.

[0078] In some embodiments, the lipid nanoparticle formulation is not processed between mixing and administration. In some embodiments, the methods of the present disclosure do not include pH adjustment between mixing and administration. In some embodiments, the lipid nanoparticle formulation is not filtered between mixing and administration.

[0079] In some embodiments, the method further comprises receiving an organic solution at a first inlet of the mixing and dosing device. In some embodiments, the method further comprises receiving an aqueous buffer solution at a second inlet of the mixing and administration device.

[0080] In some embodiments, mixing occurs in a mixer section of a mixing and dosing device. In some embodiments, the lipid nanoparticle formulation is administered through an outlet of the mixing and administration device.

[0081] In some embodiments, providing, forming, mixing, and dispensing are all performed employing a single mixing and dispensing device, for example, a fluidly connected mixing and dispensing device. In some embodiments, the mixing and administration device comprises a syringe with two barrels.

[0082] In some embodiments, the mixing and administration device comprises at least one selected from the group consisting of a K-syringe and an L-syringe. In some embodiments, the mixing and dosing device includes a static mixer at the mixer site.

[0083] In some embodiments, the static mixer is a helical static mixer. In some embodiments, the pH of the aqueous buffer solution and the pH of the lipid nanoparticle formulation are about the same.

[0084] In some embodiments, the lipid nanoparticle formulation comprises about 1% to about 50% by volume of organic solvent relative to the total volume of the lipid nanoparticle formulation, e.g., about 2% to about 45% by volume, e.g., about 3% to about 40% by volume, e.g., about 4% to about 35% by volume, e.g., about 5% to about 33% by volume of organic solvent relative to the total volume of the lipid nanoparticle formulation.

[0085] In some embodiments, the organic solvent is an alcohol. In some embodiments, the organic solvent is ethanol. In some embodiments, the organic solvent comprises a first organic solvent and a second organic solvent.

[0086] In some embodiments, the first organic solvent is an alcohol and the second organic solvent is an alcohol. In some embodiments, the first organic solvent is ethanol and the second organic solvent is benzyl alcohol.

[0087] In some embodiments, the weight / weight ratio of the first organic solvent to the second organic solvent ranges from about 100:1 to about 1:1, or from about 50:1 to about 1:1, or from about 20:1 to about 1:1, or from about 10:1 to about 1:1.

[0088] In some embodiments, the organic solution further comprises a wetting agent. As used herein, a wetting agent may refer to an agent that increases, decreases, or improves the ability of a liquid to maintain contact with a surface, such as a solid surface and / or a liquid surface.

[0089] In some embodiments, the wetting agent is an organic solvent. In some embodiments, the humectant is dimethyl sulfoxide (DMSO). In some embodiments, the weight / weight ratio of wetting agent to organic solvent ranges from about 1000:1 to about 1:1, or from about 500:1 to about 5:1, or from about 100:1 to about 10:1.

[0090] In some embodiments, the aqueous buffer solution is at least one selected from the group consisting of acetate buffer, citrate buffer, phosphate buffer, and Tris buffer. In some embodiments, the aqueous buffer solution can be any buffer suitable for maintaining a physiological pH. In some embodiments, the aqueous buffer solution can be any buffer suitable for maintaining a pH suitable for administration to a patient, e.g., a mammalian patient, e.g., a human patient.

[0091] In some embodiments, the aqueous buffer solution further comprises a tonicity agent. As used herein, a tonicity agent can refer to an agent that increases, decreases, or improves the effective osmotic gradient, defined by the water potential of two solutions or the relative concentrations of dissolved solutes in the solutions, which affects the direction and extent of diffusion.

[0092] In some embodiments, the tonicity agent is a sugar. In some embodiments, the sugar is sucrose. stabilizing salt The term "stabilizing salt," as used herein, refers to a salt suitable for the methods and / or LNP formulations of the present disclosure. In some embodiments, a stabilizing salt, when used in accordance with the methods of the present disclosure, reduces undesirable property changes from the resulting lipid nanoparticle LNP formulation compared to an LNP formulation produced by an equivalent method (e.g., a method that does not involve the use of a stabilizing salt (e.g., a method that does not include step ia) and / or step iia), a method that does not include step ia), step iia), step iic), and / or step iid).

[0093] In some embodiments, the stabilizing salt has an affinity for nucleic acids (e.g., the PO4-backbone of mRNA) that is greater than the affinity for nucleic acids of a comparable sodium salt (e.g., a sodium salt having the same anion as the stabilizing salt).

[0094] In some embodiments, the stabilizing salt has an affinity for nucleic acids that is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1-fold or more, about 2-fold or more, about 3-fold or more, about 4-fold or more, about 5-fold or more greater than that of a comparable sodium salt (e.g., a sodium salt having the same anion as the stabilizing salt). or about 10 times or more, about 20 times or more, about 30 times or more, about 40 times or more, about 50 times or more, about 100 times or more, about 200 times or more, about 300 times or more, about 400 times or more, about 500 times or more, about 1000 times or more, about 2000 times or more, about 3000 times or more, about 4000 times or more, about 5000 times or more, or about 10000 times or more greater affinity for nucleic acids (e.g., the PO4-backbone of mRNA).

[0095] In some embodiments, the stabilizing salt is an alkali or alkaline earth salt, such as a lithium, sodium, potassium, beryllium, magnesium, or calcium salt.

[0096] In some embodiments, the stabilizing salt is an alkali salt, such as a lithium salt, a sodium salt, or a potassium salt. In some embodiments, the stabilizing salt is a lithium salt.

[0097] In some embodiments, the stabilizing salt is a fluoride salt, a bromide salt, a bromate salt, a perbromide salt, a chloride salt, a chlorite salt, a hydroxide salt, a hypochlorite salt, a perchlorate salt, an iodide salt, an iodate salt, a periodate salt, an azide salt, a carbonate salt, a phosphate salt, or a sulfate salt. In some embodiments, the stabilizing salt is a fluoride salt, a chloride salt, a bromide salt, or an iodide salt.

[0098] In some embodiments, the stabilizing salt is a chloride salt. In some embodiments, the stabilizing salt is lithium fluoride, lithium bromide, lithium bromate, lithium perbromate, lithium chloride, lithium chlorite, lithium hydroxide, lithium hypochlorite, lithium perchlorate, lithium iodide, lithium iodate, lithium periodate, lithium azide, lithium carbonate, lithium phosphate, or lithium sulfate. In some embodiments, the stabilizing salt is lithium fluoride, lithium chloride, lithium bromide, or lithium iodide.

[0099] In some embodiments, the stabilizing salt is lithium chloride. In some embodiments, the stabilizing salt is acetate, adipate, anthranilate, ascorbate, benzoate, butyrate, cinnamate, citrate, decanoate, ethylhexanoate, formate, fumarate, gluconate, glutamate, isobutyrate, lactate, laurate, malate, malonate, octanoate, oxalate, palmitate, phthalate, pivalate, propionate, salicylate, sorbate, stearate, succinate, tartrate, or valerate.

[0100] In some embodiments, the stabilizing salt is acetate. In some embodiments, the stabilizing salt is lithium acetate, lithium adipate, lithium anthranilate, lithium ascorbate, lithium benzoate, lithium butyrate, lithium cinnamate, lithium citrate, lithium decanoate, lithium ethylhexanoate, lithium formate, lithium fumarate, lithium gluconate, lithium glutamate, lithium isobutyrate, lithium lactate, lithium laurate, lithium malate, lithium malonate, lithium octanoate, lithium oxalate, lithium palmitate, lithium phthalate, lithium pivalate, lithium propionate, lithium salicylate, lithium sorbate, lithium stearate, lithium succinate, lithium tartrate, or lithium valerate.

[0101] In some embodiments, the stabilizing salt is lithium acetate. In some embodiments, the stabilizing salt is an alkaline earth salt, such as a beryllium salt, a magnesium salt, or a calcium salt.

[0102] In some embodiments, the stabilizing salt is a calcium salt. In some embodiments, the stabilizing salt is calcium fluoride, calcium bromide, calcium bromate, calcium perbromate, calcium chloride, calcium chlorite, calcium hydroxide, calcium hypochlorite, calcium perchlorate, calcium iodide, calcium iodate, calcium periodate, calcium azide, calcium carbonate, calcium phosphate, or calcium sulfate.

[0103] In some embodiments, the stabilizing salt is calcium acetate, calcium adipate, calcium anthranilate, calcium ascorbate, calcium benzoate, calcium butyrate, calcium cinnamate, calcium citrate, calcium decanoate, calcium ethylhexanoate, calcium formate, calcium fumarate, calcium gluconate, calcium glutamate, calcium isobutyrate, calcium lactate, calcium laurate, calcium malate, calcium malonate, calcium octanoate, calcium oxalate, calcium palmitate, calcium phthalate, calcium pivalate, calcium propionate, calcium salicylate, calcium sorbate, calcium stearate, calcium succinate, calcium tartrate, or calcium valerate.

[0104] It should be understood that, in addition to the salts specifically disclosed herein, various salts known in the art (e.g., commercially available) may be suitable as stabilizing salts. The effectiveness of a salt with respect to the disclosed methods or LNP formulations can be determined by one of skill in the art, for example, by comparing the LNP formulation produced with an LNP formulation produced by an equivalent method.

[0105] First and second buffer solutions In some embodiments, the pH value of the first buffer solution is greater than the pH value of the second buffer solution.

[0106] In some embodiments, the pH value of the first buffer is about 7.0 or greater, about 7.25 or greater, about 7.5 or greater, about 7.75 or greater, or about 8.0 or greater. In some embodiments, the pH value of the first buffer solution ranges from about 7.0 to about 10, from about 7.5 to about 9.5, from about 7.75 to about 9.25, or from about 8 to about 9.

[0107] In some embodiments, the first buffer comprises a first buffering agent. In some embodiments, the first buffer can be substantially removed by lyophilization.

[0108] In some embodiments, the first buffer can be completely removed by lyophilization. In some embodiments, the first buffer is substantially removed by lyophilization.

[0109] In some embodiments, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, about 98% or more, about 99% or more, about 99.5% or more, about 99.8% or more, about 99.9% or more, or about 99.95% or more of the first buffer is removed by lyophilization.

[0110] In some embodiments, the first buffer has a sublimation point at mmHg of less than or equal to, less than or equal to, or less than or equal to. In some embodiments, the first buffering agent is a triethylammonium salt.

[0111] In some embodiments, the first buffering agent is triethylammonium bicarbonate. In some embodiments, the concentration of triethylammonium bicarbonate in the first buffer solution ranges from about 1 mM to about 200 mM, from about 5 mM to about 100 mM, from about 10 mM to about 50 mM, or from about 15 mM to about 25 mM.

[0112] In some embodiments, the concentration of triethylammonium bicarbonate in the first buffer is about 20 mM. In some embodiments, the pH value of the second buffer is about 9.0 or less, about 8.75 or less, about 8.5 or less, about 8.25 or less or more, about 8.0 or less, about 7.75 or less, about 7.5 or less, about 7.25 or less, or about 7.0 or less.

[0113] In some embodiments, the pH value of the second buffer solution ranges from about 7.0 to about 9.0, from about 7.25 to about 8.75, from about 7.5 to about 8.5, or from about 7.75 to about 8.25. In some embodiments, the second buffer is water. In some embodiments, the second buffer comprises tris(hydroxymethyl)aminomethane.

[0114] In some embodiments, the concentration of tris(hydroxymethyl)aminomethane in the second buffer solution ranges from about 1 mM to about 200 mM, from about 5 mM to about 100 mM, from about 10 mM to about 50 mM, or from about 15 mM to about 25 mM.

[0115] In some embodiments, the concentration of tris(hydroxymethyl)aminomethane in the second buffer is about 20 mM. LNP formulations and lipid nanoparticles (LNPs) In some embodiments, the LNP formulations of the present disclosure are prepared by the methods disclosed herein.

[0116] In some embodiments, the LNP formulations of the present disclosure comprise a plurality of LNPs, wherein the LNPs comprise a nucleic acid and an ionizable lipid. Nucleic acids suitable for the methods of the present disclosure are further disclosed herein. In some embodiments, the nucleic acid is RNA (e.g., mRNA).

[0117] Ionizable lipids suitable for the methods of the present disclosure are further disclosed herein. In some embodiments, the LNP further comprises a phospholipid, a PEG lipid, a structured lipid, or any combination thereof. Phospholipids, PEG lipids, and structured lipids suitable for the methods of the present disclosure are further disclosed herein.

[0118] In some embodiments, the LNP formulations of the present disclosure comprise at least one lipid nanoparticle component. The lipid nanoparticles may comprise a lipid component and one or more additional components, such as therapeutic and / or prophylactic agents, e.g., nucleic acids. LNPs may be designed for one or more specific applications or targets. The components of the LNP may be selected based on the specific application or target and / or based on efficacy, toxicity, cost, ease of use, availability, or other characteristics of one or more components. Similarly, a particular formulation of an LNP may be selected for a particular application or target, depending, for example, on the efficacy and toxicity of a particular combination of components. The efficacy and tolerability of an LNP formulation may be affected by the stability of the formulation.

[0119] The lipid component of the LNP can include, for example, a lipid represented by formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8), a phospholipid (an unsaturated lipid such as DOPE or DSPC), a PEG-lipid, and a structured lipid. The lipid component of the LNP can include, for example, a lipid represented by formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8), a phospholipid (an unsaturated lipid, such as DOPE or DSPC), and a structural lipid. The elements of the lipid component can be provided in specific ratios.

[0120] In some embodiments, the lipid component of the LNP comprises a lipid represented by formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8), a phospholipid, a PEG-lipid, and a structural lipid. In some embodiments, the lipid component of the LNP comprises about 30 mol% to about 60 mol% of a compound of formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8), about 0 mol% to about 30 mol% phospholipid, about 18.5 mol% to about 48.5 mol% structural lipid, and about 0 mol% to about 10 mol% PEG lipid, provided that the total mol% does not exceed 100%. In some embodiments, the lipid component of the lipid nanoparticles comprises about 35 mol% to about 55 mol% of a compound of formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-Ilf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8), about 5 mol% to about 25 mol% of a phospholipid, about 30 mol% to about 40 mol% of a structural lipid, and about 0 mol% to about 10 mol% of a PEG lipid. In certain embodiments, the lipid component comprises about 50 mol % of the compound, about 10 mol % of a phospholipid, about 38.5 mol % of a structural lipid, and about 1.5 mol % of a PEG lipid.In another specific embodiment, the lipid component comprises about 40 mol% of the compound, about 20 mol% of a phospholipid, about 38.5 mol% of a structured lipid, and about 1.5 mol% of a PEG lipid. In some embodiments, the phospholipid can be DOPE or DSPC. In some embodiments, the PEG lipid can be PEG-DMG and / or the structured lipid can be cholesterol.

[0121] Lipid nanoparticles can be designed for one or more specific applications or targets. In some embodiments, LNPs can be designed to deliver therapeutic and / or prophylactic agents, such as RNA, to specific cells, tissues, organs, or systems or groups thereof in the mammalian body. The physiochemical properties of lipid nanoparticles can be modified to enhance selectivity for specific bodily targets. For example, particle size can be adjusted based on the size of fenestrations in various organs. The therapeutic and / or prophylactic agents included in LNPs can also be selected based on one or more desired delivery targets. In some embodiments, therapeutic and / or prophylactic agents can be selected for a particular indication, condition, disease, or disorder and / or for delivery (e.g., localized or specific delivery) to specific cells, tissues, organs, or systems or groups thereof. In some embodiments, LNPs can contain mRNA encoding a polypeptide of interest that can be translated intracellularly to produce the polypeptide of interest. Such compositions can be designed for specific delivery to a specific organ. In some embodiments, compositions can be designed for specific delivery to the mammalian liver.

[0122] The amount of therapeutic and / or prophylactic agent in an LNP can depend on the size, composition, desired target and / or use, or other characteristics of the lipid nanoparticle and the properties of the therapeutic and / or prophylactic agent. In some embodiments, the amount of RNA useful in an LNP can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of therapeutic and / or prophylactic agent and other components (e.g., lipids) in an LNP can also vary. In some embodiments, the weight / weight ratio of lipid component to therapeutic and / or prophylactic agent, e.g., nucleic acid, in an LNP can be from about 5:1 to about 60:1, e.g., 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1, 15:1, 16:1, 17:1, 18:1, 19:1, 20:1, 25:1, 30:1, 35:1, 40:1, 45:1, 50:1, and 60:1. In some embodiments, the weight / weight ratio of lipid component to therapeutic and / or prophylactic agent can be from about 10:1 to about 40:1. In some embodiments, the weight / weight ratio is about 20:1. The amount of therapeutic and / or prophylactic agent in the LNP can be measured, for example, using absorption spectroscopy (e.g., UV-visible spectroscopy).

[0123] In some embodiments, LNPs comprise one or more RNAs, and the one or more RNAs, lipids, and their amounts can be selected to provide a particular N:P ratio. The N:P ratio of a composition refers to the molar ratio of nitrogen atoms in the one or more lipids to the number of phosphate groups in the RNA. Generally, lower N:P ratios are preferred. The one or more RNAs, lipids, and their amounts can be selected to provide an N:P ratio of about 2:1 to about 30:1, e.g., 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 12:1, 14:1, 16:1, 18:1, 20:1, 22:1, 24:1, 26:1, 28:1, or 30:1. In some embodiments, the N:P ratio can be about 2:1 to about 8:1. In some embodiments, the N:P ratio is about 5:1 to about 8:1. In some embodiments, the N:P ratio can be about 5.0:1, about 5.5:1, about 5.67:1, about 6.0:1, about 6.5:1, or about 7.0:1. In some embodiments, the N:P ratio can be about 5.67:1.

[0124] In some embodiments, a formulation comprising an LNP may further comprise a salt, for example, a chloride salt. In some embodiments, a formulation comprising an LNP may further comprise a sugar, e.g., a disaccharide. In some embodiments, the formulation further comprises a sugar but does not comprise a salt, e.g., a chloride salt.

[0125] physical properties The physical properties of the LNPs of the present disclosure can be characterized by various methods. In some embodiments, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) can be used to examine the morphology and size distribution of the LNPs. Dynamic light scattering or potentiometry (e.g., potentiometric titration) can be used to measure zeta potential. Dynamic light scattering can also be used to determine particle size. Instruments such as the Zetasizer Nano ZS (Malvern Instruments Ltd, Malvern, Worcestershire, UK) can also be used to determine several properties of nanoparticle compositions, such as particle size, polydispersity index, and zeta potential.

[0126] The mean LNP diameter of an LNP formulation can be tens to hundreds of nanometers, as measured, for example, by dynamic light scattering (DLS). In some embodiments, the mean LNP diameter of an LNP formulation can be about 40 nm to about 150 nm, e.g., about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 50 nm to about 100 nm, about 50 nm to about 90 nm, about 50 nm to about 80 nm, about 50 nm to about 70 nm, about 50 nm to about 60 nm, about 60 nm to about 100 nm, about 60 nm to about 90 nm, about 60 nm to about 80 nm, about 60 nm to about 70 nm, about 70 nm to about 100 nm, about 70 nm to about 90 nm, about 70 nm to about 80 nm, about 80 nm to about 100 nm, about 80 nm to about 90 nm, or about 90 nm to about 100 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 70 nm to about 100 nm. In certain embodiments, the mean LNP diameter of an LNP formulation can be about 80 nm. In some embodiments, the mean LNP diameter of an LNP formulation can be about 100 nm.

[0127] In some embodiments, the mean LNP diameter of the LNP formulation ranges from about 1 mm to about 500 mm, about 5 mm to about 200 mm, about 10 mm to about 100 mm, about 20 mm to about 80 mm, about 25 mm to about 60 mm, about 30 mm to about 55 mm, about 35 mm to about 50 mm, or about 38 mm to about 42 mm.

[0128] In some embodiments, the mean LNP diameter of an LNP formulation is about 99% or less, about 98% or less, about 97% or less, about 96% or less, about 95% or less, about 90% or less, about 85% or less, about 80% or less, about 75% or less, about 70% or less, about 65% or less, about 60% or less, about 55% or less, about 50% or less, about 40% or less, about 30% or less, about 20% or less, or about 10% or less compared to an LNP formulation made by an equivalent method.

[0129] LNPs can be relatively uniform. The polydispersity index can be used to indicate the uniformity of LNPs, e.g., the particle size distribution of lipid nanoparticles. A small polydispersity index (e.g., less than 0.3) generally indicates a narrow particle size distribution. LNPs can have a polydispersity index of about 0 to about 0.25, e.g., 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of LNPs can be about 0.10 to about 0.20.

[0130] The zeta potential of LNPs can be used to indicate the kinetic potential of the composition. In some embodiments, the zeta potential can represent the surface charge of the LNPs. Lipid nanoparticles with a relatively low charge (whether positive or negative) are generally desirable because more highly charged species can have undesired interactions with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of the LNP can be about -10 mV to about +20 mV, about -10 mV to about +15 mV, about -10 mV to about +10 mV, about -10 mV to about +5 mV, about -10 mV to about 0 mV, about -10 mV to about -5 mV, about -5 mV to about +20 mV, about -5 mV to about +15 mV, about -5 mV to about +10 mV, about -5 mV to about +5 mV, about -5 mV to about 0 mV, about 0 mV to about +20 mV, about 0 mV to about +15 mV, about 0 mV to about +10 mV, about 0 mV to about +5 mV, about +5 mV to about +20 mV, about +5 mV to about +15 mV, or about +5 mV to about +10 mV.

[0131] The efficiency of encapsulation of a therapeutic and / or prophylactic agent, e.g., a nucleic acid, represents the amount of therapeutic and / or prophylactic agent encapsulated or otherwise associated with the LNP after preparation compared to the initial amount provided. A high encapsulation efficiency is desirable (e.g., near 100%). The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and / or prophylactic agent in a solution containing lipid nanoparticles before and after disintegrating the lipid nanoparticles with one or more organic solvents or detergents. Anion exchange resins can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. Fluorescence can be used to measure the amount of free therapeutic and / or prophylactic agent (e.g., RNA) in solution. The lipid nanoparticles described herein can have an encapsulation efficiency of the therapeutic and / or prophylactic agent of at least 50%, e.g., 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In some embodiments, the encapsulation efficiency can be at least 90%. In some embodiments, the encapsulation efficiency can be at least 95%.

[0132] LNPs can optionally include one or more coatings. In some embodiments, LNPs can be formulated in capsules, films, or tablets with coatings. The capsules, films, or tablets containing the compositions described herein can have any useful size, tensile strength, hardness, or density.

[0133] chemical properties The chemical properties of the disclosed LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations can be characterized by various methods. In some embodiments, electrophoresis (e.g., capillary electrophoresis) or chromatography (e.g., reverse-phase liquid chromatography) can be used to examine mRNA integrity.

[0134] In some embodiments, the LNP integrity of the LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations of the present disclosure is about 20% or more, about 25% or more, about 30% or more, about 35% or more, about 40% or more, about 45% or more, about 50% or more, about 55% or more, about 60% or more, about 65% or more, about 70% or more, about 75% or more, about 80% or more, about 85% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more.

[0135] In some embodiments, the LNP integrity of an LNP, LNP solution, lyophilized LNP composition, or LNP formulation of the present disclosure is about 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more than the LNP integrity of an LNP, LNP solution, lyophilized LNP composition, or LNP formulation made by a comparable method. or about 90% or more, about 1 fold or more, about 2 fold or more, about 3 fold or more, about 4 fold or more, about 5 fold or more, about 10 fold or more, about 20 fold or more, about 30 fold or more, about 40 fold or more, about 50 fold or more, about 100 fold or more, about 200 fold or more, about 300 fold or more, about 400 fold or more, about 500 fold or more, about 1000 fold or more, about 2000 fold or more, about 3000 fold or more, about 4000 fold or more, about 5000 fold or more, or about 10,000 fold or more higher.

[0136] In some embodiments, the T of the LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations of the present disclosure. 80% are about 12 months or more, about 15 months or more, about 18 months or more, about 21 months or more, about 24 months or more, about 27 months or more, about 30 months or more, about 33 months or more, about 36 months or more, about 48 months or more, about 60 months or more, about 72 months or more, about 84 months or more, about 96 months or more, about 108 months or more, and about 120 months or more.

[0137] In some embodiments, the T of the LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations of the present disclosure. 80% is the T of LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations made by equivalent methods. 80%About 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1 time or more, about 2 times or more, about 3 times or more, about 4 times or more, or about 5 times or more longer.

[0138] In some embodiments, the T of the LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations of the present disclosure. 1 / 2 are about 12 months or more, about 15 months or more, about 18 months or more, about 21 months or more, about 24 months or more, about 27 months or more, about 30 months or more, about 33 months or more, about 36 months or more, about 48 months or more, about 60 months or more, about 72 months or more, about 84 months or more, about 96 months or more, about 108 months or more, and about 120 months or more.

[0139] In some embodiments, the T of the LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations of the present disclosure. 1 / 2 is the T of LNPs, LNP solutions, lyophilized LNP compositions, or LNP formulations made by equivalent methods. 1 / 2 About 5% or more, about 10% or more, about 15% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 1 time or more, about 2 times or more, about 3 times or more, about 4 times or more, or about 5 times or more longer.

[0140] definition As used herein, the term "alkyl" or "alkyl group" refers to a straight or branched concatemeric saturated hydrocarbon containing one or more carbon atoms (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms), which is optionally substituted. 1-14 The term "alkyl" means an optionally substituted straight or branched concatameric saturated hydrocarbon containing 1 to 14 carbon atoms. Unless otherwise specified, alkyl groups described herein refer to both unsubstituted and substituted alkyl groups.

[0141] As used herein, the term "alkenyl" or "alkenyl group" refers to an optionally substituted straight or branched concatemeric hydrocarbon containing two or more carbon atoms (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more carbon atoms) and at least one double bond. 2-14 The term "alkenyl" refers to an optionally substituted straight or branched concatemeric hydrocarbon containing 2 to 14 carbon atoms and at least one carbon-carbon double bond. An alkenyl group can contain 1, 2, 3, 4, or more carbon-carbon double bonds. In some embodiments, C 18 Alkenyl may contain one or more double bonds. C containing two double bonds 18 The alkenyl group may be a linoleyl group. Unless otherwise specified, the alkenyl groups described herein refer to both unsubstituted and substituted alkenyl groups.

[0142] As used herein, the term "carbocycle" or "carbocyclic group" means an optionally substituted monocyclic or polycyclic ring system containing one or more rings of carbon atoms. The rings can be 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, 14-, 15-, 16-, 17-, 18-, 19-, or 20-membered rings. 3-6 The term "carbocycle" refers to a carbocycle containing a single ring having 3 to 6 carbon atoms. A carbocycle may contain one or more carbon-carbon double or triple bonds and may be non-aromatic or aromatic (e.g., a cycloalkyl or aryl group). Examples of carbocycles include cyclopropyl, cyclopentyl, cyclohexyl, phenyl, naphthyl, and 1,2-dihydronaphthyl groups. The term "cycloalkyl," as used herein, refers to a non-aromatic carbocycle, which may or may not contain any double or triple bonds. Unless otherwise specified, carbocycles described herein refer to both unsubstituted and substituted carbocyclic groups, i.e., optionally substituted carbocycles.

[0143] As used herein, the term "heterocycle" or "heterocyclic group" refers to an optionally substituted monocyclic or polycyclic ring system containing one or more rings, wherein at least one ring contains at least one heteroatom. The heteroatom can be, for example, a nitrogen, oxygen, or sulfur atom. The ring can be a 3-, 4-, 5-, 6-, 7-, 8-, 9-, 10-, 11-, 12-, 13-, or 14-membered ring. The heterocycle may contain one or more double or triple bonds and can be non-aromatic or aromatic (e.g., a heterocycloalkyl or heteroaryl group). Examples of heterocyclic rings include imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl groups. As used herein, the term "heterocycloalkyl" refers to a non-aromatic heterocyclic ring, and may or may not contain any double or triple bond. Unless otherwise specified, the heterocyclic rings described herein refer to both unsubstituted and substituted heterocyclic rings, i.e., optionally substituted heterocyclic rings.

[0144] As used herein, a "biodegradable group" is a group that can promote faster metabolism of lipids in mammalian organisms. Biodegradable groups include, but are not limited to, -C(O)O-, -OC(O)-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, The heteroaryl group may be selected from the group consisting of -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, an aryl group, and a heteroaryl group. As used herein, an "aryl group" is an optionally substituted carbocyclic group containing one or more aromatic rings. Examples of aryl groups include phenyl and naphthyl groups. As used herein, a "heteroaryl group" is an optionally substituted heterocyclic group containing one or more aromatic rings. Examples of heteroaryl groups include pyrrolyl, furyl, thiophenyl, imidazolyl, oxazolyl, and thiazolyl. Both the aryl and heteroaryl groups may be optionally substituted. In some embodiments, M and M' may be selected from the non-limiting group consisting of optionally substituted phenyl, oxazole, and thiazole. In the formulas herein, M and M' may be independently selected from the list of biodegradable groups above. Unless otherwise specified, the aryl or heteroaryl groups described herein refer to both unsubstituted and substituted groups, i.e., optionally substituted aryl or heteroaryl groups.

[0145] Alkyl, alkenyl, and cyclyl (eg, carbocyclyl and heterocyclyl) groups may be optionally substituted, unless otherwise specified. Optional substituents include, but are not limited to, halogen atoms (e.g., chloride, bromide, fluoride, or iodide groups), carboxylic acids (e.g., —C(O)OH), alcohols (e.g., hydroxyl, —OH), esters (e.g., —C(O)OR or —OC(O)R), aldehydes (e.g., —C(O)H), carbonyls (e.g., represented by —C(O)R, or alternatively, C═O), acyl halides (e.g., —C(O)X, where X is a halide selected from bromide, fluoride, chloride, and iodide), carbonates (e.g., —OC(O)OR), alkoxy (e.g., —OR), acetals (e.g., —C(OR)R″″, where each OR is an alkoxy group, which may be the same or different, and R″″ is an alkyl or alkenyl group), phosphates (e.g., P(O) 3-), thiol (e.g., -SH), sulfoxide (e.g., -S(O)R), sulfinic acid (e.g., -S(O)OH), sulfonic acid (e.g., -S(O)2OH), thial (e.g., -C(S)H), sulfate (e.g., S(O)4 2- ), sulfonyl (e.g., -S(O)2-), amido (e.g., -C(O)NR2, or -N(R)C(O)R), azido (e.g., -N3), nitro (e.g., -NO2), cyano (e.g., -CN), isocyano (e.g., -NC), acyloxy (e.g., -OC(O)R), amino (e.g., -NR2, -NRH, or -NH2), carbamoyl (e.g., -OC(O)NR2 , -OC(O)NRH, or -OC(O)NH), sulfonamide (e.g., -S(O)NRH, -S(O)NH, -N(R)S(O)R, -N(H)S(O)R, -N(R)S(O)H, or -N(H)S(O)H), alkyl, alkenyl, and cyclyl (e.g., carbocyclyl or heterocyclyl) groups. In any of the above, R is an alkyl or alkenyl group, as defined herein. In some embodiments, the substituents themselves can be further substituted, for example, with 1, 2, 3, 4, 5, or 6 substituents as defined herein. In some embodiments, C 1-6 Alkyl groups may be further substituted with 1, 2, 3, 4, 5, or 6 substituents as defined herein.

[0146] About, Approximately: As used herein, the terms "approximately" and "about" when applied to one or more values ​​of interest refer to values ​​similar to the stated reference value. In some embodiments, the terms "approximately" or "about" refer to a range in either direction (greater or less than) 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less of the stated reference value, unless otherwise stated or a different interpretation is apparent from the context (except when such value exceeds 100% of the possible value). In some embodiments, when used in reference to the amount of a given compound in the lipid component of an LNP, "about" can mean + / - 10% of the stated value. For example, an LNP containing a lipid component having about 40% of a given compound may contain 30-50% of the compound.

[0147] As used herein, the term "compound" is meant to include all isomers and isotopes of the depicted structure. "Isotopes" refer to atoms having the same atomic number but different mass numbers due to the different number of neutrons in the nucleus. In some embodiments, isotopes of hydrogen include tritium and deuterium. Furthermore, compounds, salts, or complexes of the present disclosure can be prepared in combination with solvents or water molecules to form solvates and hydrates by conventional methods.

[0148] As used herein, the term "contacting" refers to establishing a physical connection between two or more entities. In some embodiments, contacting a mammalian cell with an LNP means causing the mammalian cell and the nanoparticle to share a physical connection. Methods for contacting cells with external entities both in vivo and ex vivo are well known in the biological arts. In some embodiments, contacting LNPs and mammalian cells placed within a mammal may be performed by various routes of administration (e.g., intravenous, intramuscular, intradermal, and subcutaneous) and may involve various amounts of lipid nanoparticles. Furthermore, two or more mammalian cells may be contacted by an LNP.

[0149] As used herein, the term "equivalent method" refers to a method having equivalent parameters or steps to the method being compared (e.g., a method of making an LNP formulation of the present disclosure). In some embodiments, an "equivalent method" is a method that has one or more of steps i), ia), iaa), ib), ii), iia), iib), iic), iid), and iie) of the method being compared. In some embodiments, an "equivalent method" is a method that does not have one or more of steps i), ia), iaa), ib), ii), iia), iib), iic), iid), and iie) of the method being compared. In some embodiments, an "equivalent method" is a method that does not have one or more of steps ia) and ib) of the method being compared. In some embodiments, an "equivalent method" is a method that employs a water-soluble salt of a nucleic acid. In some embodiments, an "equivalent method" is a method that employs an organic solution that does not contain organic solvent-soluble nucleic acids. In some embodiments, an "equivalent method" is a method that includes treating the lipid nanoparticles prior to administration of the lipid nanoparticle formulation.

[0150] As used herein, the term "delivering" means providing an entity to a destination. In some embodiments, delivering a therapeutic and / or prophylactic agent to a subject can include administering LNPs containing the therapeutic and / or prophylactic agent to the subject (e.g., by intravenous, intramuscular, intradermal, or subcutaneous routes). Administering LNPs to a mammal or mammalian cells can include contacting one or more cells with lipid nanoparticles.

[0151] As used herein, the term "enhanced delivery" refers to greater (e.g., at least 1.5-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater) delivery of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., the liver of a mammal) compared to the level of delivery of a therapeutic and / or prophylactic agent by a control nanoparticle to a target tissue of interest (e.g., MC3, KC2, or DLinDMA). The level of nanoparticle delivery to a particular tissue can be measured by comparing the amount of protein made in the tissue to the weight of the tissue, the amount of therapeutic and / or prophylactic agent in the tissue to the weight of the tissue, the amount of protein made in the tissue to the total amount of protein in the tissue, or the amount of therapeutic and / or prophylactic agent in the tissue to the amount of total therapeutic and / or prophylactic agent in the tissue. It will be appreciated that enhanced delivery of nanoparticles to target tissues need not be determined in the subject being treated, but rather it can be determined in a surrogate, such as an animal model (e.g., a rat model).

[0152] As used herein, the terms "specific delivery," "specifically deliver," or "specifically delivering" refer to greater (e.g., at least 1.5-fold greater, at least 2-fold greater, at least 3-fold greater, at least 4-fold greater, at least 5-fold greater, at least 6-fold greater, at least 7-fold greater, at least 8-fold greater, at least 9-fold greater, at least 10-fold greater) delivery of a therapeutic and / or prophylactic agent by a nanoparticle to a target tissue of interest (e.g., the liver of a mammal) compared to a non-target tissue (e.g., the spleen of a mammal). The level of nanoparticle delivery to a particular tissue can be measured by comparing the amount of protein made in the tissue to the weight of the tissue, the amount of therapeutic and / or prophylactic agent in the tissue to the weight of the tissue, the amount of protein made in the tissue to the total amount of protein in the tissue, or the amount of therapeutic and / or prophylactic agent in the tissue to the total therapeutic and / or prophylactic agent in the tissue. In some embodiments, for renal vascular targeting, a therapeutic and / or prophylactic agent is specifically delivered to the kidney of a mammal compared to the liver and spleen if 1.5, 2, 3, 5, 10, 15, or 20 times more therapeutic and / or prophylactic agent is delivered to the kidney per gram of tissue compared to that delivered to the liver or spleen following systemic administration of the therapeutic and / or prophylactic agent. It will be understood that the ability of nanoparticles to specifically deliver to target tissues need not be determined in the subject being treated, but can be determined in a surrogate such as an animal model (e.g., a rat model).

[0153] As used herein, "encapsulation efficiency" refers to the amount of therapeutic and / or prophylactic agent that becomes part of the LNP relative to the initial total amount of therapeutic and / or prophylactic agent used to prepare the LNP. In some embodiments, if 97 mg of therapeutic and / or prophylactic agent are encapsulated in the LNP out of a total of 100 mg of therapeutic and / or prophylactic agent initially provided in the composition, the encapsulation efficiency can be expressed as 97%.

[0154] As used herein, "encapsulation," "encapsulated," "loaded," and "associated" can refer to complete, substantial, or partial enclosure, confinement, surrounding, or encasement. As used herein, "encapsulation" or "association" refers to the process of confining individual nucleic acid molecules within a nanoparticle and / or establishing a physicochemical relationship between individual nucleic acid molecules and a nanoparticle. As used herein, "empty nanoparticles" refer to nanoparticles that are substantially free of therapeutic or prophylactic agents. As used herein, "empty nanoparticles" refer to nanoparticles that are substantially free of nucleic acids. As used herein, "empty nanoparticles" refer to nanoparticles that are substantially composed of only lipid components.

[0155] As used herein, "expression" of a nucleic acid sequence refers to translation of mRNA into a polypeptide or protein and / or post-translational modification of the polypeptide or protein. As used herein, the term "in vitro" refers to events that take place not within a living organism (e.g., an animal, plant, or microorganism), but in an artificial environment, e.g., a test tube or reaction vessel, a cell culture, a Petri dish, etc.

[0156] As used herein, the term "in vivo" refers to events that take place within an organism (e.g., an animal, plant, or microorganism, or cells or tissues thereof). As used herein, the term "ex vivo" refers to an event that occurs outside of an organism (e.g., an animal, plant, or microorganism, or cells or tissues thereof). An ex vivo event can occur in an environment that is minimally altered from the natural (e.g., in vivo) environment.

[0157] As used herein, the term "isomer" refers to any geometric isomer, tautomer, zwitterion, stereoisomer, enantiomer, or diastereomer of a compound. Compounds may contain one or more chiral centers and / or double bonds and, therefore, can exist as stereoisomers, e.g., double bond isomers (i.e., geometric E / Z isomers) or diastereomers (e.g., enantiomers (i.e., (+) or (-)) or cis / trans isomers). The present disclosure encompasses all isomers of the compounds described herein, including stereomerically pure forms (e.g., geometrically pure, enantiomerically pure, or diastereomerically pure) and enantiomeric and stereoisomeric mixtures, e.g., racemates. Enantiomeric and stereoisomeric mixtures of compounds and means for resolving them into their component enantiomers or stereoisomers are well known.

[0158] As used herein, a "lipid component" refers to a component of a lipid nanoparticle that comprises one or more lipids. In some embodiments, the lipid component may comprise one or more cationic / ionizable lipids, PEGylated lipids, structured lipids, or other lipids, such as phospholipids.

[0159] As used herein, a "linker" refers to a moiety that connects two moieties, such as the bond between two nucleosides of a capping species. The linker may contain one or more groups, including, but not limited to, a phosphate group (e.g., phosphate, boranophosphate, thiophosphate, selenophosphate, and phosphonate), an alkyl group, an amidate, or glycerol. In some embodiments, the two nucleosides of a capping species may be linked at their 5' positions by a chain comprising a triphosphate group or two phosphate moieties and a boranophosphate moiety.

[0160] As used herein, "method of administration" can include intravenous, intramuscular, intradermal, subcutaneous, or other methods of delivering a composition to a subject. The method of administration can be selected to target delivery (e.g., specifically deliver) to a particular area or system of the body.

[0161] As used herein, "modified" means non-natural. In some embodiments, RNA can be modified RNA. That is, RNA can contain one or more non-natural nucleobases, nucleosides, nucleotides, or linkers. "Modified" species are sometimes referred to herein as "altered" species. Species can be chemically, structurally, or functionally modified or altered. In some embodiments, modified nucleobase species can contain one or more non-natural substitutions.

[0162] As used herein, "N:P ratio" is the molar ratio of ionic (in the physiological pH range) nitrogen atoms in the lipid to phosphate groups in the RNA, for example, in an LNP comprising a lipid component and RNA.

[0163] As used herein, a "lipid nanoparticle" is a composition comprising one or more lipids. Lipid nanoparticles are typically micrometer-sized or smaller and may include lipid bilayer lipid nanoparticles. As used herein, lipid nanoparticles encompass lipid nanoparticles (LNPs), liposomes (e.g., lipid vesicles), and lipoplexes, unless otherwise specified. In some embodiments, LNPs may be liposomes having a lipid bilayer with a diameter of 500 nm or less.

[0164] As used herein, "naturally occurring" means existing in nature without artificial assistance. As used herein, "patient" refers to a subject who is seeking or may need treatment, who needs treatment, who is undergoing treatment, who is to receive treatment, or who is receiving professional medical care for a particular disease or condition.

[0165] As used herein, "PEG lipid" or "PEGylated lipid" refers to a lipid that includes a polyethylene glycol moiety. The phrase "pharmaceutically acceptable" is used herein to refer to compounds, materials, compositions, and / or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable risk-benefit ratio.

[0166] As used herein, the phrase "pharmaceutically acceptable excipient" refers to any ingredient other than the compounds described herein (e.g., a vehicle capable of suspending, complexing, or dissolving an active compound) that has substantially non-toxic and non-inflammatory properties in patients. Excipients include, for example: anti-caking agents, antioxidants, binders, coatings, compression adjuvants, disintegrants, dyes (pigments), emollients, emulsifiers, fillers (diluents), film-forming agents or coatings, flavors, fragrances, glidants (glidants), lubricants, preservatives, printing inks, adsorbents, suspending or dispersing agents, sweeteners, and water for hydration. Exemplary excipients include, but are not limited to: butylated hydroxytoluene (BHT), calcium carbonate, calcium phosphate (dibasic), calcium stearate, croscarmellose, cross-linked polyvinylpyrrolidone, citric acid, crospovidone, cysteine, ethylcellulose, gelatin, hydroxypropyl cellulose, hydroxypropylmethylcellulose, lactose, magnesium stearate, maltitol, mannitol, methionine, methylcellulose, methylparaben, microcrystalline cellulose, polyethylene glycol, polyvinylpyrrolidone, povidone-iodine, pregelatinized starch, propylparaben, retinyl palmitate, shellac, silicon dioxide, sodium carboxymethylcellulose, sodium citrate, sodium starch glycolate, sorbitol, starch (corn), stearic acid, sucrose, talc, titanium dioxide, vitamin A, vitamin E (α-tocopherol), vitamin C, xylitol, and other species disclosed herein.

[0167] The composition may also include one or more salts of compounds. The salt may be a pharmaceutically acceptable salt. As used herein, " pharmaceutically acceptable salt " refers to a derivative of the disclosed compound, in which the parent compound is modified by converting an existing acid or base moiety into its salt form (for example, by reacting a free base group with a suitable organic acid). Examples of pharmaceutically acceptable salts include, but are not limited to, inorganic or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids. Representative acid addition salts include acetate, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisulfate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropionate, digluconate, dodecyl sulfate, ethanesulfonate, fumarate, glucoheptonate, glycerophosphate, hemisulfate, heptonate, hexanoate, hydrobromide, hydrochloride, hydroiodide, and 2-hydroxyethanesulfonate. Representative alkali metal or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including, but not limited to, ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, ethylamine, and the like. Pharmaceutically acceptable salts of the present disclosure include conventional non-toxic salts of the parent compound formed, for example, from non-toxic inorganic or organic acids. The pharmaceutically acceptable salts of the present disclosure can be synthesized from the parent compound which contains a basic or acidic moiety by conventional chemical methods.Generally, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in water or an organic solvent, or a mixture of both; generally, non-aqueous media such as ether, ethyl acetate, ethanol, isopropanol, or acetonitrile are preferred. A listing of suitable salts can be found in Remington's Pharmaceutical Sciences, 17. th ed., Mack Publishing Company, Easton, Pa., 1985, p. 1418, Pharmaceutical Salts: Properties, Selection, and Use, P.H. Stahl and C.G. Wermuth (eds.), Wiley-VCH, 2008, and Berge et al., Journal of Pharmaceutical Science, 66, 1-19 (1977), each of which is incorporated herein by reference in its entirety.

[0168] As used herein, a "phospholipid" is a lipid containing a phosphate moiety and one or more carbon chains, such as an unsaturated fatty acid chain. A phospholipid may contain one or more multiple (e.g., double or triple) bonds (e.g., one or more unsaturations). A phospholipid or an analog or derivative thereof may contain choline. A phospholipid or an analog or derivative thereof may not contain choline. Certain phospholipids can promote fusion with membranes. In some embodiments, cationic phospholipids can interact with one or more negatively charged phospholipids in a membrane (e.g., a cell membrane or an intracellular membrane). Fusion of a phospholipid with a membrane can allow one or more components of a lipid-containing composition to pass through the membrane, for example, allowing delivery of one or more components to a cell.

[0169] As used herein, "polydispersity index" is a ratio that describes the uniformity of the particle size distribution of a system. A small value, e.g., less than 0.3, indicates a narrow particle size distribution. As used herein, an amphiphilic "polymer" is an amphiphilic compound, including an oligomer or polymer. In some embodiments, an amphiphilic polymer can include an oligomeric fragment, such as two or more PEG monomer units. In some embodiments, the amphiphilic polymer described herein can be PS20.

[0170] As used herein, the term "polypeptide" or "polypeptide of interest" refers to a polymer of amino acid residues typically joined by peptide bonds, which may be naturally occurring or synthetically produced (e.g., isolated or purified).

[0171] As used herein, "RNA" refers to naturally occurring or non-naturally occurring ribonucleic acid. In some embodiments, RNA may contain modified and / or non-naturally occurring components, such as one or more nucleobases, nucleosides, nucleotides, or linkers. RNA may contain a cap structure, a chain-terminating nucleoside, a stem-loop, a polyA sequence, and / or a polyadenylation signal. RNA may have a nucleotide sequence encoding a polypeptide of interest. In some embodiments, RNA may be messenger RNA (mRNA). Translation of an mRNA encoding a specific polypeptide, for example, in vivo translation of an mRNA in a mammalian cell, may produce the encoded polypeptide. The RNA may be selected from the non-limiting group consisting of small interfering RNA (siRNA), asymmetric interfering RNA (aiRNA), microRNA (miRNA), Dicer substrate RNA (dsRNA), small hairpin RNA (shRNA), mRNA, long non-coding RNA (lncRNA), and mixtures thereof.

[0172] As used herein, a "single unit dose" is a dose of any therapeutic agent administered in one dose / one time / single route / single point of contact, i.e., a single administration event. As used herein, a "split dose" is the division of a single unit dose or total daily dose into two or more doses.

[0173] As used herein, a "total daily dose" is the amount administered or prescribed in a 24-hour period. It may be administered as a single unit dose. As used herein, the term "subject" refers to any living organism to which a composition or formulation according to the present disclosure can be administered, for example, for experimental, diagnostic, prophylactic, and / or therapeutic purposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans) and / or plants.

[0174] As used herein, "T x " refers to the amount of time it takes for the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP solution, lyophilized LNP composition, or LNP formulation to deteriorate to about X of the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP solution, lyophilized LNP composition, or LNP formulation. For example, "T 80% " refers to the amount of time it takes for the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP solution, lyophilized LNP composition, or LNP formulation to deteriorate to about 80% of the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP solution, lyophilized LNP composition, or LNP formulation. As another example, "T 1 / 2 " refers to the amount of time until the nucleic acid integrity (e.g., mRNA integrity) of an LNP, LNP solution, lyophilized LNP composition, or LNP formulation has deteriorated to about half the initial integrity of the nucleic acid (e.g., mRNA) used to prepare the LNP, LNP solution, lyophilized LNP composition, or LNP formulation.

[0175] As used herein, "target cell" refers to any one or more cells of interest. Cells can be found in vitro, in vivo, in situ, or in the tissues or organs of an organism. The organism can be an animal, e.g., a mammal, e.g., a human, e.g., a patient.

[0176] As used herein, "target tissue" refers to any one or more tissue types of interest where delivery of a therapeutic and / or prophylactic agent may result in a desired biological and / or pharmacological effect. Examples of target tissues of interest include specific tissues, organs, and systems or groups thereof. In particular applications, the target tissue may be the kidney, lung, spleen, the vascular endothelium of a blood vessel (e.g., in a coronary artery or femur), or tumor tissue (e.g., by intratumoral administration). "Non-target tissue" refers to any one or more tissue types where expression of the encoded protein does not result in a desired biological and / or pharmacological effect. In particular applications, non-target tissues may include the liver and spleen.

[0177] The terms "therapeutic agent" or "prophylactic agent" refer to any agent that has a therapeutic, diagnostic, and / or prophylactic effect and / or induces a desired biological and / or pharmacological effect when administered to a subject. A therapeutic agent is also called an "active" or "agent." Such agents include, but are not limited to, cytotoxins, radioactive ions, chemotherapeutic agents, small molecule drugs, proteins, and nucleic acids.

[0178] As used herein, the term "therapeutically effective amount" means the amount of delivered agent (e.g., nucleic acid, drug, composition, therapeutic agent, diagnostic agent, prophylactic agent, etc.) that, when administered to a subject suffering from or susceptible to an infection, disease, disorder, and / or condition, is sufficient to treat, ameliorate the symptoms of, diagnose, prevent, and / or delay the onset of the infection, disease, disorder, and / or condition.

[0179] As used herein, "transfection" refers to the introduction of a species (e.g., RNA) into a cell. Transfection can be performed, for example, in vitro, ex vivo, or in vivo.

[0180] As used herein, the term "treating" refers to the partial or complete alleviation, remission, improvement, relief, delay in onset, inhibition of progression, reduction in severity, and / or reduction in incidence of one or more symptoms or characteristics of a particular infection, disease, disorder, and / or condition. In some embodiments, "treating" cancer can refer to the inhibition of tumor survival, growth, and / or spread. Treatment can be administered to subjects who do not show signs of the disease, disorder, and / or condition and / or who show only early signs of the disease, disorder, and / or condition, with the intent of reducing the risk of developing pathologies associated with the disease, disorder, and / or condition.

[0181] As used herein, "zeta potential" is the kinetic potential of, for example, lipids in a particle composition. Ionizable lipids The present disclosure provides ionizable lipids, e.g., ionizable lipids comprising a central amine moiety and at least one biodegradable group. The lipids described herein can be advantageously used in lipid nanoparticles and lipid nanoparticle formulations for delivery of therapeutic and / or prophylactic agents, e.g., nucleic acids, to mammalian cells or organs.

[0182] In some embodiments, the ionizable lipid of the present disclosure has the formula (IL-1):

[0183] [ka]

[0184] or an N-oxide thereof, or a salt or isomer thereof, wherein R 1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R'M'R'; R 2 and R 3 are independently H, C 1-14 Alkyl, C 2-14Alkenyl, -R * YR”, -YR”, and -R * OR”, or R 2 and R 3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring, R 4 is hydrogen, C 3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -(CH2) o C(R 10 )2(CH2) n-o Q, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, -N(R)R 8 , -N(R)S(O)R 8 , -O(CH2) n OR, -N(R)C(=NR 9 )N(R)2, -N(R)C(=CHR 9 )N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR 9 )N(R)2, -N(OR)C(=CHR 9 )N(R)2, -C(=NR 9 )N(R)2, -C(=NR 9 )R, —C(O)N(R)OR, and —C(R)N(R)C(O)OR, each o is independently selected from 1, 2, 3, and 4, and each n is independently selected from 1, 2, 3, 4, and 5; Each R 5 are independently OH, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R 6 are independently OH, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)-M″-C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group; 1-13 Alkyl or C 2-13 is alkenyl, R 7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R 8 is C 3-6 selected from the group consisting of carbocycles and heterocycles; R 9 are H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; R 10 are H, OH, and C 1-3 Alkyl, and C 2-3 alkenyl, Each R is independently C 1-3 Alkyl, C 2-3 Alkenyl, (CH2) q OR * and H, and each q is independently selected from 1, 2, and 3; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R" is independently C 3-15 Alkyl and C 3-15 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13, and wherein R 4 But -(CH2) n Q, -(CH2) n When CHQR, -CHQR, or -CQ(R), (i) when n is 1, 2, 3, 4, or 5, Q is not -N(R), or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl.

[0185] In some embodiments, the ionizable lipid of the present disclosure has the formula (IL-X):

[0186] [ka]

[0187] or an N-oxide thereof, or a salt or isomer thereof, wherein R 1 is C 5-30 Alkyl, C 5-20 Alkenyl, -R * -YR", -YR", and -R'M'R'; R 2 and R 3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R 2 and R 3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring, R 4 is hydrogen, C3-6 Carbocyclic ring, -(CH2) n Q, -(CH2) n CHQR, -(CH2) o C(R 10 )2(CH2) n-o Q, -CHQR, -CQ(R)2, and unsubstituted C 1-6 alkyl, where Q is a carbocycle, a heterocycle, -OR, -O(CH2) n N(R)2, -C(O)OR, -OC(O)R, -CX3, -CX2H, -CXH2, -CN, -N(R)2, -C(O)N(R)2, -N(R)C(O)R, -N(R)S(O)2R, -N(R)C(O)N(R)2, -N(R)C(S)N(R)2, N(R)R 8 , -N(R)S(O)R 8 , -O(CH2) n OR, -N(R)C(=NR 9 )N(R)2, -N(R)C(=CHR 9 )N(R)2, -OC(O)N(R)2, -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O)2R, -N(OR)C(O)OR, -N(OR)C(O)N(R)2, -N(OR)C(S)N(R)2, -N(OR)C(=NR 9 )N(R)2, -N(OR)C(=CHR 9 )N(R)2, -C(=NR 9 )N(R)2, -C(=NR 9 )R, -C(O)N(R)OR, and -C(R)N(R)C(O)OR, each o is independently selected from 1, 2, 3, and 4, and each n is independently selected from 1, 2, 3, 4, and 5; R x is C 1-6 Alkyl, C 2-6 Alkenyl, -(CH2) V OH, and -(CH2) V N(R)2, wherein v is selected from 1, 2, 3, 4, 5, and 6; Each R 5 are independently OH, C 1-3 Alkyl, C 2-3selected from the group consisting of alkenyl, and H; Each R 6 are independently OH, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)-M″-C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group; 1-13 Alkyl or C 2-13 is alkenyl, R 7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; R 8 is C 3-6 selected from the group consisting of carbocycles and heterocycles; R 9 are H, CN, NO2, C 1-6 Alkyl, -OR, -S(O)2R, -S(O)2N(R)2, C 2-6 Alkenyl, C 3-6 selected from the group consisting of carbocycles and heterocycles; R 10 are H, OH, and C 1-3 Alkyl, and C 2-3 alkenyl, Each R is independently C 1-3 Alkyl, C 2-3 Alkenyl, (CH2) q OR * and H; and each q is independently selected from 1, 2, and 3; Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R" is independently C 3-15 Alkyl and C3-15 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13.

[0188] In some embodiments, a subset of compounds of formula (IL-I) has formula (IL-IA):

[0189] [ka]

[0190] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M is a bond or M'; and R 4 is hydrogen, unsubstituted C 1-3 Alkyl, -(CH2) o C(R 10 )2(CH2) n-o Q, or -(CH2) n Q, where Q is OH, -NHC(S)N(R), -NHC(O)N(R), -N(R)C(O)R, -N(R)S(O)R, -N(R)R 8 , -NHC(=NR 9 )N(R)2, -NHC(=CHR 9 )N(R), -OC(O)N(R), -N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; and R 2 and R 3are independently H, C 1-14 Alkyl, and C 2-14 For example, Q is selected from the group consisting of alkenyl. For example, m is 5, 7, or 9. For example, Q is OH, -NHC(S)N(R)2, or -NHC(O)N(R)2. For example, Q is -N(R)C(O)R, or -N(R)S(O)2R.

[0191] In some embodiments, a subset of compounds of formula (I) has formula (IL-IB):

[0192] [ka]

[0193] or an N-oxide thereof, or a salt or isomer thereof, wherein all variables are as defined herein. In some embodiments, m is selected from 5, 6, 7, 8, and 9, and R is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where Q is —OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R and R are independently selected from H, C 1-14 Alkyl, and C 2-14 In some embodiments, Q is selected from the group consisting of alkenyl. In some embodiments, m is 5, 7, or 9. In some embodiments, Q is OH, -NHC(S)N(R), or -NHC(O)N(R). In some embodiments, Q is -N(R)C(O)R, or -N(R)S(O)R.

[0194] In some embodiments, a subset of compounds of formula (IL-I) is of formula (IL-II):

[0195] [ka]

[0196] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4 and 5; 1 is a bond or M', and R4 is hydrogen, unsubstituted C 1-3 Alkyl, or -(CH2) n Q, where n is 2, 3, or 4, and Q is —OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, —N(R)S(O)R, —N(R)R, —NHC(═NR)N(R), —NHC(═CHR)N(R), —OC(O)N(R), —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)—M″—C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —SS—, an aryl group, and a heteroaryl group; and R 2 and R 3 are independently H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0197] In some embodiments, the ionizable lipid compounds of the present disclosure have the formula (IL-VI):

[0198] [ka]

[0199] or an N-oxide thereof, or one or more salts or isomers thereof, During the ceremony, R 1 is C 5-30 Alkyl, C 5-20Alkenyl, -R * -YR", -YR", and -R'M'R'; R 2 and R 3 are independently H, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R 2 and R 3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring, Each R 5 are independently OH, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R 6 are independently OH, C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)-M″-C(O)O—, —C(O)N(R′)—, —N(R′)C(O)—, —C(O)—, —C(S)—, —C(S)S—, —SC(S)—, —CH(OH)—, —P(O)(OR′)O—, —S(O)—, —SS—, an aryl group, and a heteroaryl group; 1-13 Alkyl or C 2-13 is alkenyl, R 7 is C 1-3 Alkyl, C 2-3 selected from the group consisting of alkenyl, and H; Each R is independently H, C 1-3 Alkyl, and C 2-3 alkenyl, R N is H or C 1-3 is alkyl, Each R' is independently C 1-18 Alkyl, C 2-18 Alkenyl, -R * selected from the group consisting of Y-R″, -Y-R″, and H; Each R" is independently C 3-15 Alkyl and C 3-15 alkenyl, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each Y is independently C 3-6 is a carbocyclic ring, each X is independently selected from the group consisting of F, Cl, Br, and I; X a and X b are each independently O or S, R 10 is H, halo, -OH, R, -N(R)2, -CN, -N3, -C(O)OH, -C(O)OR, -OC(O)R, -OR, -SR, -S(O)R, -S(O)OR, -S(O)2OR, -NO2, -S(O)2N(R)2, -N(R)S(O)2R, -NH(CH2) t1 N(R)2, -NH(CH2) p1 O(CH2) q 1N(R)2, -NH(CH2) s1 OR, -N((CH2) s1 OR)2, carbocycle, heterocycle, aryl, and heteroaryl; m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; n is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; r is 0 or 1, t l is selected from 1, 2, 3, 4, and 5, p l is selected from 1, 2, 3, 4, and 5, q l is selected from 1, 2, 3, 4, and 5, and s l is selected from 1, 2, 3, 4, and 5.

[0200] In some embodiments, a subset of compounds of Formula (IL-VI) is represented by Formula (IL-VI-a):

[0201] [ka]

[0202] or an N-oxide thereof, or a salt or isomer thereof, wherein: R 1a and R 1b independently, C 1-14 Alkyl and C 2-14 alkenyl, and R 2 and R 3 independently, C 1-14 Alkyl, C 2-14 Alkenyl, -R * YR”, -YR”, and -R * OR”, or R 2 and R 3 together with the atoms to which they are attached form a heterocyclic or carbocyclic ring.

[0203] In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VII):

[0204] [ka]

[0205] or an N-oxide thereof, or a salt or isomer thereof, wherein: l is selected from 1, 2, 3, 4, and 5; M1 is a bond or M', and R 2 and R 3 are independently H, C 1-14 Alkyl, and C 2-14 alkenyl.

[0206] In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIII):

[0207] [ka]

[0208] or an N-oxide thereof, or a salt or isomer thereof, wherein: l is selected from 1, 2, 3, 4, and 5; M1 is a bond or M', and R a’ and R b’ independently, C 1-14 Alkyl and C 2-14 alkenyl, and R 2 and R 3 independently, C 1-14 Alkyl, and C 2-14 alkenyl.

[0209] A compound of any one of formula (IL-I), (IL-IA), (IL-VI), (IL-VI-a), (IL-VII) or (IL-VIII), as applicable, comprises one or more of the following features:

[0210] In some embodiments, M1 is M'. In some embodiments, M and M' are independently -C(O)O- or -OC(O)-.

[0211] In some embodiments, at least one of M and M' is -C(O)O- or -OC(O)-. In certain embodiments, at least one of M and M' is -OC(O)-.

[0212] In certain embodiments, M is -OC(O)- and M' is -C(O)O-. In some embodiments, M is -C(O)O- and M' is -OC(O)-. In certain embodiments, M and M' are each -OC(O)-. In some embodiments, M and M' are each -C(O)O-.

[0213] In certain embodiments, at least one of M and M′ is —OC(O)—M″—C(O)O—. In some embodiments, M and M' are independently -SS-.

[0214] In some embodiments, at least one of M and M' is -SS-. In some embodiments, one of M and M' is -C(O)O- or -OC(O)-, and the other is -SS-. For example, M is -C(O)O- or -OC(O)- and M' is -SS-, or M' is -C(O)O- or -OC(O)- and M is -SS-.

[0215] In some embodiments, one of M and M′ is —OC(O)—M″—C(O)O—, where M″ is a bond, C 1-13 Alkyl or C 2-13 In other embodiments, M" is C 1-6 Alkyl or C 2-6 In certain embodiments, M" is C 1-4 Alkyl or C 2-4 For example, in some embodiments, M" is a C1 alkyl. For example, in some embodiments, M" is a C2 alkyl. For example, in some embodiments, M" is a C3 alkyl. For example, in some embodiments, M" is a C4 alkyl. For example, in some embodiments, M" is a C2 alkenyl. For example, in some embodiments, M" is a C3 alkenyl. For example, in some embodiments, M" is a C4 alkenyl.

[0216] In some embodiments, 1 is 1, 3, or 5. In some embodiments, R 4 is hydrogen. In some embodiments, R 4 is not hydrogen.

[0217] In some embodiments, R 4 is unsubstituted methyl or -(CH2) n Q, where Q is OH, —NHC(S)N(R), —NHC(O)N(R), —N(R)C(O)R, or —N(R)S(O)R.

[0218] In some embodiments, Q is OH. In some embodiments, Q is —NHC(S)N(R) 2 . In some embodiments, Q is —NHC(O)N(R) 2 .

[0219] In some embodiments, Q is —N(R)C(O)R. In some embodiments, Q is —N(R)S(O)R. In some embodiments, Q is —O(CH) n N(R)2.

[0220] In some embodiments, Q is —O(CH) n It is OR. In some embodiments, Q is —N(R)R 8 is. In some embodiments, Q is —NHC(═NR 9 )N(R)2.

[0221] In some embodiments, Q is —NHC(═CHR 9 )N(R)2. In some embodiments, Q is —OC(O)N(R) 2 . In some embodiments, Q is —N(R)C(O)OR.

[0222] In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4.

[0223] In some embodiments, M1 is absent. In some embodiments, at least one R 5 is a hydroxyl. For example, one R 5 is a hydroxyl.

[0224] In some embodiments, at least one R 6 is a hydroxyl. For example, one R 6 is a hydroxyl. In some embodiments, R 5 and R 6 One of the R is hydroxyl. For example, 5 is hydroxyl, and each R 6 is hydrogen. For example, one R 6 is hydroxyl, and each R 5 is hydrogen.

[0225] In some embodiments, R x is C 1-6 In some embodiments, R x is C 1-3 alkyl. For example, R x is methyl. For example, R x is ethyl. For example, R x is propyl.

[0226] In some embodiments, R x is -(CH2) v OH and v is 1, 2 or 3. For example, R x is methanoyl. For example, R x is ethanoyl. For example, R x is propanoyl.

[0227] In some embodiments, R x is -(CH2) v N(R)2, v is 1, 2, or 3, and each R is H or methyl. For example, R x is methaneamino, methylmethaneamino, or dimethylmethaneamino. For example, R xis aminomethanil, methylaminomethanil, or dimethylaminomethanil. For example, R x is aminoethanyl, methylaminoethanyl, or dimethylaminoethanyl. For example, R x is aminopropanyl, methylaminopropanyl, or dimethylaminopropanyl.

[0228] In some embodiments, R' is C 1-18 Alkyl, C 2-18 Alkenyl, -R * YR”, or -YR”. In some embodiments, R 2 and R 3 independently, C 3-14 Alkyl or C 3-14 It is alkenyl.

[0229] In some embodiments, R 1b is C 1-14 In some embodiments, R 1b is C 2-14 In some embodiments, R 1b is C 3-14 In some embodiments, R 1b is C 1-8 In some embodiments, R 1b is C 1-5 In some embodiments, R 1b is C 1-3 In some embodiments, R 1b is selected from C alkyl, C alkyl, C alkyl, C alkyl, and C alkyl. For example, in some embodiments, R 1b is C alkyl. For example, in some embodiments, R 1b is a C alkyl. For example, in some embodiments, R 1b is a C alkyl. For example, in some embodiments, R 1b is a C4 alkyl. For example, in some embodiments, R 1bis a C5 alkyl.

[0230] In some embodiments, R 1 is -(CHR 5 R 6 ) m -M-CR 2 R 3 R 7 is different. In some embodiments, —CHR 1a R 1b - is -(CHR 5 R 6 ) m -M-CR 2 R 3 R 7 is different.

[0231] In some embodiments, R 7 is H. In some embodiments, R 7 is C 1-3 For example, in some embodiments, R 7 is C alkyl. For example, in some embodiments, R 7 is a C alkyl. For example, in some embodiments, R 7 is C alkyl. In some embodiments, R 7 is C4 alkyl, C4 alkenyl, C5 alkyl, C5 alkenyl, C6 alkyl, C6 alkenyl, C7 alkyl, C7 alkenyl, C9 alkyl, C9 alkenyl, C 11 Alkyl, C 11 Alkenyl, C 17 Alkyl, C 17 Alkenyl, C 18 Alkyl, and C 18 alkenyl.

[0232] In some embodiments, R b’ is C 1-14 In some embodiments, R b’ is C 2-14 In some embodiments, R b’ is C 3-14In some embodiments, R b’ is C 1-8 In some embodiments, R b’ is C 1-5 In some embodiments, R b’ is C 1-3 In some embodiments, R b’ is selected from C alkyl, C alkyl, C alkyl, C alkyl, and C alkyl. For example, in some embodiments, R b’ is C alkyl. For example, in some embodiments, R b’ is a C alkyl. For example, in some embodiments, R b’ is a C alkyl. For example, in some embodiments, R b’ is a C4 alkyl.

[0233] In some embodiments, the compound of formula (IL-I) has the formula (IL-IIa):

[0234] [ka]

[0235] or an N-oxide thereof, or a salt or isomer thereof, wherein R 4 is as described herein. In another embodiment, the compound of formula (IL-I) has the formula (IL-IIb):

[0236] [ka]

[0237] or an N-oxide thereof, or a salt or isomer thereof, wherein R 4 is as described herein. In another embodiment, the compound of formula (IL-I) has formula (IL-IIc) or (IL-IIe):

[0238] [ka]

[0239] or an N-oxide thereof, or a salt or isomer thereof, wherein R 4 is as described herein. In another embodiment, the compound of formula (IL-I) has the formula (IL-IIf):

[0240] [ka]

[0241] or an N-oxide thereof, or a salt or isomer thereof, wherein M is —C(O)O— or —OC(O)—, and M″ is C 1-6 Alkyl or C 2-6 alkenyl, and R 2 and R 3 independently, C 5-14 Alkyl and C 5-14 alkenyl, wherein n is selected from 2, 3, and 4.

[0242] In a further embodiment, the compound of formula (IL-I) has the formula (IL-IId):

[0243] [ka]

[0244] or an N-oxide thereof, or a salt or isomer thereof, wherein n is 2, 3, or 4, and m, R′, R″, and R2 through R6 are as described herein. For example, each of R2 and R3 is independently C 5-14 Alkyl and C 5-14 alkenyl.

[0245] In a further embodiment, the compound of formula (IL-I) has the formula (IL-g):

[0246] [ka]

[0247] or an N-oxide thereof, or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4, and 5; m is selected from 5, 6, 7, 8, and 9; M1 is a bond or M'; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -P(O)(OR')O-, -SS-, an aryl group, and a heteroaryl group; and R2 and R3 are independently selected from H, C 1-14 Alkyl, and C 2-14 In some embodiments, M" is selected from the group consisting of C 1-6 Alkyl (e.g., C 1-4 alkyl) or C 2-6 Alkenyl (e.g., C 2-4 In some embodiments, R2 and R3 are independently C 5-14 Alkyl and C 5-14 alkenyl.

[0248] In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIa):

[0249] [ka]

[0250] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (VI) is represented by formula (IL-VIIIa):

[0251] [ka]

[0252] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIIb):

[0253] [ka]

[0254] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIb-1):

[0255] [ka]

[0256] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIb-2):

[0257] [ka]

[0258] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is formula (IL-VIIb-3):

[0259] [ka]

[0260] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIc):

[0261] [ka]

[0262] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIId):

[0263] [ka]

[0264] or an N-oxide thereof, or a salt or isomer thereof. In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIIc):

[0265] [ka]

[0266] This includes compounds of the formula: In another embodiment, a subset of compounds of formula (IL-VI) is of formula (IL-VIIId):

[0267] [ka]

[0268] or an N-oxide thereof, or a salt or isomer thereof. Formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-VI), (IL-VI-a), (IL-VII), (IL-VIII), (I Any one compound of L-VIIa), (IL-VIIIa), (IL-VIIIb), (IL-VIIb-1), (IL-VIIb-2), (IL-VIIb-3), (IL-VIIc), (IL-VIId), (IL-VIIIc), or (IL-VIIId) contains one or more of the following characteristics, as applicable:

[0269] In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Application Nos. 62 / 220,091, 62 / 252,316, 62 / 253,433, 62 / 266,460, 62 / 333,557, 62 / 382,740, 62 / 393,940, 62 / 471,937, 62 / 471,949, 62 / 475,140, ​​and 62 / 475,166, and PCT Application No. PCT / US2016 / 052352.

[0270] In some embodiments, the ionizable lipid is selected from compounds 1-280 described in US Application No. 62 / 475,166. In some embodiments, the ionizable lipid is

[0271] [ka]

[0272] or a salt thereof. In some embodiments, the ionizable lipid is

[0273] [ka]

[0274] or a salt thereof. In some embodiments, the ionizable lipid is

[0275] [ka]

[0276] or a salt thereof. In some embodiments, the ionizable lipid is

[0277] [ka]

[0278] or a salt thereof. In some embodiments, the ionizable lipid of the present disclosure has the formula (IL-III):

[0279] [ka]

[0280] or a salt or isomer thereof, wherein W is

[0281] [ka]

[0282] and Ring A is

[0283] [ka]

[0284] and t is 1 or 2, A1 and A2 are each independently selected from CH or N; Z is CH2 or absent, where when Z is CH2, dashed lines (1) and (2) each represent a single bond, and when Z is absent, dashed lines (1) and (2) are both absent; R1, R2, R3, R4, and R5 are independently C 5-20 Alkyl, C 5-20 Alkenyl, -R'MR', -R * YR”, -YR”, and -R * OR" R x1 and R x2 are each independently H or C 1-3 is alkyl, each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M * is C1-C6 alkyl, W 1 and W 2 are each independently selected from the group consisting of —O— and —N(R6)—; Each R6 is independently H and C 1-5 is selected from the group consisting of alkyl, X 1 , X 2 , and X 3 are independently a bond, -CH2-, -(CH2)2-, -CHR-, -CHY-, -C(O)-, -C(O)O-, -OC(O)-, or -(CH2) n -C(O)-, -C(O)-(CH2) n -, -(CH2) n -C(O)O-, -OC(O)-(CH2) n -, -(CH2) n -OC(O)-, -C(O)O-(CH2) n is selected from the group consisting of -, -CH(OH)-, -C(S)-, and -CH(SH)-; Each Y is independently C 3-6is a carbocyclic ring, Each R * independently, C 1-12 Alkyl and C 2-12 alkenyl, Each R is independently C 1-3 Alkyl and C 3-6 is selected from the group consisting of carbocycles; Each R' is independently C 1-12 Alkyl, C 2-12 selected from the group consisting of alkenyl, and H; Each R" is independently C 3-12 Alkyl, C 3-12 Alkenyl and -R * MR′, and n is an integer from 1 to 6, In the formula, ring A is

[0285] [ka]

[0286] If i)X 1 , X 2 , and X 3 is not -CH2-, and / or ii) At least one of R1, R2, R3, R4, and R5 is -R"MR'.

[0287] In some embodiments, the compound has the formula (IL-IIIa1)-(IL-IIIa8):

[0288] [ka]

[0289] Either: In some embodiments, the ionizable lipid is one or more of the compounds described in U.S. Application Nos. 62 / 271,146, 62 / 338,474, 62 / 413,345, and 62 / 519,826, PCT Application No. PCT / US2019 / 052009, and International Publication Nos. WO2017 / 112865, WO2017 / 049245, and WO2018 / 170306.

[0290] In some embodiments, the ionizable lipid is selected from compounds 1-156 described in US Application No. 62 / 519,826. In some embodiments, the ionizable lipid is selected from compounds 1-16, 42-66, 68-76, and 78-156 described in US Application No. 62 / 519,826.

[0291] In some embodiments, the ionizable lipid is

[0292] [ka]

[0293] or a salt thereof. The central amine moiety of lipids represented by formula (IL-1), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8) can be protonated at physiological pH. Thus, the lipids can have a positive or partial positive charge at physiological pH. Such lipids can be referred to as cationic or ionic (amino) lipids. Lipids can also be zwitterionic, i.e., neutral molecules with both positive and negative charges.

[0294] In some embodiments, the ionizable lipid is 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N -dimethylaminepropane (DLin-DMA), 2,2-dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-di Oleyloxy-N,N-dimethylaminepropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3 -[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)).

[0295] Polyethylene glycol (PEG) lipids As used herein, the term "PEG lipid" refers to a polyethylene glycol (PEG)-modified lipid. Non-limiting examples of PEG lipids include PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates (e.g., PEG-CerC14 or PEG-CerC20), PEG-modified dialkylamine, and PEG-modified 1,2-diacyloxypropan-3-amine. Such lipids are also referred to as PEGylated lipids. In some embodiments, the PEG lipid may be a PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0296] In some embodiments, PEG lipids include, but are not limited to, 1,2-dimyristoyl-sn-glycerol methoxypolyethylene glycol (PEG-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[amino(polyethylene glycol)] (PEG-DSPE), PEG-disterylglycerol (PEG-DSG), PEG-dipalmetoleyl, PEG-dioleyl, PEG-distearyl, PEG-diacylglycamide (PEG-DAG), PEG-dipalmitoylphosphatidylethanolamine (PEG-DPPE), or PEG-1,2-dimyristylocsulpropyl-3-amine (PEG-c-DMA).

[0297] In some embodiments, the PEG lipid is selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof.

[0298] In some embodiments, the lipid portion of the PEG-lipid has a molecular weight of about C 14 ~About C 22 , preferably about C 14 ~About C 16In some embodiments, the PEG moiety, e.g., mPEG-NH2, has a size of about 1000, 2000, 5000, 10,000, 15,000, or 20,000 daltons. In some embodiments, the PEG lipid is PEG 2k -DMG.

[0299] In some embodiments, the lipid nanoparticles described herein can include a PEG lipid that is a non-diffusible PEG. Non-limiting examples of non-diffusible PEGs include PEG-DSG and PEG-DSPE.

[0300] PEG lipids are known in the art, such as those described in U.S. Pat. No. 8,158,601 and International Publication No. WO 2015 / 130584 A2, which are incorporated herein by reference in their entireties.

[0301] Generally, some of the other lipid components (e.g., PEG lipids) of the various formulas described herein can be synthesized as described in International Patent Application PCT / US2016 / 000129, entitled "Compositions and Methods for Delivery of Therapeutic Agents," filed December 10, 2016, which is incorporated herein by reference in its entirety.

[0302] The lipid component of the lipid nanoparticle or lipid nanoparticle formulation may include one or more molecules containing polyethylene glycol, such as PEG or PEG-modified lipids. Such species may alternatively be referred to as PEGylated lipids. PEG lipids are lipids modified with polyethylene glycol. The PEG lipid may be selected from the non-limiting group including PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol, and mixtures thereof. In some embodiments, the PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, or PEG-DSPE lipid.

[0303] In some embodiments, the PEG-modified lipid is a modified form of PEG-DMG, which has the following structure:

[0304] [ka]

[0305] In some embodiments, PEG lipids useful in the present invention may be PEGylated lipids described in International Publication WO2012099755, the contents of which are incorporated herein by reference in their entirety. Any of these exemplary PEG lipids described herein may be modified to include hydroxyl groups on the PEG chain. In some embodiments, the PEG lipid is a PEG-OH lipid. As generally defined herein, a "PEG-OH lipid" (also referred to herein as a "hydroxy-PEGylated lipid") is a PEGylated lipid having one or more hydroxyl (-OH) groups on the lipid. In some embodiments, the PEG-OH lipid includes one or more hydroxyl groups on the PEG chain. In some embodiments, the PEG-OH or hydroxy-PEGylated lipid includes an -OH group at the end of the PEG chain. Each possibility represents a separate embodiment of the present invention.

[0306] In some embodiments, the PEG lipid useful in the present invention is a compound of formula (PL-I): Provided herein is a compound of formula (PL-I):

[0307] [ka]

[0308] or a salt thereof, wherein R 3 -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; L 1 is an optionally substituted C 1-10 alkylene, wherein optionally substituted C 1-10 At least one methylene of the alkylene is optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, -OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, or NR N C(O)N(R N ) and are independently replaced by D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula:

[0309] [ka]

[0310] and L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene, wherein optionally substituted C 1-6 One methylene unit of alkylene is O, N(R N ), S, C(O), C(O)N(R N ), NR N C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), -NR N C(O)O, or NR N C(O)N(R N ), optionally replaced by R 2 Each instance of may independently be selected from the group consisting of optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30 alkynyl, optionally where R 2 one or more methylene units of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), C(O)N(R N ), NR N C(O), -NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), NR N C(O)O, C(O)S, SC(O), -C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, S(O)2O, OS(O)2O, N(R N )S(O), -S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, R N each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; p is 1 or 2.

[0311] In some embodiments, the compound of formula (PL-I) is a PEG-OH lipid (i.e., R 3 -OR O and R O is hydrogen). In some embodiments, the compound of formula (PL-I) has the formula (PL-I-OH):

[0312] [ka]

[0313] or a salt thereof. In some embodiments, the PEG lipid useful in the present invention is a PEGylated fatty acid. In some embodiments, the PEG lipid useful in the present invention is a compound of formula (PL-II). Provided herein is a compound of formula (PL-II):

[0314] [ka]

[0315] or a salt thereof, wherein R 3 -OR O and R O is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer between 1 and 100, inclusive; R 5 is an optionally substituted C 10-40 Alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C 10-40 alkynyl, and optionally R 5 one or more methylene groups in the formula (I) are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), -C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), -NR N C(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, -S(O)2O, OS(O)2O, N(R N)S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, and R N Each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0316] In some embodiments, the compound of formula (PL-II) has the formula (PL-II-OH):

[0317] [ka]

[0318] or a salt thereof, wherein r is an integer from 1 to 100, R 5 is an optionally substituted C 10-40 Alkyl, optionally substituted C 10-40 alkenyl, or optionally substituted C 10-40 alkynyl, and optionally R 5 one or more methylene groups in the formula (I) are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R N ), O, S, C(O), -C(O)N(R N ), NR N C(O), NR N C(O)N(R N ), C(O)O, OC(O), OC(O)O, OC(O)N(R N ), -NR NC(O)O, C(O)S, SC(O), C(=NR N ), C(=NR N )N(R N ), NR N C(=NR N ), NR N C(=NR N )N(R N ), C(S), C(S)N(R N ), NR N C(S), NR N C(S)N(R N ), S(O), OS(O), S(O)O, OS(O)O, OS(O)2, -S(O)2O, OS(O)2O, N(R N )S(O), S(O)N(R N ), N(R N )S(O)N(R N ), OS(O)N(R N ), N(R N )S(O)O, S(O)2, N(R N )S(O)2, S(O)2N(R N ), N(R N )S(O)2N(R N ), OS(O)2N(R N ), or N(R N )S(O)2O, and R N Each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group.

[0319] In some embodiments, r is an integer between 10 and 80, between 20 and 70, between 30 and 60, or between 40 and 50. In some embodiments, r is 45.

[0320] In some embodiments, R 5 is C 17 It is alkyl. In yet another embodiment, the compound of formula (PL-II) is

[0321] [ka]

[0322] or a salt thereof. In some embodiments, the compound of formula (PL-II) is

[0323] [ka]

[0324] is. In some embodiments, the lipid composition of the pharmaceutical compositions described herein does not comprise a PEG lipid.

[0325] In some embodiments, the PEG lipid can be one or more of the PEG lipids described in US Patent Application No. 62 / 520,530. In some embodiments, the PEG lipid has the formula (PL-III):

[0326] [ka]

[0327] or a salt or isomer thereof, wherein s is an integer from 1 to 100. In some embodiments, the PEG lipid has the following formula:

[0328] [ka]

[0329] or a salt or isomer thereof. structural lipids As used herein, the term "structured lipid" refers to a sterol and also to a lipid that includes a sterol moiety.

[0330] The incorporation of structured lipids into lipid nanoparticles can help alleviate aggregation of other lipids within the particles. The structured lipid can be selected from the group including, but not limited to, cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, steroids, and mixtures thereof. In some embodiments, the structured lipid is a mixture of two or more components each independently selected from cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, hopanoids, phytosterols, and steroids. In some embodiments, the structured lipid is a sterol. In some embodiments, the structured lipid is a mixture of two or more sterols. As defined herein, "sterol" is a subgroup of steroids consisting of steroid alcohols. In some embodiments, the structured lipid is a steroid. In some embodiments, the structured lipid is cholesterol. In some embodiments, the structured lipid is a cholesterol analog. In some embodiments, the structured lipid is alpha-tocopherol.

[0331] In some embodiments, the structured lipid can be one or more of the structured lipids described in US Patent Application No. 62 / 520,530. Mounting agent In some embodiments of the present disclosure, the encapsulating agent is a compound of formula (EA-I):

[0332] [ka]

[0333] or a salt or isomer thereof, wherein: R 201 and R 202 are each independently H, C1-C6 alkyl, C2-C6 alkenyl, and (C=NH)N(R101 )2, wherein each R 101 is independently selected from the group consisting of H, C1-C6 alkyl, and C2-C6 alkenyl; R 203 is C1-C 20 Alkyl and C2-C 20 alkenyl, R 204 is H, C1-C 20 Alkyl, C2-C 20 Alkenyl, C(O)(OC1-C 20 alkyl), C(O)(OC-C 20 alkenyl), C(O)(NHC1-C 20 alkyl), and C(O)(NHC-C 20 alkenyl), n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0334] In some embodiments, R 201 and R 202 are each independently selected from the group consisting of H and CH3. In some embodiments, R 201 and R 202 are each independently selected from the group consisting of (C=NH)NH2 and (C=NH)N(CH3)2.

[0335] In some embodiments, R 203 is C1-C 20 Alkyl, C8-C 18 Alkyl, and C 12 -C 16 alkyl. In some embodiments, R 204 is H, C1-C 20 Alkyl, C2-C 20 Alkenyl, C(O)(OC1-C 20 alkyl), C(O)(OC-C 20 alkenyl), C(O)(NHC1-C 20 alkyl), and C(O)(NHC-C 20alkenyl), C8-C 18 Alkyl, C8-C 18 Alkenyl, C(O)(OC-C 18 alkyl), C(O)(OC8-C 18 alkenyl), C(O)(NHC8-C 18 alkyl), and C(O)(NHC8-C 18 alkenyl), and C 12 -C 16 Alkyl, C 12 -C 16 Alkenyl, C(O)(OC 12 -C 16 alkyl), C(O)(OC 12 -C 16 alkenyl), C(O)(NHC 12 -C 16 alkyl), and C(O)(NHC 12 -C 16 alkenyl).

[0336] In some embodiments, n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; n1 is selected from 1, 2, 3, 4, 5, and 6; and n1 is selected from 2, 3, and 4.

[0337] In some embodiments, n1 is 3. In some embodiments of the present disclosure, the encapsulating agent is a compound of formula (EA-II):

[0338] [ka]

[0339] or a salt or isomer thereof, wherein: X 101 is a bond, NH, or O, R 101 and R 102 are each independently selected from the group consisting of H, C1-C6 alkyl, and C2-C6 alkenyl; R 103 and R 104 are each independently C1-C20 Alkyl and C2-C 20 alkenyl, and n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0340] In some embodiments, X 101 is a bond. In some embodiments, X 101 is NH. In some embodiments, X 101 is O.

[0341] In some embodiments, R 101 and R 102 are each independently selected from the group consisting of H and CH3. In some embodiments, R 103 is C1-C 20 Alkyl, C8-C 18 Alkyl, and C 12 -C 16 alkyl.

[0342] In some embodiments, R 104 is C1-C 20 Alkyl, C8-C 18 Alkyl, and C 12 -C 16 alkyl. In some embodiments, n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; n1 is selected from 1, 2, 3, 4, 5, and 6; and n1 is selected from 2, 3, and 4.

[0343] In some embodiments, n1 is 3. Exemplary encapsulating agents include, but are not limited to, ethyl lauroyl alginate, ethyl myristoyl alginate, ethyl palmitoyl alginate, ethyl cholesterol alginate, ethyl oleate alginate, ethyl caprate alginate, and ethyl caprylate alginate.

[0344] In certain embodiments, the encapsulating agent is ethyl lauroyl arginate.

[0345] [ka]

[0346] or a salt or isomer. In certain embodiments, the encapsulating agent is

[0347] [ka]

[0348] or salts and isomers thereof, such as free bases, TFA salts, and / or HCl salts. phospholipids Phospholipids may assemble into one or more lipid bilayers. Generally, phospholipids comprise a phospholipid moiety and one or more fatty acid moieties.

[0349] The phospholipid moiety can be selected from the non-limiting group consisting of, for example, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine, phosphatidic acid, 2-lysophosphatidylcholine, and sphingomyelin.

[0350] The fatty acid moiety can be selected from the non-limiting group consisting of, for example, lauric acid, myristic acid, myristoleic acid, palmitic acid, palmitoleic acid, stearic acid, oleic acid, linoleic acid, alpha-linolenic acid, erucic acid, phytanic acid, arachidic acid, arachidonic acid, eicosapentaenoic acid, behenic acid, docosapentaenoic acid, and docosahexaenoic acid.

[0351] Certain phospholipids can promote fusion with membranes. In some embodiments, cationic phospholipids can interact with one or more negatively charged phospholipids in membranes (e.g., cell membranes or intracellular membranes). The fusion of phospholipids with membranes allows one or more components (e.g., therapeutic agents) of lipid-containing compositions (e.g., LNPs) to pass through the membrane, for example, allowing one or more components to be delivered to target tissues.

[0352] Non-natural phospholipid species are also contemplated, including naturally occurring species with modifications and substitutions, including branching, oxidation, cyclization, and alkynes. In some embodiments, phospholipids can be functionalized or crosslinked with one or more alkynes (e.g., alkenyl groups in which one or more double bonds are replaced with triple bonds). Under appropriate reaction conditions, the alkyne groups can undergo copper-catalyzed cycloaddition upon exposure to azides. Such reactions can be useful for functionalizing the lipid bilayer of nanoparticle compositions to facilitate membrane permeation or cellular recognition, or for attaching nanoparticle compositions to useful components such as targeting or imaging moieties (e.g., dyes).

[0353] Phospholipids include, but are not limited to, glycerophospholipids such as phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidylglycerol, and phosphatidic acid. Phospholipids also include glycosphingolipids such as sphingomyelin.

[0354] In some embodiments, phospholipids useful or potentially useful in the present invention are analogs or variants of DSPC. In some embodiments, phospholipids useful or potentially useful in the present invention have the formula (PL-I):

[0355] [ka]

[0356] or a salt thereof, wherein Each R 1are independently optionally substituted alkyl, or optionally, two R 1 together with the intervening atoms form an optionally substituted monocyclic carbocyclyl or an optionally substituted monocyclic heterocyclyl, or optionally three R 1 together with the intervening atoms form an optionally substituted bicyclic carbocyclyl or an optionally substituted bicyclic heterocyclyl; n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is a group having the formula:

[0357] [ka]

[0358] and L 2 Each instance of is independently a bond or an optionally substituted C 1-6 alkylene, wherein optionally substituted C 1-6 One methylene unit of alkylene is -O-, -N(R N )-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, or -NR N C(O)N(R N )-, optionally replaced by Each instance of R2 independently represents an optionally substituted C 1-30 Alkyl, optionally substituted C 1-30 alkenyl, or optionally substituted C 1-30alkynyl, optionally wherein one or more methylene units of R2 are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NR N C(=NR N )-, -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NR N C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N )S(O)2O- are independently replaced by R Neach instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is 1 or 2; However, this compound has the formula:

[0359] [ka]

[0360] (In the formula, R 2 Each instance of is independently an unsubstituted alkyl, an unsubstituted alkenyl, or an unsubstituted alkynyl. It is not a compound of.

[0361] In some embodiments, the phospholipid can be one or more of the phospholipids described in US Patent Application No. 62 / 520,530. In some embodiments, the phospholipid is 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin. In some embodiments, the LNPs include DSPC. In some embodiments, the LNPs include DOPE. In some embodiments, the LNPs include both DSPC and DOPE.

[0362] i) Modification of phospholipid head groups In some embodiments, phospholipids useful or potentially useful in the present invention comprise a modified phospholipid head group (e.g., a modified choline group). In some embodiments, the phospholipid with the modified head group is DSPC or an analog thereof with a modified quaternary amine. In some embodiments, in embodiments of Formula (PL-I), R 1 At least one of R is not methyl. 1 In some embodiments, the compound of formula (PL-I) has the following formula:

[0363] [ka]

[0364] or a salt thereof, wherein each t is independently 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; each u is independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; Each v is independently 1, 2, or 3.

[0365] In some embodiments, the compound of formula (PL-I) has formula (PL-Ia):

[0366] [ka]

[0367] or a salt thereof. In some embodiments, the phospholipids useful or potentially useful in the present invention comprise a cyclic moiety instead of a glyceride moiety. In some embodiments, the phospholipids useful in the present invention are DSPC or analogs thereof with a cyclic moiety instead of a glyceride moiety. In some embodiments, the compound of formula (PL-I) has formula (PL-Ib):

[0368] [ka]

[0369] or a salt thereof. ii) Modification of phospholipid tails In some embodiments, the phospholipids useful or potentially useful in the present invention comprise a modified tail. In some embodiments, the phospholipids useful or potentially useful in the present invention are DSPC or analogs thereof with a modified tail. As described herein, a "modified tail" can be a shorter or longer aliphatic chain, a branched aliphatic chain, a substituted aliphatic chain, an aliphatic chain in which one or more methylenes are replaced with a cyclic or heteroatom group, or any combination thereof. In some embodiments, the compound of (PL-I) is a compound of formula (PL-Ia), or a salt thereof, wherein R 2 At least one example of 2 Each example of 1-30 alkyl, where R 2 one or more methylene units of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR N C(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NR N C(=NR N )-, -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NRN C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N )S(O)2O- are independently replaced by

[0370] In some embodiments, the compound of formula (PL-I) has formula (PL-Ic):

[0371] [ka]

[0372] or a salt thereof, wherein each x is independently an integer from 0 to 30, inclusive; and Each instance of G is independently selected from optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, -N(R N )-, -O-, -S-, -C(O)-, -C(O)N(R N )-, -NR N C(O)-, -NR N C(O)N(R N )-, -C(O)O-, -OC(O)-, -OC(O)O-, -OC(O)N(R N )-, -NR NC(O)O-, -C(O)S-, -SC(O)-, -C(=NR N )-, -C(=NR N )N(R N )-, -NR N C(=NR N )-, -NR N C(=NR N )N(R N )-, -C(S)-, -C(S)N(R N )-, -NR N C(S)-, -NR N C(S)N(R N )-, -S(O)-, -OS(O)-, -S(O)O-, -OS(O)O-, -OS(O)2-, -S(O)2O-, -OS(O)2O-, -N(R N )S(O)-, -S(O)N(R N )-, -N(R N )S(O)N(R N )-, -OS(O)N(R N )-, -N(R N )S(O)O-, -S(O)2-, -N(R N )S(O)2-, -S(O)2N(R N )-, -N(R N )S(O)2N(R N )-, -OS(O)2N(R N )-, or -N(R N )S(O)2O-. Each possibility represents a separate embodiment of the present invention.

[0373] In some embodiments, phospholipids useful or potentially useful in the present invention comprise a modified phosphocholine moiety, wherein the alkyl chain linking the quaternary amine to the phosphoryl group is not ethylene (e.g., n is not 2). Thus, in some embodiments, phospholipids useful or potentially useful in the present invention are compounds of formula (PL-I), where n is 1, 3, 4, 5, 6, 7, 8, 9, or 10. In some embodiments, compounds of formula (PL-I) have the following formula:

[0374] [ka]

[0375] or a salt thereof. Alternative lipids In some embodiments, alternative lipids are used in place of the phospholipids of the present disclosure. Non-limiting examples of such alternative lipids include:

[0376] [ka]

[0377] Adjuvants In some embodiments, LNPs comprising one or more lipids described herein may further comprise one or more adjuvants, such as glucopyranosyl lipid adjuvant (GLA), CpG oligodeoxynucleotide (e.g., class A or B), poly(I:C), aluminum hydroxide, and Pam3CSK4.

[0378] Treatment drugs The lipid nanoparticles can include one or more therapeutic and / or prophylactic agents, e.g., nucleic acids. The disclosure features methods for delivering a therapeutic and / or prophylactic agent, e.g., a nucleic acid, to a mammalian cell or organ, producing a polypeptide of interest in the mammalian cell, and treating a disease or disorder in a mammal in need thereof, comprising administering to the mammal LNPs containing the therapeutic and / or prophylactic agent and / or contacting mammalian cells with LNPs containing the therapeutic and / or prophylactic agent, e.g., a nucleic acid.

[0379] Therapeutic and / or prophylactic agents include biologically active substances, otherwise referred to as "active agents." Therapeutic and / or prophylactic agents can be substances that, when delivered to a cell or organ, effect a desired change in the cell, organ, or other body tissue or system. Such species can be useful in treating one or more diseases, disorders, or conditions. In some embodiments, the therapeutic and / or prophylactic agents are small molecule drugs useful in treating a particular disease, disorder, or condition. Examples of drugs useful in lipid nanoparticles include, but are not limited to, antitumor drugs (e.g., vincristine, doxorubicin, mitoxantrone, camptothecin, cisplatin, bleomycin, cyclophosphamide, methotrexate, and streptozotocin), anti-tumor agents (e.g., actinomycin D, vincristine, vinblastine, cystine arabinoside, anthracyclines, alkylating agents, platinum compounds, antimetabolites, and nucleoside analogs, e.g., methotrexate and purine and pyrimidine analogs), anti-infectives, local anesthetics (e.g., dibucaine and chlorpromazine), beta-adrenergic blockers (e.g., propranolol, timolol, and labetalol), antihypertensives (e.g., steroids, steroids, steroid hormone ... antihistamines (e.g., diphenylhydramine, chlorpheniramine, and promethazine), antibiotics / antibacterials (e.g., gentamicin, ciprofloxacin, and cefoxitin), antifungals (e.g., miconazole, terconazole, econazole, isoconazole, butoconazole, clotrimazole, itraconazole, nystatin, naftifine, and amphotericin B), antiparasitic agents, hormones, hormone antagonists, immunomodulators, neurotransmitter antagonists, antiglaucoma agents, vitamins, anesthetics, and imaging agents.

[0380] In some embodiments, the therapeutic and / or prophylactic agent is a cytotoxin, a radioactive ion, a chemotherapeutic agent, a vaccine, a compound that elicits an immune response, and / or another therapeutic and / or prophylactic agent. A cytotoxin or cytotoxic agent includes any agent that can be harmful to cells. Examples include, but are not limited to, taxol, cytochalasin B, gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicine, doxorubicin, daunorubicin, dihydroxyanthracenedione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, puromycin, maytansinoids, such as maytansinol, rachelmycin (CC-1065), and analogs or congeners thereof. Radioactive ions include, but are not limited to, iodine (e.g., iodine-125 or iodine-131), strontium-89, phosphorus, palladium, cesium, iridium, sulfate, cobalt, yttrium-90, samarium-153, and praseodymium. Vaccines include compounds and preparations capable of conferring immunization against one or more conditions associated with infectious diseases, such as influenza, measles, human papillomavirus (HPV), rabies, meningitis, whooping cough, tetanus, plague, hepatitis, and tuberculosis, and may include mRNA encoding antigens and / or epitopes derived from the infectious disease. Vaccines also include compounds and preparations that direct an immune response against cancer cells and may include mRNA encoding antigens, epitopes, and / or neoepitopes derived from tumor cells. Compounds that elicit an immune response may include, but are not limited to, vaccines, corticosteroids (e.g., dexamethasone), and other species.

[0381] In some embodiments, the therapeutic and / or prophylactic agent is a protein. Therapeutic proteins useful in the nanoparticles of the present disclosure include, but are not limited to, gentamicin, amikacin, insulin, erythropoietin (EPO), granulocyte colony-stimulating factor (G-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), factor VIR, luteinizing hormone-releasing hormone (LHRH) analogs, interferon, heparin, hepatitis B surface antigen, typhoid vaccine, and cholera vaccine. In some embodiments, the vaccine and / or compound capable of eliciting an immune response is administered intramuscularly via a composition comprising a compound of Formula (IL-I), (IL-IA), (IL-IB), (IL-II), (IL-IIa), (IL-IIb), (IL-IIc), (IL-IId), (IL-IIe), (IL-IIf), (IL-IIg), (IL-III), (IL-IIIa1), (IL-IIIa2), (IL-IIIa3), (IL-IIIa4), (IL-IIIa5), (IL-IIIa6), (IL-IIIa7), or (IL-IIIa8) (e.g., compound 3, 18, 20, 26, or 29). Other therapeutic and / or prophylactic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil dacarbazine), alkylating agents (e.g., mechlorethamine, thiotepa chlorambucil, rachelmycin (CC-1065), melphalan, carmustine (BSNU), lomustine (CCNU), cyclophosphamide, busulfan, dibromomannitol, streptozotocin, These include tocine, mitomycin C, and cis-dichlorodiamineplatinum(II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and antimitotic agents (e.g., vincristine, vinblastine, taxol, and maytansinoids).

[0382] Polynucleotides and Nucleic Acids In some embodiments, the therapeutic agent is a polynucleotide or nucleic acid (e.g., ribonucleic acid or deoxyribonucleic acid). The term "polynucleotide," in its broadest sense, includes any compound and / or substance that is or can be incorporated into an oligonucleotide strand. Exemplary polynucleotides for use in accordance with the present disclosure include, but are not limited to, one or more of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), including messenger mRNA (mRNA), hybrids thereof, RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, RNA that induces triple helix formation, aptamers, vectors, and the like. In some embodiments, the therapeutic and / or prophylactic agent is RNA. RNA useful in the compositions and methods described herein may be selected from the group consisting of, but not limited to, shortmers, antagomirs, antisense, ribozymes, small interfering RNAs (siRNAs), asymmetric interfering RNAs (aiRNAs), microRNAs (miRNAs), dicer substrate RNAs (dsRNAs), small hairpin RNAs (shRNAs), transfer RNAs (tRNAs), messenger RNAs (mRNAs), and mixtures thereof. In some embodiments, the RNA is mRNA.

[0383] In some embodiments, the therapeutic and / or prophylactic agent is an mRNA. The mRNA can encode any polypeptide of interest, including any natural or non-natural or modified polypeptide. The polypeptide encoded by the mRNA can be of any size and have any secondary structure or activity. In some embodiments, the polypeptide encoded by the mRNA can have a therapeutic effect when expressed in a cell.

[0384] In some embodiments, the therapeutic and / or prophylactic agent is an siRNA. The siRNA may be capable of selectively knocking down or downregulating the expression of a gene of interest. In some embodiments, the siRNA may be selected so that, when an LNP containing the siRNA is administered to a subject in need thereof, it silences a gene associated with a particular disease, disorder, or condition. The siRNA may comprise a sequence complementary to an mRNA sequence encoding the gene or protein of interest. In some embodiments, the siRNA may be an immunomodulatory siRNA.

[0385] In some embodiments, the therapeutic agent and / or prophylactic agent is shRNA or its encoding vector or plasmid.When appropriate construct is delivered to nucleus, shRNA can be produced inside target cell.The construct and mechanism related to shRNA are well known in the art.

[0386] Nucleic acids and polynucleotides useful in the present disclosure typically include a first region of linked nucleosides encoding a polypeptide of interest (e.g., a coding region), a first flanking region (e.g., a 5'-UTR) located at the 5' end of the first region, a second flanking region (e.g., a 3'-UTR) located at the 3' end of the first region, at least one 5'-cap region, and a 3'-stabilizing region. In some embodiments, the nucleic acid or polynucleotide further includes a poly-A region or a Kozak sequence (e.g., in the 5'-UTR). In some cases, the polynucleotide may contain one or more intronic nucleotide sequences that can be excised from the polynucleotide. In some embodiments, the polynucleotide or nucleic acid (e.g., mRNA) may include a 5'-cap structure, a chain-terminating nucleotide, a stem-loop, a polyA sequence, and / or a polyadenylation signal. Any one of the regions of the nucleic acid may include one or more modified components (e.g., modified nucleosides). In some embodiments, the 3'-stabilization region may contain modified nucleosides, e.g., L-nucleosides, reverse thymidines, or 2'-O-methyl nucleosides, and / or the coding region, 5'-UTR, 3'-UTR, or cap region may include modified nucleosides, e.g., 5-substituted uridines (e.g., 5-methoxyuridine), 1-substituted pseudouridines (e.g., 1-methyl-pseudouridine or 1-ethyl-pseudouridine), and / or 5-substituted cytidines (e.g., 5-methyl-cytidine).

[0387] In general, the shortest length of a polynucleotide may be a length of polynucleotide sequence sufficient to encode a dipeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tripeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a tetrapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a pentapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a hexapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a heptapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode an octapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a nonapeptide. In another embodiment, the length of the polynucleotide sequence is sufficient to encode a decapeptide.

[0388] Examples of dipeptides that the modified polynucleotide sequences can encode include, but are not limited to, carnosine and anserine. In some embodiments, the polynucleotide is greater than 30 nucleotides in length. In another embodiment, the polynucleotide molecule is greater than 35 nucleotides in length. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 50 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides.In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides. In another embodiment, the length is at least 4000 nucleotides. In another embodiment, the length is at least 5000 nucleotides or more than 5000 nucleotides.

[0389] Nucleic acids and polynucleotides may contain one or more naturally occurring nucleotides, including any of the standard nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine). In some embodiments, all or substantially all of the nucleotides comprising (a) the 5'-UTR, (b) the open reading frame (ORF), (c) the 3'-UTR, (d) the poly-A tail, and any combination of (a, b, c, or d above) contain the naturally occurring standard nucleotides A (adenosine), G (guanosine), C (cytosine), U (uridine), or T (thymidine).

[0390] Nucleic acids and polynucleotides may contain one or more alternative components described herein that confer useful properties, including improved stability and / or no substantial induction of an innate immune response in cells into which the polynucleotide is introduced. In some embodiments, the alternative polynucleotides or nucleic acids exhibit reduced degradation in cells into which the polynucleotide or nucleic acid is introduced, compared to the corresponding unmodified polynucleotide or nucleic acid. These alternative species can improve the efficiency of protein production, intracellular retention of the polynucleotide, and / or viability of contacted cells, as well as have reduced immunogenicity.

[0391] Polynucleotides and nucleic acids can be natural or non-natural. Polynucleotides and nucleic acids can contain one or more modifications (e.g., modified or alternative nucleobases, nucleosides, nucleotides, or combinations thereof). Nucleic acids and polynucleotides useful for LNPs can contain any useful modification or alteration, such as those to the nucleobase, sugar, or internucleoside linkage (e.g., linking phosphate / phosphodiester bond / phosphodiester backbone). In some embodiments, the modification (e.g., one or more modifications) is present in each of the nucleobase, sugar, and internucleoside linkage. Modifications according to the present disclosure can be modifications of ribonucleic acid (RNA) to deoxyribonucleic acid (DNA) (e.g., replacement of 2'-OH with 2'-H in a ribofuranosyl ring), threose nucleic acid (TNA), glycol nucleic acid (GNA), peptide nucleic acid (PNA), locked nucleic acid (LNA), or hybrids thereof. Additional modifications are described herein.

[0392] Polynucleotides and nucleic acids may be uniformly modified or non-uniformly modified along the entire length of the molecule. In some embodiments, one or more or all types of nucleotides (e.g., purines or pyrimidines, or one or more or all of A, G, U, C) may be uniformly modified or non-uniformly modified in a polynucleotide or nucleic acid, or in a given, predetermined sequence region thereof. In some cases, all nucleotides X in a polynucleotide (or in a given sequence region thereof) are modified, where X can be any one of the nucleotides A, G, U, C, or any one of the combinations A+G, A+U, A+C, G+U, G+C, U+C, A+G+U, A+G+C, G+U+C, or A+G+C.

[0393] Different sugar modifications and / or internucleoside linkages (e.g., backbone structures) can be present at various positions in a polynucleotide. It will be understood by those skilled in the art that nucleotide analogs or other modification(s) can be placed at any position(s) in a polynucleotide such that the function of the polynucleotide is not substantially diminished. Modifications can also be 5'- or 3'-terminal modifications. In some embodiments, a polynucleotide comprises a modification at the 3'-terminus. Polynucleotides may contain from about 1% to about 100% alternative nucleotides (relative to the total nucleotide content, or relative to one or more types of nucleotides, i.e., any one or more of A, G, U, or C), or any percentage in between (e.g., 1%-20%, 1%-25%, 1%-50%, 1%-60%, 1%-70%, 1%-80%, 1%-90%, 1%-95%, 10%-20%, 10%-25%, 10%-50%, 10%-60%, 10%-70%, 10%-80%, 10%-90%, It may contain 10% to 95%, 10% to 100%, 20% to 25%, 20% to 50%, 20% to 60%, 20% to 70%, 20% to 80%, 20% to 90%, 20% to 95%, 20% to 100%, 50% to 60%, 50% to 70%, 50% to 80%, 50% to 90%, 50% to 95%, 50% to 100%, 70% to 80%, 70% to 90%, 70% to 95%, 70% to 100%, 80% to 90%, 80% to 95%, 80% to 100%, 90% to 95%, 90% to 100%, and 95% to 100%). It will be understood that occurrences of standard nucleotides (eg, A, G, U, or C) may account for any remaining percentages.

[0394] A polynucleotide can contain a minimum of 0% and a maximum of 100% alternative nucleotides, or any percentage therebetween, e.g., at least 5% alternative nucleotides, at least 10% modified nucleotides, at least 25% alternative nucleotides, at least 50% alternative nucleotides, at least 80% alternative nucleotides, or at least 90% alternative nucleotides. For example, a polynucleotide can contain alternative pyrimidines, e.g., alternative uracils or cytosines. In some embodiments, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the uracils in a polynucleotide are substituted with modified uracils (e.g., 5-substituted uracils). The alternative uracils can be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures). In some cases, at least 5%, at least 10%, at least 25%, at least 50%, at least 80%, at least 90%, or 100% of the cytosines in a polynucleotide are substituted with alternative cytosines (e.g., 5-substituted cytosines). The alternative cytosines can be substituted with a compound having a single unique structure, or with multiple compounds having different structures (e.g., two, three, four, or more unique structures).

[0395] In some embodiments, the nucleic acid does not substantially induce an innate immune response in a cell into which the polynucleotide (e.g., mRNA) has been introduced, characterized by: 1) increased expression of pro-inflammatory cytokines, 2) activation of intracellular PRRs (e.g., RIG-I, MDA5, etc.), and / or 3) termination or reduction of protein translation.

[0396] The nucleic acid may optionally include other agents (e.g., RNAi-inducing agents, RNAi agents, siRNA, shRNA, miRNA, antisense RNA, ribozymes, catalytic DNA, tRNA, RNA that induces triple helix formation, aptamers, vectors). In some embodiments, the nucleic acid may include one or more messenger RNAs (mRNAs) with one or more alternative nucleosides or nucleotides (i.e., alternative mRNA molecules).

[0397] In some embodiments, the nucleic acid (e.g., mRNA) molecules, formulas, compositions, or methods related thereto are disclosed in WO2002 / 098443, WO2003 / 051401, WO2008 / 052770, WO2009127230, WO2006122828, WO2008 / 083949, WO2010088927, WO2010 / 037539, WO2004 / 004743, WO2005 / 016376, WO 2006 / 024518, WO2007 / 095976, WO2008 / 014979, WO2008 / 077592, WO2009 / 030481, WO2009 / 095226, WO201106958 6, WO2011026641, WO2011 / 144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811 , WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, W O2013 / 120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015 / 024669, W WO2015 / 024668, WO2015 / 024667, WO2015 / 024665, WO2015 / 024666, WO2015 / 024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416 (all of which are incorporated herein by reference).

[0398] Nucleobase substitutes Alternative nucleosides and nucleotides may include alternative nucleobases. The nucleobases of nucleic acids are organic bases, such as purines or pyrimidines or their derivatives. The nucleobases may be standard bases (e.g., adenine, guanine, uracil, thymine, and cytosine). These nucleobases may be modified or completely replaced to provide polynucleotide molecules with improved properties, such as improved stability, such as resistance to nucleases. Non-standard or modified bases may include one or more substitutions or modifications, including, but not limited to, alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and / or thio substitutions; one or more fused or open rings; oxidation; and / or reduction.

[0399] Alternative nucleotide base pairing encompasses not only canonical adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between alternative nucleotides, including nucleotides and / or non-standard or alternative bases, where the configuration of hydrogen bond donors and hydrogen bond acceptors allows for hydrogen bonding between the non-standard base and the standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is base pairing between the alternative nucleotide inosine and adenine, cytosine, or uracil.

[0400] In some embodiments, the nucleobase is a substituted uracil. Exemplary nucleobases and nucleosides having a substituted uracil include pseudouridine (ψ), pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U), 4-thio-uracil (s 4 U), 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U), 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil), 3-methyl-uracil (m 3 U), 5-methoxy-uracil (mo5 U), uracil 5-hydroxyacetic acid (cmo 5 U), uracil 5-hydroxyacetic acid methyl ester (mcmo 5 U), 5-carboxymethyl-uracil (cm 5 U), 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5 U), 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5 U), 5-methoxycarbonylmethyl-uracil (mcm 5 U), 5-methoxycarbonylmethyl-2-thiouracil (mcm 5 s 2 U), 5-aminomethyl-2-thio-uracil (nm 5 s 2 U), 5-methylaminomethyl-uracil (mnm 5 U), 5-methylaminomethyl-2-thiouracil (mnm 5 s 2 U), 5-methylaminomethyl-2-seleno-uracil (mnm 5 se 2 U), 5-carbamoylmethyl-uracil (ncm 5 U), 5-carboxymethylaminomethyl-uracil (cmnm 5 U), 5-carboxymethylaminomethyl-2-thiouracil (cmnm 5 s 2 U), 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5 U), 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 5 s 2 U), 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5 U, i.e., having the nucleobase deoxythymine), 1-methyl-pseudouridine (m 1 ψ), 1-ethyl-pseudouridine (Et 1 ψ), 5-methyl-2-thiouracil (m 5 s 2 U), 1-methyl-4-thio-pseudouridine (m1 s 4 ψ), 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3 ψ), 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D), dihydropseudouridine, 5,6-dihydrouracil, 5-methyl-dihydrouracil (m 5 D), 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3-(3-amino-3-carboxypropyl)uracil (acp 3 U), 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine (acp 3 ψ), 5-(isopentenylaminomethyl)uracil (inm 5 U), 5-(isopentenylaminomethyl)-2-thiouracil (inm 5 s 2 U), 5,2'-O-dimethyl-uridine (m 5 Um), 2-thio-2'-O_methyl-uridine (s 2 Um), 5-methoxycarbonylmethyl-2'-O-methyl-uridine (mcm 5 Um), 5-carbamoylmethyl-2'-O-methyl-uridine (ncm 5 Um), 5-carboxymethylaminomethyl-2'-O-methyl-uridine (cmnm 5 Um), 3,2'-O-dimethyl-uridine (m 3 Um), and 5-(isopentenylaminomethyl)-2'-O-methyl-uridine (inm 5Um), 1-thio-uracil, deoxythymidine, 5-(2-carbomethoxyvinyl)-uracil, 5-(carbamoylhydroxymethyl)-uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5-[3-(1-E-propenylamino)]uracil.

[0401] In some embodiments, the nucleobase is an alternative cytosine. Exemplary nucleobases and nucleosides having an alternative cytosine include, but are not limited to, 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (mC), N-acetyl-cytosine (acC), 5-formyl-cytosine (fC), N-methyl-cytosine (mC), 5-methyl-cytosine (mC), 5-halo-cytosine (e.g., 5-iodo- cytosine), 5-hydroxymethyl-cytosine (hm5C), 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C), 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza Pseudoisocytidine, Zebularine, 5-Aza-Zebularine, 5-Methyl-Zebularine, 5-Aza-2-Thio-Zebularine, 2-Thio-Zebularine, 2-Methoxy-Cytosine, 2-Methoxy-5-Methyl-Cytosine, 4-Methoxy-Pseudoisocytidine, 4-Methoxy-1-Methyl-Pseudoisocytidine, Lysidine (k2C), 5,2'-O-Dimethyl-Cytidine (m5Cm), N These include 4-acetyl-2'-O-methyl-cytidine (ac4Cm), N4,2'-O-dimethyl-cytidine (m4Cm), 5-formyl-2'-O-methyl-cytidine (f5Cm), N4,N4,2'-O-trimethyl-cytidine (m42Cm), 1-thio-cytosine, 5-hydroxy-cytosine, 5-(3-azidopropyl)-cytosine, and 5-(2-azidoethyl)-cytosine.

[0402] In some embodiments, the nucleobase is an adenine substitute. Exemplary nucleobases and nucleosides having an adenine substitute include, but are not limited to, 2-amino-purine, 2,6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine), 6-halo-purine (e.g., 6-chloro-purine), 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2,6-diaminopurine, 7 -Deaza-8-aza-2,6-diaminopurine, 1-methyl-adenine (m1A), 2-methyl-adenine (m2A), N6-methyl-adenine (m6A), 2-methylthio-N6-methyl-adenine (ms2m6A), N6-isopentenyl-adenine (i6A), 2-methylthio-N6-isopentenyl-adenine (ms2i6A), N6-(cis-hydroxyisopentenyl)adenine (io6A), 2-methylthio-N6-(cis-hydroxyisopentenyl)adenine (ms2io6A), N6-glycine Nylcarbamoyl-adenine (g6A), N6-threonylcarbamoyl-adenine (t6A), N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A), 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A), N6,N6-dimethyl-adenine (m62A), N6-hydroxynorvalylcarbamoyl-adenine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A), N6-acetyl-adenine (ac6A), 7-methyl Amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6-(19-amino-pentaoxanonadecyl)-adenine, 2,8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.

[0403] In some embodiments, the nucleobase is a guanine substitute. Exemplary nucleobases and nucleosides having a guanine substitute include, but are not limited to, inosine (I), 1-methyl-inosine (m1I), wyosine (imG), methylwyosine (mimG), 4-demethyl-wyosine (imG-14), isowyosine (imG2), wyobutosine (yW), peroxywyobutosine (o2yW), hydroxywyobutosine (OHyW), incompletely modified hydroxywyobutosine (OHyW*), 7-deaza-guanine, Queuosine (Q), epoxyqueousine (oQ), galactosyl-queousine (galQ), mannosyl-queousine (manQ), 7-cyano-7-deaza-guanine (preQ0), 7-aminomethyl-7-deaza-guanine (preQ1), archaeosine (G+), 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G), 6- Thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G), N2-methyl-guanine (m2G), N2,N2-dimethyl-guanine (m22G), N2,7-dimethyl-guanine (m2,7G), N2,N2,7-dimethyl-guanine (m2,2,7G), 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2,N2- These include dimethyl-6-thio-guanine, N2-methyl-2'-O-methyl-guanosine (m2Gm), N2,N2-dimethyl-2'-O-methyl-guanosine (m22Gm), 1-methyl-2'-O-methyl-guanosine (m1Gm), N2,7-dimethyl-2'-O-methyl-guanosine (m2,7Gm), 2'-O-methyl-inosine (Im), 1,2'-O-dimethyl-inosine (m1Im), 1-thio-guanine, and O-6-methyl-guanine.

[0404] The alternative nucleobase of a nucleotide can independently be a purine, a pyrimidine, a purine or pyrimidine analog. In some embodiments, the nucleobase can be an alternative to adenine, cytosine, guanine, uracil, or hypoxanthine. In another embodiment, the nucleobases can also include, for example, natural and synthetic derivatives of bases, including, but not limited to, pyrazolo[3,4-d]pyrimidine, 5-methylcytosine (5-me-C), 5-hydroxymethylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyluracil and cytosine, 6-azouracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo (e.g., 8-bromo), 8-amino, 8-thio ol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo, especially 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo[3,4-d]pyrimidine, imidazo[1,5-a]1,3,5 triazinone, 9-deazapurine, imidazo[4,5-d]pyrazine, thiazolo[4,5-d]pyrimidine, pyrazin-2-one, 1,2,4-triazine, pyridazine; or 1,3,5 triazine. When nucleotides are designated using the abbreviations A, G, C, T, or U, each letter refers to a representative base and / or its derivatives, e.g., A includes adenine or an adenine analog, e.g., 7-deazaadenine.

[0405] Modifications in sugars Nucleosides comprise a sugar molecule (e.g., a 5-carbon or 6-carbon sugar, such as pentose, ribose, arabinose, xylose, glucose, galactose, or deoxy derivatives thereof) in combination with a nucleobase, while nucleotides are nucleosides containing a nucleoside and a phosphate group or surrogate group (e.g., boranophosphate, thiophosphate, selenophosphate, phosphonate, alkyl group, amidate, and glycerol). The nucleoside or nucleotide can be a standard species, e.g., a nucleoside or nucleotide comprising a standard nucleobase, sugar, and, in the case of a nucleotide, a phosphate group, or can be an alternative nucleoside or nucleotide comprising one or more alternative moieties. In some embodiments, the alternative nucleosides and nucleotides can be modified in the sugar of the nucleoside or nucleotide. In some embodiments, the alternative nucleoside or nucleotide has the structure:

[0406] [ka]

[0407] In each of formulas IV, V, VI and VII: each of m and n is independently an integer of 0 to 5; Each of U and U′ is independently O, S, N(R U ) nu , or C(R U ) nu where nu is an integer from 0 to 2, and each R U is independently H, halo, or optionally substituted alkyl; R 1’ , R 2’ , R 1” , R 2” , R 1 , R 2 , R 3 , R 4 , and R 5each, if present, is independently H, halo, hydroxy, thiol, optionally substituted alkyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted aminoalkoxy, optionally substituted alkoxyalkoxy, optionally substituted hydroxyalkoxy, optionally substituted amino, azido, optionally substituted aryl, optionally substituted aminoalkyl, optionally substituted aminoalkenyl, optionally substituted aminoalkynyl, or absent; 3x and R 1’ , R 1” , R 2’ , R 2” , or R 5 combination with one or more of the following (e.g., R 1” and R 3x Combination of R 1” and R 3x Combination of R 2’ and R 3x Combination of R 2” and R 3x combination, or R 5x and R 3x (combination of) can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., bicyclic, tricyclic, or tetracyclic heterocyclyl), where R 5 and R 1’ , R 1” , R 2’ , or R 2” combination with one or more of the following (e.g., R 1’ and R 5 Combination of R 1” and R 5 Combination of R 2’ and R 5 combination, or R 2” and R 5(combination of) can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., bicyclic, tricyclic, or tetracyclic heterocyclyl), where R 4x and R 1’ , R 1” , R 2’ , R 2” , R 3 , or R 5 can be joined together to form an optionally substituted alkylene or an optionally substituted heteroalkylene, which, together with the carbons to which they are attached, provide an optionally substituted heterocyclyl (e.g., a bicyclic, tricyclic, or tetracyclic heterocyclyl), wherein each of m' and m" is independently an integer from 0 to 3 (e.g., 0 to 2, 0 to 1, 1 to 3, or 1 to 2); Y 1 , Y 2 , and Y 3 each independently represents O, S, Se, -NR N1 -, optionally substituted alkylene, or optionally substituted heteroalkylene, where R N1 is H, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted aryl, or absent; Each Y 4 are independently H, hydroxy, thiol, boranyl, optionally substituted alkyl, optionally substituted alkenyl, optionally substituted alkynyl, optionally substituted alkoxy, optionally substituted alkenyloxy, optionally substituted alkynyloxy, optionally substituted thioalkoxy, optionally substituted alkoxyalkoxy, or optionally substituted amino; Each Y 5is independently O, S, Se, optionally substituted alkylene (e.g., methylene), or optionally substituted heteroalkylene; B is either a modified or unmodified nucleobase.

[0408] In some embodiments, the 2'-hydroxy group (OH) can be modified or substituted with several different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, azido, halo (e.g., fluoro), optionally substituted C 1-6 Alkyl (e.g., methyl), optionally substituted C 1-6 Alkoxy (e.g., methoxy or ethoxy), optionally substituted C 6-10 Aryloxy; optionally substituted C 3-8 Cycloalkyl; optionally substituted C 6-10 Aryl-C 1-6 Alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; sugars (e.g., ribose, pentose, or any described herein), polyethylene glycol (PEG), -O(CH2CHO) n CH2CH2OR (wherein R is H or optionally substituted alkyl and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20)), "locked" nucleic acids (LNA) (wherein the 2'-hydroxy is 1-6 Alkylene or C 1-6 linked to the 4'-carbon of the same ribose sugar by a heteroalkylene bridge; exemplary bridges included methylene, propylene, ether, or amino bridges), aminoalkyl as defined herein, aminoalkoxy as defined herein, amino as defined herein; and amino acid as defined herein.

[0409] Generally, RNA contains the sugar group ribose, which is a five-membered ring with oxygen. Exemplary, non-limiting alternative nucleotides include substitution of oxygen in ribose (e.g., with S, Se, or alkylenes such as methylene or ethylene), addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., adding additional carbon atoms, such as anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (also having a phosphoramidate backbone)). or to form 6- or 7-membered rings with heteroatoms), polycyclic forms (e.g., tricyclic and "unlocked" forms such as glycol nucleic acids (GNAs) (e.g., R-GNAs or S-GNAs, in which the ribose is replaced by a glycol unit linked to a phosphodiester bond), threose nucleic acids (TNAs, in which the ribose is replaced by α-L-threofuranosyl-(3'→2')), and peptide nucleic acids (PNAs, in which a 2-amino-ethyl-glycine linkage replaces the ribose and phosphodiester backbone).

[0410] In some embodiments, the sugar group contains one or more carbons that have the opposite stereochemical configuration as the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides that contain, for example, arabinose or L-ribose as the sugar.

[0411] In some embodiments, the polynucleotide comprises at least one nucleoside, where the sugar is L-ribose, 2'-O-methyl-ribose, 2'-fluoro-ribose, arabinose, hexitol, LNA, or PNA.

[0412] Modifications in internucleoside linkages Alternative nucleotides can be modified in the internucleoside linkage (e.g., the phosphate backbone). As used herein, the terms "phosphate" and "phosphodiester" are used interchangeably with respect to the polynucleotide backbone. The backbone phosphate group can be modified by replacing one or more of the oxygen atoms with different substituents.

[0413] Alternative nucleotides may include large substitutions of unmodified phosphate moieties with alternative internucleoside linkages as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linked oxygens replaced by sulfur. Phosphate linkers can also be modified by replacing the linking oxygen with nitrogen (bridged phosphoramidates), sulfur (bridged phosphorothioates), and carbon (bridged methylene-phosphonates).

[0414] Alternative nucleosides and nucleotides may include replacement of one or more of the non-bridging oxygens with a borane moiety (BH3), sulfur (thio), methyl, ethyl, and / or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α), beta (β), or gamma (γ) position) may be replaced with sulfur (thio) and methoxy.

[0415] Substitution of one or more oxygen atoms at the α-position of the phosphate moiety (e.g., α-thiophosphate) provides for the non-natural phosphorothioate backbone linkages to confer stability (e.g., against exonucleases and endonucleases) to RNA and DNA. Phosphorothioate DNA and RNA have increased nuclease resistance and therefore a longer half-life in the cellular environment.

[0416] Other internucleoside linkages that can be used in accordance with the present disclosure are described herein, including internucleoside linkages that do not contain a phosphorus atom. Internal ribosome entry site A polynucleotide may contain an internal ribosome entry site (IRES). An IRES may act as the sole ribosome binding site or as one of multiple ribosome binding sites of an mRNA. A polynucleotide containing two or more functional ribosome binding sites may encode several peptides or polypeptides that are independently translated by the ribosome (e.g., a polycistronic mRNA). When a polynucleotide comprises an IRES, a second translatable region is optionally further provided. Examples of IRES sequences that can be used in accordance with the present disclosure include, but are not limited to, those derived from picornaviruses (e.g., FMDV), plague viruses (CFFV), polioviruses (PV), encephalomyocarditis viruses (ECMV), foot-and-mouth disease viruses (FMDV), hepatitis C virus (HCV), classical swine fever viruses (CSFV), murine leukemia viruses (MLV), simian immunodeficiency viruses (SIV), or cricket paralysis viruses (CrPV).

[0417] 5'-cap structure A polynucleotide (e.g., mRNA) can contain a 5'-cap structure. The 5'-cap structure of a polynucleotide is involved in nuclear export, enhances polynucleotide stability, and binds to mRNA cap-binding protein (CBP), which is involved in intracellular polynucleotide stability and translation competence via the binding of CBP to poly-A binding protein to form mature circular mRNA species. The cap also assists in the removal of 5'-proximal introns during mRNA splicing.

[0418] Endogenous polynucleotide molecules can be capped at the 5' end to form a 5'-ppp-5'-triphosphate linkage between the terminal guanosine cap residue of the polynucleotide and the 5'-terminal transcribed sense nucleotide. This 5'-guanylate cap can then be methylated to generate an N7-methyl-guanylate residue. The ribose sugar of the terminal and / or penultimate transcribed nucleotide at the 5' end of the polynucleotide can also optionally be 2'-O-methylated. 5'-cap removal by hydrolysis and cleavage of the guanylate cap structure can target degradation of polynucleotide molecules, such as mRNA molecules.

[0419] Modifications to polynucleotides can generate non-hydrolyzable cap structures to prevent cap removal and thereby increase polynucleotide half-life. Because cap structure hydrolysis requires cleavage of the 5'-ppp-5' phosphorodiester bond, alternative nucleotides can be used during the capping reaction. In some embodiments, vaccinia capping enzyme from New England Biolabs (Ipswich, MA) can be used with α-thio-guanosine nucleotides according to the manufacturer's instructions to form phosphorothioate linkages within the 5'-ppp-5' cap. Additional alternative guanosine nucleotides, such as α-methyl-phosphonate and seleno-phosphate nucleotides, can be used.

[0420] Further modifications include, but are not limited to, 2'-O-methylation (described above) of the ribose sugar of the 5'-terminus and / or penultimate nucleotide of the polynucleotide at the 2'-hydroxy group of the sugar. Several different 5'-cap structures can be used to create the 5'-cap of a polynucleotide, such as an mRNA molecule.

[0421] 5'-cap structures include those described in International Patent Publication Nos. WO2008127688, WO2008016473, and WO2011015347, each of which is incorporated herein by reference.

[0422] A cap analog, also referred to herein as a synthetic cap analog, chemical cap, chemical cap analog, or structural or functional cap analog, differs in its chemical structure from the natural (i.e., endogenous, wild-type, or physiological) 5'-cap while retaining cap function. Cap analogs can be synthesized / linked to a polynucleotide chemically (i.e., non-enzymatically) or enzymatically.

[0423] For example, an anti-reverse cap analog (ARCA) cap contains two guanosines linked by a 5'-5'-triphosphate group, where one guanosine contains an N7-methyl group and a 3'-O-methyl group (i.e., N7,3'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7G-3'mppp-G, which may also be referred to as 3'O-Me-m7G(5')ppp(5')G). The 3'-O atom of the other unmodified guanosine is linked to the 5'-terminal nucleotide of a capped polynucleotide (e.g., mRNA). The N7- and 3'-O-methylated guanosines provide the terminal portion of the capped polynucleotide (e.g., mRNA).

[0424] Another exemplary cap is mCAP, which is similar to ARCA but has a 2'-O-methyl group on the guanosine (i.e., N7,2'-O-dimethyl-guanosine-5'-triphosphate-5'-guanosine, m7Gm-ppp-G).

[0425] The cap can be a dinucleotide cap analog. As a non-limiting example, dinucleotide cap analogs, such as those described in U.S. Patent No. 8,519,110 (the cap structures of which are incorporated herein by reference), can be modified with boranophosphate or phosphoroselenoate groups at various phosphate positions.

[0426] Alternatively, the cap analog can be an N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analog known in the art and / or described herein. Non-limiting examples of N7-(4-chlorophenoxyethyl)-substituted dinucleotide cap analogs include N7-(4-chlorophenoxyethyl)-G(5')ppp(5')G and N7-(4-chlorophenoxyethyl)-m3'-OG(5')ppp(5')G cap analogs (see, e.g., the various cap analogs and methods for synthesizing cap analogs described in Kore et al. Bioorganic & Medicinal Chemistry 2013 21:4570-4574, the cap structures of which are incorporated herein by reference). In other cases, cap analogs useful in polynucleotides of the present disclosure are 4-chloro / bromophenoxyethyl analogs.

[0427] Although cap analogs allow for the simultaneous capping of polynucleotides in in vitro transcription reactions, up to 20% of transcripts remain uncapped. This, along with structural differences between the cap analog and the endogenous 5'-cap structure of polynucleotides produced by the endogenous cellular transcription machinery, can result in reduced translational efficiency and reduced cellular stability.

[0428] Alternative polynucleotides can also be post-transcriptionally capped using enzymes to create more authentic 5'-cap structures. As used herein, the phrase "more authentic" refers to features that structurally or functionally resemble or mimic endogenous or wild-type features. That is, a "more authentic" feature better represents endogenous, wild-type, native, or physiological cellular function and / or structure compared to prior art synthetic features or analogs, or outperforms the corresponding endogenous, wild-type, native, or physiological feature in one or more respects. Non-limiting examples of more authentic 5'-cap structures useful for polynucleotides of the present disclosure are those that have, among other things, increased binding of cap-binding proteins, increased half-life, reduced susceptibility to 5'-endonucleases, and / or decreased 5'-cap removal compared to synthetic 5'-cap structures (or wild-type, native, or physiological 5'-cap structures) known in the art. In some embodiments, the recombinant vaccinia virus capping enzyme and recombinant 2'-O-methyltransferase enzyme can form a standard 5'-5'-triphosphate linkage between the 5'-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide, where the cap guanosine comprises an N7-methylation and the 5'-terminal nucleotide of the polynucleotide comprises a 2'-O-methyl. Such a structure is referred to as a Cap 1 structure. This cap results in higher translational capacity, cellular stability, and reduced cellular pro-inflammatory cytokine activation, for example, compared to other 5'-cap analog structures known in the art. Other exemplary cap structures include 7mG(5')ppp(5')N,pN2p (cap 0), 7mG(5')ppp(5')NlmpNp (cap 1), 7mG(5')-ppp(5')NlmpN2mp (cap 2), and m(7)Gpppm(3)(6,6,2')Apm(2')Apm(2')Cpm(2)(3,2')Up (cap 4).

[0429] Because the alternative polynucleotides can be capped after transcription, and because this process is more efficient, nearly 100% of the alternative polynucleotides can be capped, as opposed to about 80% when the cap analog is ligated to the polynucleotide during the in vitro transcription reaction.

[0430] The 5'-end cap can comprise an endogenous cap or a cap analog. The 5'-end can comprise a guanosine analog. Useful guanosine analogs include inosine, N1-methyl-guanosine, 2'-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.

[0431] In some cases, the polynucleotide contains a modified 5'-cap. Modifications at the 5'-cap can increase the stability of the polynucleotide, increase the half-life of the polynucleotide, and increase the translation efficiency of the polynucleotide. Modified 5'-caps include, but are not limited to, one or more of the following modifications: a modification at the 2' and / or 3' position of the capped guanosine triphosphate (GTP), a sugar ring oxygen replacement with a methylene moiety (CH2) (thus creating a carbocyclic ring), a modification at the triphosphate bridge portion of the cap structure, or a modification at the nucleobase (G) portion.

[0432] 5'-UTR A 5'-UTR can be provided as a flanking region of a polynucleotide (e.g., mRNA). The 5'-UTR can be homologous or heterologous to the coding region found in the polynucleotide. Multiple 5'-UTRs can be included in a flanking region and can be of the same or different sequence. Any portion (including none) of a flanking region can be codon-optimized and, independently, can contain one or more different structural or chemical modifications before and / or after codon optimization.

[0433] Table 21 of U.S. Provisional Patent Application No. 61 / 775,509 and Tables 21 and 22 of U.S. Provisional Patent Application No. 61 / 829,372 (which are incorporated herein by reference) provide lists of alternative polynucleotide (e.g., mRNA) start and stop sites. In Table 21, each 5'-UTR (5'-UTR-005 to 5'-UTR 68511) is identified by its start and stop site relative to its native or wild-type (homologous) transcript (ENST; identification number used in the ENSEMBL database).

[0434] A 5'-UTR heterologous to the coding region of a modified polynucleotide (e.g., mRNA) can be engineered to alter one or more properties of the polynucleotide (e.g., mRNA). The polynucleotide (e.g., mRNA) can then be administered to a cell, tissue, or organism, and results such as protein levels, localization, and / or half-life can be measured to assess the beneficial effect the heterologous 5'-UTR may have over an alternative polynucleotide (mRNA). Variants of the 5'-UTR can be used in which one or more nucleotides, including A, T, C, or G, have been added to or removed from the terminus. The 5'-UTR can also be codon-optimized or modified by any of the methods described herein.

[0435] 5'-UTR, 3'-UTR, and translational enhancer element (TEE) The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least one translational enhancer element. The term "translational enhancer element" refers to a sequence that increases the amount of a polypeptide or protein produced from a polynucleotide. As a non-limiting example, a TEE may be located between the transcription promoter and the start codon. A polynucleotide (e.g., mRNA) having at least one TEE in its 5'-UTR may also contain a cap in the 5'-UTR. Furthermore, at least one TEE may be located in the 5'-UTR of a polynucleotide (e.g., mRNA) to effect cap-dependent or cap-independent translation.

[0436] In some embodiments, the TEE is a conserved element in the UTR that can facilitate translational activity of a polynucleotide, such as, but not limited to, cap-dependent or cap-independent translation. The conservation of these sequences has been previously demonstrated by Panek et al. (Nucleic Acids Research, 2013, 1-10) for 14 species, including humans.

[0437] In one non-limiting example, a known TEE can be in the 5'-leader of the Gtx homeodomain protein (Chappell et al., Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004, which TEE is incorporated herein by reference).

[0438] In another non-limiting example, TEEs are disclosed in U.S. Patent Publication Nos. 2009 / 0226470 and 2013 / 0177581, International Patent Publication Nos. WO2009 / 075886, WO2012 / 009644, and WO1999 / 024595, U.S. Patent Nos. 6,310,197 and 6,849,405, the respective TEE sequences of which are incorporated herein by reference.

[0439] In yet another non-limiting example, the TEE can be an internal ribosome entry site (IRES), HCV-IRES, or IRES element, such as, but not limited to, those described in U.S. Pat. No. 7,468,275, U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055369 (the respective IRES sequences of which are incorporated herein by reference). IRES elements include, but are not limited to, Gtx sequences (e.g., Gtx9-nt, Gtx8-nt, Gtx7-nt) described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), and in U.S. Patent Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication No. WO2007 / 025008 (the IRES sequences of each of which are incorporated herein by reference).

[0440] "Translation enhancer polynucleotides" are exemplified herein and / or disclosed in the art (e.g., U.S. Pat. Nos. 6,310,197, 6,849,405, 7,456,273, 7,183,395, U.S. Patent Application Publication Nos. 20090 / 226470, 2007 / 0048776, 2011 / 0124100, 2009 / 009304, etc.). See International Patent Publication Nos. WO2009 / 075886, WO2007 / 025008, WO2012 / 009644, WO2001 / 055371, WO1999 / 024595, and European Patent Nos. 2610341 and 2610340 (the TEE sequences of each of which are incorporated herein by reference). A polynucleotide containing a specific TEE may be a polynucleotide containing a homolog, homolog, or functional derivative thereof. One or more copies of a specific TEE may be present in a polynucleotide (e.g., mRNA). A TEE in a translational enhancer polynucleotide may be composed of one or more sequence segments. A sequence segment may possess one or more of the specific TEEs exemplified herein, with each TEE being present in one or more copies. When multiple sequence segments are present in a translational enhancer polynucleotide, they may be homologous or heterologous. Thus, multiple sequence segments in a translational enhancer polynucleotide may possess the same or different types of the specific TEEs exemplified herein, the same or different numbers of copies of each of the specific TEEs, and / or the same or different configurations of TEEs within each sequence segment.

[0441] Polynucleotides (e.g., mRNA) can be prepared using methods described in International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, WO2007 / 025008, WO1999 / 024595, European Patent Publication Nos. 2610341 and 2610340, U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,222, and the like. 73, 7,183,395, and U.S. Patent Application Publication Nos. 2009 / 0226470, 2011 / 0124100, 2007 / 0048776, 2009 / 0093049, and 2013 / 0177581 (the TEE sequences of each of which are incorporated herein by reference). The TEE may be located in the 5'-UTR of a polynucleotide (e.g., an mRNA).

[0442] Polynucleotides (e.g., mRNA) can be prepared using methods described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, U.S. Patent Nos. 6,310,197, 6,310,198, 6,310,19 ... The TEE may include at least one TEE having at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identity to a TEE described in US Pat. Nos. 7,849,405, 7,456,273 and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0443] The 5'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 5'-UTR of a polynucleotide (e.g., mRNA) may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0444] In some cases, the 5'-UTR can include a spacer separating the two TEE sequences. As a non-limiting example, the spacer can be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 5'-UTR can include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 5'-UTR.

[0445] In other cases, the spacer separating the two TEE sequences may include other sequences known in the art that can regulate translation of a polynucleotide (e.g., an mRNA) of the present disclosure, such as, but not limited to, an miR sequence (e.g., an miR binding site and an miR seed). As a non-limiting example, each spacer used to separate the two TEE sequences may include a different miR sequence or component of a miR sequence (e.g., an miR seed sequence).

[0446] In some cases, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) can be selected from the group consisting of those described in U.S. Patent Application Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100, International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008, European Patent Publication Nos. 2610341 and 2610340, and U.S. Patent Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (each of which TEE sequences are incorporated herein by reference) at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99% or more than 99% of the TEE sequences disclosed in the above-mentioned US Pat. In another embodiment, the TEE in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure is selected from the group consisting of those described in U.S. Patent Publication Nos. 2009 / 0226470, 2007 / 0048776, 2013 / 0177581, and 2011 / 0124100; International Patent Publication Nos. WO1999 / 024595, WO2012 / 009644, WO2009 / 075886, and WO2007 / 025008; European Patent Publication No. 26 The TEE sequences may include 5-30 nucleotide fragments, 5-25 nucleotide fragments, 5-20 nucleotide fragments, 5-15 nucleotide fragments, and 5-10 nucleotide fragments of the TEE sequences disclosed in U.S. Pat. Nos. 10341 and 2610340, and U.S. Pat. Nos. 6,310,197, 6,849,405, 7,456,273, and 7,183,395 (the TEE sequences of each of which are incorporated herein by reference).

[0447] In some cases, the TEE in the 5′-UTR of a polynucleotide (e.g., mRNA) of the disclosure may be selected from the group consisting of TEEs described by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), and Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature The TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by NIH (Natl. Methods, 2013; DOI: 10.1038 / NMETH.2522) (each of which TEE sequences is incorporated herein by reference) may comprise at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or more than 99% of the TEE sequences disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by NIH (Natl. Methods, 2013; DOI: 10.1038 / NMETH.2522) (each of which TEE sequences is incorporated herein by reference). In another embodiment, a TEE in the 5'-UTR of a polynucleotide (e.g., an mRNA) of the present disclosure can include a 5-30 nucleotide fragment, a 5-25 nucleotide fragment, a 5-20 nucleotide fragment, a 5-15 nucleotide fragment, or a 5-10 nucleotide fragment of a TEE sequence disclosed in Supplementary Table 1 and Supplementary Table 2 disclosed by Chappell et al. (Proc. Natl. Acad. Sci. USA 101:9590-9594, 2004) and Zhou et al. (PNAS 102:6273-6278, 2005), and Wellensiek et al. (Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013; DOI:10.1038 / NMETH.2522) (each of which TEE sequences is incorporated herein by reference).

[0448] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is an IRES sequence, such as, but not limited to, those described in U.S. Pat. No. 7,468,275 and International Patent Publication No. WO2001 / 055369 (the TEE sequences of each of which are incorporated herein by reference).

[0449] In some cases, TEEs used in the 5'-UTR of a polynucleotide (e.g., mRNA) can be identified by the methods described in U.S. Patent Application Publication Nos. 2007 / 0048776 and 2011 / 0124100 and International Patent Publication Nos. WO2007 / 025008 and WO2012 / 009644, each of which is incorporated herein by reference.

[0450] In some cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be a transcriptional regulatory element described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371, the TEE sequences of each of which are incorporated herein by reference. Transcriptional regulatory elements may be identified by methods known in the art, such as, but not limited to, the methods described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371, the TEE sequences of each of which are incorporated herein by reference.

[0451] In still other cases, the TEE used in the 5'-UTR of a polynucleotide (e.g., mRNA) is a polynucleotide or portion thereof described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication No. 2009 / 0093049, and International Publication No. WO2001 / 055371 (the TEE sequences of each of which are incorporated herein by reference).

[0452] A 5'-UTR comprising at least one TEE described herein can be incorporated into a monocistronic sequence, such as, but not limited to, a vector system or a polynucleotide vector. By way of non-limiting example, vector systems and polynucleotide vectors can include those described in U.S. Patent Nos. 7,456,273 and 7,183,395, U.S. Patent Application Publication Nos. 2007 / 0048776, 2009 / 0093049 and 2011 / 0124100, and International Patent Publication Nos. WO2007 / 025008 and WO2001 / 055371 (the TEE sequences of each of which are incorporated herein by reference).

[0453] The TEEs described herein can be located in the 5'-UTR and / or 3'-UTR of a polynucleotide (e.g., mRNA). A TEE located in the 3'-UTR can be the same and / or different from a TEE located in the 5'-UTR and / or described for incorporation into the 5'-UTR.

[0454] In some cases, the 3'-UTR of a polynucleotide (e.g., mRNA) may contain at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, or more than 60 TEE sequences. The TEE sequences in the 3'-UTR of a polynucleotide (e.g., mRNA) of the present disclosure may be the same or different TEE sequences. The TEE sequences may be in a pattern such as ABABAB, AABBAABBAABB, or ABCABCABC, or variations thereof, repeated once, twice, or more than three times. In these patterns, each letter A, B, or C represents a different TEE sequence at the nucleotide level.

[0455] In one example, the 3'-UTR can include a spacer separating the two TEE sequences. As a non-limiting example, the spacer can be a 15-nucleotide spacer and / or other spacers known in the art. As another non-limiting example, the 3'-UTR can include a TEE sequence-spacer module that is repeated at least once, at least twice, at least three times, at least four times, at least five times, at least six times, at least seven times, at least eight times, at least nine times, or ten or more times in the 3'-UTR.

[0456] In other cases, the spacer separating the two TEE sequences can include other sequences known in the art that can regulate translation of a polynucleotide (e.g., an mRNA) of the present disclosure, such as, but not limited to, the miR sequences described herein (e.g., miR binding sites and miR seeds). As a non-limiting example, each spacer used to separate the two TEE sequences can include a different miR sequence or component of a miR sequence (e.g., a miR seed sequence).

[0457] In some embodiments, a polyribonucleotide of the present disclosure comprises an miR and / or a TEE sequence. In some embodiments, incorporation of an miR sequence and / or a TEE sequence into a polyribonucleotide of the present disclosure alters the shape of the stem-loop region, which may increase and / or decrease translation (see, e.g., Kedde et al., Nature Cell Biology 2010 12(10):1014-20, incorporated herein by reference in its entirety).

[0458] Sensor sequences and microRNA (miRNA) binding sites Sensor sequences include, for example, microRNA (miRNA) binding sites, transcription factor binding sites, structured mRNA sequences and / or motifs, artificial binding sites engineered to act as pseudo-receptors for endogenous nucleic acid binding molecules, and combinations thereof. Non-limiting examples of sensor sequences are described in U.S. Publication No. 2014 / 0200261, the contents of which are incorporated herein by reference in their entirety.

[0459] In some embodiments, a polyribonucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) of the present disclosure comprising an open reading frame (ORF) encoding a polypeptide further comprises a sensor sequence. In some embodiments, the sensor sequence is an miRNA binding site.

[0460] miRNAs are non-coding RNAs 19-25 nucleotides in length that downregulate gene expression by binding to polyribonucleotides and reducing their stability or inhibiting their translation. The miRNA sequence comprises a "seed" region, i.e., a sequence within positions 2-8 of a mature miRNA. The miRNA seed can comprise positions 2-8 or 2-7 of a mature miRNA. In some embodiments, the miRNA seed can comprise 7 nucleotides (e.g., nucleotides 2-8 of a mature miRNA), and the seed-complementary portion of the corresponding miRNA-binding site is flanked by an adenosine (A) opposite position 1 of the miRNA. In some embodiments, the miRNA seed can comprise 6 nucleotides (e.g., nucleotides 2-7 of a mature miRNA), and the seed-complementary portion of the corresponding miRNA-binding site is flanked by an adenosine (A) opposite position 1 of the miRNA. See, e.g., Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP, Bartel DP; Mol Cell. 2007 Jul 6;27(1):91-105. MiRNA profiling of target cells or tissues can be performed to determine the presence or absence of miRNAs in the cells or tissues. In some embodiments, polyribonucleotides (e.g., ribonucleic acid (RNA), e.g., messenger RNA (mRNA)) of the present disclosure comprise one or more microRNA target sequences, microRNA sequences, or microRNA seeds. Such sequences can correspond to any known microRNA, such as those taught in U.S. Patent Publication No. 2005 / 0261218 and U.S. Patent Publication No. 2005 / 0059005, the contents of each of which are incorporated herein by reference in their entireties.

[0461] As used herein, the term "microRNA (miRNA or miR) binding site" refers to a sequence within a polyribonucleotide, e.g., within a DNA or RNA transcript, including a 5' UTR and / or a 3' UTR, that has sufficient complementarity to all or a region of a miRNA to interact with, bind to, or be bound by the miRNA. In some embodiments, a polyribonucleotide of the present disclosure that includes an ORF encoding a polypeptide further comprises a miRNA binding site. In exemplary embodiments, the 5' UTR and / or 3' UTR of a polyribonucleotide (e.g., a ribonucleic acid (RNA), e.g., a messenger RNA (mRNA)) comprises a miRNA binding site.

[0462] An miRNA binding site having sufficient complementarity to an miRNA refers to a sufficient degree of complementarity to promote miRNA-mediated regulation of polyribonucleotides, e.g., miRNA-mediated translational repression or degradation of polyribonucleotides. In exemplary embodiments of the present disclosure, an miRNA binding site having sufficient complementarity to an miRNA refers to a sufficient degree of complementarity to promote miRNA-mediated degradation of polyribonucleotides, e.g., miRNA-guided RNA-induced silencing complex (RISC)-mediated cleavage of mRNA. The miRNA binding site may be complementary to, for example, a 19-25 nucleotide miRNA sequence, a 19-23 nucleotide miRNA sequence, or a 22 nucleotide miRNA sequence. The miRNA binding site may be complementary to only a portion of the miRNA, e.g., less than 1, 2, 3, or 4 nucleotides of the full length of a naturally occurring miRNA sequence. When the desired regulation is mRNA degradation, full or complete complementarity (e.g., full complementarity or complete complementarity across all or a substantial portion of the length of a naturally occurring miRNA) is preferred.

[0463] In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA seed sequence. In some embodiments, the miRNA binding site comprises a sequence that has complementarity (e.g., partial or complete complementarity) with the miRNA sequence. In some embodiments, the miRNA binding site comprises a sequence that has complete complementarity with the miRNA sequence. In some embodiments, the miRNA binding site has complete complementarity to the miRNA sequence but with one, two, or three nucleotide substitutions, tail additions, and / or truncations.

[0464] In some embodiments, the miRNA binding site is the same length as the corresponding miRNA. In other embodiments, the miRNA binding site is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 nucleotides shorter than the corresponding miRNA at the 5' end, 3' end, or both. In still other embodiments, the microRNA binding site is 2 nucleotides shorter than the corresponding microRNA at the 5' end, 3' end, or both. A miRNA binding site that is shorter than the corresponding miRNA can still degrade mRNA that incorporates one or more miRNA binding sites or prevent translation of the mRNA.

[0465] In some embodiments, the miRNA-binding site binds to a corresponding mature miRNA that is part of an active RISC that includes Dicer. In another embodiment, binding of the miRNA-binding site to the corresponding miRNA in the RISC degrades the mRNA containing the miRNA-binding site or prevents the mRNA from being translated. In some embodiments, the miRNA-binding site has sufficient complementarity with the miRNA such that the RISC complex containing the miRNA cleaves the polyribonucleotide containing the miRNA-binding site. In some embodiments, the miRNA-binding site has imperfect complementarity such that the RISC complex containing the miRNA induces instability in the polyribonucleotide containing the miRNA-binding site. In another embodiment, the miRNA-binding site has imperfect complementarity such that the RISC complex containing the miRNA represses transcription of the polyribonucleotide containing the miRNA-binding site.

[0466] In some embodiments, the miRNA binding site has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 mismatches from the corresponding miRNA. In some embodiments, the miRNA binding site has at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides complementary to at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, or at least about 21 contiguous nucleotides of the corresponding miRNA, respectively.

[0467] By engineering one or more miRNA binding sites into the polyribonucleotide of the present disclosure, the polyribonucleotide can be targeted for degradation or reduced translation if the miRNA of interest is available. This can reduce off-target effects during polyribonucleotide delivery. In some embodiments, if the polyribonucleotide of the present disclosure is not intended to be delivered to a tissue or cell, but ends up there, abundant miRNAs in that tissue or cell can inhibit the expression of a gene of interest if one or more miRNA binding sites are engineered into the 5'UTR and / or 3'UTR of the polyribonucleotide.

[0468] Conversely, miRNA binding sites can be removed from naturally occurring polyribonucleotide sequences to increase protein expression in particular tissues. In some embodiments, binding sites for specific miRNAs can be removed from polyribonucleotides to improve protein expression in tissues or cells that contain the miRNA.

[0469] In some embodiments, polyribonucleotides of the present disclosure can contain at least one miRNA binding site in the 5'UTR and / or 3'UTR to target cytotoxic or cytoprotective mRNA therapeutics to specific cells, such as, but not limited to, normal and / or cancerous cells. In other embodiments, polyribonucleotides of the present disclosure can contain two, three, four, five, six, seven, eight, nine, ten, or more miRNA binding sites in the 5'-UTR and / or 3'-UTR to target cytotoxic or cytoprotective mRNA therapeutics to specific cells, such as, but not limited to, normal and / or cancerous cells.

[0470] Modulation of expression in multiple tissues can be achieved by introducing or removing one or more miRNA binding sites. The decision to remove or insert miRNA binding sites can be made based on miRNA expression patterns and / or disease profiling. The identification of miRNAs, miRNA binding sites, and their expression patterns and roles in biology have been reported (e.g., Bonauer et al., Curr Drug Targets 2010 11:943-949; Anand and Cheresh Curr Opin Hematol 2011 18:171-176; Contreras and Rao Leukemia 2012 26:404-413 (2011 Dec 20. doi:10.1038 / leu.2011.356); Bartel Cell 2009 136:215-233; Landgraf et al., Cell, 2007 129:1401-1414; Gentner and Naldini, Tissue Antigens. 2012 80:393-403, and citations therein, each of which is incorporated herein by reference in its entirety).

[0471] The miRNA and miRNA binding sites can correspond to any known sequences, including non-limiting examples described in U.S. Publication Nos. 2014 / 0200261, 2005 / 0261218, and 2005 / 0059005, each of which is incorporated by reference in its entirety.

[0472] Examples of tissues in which miRNAs are known to regulate mRNA and thereby protein expression include, but are not limited to, liver (miR-122), muscle (miR-133, miR-206, miR-208), endothelial cells (miR-17-92, miR-126), bone marrow cells (miR-142-3p, miR-142-5p, miR-16, miR-21, miR-223, miR-24, miR-27), adipose tissue (let-7, miR-30c), heart (miR-ld, miR-149), kidney (miR-192, miR-194, miR-204), and lung epithelial cells (let-7, miR-133, miR-126).

[0473] Specifically, miRNAs are known to be differentially expressed in immune cells (also called hematopoietic cells), such as antigen-presenting cells (APCs) (e.g., dendritic cells and macrophages), macrophages, monocytes, B lymphocytes, T lymphocytes, granulocytes, and natural killer cells. Immune cell-specific miRNAs are involved in immunogenicity, autoimmunity, immune responses to infection, inflammation, and undesirable immune responses after gene therapy and tissue / organ transplantation. Immune cell-specific miRNAs also regulate many aspects of hematopoietic cell (immune cell) development, proliferation, differentiation, and apoptosis. In some embodiments, miR-142 and miR-146 are expressed exclusively in immune cells and are particularly abundant in myeloid dendritic cells. It has been demonstrated that adding miR-142 binding sites to the 3'-UTR of polyribonucleotides can block immune responses to polyribonucleotides, enabling more stable gene transfer within tissues and cells. miR-142 efficiently degrades exogenous polyribonucleotides in antigen-presenting cells and suppresses cytotoxic elimination of transduced cells (e.g., Annoni A et al., Blood, 2009, 114, 5152-5161; Brown BD, et al., Nat med. 2006, 12(5), 585-591; Brown BD, et al., Blood, 2007, 110(13):4144-4152, each of which is incorporated herein by reference in its entirety).

[0474] An antigen-mediated immune response can refer to an immune response elicited by a foreign antigen, which, upon entering an organism, is processed by antigen-presenting cells and displayed on their surface. T cells can recognize the presented antigen and induce cytotoxic elimination of cells expressing the antigen.

[0475] Introducing a miR-142 binding site into the 5'UTR and / or 3'UTR of the polyribonucleotide of the present disclosure can selectively suppress gene expression in antigen-presenting cells through miR-142-mediated degradation, limiting antigen presentation by antigen-presenting cells (e.g., dendritic cells), thereby preventing antigen-mediated immune responses after delivery of the polyribonucleotide. The polyribonucleotide is stably expressed in target tissues or cells without inducing cytotoxic clearance.

[0476] In some embodiments, binding sites for miRNAs known to be expressed in immune cells, particularly antigen-presenting cells, can be engineered into the polyribonucleotides of the present disclosure, thereby suppressing expression of the polyribonucleotides in antigen-presenting cells through miRNA-mediated RNA degradation and suppressing antigen-mediated immune responses. Expression of the polyribonucleotides is maintained in non-immune cells that do not express immune cell-specific miRNAs. In some embodiments, to prevent immunogenic responses to liver-specific proteins, the miR-122 binding site can be removed and miR-142 (and / or miR-146) binding sites can be engineered into the 5'UTR and / or 3'UTR of the polyribonucleotides of the present disclosure.

[0477] To further promote the selective degradation and suppression of APCs and macrophages, the polyribonucleotides of the present disclosure can include additional negative regulatory elements in the 5'UTR and / or 3'UTR, either alone or in combination with the miR-142 and / or miR-146 binding sites. As a non-limiting example, the additional negative regulatory element is a constitutive attenuation element (CDE).

[0478] Immune cell-specific miRNAs include hsa-let-7a-2-3p, hsa-let-7a-3p, hsa-7a-5p, hsa-let-7c, hsa-let-7e-3p, hsa-let-7e-5p, hsa-let-7g-3p, hsa-let-7g-5p, hsa-let-7i-3p, hsa-let-7i-5p, miR-10a-3p, miR-10a-5p, miR-1184, hsa-let-7f-l-3p, hsa-let-7f-2-5p, hsa-let-7f-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1279, miR-130a-3p, miR-130a-5p, miR-132-3p, miR-132-5p, miR-142-3p, miR-142-5p, miR-143-3p, miR-143-5p, miR-146a-3p, miR-146a-5p, miR-146b-3p, miR-146b-5p, miR-147a, miR-147b, miR-148a-5p, miR-148a-3p, miR-150-3p, miR-150-5p, miR-151b, miR-155-3p, miR-155-5p, miR-15a-3p, miR-15a-5p, miR-15b-5p, miR-15b-3p, miR-16-1-3p, miR-16-2-3p, miR-16-5p, miR-17-5p, miR-181a-3p, miR-181a-5p, miR-181a-2-3p, miR-182-3p, miR-182-5p, miR-197-3p, miR-197-5p, miR-21-5p, miR-21-3p, miR-214-3p, miR-214-5p, miR-223-3p, miR-223-5p, miR-221-3p, miR-221-5p, miR-23b-3p, miR-23b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-26a-1-3p, miR-26a-2-3p, miR-26a-5p, miR-26b-3p, miR-26b-5p, miR-27a-3p, miR-27a-5p, miR-27b-3p, miR-27b-5p, miR-28-3p, miR-28-5p, miR-2909, miR-29a-3p, miR-29a-5p, miR-29b-1-5p, miR-29b-2-5p,miR-29c-3p, miR-29c-5p, miR-30e-3p, miR-30e-5p, miR-331-5p, miR-339-3p, miR-339-5p, miR-345-3p, m iR-345-5p, miR-346, miR-34a-3p, miR-34a-5p, miR-363-3p, miR-363-5p, miR-372, miR-377-3p, miR-377-5 These include, but are not limited to, miR-493-3p, miR-493-5p, miR-542, miR-548b-5p, miR-548c-5p, miR-548i, miR-548j, miR-548n, miR-574-3p, miR-598, miR-718, miR-935, miR-99a-3p, miR-99a-5p, miR-99b-3p, and miR-99b-5p. Furthermore, novel miRNAs can be identified in immune cells by microarray hybridization and microtome analysis (e.g., Jima DD et al., Blood, 2010, 116:el 18-el27; Vaz C et al., BMC Genomics, 2010, 11, 288; the contents of each of which are incorporated herein by reference in their entirety). ,

[0479] miRNAs known to be expressed in the liver include, but are not limited to, miR-107, miR-122-3p, miR-122-5p, miR-1228-3p, miR-1228-5p, miR-1249, miR-129-5p, miR-1303, miR-151a-3p, miR-151a-5p, miR-152, miR-194-3p, miR-194-5p, miR-199a-3p, miR-199a-5p, miR-199b-3p, miR-199b-5p, miR-296-5p, miR-557, miR-581, miR-939-3p, and miR-939-5p. The miRNA binding site from any liver-specific miRNA can be introduced into or removed from the polyribonucleotide of the present disclosure to regulate the expression of the polyribonucleotide in the liver. The liver-specific miRNA binding site can be engineered alone or in combination with the immune cell (e.g., APC) miRNA binding site in the polyribonucleotide of the present disclosure.

[0480] miRNAs known to be expressed in the lung include let-7a-2-3p, let-7a-3p, let-7a-5p, miR-126-3p, miR-126-5p, miR-127-3p, miR-127-5p, miR-130a-3p, miR-130a-5p, miR-130b-3p, miR-130b-5p, miR-133a, miR-133b, miR-134, These include, but are not limited to, miR-18a-3p, miR-18a-5p, miR-18b-3p, miR-18b-5p, miR-24-1-5p, miR-24-2-5p, miR-24-3p, miR-296-3p, miR-296-5p, miR-32-3p, miR-337-3p, miR-337-5p, miR-381-3p, and miR-381-5p. The miRNA binding site from any lung-specific miRNA can be introduced into or removed from the polyribonucleotide of the present disclosure to regulate the expression of the polyribonucleotide in the lung. The lung-specific miRNA binding site can be modified alone or in combination with the immune cell (e.g., APC) miRNA binding site in the polyribonucleotide of the present disclosure.

[0481] miRNAs known to be expressed in the heart include, but are not limited to, miR-1, miR-133a, miR-133b, miR-149-3p, miR-149-5p, miR-186-3p, miR-186-5p, miR-208a, miR-208b, miR-210, miR-296-3p, miR-320, miR-451a, miR-451b, miR-499a-3p, miR-499a-5p, miR-499b-3p, miR-499b-5p, miR-744-3p, miR-744-5p, miR-92b-3p, and miR-92b-5p. The miRNA binding site from any cardiac-specific microRNA can be introduced or removed from the polyribonucleotide of the present disclosure to regulate the expression of the polyribonucleotide in the heart.The cardiac-specific miRNA binding site can be engineered alone or in combination with the immune cell (e.g., APC) miRNA binding site in the polyribonucleotide of the present disclosure.

[0482] MiRNAs known to be expressed in the nervous system include miR-124-5p, miR-125a-3p, miR-125a-5p, miR-125b-1-3p, miR-125b-2-3p, miR-125b-5p, miR-1271-3p, miR-1271-5p, miR-128, miR-132-5p, miR-135a-3p, miR-135a-5p, miR-135b-3p, and miR-13 5b-5p, miR-137, miR-139-5p, miR-139-3p, miR-149-3p, miR-149-5p, miR-153, miR-181c-3p, miR-181c-5p, mi R-183-3p, miR-183-5p, miR-190a, miR-190b, miR-212-3p, miR-212-5p, miR-219-1-3p, miR-219-2-3p, miR-23a -3p, miR-23a-5p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR-30c-5p, miR-30d -3p, miR-30d-5p, miR-329, miR-342-3p, miR-3665, miR-3666, miR-380-3p, miR-380-5p, miR-383, miR-410, miR These include, but are not limited to, miR-425-3p, miR-425-5p, miR-454-3p, miR-454-5p, miR-483, miR-510, miR-516a-3p, miR-548b-5p, miR-548c-5p, miR-571, miR-7-1-3p, miR-7-2-3p, miR-7-5p, miR-802, miR-922, miR-9-3p, and miR-9-5p.MiRNAs abundant in the nervous system include, but are not limited to, miR-132-3p, miR-132-3p, miR-148b-3p, miR-148b-5p, miR-151a-3p, miR-151a-5p, miR-212-3p, miR-212-5p, miR-320b, miR-320e, miR-323a-3p, miR-323a-5p, miR-324-5p, miR-325, miR-326, miR-328, and miR-922. Further included are miRs specifically expressed in neurons, which are not specifically expressed in the nervous system, as well as those specifically expressed in glial cells, including, but not limited to, miR-1250, miR-219-1-3p, miR-219-2-3p, miR-219-5p, miR-23a-3p, miR-23a-5p, miR-3065-3p, miR-3065-5p, miR-30e-3p, miR-30e-5p, miR-32-5p, miR-338-5p, and miR-657. MiRNA binding sites from any CNS-specific miRNA can be introduced or removed from the polyribonucleotides of the present disclosure to regulate expression of the polyribonucleotides in the nervous system. Nervous system-specific miRNA binding sites can be engineered alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polyribonucleotides of the present disclosure.

[0483] miRNAs known to be expressed in the pancreas include, but are not limited to, miR-105-3p, miR-105-5p, miR-184, miR-195-3p, miR-195-5p, miR-196a-3p, miR-196a-5p, miR-214-3p, miR-214-5p, miR-216a-3p, miR-216a-5p, miR-30a-3p, miR-33a-3p, miR-33a-5p, miR-375, miR-7-1-3p, miR-7-2-3p, miR-493-3p, miR-493-5p, and miR-944. The miRNA binding site from any pancreatic-specific miRNA can be introduced into or removed from the polyribonucleotide of the present disclosure to regulate the expression of the polyribonucleotide in the pancreas. The pancreatic-specific miRNA binding site can be modified alone or in combination with the immune cell (e.g., APC) miRNA binding site in the polyribonucleotide of the present disclosure.

[0484] MiRNAs known to be expressed in the kidney include miR-122-3p, miR-145-5p, miR-17-5p, miR-192-3p, miR-192-5p, miR-194-3p, miR-194-5p, miR-20a-3p, miR-20a-5p, miR-204-3p, miR-204-5p, miR-210, miR-216a-3p, and miR-216a-5p. , miR-296-3p, miR-30a-3p, miR-30a-5p, miR-30b-3p, miR-30b-5p, miR-30c-1-3p, miR-30c-2-3p, miR30c-5p, miR-324-3p, miR-335-3p, miR-335-5p, miR-363-3p, miR-363-5p, and miR-562. A miRNA binding site from any kidney-specific miRNA can be introduced into or removed from the polyribonucleotides of the present disclosure to regulate expression of the polyribonucleotide in the kidney. Kidney-specific miRNA binding sites can be engineered alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polyribonucleotides of the present disclosure.

[0485] miRNAs known to be expressed in muscle include, but are not limited to, let-7g-3p, let-7g-5p, miR-1, miR-1286, miR-133a, miR-133b, miR-140-3p, miR-143-3p, miR-143-5p, miR-145-3p, miR-145-5p, miR-188-3p, miR-188-5p, miR-206, miR-208a, miR-208b, miR-25-3p, and miR-25-5p. MiRNA binding sites from any muscle-specific miRNA can be introduced into or removed from the polyribonucleotides of the present disclosure to regulate expression of the polyribonucleotides in muscle. Muscle-specific miRNA binding sites can be engineered alone or in further combination with immune cell (e.g., APC) miRNA binding sites in the polyribonucleotides of the present disclosure.

[0486] miRNAs are also differentially expressed in various cell types, including but not limited to endothelial cells, epithelial cells, and adipocytes. MiRNAs known to be expressed in endothelial cells include let-7b-3p, let-7b-5p, miR-100-3p, miR-100-5p, miR-101-3p, miR-101-5p, miR-126-3p, miR-126-5p, miR-1236-3p, miR-1236-5p, miR-130a-3p, miR-130a-5p, miR-17-5p, miR-17-3p, miR-18a-3p, miR-18a-5p, miR-19a-3p, miR-19a-5p, miR-19b-1-5p, miR-19b-2-5p, miR-19b-3p, and miR-20a- Examples of miR-3p include, but are not limited to, miR-20a-5p, miR-217, miR-210, miR-21-3p, miR-21-5p, miR-221-3p, miR-221-5p, miR-222-3p, miR-222-5p, miR-23a-3p, miR-23a-5p, miR-296-5p, miR-361-3p, miR-361-5p, miR-421, miR-424-3p, miR-424-5p, miR-513a-5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-92b-3p, and miR-92b-5p. Many novel miRNAs have been discovered in endothelial cells through deep sequencing analysis (e.g., Voellenkle C et al., RNA, 2012, 18, 472-484, the entire contents of which are incorporated herein by reference). The miRNA binding site from any endothelial cell-specific miRNA can be introduced into or removed from the polyribonucleotides of the present disclosure to regulate the expression of the polyribonucleotides in endothelial cells.

[0487] MiRNAs known to be expressed in epithelial cells include let-7b-3p, let-7b-5p, miR-1246, miR-200a-3p, miR-200a-5p, miR-200b-3p, miR-200b-5p, miR-200c-3p, miR-200c-5p, miR-338-3p, miR-429, miR-451a, miR-451b, miR-494, miR-802, and miR-3 These include, but are not limited to, miR-4a, miR-34b-5p, miR-34c-5p, miR-449a, miR-449b-3p, respiratory ciliated epithelial cell-specific miR-449b-5p, the let-7 family, miR-133a, miR-133b, lung epithelial cell-specific miR-126, miR-382-3p, renal epithelial cell-specific miR-382-5p, and corneal epithelial cell-specific miR-762. The miRNA binding site from any epithelial cell-specific miRNA can be introduced into or removed from the polyribonucleotides of the present disclosure to regulate expression of the polyribonucleotide in epithelial cells.

[0488] Furthermore, a large group of miRNAs are enriched in embryonic stem cells and regulate stem cell self-renewal and the development and / or differentiation of various cell lineages, such as neural, cardiac, hematopoietic, skin, osteogenic, and muscle cells (e.g., Kuppusamy KT et al., Curr. Mol Med, 2013, 13(5), 757-764; Vidigal JA and Ventura A, Semin Cancer Biol. 2012, 22(5-6), 428-436; Goff LA et al., PLoS One, 2009, 4:e7192; Morin RD et al., Genome Res, 2008, 18, 610-621; Yoo JK et al., Stem Cells Dev. 2012, 21(11), 2049-2057, the entire contents of which are incorporated herein by reference).MiRNAs enriched in embryonic stem cells include let-7a-2-3p, let-a-3p, let-7a-5p, let7d-3p, let-7d-5p, miR-103a-2-3p, miR-103a-5p, miR-106b-3p, miR-106b-5p, miR-1246, miR-1275, miR-138-1-3p, miR-138-2-3p, miR-138-5p, miR-154-3p, miR-154-5p, miR-200c-3p, miR-200c-5p, miR-290, miR-301a-3p, miR-301a-5p, miR-302a-3p, miR-302a-5p, miR-302b-3p, miR-3 02b-5p, miR-302c-3p, miR-302c-5p, miR-302d-3p, miR-302d-5p, miR-302e, miR-367-3p, miR-367-5p, miR-369-3p, m iR-369-5p, miR-370, miR-371, miR-373, miR-380-5p, miR-423-3p, miR-423-5p, miR-486-5p, miR-520c-3p, miR-548 e, miR-548f, miR-548g-3p, miR-548g-5p, miR-548i, miR-548k, miR-548l, miR-548m, miR-548n, miR-548o-3p, miR-54 These include, but are not limited to, miR-8o-5p, miR-548p, miR-664a-3p, miR-664a-5p, miR-664b-3p, miR-664b-5p, miR-766-3p, miR-766-5p, miR-885-3p, miR-885-5p, miR-93-3p, miR-93-5p, miR-941, miR-96-3p, miR-96-5p, miR-99b-3p, and miR-99b-5p. Many predicted novel miRNAs are discovered by deep sequencing of human embryonic stem cells (e.g., Morin RD et al., Genome Res, 2008, 18, 610-621; Goff LA et al., PLoS One, 2009, 4:e7192; Bar M et al., Stem cells, 2008, 26, 2496-2505, the contents of each of which are incorporated herein by reference in their entirety).

[0489] In some embodiments, binding sites for embryonic stem cell-specific miRNAs can be included in or removed from the 3' UTR of the polyribonucleotides of the present disclosure to regulate embryonic stem cell development and / or differentiation, inhibit stem cell senescence in degenerative conditions (e.g., degenerative diseases), or stimulate senescence and apoptosis of stem cells in disease states (e.g., cancer stem cells).

[0490] Many miRNA expression studies have been conducted to profile the differential expression of miRNAs in various cancer cells / tissues and other diseases. Some miRNAs are aberrantly overexpressed in certain cancer cells, while others are underexpressed. For example, miRNAs have been shown to be involved in cancer cells (WO2008 / 154098, US2013 / 0059015, US2013 / 0042333, WO2011 / 157294), cancer stem cells (US2012 / 0053224), pancreatic cancer and disease (US2009 / 0131348, US2011 / 0171646, US2010 / 0286232, US8389210), asthma and inflammation (US8415096), and precancerous disorders (US8415096). in prostate cancer (US2013 / 0053264), hepatocellular carcinoma (WO2012 / 151212, US2012 / 0329672, WO2008 / 054828, US8252538), germ cell carcinoma (WO2011 / 076143, WO2013 / 033640, WO2009 / 070653, US2010 / 0323357), cutaneous T-cell lymphoma (WO2013 / 011378), and colorectal cancer (W WO2011 / 0281756, US2011 / 076142), in cancer-positive lymph nodes (WO2009 / 100430, US2009 / 0263803), in nasopharyngeal carcinoma (EP2112235), in chronic obstructive pulmonary disease (US2012 / 0264626, US2013 / 0053263), in thyroid cancer (WO2013 / 066678), and in ovarian cancer cells (US2012 / 0309645, WO2011 / 09 5623), in breast cancer cells (WO2008 / 154098, WO2007 / 081740, US2012 / 0214699), and in leukemia and lymphoma (WO2008 / 073915, US2009 / 0092974, US2012 / 0316081, US2012 / 0283310, WO2010 / 018563), the contents of each of which are incorporated herein by reference in their entirety.

[0491] As a non-limiting example, the miRNA-binding site of a miRNA that is overexpressed in certain cancer and / or tumor cells can be removed from the 3'UTR of a polyribonucleotide of the present disclosure to restore expression suppressed by the overexpressed miRNA in cancer cells, thus improving the corresponding biological functions, such as, for example, transcriptional stimulation and / or repression, cell cycle arrest, apoptosis, and cell death. Normal cells and tissues in which miRNA expression is not upregulated are unaffected.

[0492] miRNAs can also regulate complex biological processes such as angiogenesis (e.g., miR-132) (Anand and Cheresh Curr Opin Hematol 2011 18:171-176). In the polyribonucleotides of the present disclosure, miRNA binding sites involved in such processes can be removed or introduced to tailor the expression of the polyribonucleotide to biologically relevant cell types or relevant biological processes. In this regard, the polyribonucleotides of the present disclosure are defined as auxotrophic polyribonucleotides.

[0493] stem loop A polynucleotide (e.g., mRNA) can include a stem loop, such as, but not limited to, a histone stem loop. The stem loop can be a nucleotide sequence of about 25 or about 26 nucleotides in length, such as, but not limited to, SEQ ID NOS: 7-17, as set forth in International Patent Publication No. WO2013 / 103659 (SEQ ID NOS: 7-17 of which are incorporated herein by reference). The histone stem loop can be located 3' to the coding region (e.g., at the 3' end of the coding region). As a non-limiting example, the stem loop can be located at the 3' end of a polynucleotide described herein. In some cases, a polynucleotide (e.g., mRNA) includes two or more stem loops (e.g., two stem loops). Examples of stem loop sequences are described in International Patent Publication Nos. WO2012 / 019780 and WO201502667 (these stem loop sequences are incorporated herein by reference). In some cases, the polynucleotide comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 1). In other cases, the polynucleotide comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 2).

[0494] The stem loop may be located in the second terminal region of the polynucleotide. As a non-limiting example, the stem loop may be located in the untranslated region (e.g., 3'-UTR) of the second terminal region. In some cases, polynucleotides, such as, but not limited to, mRNAs containing histone stem loops, can be stabilized by the addition of a 3'-stabilizing region (e.g., a 3'-stabilizing region comprising at least one chain-terminating nucleoside). Without intending to be bound by theory, the addition of at least one chain-terminating nucleoside can slow down the degradation of the polynucleotide, thereby increasing the half-life of the polynucleotide.

[0495] In other cases, polynucleotides, such as, but not limited to, mRNAs containing histone stem loops, can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO2013 / 103659).

[0496] In still other cases, polynucleotides such as, but not limited to, mRNAs containing histone stem loops can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0497] In some cases, polynucleotides of the present disclosure can include a histone stem loop, a poly-A tract, and / or a 5'-cap structure. The histone stem loop can precede and / or follow the poly-A tract. Polynucleotides comprising histone stem loop and poly-A tract sequences can include chain-terminating nucleosides as described herein.

[0498] In other cases, polynucleotides of the present disclosure may comprise histone stem loop and 5'-cap structures, which may include, but are not limited to, those described herein and / or known in the art.

[0499] In some cases, the conserved stem-loop region can include a miR sequence described herein. As a non-limiting example, the stem-loop region can include a seed sequence of a miR sequence described herein. In another non-limiting example, the stem-loop region can include a miR-122 seed sequence.

[0500] In some cases, the conserved stem-loop region may comprise a miR sequence described herein and may also comprise a TEE sequence. In some cases, incorporation of miR and / or TEE sequences alters the shape of the stem-loop region, which can increase and / or decrease translation (see, e.g., Kedde et al. A Pumilio-induced RNA structure switch in p27-3'UTR controls miR-221 and miR-22 accessibility. 2010, incorporated herein by reference in its entirety).

[0501] The polynucleotide can comprise at least one histone stem loop and poly-A tract or polyadenylation signal. Non-limiting examples of polynucleotide sequences encoding at least one histone stem loop and poly-A tract or polyadenylation signal are described in International Patent Publication Nos. WO2013 / 120497, WO2013 / 120629, WO2013 / 120500, WO2013 / 120627, WO2013 / 120498, WO2013 / 120626, WO2013 / 120499, and WO2013 / 120628 (the sequences of each of which are incorporated herein by reference). In some cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a pathogen antigen or fragment thereof, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO2013 / 120499 and WO2013 / 120628 (both of which sequences are incorporated herein by reference). In other cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a therapeutic protein, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO2013 / 120497 and WO2013 / 120629 (both of which sequences are incorporated herein by reference). In some cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode a tumor antigen or a fragment thereof, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO2013 / 120500 and WO2013 / 120627 (both of which sequences are incorporated herein by reference). In other cases, the polynucleotide encoding the histone stem loop and poly-A region or polyadenylation signal may encode an allergenic antigen or an autoimmune autoantigen, such as the polynucleotide sequences set forth in International Patent Publication Nos. WO2013 / 120498 and WO2013 / 120626 (both of which sequences are incorporated herein by reference).

[0502] Poly-A region A polynucleotide or nucleic acid (e.g., mRNA) can contain a polyA sequence and / or a polyadenylation signal. The polyA sequence can be composed entirely or predominantly of adenine nucleotides or their analogs or derivatives. The polyA sequence can be a tail located adjacent to the 3' untranslated region of the nucleic acid.

[0503] During RNA processing, long chains of adenosine nucleotides (poly-A tracts) are typically added to messenger RNA (mRNA) molecules to increase the molecule's stability. Shortly after transcription, the 3' end of the transcript is cleaved, releasing a 3'-hydroxyl group. Poly-A polymerase then adds chains of adenosine nucleotides to the RNA. This process, called polyadenylation, adds poly-A tracts that are 100 to 250 residues in length.

[0504] The length of the unique poly-A region may confer several advantages to the modified polynucleotides of the present disclosure. Generally, the length of a poly-A region of the present disclosure is at least 30 nucleotides. In another embodiment, the poly-A region is at least 35 nucleotides long. In another embodiment, the length is at least 40 nucleotides. In another embodiment, the length is at least 45 nucleotides. In another embodiment, the length is at least 55 nucleotides. In another embodiment, the length is at least 60 nucleotides. In another embodiment, the length is at least 70 nucleotides. In another embodiment, the length is at least 80 nucleotides. In another embodiment, the length is at least 90 nucleotides. In another embodiment, the length is at least 100 nucleotides. In another embodiment, the length is at least 120 nucleotides. In another embodiment, the length is at least 140 nucleotides. In another embodiment, the length is at least 160 nucleotides. In another embodiment, the length is at least 180 nucleotides. In another embodiment, the length is at least 200 nucleotides. In another embodiment, the length is at least 250 nucleotides. In another embodiment, the length is at least 300 nucleotides. In another embodiment, the length is at least 350 nucleotides. In another embodiment, the length is at least 400 nucleotides. In another embodiment, the length is at least 450 nucleotides. In another embodiment, the length is at least 500 nucleotides. In another embodiment, the length is at least 600 nucleotides. In another embodiment, the length is at least 700 nucleotides. In another embodiment, the length is at least 800 nucleotides. In another embodiment, the length is at least 900 nucleotides. In another embodiment, the length is at least 1000 nucleotides. In another embodiment, the length is at least 1100 nucleotides. In another embodiment, the length is at least 1200 nucleotides. In another embodiment, the length is at least 1300 nucleotides. In another embodiment, the length is at least 1400 nucleotides. In another embodiment, the length is at least 1500 nucleotides.In another embodiment, the length is at least 1600 nucleotides. In another embodiment, the length is at least 1700 nucleotides. In another embodiment, the length is at least 1800 nucleotides. In another embodiment, the length is at least 1900 nucleotides. In another embodiment, the length is at least 2000 nucleotides. In another embodiment, the length is at least 2500 nucleotides. In another embodiment, the length is at least 3000 nucleotides.

[0505] In some cases, the poly-A region can be 80 nucleotides, 120 nucleotides, 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0506] In other cases, the poly-A region can be 20, 40, 80, 100, 120, 140, or 160 nucleotides in length in the modified polynucleotide molecules described herein.

[0507] In some cases, the poly-A region is designed for the entire length of the modified polynucleotide. This design can be based on the length of the coding region of the modified polynucleotide, the length of a particular feature or region of the modified polynucleotide (such as mRNA), or the length of the final product expressed from the modified polynucleotide. Compared to any feature of the modified polynucleotide (e.g., other than the mRNA portion containing the poly-A region), the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100% longer in length than the additional feature. The poly-A region can also be designed as part of the modified polynucleotide to which it belongs. In this regard, the poly-A region can be 10, 20, 30, 40, 50, 60, 70, 80, or 90% or more of the total length of the construct or the total length of the construct minus the poly-A region.

[0508] In some cases, engineered binding sites and / or conjugation of polynucleotides (e.g., mRNA) for poly-A binding protein can be used to enhance expression. The engineered binding site can be a sensor sequence that can act as a binding site for a ligand in the local microenvironment of the polynucleotide (e.g., mRNA). As a non-limiting example, a polynucleotide (e.g., mRNA) can include at least one engineered binding site to modify the binding affinity of poly-A binding protein (PABP) and its analogs. Incorporation of at least one engineered binding site can increase the binding affinity of PABP and its analogs.

[0509] Furthermore, multiple different polynucleotides (e.g., mRNAs) can be linked together via their 3' ends to PABP (poly-A binding protein) using modified nucleotides at the 3' end of the poly-A region. Transfection experiments can be performed in relevant cell lines, and protein production can be assayed by ELISA at 12 hours, 24 hours, 48 ​​hours, 72 hours, and 7 days after transfection. As a non-limiting example, transfection experiments can be used to assess the effect on the binding affinity of PABP or its analogs as a result of the addition of at least one engineered binding site.

[0510] In some cases, poly-A regions may be used to regulate translation initiation. Without intending to be bound by theory, poly-A regions may be essential for protein synthesis because they recruit PABP, which can then interact with the translation initiation complex.

[0511] In some cases, poly-A regions may also be used in the present disclosure to protect against 3'-5'-exonuclease digestion. In some cases, a polynucleotide (e.g., mRNA) may contain a poly-AG quartet. A G-quartet is a cyclic hydrogen-bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of a poly-A tract. The resulting polynucleotide (e.g., mRNA) may be assayed at various time points for other parameters, including stability, protein production, and half-life. It has been discovered that poly-AG quartets result in protein production equivalent to at least 75% of that seen using only a 120-nucleotide poly-A tract.

[0512] In some cases, a polynucleotide (e.g., mRNA) may contain a poly-A region and be stabilized by the addition of a 3'-stabilizing region. A polynucleotide (e.g., mRNA) containing a poly-A region may further contain a 5'-cap structure.

[0513] In other cases, a polynucleotide (e.g., an mRNA) may comprise a poly-AG quartet. A polynucleotide (e.g., an mRNA) that comprises a poly-AG quartet may further comprise a 5'-cap structure.

[0514] In some cases, 3'-stabilizing regions that can be used to stabilize polynucleotides (e.g., mRNA) that contain poly-A regions or poly-AG quartets can be, but are not limited to, those described in International Patent Publication No. WO2013 / 103659 (the poly-A regions and poly-AG quartets of which are incorporated herein by reference). In other cases, 3'-stabilizing regions that can be used in the present disclosure include chain-terminating nucleosides such as 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, 2',3'-dideoxynucleosides, e.g., 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, 2',3'-dideoxythymine, 2'-deoxynucleosides, or O-methylnucleosides.

[0515] In other cases, polynucleotides such as, but not limited to, mRNAs containing polyA tracts or poly-AG quartets can be stabilized by modifications to the 3'-region of the polynucleotide that can prevent and / or inhibit the addition of oligo(U) (see, e.g., International Patent Publication No. WO2013 / 103659).

[0516] In still other cases, polynucleotides such as, but not limited to, mRNAs containing poly-A tracts or poly-AG quartets can be stabilized by the addition of oligonucleotides terminating in 3'-deoxynucleosides, 2',3'-dideoxynucleosides, 3'-O-methylnucleosides, 3'-O-ethylnucleosides, 3'-arabinosides, and other modified nucleosides known in the art and / or described herein.

[0517] Chain-terminating nucleosides Nucleic acids can include chain-terminating nucleosides. In some embodiments, chain-terminating nucleosides can include nucleosides deoxygenated at the 2' and / or 3' positions of their sugar groups. Such species include 3'-deoxyadenosine (cordycepin), 3'-deoxyuridine, 3'-deoxycytosine, 3'-deoxyguanosine, 3'-deoxythymine, and 2',3'-dideoxynucleosides, such as 2',3'-dideoxyadenosine, 2',3'-dideoxyuridine, 2',3'-dideoxycytosine, 2',3'-dideoxyguanosine, and 2',3'-dideoxythymine.

[0518] Genome editing technology In some embodiments, the nucleic acid is suitable for genome editing techniques. In some embodiments, the genome editing technology is clustered regularly interspaced short repeats (CRISPR) or transcription activator-like effector nucleases (TALEN).

[0519] In some embodiments, the nucleic acid is at least one nucleic acid suitable for a genome editing technique selected from the group consisting of CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), single guide RNA (sgRNA), and a DNA repair template.

[0520] vaccine In some embodiments, the therapeutic and / or prophylactic agent is a ribonucleic acid (RNA) cancer vaccine RNA (e.g., messenger RNA (mRNA)) that can safely induce the body's cellular machinery to produce almost any cancer protein or fragment thereof of interest. In some embodiments, the RNA is modified RNA. The RNA vaccines of the present disclosure can be used, for example, to induce a balanced immune response that includes both cancer cellular immunity and humoral immunity without the potential risk of insertional mutagenesis.

[0521] RNA vaccines can be used in a variety of settings, depending on the prevalence of cancer or the extent or level of unmet medical need. RNA vaccines can be used to treat and / or prevent cancer at various stages or degrees of metastasis. RNA vaccines have superior properties compared to alternative anticancer therapies, including cancer vaccines, in that they produce greater antibody titers and faster responses. Without wishing to be bound by theory, RNA vaccines, such as mRNA polynucleotides, are believed to be better designed to produce the appropriate protein conformation upon translation because they utilize natural cellular machinery. Unlike conventional vaccines, which are produced ex vivo and can elicit undesirable cellular responses, RNA vaccines are delivered to cell lines in a more natural way.

[0522] Some embodiments of the present disclosure provide cancer vaccines comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one cancer antigenic polypeptide or immunogenic fragment thereof (e.g., an immunogenic fragment capable of eliciting an immune response against cancer). Other embodiments comprise at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding two or more antigens or epitopes capable of eliciting an immune response against cancer.

[0523] In some aspects, the present invention provides a vaccine comprising an mRNA having an open reading frame encoding a cancer antigen and an mRNA having an open reading frame encoding an immune checkpoint modulator. In some embodiments, the immune checkpoint modulator is an inhibitory checkpoint polypeptide. In some embodiments, the inhibitory checkpoint polypeptide is an antibody or fragment thereof that specifically binds to a molecule selected from the group consisting of PD-1, TIM-3, VISTA, A2AR, B7-H3, B7-H4, BTLA, CTLA-4, IDO, KIR, and LAG3. The inhibitory checkpoint polypeptide is an anti-CTLA4 or anti-PD1 antibody. In some embodiments, the vaccine optionally comprises lipid nanoparticles. In some embodiments, a vaccine comprising an mRNA having an open reading frame encoding a cancer antigen is administered to a subject. In other embodiments, a checkpoint inhibitor is administered 3 to 10 weeks later. In some embodiments, a checkpoint inhibitor is administered 4 weeks later.

[0524] In another aspect, the invention is a personalized cancer vaccine comprising mRNA having an open reading frame encoding at least two cancer antigens, the at least two cancer antigens being patient-specific cancer antigens, and a lipid nanoparticle carrier. In some embodiments, the lipid nanoparticles have an average diameter of 50-200 nm.

[0525] In yet another aspect, the present invention is a personalized cancer vaccine of mRNA having open reading frames encoding at least two cancer antigens, wherein the at least two cancer antigens represent antigens of a patient. In some embodiments, the patient's antigens are exosome-identified antigens of the patient. In some embodiments, a single mRNA encodes the cancer antigen. In other embodiments, multiple mRNAs encode the cancer antigens.

[0526] Each mRNA may encode 5 to 10 cancer antigens or a single cancer antigen, in other embodiments. In some embodiments, the mRNA encodes 2 to 100 cancer antigens. In other embodiments, the mRNA encodes 10 to 100, 20 to 100, 50 to 100, 100 to 200, 300 to 400, 500 to 600, 600 to 700, 700 to 800, 900 to 1,000, or 1,000 to 10,000 cancer antigens.

[0527] In some embodiments, a) The mRNA encoding each cancer antigen is interspersed with cleavage-sensitive sites; b) The mRNAs encoding each cancer antigen are directly linked to each other without a linker; c) the mRNAs encoding each cancer antigen are linked to each other using a single nucleotide linker; d) each cancer antigen contains 25-35 amino acids and contains a centrally located SNP mutation; e) at least 30% of the cancer antigens have the highest affinity for class I MHC molecules from the subject; f) at least 30% of the cancer antigens have the highest affinity for class II MHC molecules from the subject; g) at least 50% of the cancer antigens have a predicted binding affinity for HLA-A, HLA-B and / or DRB1 with an IC of less than 500 nM; h) mRNA encodes 20 cancer antigens, i) 50% of the cancer antigens have binding affinity for class I MHC and 50% of the cancer antigens have binding affinity for class II MHC, and / or j) The mRNA encoding the cancer antigen is arranged so that the cancer antigen is ordered to minimize spurious epitopes.

[0528] In some embodiments, each cancer antigen comprises 31 amino acids and includes a centrally located SNP mutation with 15 flanking amino acids on either side of the SNP mutation. In some embodiments, the vaccine is a personalized cancer vaccine and the cancer antigen is a subject-specific cancer antigen. In some embodiments, the subject-specific cancer antigen may represent the exome of a tumor sample from the subject or the transcriptome of a tumor sample from the subject. In some embodiments, the subject-specific cancer antigen may represent the exosome of the subject.

[0529] In some embodiments, the open reading frame further encodes one or more conventional cancer antigens. In some embodiments, the conventional cancer antigen is a non-mutated antigen. In some embodiments, the conventional cancer antigen is a mutated antigen.

[0530] In some embodiments, the mRNA vaccine further comprises an mRNA having an open reading frame encoding one or more conventional cancer antigens. In some embodiments, a single mRNA encodes the cancer antigen. In other embodiments, multiple mRNAs encode the cancer antigens. Each cancer antigen is, in some embodiments, 10-50 amino acids in length. In other embodiments, each cancer antigen is 15-20 amino acids in length. In other embodiments, the cancer antigen is 20-50, 25-100, 100-200, 200-300, 300-400, 400-500, 500-1,000, or 1,000-10,000 amino acids in length.

[0531] In some embodiments, the vaccine further comprises an adjuvant. Some embodiments of the present disclosure provide a cancer vaccine comprising at least one ribonucleic acid (RNA) polynucleotide having an open reading frame encoding at least one cancer polypeptide, at least one 5'-end cap, and at least one chemical modification, formulated within a lipid nanoparticle. In some embodiments, the 5'-end cap is 7mG(5')ppp(5')NlmpNp.

[0532] In some embodiments, the at least one chemical modification is selected from pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4'-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methyl-pseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methoxyuridine, and 2'-O-methyluridine. In some embodiments, the degree of incorporation of chemically modified nucleotides is optimized for improved immune response to the vaccine formulation.

[0533] In some embodiments, the lipid nanoparticles comprise a cationic lipid, a PEG-modified lipid, a sterol, and a non-cationic lipid. In some embodiments, the cationic lipid is an ionizable cationic lipid, the non-cationic lipid is a neutral lipid, and the sterol is cholesterol. In some embodiments, the cationic lipid is selected from 2,2-dilinoleyl-4-dimethylaminoethyl-[1,3]-dioxolane (DLin-KC2-DMA), dilinoleyl-methyl-4-dimethylaminobutyrate (DLin-MC3-DMA), and di((Z)-non-2-en-1-yl)9-((4-(dimethylamino)butanoyl)oxy)heptadecanedioic acid (L319).

[0534] In some embodiments, the lipid nanoparticle formulation comprises an immunopotentiator (eg, a TLR agonist) to enhance the immunogenicity of the vaccine (formulation). In some embodiments, 100% of the uracils in the open reading frame have a chemical modification. In some embodiments, the chemical modification is at the 5-position of the uracil. In some embodiments, the chemical modification is N1-methylpseudouridine.

[0535] In other embodiments, mRNA encoding an APC reprogramming molecule is included in or co-administered with the vaccine. The APC reprogramming molecule can be CIITA, a chaperone protein, e.g., CLIP, HLA-DO, HLA-DM, etc., a costimulatory molecule such as CD40, CD80, CD86, etc., a fragment of CIITA, such as amino acids 26-137 of CIITA, or a protein having at least 80% sequence identity to CIITA.

[0536] In another aspect, there is provided a method of eliciting an immune response in a subject by identifying at least two cancer antigens from a sample from the subject, wherein the at least two cancer antigens comprise a mutation selected from the group consisting of a frameshift mutation and a recombination, and administering to the subject an mRNA vaccine having open reading frames encoding the at least two cancer antigens.

[0537] In some embodiments, cancer antigens are identified from the subject's exosomes. In some embodiments, 2 to 100 antigens are identified from the exosomes. In other embodiments, the mRNA vaccine has open reading frames encoding 2 to 100 antigens. A single mRNA or multiple mRNAs can encode the antigens.

[0538] In some embodiments, the antigen is a cancer antigen. The cancer antigen may have a mutation selected from a point mutation, a frameshift mutation, and a recombination. The method may further include confirming that the cancer antigen is specific to the subject by exome analysis.

[0539] In some embodiments, the method may further comprise confirming that the cancer antigen is specific to the subject by transcriptome analysis. In some embodiments, the method also includes identifying at least two cancer antigens from the subject's sample at least one month after administration of the mRNA vaccine to generate a second set of cancer antigens, and administering to the subject an mRNA vaccine having an open reading frame encoding the second set of cancer antigens to the subject.

[0540] In other embodiments, the subject sample is a tumor sample. In another aspect, the invention includes a method of eliciting an immune response in a subject by identifying at least two cancer antigens from a sample from the subject to generate a first set of cancer antigens, administering to the subject an mRNA vaccine having open reading frames encoding the first set of cancer antigens to the subject at least one month after administration of the mRNA vaccine, identifying at least two cancer antigens from the subject to generate a second set of cancer antigens, and administering to the subject an mRNA vaccine having open reading frames encoding the second set of cancer antigens to the subject.

[0541] In some embodiments, the mRNA vaccine having an open reading frame encoding the second set of antigens is administered to a subject 6 months to 1 year after administration of the mRNA vaccine having an open reading frame encoding the first set of cancer antigens. In other embodiments, the mRNA vaccine having an open reading frame encoding the second set of antigens is administered to a subject 1 to 2 years after administration of the mRNA vaccine having an open reading frame encoding the first set of cancer antigens.

[0542] In some embodiments, a single mRNA has an open reading frame encoding the cancer antigen. In other embodiments, multiple mRNAs encode the antigens. In some embodiments, the second set of cancer antigens comprises 2 to 100 antigens. In other embodiments, the cancer antigens may have a mutation selected from a point mutation, a frameshift mutation, and a recombination.

[0543] In another aspect, the present invention includes a method for inducing an immune response in a subject by identifying at least two cancer antigens from a sample from the subject, administering to the subject mRNA having an open reading frame encoding the at least two cancer antigens, and administering to the subject a cancer therapeutic agent. In some embodiments, the cancer therapeutic agent is a targeted therapy. The targeted therapy can be a BRAF inhibitor, such as vemurafenib (PLX4032) or dabrafenib.

[0544] In other embodiments, the cancer therapeutic is a T cell therapeutic. The T cell therapeutic can be a checkpoint inhibitor, such as an anti-PD-1 antibody or an anti-CTLA-4 antibody. In some embodiments, the anti-PD-1 antibody is BMS-936558 (nivolumab). In other embodiments, the anti-CTLA-4 antibody is ipilimumab. The T cell therapeutic, in other embodiments, is OX40L. In still other embodiments, the cancer therapeutic is a vaccine comprising a population-based tumor-specific antigen.

[0545] In other embodiments, the cancer therapeutic is a vaccine comprising mRNA having an open reading frame encoding one or more conventional cancer antigens. In some embodiments, the mRNA having an open reading frame encoding at least two cancer antigens is administered to the subject simultaneously with the cancer therapeutic agent. In some embodiments, the mRNA having an open reading frame encoding at least two cancer antigens is administered to the subject before the administration of the cancer therapeutic agent. In some embodiments, the mRNA having an open reading frame encoding at least two cancer antigens is administered to the subject after the administration of the cancer therapeutic agent.

[0546] Another aspect of the present invention provides a method comprising combining mRNA having an open reading frame encoding a cancer antigen with a lipid nanoparticle formulation to produce an mRNA cancer vaccine, and administering the mRNA cancer vaccine to a subject within 24 hours of combining. In some embodiments, the mRNA cancer vaccine is administered to a subject within 12 hours of combining. In other embodiments, the mRNA cancer vaccine is administered to a subject within 1 hour of combining. In some embodiments, the mRNA cancer vaccine encodes 2 to 100 cancer antigens or 10 to 100 cancer antigens.

[0547] In some embodiments, the vaccine is a personalized cancer vaccine and the cancer antigen is a subject-specific cancer antigen. In some embodiments, a single mRNA encodes a cancer antigen. In other embodiments, multiple mRNAs encode cancer antigens. Each mRNA encodes, in other embodiments, 5-10 cancer antigens or a single cancer antigen. In yet other embodiments, each cancer antigen is 10-50 amino acids in length or 15-20 amino acids in length.

[0548] Further provided herein is the use of a cancer vaccine in the manufacture of a medicament for use in a method of inducing an antigen-specific immune response in a subject, comprising administering the cancer vaccine to the subject in an amount effective to produce an antigen-specific immune response.

[0549] In another aspect, there is provided a method for treating cancer in a subject in need thereof, by identifying at least two cancer antigens from exosomes isolated from a subject, producing an mRNA vaccine having an open reading frame encoding the antigens based on the identified antigens, and administering the mRNA vaccine to the subject, wherein the mRNA vaccine treats cancer in the subject by inducing a tumor-specific immune response in the subject.In another aspect, the present invention relates to an RNA vaccine that can be prepared according to a method comprising identifying at least two cancer antigens from exosomes isolated from a subject, and producing an mRNA vaccine having an open reading frame encoding the antigens based on the identified antigens.

[0550] An embodiment of the present invention provides a method for inducing an immune response in a subject against a cancer antigen. The method comprises administering to the subject an RNA vaccine comprising at least one RNA polynucleotide having an open reading frame encoding at least one antigenic polypeptide or an immunogenic fragment thereof, thereby inducing an immune response in the subject specific to the antigenic polypeptide or an immunogenic fragment thereof, wherein the subject's anti-antigenic polypeptide antibody tite...

Claims

1. 1. A method of making a lipid nanoparticle (LNP) formulation, comprising: mixing a lipid solution comprising ionizable lipids with an aqueous buffer solution comprising a first buffering agent, thereby forming a lipid nanoparticle solution comprising lipid nanoparticles; and adding a nucleic acid solution containing nucleic acid to said lipid nanoparticle solution, thereby forming a lipid nanoparticle (LNP) formulation containing said lipid nanoparticles associated with said nucleic acid; Including, said aqueous buffer solution having a pH of about 4.8 to about 5.5; The ionizable lipid is i) Formula (IL-1): 【Chemistry 1】 or a salt or isomer thereof, wherein R 1 is selected from the group consisting of C 5-30 alkyl, C 5-20 alkenyl, -R*YR", -YR", and -R"M'R'; R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, C 2-14 alkenyl, -R*YR", -YR", and -R*OR", or R 2 and R 3 together with the atom to which they are attached form a heterocycle or carbocycle; R 4 is selected from the group consisting of hydrogen, C 3-6 carbocycle, -(CH 2 ) n Q, -(CH 2 ) n CHQR, -CHQR, -CQ(R) 2 , and unsubstituted C 1-6 alkyl, where Q is carbocycle, heterocycle, -OR, -O(CH 2 ) n N(R) 2 , -C(O)OR, -OC(O)R, -CX 3 , -CX 2 H, -CXH 2 , -CN, -N(R) 2 , -C(O)N(R) 2 , -N(R)C(O)R, -N(R)S(O) 2 R, -N(R)C(O)N(R) 2 , -N(R)C(S)N(R) 2 , -N(R)R 8 . , N(R)S(O) 2 R 8 , -O(CH 2 ) n OR, -N(R)C(=NR 9 )N(R) 2 , -N(R)C(=CHR 9 )N(R) 2 , -OC(O)N(R) 2 , -N(R)C(O)OR, -N(OR)C(O)R, -N(OR)S(O) 2 R, -N(OR)C(O)OR, -N(OR)C(O)N(R) 2 , -N(OR)C(S)N(R) 2 , -N(OR)C(=NR 9 )N(R) 2 , -N(OR)C(=CHR 9 )N(R) 2 , -C(=NR 9 )N(R) 2 , -C(=NR 9 )R, -C(O)N(R)OR, and -C(R)N(R) 2 C(O)OR, and each n is independently selected from 1, 2, 3, 4, and 5; each R 5 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H; each R 6 is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H; M and M' are independently selected from -C(O)O-, -OC(O)-, -OC(O)-M"-C(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -S-S-, an aryl group, and a heteroaryl group, where M" is a bond, C1-13 alkyl, or C2-13 alkenyl; R 7 is selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H; R 8 is selected from the group consisting of C 3-6 carbocycles and heterocycles; R 9 is selected from the group consisting of H, CN, NO 2 , C 1-6 alkyl, —OR, —S(O) 2 R, —S(O) 2 N(R) 2 , C 2-6 alkenyl, C 3-6 carbocycle and heterocycle; each R is independently selected from the group consisting of C 1-3 alkyl, C 2-3 alkenyl, and H; each R' is independently selected from the group consisting of C 1-18 alkyl, C 2-18 alkenyl, -R*YR", -YR", and H; each R″ is independently selected from the group consisting of C 3-15 alkyl and C 3-15 alkenyl; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each Y is independently a C 3-6 carbocycle; Each X is independently selected from the group consisting of F, Cl, Br, and I; and m is selected from 5, 6, 7, 8, 9, 10, 11, 12, and 13; and wherein R 4 is —(CH 2 ) n Q, —(CH 2 ) n CHQR, —CHQR, or —CQ(R) 2 , then: (i) when n is 1, 2, 3, 4, or 5, Q is not —N(R) 2 , or (ii) when n is 1 or 2, Q is not a 5-, 6-, or 7-membered heterocycloalkyl; ii) Formula (IL-II): 【Chemistry 2】 or a salt or isomer thereof, wherein l is selected from 1, 2, 3, 4 and 5; M 1 is a bond or M′; R 4 is hydrogen, unsubstituted C 1-3 alkyl, or —(CH 2 ) n Q, where n is 2, 3, or 4; and Q is —OH, —NHC(S)N(R) 2 , —NHC(O)N(R) 2 , —N(R)C(O)R, —N(R)S(O) 2 R, —N(R)R 8 , —NHC(═NR 9 )N(R) 2 , —NHC(═CHR 9 )N(R) 2 , —OC(O)N(R) 2 , —N(R)C(O)OR, heteroaryl, or heterocycloalkyl; M and M′ are independently selected from —C(O)O—, —OC(O)—, —OC(O)-M″-C(O)O—, —C(O)N(R′)—, —P(O)(OR′)O—, —S—S—, an aryl group, and a heteroaryl group; and R 2 and R 3 are independently selected from the group consisting of H, C 1-14 alkyl, and C 2-14 alkenyl; iii) Formula (IL-III): 【Chemistry 3】 or a salt or isomer thereof, wherein W is 【Chemistry 4】 and Ring A is 【Chemistry 5】 and t is 1 or 2; A 1 and A 2 are each independently selected from CH or N; Z is CH 2 or absent, where when Z is CH 2 , dashed lines (1) and (2) each represent a single bond, and when Z is absent, dashed lines (1) and (2) are both absent; R 1 , R 2 , R 3 , R 4 , and R 5 are independently selected from the group consisting of C 5-20 alkyl, C 5-20 alkenyl, -R'MR', -R*YR'', -YR'', and -R*OR''; R x1 and R x2 are each independently H or C 1-3 alkyl; each M is independently selected from the group consisting of -C(O)O-, -OC(O)-, -OC(O)O-, -C(O)N(R')-, -N(R')C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR')O-, -S(O)2-, -C(O)S-, -SC(O)-, an aryl group, and a heteroaryl group; M* is C 1 -C 6 alkyl; W 1 and W 2 are each independently selected from the group consisting of —O— and —N(R 6 )—; each R 6 is independently selected from the group consisting of H and C 1-5 alkyl; X 1 , X 2 , and X 3 are independently selected from the group consisting of a bond, —CH 2 —, —(CH 2 ) 2 —, —CHR—, —CHY—, —C(O)—, —C(O)O—, —OC(O)—, —(CH 2 ) n —C(O)—, —C(O)—(CH 2 ) n —, —(CH 2 ) n —C(O)O—, —OC(O)—(CH 2 ) n —, —(CH 2 ) n —OC(O)—(CH 2 ) n —, —(CH 2 ) n —OC(O)—, —C(O)O—(CH 2 ) n —, —CH(OH)—, —C(S)—, and —CH(SH)—; each Y is independently a C 3-6 carbocycle; each R* is independently selected from the group consisting of C 1-12 alkyl and C 2-12 alkenyl; each R is independently selected from the group consisting of C 1-3 alkyl and C 3-6 carbocycle; each R' is independently selected from the group consisting of C 1-12 alkyl, C 2-12 alkenyl, and H; each R″ is independently selected from the group consisting of C 3-12 alkyl, C 3-12 alkenyl, and —R*MR′; and n is an integer from 1 to 6, In the formula, ring A is 【Chemistry 6】 If i) at least one of X 1 , X 2 and X 3 is not —CH 2 —; and / or ii) At least one of R 1 , R 2 , R 3 , R 4 , and R 5 is -R"MR'.

2. 2. The method of claim 1, wherein the lipid nanoparticles of the lipid nanoparticle solution are empty lipid nanoparticles.

3. 2. The method of claim 1, wherein the lipid nanoparticles of the lipid nanoparticle solution have an average diameter of less than about 150 nm, less than about 125 nm, less than about 100 nm, less than about 90 nm, less than about 80 nm, less than about 75 nm, less than about 70 nm, less than about 65 nm, less than about 60 nm, less than about 55 nm, less than about 50 nm, less than about 45 nm, less than about 40 nm, less than about 35 nm, or less than about 30 nm.

4. 2. The method of claim 1, wherein the lipid nanoparticles of the lipid nanoparticle solution have an average diameter of about 25 nm to about 125 nm, about 30 nm to about 110 nm, about 35 nm to about 100 nm, about 40 nm to about 90 nm, about 45 nm to about 80 nm, or about 50 nm to about 70 nm.

5. 10. The method of claim 1, wherein the lipid solution has a pH in the range of about 7.0 to about 8.0, about 7.1 to about 7.8, about 7.2 to about 7.6, or about 7.3 to about 7.

5.

6. 10. The method of claim 1, wherein the nucleic acid solution has a pH in the range of about 4.5 to about 6.5, about 4.8 to about 6.25, about 4.8 to about 6.0, about 5.0 to about 5.8, or about 5.2 to about 5.

5.

7. 10. The method of claim 1, wherein the lipid nanoparticle solution has a pH in the range of about 4.5 to about 6.25, about 4.6 to about 6.0, about 4.8 to about 5.8, about 5.0 to about 5.75, about 5.0 to about 5.

5.

8. 10. The method of claim 1, wherein the lipid nanoparticle formulation has a pH in the range of about 4.5 to about 6.0, about 4.6 to about 5.8, about 4.8 to about 5.6, about 5.0 to about 5.5, or about 5.1 to about 5.

4.

9. 2. The method of claim 1, wherein the lipid nanoparticle solution or the lipid nanoparticle formulation has a pH that is less than the pKa of the ionizable lipid.

10. The method of claim 1 , wherein the nucleic acid is a ribonucleic acid.

11. The method of claim 10, wherein the nucleic acid is messenger RNA (mRNA).

12. The method of claim 1 , wherein the lipid solution and / or the lipid nanoparticle solution further comprises a first organic solvent.

13. The method of claim 1 , wherein the aqueous buffer solution, the nucleic acid solution, and / or the lipid nanoparticle solution comprises a first aqueous buffer.

14. 2. The method of claim 1, wherein the aqueous buffer solution, the nucleic acid solution, and / or the lipid nanoparticle solution further comprises a second aqueous buffer, a second organic solvent, or both.

15. 15. The method of claim 14, wherein the first aqueous buffer and the second aqueous buffer are at least one buffer selected from the group consisting of acetate buffer, citrate buffer, phosphate buffer, and Tris buffer.

16. 16. The method of claim 15, wherein the first organic solvent, the second organic solvent, or both, are an alcohol.

17. 10. The method of claim 1, wherein the lipid solution, the nucleic acid solution, or both further comprise a third organic solvent.

18. 20. The method of claim 17, wherein the third organic solvent is an alcohol.

19. 2. The method of claim 1, further comprising processing the lipid nanoparticle formulation, wherein processing the lipid nanoparticle formulation comprises at least one step selected from the group consisting of filtration, pH adjustment, buffer exchange, dialysis, concentration, freezing, lyophilization, and packing.

20. The lipid solution, the lipid nanoparticle (LNP) solution, and / or the lipid nanoparticle (LNP) formulation further comprises an encapsulating agent, the encapsulating agent comprising: i) Formula (EA-I): 【Chemistry 7】 or a salt or isomer thereof, wherein R 201 and R 202 are each independently selected from the group consisting of H, C 1 -C 6 alkyl, C 2 -C 6 alkenyl, and (C═NH)N(R 101 ) 2 , where each R 101 is independently selected from the group consisting of H, C 1 -C 6 alkyl, and C 2 -C 6 alkenyl; R 203 is selected from the group consisting of C 1 -C 20 alkyl and C 2 -C 20 alkenyl; R 204 is selected from the group consisting of H, C 1 -C 20 alkyl, C 2 -C 20 alkenyl, C(O)(OC 1 -C 20 alkyl), C(O)(OC 2 -C 20 alkenyl), C(O)(NHC 1 -C 20 alkyl), and C(O)(NHC 2 -C 20 alkenyl); n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; ii) Formula (EA-II): 【Chemistry 8】 or a salt or isomer thereof, wherein X 101 is a bond, NH, or O; R 101 and R 102 are each independently selected from the group consisting of H, C 1 -C 6 alkyl, and C 2 -C 6 alkenyl; R 103 and R 104 are each independently selected from the group consisting of C 1 -C 20 alkyl and C 2 -C 20 alkenyl; and n1 is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10; or iii) ethyl lauroyl arginate or a salt or isomer thereof.

21. 2. The method of claim 1, wherein the weight / weight ratio of the lipid nanoparticle (LNP) formulation to the nucleic acid ranges from about 5:1 to about 60:

1.

22. 2. The method of claim 1, wherein the lipid nanoparticle or lipid nanoparticle formulation further comprises a phospholipid, a PEG lipid, a structured lipid, or any combination thereof, wherein the structured lipid is cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, ursolic acid, or alpha-tocopherol.

23. The lipid nanoparticles and / or lipid nanoparticle formulations are About 40-60 mol % ionizable lipids; about 5-15 mol % phospholipids, about 35-45 mol % structured lipids, or Approximately 0.01 to 2.0 mol% PEG lipid 23. The method of claim 22, comprising:

24. The PEG lipid may be i) selected from PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, and PEG-modified dialkylglycerols; ii) Formula (PL-I): 【Chemistry 9】 or a salt or isomer thereof, wherein R ３ is -OR Ｏ and R Ｏ is hydrogen, an optionally substituted alkyl, or an oxygen protecting group; r is an integer from 1 to 100, inclusive; L １ is optionally substituted C １－１０ alkylene, wherein said optionally substituted C １－１０ At least one methylene of the alkylene is optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, O, N(R Ｎ ), S, C(O), C(O)N(R Ｎ ), N.R. Ｎ C(O), C(O)O, -OC(O), OC(O)O, OC(O)N(R Ｎ ), N.R. Ｎ C(O)O, or NR Ｎ C(O)N(R Ｎ ) are independently replaced by D is a moiety obtained by click chemistry or a moiety cleavable under physiological conditions; m is 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; A is, 【Chemistry 10】 is the formula: L ２ Each instance of is independently a bond or an optionally substituted C １－６ alkylene, wherein said optionally substituted C １－６ One methylene unit of an alkylene is O, N(R Ｎ ), S, C(O), C(O)N(R Ｎ ), N.R. Ｎ C(O), C(O)O, OC(O), OC(O)O, OC(O)N(R Ｎ ), -NR Ｎ C(O)O, or NR Ｎ C(O)N(R Ｎ ) optionally replaced by R ２ Each instance of is independently an optionally substituted C １－３０ Alkyl, optionally substituted C １－３０ alkenyl, or optionally substituted C １－３０ alkynyl, optionally wherein R ２ one or more methylene units of optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R Ｎ ), O, S, C(O), C(O)N(R Ｎ ), N.R. Ｎ C(O), -NR Ｎ C(O)N(R Ｎ ), C(O)O, OC(O), OC(O)O, OC(O)N(R Ｎ ), N.R. Ｎ C(O)O, C(O)S, SC(O), -C(=NR Ｎ ), C(=NR Ｎ ) N (R Ｎ ), N.R. Ｎ C (=NR Ｎ ), N.R. Ｎ C (=NR Ｎ ) N (R Ｎ ), C(S), C(S)N(R Ｎ ), N.R. Ｎ C(S), NR Ｎ C(S)N(R Ｎ ), S(O), OS(O), S(O)O, OS(O)O, OS(O) ２ , S(O) ２ O, OS (O) ２ O, N (R Ｎ )S(O), -S(O)N(R Ｎ ), N(R Ｎ ) S (O) N (R Ｎ ), OS(O)N(R Ｎ ), N(R Ｎ )S(O)O,S(O) ２ , N(R Ｎ ) S (O) ２ , S(O) ２ N (R Ｎ ), N(R Ｎ ) S(0) ２ N (R Ｎ ), OS(O) ２ N (R Ｎ ), or N(R Ｎ ) S (O) ２ independently replaced by O; R Ｎ each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; Ring B is an optionally substituted carbocyclyl, an optionally substituted heterocyclyl, an optionally substituted aryl, or an optionally substituted heteroaryl; and p is 1 or 2, iii) Formula (PL-II): 【Chemistry 11】 or a salt or isomer thereof, wherein R ３ is -OR Ｏ and R Ｏ is hydrogen, an optionally substituted alkyl or an oxygen protecting group; r is an integer from 1 to 100; R ５ is optionally substituted C １０－４０ Alkyl, optionally substituted C １０－４０ alkenyl, or optionally substituted C １０－４０ alkynyl, and optionally R ５ One or more methylene groups in the formula (I) are optionally substituted carbocyclylene, optionally substituted heterocyclylene, optionally substituted arylene, optionally substituted heteroarylene, N(R Ｎ ), O, S, C(O), -C(O)N(R Ｎ ), N.R. Ｎ C(O), NR Ｎ C(O)N(R Ｎ ), C(O)O, OC(O), OC(O)O, OC(O)N(R Ｎ ), -NR Ｎ C(O)O, C(O)S, SC(O), C(=NR Ｎ ), C(=NR Ｎ ) N (R Ｎ ), N.R. Ｎ C (=NR Ｎ ), N.R. Ｎ C (=NR Ｎ ) N (R Ｎ ), C(S), C(S)N(R Ｎ ), N.R. Ｎ C(S), NR Ｎ C(S)N(R Ｎ ), S(O), OS(O), S(O)O, OS(O)O, OS(O) ２ , -S(O) ２ O, OS (O) ２ O, N (R Ｎ )S(O), S(O)N(R Ｎ ), N(R Ｎ ) S (O) N (R Ｎ ), OS(O)N(R Ｎ ), N(R Ｎ )S(O)O,S(O) ２ , N(R Ｎ ) S (O) ２ , S(O) ２ N (R Ｎ ), N(R Ｎ ) S (O) ２ N (R Ｎ ), OS(O) ２ N (R Ｎ ), or N(R Ｎ ) S (O) ２ is replaced by O, and R Ｎ each instance of is independently hydrogen, an optionally substituted alkyl, or a nitrogen protecting group; or iv) Formula (PL-III): 【Chemistry 12】 or a salt or isomer thereof, wherein s is an integer from 1 to 100.

25. The phospholipid may be 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-diundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), and sphingomyelin.

26. The ionizable lipid may be 3-(didodecylamino)-N1,N1,4-tridodecyl-1-piperazineethanamine (KL10), N1-[2-(didodecylamino)ethyl]-N1,N4,N4-tridodecyl-1,4-piperazinediethanamine (KL22), 14,25-ditridecyl-15,18,21,24-tetraaza-octatriacontane (KL25), 1,2-dilinoleyloxy-N,N-dimethylaminopropane (KL26), 1,2-diaminopropane (KL27), 1,2-diaminopropane (KL28), 1,2-diaminopropane (KL29), 1,2-diaminopropane (KL30), 1,2-diaminopropane (KL31), 1,2-diaminopropane (KL32), 1,2-diaminopropane (KL33), 1,2-diaminopropane (KL34), 1,2-diaminopropane (KL35), 1,2-diaminopropane (KL36), 1,2-diaminopropane (KL37), 1,2-diaminopropane (KL38), 1,2-diaminopropane (KL39 ... 2,2-Dilinoleyl-4-dimethylaminomethyl-[1,3]-dioxolane (DLin-K-DMA), heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLin-MC3-DMA), 2,2-Dilinoleyl-4-(2-dimethylaminoethyl)-[1,3]-dioxolane (DLin-KC2-DMA), 1,2-dioleyloxy- N,N-dimethylaminopropane (DODMA), 2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), (2R)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA), 23. The method of claim 22, wherein the aryloxy group is selected from (2Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2R)), and (2S)-2-({8-[(3β)-cholest-5-en-3-yloxy]octyl}oxy)-N,N-dimethyl-3-[(9Z,12Z)-octadeca-9,12-dien-1-yloxy]propan-1-amine (octyl-CLinDMA(2S)).

Images