Compositions and methods for treating TTR gene editing and ATTR amyloidosis, including corticosteroids, or uses thereof

Abstract

Compositions and methods are provided for editing, e.g., introducing a double-strand break, within the TTR gene in combination with administration of a corticosteroid.Compositions and methods are provided for treating a subject with transthyretin-associated amyloidosis (ATTR) in which a guide RNA and a corticosteroid are administered.

Description

[Technical Field]

[0001] This patent application claims priority to U.S. Provisional Application No. 62 / 825,676, filed March 28, 2019, and U.S. Provisional Application No. 62 / 825,637, filed March 28, 2019, the contents of each of which are incorporated herein by reference in their entirety for all purposes.

[0002] This application contains a Sequence Listing that has been submitted electronically in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy, created on March 20, 2020, is titled 2020-03-20_01155-0029-00PCT_ST25.txt and is 967KB in size. [Background technology]

[0003] Transthyretin (TTR) is a protein produced by the TTR gene that normally functions to transport retinol and thyroxine throughout the body. TTR is primarily synthesized in the liver, with small amounts produced in the choroid plexus and retina. TTR normally circulates as a soluble tetrameric protein in the blood.

[0004] Pathogenic variants of TTR that can disrupt the stability of the tetramer can be encoded by mutant alleles of the TTR gene. Mutant TTR can result in misfolded TTR, which can generate amyloid (i.e., aggregates of misfolded TTR protein). In some cases, pathogenic variants of TTR can cause amyloidosis, i.e., a disease resulting from the accumulation of amyloid. For example, misfolded TTR monomers can polymerize into amyloid fibrils in tissues such as peripheral nerves, the heart, and the digestive tract. Amyloid plaques can also contain wild-type TTR deposited on misfolded TTR.

[0005] Additionally, misfolding and deposition of wild-type TTR has been observed in men over 60 years of age, which has been linked to heart rhythm problems, heart failure, and carpal tunnel.

[0006] Amyloidosis characterized by the deposition of TTR may be referred to as "ATTR," "TTR-related amyloidosis," "TTR amyloidosis," or "ATTR amyloidosis," "ATTR familial amyloidosis" (when associated with a genetic mutation within a family), or "ATTRwt" or "wild-type ATTR" (when resulting from the misfolding and deposition of wild-type TTR).

[0007] ATTR can present with a wide range of symptoms, and patients with different types of ATTR may have different characteristics and prognosis. Some types of ATTR include familial amyloid polyneuropathy (FAP), familial amyloid cardiomyopathy (FAC), and wild-type TTR amyloidosis (wt-TTR amyloidosis). FAP generally presents with sensory motor neuropathy, while FAC and wt-TTR amyloidosis generally present with congestive heart failure. FAP and FAC are usually associated with genetic mutations in the TTR gene, and more than 100 different mutations in the TTR gene have been associated with ATTR. In contrast, wt-TTR amyloidosis is associated with aging and is not associated with genetic mutations in TTR. It is estimated that approximately 50,000 patients worldwide may suffer from FAP and FAC.

[0008] Although over 100 mutations in TTR are associated with ATTR, certain mutations are more closely associated with neuropathy and / or cardiomyopathy. For example, mutations at T60 of TTR are associated with both cardiomyopathy and neuropathy, mutations at V30 are more associated with neuropathy, and mutations at V122 are more associated with cardiomyopathy.

[0009] Various therapeutic approaches for the treatment of ATTR have been investigated, but no approved medications have been shown to halt disease progression or improve quality of life. Liver transplantation has been studied for the treatment of ATTR, but its use is declining because it carries significant risks and disease progression can continue after transplant. Small molecule stabilizers such as diflunisal and tafamidis appear to slow the progression of ATTR, but these agents do not halt disease progression.

[0010] Approaches using small interfering RNA (siRNA) knockdown, antisense knockdown, or monoclonal antibodies to target amyloid fibrils for destruction are also currently being investigated, but results on short-term inhibition of TTR expression show encouraging preliminary data, and a need exists for therapies that can produce long-lasting inhibition of TTR. Summary of the Invention [Problem to be solved by the invention]

[0011] In the context of gene editing and therapy, the administration of foreign RNA can cause undesirable natural immune response.Therefore, the present disclosure provides gene editing compositions and methods that can reduce inflammation or immune response.For example, the simultaneous administration of corticosteroids to the subject who receives guide RNA can reduce such inflammation or immune response.

[0012] Therefore, the following embodiments are provided. In some embodiments, the present invention provides compositions and methods that use corticosteroids in combination with guide RNA, and optionally with an RNA-guided DNA binding agent such as a CRISPR / Cas system, to substantially reduce or knock out the expression of the TTR gene, thereby substantially reducing or eliminating the production of TTR protein associated with ATTR. Substantially reducing or eliminating the production of TTR protein associated with ATTR by modifying the TTR gene can be a long-term reduction or elimination. [Means for solving the problem]

[0013] The following embodiments are provided herein:

[0014] Embodiment 1 is a method of treating TTR-associated amyloidosis (ATTR), comprising administering to a subject in need thereof a corticosteroid and a composition, the composition comprising: (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent; and (ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. a guide RNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; This is a method for treating ATTR.

[0015] Embodiment 2 is a method of reducing TTR serum concentrations, comprising administering to a subject in need thereof a corticosteroid and a composition, the composition comprising: (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent; and (ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. a guide RNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; This reduces TTR serum concentrations.

[0016] Embodiment 3 is a method of reducing or preventing accumulation of amyloid or amyloid fibrils comprising TTR in a subject, comprising administering to a subject in need thereof a corticosteroid and a composition, the composition comprising: (i) an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent; and (ii) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. a guide RNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; This reduces the accumulation of amyloid or amyloid fibrils.

[0017] Embodiment 4 is a composition comprising a guide RNA, wherein the guide RNA is: a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. A guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; Compositions for use in combination with corticosteroids in methods for inducing a double-strand break (DSB) in the TTR gene in a subject, modifying the TTR gene in a cell or a subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentrations in a subject, and / or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0018] Embodiment 5 is a composition comprising a vector encoding a guide RNA, wherein the guide RNA is: a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. A guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; Compositions for use in combination with corticosteroids in methods for inducing a double-strand break (DSB) in the TTR gene in a subject, modifying the TTR gene in a cell or a subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentrations in a subject, and / or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0019] Embodiment 6 is a composition comprising: (i) a guide RNA, a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. A guide RNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; (ii) an mRNA encoding an RNA-guided DNA-binding agent, the open reading frame comprises a sequence having at least 95% identity to SEQ ID NO: 311; an open reading frame having at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; the open reading frame consists of a set of codons, at least 75% of which are codons listed in Table 1; the open reading frame has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content, and / or the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content; Compositions for use in combination with corticosteroids in methods for inducing a double-strand break (DSB) in the TTR gene in a subject, modifying the TTR gene in a cell or a subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentrations in a subject, and / or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0020] Embodiment 7 is a composition comprising: (i) A vector encoding a guide RNA, wherein the guide RNA is a. a guide sequence selected from SEQ ID NOs: 5 to 82; b. at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82, or c. A vector comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82; (ii) an mRNA encoding an RNA-guided DNA-binding agent, the open reading frame comprises a sequence having at least 95% identity to SEQ ID NO: 311; an open reading frame having at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; the open reading frame consists of a set of codons, at least 75% of which are codons listed in Table 1; the open reading frame has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content, and / or the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content; Compositions for use in combination with corticosteroids in methods for inducing a double-strand break (DSB) in the TTR gene in a subject, modifying the TTR gene in a cell or a subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentrations in a subject, and / or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0021] Embodiment 8 is the composition or method for use of any one of embodiments 1-3 or 5-7, wherein the method comprises administering the composition by infusion for more than 30 minutes, e.g., more than 60 minutes, or more than 120 minutes.

[0022] Embodiment 9 is the composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82.

[0023] Embodiment 10 is the composition or method of any one of the preceding embodiments, wherein the guide RNA comprises a guide sequence selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69.

[0024] Embodiment 11 is the composition of any one of Embodiments 4 to 10 for use in inducing a double-strand break (DSB) in the TTR gene in a cell or a subject.

[0025] Embodiment 12 is the composition of any one of Embodiments 4 to 11 for use in modifying the TTR gene in a cell or a subject.

[0026] Embodiment 13 is the composition of any one of Embodiments 4 to 12 for use in treating TTR-associated amyloidosis (ATTR) in a subject.

[0027] Embodiment 14 is the composition of any one of Embodiments 4 to 13 for use in reducing TTR serum concentrations in a subject.

[0028] Embodiment 15 is the composition of any one of Embodiments 4 to 14 for use in reducing or preventing amyloid or amyloid fibril accumulation in a subject.

[0029] Embodiment 16 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or etamethasoneb.

[0030] Embodiment 17 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone.

[0031] Embodiment 18 is a composition for the method or use of any one of the preceding embodiments, wherein a corticosteroid is administered prior to the composition.

[0032] Embodiment 19 is a composition for the method or use of any one of the preceding embodiments, wherein a corticosteroid is administered after the composition.

[0033] Embodiment 20 is a composition for the method or use of any one of the preceding embodiments, wherein a corticosteroid is administered simultaneously with the composition.

[0034] Embodiment 21 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered within about 5 minutes to about 168 hours before the composition is administered.

[0035] Embodiment 22 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered within about 5 minutes to about 168 hours after the composition is administered.

[0036] Embodiment 23 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week before the composition is administered.

[0037] Embodiment 24 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1 day, 1.5 days, 2 days, 3 days, 4 days, 5 days, 6 days, or 1 week before the composition is administered.

[0038] Embodiment 25 is a composition for the method or use of any one of the preceding embodiments, wherein at least two doses of a corticosteroid are administered before or after administration of the composition.

[0039] Embodiment 26 is a composition for the method or use of any one of the preceding embodiments, wherein at least two doses of a corticosteroid and at least two doses of the composition are administered.

[0040] Embodiment 27 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject at a dose of 0.75 mg to 20 mg.

[0041] Embodiment 28 is a composition for the method or use of Embodiment 27, wherein the corticosteroid is administered to the subject at a dose of about 0.01 to 0.4 mg / kg, e.g., 0.1 to 0.35 mg / kg or 0.25 to 0.35 mg / kg.

[0042] Embodiment 29 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject parenterally or by injection.

[0043] Embodiment 30 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject via intravenous injection.

[0044] Embodiment 31 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is administered to the subject intramuscularly or by injection.

[0045] Embodiment 32 is a composition for the method or use of any one of Embodiments 1 to 31, wherein the corticosteroid is administered orally to the subject.

[0046] Embodiment 33 is a composition for the method or use of any one of Embodiment 32, wherein the corticosteroid is administered orally to the subject before the composition is administered to the subject by intravenous injection.

[0047] Embodiment 34 is a composition for the method or use of any one of Embodiment 32, wherein the composition is administered to the subject by intravenous injection, followed by oral administration of the corticosteroid to the subject.

[0048] Embodiment 35 is a composition for the method or use of any one of embodiments 32 and 33, wherein the corticosteroid is dexamethasone, and the dexamethasone is orally administered to the subject in an amount of 20 mg 6 to 12 hours before the composition is administered to the subject.

[0049] Embodiment 36 is a composition for the method or use of any one of embodiments 32, 33, or 35, wherein the corticosteroid is dexamethasone, and the dexamethasone is administered intravenously to the subject in an amount of 20 mg over 30 minutes for 6 to 12 hours before the composition is administered to the subject.

[0050] Embodiment 37 is a composition for the method or use of any one of the preceding embodiments, wherein the composition is administered by infusion over about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes, 135 to 165 minutes, 165 to 195 minutes, 195 to 225 minutes, 225 to 255 minutes, 255 to 285 minutes, 285 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes. In some embodiments, the composition is administered by infusion for about 1.5 to 6 hours.

[0051] Embodiment 38 is a composition for the method or use of any one of the preceding embodiments, wherein the composition is administered by infusion over about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, or about 240 minutes.

[0052] Embodiment 39 is a composition for the method or use of any one of the preceding embodiments, wherein the composition is administered by infusion over about 120 minutes.

[0053] Embodiment 40 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone.

[0054] Embodiment 41 is a composition for the method or use of any one of the preceding embodiments, wherein the method further comprises administering infusion prophylaxis, wherein the infusion prophylaxis comprises one or more of acetaminophen, an H1 blocker, or an H2 blocker, optionally wherein the one or more of the acetaminophen, H1 blocker, or H2 blocker are administered simultaneously with the corticosteroid and / or prior to the composition.

[0055] Embodiment 42 is a composition for the method or use of embodiment 41, wherein each of acetaminophen, an H1 blocker, or an H2 blocker is administered.

[0056] Embodiment 42a is a composition for the method or use of Embodiment 41 or 42, wherein the H1 blocker and / or H2 blocker is administered orally.

[0057] Embodiment 42b is a composition for the method or use of any one of Embodiments 41-42a, wherein the infusion prophylaxis comprises intravenous corticosteroid (e.g., dexamethasone 8-12 mg, or 10 mg or equivalent) and acetaminophen (e.g., oral acetaminophen 500 mg).

[0058] Embodiment 42c is a composition for the method or use of any one of embodiments 41-42b, wherein the infusion prophylaxis is administered as a necessary premedication prior to administering the guide RNA-containing composition, e.g., the LNP composition.

[0059] Embodiment 43 is a composition for the method or use of any one of embodiments 41-42c, wherein the H1 blocker is diphenhydramine.

[0060] Embodiment 44 is a composition for the method or use of any one of embodiments 41-43, wherein the H2 blocker is ranitidine.

[0061] Embodiment 45 is a composition for the method or use of any one of the preceding embodiments, wherein the first dose of corticosteroid is administered about 8 to 24 hours before the composition is administered, and the second dose of corticosteroid is administered about 1 to 2 hours before the composition is administered.

[0062] Embodiment 46 is a composition for the method or use of any one of the preceding embodiments, wherein the first dose of corticosteroid is administered orally and the second dose of corticosteroid is administered intravenously before the composition is administered.

[0063] Embodiment 47 is a composition for the method or use of any one of embodiments 45 and 46, wherein the method further comprises administering one or more of acetaminophen, an H1 blocker, or an H2 blocker, optionally wherein the one or more of acetaminophen, an H1 blocker, or an H2 blocker is administered simultaneously with the second dose of a corticosteroid.

[0064] Embodiment 48 is a composition for the method or use of any one of the preceding embodiments, wherein the first dose of corticosteroid is administered orally about 8 to 24 hours before the composition is administered, and the second dose of corticosteroid is administered intravenously about 1 to 2 hours before the composition is administered.

[0065] Embodiment 49 is a composition for the method or use of any one of the preceding embodiments, wherein the first dose of corticosteroid is administered orally about 8 to 24 hours before the composition is administered, and the second dose of corticosteroid is administered intravenously, simultaneously with administration of the acetaminophen, H1 blocker, and H2 blocker, about 1 to 2 hours before the composition is administered.

[0066] Embodiment 50 is the composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone; and a first dose of dexamethasone is orally administered to the subject in an amount of about 6-10 mg about 8 to 24 hours before administering the composition to the subject; and a second dose of dexamethasone in an amount of about 8-12 mg is administered intravenously to the subject, concurrently with the oral administration of acetaminophen and the intravenous administration of an H1 blocker and an H2 blocker about 1 to 2 hours before administering the composition to the subject; optionally, the H1 blocker is diphenhydramine and the H2 blocker is ranitidine; and / or optionally, the subject is a human.

[0067] Embodiment 51 is a composition for the method or use of any one of the preceding embodiments, wherein the corticosteroid is dexamethasone; and a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg about 8 to 24 hours before administering the composition to the subject; and a second dose of dexamethasone in an amount of 10 mg is administered intravenously to the subject, concurrently with the oral administration of acetaminophen and the intravenous administration of an H1 blocker and an H2 blocker about 1 to 2 hours before administering the composition to the subject, wherein optionally the H1 blocker is diphenhydramine and the H2 blocker is ranitidine.

[0068] Embodiment 52 is a composition for the method or use of any one of the preceding embodiments, wherein the composition is administered by infusion in an amount of 3 mg / kg over about 1.5 to 6 hours, and wherein a first dose of corticosteroid is administered orally about 8 to 24 hours before the composition is infused, and a second dose of corticosteroid is administered intravenously about 1 to 2 hours before the composition is infused.

[0069] Embodiment 53 is a composition for the method or use of any one of the preceding embodiments, wherein administering a corticosteroid improves tolerability of the composition comprising the guide RNA.

[0070] Embodiment 54 is a composition for the method or use of any one of the preceding embodiments, wherein administering a corticosteroid reduces the incidence or severity of one or more of inflammation, nausea, vomiting, elevated ALT blood levels, hyperthermia, and / or hyperalgesia in response to the composition comprising the guide RNA.

[0071] Embodiment 55 is a composition for the method or use of any one of the preceding embodiments, wherein administering a corticosteroid reduces or inhibits the production or activity of one or more interferons and / or pro-inflammatory cytokines in response to the composition comprising the guide RNA.

[0072] Embodiment 56 is a composition for the method or use of any one of the preceding embodiments, wherein the composition reduces serum TTR levels.

[0073] Embodiment 57 is a composition for the method or use of embodiment 56, wherein the serum TTR level is reduced by at least 50% compared to the serum TTR level before administration of the composition.

[0074] Embodiment 58 is a composition for the method or use of embodiment 56, which reduces serum TTR levels by 50-60%, 60-70%, 70-80%, 80-90%, 90-95%, 95-98%, 98-99%, or 99-100% compared to serum TTR levels before administration of the composition.

[0075] Embodiment 59 is a composition for the method or use of any one of the preceding embodiments, wherein the composition causes editing of the TTR gene.

[0076] Embodiment 60 is a composition for the method or use of embodiment 59, wherein the editing is calculated as a percentage of the population that is edited (percent editing).

[0077] Embodiment 61 is a composition for the method or use of embodiment 60, wherein the editing percentage is 30-99% of the population.

[0078] Embodiment 62 is a composition for the method or use of embodiment 61, wherein the percent edited is 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the population.

[0079] Embodiment 63 is a composition for the method or use of any one of the preceding embodiments, wherein the composition reduces amyloid deposits in at least one tissue.

[0080] Embodiment 64 is a composition for the method or use of embodiment 63, wherein the at least one tissue comprises one or more of the stomach, colon, sciatic nerve, or dorsal root ganglion.

[0081] Embodiment 65 is a composition for the method or use of any one of embodiments 63 or 64, wherein amyloid deposits are measured 8 weeks after administration of the composition.

[0082] Embodiment 66 is a composition for the method or use of any one of embodiments 63 to 65, wherein amyloid deposits are compared to a negative control, or to levels measured before administration of the composition.

[0083] Embodiment 67 is a composition for the method or use of any one of embodiments 63 to 66, wherein amyloid deposits are measured in biopsy samples and / or by immunostaining.

[0084] Embodiment 68 is a composition for the method or use of any one of embodiments 63 to 67, wherein amyloid deposits are reduced by 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the amyloid deposits seen in a negative control.

[0085] Embodiment 69 is a composition for the method or use of any one of embodiments 63 to 68, wherein amyloid deposits are reduced by 30-35%, 35-40%, 40-45%, 45-50%, 50-55%, 55-60%, 60-65%, 65-70%, 70-75%, 75-80%, 80-85%, 85-90%, 90-95%, or 95-99% of the amyloid deposits seen before administration of the composition.

[0086] Embodiment 70 is a composition for the method or use of any one of the preceding embodiments, wherein the composition is administered or delivered at least twice.

[0087] Embodiment 71 is a composition for the method or use of embodiment 70, wherein the composition is administered or delivered at least three times.

[0088] Embodiment 72 is a composition for the method or use of embodiment 70, wherein the composition is administered or delivered at least four times.

[0089] Embodiment 73 is a composition for the method or use of embodiment 70, wherein the composition is administered or delivered up to 5, 6, 7, 8, 9, or 10 times.

[0090] Embodiment 74 is a composition for the method or use of any one of embodiments 70-73, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days.

[0091] Embodiment 75 is a composition for the method or use of any one of embodiments 70 to 73, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks.

[0092] Embodiment 76 is a composition for the method or use of any one of embodiments 70-73, wherein the administration or delivery occurs at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 months.

[0093] Embodiment 77 is the method or composition of any one of the preceding embodiments, wherein the guide sequence is selected from SEQ ID NOs: 5-82.

[0094] Embodiment 78 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is at least partially complementary to a target sequence present in the human TTR gene.

[0095] Embodiment 79 is the method or composition of embodiment 78, wherein the target sequence is within exon 1, 2, 3, or 4 of the human TTR gene.

[0096] Embodiment 80 is the method or composition of embodiment 78, wherein the target sequence is within exon 1 of the human TTR gene.

[0097] Embodiment 81 is the method or composition of embodiment 78, wherein the target sequence is within exon 2 of the human TTR gene.

[0098] Embodiment 82 is the method or composition of embodiment 78, wherein the target sequence is within exon 3 of the human TTR gene.

[0099] Embodiment 83 is the method or composition of embodiment 78, wherein the target sequence is within exon 4 of the human TTR gene.

[0100] Embodiment 84 is a composition for the method or use of any one of the preceding embodiments, wherein the guide sequence is complementary to a target sequence within the plus strand of TTR.

[0101] Embodiment 85 is the method or composition of any one of embodiments 1 to 83, wherein the guide sequence is complementary to a target sequence within the minus strand of TTR.

[0102] Embodiment 86 is the method or composition of any one of embodiments 1 to 83, wherein the first guide sequence is complementary to a first target sequence within the plus strand of the TTR gene, and the composition further comprises a second guide sequence that is complementary to a second target sequence within the minus strand of the TTR gene.

[0103] Embodiment 87 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is a dual guide (dgRNA).

[0104] Embodiment 88 is the method or composition of any one of embodiments 1 to 86, wherein the guide RNA is a single guide (sgRNA).

[0105] Embodiment 89 is the method or composition of embodiment 88, wherein the sgRNA comprises a guide sequence of SEQ ID NOs: 5-82 and any one of nucleotides 21-100 of SEQ ID NO: 3.

[0106] Embodiment 90 is the method or composition of any one of embodiments 88 and 89, wherein the sgRNA comprises a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 87-124.

[0107] Embodiment 91 is the method or composition of embodiment 88, wherein the sgRNA comprises a sequence selected from SEQ ID NOs: 87-124.

[0108] Embodiment 92 is the method or composition of any one of the preceding embodiments, wherein the guide RNA comprises at least one modification.

[0109] Embodiment 93 is the method or composition of embodiment 92, wherein at least one modification comprises a 2'-O-methyl (2'-O-Me) modified nucleotide.

[0110] Embodiment 94 is the method or composition of embodiment 92 or 93, wherein at least one modification comprises an internucleotide phosphorothioate (PS) linkage.

[0111] Embodiment 95 is the method or composition of any one of embodiments 92 to 94, wherein at least one modification comprises a 2'-fluoro (2'-F) modified nucleotide.

[0112] Embodiment 96 is the method or composition of any one of embodiments 92 to 95, wherein the at least one modification comprises a 5'-end modification, a 3'-end modification, or a 5'- and 3'-end modification.

[0113] Embodiment 97 is the method or composition of any one of embodiments 92 to 96, wherein the at least one modification comprises a modification in one or more of the first five nucleotides at the 5' end.

[0114] Embodiment 98 is the method or composition of any one of embodiments 92 to 97, wherein the at least one modification comprises a modification in one or more of the last five nucleotides at the 3' end.

[0115] Embodiment 99 is the method or composition of any one of embodiments 92 to 98, wherein at least one modification comprises a PS bond between the first four nucleotides.

[0116] Embodiment 100 is the method or composition of any one of embodiments 92 to 99, wherein at least one modification comprises a PS bond between the last four nucleotides.

[0117] Embodiment 101 is the method or composition of any one of embodiments 92 to 100, wherein at least one modification comprises 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end.

[0118] Embodiment 102 is the method or composition of any one of embodiments 92 to 101, wherein at least one modification comprises 2'-O-Me modified nucleotides in the last three nucleotides at the 3' end.

[0119] Embodiment 103 is the method or composition of any one of embodiments 92 to 102, wherein the guide RNA comprises modified nucleotides of SEQ ID NO:3.

[0120] Embodiment 104 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises a pharmaceutically acceptable excipient.

[0121] Embodiment 105 is the method or composition of any one of the preceding embodiments, wherein the guide RNA is associated with a lipid nanoparticle (LNP).

[0122] Embodiment 106 is the method or composition of embodiment 105, wherein the LNP comprises an ionizable lipid.

[0123] Embodiment 107 is the method or composition of embodiment 106, wherein the LNP comprises a biodegradable ionizable lipid.

[0124] Embodiment 108 is the method or composition of any one of embodiments 105-017, wherein the LNP comprises an amine lipid, for example, a CCD lipid.

[0125] Embodiment 109 is the method or composition of any one of embodiments 105-108, wherein the LNP comprises a helper lipid.

[0126] Embodiment 110 is a method for preparing a LNP comprising: (i) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 8-10 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (ii) the LNP comprises about 50-60 mol% amine lipid, such as lipid A, about 27-39.5 mol% helper lipid, about 8-10 mol% neutral lipid, and about 2.5-4 mol% stealth lipid (e.g., PEG lipid), and the N / P ratio of the LNP composition is about 5-7 (e.g., about 6); (iii) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP composition is about 3-10; (iv) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 2.5-4 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (v) the LNP comprises a lipid component, the lipid component comprising about 50-60 mol % of an amine lipid, such as lipid A, about 5-15 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 6; (vi) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, about 0-10 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid; and the N / P ratio of the LNP composition is about 3-10; (vii) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, less than about 1 mol % of a neutral lipid, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, and the N / P ratio of the LNP composition is about 3-10; (viii) the LNP comprises a lipid component, the lipid component comprising about 40-60 mol % of an amine lipid, such as lipid A, and about 1.5-10 mol % of a stealth lipid (e.g., a PEG lipid), with the remainder of the lipid component being a helper lipid, the N / P ratio of the LNP composition being about 3-10, and the LNP composition is essentially free of, or free of, neutral phospholipids; or (ix) The method or composition of any one of embodiments 105-109, wherein the LNP comprises a lipid component comprising about 50-60 mol % amine lipid, such as lipid A, about 8-10 mol % neutral lipid, and about 2.5-4 mol % stealth lipid (e.g., PEG lipid), with the remainder of the lipid component being helper lipid, and the N / P ratio of the LNP composition being about 3-7.

[0127] Embodiment 111 is the method or composition of any one of embodiments 105-110, wherein the LNP comprises a neutral lipid.

[0128] Embodiment 112 is the method or composition of any one of embodiments 105-111, wherein the amine lipid is present at about 50 mol %.

[0129] Embodiment 113 is the method or composition of any one of embodiments 105-112, wherein the neutral lipid is present at about 9 mol %.

[0130] Embodiment 114 is the method or composition of any one of embodiments 105-113, wherein the stealth lipid is present at about 3 mol %.

[0131] Embodiment 115 is the method or composition of any one of embodiments 105-114, wherein the helper lipid is present at about 38 mol %.

[0132] Embodiment 116 is the method or composition of any one of embodiments 105-115, wherein the N / P ratio of the LNP composition is about 6.

[0133] Embodiment 117 is the method or composition of any one of embodiments 105-116, wherein the LNP comprises a lipid component comprising about 50 mol% of an amine lipid, such as lipid A, about 9 mol% of a neutral lipid, such as DSPC, and about 3 mol% of a stealth lipid, such as a PEG lipid (e.g., PEG2k-DMG), with the remainder of the lipid component being a helper lipid, such as cholesterol, and wherein the N / P ratio of the LNP composition is about 6.

[0134] Embodiment 118 is the method or composition of any one of embodiments 105 to 117, wherein the amine lipid is lipid A.

[0135] Embodiment 119 is the method or composition of any one of embodiments 105-118, wherein the neutral lipid is DSPC.

[0136] Embodiment 120 is the method or composition of any one of embodiments 105-119, wherein the stealth lipid is PEG2k-DMG.

[0137] Embodiment 121 is the method or composition of any one of embodiments 105-120, wherein the helper lipid is cholesterol.

[0138] Embodiment 122 is the method or composition of any one of embodiments 105 to 121, wherein the LNP comprises a lipid component comprising about 50 mol% lipid A, about 9 mol% DSPC, and about 3 mol% PEG2k-DMG, with the remainder of the lipid component being cholesterol, and the N / P ratio of the LNP composition is about 6.

[0139] Embodiment 123 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises an RNA-guided DNA binding agent.

[0140] Embodiment 124 is the method or composition of any one of the preceding embodiments, wherein the composition further comprises a polynucleotide encoding the RNA-guided DNA-binding agent.

[0141] Embodiment 125 is the method or composition of embodiment 124, wherein the polynucleotide is mRNA.

[0142] Embodiment 126 is the method or composition of any one of embodiments 123 to 125, wherein the RNA-guided DNA-binding agent is a Cas cleavase.

[0143] Embodiment 127 is the method or composition of any one of embodiments 123 to 126, wherein the RNA-guided DNA binding agent is a Cas from a type II CRISPR / Cas system.

[0144] Embodiment 128 is the method or composition of any one of embodiments 123 to 127, wherein the RNA-guided DNA binding agent is Cas9.

[0145] Embodiment 129 is the method or composition of embodiment 128, wherein the RNA-guided DNA binding agent is S. pyogenes Cas9 nuclease.

[0146] Embodiment 130 is a method for producing a nucleic acid sequence comprising the steps of: a. the open reading frame comprises a sequence having at least 95% identity to SEQ ID NO: 311; b. the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides; c. the open reading frame consists of a set of codons, at least 75% of which are codons listed in Table 4; d. the open reading frame has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content; and / or e. The method or composition of any one of embodiments 124-129, wherein the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content.

[0147] Embodiment 131 is the composition or method of embodiment 130, wherein the open reading frame has at least 95% identity to SEQ ID NO: 311 over at least the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence.

[0148] Embodiment 132 is the composition or method of embodiment 130 or 131, wherein the open reading frame comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 311.

[0149] Embodiment 133 is the composition or method of any one of embodiments 130 to 132, wherein at least 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons in the open reading frame are codons listed in Table 4.

[0150] Embodiment 134 is the composition or method of any one of embodiments 130 to 133, wherein the open reading frame has an adenine content ranging from its minimum adenine content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of its minimum adenine content.

[0151] Embodiment 135 is the composition or method of any one of embodiments 130 to 134, wherein the open reading frame has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 101%, 102%, 103%, 105%, 110%, 115%, 120%, 125%, 130%, 135%, 140%, 145%, or 150% of its minimum adenine dinucleotide content.

[0152] Embodiment 136 is the composition or method of any one of embodiments 124 to 135, wherein the polynucleotide comprises a 5'UTR having at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277.

[0153] Embodiment 137 is the composition or method of any one of embodiments 124 to 136, wherein the polynucleotide comprises a 3'UTR having at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240.

[0154] Embodiment 138 is the composition or method of any one of embodiments 124 to 137, wherein the polynucleotide comprises a 5'UTR and a 3'UTR from the same source.

[0155] Embodiment 139 is the composition or method of any one of embodiments 124 to 138, wherein the polynucleotide comprises a 5' cap selected from Cap0, Cap1, and Cap2.

[0156] Embodiment 140 is the composition or method of any one of embodiments 124 to 139, wherein the open reading frame comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO: 311.

[0157] Embodiment 141 is the composition or method of any of embodiments 125-140, wherein at least 10% of the uridines in the mRNA are substituted with modified uridines.

[0158] Embodiment 142 is the composition or method of embodiment 141, wherein the modified uridine is one or more of N1-methyl-pseudouridine, pseudouridine, 5-methoxyuridine, or 5-iodouridine.

[0159] Embodiment 143 is the composition or method of embodiment 141, wherein the modified uridine is one or both of N1-methyl-pseudouridine or 5-methoxyuridine.

[0160] Embodiment 144 is the composition or method of embodiment 141, wherein the modified uridine is N1-methyl-pseudouridine.

[0161] Embodiment 145 is the composition or method of embodiment 141, wherein the modified uridine is 5-methoxyuridine.

[0162] Embodiment 146 is the composition or method of any one of embodiments 141 to 145, wherein between 15% and 45% of the uridines are substituted with modified uridines.

[0163] Embodiment 147 is the composition or method of any one of embodiments 141 to 146, wherein at least 20% or at least 30% of the uridines are substituted with modified uridines.

[0164] Embodiment 148 is the composition or method of embodiment 147, wherein at least 80% or at least 90% of the uridines are substituted with modified uridines.

[0165] Embodiment 149 is the composition or method of embodiment 147, wherein 100% of the uridines are substituted with modified uridines.

[0166] Embodiment 150 is the method or composition of any one of embodiments 123 to 149, wherein the RNA-guided DNA binding agent is modified.

[0167] Embodiment 151 is the method or composition of embodiment 150, wherein the modified RNA-guided DNA binding agent comprises a nuclear localization signal (NLS).

[0168] Embodiment 152 is the method or composition of any one of the preceding embodiments, wherein the composition is a pharmaceutical formulation and further comprises a pharmaceutically acceptable carrier.

[0169] Embodiment 153 is a composition for the method or use of any one of the preceding embodiments, wherein the composition reduces or prevents amyloid or amyloid fibrils comprising TTR.

[0170] Embodiment 154 is a composition for the method or use of embodiment 153, wherein the amyloid or amyloid fibrils are in the nerves, heart, or gastrointestinal tract.

[0171] Embodiment 155 is the method or composition for use of any one of the preceding embodiments, wherein non-homologous end joining (NHEJ) causes the mutation during repair of the DSB in the TTR gene.

[0172] Embodiment 156 is a composition for the method or use of embodiment 155, wherein the NHEJ causes a deletion or insertion of a nucleotide during repair of the DSB in the TTR gene.

[0173] Embodiment 157 is the composition for the method or use of embodiment 156, wherein the deletion or insertion of nucleotides induces a frameshift or nonsense mutation in the TTR gene.

[0174] Embodiment 158 ​​is a composition for the method or use of embodiment 155 or 156, wherein a frameshift or nonsense mutation is induced in the TTR gene in at least 50% of liver cells.

[0175] Embodiment 159 is a composition for the method or use of embodiment 158, wherein a frameshift or nonsense mutation is induced in the TTR gene in 50% to 60%, 60% to 70%, 70% or 80%, 80% to 90%, 90 to 95%, 95% to 99%, or 99% to 100% of liver cells.

[0176] Embodiment 160 is a composition for the method or use of any one of embodiments 156 to 159, wherein nucleotide deletions or insertions occur at least 50 times more frequently in the TTR gene than in off-target sites.

[0177] Embodiment 161 is a composition for the method or use of embodiment 160, wherein nucleotide deletions or insertions occur 50-fold to 150-fold, 150-fold to 500-fold, 500-fold to 1500-fold, 1500-fold to 5000-fold, 5000-fold to 15000-fold, 15000-fold to 30000-fold, or 30000-fold to 60000-fold more frequently in the TTR gene than at off-target sites.

[0178] Embodiment 162 is a composition for the method or use of any one of embodiments 156 to 161, wherein the nucleotide deletions or insertions occur at no more than 3, no more than 2, no more than 1, or no off-target sites in the primary human hepatocyte, and optionally, the off-target sites do not occur in protein-coding regions within the genome of the primary human hepatocyte.

[0179] Embodiment 163 is a composition for the method or use of embodiment 162, wherein the nucleotide deletions or insertions occur at a number of off-target sites in the primary human hepatocytes that is fewer than the number of off-target sites at which nucleotide deletions or insertions occur in cells overexpressing Cas9, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0180] Embodiment 164 is a composition for the method or use of embodiment 163, wherein the cells overexpressing Cas9 are HEK293 cells stably expressing Cas9.

[0181] Embodiment 165 is a composition for the method or use of any one of embodiments 162 to 164, wherein the number of off-target sites in primary human hepatocytes is determined by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and guide RNA, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0182] Embodiment 166 is a composition for the method or use of any one of embodiments 162 to 164, wherein the number of off-target sites in primary human hepatocytes is determined by an oligonucleotide insertion assay comprising analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, a guide RNA, and a donor oligonucleotide, and optionally, the off-target sites do not occur within protein-coding regions in the genome of the primary human hepatocytes.

[0183] Embodiment 167 is a method for producing a guide RNA comprising the steps of: a) SEQ ID NO: 92 or 104, b) SEQ ID NO: 87, 89, 96, or 113; c) SEQ ID NO: 100, 102, 106, 111, or 112, or d) SEQ ID NO: 88, 90, 91, 93, 94, 95, 97, 101, 103, 108, or 109;

[0184] Optionally, the method or composition of any one of the preceding embodiments, wherein the guide RNA does not generate indels at off-target sites occurring within protein-coding regions in the genome of the primary human hepatocyte.

[0185] Embodiment 168 is a composition for the method or use of any one of the preceding embodiments, wherein administering the composition reduces the level of TTR in a subject.

[0186] Embodiment 169 is a composition for the method or use of embodiment 168, wherein the level of TTR is reduced by at least 50%.

[0187] Embodiment 170 is a composition for the method or use of embodiment 169, wherein the level of TTR is reduced by 50% to 60%, 60% to 70%, 70% or 80%, 80% to 90%, 90 to 95%, 95% to 99%, or 99% to 100%.

[0188] Embodiment 171 is a composition for the method or use of embodiment 168 or 169, wherein the level of TTR is measured in serum, plasma, blood, cerebrospinal fluid, or sputum.

[0189] Embodiment 172 is a composition for the method or use of embodiment 168 or 169, wherein the level of TTR is measured in the liver, choroid plexus, and / or retina.

[0190] Embodiment 173 is the composition for the method or use of any one of embodiments 168 to 172, wherein the level of TTR is measured via enzyme-linked immunosorbent assay (ELISA).

[0191] Embodiment 174 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has ATTR.

[0192] Embodiment 175 is a composition for the method or use of any one of the preceding embodiments, wherein the subject is a human.

[0193] Embodiment 176 is the composition for the method or use of embodiment 174 or 175, wherein the subject has ATTRwt.

[0194] Embodiment 177 is the composition for the method or use of embodiment 174 or 175, wherein the subject has an inherited ATTR.

[0195] Embodiment 178 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has a family history of ATTR.

[0196] Embodiment 179 is a composition for the method or use of any one of the preceding embodiments, wherein the subject has familial amyloid polyneuropathy.

[0197] Embodiment 180 is the composition for the method or use of any one of the preceding embodiments, wherein the subject has only or primarily neurological symptoms of ATTR.

[0198] Embodiment 181 is a composition for the method or use of any one of embodiments 1 to 179, wherein the subject has familial amyloidotic cardiomyopathy.

[0199] Embodiment 182 is the composition for the method or use of any one of embodiments 1-179 or 181, wherein the subject has only or primarily cardiac symptoms of ATTR.

[0200] Embodiment 183 is a composition for the method or use of any one of the preceding embodiments, wherein the subject expresses TTR with the V30 mutation.

[0201] Embodiment 184 is a composition for the method or use of embodiment 183, wherein the V30 mutation is V30A, V30G, V30L, or V30M.

[0202] Embodiment 185 is the composition for the method or use of any one of the preceding embodiments, wherein the subject expresses TTR with a T60 mutation.

[0203] Embodiment 186 is the composition for the method or use of embodiment 185, wherein the T60 mutation is T60A.

[0204] Embodiment 187 is the composition for the method or use of any one of the preceding embodiments, wherein the subject expresses TTR with the V122 mutation.

[0205] Embodiment 188 is the composition for the method or use of embodiment 187, wherein the V122 mutation is V122A, V122I, or V122(-).

[0206] Embodiment 189 is the composition for the method or use of any one of the preceding embodiments, wherein the subject expresses wild-type TTR.

[0207] Embodiment 190 is a composition for the method or use of any one of embodiments 1 to 182, or embodiment 189, wherein the subject does not express TTR with the V30, T60, or V122 mutation.

[0208] Embodiment 191 is a composition for the method or use of any one of embodiments 1 to 182, or 189 to 190, wherein the subject does not express TTR with a deleterious mutation.

[0209] Embodiment 192 is the composition for the method or use of any one of embodiments 190 to 192, wherein the subject is homozygous for wild-type TTR.

[0210] Embodiment 193 is a composition for the method or use of any one of the preceding embodiments, wherein the subject experiences improvement, stabilization, or slowed change in symptoms of sensory motor neuropathy after administration.

[0211] Embodiment 194 is a composition for the method or use of embodiment 193, wherein the sensorimotor neuropathy improves, stabilizes, or slows down in change as measured using electromyography, nerve conduction studies, or patient-reported outcomes.

[0212] Embodiment 195 is a composition for the method or use of any one of the preceding embodiments, wherein the subject experiences improvement, stabilization, or slowed change in symptoms of congestive heart failure.

[0213] Embodiment 196 is a composition for the method or use of embodiment 195, wherein the improvement, stabilization, or slowing of congestive heart failure is measured using cardiac biomarker testing, pulmonary function testing, chest x-ray, or electrocardiography.

[0214] Embodiment 197 is the composition for the method or use of any one of the preceding embodiments, wherein the composition or pharmaceutical formulation is administered via a viral vector.

[0215] Embodiment 198 is a composition for the method or use of any one of the preceding embodiments, wherein the composition or pharmaceutical formulation is administered via lipid nanoparticles.

[0216] Embodiment 199 is the composition for the method or use of any one of the preceding embodiments, wherein the subject is tested for a specific mutation in the TTR gene prior to administering the composition or formulation.

[0217] Embodiment 200 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 5.

[0218] Embodiment 201 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 6.

[0219] Embodiment 202 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 7.

[0220] Embodiment 203 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 8.

[0221] Embodiment 204 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 9.

[0222] Embodiment 205 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 10.

[0223] Embodiment 206 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 11.

[0224] Embodiment 207 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 12.

[0225] Embodiment 208 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 13.

[0226] Embodiment 209 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 14.

[0227] Embodiment 210 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 15.

[0228] Embodiment 211 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 16.

[0229] Embodiment 212 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 17.

[0230] Embodiment 213 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 18.

[0231] Embodiment 214 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 19.

[0232] Embodiment 215 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 20.

[0233] Embodiment 216 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 21.

[0234] Embodiment 217 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 22.

[0235] Embodiment 218 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 23.

[0236] Embodiment 219 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 24.

[0237] Embodiment 220 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 25.

[0238] Embodiment 221 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 26.

[0239] Embodiment 222 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 27.

[0240] Embodiment 223 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 28.

[0241] Embodiment 224 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 29.

[0242] Embodiment 225 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 30.

[0243] Embodiment 226 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 31.

[0244] Embodiment 227 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 32.

[0245] Embodiment 228 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 33.

[0246] Embodiment 229 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 34.

[0247] Embodiment 230 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 35.

[0248] Embodiment 231 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 36.

[0249] Embodiment 232 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 37.

[0250] Embodiment 233 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 38.

[0251] Embodiment 234 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 39.

[0252] Embodiment 235 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 40.

[0253] Embodiment 236 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 41.

[0254] Embodiment 237 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 42.

[0255] Embodiment 238 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 43.

[0256] Embodiment 239 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 44.

[0257] Embodiment 240 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 45.

[0258] Embodiment 241 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 46.

[0259] Embodiment 242 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 47.

[0260] Embodiment 243 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 48.

[0261] Embodiment 244 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 49.

[0262] Embodiment 245 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 50.

[0263] Embodiment 246 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 51.

[0264] Embodiment 247 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 52.

[0265] Embodiment 248 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 53.

[0266] Embodiment 249 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 54.

[0267] Embodiment 250 is the method or composition of any one of embodiments 1-199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 55.

[0268] Embodiment 251 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 56.

[0269] Embodiment 252 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 57.

[0270] Embodiment 253 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 58.

[0271] Embodiment 254 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 59.

[0272] Embodiment 255 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 60.

[0273] Embodiment 256 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 61.

[0274] Embodiment 257 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 62.

[0275] Embodiment 258 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 63.

[0276] Embodiment 259 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 64.

[0277] Embodiment 260 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 65.

[0278] Embodiment 261 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 66.

[0279] Embodiment 262 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 67.

[0280] Embodiment 263 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 68.

[0281] Embodiment 264 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 69.

[0282] Embodiment 265 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 70.

[0283] Embodiment 266 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 71.

[0284] Embodiment 267 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 72.

[0285] Embodiment 268 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 73.

[0286] Embodiment 269 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 74.

[0287] Embodiment 270 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 75.

[0288] Embodiment 271 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 76.

[0289] Embodiment 272 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 77.

[0290] Embodiment 273 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 78.

[0291] Embodiment 274 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 79.

[0292] Embodiment 275 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 80.

[0293] Embodiment 276 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 81.

[0294] Embodiment 277 is the method or composition of any one of embodiments 1 to 199, wherein the sequence selected from SEQ ID NOs: 5-82 is SEQ ID NO: 82.

[0295] Embodiment 278 is the use of a composition or formulation of any of the preceding embodiments for the preparation of a medicament for treating a human subject with ATTR. [Brief explanation of the drawings]

[0296] [Figure 1] FIG. 1 shows a schematic diagram of chromosome 18 with regions of the TTR gene targeted by the guide sequences provided in Table 1. [Figure 2]Off-target analysis in HEK293_Cas9 cells of specific dual-guide RNAs targeting TTR. On-target sites are designated by solid squares for each dual-guide RNA tested, while black circles represent potential off-target sites. [Figure 3] Off-target analysis in HEK_Cas9 cells of specific single-guide RNAs targeting TTR. On-target sites are designated by solid squares for each single-guide RNA tested, while open circles represent potential off-target sites. [Figure 4] Figure 1 shows the dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary human hepatocytes. [Figure 5] Dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figure 6] FIG. 1 shows a dose-response curve of lipid nanoparticle-formulated cynomolgus monkey TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figure 7] The percent editing (% editing) of TTR and reduction of secreted TTR after guide administration are shown in the HUH7 cell array provided on the x-axis. Values ​​are normalized to the amount of alpha-1-antitrypsin (AAT) protein. [Figure 8] Figure 1 shows a Western blot analysis of intracellular TTR following administration of targeted guides (listed in Table 1) in HUH7 cells. [Figure 9] Figure 1 shows the percentage of hepatic editing of TTR observed after administration of LNP formulations to mice harboring humanized (G481-G499) or murine (G282) TTR. NOTE: The first three "0"s of each guide ID have been omitted from the figures; for example, "G481" is "G000481" in Tables 2 and 3. [Figure 10A] Serum TTR levels observed after the dosing regimens indicated on the horizontal axis are shown as μg / ml (FIG. 10A) or as a percentage of TSS controls (FIG. 10B). MPK = mg / kg total. [Figure 10B] (As mentioned above.) [Figure 11A] Serum TTR levels observed following the dosing regimens indicated on the horizontal axis are shown for a 1 mg / kg (FIG. 11A) or 0.5 mg / kg dose (FIG. 11B). Data for a single 2 mg / kg dose are included as the right-hand column in both panels. [Figure 11B] (As mentioned above.) [Figure 12A] The percentage of liver editing observed after the dosing regimens indicated on the horizontal axis is shown for a 1 mg / kg (FIG. 12A) or 0.5 mg / kg dosage (FIG. 12B). Figure 12C shows the percentage of liver editing observed after a single dose of 0.5, 1, or 2 mg / kg. [Figure 12B] (As mentioned above.) [Figure 12C] (As mentioned above.) [Figure 13] Figure 1 shows the liver editing percentage observed after administration of LNP formulations to mice humanized for the TTR gene. Note: The first three "0"s of each guide ID have been omitted from the figure; for example, "G481" is "G000481" in Tables 2 and 3. [Figures 14A-14B] We show a correlation between liver editing (Figure 14A) and serum human TTR levels (Figure 14B) after administration of the LNP formulation to mice humanized for the TTR gene. Note: The first three "0"s in each guide ID have been omitted from the figure; for example, "G481" is "G000481" in Tables 2 and 3. [Figure 15A] 15A and 15B show that there is a dose response in wild-type mice with respect to percent editing (FIG. 15A) and serum TTR levels (FIG. 15B) after administration of an LNP formulation containing guide G502, which is cross-homologous between mouse and cynomolgus monkey. [Figure 15B] (As mentioned above.) [Figure 16] Dose-response curve of lipid nanoparticle-formulated human TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figure 17]FIG. 1 shows the dose-response curve of lipid nanoparticle-formulated cynomolgus monkey TTR-specific sgRNA in primary human hepatocytes. [Figure 18] FIG. 1 shows a dose-response curve of lipid nanoparticle-formulated cynomolgus monkey TTR-specific sgRNA in primary cynomolgus monkey hepatocytes. [Figures 19A-19B] Serum TTR (TSS%, Figures 19A and 19C) and editorial results after dosing with LNP formulations at the indicated ratios and amounts are shown (Figures 19B and 19D). [Figures 19C-19D] (As mentioned above.) [Figure 20] Figure 1 shows off-target analysis of specific single guide RNAs targeting TTR in primary human hepatocytes (PHH). In the graph, black squares represent the identification of on-target cleavage sites, while white circles represent the identification of potential off-target sites. [Figure 21A] Shown is the percent editing at on-target (ONT, FIG. 21A) and two off-target sites (OT2 and OT4) in primary human stem cells following administration of lipid nanoparticle-formulated G000480. [Figure 21B] 21B is a scaled version of the OT2, OT4, and negative control (Neg Cont) data in FIG. 21A. [Figure 21B] (As mentioned above.) [Figure 22A] Shown is the percent editing at on-target (ONT, FIG. 22A) and off-target sites (OT4) in primary human stem cells following administration of lipid nanoparticle-formulated G000486. [Figure 22B] 22B is a scaled version of the OT4 and negative control (Neg Cont) data in FIG. 22A. [Figure 22B] (As mentioned above.) [Figure 23A]The percentage of editing at the TTR locus (Figure 23A) and the number of insertion and deletion events (Figure 23B) are shown. Figure 23A shows the percentage of editing at the TTR locus in the control and treatment (administered lipid nanoparticle-formulated TTR-specific sgRNA) groups. Figure 23B shows the number of insertion and deletion events at the TTR locus when editing was observed in the treatment group of Figure 23A. [Figure 23B] (As mentioned above.) [Figure 24A] Circulating serum TTR levels (Figure 24A) and cerebrospinal fluid (CSF) TTR levels (Figure 24B) are shown in μg / mL for the control and treatment (treated with lipid nanoparticle-formulated TTR-specific sgRNA) groups, respectively. Treatment resulted in a greater than 99% knockdown of serum TTR levels. [Figure 24B] (As mentioned above.) [Figures 25A-25B] Immunohistochemistry images of TTR staining in the stomach (FIG. 25A), colon (FIG. 25B), sciatic nerve (FIG. 25C), and dorsal root ganglion (DRG) (FIG. 25D) from control and treated (treated with lipid nanoparticle-formulated TTR-specific sgRNA) mice are shown. On the right, bar graphs show the reduction in TTR staining in treated mice 8 weeks after treatment, as measured by percent area coverage for each tissue type. [Figures 25C-25D] (As mentioned above.) [Figure 26A] Liver TTR editing (Figure 26A) and serum TTR results (in μg / mL) (Figure 26B) and as a percentage of TSS-treated controls (Figure 26C) are shown from humanized TTR mice administered LNP formulations containing Cas9 mRNA (SEQ ID NO: 1) at a 1:1 weight ratio to the guide across various dose ranges of guides G000480, G000488, G000489, and G000502, respectively. [Figure 26B] (As mentioned above.) [Figure 26C] (As mentioned above.) [Figure 27A]Liver TTR editing (Figure 27A) and serum TTR results (in μg / mL) (Figure 27B) and as a percentage of TSS-treated controls (Figure 27C) are shown from humanized TTR mice administered LNP formulations containing Cas9 mRNA (SEQ ID NO: 1) at a 1:1 weight ratio to the guide across various dose ranges of guides G000481, G000482, G000486, and G000499, respectively. [Figure 27B] (As mentioned above.) [Figure 27C] (As mentioned above.) [Figure 28A] Liver TTR editing (Figure 28A) and serum TTR results (in μg / mL) (Figure 28B) and as a percentage of TSS-treated controls (Figure 28C) are shown from humanized TTR mice administered LNP formulations containing Cas9 mRNA (SEQ ID NO: 1) at a 1:2 weight ratio to the guide across various dose ranges of guides G000480, G000481, G000486, G000499, and G000502, respectively. [Figure 28B] (As mentioned above.) [Figure 28C] (As mentioned above.) [Figure 29] Relative expression of TTR mRNA in primary human hepatocytes (PHHs) after treatment with LNPs containing the indicated Cas9 mRNA and gRNA compared to negative (untreated) controls. [Figure 30] Relative expression of TTR mRNA in primary human hepatocytes (PHHs) after treatment with LNPs containing the indicated Cas9 mRNA and gRNA compared to negative (untreated) controls. [Figure 31A] Serum TTR levels (FIG. 31A), liver TTR editing (FIG. 31B), and circulating ALT levels (FIG. 31C) in an in vivo study in non-human primates comparing 30-minute administration of LNPs with a longer dosing protocol are shown. [Figure 31B] (As mentioned above.) [Figure 31C] (As mentioned above.) DETAILED DESCRIPTION OF THE INVENTION

[0297] Reference will now be made in detail to certain embodiments of the invention, examples of which are illustrated in the accompanying drawings. While the invention will be described in conjunction with the illustrated embodiments, it will be understood that they are not intended to limit the invention to those embodiments. On the contrary, the invention is intended to cover all alternatives, modifications, and equivalents, which may be included within the invention as defined by the appended claims.

[0298] Before describing the present teachings in detail, it should be understood that the present disclosure is not limited to particular compositions or process steps, as such may vary. It should be noted that as used herein and in the appended claims, the singular forms "a," "an," and "the" include plural references unless the context clearly dictates otherwise. Thus, for example, a reference to "a conjugate" includes a plurality of conjugates, a reference to "a cell" includes a plurality of cells, and so forth.

[0299] Numerical ranges are inclusive of the numbers defining the range. Measured and measurable values ​​are understood to be approximate, taking into account significant orders of magnitude and the error associated with the measurements. Additionally, the use of "comprise," "comprises," "comprising," "contain," "contains," "containing," "include," "includes," and "including" is not intended to be limiting. It should be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the teachings herein.

[0300] Unless otherwise stated in the specification above, embodiments herein that recite various components as "comprising" are also assumed to "consist of" or "consist essentially of" the recited components. Embodiments herein that recite various components as "consisting of" are also assumed to "comprising" or "consisting essentially of" the recited components. Embodiments herein that recite various components as "consisting essentially of" are also assumed to "consist of" or "comprising" the recited components (this interchangeability does not apply to the use of these terms in the claims). The term "or" is used in its inclusive sense, i.e., equivalent to "and / or," unless the context clearly dictates otherwise.

[0301] The chapter headings used herein are for organizational purposes only and should not be construed as limiting the desired subject matter in any way. In the event that any material incorporated by reference contradicts any term defined herein or any other explicit content of this specification, this specification shall control. While the present teachings are described in conjunction with various embodiments, it is not intended that the present teachings be limited to such embodiments. On the contrary, the present teachings encompass various alternatives, modifications, and equivalents, as will be understood by those skilled in the art.

[0302] I. Definition Unless otherwise stated, the following terms and phrases used herein are intended to have the following meanings:

[0303] "Polynucleotide" and "nucleic acid" are used herein to refer to polymeric compounds comprising nucleosides or nucleoside analogs (including traditional RNA, DNA, mixed RNA-DNA, and polymers of their analogs) with nitrogenous heterocyclic bases or base analogs linked together along the backbone. The nucleic acid "backbone" can be composed of various linkages, including one or more of sugar phosphodiester linkages, peptide-nucleic acid linkages ("peptide nucleic acid" or PNA, PCT Publication No. WO 95 / 32305), phosphorothioate linkages, methylphosphonate linkages, or combinations thereof. The sugar moiety of the nucleic acid can be ribose, deoxyribose, or similar compounds with substitutions, e.g., 2' methoxy or 2' halide substitutions. The nitrogenous bases can be the traditional bases (A, G, C, T, U), their analogs (e.g., modified uridines such as 5-methoxyuridine, pseudouridine, or N1-methylpseudouridine), derivatives of inosine, purine, or pyrimidine (e.g., N 4 -methyldeoxyguanosine, deaza- or aza-purines, deaza- or aza-pyrimidines, pyrimidine bases with a substituent at the 5- or 6-position (e.g., 5-methylcytosine), purine bases with a substituent at the 2-, 6-, or 8-position, 2-amino-6-methylaminopurine, O 6 -methylguanine, 4-thio-pyrimidine, 4-amino-pyrimidine, 4-dimethylhydrazine-pyrimidine, and O 4 5,378,825 and PCT Publication WO 93 / 13121). For a general discussion, see The Biochemistry of the Nucleic Acids, vol. 5-36, Adams et al., ed., 11 th(See U.S. Pat. No. 5,585,481). Nucleic acids may contain one or more "abasic" residues, where the backbone does not contain a nitrogenous base at any position in the polymer (U.S. Pat. No. 5,585,481). Nucleic acids may contain only conventional RNA or DNA sugars, bases, and linkages, or may contain both conventional components and substitutions (e.g., conventional bases with 2' methoxy linkages, or polymers containing both conventional bases and one or more base analogs). Nucleic acids include "locked nucleic acids" (LNAs), analogs containing one or more LNA nucleotide monomers with a bicyclic furanose unit locked to an RNA-mimetic sugar structure, enhancing hybridization affinity for complementary RNA and DNA sequences (Vester and Wengel, 2004, Biochemistry 43(42):13233-41). RNA and DNA have different sugar moieties and may differ by the presence of uracil or its analogs in RNA and thymine or its analogs in DNA.

[0304] As used herein, "polypeptide" refers to a multimeric compound comprising amino acid residues capable of adopting a three-dimensional conformation. Polypeptides include, but are not limited to, enzymes, proenzyme proteins, regulatory proteins, structural proteins, receptors, nucleic acid binding proteins, antibodies, and the like. Polypeptides may, but do not necessarily, include post-translational modifications, unnatural amino acids, artificial groups, and the like.

[0305] "Guide RNA," "gRNA," and "guide" are used interchangeably herein to refer to either crRNA (also known as CRISPR RNA) or a combination of crRNA and trRNA (also known as tracrRNA). The crRNA and trRNA can associate as a single-stranded RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). "Guide RNA" or "gRNA" refers to each type. The trRNA can be a naturally occurring sequence or a trRNA sequence that has modifications or variations compared to the naturally occurring sequence. The guide RNA can include modified RNA as described herein.

[0306] As used herein, a "guide sequence" refers to a sequence within a guide RNA that is complementary to a target sequence and functions to direct the guide RNA to the target sequence for binding or modification (e.g., cleavage) by an RNA-guided DNA-binding agent. A "guide sequence" may also be referred to as a "targeting sequence" or a "spacer sequence." A guide sequence can be 20 base pairs in length, for example, in the case of Streptococcus pyogenes (i.e., Spy Cas9) and related Cas9 homologs / orthologs. Shorter or longer sequences, such as 15, 16, 17, 18, 19, 21, 22, 23, 24, or 25 nucleotides in length, can also be used as a guide. For example, in some embodiments, the guide sequence comprises at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82. In some embodiments, the target sequence is, for example, within a gene or on a chromosome, and is complementary to the guide sequence. In some embodiments, the degree of complementarity or identity between a guide sequence and its corresponding target sequence can be about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. For example, in some embodiments, the guide sequence comprises a sequence having about 75%, 80%, 85%, 88%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity for at least 17, 18, 19, or 20 contiguous nucleotides of a sequence selected from SEQ ID NOs: 5-82. In some embodiments, the guide sequence and target sequence can be 100% complementary or identical. In other embodiments, the guide sequence and target sequence may contain at least one mismatch. For example, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the total length of the target sequence is at least 17, 18, 19, 20, or more base pairs. In some embodiments, the guide sequence and target sequence may contain 1 to 4 mismatches, and the guide sequence comprises at least 17, 18, 19, 20, or more nucleotides.In some embodiments, the guide sequence and target sequence may contain 1, 2, 3, or 4 mismatches, and the guide sequence comprises 20 nucleotides.

[0307] Because the nucleic acid substrate of a Cas protein is a double-stranded nucleic acid, the target sequence of the Cas protein includes both the plus and minus strands of genomic DNA (i.e., a given sequence and its reverse complement). Thus, when a guide sequence is said to be "complementary to a target sequence," it should be understood that it can direct the guide RNA to bind to the reverse complement of the target sequence. Thus, in some embodiments, when the guide sequence binds to the reverse complement of the target sequence, the guide sequence is identical to certain nucleotides of the target sequence (e.g., the target sequence without the PAM), except for the substitution of U for T in the guide sequence.

[0308] As used herein, "RNA-guided DNA binding agent" refers to a polypeptide or polypeptide complex having RNA and DNA binding activity, or a DNA-binding subunit of such a complex, wherein the DNA-binding activity is sequence-specific and dependent on the sequence of the RNA. Exemplary RNA-guided DNA binding agents include Cas cleavase / nickases and their inactivated forms ("dCas DNA binding agents"). As used herein, "Cas nuclease," also referred to as "Cas protein," encompasses Cas cleavase, Cas nickase, and dCas DNA binding agents. Cas cleavase / nickases and dCas DNA binding agents include the Csm or Cmr complex of type III CRISPR systems, Cas10, Csm1, or their Cmr2 subunits, the Cascade complex of type I CRISPR systems, their Cas3 subunits, and class 2 Cas nucleases. As used herein, a "Class 2 Cas nuclease" is a single-chain polypeptide with RNA-guided DNA-binding activity, such as Cas9 or Cpfl nuclease. Class 2 Cas nucleases include Class 2 Cas cleavases and Class 2 Cas nickases (e.g., H840A, D10A, or N863A variants) that also have RNA-guided DNA cleavase or nickase activity, as well as Class 2 dCas DNA binders in which the cleavase / nickase activity has been inactivated. Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, C2c3, HF Cas9 (e.g., N497A, R661A, Q695A, Q926A variants), HypaCas9 (e.g., N692A, M694A, Q695A, H698A variants), eSPCas9(1.0) (e.g., K810A, K1003A, R1060A variants), and eSPCas9(1.1) (e.g., K848A, K1003A, R1060A variants) proteins, and modifications thereof. The Cpf1 protein (Zetsche et al., Cell, 163:1-13 (2015)) is homologous to Cas9 and contains a RuvC-like nuclease domain.The Cpf1 sequences of Zetsche are incorporated by reference in their entirety. See, e.g., Tables S1 and S3 of Zetsche. "Cas9" encompasses Spy Cas9, the Cas9 variants listed herein, and their equivalents. See, e.g., Makarova et al., Nat Rev Microbiol, 13(11):722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015).

[0309] The term "modified uridine" is used herein to refer to a nucleoside other than thymidine that has the same hydrogen bond acceptor as uridine and has one or more structural differences from uridine. In some embodiments, the modified uridine is a substituted uridine, i.e., a uridine in which one or more aprotic substituents (e.g., alkoxy, e.g., methoxy) are placed in place of a proton. In some embodiments, the modified uridine is a pseudouridine. In some embodiments, the modified uridine is a substituted pseudouridine, i.e., a pseudouridine in which one or more aprotic substituents (e.g., alkyl, e.g., methyl) are placed in place of a proton, e.g., N1-methylpseudouridine. In some embodiments, the modified uridine is any of a substituted uridine, pseudouridine, or substituted pseudouridine.

[0310] As used herein, a "uridine position" refers to a position in a polynucleotide that is occupied by a uridine or modified uridine. Thus, for example, a polynucleotide in which "100% of the uridine positions are modified uridines" contains modified uridines at all positions that would be uridines in conventional RNA of the same sequence (where all bases are standard A, U, C, or G bases). Unless otherwise indicated, U in a polynucleotide sequence in this disclosure or in the accompanying sequence tables or sequence listings can be a uridine or a modified uridine.

[0311] As used herein, a first sequence is considered to "contain a sequence having at least X% identity" with a second sequence if alignment of the first sequence to the second sequence shows that X% or more of the positions of the second sequence are matched overall by the first sequence. For example, the sequence AAGA contains a sequence having 100% identity with the sequence AAG, because the alignment gives 100% identity in that there is a match at all three positions in the second sequence. Differences between RNA and DNA (generally, the exchange of thymidine with uridine, or vice versa), and the presence of nucleoside analogs such as modified uridines, do not contribute to the difference in identity or complementarity between polynucleotides, as long as the related nucleotides (such as thymidine, uridine, or modified uridine) have the same complement (e.g., adenosine for all thymidine, uridine, or modified uridine; another example is cytosine and 5-methylcytosine, both of which have guanosine or modified guanosine as their complement). Thus, for example, the sequence 5'-AXG, where X is any modified uridine, such as pseudouridine, N1-methylpseudouridine, or 5-methoxyuridine, is considered 100% identical to AUG, in that both are fully complementary to the same sequence (5'-CAU). Exemplary alignment algorithms are the Smith-Waterman and Needleman-Wunsch algorithms, which are well known in the art. Those skilled in the art will understand what selection of algorithm and parameter settings is appropriate for a given pair of sequences to be aligned. Generally, for sequences of similar length and predicted identity greater than 50% for amino acids or 75% for nucleotides, the Needleman-Wunsch algorithm, using the default settings of the Needleman-Wunsch algorithm interface provided by EBI at the www.ebi.ac.uk web server, is generally appropriate.

[0312] "mRNA" is used herein to refer to a polynucleotide that is RNA or modified RNA and contains an open reading frame that can be translated into a polypeptide (i.e., can serve as a substrate for translation by ribosomes and aminoacylated tRNAs). mRNA can contain a phosphate sugar backbone that includes ribose residues or analogs thereof, such as 2'-methoxyribose residues. In some embodiments, the sugars of the nucleic acid phosphate sugar backbone consist essentially of ribose residues, 2'-methoxyribose residues, or combinations thereof. Generally, mRNA does not contain a substantial amount of thymidine residues (e.g., 0 residues or less than 30, 20, 10, 5, 4, 3, or 2 thymidine residues, or a thymidine content of less than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, or 0.1%). mRNA can contain modified uridines at some or all of its uridine positions.

[0313] As used herein, the "minimum uridine content" of a given ORF is the uridine content of an ORF that (a) uses a minimum uridine codon at all positions and (b) encodes the same amino acid sequence as the given ORF. The minimum uridine codon for a given amino acid is the codon with the fewest uridines (usually 0 or 1, except for the codon for phenylalanine, which has two uridines). Modified uridine residues are considered equivalent to uridine for the purposes of assessing minimum uridine content.

[0314] As used herein, the "minimum uridine dinucleotide content" of a given ORF is the minimum possible uridine dinucleotide (UU) content of an ORF that (a) uses a minimum of uridine codons (as described above) at all positions and (b) encodes the same amino acid sequence as the given ORF. Uridine dinucleotide (UU) content can be expressed in absolute terms based on percentages, as a count of UU dinucleotides in the ORF, or as the percentage of positions occupied by uridines of uridine dinucleotides (e.g., AUUAU has a uridine dinucleotide content of 40% because two of the five positions are occupied by uridines of uridine dinucleotides). Modified uridine residues are considered equivalent to uridine for purposes of assessing minimum uridine dinucleotide content.

[0315] As used herein, the "minimum adenine content" of a given open reading frame (ORF) is the adenine content of an ORF that (a) uses a minimum of adenine codons at all positions and (b) encodes the same amino acid sequence as the given ORF. The minimum adenine codon for a given amino acid is the codon with the fewest adenines (usually 0 or 1, except for codons for lysine and asparagine, where the minimum adenine codon has 2 adenines). Modified adenine residues are considered equivalent to adenine for the purposes of assessing minimum adenine content.

[0316] As used herein, the "minimum adenine dinucleotide content" of a given open reading frame (ORF) is the minimum possible adenine dinucleotide (AA) content of the ORF that (a) uses a minimum of adenine codons (as described above) at all positions and (b) encodes the same amino acid sequence as the given ORF. Adenine dinucleotide (AA) content can be expressed in absolute terms based on percentages, as a count of AA dinucleotides in the ORF, or as the percentage of positions occupied by adenine dinucleotides (e.g., UAAUA has an adenine dinucleotide content of 40% because two of the five positions are occupied by adenine dinucleotides). Modified adenine residues are considered equivalent to adenine for purposes of assessing minimum adenine dinucleotide content.

[0317] As used herein, "TTR" refers to transthyretin, the gene product of the TTR gene.

[0318] As used herein, "amyloid" refers to abnormal aggregates of normally soluble proteins or peptides. Amyloids are insoluble and can form proteinaceous deposits in organs and tissues. The proteins or peptides in amyloids can misfold into a form that allows many copies of the protein to stick together and form fibrils. While some forms of amyloids can function normally in the human body, "amyloid" as used herein refers to abnormal or pathological aggregates of proteins. Amyloids can contain a single protein or peptide, such as TTR, or multiple proteins or peptides, such as TTR and additional proteins.

[0319] As used herein, "amyloid fibrils" refer to insoluble fibers of amyloid that are resistant to degradation. Amyloid fibrils can cause symptoms based on the particular protein or peptide and the tissue and cell type in which they aggregate.

[0320] As used herein, "amyloidosis" refers to a disease characterized by symptoms caused by the deposition of amyloid or amyloid fibrils. Amyloidosis can affect many organs, including the heart, kidneys, liver, spleen, nervous system, and gastrointestinal tract.

[0321] As used herein, "ATTR," "TTR-associated amyloidosis," "TTR amyloidosis," "ATTR amyloidosis," or "amyloidosis associated with TTR" refers to amyloidosis associated with deposits of TTR.

[0322] As used herein, "familial amyloidotic cardiomyopathy" or "FAC" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by restrictive cardiomyopathy. Congestive heart failure is common in FAC. The average age of onset is approximately 60-70 years, with an estimated life expectancy of 4-5 years after diagnosis.

[0323] As used herein, "familial amyloid polyneuropathy" or "FAP" refers to hereditary transthyretin amyloidosis (ATTR), which is primarily characterized by sensorimotor neuropathy. Autonomic neuropathy is common in FAP. Although neuropathy is the primary feature, symptoms of FAP can also include cachexia, renal failure, and heart disease. The average age of onset of FAP is approximately 30-50 years, with an estimated life expectancy of 5-15 years after diagnosis.

[0324] As used herein, "wild-type ATTR" and "ATTRwt" refer to ATTR not associated with a pathogenic TTR mutation, such as T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-). ATTRwt has also been called senile systemic amyloidosis. Onset typically occurs in men over 60 years of age, and the most common symptoms are congestive heart failure and abnormal heart rhythms, such as atrial fibrillation. Additional symptoms include consequences of poor cardiac function, such as shortness of breath, fatigue, dizziness, swelling (especially in the legs), nausea, angina, sleep disturbances, and weight loss. A history of carpal tunnel syndrome indicates an increased risk of ATTRwt and, in some cases, may indicate early-stage disease. ATTRwt generally causes a decline in cardiac function over time, but wild-type TTR deposits accumulate more slowly, potentially resulting in a better prognosis than hereditary ATTR. Existing treatments are similar to other forms of ATTR (except liver transplantation) and generally aim to support or improve cardiac function, ranging from diuretics and restriction of fluid and salt intake to anticoagulants and, in severe cases, heart transplantation. Nevertheless, like FAC, ATTRwt can lead to death from heart failure within 3–5 years of diagnosis.

[0325] Guide sequences useful in the guide RNA compositions and methods described herein are provided in Table 1 and throughout the application.

[0326] As used herein, "inherited ATTR" refers to an ATTR associated with a mutation in the sequence of the TTR gene. Known mutations in the TTR gene associated with ATTR include mutations that result in a TTR with a substitution of T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0327] As used herein, "indel" refers to an insertion / deletion mutation consisting of a number of nucleotides that are either inserted or deleted at the site of a double-strand break (DSB) in a target nucleic acid.

[0328] As used herein, "knockdown" refers to a reduction in the expression of a particular gene product (e.g., protein, mRNA, or both). Protein knockdown can be measured either by detecting the protein secreted by a tissue or cell aggregate (e.g., in serum or cell culture medium) or by detecting the total cellular amount of protein from a tissue or cell aggregate of interest. Methods for measuring mRNA knockdown are known and include sequencing mRNA isolated from a tissue or cell aggregate of interest. In some embodiments, "knockdown" can refer to some degree of loss of expression of a particular gene product, for example, a reduction in the amount of transcribed mRNA or a reduction in the amount of protein expressed or secreted by a cell aggregate (including in vivo aggregates such as those found in tissues).

[0329] As used herein, "knockout" refers to the loss of expression of a particular protein in a cell. Knockout can be measured either by detecting the amount of protein secreted from a tissue or cell aggregate (e.g., in serum or cell culture medium) or by detecting the total cellular amount of protein in a tissue or cell aggregate. In some embodiments, methods are provided for "knockout" TTR in one or more cells (e.g., in a cell aggregate, including an in vivo aggregate such as one found in a tissue). In some embodiments, the knockout is a complete loss of expression of TTR protein in a cell, rather than the formation of a mutant TTR protein, e.g., created by indels.

[0330] As used herein, "mutant TTR" refers to a gene product of TTR (i.e., TTR protein) that has a change in the amino acid sequence of TTR compared to the wild-type amino acid sequence of TTR. The human wild-type TTR sequence is available at NCBI Gene ID: 7276; Ensembl: Ensembl: ENSG00000118271. For example, mutant forms of TTR associated with ATTR in humans include T60A, V30M, V30A, V30G, V30L, V122I, V122A, or V122(-).

[0331] As used herein, "mutant TTR" or "mutant TTR allele" refers to a TTR sequence that has a change in the nucleotide sequence of TTR compared to the wild-type sequence (NCBI Gene ID: 7276; Ensembl: ENSG00000118271).

[0332] As used herein, "ribonucleoprotein" (RNP) or "RNP complex" refers to a guide RNA comprising an RNA-guided DNA-binding agent, e.g., a Cas nuclease, e.g., a Cas cleavase, a Cas nickase, or a dCas DNA-binding agent (e.g., Cas9). In some embodiments, the guide RNA guides the RNA-guided DNA-binding agent, such as Cas9, to a target sequence, the guide RNA hybridizes to the target sequence, and an agent binds to the target sequence, where the agent is a cleavase or nickase and can perform cleavage or nicking after binding.

[0333] As used herein, "target sequence" refers to a nucleic acid sequence within a target gene that has complementarity to the guide sequence of a gRNA. The interaction between the target sequence and the guide sequence directs the RNA-guided DNA-binding agent to bind and potentially (depending on the activity of the agent) nick or cleave within the target sequence.

[0334] As used herein, "treatment" refers to any administration or treatment for a disease or disorder in a subject, including inhibiting the disease, halting its progression, alleviating one or more symptoms of the disease, curing the disease, or preventing the recurrence of one or more symptoms of the disease. For example, treating ATTR can include alleviating the symptoms of ATTR.

[0335] As used herein, the term "pathogenic mutation" refers to a mutation that likely prevents a gene product, such as TTR, from causing, promoting, contributing to, or inhibiting the development of a disease, such as ATTR.

[0336] As used herein, the term "lipid nanoparticle" (LNP) refers to a particle comprising multiple (i.e., more than one) lipid molecules physically associated with each other by intermolecular forces. LNPs can be, for example, microspheres (unilamellar and multilamellar vesicles, e.g., "liposomes," which in some embodiments are substantially spherical and, in more specific embodiments, comprise a lamellar phase lipid bilayer that may include an aqueous core, e.g., containing a substantial portion of RNA molecules), the dispersed phase in an emulsion, a micelle, or the internal phase in a suspension. Emulsions, micelles, and suspensions can be suitable compositions for local and / or topical delivery. See, e.g., WO2017173054A1 and WO2019067992A1, the contents of which are incorporated herein by reference in their entireties. Any LNP known to those skilled in the art capable of delivering nucleotides to a subject can be utilized with a guide RNA and a nucleic acid encoding an RNA-guided DNA binder described herein.

[0337] As used herein, the term "donor oligonucleotide" or "donor template" refers to an oligonucleotide containing a desired nucleic acid sequence to be inserted into a target site (e.g., a target site in genomic DNA). The donor oligonucleotide may be a single-stranded oligonucleotide or a double-stranded oligonucleotide. In some embodiments, the donor oligonucleotide may be delivered together with a nucleic acid sequence encoding a guide RNA and an RNA-guided DNA-binding agent (e.g., Cas9) via the use of LNP or transfection.

[0338] As used herein, the term "nuclear localization signal" (NLS) or "nuclear localization sequence" refers to an amino acid sequence that directs the transport of a molecule containing or linked to such a sequence into the nucleus of a eukaryotic cell. The nuclear localization signal may form part of the molecule to be transported. In some embodiments, the NLS may be linked to the remainder of the molecule by a covalent bond, a hydrogen bond, or an ionic interaction.

[0339] As used herein, the phrase "pharmaceutically acceptable" means useful in preparing pharmaceutical compositions that are generally non-toxic, not biologically undesirable, and not otherwise unacceptable for pharmaceutical use.

[0340] The term "about" or "approximately" refers to an acceptable error for a particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined.

[0341] As used herein, "infusion" refers to the active administration of one or more agents, e.g., over an infusion period of approximately 30 minutes to 12 hours. In some embodiments, the one or more agents include, e.g., an LNP comprising an mRNA encoding an RNA-guided DNA-binding agent (e.g., Cas9) described herein and a gRNA described herein.

[0342] As used herein, "infusion prophylaxis" refers to a regimen administered to a subject prior to treatment (e.g., including administration of LNP) that includes one or more or all of the following: intravenous corticosteroid (e.g., dexamethasone 10 mg or equivalent), antipyretic (e.g., oral acetaminophen or paracetamol 500 mg), intravenous H1 blocker (e.g., diphenhydramine 50 mg or equivalent), and intravenous H2 blocker (e.g., ranitidine 50 mg or equivalent). Infusion prophylaxis is optionally combined with pre-administration of oral corticosteroid (e.g., dexamethasone 8 mg or equivalent). In some embodiments, oral corticosteroid is administered 8 to 24 hours prior to treatment. In some embodiments, one or more or all of the following are administered 1-2 hours prior to treatment: an intravenous corticosteroid (e.g., dexamethasone 10 mg or equivalent), oral acetaminophen 500 mg, an intravenous H1 blocker (e.g., diphenhydramine 50 mg or equivalent), an intravenous H2 blocker (e.g., ranitidine 50 mg or equivalent). In some embodiments, the H1 blocker and / or H2 blocker are administered orally.

[0343] II. Methods and Compositions Targeting the TTR Gene Disclosed herein are methods for treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentration in a subject, and / or reducing or preventing the accumulation of amyloid or amyloid fibrils in a subject, as well as related compositions, including compositions for use in such methods. Corticosteroids, guide RNAs, RNA-guided DNA binders, or polynucleotides encoding RNA-guided DNA binders, such as any of those described herein, are also provided for use in the methods disclosed herein. For example, in some embodiments, the disclosed compositions, such as LNP compositions, comprise a guide RNA targeting TTR and, optionally, an RNA-guided DNA binder, or a nucleic acid comprising an open reading frame encoding such an RNA-guided DNA binder (e.g., a CRISPR / Cas system). The subjects treated with such methods and compositions may have wild-type or non-wild-type TTR gene sequences, and may, for example, have ATTR (which may be ATTRwt, or a hereditary or familial form of ATTR).

[0344] The dosage, frequency, and mode of administration of the corticosteroid, infusion prophylaxis, and guide RNA-containing compositions described herein can be controlled independently.

[0345] In some embodiments, the corticosteroid is administered before the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered after the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered simultaneously with the guide RNA-containing composition described herein. In some embodiments, multiple doses of the corticosteroid are administered before or after the administration of the guide RNA-containing composition. In some embodiments, multiple doses of the guide RNA-containing composition are administered before or after the administration of the corticosteroid. In some embodiments, multiple doses of the corticosteroid and multiple doses of the guide RNA-containing composition are administered.

[0346] Guide RNA-containing compositions, e.g., LNP compositions comprising a polynucleotide encoding a guide RNA and, optionally, an RNA-guided DNA binder, may be administered by infusion. In some embodiments, the composition is administered by infusion for more than 30 minutes. In some embodiments, the composition is administered by infusion for more than 30 minutes. In some embodiments, the composition is administered by infusion for more than 60 minutes. In some embodiments, the composition is administered by infusion for more than 90 minutes. In some embodiments, the composition is administered by infusion for more than 120 minutes, more than 150 minutes, more than 180 minutes, more than 240 minutes, more than 300 minutes, or more than 360 minutes. In some embodiments, the composition is administered by infusion for at least 1 hour, at least 2 hours, at least 4 hours, at least 6 hours, at least 7 hours, at least 8 hours, at least 9 hours, at least 10 hours, at least 11 hours, or at least 12 hours. In some embodiments, the composition is administered by infusion over a period of 0.5 to 1.5 hours, 1.5 to 2.5 hours, 2.5 to 3.5 hours, 3.5 to 4.5 hours, 4.5 to 5.5 hours, 5.5 to 6.5 hours, 6.5 to 7.5 hours, 7.5 to 8.5 hours, 8.5 to 9.5 hours, 9.5 to 10.5 hours, 10.5 to 11.5 hours, or 11.5 to 12.5 hours. In some embodiments, the composition is administered by infusion over a period of about 60 minutes, about 90 minutes, about 120 minutes, about 150 minutes, about 180 minutes, about 240 minutes, about 300 minutes, or about 360 minutes. In some embodiments, the composition is administered by infusion over about 45 to 75 minutes, 75 to 105 minutes, 105 to 135 minutes, 135 to 165 minutes, 165 to 195 minutes, 195 to 225 minutes, 225 to 255 minutes, 255 to 285 minutes, 285 to 315 minutes, 315 to 345 minutes, or 345 to 375 minutes. In some embodiments, the composition is administered by infusion over about 1.5 to 6 hours.

[0347] In some embodiments, the corticosteroid is administered about 5 minutes to about 168 hours before administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered about 5 minutes to about 168 hours after administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered 5 minutes, 10 minutes, 15 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours, 144 hours, 168 hours, or an amount of time within a range bounded by any two of the foregoing values, before administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 ​​hours, 72 hours, 96 hours, 120 hours, 144 hours, 168 hours, or within a range bounded by any two of the foregoing values, after administration of a guide RNA-containing composition described herein. In certain embodiments, the corticosteroid is administered about 8-24 hours before administration of the guide RNA-containing composition, and infusion prophylaxis is administered 1-2 hours before administration of the guide RNA-containing composition. The corticosteroid may be administered simultaneously with or at about the same time as administration of a guide RNA-containing composition described herein.

[0348] Where appropriate, a dose of corticosteroid may be administered as at least two subdoses administered separately at appropriate intervals. In some embodiments, the corticosteroid is administered at least twice before the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at least twice after the administration of the guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered (e.g., before, with, and / or after the administration of the guide RNA-containing composition described herein) at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a time range bounded by any two of the aforementioned values. In some embodiments, the corticosteroid is administered at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a range of time bounded by any two of the foregoing values, prior to administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered at intervals of 1 hour, 2 hours, 3 hours, 4 hours, 6 hours, 12 hours, 18 hours, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 days, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 weeks, or within a range of time bounded by any two of the foregoing values, following administration of a guide RNA-containing composition described herein.

[0349] In some embodiments, the corticosteroid is administered at least twice. In some embodiments, the corticosteroid is administered at least three times. In some embodiments, the corticosteroid is administered at least four times. In some embodiments, the corticosteroid is administered up to five, six, seven, eight, nine, or ten times. The first dose may be administered orally, and the second or subsequent doses may be administered parenterally, for example, by injection. Alternatively, the first dose may be administered parenterally, and the second or subsequent doses may be administered orally.

[0350] In some embodiments, the corticosteroid is administered orally prior to intravenous administration of a guide RNA-containing composition described herein. In some embodiments, the corticosteroid is administered orally during or after intravenous administration of a guide RNA-containing composition described herein.

[0351] A. Corticosteroids, injection prophylaxis The corticosteroids used in the disclosed methods and compositions are useful for treating subjects undergoing gene editing and / or gene editing composition therapy. Without wishing to be bound by any particular theory, corticosteroids may be useful for reducing inflammation or immune responses to foreign RNA (mRNA encoding guide RNA or RNA-guided DNA binding agent). The corticosteroids used in the disclosed methods and compositions may be any of those known in the art and / or commercially available from several sources.

[0352] In some embodiments, infusion prophylaxis is administered to the subject prior to the gene-editing composition, e.g., 1-2 hours prior to administration of the gene-editing composition. In some embodiments, infusion prophylaxis includes one or more, or all, of an intravenous corticosteroid (e.g., 8-12 mg, e.g., 10 mg, or equivalent, of dexamethasone, or any of the other corticosteroids described elsewhere herein), an antipyretic (e.g., oral acetaminophen (also called paracetamol) 500 mg), an H1 blocker (e.g., diphenhydramine 50 mg or equivalent), or an H2 blocker (e.g., ranitidine 50 mg or equivalent). In some embodiments, infusion prophylaxis includes an intravenous corticosteroid (e.g., 8-12 mg, e.g., 10 mg, or equivalent) and an antipyretic (e.g., oral acetaminophen or paracetamol 500 mg). In some embodiments, the H1 blocker (e.g., diphenhydramine 50 mg or equivalent) and / or H2 blocker (e.g., ranitidine 50 mg or equivalent) are administered orally. In some embodiments, the H1 blocker (e.g., diphenhydramine 50 mg or equivalent) and / or H2 blocker (e.g., ranitidine 50 mg or equivalent) are administered intravenously. In some embodiments, the intravenous H1 blocker and / or intravenous H2 blocker are replaced with an equivalent, e.g., an orally administered equivalent. Additionally or alternatively, an oral corticosteroid (e.g., dexamethasone 6-10 mg, e.g., 8 mg or equivalent, or any of the other corticosteroids described elsewhere herein) may be administered, e.g., 8-24 hours prior to treatment. These dosages may be used, for example, when the subject is a human, e.g., an adult human.In some embodiments, infusion prophylaxis consists of intravenous corticosteroids (e.g., dexamethasone 10 mg or equivalent), which may reduce the severity of inflammation; oral acetaminophen 500 mg, which may reduce pain and fever and / or inhibit COX enzymes and / or prostaglandins; intravenous H1 blockers (e.g., diphenhydramine 50 mg or equivalent); and intravenous H2 blockers (e.g., ranitidine 50 mg or equivalent), which act to block the action of histimine at H1 and H2 receptors, respectively; optionally, preceded by oral dexamethasone (8 mg or equivalent), e.g., 8-24 hours prior to administration of the gene-editing composition. Infusion prophylaxis may function to reduce adverse reactions associated with administering a guide RNA-containing composition (e.g., an LNP composition). In some embodiments, corticosteroids and / or infusion prophylaxis are administered as necessary premedication prior to administering a guide RNA-containing composition (e.g., an LNP composition).

[0353] In some embodiments, the corticosteroid is administered simultaneously with one or more of acetaminophen, an H1 blocker, or an H2 blocker. In some embodiments, the corticosteroid is administered simultaneously with acetaminophen and an H1 blocker. In some embodiments, the corticosteroid is administered simultaneously with acetaminophen and an H2 blocker. In some embodiments, the corticosteroid is administered simultaneously with an H1 blocker and an H2 blocker. In some embodiments, the H1 blocker and / or the H2 blocker is administered orally. In some embodiments, the composition is administered simultaneously with acetaminophen, an H1 blocker, and an H2 blocker.

[0354] Many H1 and H2 blockers are known in the art. In some embodiments, the H1 blocker is diphenhydramine, clemastine, cetirizine, terfenadine, doxylamine, mirtazapine, brompheniramine, triprolidine, cyproheptadine, loratadine, hydroxyzine, cinnarizine, astemizole, azatadine, meclizine, carbinoxamine, epinastine, olopatadine, triprolidine, brompheniramine, ketotifen, fexofenadine, desloratadine, or the like. Tadine, azelastine, dimenhydrinate, promethazine, mequitazine, emedastine, levocabastine, chlorpheniramine, cyclizine, alimemazine, phenindamine, pheniramine, methapyrilene, flunarizine, mianserin, levocetirizine, esmirtazapine, mepyramine, alcaftadine, antazoline, chloropyramine, dimethindene, dimetotiazine, acrivastine, chlorpheniramine maleate, evastine , mizolastine, GSK-1004723, oxatomide, chlorpheniramine, bepotastine, buclizine, risperidone, methdilazine, maprotiline, diphenylpyraline, bromodiphenhydramine, ziprasidone, olanzapine, clozapine, promazine, trazodone, doxepin, desipramine, orphenadrine, methotrimeprazine, clofedanol, chlorprothixene, quetiapine, asenapine, benzatrol thiprazine, aripiprazole, amitriptyline, imipramine, nortriptyline, trimipramine, isothipendyl, chlorpromazine, iloperidone, zuclopenthixol, chlorcyclizine, amoxapine, butriptyline, cariprazine, bilastine, dosulepin, rupatadine, pizotifen, thonzylamine, benzquinamine, propiomazine, acepromethazine, aripiprazole lauroxyl, or deptropine.

[0355] In some embodiments, the H2 blocker is ranitidine, nizatidine, cimetidine, or famotidine. Equivalent corticosteroids and dosages can be found, for example, in Liu et al., Allergy, Asthma & Clinical Immunology, 2013, 9:30. Equivalent antihistamines (H1 blockers and / or H2 blockers) and dosages include conventional dosages for suitable members of the class known in the art.

[0356] In some embodiments, at least two doses of corticosteroid are administered prior to administration of the composition. In some embodiments, a first dose of corticosteroid is administered followed by a second dose of corticosteroid before administration of the composition. In some embodiments, the first dose of corticosteroid is administered within 8 to 24 hours before administration of the composition. In some embodiments, the first dose of corticosteroid is administered orally within 8 to 24 hours before administration of the composition. In some embodiments, the second dose of corticosteroid is administered within 1 to 2 hours before administration of the composition. In some embodiments, the second dose of corticosteroid is administered intravenously within 1 to 2 hours before administration of the composition. In some embodiments, the first dose of corticosteroid is administered within 8 to 24 hours before administration of the composition, and the second dose of corticosteroid is administered within 1 to 2 hours before administration of the composition.

[0357] In some embodiments, the first dose of corticosteroid is administered orally and the second dose of corticosteroid is administered intravenously before the composition is administered. In some embodiments, the first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered and the second dose of corticosteroid is administered intravenously within 1 to 2 hours before the composition is administered.

[0358] In some embodiments, the first dose of corticosteroid is administered orally and the second dose of corticosteroid is administered concurrently with one or more of acetaminophen, an H1 blocker, or an H2 blocker before the composition is administered. In some embodiments, the first dose of corticosteroid is administered orally and the second dose of corticosteroid is administered concurrently with acetaminophen, an H1 blocker, and an H2 blocker before the composition is administered. In some embodiments, the first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered and the second dose of corticosteroid is administered intravenously within 1 to 2 hours before the composition is administered concurrently with one or more of acetaminophen, an H1 blocker, or an H2 blocker. In some embodiments, a first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered, and a second dose of corticosteroid is administered intravenously, concurrently with acetaminophen, an H1 blocker, and an H2 blocker, within 1 to 2 hours before the composition is administered. In some embodiments, a first dose of corticosteroid is administered orally within 8 to 24 hours before the composition is administered, and a second dose of corticosteroid is administered intravenously, concurrently with acetaminophen, an H1 blocker, and an H2 blocker, within 1 to 2 hours before the composition is administered, wherein acetaminophen is administered orally and the H1 blocker and H2 blocker are administered intravenously.

[0359] In some embodiments, administering a corticosteroid improves the tolerability of a composition comprising a guide RNA. For example, compared to administering a composition comprising a guide RNA without a corticosteroid, administering a corticosteroid may reduce the incidence or severity of one or more adverse effects, such as inflammation, nausea, vomiting, elevated blood ALT levels, hyperthermia, and / or hyperalgesia. In some embodiments, administering a corticosteroid reduces or inhibits the production or activity of one or more interferons and / or inflammatory cytokines in response to a composition comprising a guide RNA.

[0360] Exemplary corticosteroids include, but are not limited to, dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or ethametasone, or pharmaceutically acceptable salts thereof. Exemplary corticosteroids include, but are not limited to, dexamethasone, betamethasone, prednisone (Rayos®, Horizon Pharma), prednisolone (Pred Forte®, Allergan, Omnipred™, Novartis), methylprednisolone (Medrol®, Pharmacia & Upjohn, Solu-Medrolx®, Pharmacia & Upjohn), cortisone, hydrocortisone, triamcinolone, ethametasone, budesonide (ENTOCORT®, Perrigo Pharma Intl., Rhinocort®, Symbicort®, Astrazeneca Pharms, Ulceris®, Valeant Pharms), paramethasone, and deflazacort. In some embodiments, the corticosteroid is dexamethasone.

[0361] The corticosteroids used in the disclosed methods can be administered according to regimens known in the art, such as regimens approved by the U.S. FDA. Suitable modes of administration include, but are not limited to, enteral administration, topical administration, and parenteral administration. As used herein, the phrases "parenteral administration" and "parenterally administered" refer to forms of administration other than enteral (including oral) and topical administration (usually by injection), including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion. In some embodiments, the corticosteroid is administered to a subject parenterally or by injection. In some embodiments, the corticosteroid is administered to a subject by intravenous injection. In some embodiments, the corticosteroid is administered to a subject orally or enterally. In some embodiments, the corticosteroid is administered to a subject topically.

[0362] In some embodiments, including, for example, for administration to or for use in a human subject, the corticosteroid may be administered in an amount ranging from about 0.75 mg to about 25 mg. In some embodiments, including, for example, for administration to or for use in a human subject, the corticosteroid may be administered in an amount ranging from about 0.01 to 0.5 mg / kg, e.g., 0.1 to 0.40 mg / kg or 0.25 to 0.40 mg / kg.

[0363] In one example, dexamethasone is administered orally in an amount of 20 mg or 25 mg 6-12 hours prior to intravenous administration of the guide RNA. In another example, dexamethasone is administered intravenously in an amount of 20 mg or 25 mg 30 minutes 6-12 hours prior to intravenous administration of the guide RNA. In another example, dexamethasone is administered orally in an amount of 8-12 mg, e.g., 10 mg, 8-24 hours prior to injection of the guide RNA composition. In another example, dexamethasone is administered intravenously in an amount of 8-12 mg, e.g., 10 mg, 1-2 hours prior to injection of the guide RNA composition. In another example, dexamethasone is administered orally in an amount of 8-12 mg, e.g., 10 mg, 8-24 hours prior to injection of the guide RNA composition, and dexamethasone is administered intravenously in an amount of 8-12 mg, e.g., 10 mg, 1-2 hours prior to injection of the guide RNA composition.

[0364] In some embodiments, the corticosteroid is dexamethasone and is administered orally to the subject in an amount of 8 mg 8 to 24 hours before the composition is administered to the subject. In some embodiments, the corticosteroid is dexamethasone and is administered orally to the subject in an amount of 8 mg 8 to 24 hours before the composition is administered to the subject.

[0365] In some embodiments, the corticosteroid is dexamethasone and is administered intravenously to the subject in an amount of 10 mg 1 to 2 hours before the composition is administered to the subject. In some embodiments, the corticosteroid is dexamethasone and is administered intravenously to the subject in an amount of 10 mg 1 to 2 hours before the composition is administered to the subject.

[0366] In some embodiments, the corticosteroid is dexamethasone, and a first dose of dexamethasone in an amount of 8 mg is administered orally to the subject 8 to 24 hours before the composition is administered to the subject, and a second dose of dexamethasone in an amount of 10 mg is administered intravenously to the subject 1 to 2 hours before the composition is administered to the subject.

[0367] In some embodiments, the corticosteroid is dexamethasone, and a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg 8 to 24 hours before the composition is administered to the subject, and a second dose of dexamethasone is intravenously administered to the subject in an amount of 10 mg 1 to 2 hours before the composition is administered to the subject, wherein the second dose of corticosteroid is administered simultaneously with one or more of acetaminophen, an H1 blocker, or an H2 blocker.

[0368] In some embodiments, the corticosteroid is dexamethasone, and a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg 8 to 24 hours before the composition is administered to the subject, and a second dose of dexamethasone is intravenously administered to the subject in an amount of 10 mg 1 to 2 hours before the composition is administered to the subject, wherein the second dose of corticosteroid is administered simultaneously with the acetaminophen, the H1 blocker, and the H2 blocker.

[0369] In some embodiments, the corticosteroid is dexamethasone, and a first dose of dexamethasone in an amount of 8 mg is administered orally to the subject 8 to 24 hours before the composition is administered to the subject, and a second dose of dexamethasone in an amount of 10 mg is administered intravenously to the subject 1 to 2 hours before the composition is administered to the subject, concurrently with the oral administration of acetaminophen and the intravenous administration of an H1 blocker and an H2 blocker.

[0370] In some embodiments, the corticosteroid is dexamethasone, and a first dose of dexamethasone is orally administered to the subject in an amount of 8 mg 8 to 24 hours before the composition is administered to the subject, and a second dose of dexamethasone is intravenously administered to the subject in an amount of 10 mg 1 to 2 hours before the composition is administered to the subject, concurrently with the oral administration of acetaminophen in an amount of 500 mg and the intravenous administration of an H1 blocker in an amount of 50 mg and an H2 blocker in an amount of 50 mg.

[0371] Furthermore, those skilled in the art will recognize that the dose of a corticosteroid can be easily adjusted depending on the selection of the particular corticosteroid. For example, for comparison purposes, the following are appropriate mg equivalent dosages of corticosteroids: hydrocortisone 20 mg, cortisone 25 mg, predisone or prednisolone 5 mg, deflazacort 6 mg, methylprednisolone 4 mg, dexamethasone or betamethasone 0.75 mg, and triamcinolone 4 mg. Thus, although the corticosteroid doses presented in the above examples are based on dexamethasone, if a different corticosteroid is administered to the patient, one skilled in the art would use the conversion information above to calculate the equivalent dose of the other corticosteroid.

[0372] B. Guide RNA (gRNA) The guide RNAs used in the disclosed methods and compositions include guide sequences that target the TTR gene. Exemplary guide sequences that target the TTR gene are shown in Table 1 as SEQ ID NOS: 5-82. [Table 1-1] [Table 1-2] [Table 1-3] [Table 1-4] [Table 1-5] [Table 1-6] [Table 1-7]

[0373] Each of the above-mentioned guide sequences may further comprise additional nucleotides to form a crRNA, for example, having the following exemplary nucleotide sequence following the guide sequence at its 3' end: GUUUUAGAGCUAUGCUGUUUUG (SEQ ID NO: 126). In the case of an sgRNA, the above-mentioned guide sequences may further comprise additional nucleotides to form an sgRNA, for example, having the following exemplary nucleotide sequence following the 3' end of the guide sequence: GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUUU (SEQ ID NO: 125) in the 5' to 3' direction.

[0374] In some embodiments, the sgRNA is modified. In some embodiments, the sgRNA comprises the modification pattern shown below in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, the entire N comprises a guide sequence as described herein, and the modified sgRNA comprises the following sequence: mN*mN*mN*NNNNNNNNNNNNNNNNNGUUUAGAmGmCmUmAmGmAmAmAmUmAmGmCAAGUUAAAAUAAGGCUAGUCCGUUAUCAmAmCmUmUmGmAmAmAmAmAmGmUmGmGmCmAmCmCmGmAmGmUmCmGmGmUmGmCmU*mU*mU*mU (SEQ ID NO: 3), where "N" can be any natural or unnatural nucleotide. For example, encompassed herein is SEQ ID NO: 3, where N is replaced with any of the guide sequences disclosed herein. The modifications remain as shown in SEQ ID NO: 3, regardless of the N substitution for the guide nucleotide. That is, the guide nucleotide replaces "N", but the first three nucleotides are 2'OMe modified, and there are phosphorothioate linkages between the first and second nucleotides, between the second and third nucleotides, and between the third and fourth nucleotides.

[0375] In some embodiments, any one of the sequences listed in Table 2 is included. [Table 2-1] [Table 2-2] [Table 2-3] [Table 2-4] [Table 2-5] [Table 2-6] [Table 2-7] [Table 2-8] [Table 2-9] [Table 2-10]

[0376] Alignment mapping of guide IDs with corresponding sgRNA IDs, as well as homology to the cynomolgus genome and cynomolgus-matched guide IDs, is provided in Table 3. [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4] [Table 3-5]

[0377] In some embodiments, the gRNA comprises a guide sequence that directs an RNA-guided DNA-binding agent, which may be a nuclease (e.g., a Cas nuclease such as Cas9), to a target DNA sequence in the TTR. The gRNA may comprise a crRNA comprising a guide sequence shown in Table 1. The gRNA may comprise a crRNA comprising 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the gRNA comprises a crRNA comprising a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to at least 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the gRNA comprises a crRNA comprising a sequence having about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a guide sequence shown in Table 1. The gRNA may further comprise a trRNA. In each composition and method embodiment described herein, the crRNA and trRNA may be associated as a single RNA (sgRNA) or may reside on separate RNAs (dgRNA). In the context of an sgRNA, the crRNA and trRNA components may be covalently linked, for example, via a phosphodiester bond or other covalent bond.

[0378] In each of the composition, use, and method embodiments described herein, the guide RNA may comprise two RNA molecules as a "dual guide RNA" or "dgRNA." The dgRNA comprises a first RNA molecule comprising a crRNA, e.g., comprising a guide sequence as shown in Table 1, and a second RNA molecule comprising a trRNA. The first and second RNA molecules may not be covalently linked, but may form an RNA duplex by base pairing between portions of the crRNA and trRNA.

[0379] In embodiments of each of the compositions, uses, and methods described herein, the guide RNA may comprise a single RNA molecule referred to as a "single guide RNA" or "sgRNA." The sgRNA may comprise a crRNA (or a portion thereof) comprising a guide sequence shown in Table 1 covalently linked to a trRNA. The sgRNA may comprise 17, 18, 19, or 20 consecutive nucleotides of a guide sequence shown in Table 1. In some embodiments, the crRNA and trRNA are covalently linked via a linker. In some embodiments, the sgRNA forms a stem-loop structure by base pairing between portions of the crRNA and trRNA. In some embodiments, the crRNA and trRNA are covalently linked via one or more bonds that are not phosphodiester bonds.

[0380] In some embodiments, the trRNA may comprise all or part of a trRNA sequence from a naturally occurring CRISPR / Cas system. In some embodiments, the trRNA comprises a truncated or modified wild-type trRNA. The length of the trRNA depends on the CRISPR / Cas system used. In some embodiments, the trRNA comprises or consists of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or more than 100 nucleotides. In some embodiments, the trRNA may comprise a specific secondary structure, such as one or more hairpin or stem-loop structures, or one or more bulges.

[0381] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-82.

[0382] In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.

[0383] In some embodiments, the composition comprises one or more guide RNAs comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the composition comprises a gRNA comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 is SEQ ID NO: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.

[0384] In other embodiments, the composition comprises at least one, e.g., at least two, gRNAs comprising a guide sequence selected from any two or more of the guide sequences of SEQ ID NOs: 5-82. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to a sequence selected from SEQ ID NOs: 5-82.

[0385] In other embodiments, the composition comprises at least one, e.g., at least two, gRNAs comprising a guide sequence selected from any two or more of the guide sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the composition comprises at least two gRNAs each comprising a guide sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the sequences selected from SEQ ID NOs: 5-72, 74-78, and 80-82. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 comprises one or two sequences selected from SEQ ID NOs: 5, 6, 7, 8, 9, 12, 13, 14, 15, 16, 17, 22, 23, 27, 29, 30, 35, 36, 37, 38, 55, 61, 63, 65, 66, 68, or 69. In some embodiments, the sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 comprises one or two sequences selected from SEQ ID NOs: 5, 6, 9, 13, 14, 15, 16, 17, 22, 23, 27, 30, 35, 36, 37, 38, 55, 63, 65, 66, 68, or 69.

[0386] In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOS: 87-124). In some embodiments, the gRNA is an sgRNA comprising any one of the sequences shown in Table 2 (SEQ ID NOS: 87-124), but without the indicated modification (i.e., unmodified SEQ ID NOS: 87-124). In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOS: 87-124. In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOS: 87-124, but without the indicated modification (i.e., unmodified SEQ ID NOS: 87-124). In some embodiments, the sgRNA comprises any one of the guide sequences shown in Table 1, with or without modifications, in place of the guide sequences shown in the sgRNA sequences of Table 2 in SEQ ID NOs: 87-124.

[0387] In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87-113, 115-120, or 122-124. In some embodiments, the gRNA is an sgRNA comprising any one of SEQ ID NOs: 87-113, 115-120, or 122-124, but does not comprise the modifications set forth in Table 2 (i.e., unmodified SEQ ID NOs: 87-113, 115-120, or 122-124). In some embodiments, the sgRNA comprises a sequence that is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids of SEQ ID NOs: 87-113, 115-120, or 122-124. In some embodiments, the sgRNA comprises a sequence at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to any of the nucleic acids in SEQ ID NOs: 87-113, 115-120, or 122-124, but does not contain the indicated modification (i.e., unmodified SEQ ID NOs: 87-113, 115-120, or 122-124). In some embodiments, the sgRNA comprises any one of the guide sequences shown in Table 1 in place of the guide sequence shown in the sgRNA sequences of Table 2 in SEQ ID NOs: 87-113, 115-120, or 122-124, with or without modifications.

[0388] The guide RNAs provided herein can be useful for recognizing (e.g., hybridizing to) target sequences within the TTR gene. For example, the TTR target sequence can be recognized and cleaved by the provided Cas cleavase containing the guide RNA. Thus, an RNA-guided DNA binding agent, e.g., Cas cleavase, can direct the guide RNA to the target sequence of the TTR gene, the guide sequence of the guide RNA hybridizes to the target sequence, and the RNA-guided DNA binding agent, e.g., Cas cleavase, cleaves the target sequence.

[0389] In some embodiments, the selection of one or more guide RNAs is determined based on a target sequence within the TTR gene.

[0390] Without being bound by any particular theory, mutations in certain regions of a gene (e.g., frameshift mutations resulting from indels resulting from nuclease-mediated DSBs) may be less tolerated than mutations in other regions of a gene, and therefore the location of the DSB is an important factor in the amount or type of protein knockdown that can be achieved. In some embodiments, a gRNA that is complementary to or has complementarity with a target sequence within TTR is used to direct an RNA-guided DNA-binding agent to a specific location within the TTR gene. In some embodiments, the gRNA is designed to have a guide sequence that is complementary to or has complementarity with a target sequence within exon 1, exon 2, exon 3, or exon 4 of TTR.

[0391] In some embodiments, the guide sequence is at least 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% identical to the target sequence present in the human TTR gene. In some embodiments, the target sequence may be complementary to the guide sequence of the guide RNA. In some embodiments, the degree of complementarity or identity between the guide sequence of the guide RNA and its corresponding target sequence may be at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the target sequence and the guide sequence of the gRNA may be 100% complementary or identical. In other embodiments, the target sequence and the guide sequence of the gRNA may contain at least one mismatch. For example, the target sequence and the guide sequence of the gRNA may contain 1, 2, 3, or 4 mismatches, where the total length of the guide sequence is about 20. In some embodiments, the target sequence and the guide sequence of the gRNA may contain 1 to 4 mismatches, where the guide sequence is 20 nucleotides.

[0392] C. gRNA Modification In some embodiments, the gRNA is chemically modified. A gRNA that includes one or more modified nucleosides or nucleotides is referred to as a "modified" gRNA or a "chemically modified" gRNA to describe the presence of one or more non-natural and / or naturally occurring components or structures used in place of, or in addition to, the standard A, G, C, and U residues. In some embodiments, the modified gRNA is synthesized using non-standard nucleosides or nucleotides and is referred to herein as "modified." Modified nucleosides or nucleotides can include one or more of the following: (i) an alteration in the phosphodiester backbone linkage, e.g., replacement of one or both of the non-bridging phosphate oxygens and / or one or more of the bridging phosphate oxygens (exemplary backbone modifications); (ii) an alteration, e.g., replacement, of a component of the ribose sugar, e.g., the 2' hydroxyl of the ribose sugar (exemplary sugar modifications); (iii) extensive replacement of a phosphate moiety with a "dephosphorylated" linker (exemplary backbone modifications); (iv) a modification or replacement of a naturally occurring nucleobase, including with a non-standard nucleobase (exemplary base modifications); (v) a replacement or modification of the ribose phosphate backbone (exemplary backbone modifications); (vi) a modification of the 3' or 5' end of the oligonucleotide, e.g., removal, modification, or replacement of a terminal phosphate group, or conjugation of a moiety, cap, or linker (such 3' or 5' cap modifications can include sugar and / or backbone modifications); and (vii) a modification or replacement of the sugar (exemplary sugar modifications).

[0393] Chemical modifications such as those listed above can be combined to provide modified gRNAs containing nucleosides and nucleotides (collectively "residues") that may have two, three, four, or more modifications. For example, modified residues may have modified sugars and modified nucleobases. In some embodiments, each base of the gRNA is modified, e.g., all bases have modified phosphate groups, such as phosphorothioate groups. In certain embodiments, all, or substantially all, of the phosphate groups of the gRNA molecule are replaced with phosphorothioate groups. In some embodiments, the modified gRNA contains at least one modified residue at or near the 5' end of the RNA. In some embodiments, the modified gRNA contains at least one modified residue at or near the 3' end of the RNA.

[0394] In some embodiments, the gRNA comprises one, two, three, or more modified residues. In some embodiments, at least 5% (e.g., at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%) of the positions in the modified gRNA are modified nucleosides or nucleotides.

[0395] Unmodified nucleic acids may be susceptible to degradation, for example, by intracellular nucleases or those found in serum. For example, nucleases can hydrolyze phosphodiester bonds of nucleic acids. Thus, in one aspect, the gRNAs described herein may contain one or more modified nucleosides or nucleotides to introduce stability against, for example, intracellular or serum-derived nucleases. In some embodiments, the modified gRNA molecules described herein may exhibit a reduced innate immune response when introduced into cell populations both in vivo and ex vivo. The term "innate immune response" includes cellular responses to exogenous nucleic acids, including single-stranded nucleic acids, including induction of cytokine (particularly interferon) expression and release and cell death.

[0396] In some embodiments of backbone modification, the phosphate group of the modified residue can be modified by replacing one or more oxygen atoms with different substituents.In addition, modified residues, such as modified residues present in modified nucleic acids, can include large-scale replacement of unmodified phosphate moieties with modified phosphate groups, as described herein.In some embodiments, backbone modification of phosphate backbone can include modifications that result in either uncharged linkers or charged linkers with asymmetric charge distribution.

[0397] Examples of modified phosphate groups include phosphorothioates, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, alkyl or aryl phosphonates, and phosphotriesters. The phosphate atom in an unmodified phosphate group is achiral. However, replacing one of the non-bridging oxygens with one of the atoms or groups of atoms described above can make the phosphorus atom chiral. The stereogenic phosphorus atom can have either the "R" configuration (Rp herein) or the "S" configuration (Sp herein). The backbone can also be modified by replacing the bridging oxygen (i.e., the oxygen connecting the phosphate to the nucleoside) with nitrogen (bridging phosphoramidates), sulfur (bridging phosphorothioates), and carbon (bridging methylene phosphonates). Replacement can occur at either or both bridging oxygens.

[0398] The phosphate group can be replaced by a non-phosphorus-containing linking group in certain backbone modifications. In some embodiments, the charged phosphate group can be replaced by a neutral moiety. Examples of moieties that can replace the phosphate group can include, but are not limited to, methylphosphonate, hydroxylamino, siloxane, carbonate, carboxymethyl, carbamate, amide, thioether, ethylene oxide linker, sulfonate, sulfonamide, thioformacetal, formacetal, oxime, methyleneimino, methylenemethylimino, methylenehydrazo, methylenedimethylhydrazo, and methyleneoxymethylimino.

[0399] Scaffolds that can mimic nucleic acids can also be constructed in which the phosphate linker and ribose sugar are replaced with nuclease-resistant nucleoside or nucleotide surrogates. Such modifications can include backbone and sugar modifications. In some embodiments, the nucleobases can be tethered by surrogate backbones. Examples can include, but are not limited to, morpholino, cyclobutyl, pyrrolidine, and peptide nucleic acid (PNA) nucleoside surrogates.

[0400] Modified nucleosides and modified nucleotides can include one or more modifications to the sugar, i.e., sugar modifications. For example, the 2' hydroxyl group (OH) can be modified, for example, replaced with many different "oxy" or "deoxy" substituents. In some embodiments, the modification of the 2' hydroxyl group can enhance the stability of nucleic acids, since the hydroxyl can no longer be further deprotonated to form a 2'-alkoxide ion.

[0401] Examples of 2' hydroxyl group modifications include alkoxy or aryloxy (OR, where "R" can be alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), polyethylene glycol (PEG), O(CH2CHO) n In some embodiments, the 2' hydroxyl group modification can be 2'-O-Me. In some embodiments, the 2' hydroxyl group modification can be 2'-fluoro, replacing the 2'-hydroxyl group with fluorine. ... 1-6 Alkylene or C 1-6They may also include "locked" nucleic acids (LNAs) that may be connected to the 4' carbon of the same ribose sugar via a heteroalkylene bridge, exemplary bridges being methylene, propylene, ether, or amino bridges, O-amino (where amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino), and aminoalkoxy, O(CH) n -amino (wherein amino can be, for example, NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino). In some embodiments, the 2' hydroxyl group modification can include an "unlocked" nucleic acid (UNA), in which the ribose ring lacks a C2'-C3' bond. In some embodiments, the 2' hydroxyl group modification can include a methoxyethyl group (MOE), (OCH2CH2OCH3, e.g., a PEG derivative).

[0402] A "deoxy" 2' modification can be hydrogen (i.e., a deoxyribose sugar, e.g., an overhanging portion of a partial dsRNA), halo (e.g., bromo, chloro, fluoro, or iodo), amino (where amino can be, e.g., NH, alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or amino acid), NH(CHCHNH) n may include CH2CH2-amino (wherein amino is, e.g., as described herein), -NHC(O)R (wherein R may be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), cyano, mercapto, alkyl-thio-alkyl, thioalkoxy, and alkyl, cycloalkyl, aryl, alkenyl, and alkynyl, optionally substituted by amino, e.g., as described herein.

[0403] Sugar modifications can include sugar groups that contain one or more carbons and have the opposite stereochemical configuration to that of the corresponding carbon in ribose. Thus, modified nucleic acids can include nucleotides containing, for example, arabinose as the sugar. Modified nucleic acids can also include abasic sugars. These abasic sugars can also be further modified at one or more of the constituent sugar atoms. Modified nucleic acids can also include one or more sugars that are L-configured, such as L-nucleosides.

[0404] The modified nucleosides and modified nucleotides described herein that can be incorporated into modified nucleic acids can contain modified bases, also referred to as nucleobases. Examples of nucleobases include, but are not limited to, adenine (A), guanine (G), cytosine (C), and uracil (U). These nucleobases can be modified or completely replaced to produce modified residues that can be incorporated into modified nucleic acids. The nucleobases of the nucleotides can be independently selected from purines, pyrimidines, purine analogs, or pyrimidine analogs. In some embodiments, the nucleobases can include, for example, naturally occurring bases and synthetic derivatives of bases.

[0405] In embodiments using dual guide RNAs, each of the crRNA and tracrRNA can contain modifications. Such modifications may be present at one or both ends of the crRNA and / or tracrRNA. In embodiments involving an sgRNA, one or more residues at one or both ends of the sgRNA may be chemically modified, or the entire sgRNA may be chemically modified. Certain embodiments include 5'-end modifications. Certain embodiments include 3'-end modifications. In certain embodiments, one or more or all of the nucleotides in the single-stranded overhangs of the guide RNA molecule are deoxynucleotides.

[0406] In some embodiments, the guide RNAs disclosed herein comprise one of the modification patterns disclosed in US 62 / 431,756, filed December 8, 2016, entitled "Chemically Modified Guide RNAs," the contents of which are incorporated herein by reference in their entirety.

[0407] In some embodiments, the present invention includes gRNAs comprising one or more modifications. In some embodiments, the modifications comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the modifications comprise internucleotide phosphorothioate (PS) linkages.

[0408] The terms "mA," "mC," "mU," or "mG" may be used to refer to nucleotides modified with 2'-O-Me.

[0409] The 2'-O-methyl modification can be depicted as follows: [ka]

[0410] Another chemical modification that has been shown to affect the nucleotide sugar ring is halogen substitution. For example, 2'-fluoro (2'-F) substitution on the nucleotide sugar ring can increase oligonucleotide binding affinity and nuclease stability.

[0411] In this application, the terms "fA," "fC," "fU," or "fG" may be used to refer to 2'-F substituted nucleotides.

[0412] The substitution of 2'-F can be depicted as follows: [ka]

[0413] Phosphorothioate (PS) linkage or bond refers to a phosphodiester linkage, e.g., a bond in which a sulfur replaces one non-bridging phosphate oxygen in the bond between nucleotide bases. When phosphorothioates are used to generate oligonucleotides, the modified oligonucleotides may also be referred to as S-oligos.

[0414] "*" may be used to indicate a PS modification. In this application, the terms A*, C*, U*, or G* may be used to indicate a nucleotide that is linked to the adjacent (e.g., 3') nucleotide by a PS bond.

[0415] In this application, the terms "mA*," "mC*," "mU*," or "mG*" may be used to refer to a nucleotide that is substituted with 2'-O-Me and linked to the next (e.g., 3') nucleotide with a PS bond.

[0416] The diagram below shows the substitution of S- for the non-bridging phosphate oxygen, resulting in a PS bond instead of a phosphodiester bond. [ka]

[0417] An abasic nucleotide is one that lacks a nitrogenous base. The diagram below depicts an oligonucleotide with an abasic (also known as apurinic) site that lacks a base. [ka]

[0418] Inverted bases refer to those having a linkage that is inverted from the normal 5' to 3' linkage (i.e., either a 5' to 5' linkage or a 3' to 3' linkage). For example, [ka]

[0419] The abasic nucleotide can be linked with an inverted bond. For example, the abasic nucleotide can be linked to the 5' nucleotide at the terminal via a 5'-5' linkage, or the abasic nucleotide can be linked to the 3' nucleotide at the terminal via a 3'-3' linkage. An inverted abasic nucleotide at either the 5' or 3' nucleotide at the terminal can also be referred to as an inverted abasic end cap.

[0420] In some embodiments, one or more of the first 3, 4, or 5 nucleotides at the 5' end and one or more of the last 3, 4, or 5 nucleotides at the 3' end are modified. In some embodiments, the modifications are 2'-O-Me, 2'-F, inverted abasic nucleotides, PS linkages, or other nucleotide modifications known in the art to increase stability and / or performance.

[0421] In some embodiments, the first four nucleotides at the 5' end and the last four nucleotides at the 3' end are linked using phosphorothioate (PS) bonds.

[0422] In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-O-methyl (2'-O-Me) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise 2'-fluoro (2'-F) modified nucleotides. In some embodiments, the first three nucleotides at the 5' end and the last three nucleotides at the 3' end comprise inverted abasic nucleotides.

[0423] In some embodiments, the guide RNA comprises a modified sgRNA. In some embodiments, the sgRNA comprises the modification pattern shown in SEQ ID NO: 3, where N is any natural or unnatural nucleotide, and the entirety of N comprises a guide sequence that directs a nuclease to a target sequence.

[0424] In some embodiments, the guide RNA comprises an sgRNA set forth in any one of SEQ ID NOs: 87 to 124. In some embodiments, the guide RNA comprises an sgRNA comprising any one of guide sequences set forth in SEQ ID NOs: 5 to 82 and the nucleotide of SEQ ID NO: 125, wherein the nucleotide of SEQ ID NO: 125 is at the 3' end of the guide sequence, and the guide sequence may be modified as set forth in SEQ ID NO: 3.

[0425] In some embodiments, the guide RNA comprises an sgRNA comprising a guide sequence selected from SEQ ID NOs: 5-72, 74-78, and 80-82 and nucleotides 21-100 of SEQ ID NO: 3, wherein the nucleotide of SEQ ID NO: 3 is at the 3' end of the guide sequence, and the guide sequence may be modified as shown in SEQ ID NO: 3.

[0426] D. RNA-guided DNA binders In some embodiments, the RNA-guided DNA binding agent is a class 2 Cas nuclease. In some embodiments, the RNA-guided DNA binding agent has cleavage activity, which may also be referred to as double-stranded endonuclease activity. In some embodiments, the RNA-guided DNA binding agent comprises a Cas nuclease, e.g., a class 2 Cas nuclease (e.g., a type II, type V, or type VI Cas nuclease). Class 2 Cas nucleases include, for example, Cas9, Cpf1, C2c1, C2c2, and C2c3 proteins, and modifications thereof. Examples of Cas9 nucleases include those in type II CRISPR systems of S. pyogenes, S. aureus, and other prokaryotes (see, e.g., the list in the next paragraph), as well as modified (e.g., engineered or mutant) versions thereof. See, e.g., US2016 / 0312198A1, US2016 / 0312199A1. Other examples of Cas nucleases include the Csm or Cmr complex of a type III CRISPR system, or the Cas10, Csm1, or Cmr2 subunit thereof, and the Cascade complex of a type I CRISPR system, or the Cas3 subunit thereof. In some embodiments, the Cas nuclease may be derived from a type IIA, type IIB, or type IIC system. For a discussion of various CRISPR systems and Cas nucleases, see, for example, Makarova et al., Nat. Rev. Microbiol. 9:467-477 (2011); Makarova et al., Nat. Rev. Microbiol, 13:722-36 (2015); Shmakov et al., Molecular Cell, 60:385-397 (2015). In some embodiments, the RNA-guided DNA-binding agent is a Cas cleavase, such as a Cas9 cleavase. In some embodiments, the RNA-guided DNA binding agent is a Cas nickase, e.g., a Cas9 nickase. In some embodiments, the RNA-guided DNA binding agent is a Cas9 nuclease, e.g., a cleavase or nickase.In some embodiments, the RNA-guided DNA binding agent is a S. pyogenes Cas9 nuclease, e.g., cleavase.

[0427] Non-limiting exemplary species from which Cas nucleases can be derived include Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Listeria innocua, Lactobacillus gasseri, Francisella novicida, Wolinella succinogenes, Sutterella wadsworthensis, Gammaproteobacterium, Neisseria meningitidis, Campylobacter jejuni, Pasteurella multocida, Fibrobacter succinogene, Rhodospirillum rubrum, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis, Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Lactobacillus buchneri, Treponema denticola, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp.、Crocosphaera watsonii、Cyanothece sp.、Microcystis aeruginosa、Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohlobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, Streptococcus pasteurianus, Neisseria cinerea, Campylobacter lari, Parvibaculum lavamentivorans, Corynebacterium diphtheria, Acidaminococcus sp., Lachnospiraceae bacterium ND2006, and Acaryochloris marina are included.

[0428] In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus pyogenes. In some embodiments, the Cas nuclease is a Cas9 nuclease from Streptococcus thermophilus. In some embodiments, the Cas nuclease is a Cas9 nuclease from Neisseria meningitidis. In some embodiments, the Cas nuclease is a Cas9 nuclease from Staphylococcus aureus. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella novicida. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus sp.. In some embodiments, the Cas nuclease is a Cpf1 nuclease from Lachnospiraceae bacterium ND2006. In further embodiments, the Cas nuclease is a Cpf1 nuclease from Francisella tularensis, Lachnospiraceae bacterium, Butyrivibrio proteoclasticus, Peregrinibacteria bacterium, Parcubacteria bacterium, Smithella, Acidaminococcus, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi, Leptospira inadai, Porphyromonas crevioricanis, Prevotella disiens, or Porphyromonas macacae. In certain embodiments, the Cas nuclease is a Cpf1 nuclease from Acidaminococcus or Lachnospiraceae.

[0429] Wild-type Cas9 has two nuclease domains, RuvC and HNH. The RuvC domain cleaves the non-target DNA strand, and the HNH domain cleaves the target strand of DNA. In some embodiments, the Cas9 nuclease contains more than one RuvC domain and / or more than one HNH domain. In some embodiments, the Cas9 nuclease is wild-type Cas9. In some embodiments, the Cas9 is capable of inducing a double-stranded break in the target DNA. In certain embodiments, the Cas nuclease may cleave dsDNA, cleave one strand of dsDNA, or may not have DNA cleavase or nickase activity. An exemplary Cas9 amino acid sequence is provided as SEQ ID NO:203. An exemplary Cas9 mRNA ORF sequence, including start and stop codons, is provided as SEQ ID NO:311. An exemplary Cas9 mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO:210.

[0430] In some embodiments, chimeric Cas nucleases are used, in which one domain or region of a protein is replaced with a portion of a different protein. In some embodiments, the Cas nuclease domain may be replaced with a domain from a different nuclease, such as Fok1. In some embodiments, the Cas nuclease may be a modified nuclease.

[0431] In other embodiments, the Cas nuclease may be derived from a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a component of a cascade complex of a type I CRISPR / Cas system. In some embodiments, the Cas nuclease may be a Cas3 protein. In some embodiments, the Cas nuclease may be derived from a type III CRISPR / Cas system. In some embodiments, the Cas nuclease may have RNA cleavage activity.

[0432] In some embodiments, the RNA-guided DNA binding agent has single-stranded nickase activity, i.e., it can cleave one DNA strand to generate a single-stranded break (also known as a "nick"). In some embodiments, the RNA-guided DNA binding agent comprises a Cas nickase. A nickase is an enzyme that creates a nick in dsDNA, i.e., it cleaves one strand of the DNA double helix but not the other. In some embodiments, the Cas nickase is an aspect of a Cas nuclease (e.g., a Cas nuclease described above) in which the endonucleolytic active site has been inactivated, e.g., by one or more modifications (e.g., point mutations) in the catalytic domain. See, e.g., U.S. Patent No. 8,889,356 for a discussion of Cas nickases and exemplary catalytic domain modifications. In some embodiments, the Cas nickase, such as the Cas9 nickase, has an inactivated RuvC or HNH domain. An exemplary Cas9 nickase amino acid sequence is provided as SEQ ID NO: 206. An exemplary Cas9 nickase mRNA ORF sequence, including start and stop codons, is provided as SEQ ID NO: 207. An exemplary Cas9 nickase mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO: 211.

[0433] In some embodiments, the RNA-guided DNA binder is modified to contain only one functional nuclease domain. For example, the drug protein may be modified so that one of the nuclease domains is mutated or completely or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, a nickase with a RuvC domain having reduced activity is used. In some embodiments, a nickase with an inactive RuvC domain is used. In some embodiments, a nickase with an HNH domain having reduced activity is used. In some embodiments, a nickase with an inactive HNH domain is used.

[0434] In some embodiments, conserved amino acids within the Cas protein nuclease domain are substituted to reduce or alter nuclease activity. In some embodiments, the Cas nuclease may include an amino acid substitution within the RuvC or RuvC-like nuclease domain. Exemplary amino acid substitutions in the RuvC or RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015) Cell Oct 22:163(3):759-771. In some embodiments, the Cas nuclease may include an amino acid substitution within the HNH or HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH or HNH-like nuclease domain include E762A, H840A, N863A, H983A, and D986A (based on the S. pyogenes Cas9 protein). See, e.g., Zetsche et al. (2015). Additional exemplary amino acid substitutions include D917A, E1006A, and D1255A (based on the Francisella novicida U112 Cpf1 (FnCpf1) sequence (UniProtKB-A0Q7Q2(CPF1_FRATN))).

[0435] In some embodiments, a nucleic acid encoding a nickase is provided in combination with a pair of guide RNAs, each complementary to the sense strand and antisense strand of a target sequence. In this embodiment, the guide RNA directs the nickase to the target sequence by generating nicks on opposite strands of the target sequence (i.e., double nicking), thereby introducing a DSB. In some embodiments, the use of double nicking can improve specificity and reduce off-target effects. In some embodiments, a nickase is used with two separate guide RNAs that target opposite strands of DNA, generating a double nick in the target DNA. In some embodiments, a nickase is used with two separate guide RNAs that are selected to be in close proximity to each other, generating a double nick in the target DNA.

[0436] In some embodiments, the RNA-guided DNA binding agent lacks cleavase and nickase activity. In some embodiments, the RNA-guided DNA binding agent comprises a dCas DNA-binding polypeptide. The dCas polypeptide essentially lacks catalytic (cleavase / nickase) activity while possessing DNA-binding activity. In some embodiments, the dCas polypeptide is a dCas9 polypeptide. In some embodiments, an RNA-guided DNA binding agent or dCas DNA-binding polypeptide lacking cleavase and nickase activity is an embodiment of a Cas nuclease (e.g., a Cas nuclease described above) whose endonucleolytic active site has been inactivated, for example, by one or more modifications (e.g., point mutations) in its catalytic domain. See, e.g., US2014 / 0186958A1 and US2015 / 0166980A1. An exemplary dCas9 amino acid sequence is provided as SEQ ID NO: 208. An exemplary dCas9 mRNA ORF sequence, including start and stop codons, is provided as SEQ ID NO: 209. An exemplary dCas9 mRNA coding sequence suitable for inclusion in a fusion protein is provided as SEQ ID NO:346.

[0437] a) Heterologous functional domains, nuclear localization signals In some embodiments, the RNA-guided DNA-binding agent (e.g., a Cas9 nuclease such as S. pyogenes Cas9) comprises one or more heterologous functional domains (e.g., is or comprises a fusion polypeptide).

[0438] In some embodiments, the heterologous functional domain can facilitate the transport of the RNA-guided DNA binding agent to the cell nucleus. For example, the heterologous functional domain can be a nuclear localization signal (NLS). In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 10 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with 1 to 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with one NLS. When one NLS is used, the NLS can be linked at the N-terminal or C-terminal end of the sequence of the RNA-guided DNA binding agent. In some embodiments, the RNA-guided DNA binding agent can be fused C-terminal to at least one NLS. An NLS can also be inserted within the sequence of the RNA-guided DNA binding agent. In other embodiments, the RNA-guided DNA binding agent can be fused with more than one NLS. In some embodiments, the RNA-guided DNA binding agent can be fused with 2, 3, 4, or 5 NLSs. In some embodiments, the RNA-guided DNA binding agent can be fused with two NLSs. In certain circumstances, the two NLSs may be the same (e.g., two SV40 NLSs) or different. In some embodiments, the RNA-guided DNA binding agent is fused to a sequence of two SV40 NLSs linked at their carboxy-terminal ends. In some embodiments, the RNA-guided DNA binding agent may be fused with two NLSs, one linked at the N-terminal end and one linked at the C-terminal end. In some embodiments, the RNA-guided DNA binding agent may be fused with three NLSs. In some embodiments, the RNA-guided DNA binding agent may be fused without an NLS. In some embodiments, the NLS may be a monokaryotic sequence, such as the SV40 NLS, PKKKRKV (SEQ ID NO: 278) or PKKKRRV (SEQ ID NO: 290). In some embodiments, the NLS may be a bikaryotic sequence, such as the nucleoplasmin NLS, KRPAATKKAGQAKKKK (SEQ ID NO: 91).In some embodiments, the NLS sequence may comprise LAAKRSRTT (SEQ ID NO: 279), QAAKRSRTT (SEQ ID NO: 280), PAPAKRERTT (SEQ ID NO: 281), QAAKRPRTT (SEQ ID NO: 282), RAAKRPRTT (SEQ ID NO: 283), AAAKRSWSMAA (SEQ ID NO: 284), AAAKRVWSMAF (SEQ ID NO: 285), AAAKRSWSMAF (SEQ ID NO: 286), AAAKRKYFAA (SEQ ID NO: 287), RAAKRKAFAA (SEQ ID NO: 288), or RAAKRKYFAV (SEQ ID NO: 289). In certain embodiments, a single PKKKRKV (SEQ ID NO: 278) NLS may be linked at the C-terminal end of the RNA-guided DNA binder. One or more linkers are optionally included in the fusion site. In some embodiments, one or more NLSs of any of the foregoing embodiments are present in the RNA-guided DNA binder in combination with one or more additional heterologous functional domains, such as any of the heterologous functional domains described below.

[0439] In some embodiments, the heterologous functional domain can modify the intracellular half-life of the RNA-guided DNA binding agent. In some embodiments, the half-life of the RNA-guided DNA binding agent can be increased. In some embodiments, the half-life of the RNA-guided DNA binding agent can be decreased. In some embodiments, the heterologous functional domain can increase the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can decrease the stability of the RNA-guided DNA binding agent. In some embodiments, the heterologous functional domain can function as a signal peptide for protein degradation. In some embodiments, the protein degradation can be mediated by proteolytic enzymes such as proteasomes, lysosomal proteases, or calpain proteases. In some embodiments, the heterologous functional domain can comprise a PEST sequence. In some embodiments, the RNA-guided DNA binding agent can be modified by the addition of ubiquitin or polyubiquitin chains. In some embodiments, the ubiquitin can be a ubiquitin-like protein (UBL). Non-limiting examples of ubiquitin-like proteins include small ubiquitin-like modifier (SUMO), ubiquitin cross-reactive protein (UCRP, also known as interferon-stimulated gene-15 (ISG15)), ubiquitin-related modifier-1 (URM1), neural progenitor cell-expressed developmentally downregulated protein-8 (NEDD8, also called Rub1 in S. cerevisiae), human leukocyte antigen F-related (FAT10), autophagy-8 (ATG8) and -12 (ATG12), Fau ubiquitin-like protein (FUB1), membrane-anchored UBL (MUB), ubiquitin-fold modifier-1 (UFM1), and ubiquitin-like protein-5 (UBL5).

[0440] In some embodiments, the heterologous functional domain may be a marker domain. Non-limiting examples of marker domains include fluorescent proteins, purification tags, epitope tags, and reporter gene sequences. In some embodiments, the marker domain may be a fluorescent protein. Non-limiting examples of suitable fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, turboGFP, sfGFP, EGFP, Emerald, Azami Green, Monomeric Azami). Green, CopGFP, AceGFP, ZsGreen1), yellow fluorescent proteins (e.g., YFP, EYFP, Citrine, Venus, YPet, PhiYFP, ZsYellow1), blue fluorescent proteins (e.g., EBFP, EBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g., ECFP, Cerulean, CyPet, AmCyan1, Midoriishi-Cyan), red fluorescent proteins (e.g., mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFP1, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRed1, AsRed2, eqFP611, mRasberry, mStrawberry, Jred), and orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric In other embodiments, the marker domain may be a purification tag and / or an epitope tag.Non-limiting exemplary tags include glutathione-S-transferase (GST), chitin-binding protein (CBP), maltose-binding protein (MBP), thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, HA, nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, S1, T7, V5, VSV-G, 6xHis, 8xHis, biotin carboxyl carrier protein (BCCP), poly-His, and calmodulin. Non-limiting exemplary reporter genes include glutathione-S-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT), β-galactosidase, β-glucuronidase, luciferase, or fluorescent protein.

[0441] In additional embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to a specific organelle, cell type, tissue, or organ. In some embodiments, the heterologous functional domain may target the RNA-guided DNA binding agent to mitochondria.

[0442] In further embodiments, the heterologous functional domain may be an effector domain. When an RNA-guided DNA binding agent is directed to its target sequence, for example, when a Cas nuclease is directed to the target sequence by a gRNA, the effector domain can modify or affect the target sequence. In some embodiments, the effector domain can be selected from a nucleic acid binding domain, a nuclease domain (e.g., a non-Cas nuclease domain), an epigenetic modification domain, a transcription activation domain, or a transcription repression domain. In some embodiments, the heterologous functional domain is a nuclease, such as a FokI nuclease. See, for example, U.S. Patent No. 9,023,649. In some embodiments, the heterologous functional domain is a transcription activator or a transcription repressor. See, for example, Qi et al., "Repurposing CRISPR as an RNA-guided platform for sequence-specific control of gene expression," Cell 152:1173-83 (2013); Perez-Pinera et al., "RNA-guided gene activation by CRISPR-Cas9-based transcription factors," Nat. Methods 10:973-6 (2013); Mali et al., "CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering," Nat. Biotechnol. 31:833-8 (2013); Gilbert et al., "CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes," Cell 154:442-51 (2013). Thus, RNA-guided DNA binders essentially become transcription factors that can be directed to bind to desired target sequences using guide RNAs.In certain embodiments, the DNA modifying domain is a methylation domain, such as a demethylation domain or a methyltransferase domain.In certain embodiments, the effector domain is a DNA modifying domain, such as a base editing domain.In certain embodiments, the DNA modifying domain is a nucleic acid editing domain that introduces specific modifications into DNA, such as a deaminase domain.For example, see WO2015 / 089406, US 2016 / 0304846.The nucleic acid editing domain, deaminase domain and Cas9 variants described in WO2015 / 089406 and US2016 / 0304846 are incorporated herein by reference.

[0443] E. A nucleic acid comprising an open reading frame encoding an RNA-guided DNA binder A nucleic acid comprising an ORF encoding an RNA-guided DNA-binding agent (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) disclosed herein may optionally be combined with a composition or method employing any of the gRNAs disclosed herein. In any of the embodiments described herein, the nucleic acid comprising an open reading frame encoding the RNA-guided DNA-binding agent may be an mRNA. 1. Low adenine content ORFs

[0444] In some embodiments, an ORF encoding an RNA-guided DNA binder, e.g., a Cas9 nuclease such as S. pyogenes Cas9, has an adenine content ranging from its minimum adenine content to about 150% of its minimum adenine content. In some embodiments, the adenine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content equal to its minimum adenine content. In some embodiments, the ORF has an adenine content about 150% or less of its minimum adenine content. In some embodiments, the ORF has an adenine content about 145% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 140% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 135% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 130% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 125% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 120% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 115% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 110% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 105% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 104% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 103% or less of its minimum adenine content. In some embodiments, an ORF has an adenine content of about 102% or less of its minimum adenine content.In some embodiments, an ORF has an adenine content of about 101% or less of its minimum adenine content.

[0445] In some embodiments, an ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 200% of its minimum adenine dinucleotide content. In some embodiments, the adenine dinucleotide content of an ORF is about 195% or less, 190% or less, 185% or less, 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 200% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 195% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 190% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 185% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 180% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 175% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 170% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 165% or less of its minimum adenine dinucleotide content, hi some embodiments, an ORF has an adenine dinucleotide content of about 160% or less of its minimum adenine dinucleotide content.In some embodiments, an ORF has an adenine dinucleotide content of about 155% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content equal to its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 150% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 145% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 140% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 135% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 130% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 125% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 120% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 115% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 110% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 105% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 104% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 103% or less of its minimum adenine dinucleotide content. In some embodiments, an ORF has an adenine dinucleotide content of about 102% or less of its minimum adenine dinucleotide content.In some embodiments, an ORF has an adenine dinucleotide content of about 101% or less of its minimum adenine dinucleotide content.

[0446] In some embodiments, an ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to an adenine dinucleotide content that is 90% or less of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question. In some embodiments, the adenine dinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine dinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.

[0447] In some embodiments, ORFs have an adenine trinucleotide content ranging from 0 adenine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 adenine trinucleotides (longer numbers of adenines count as the number of unique three-adenine segments therein, e.g., an adenine tetranucleotide contains two adenine trinucleotides, an adenine pentanucleotide contains three adenine trinucleotides, etc.). In some embodiments, an ORF has an adenine trinucleotide content ranging from 0% adenine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% adenine trinucleotides, where percent adenine trinucleotide content is calculated as the percent of positions in the sequence occupied by adenines that form part of an adenine trinucleotide (or a longer number of adenines), such that the sequences UUUAAA and UUUUAAAA each have an adenine trinucleotide content of 50%. For example, in some embodiments, an ORF has an adenine trinucleotide content of 2% or less. For example, in some embodiments, an ORF has an adenine trinucleotide content of 1.5% or less. In some embodiments, an ORF has an adenine trinucleotide content of 1% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.9% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.8% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.7% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.6% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.5% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.4% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.3% or less.In some embodiments, the ORF has an adenine trinucleotide content of 0.2% or less. In some embodiments, the ORF has an adenine trinucleotide content of 0.1% or less. In some embodiments, a nucleic acid encoding an RNA-guided DNA binder is provided that comprises an ORF that does not contain adenine trinucleotides.

[0448] In some embodiments, an ORF has an adenine trinucleotide content ranging from its minimum adenine trinucleotide content to an adenine trinucleotide content that is 90% or less of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question. In some embodiments, the adenine trinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum adenine trinucleotide content of a reference sequence that encodes the same protein as the mRNA in question.

[0449] For example, by using minimal adenine codons in a sufficient fraction of the ORF, a given ORF can have a reduced adenine content or adenine dinucleotide or adenine trinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are codons listed in Table 4. [Table 4]

[0450] In some embodiments, nucleic acids encoding an RNA-guided DNA binder (e.g., a Cas9 nuclease, such as S. pyogenes Cas9) are provided, comprising an ORF consisting of a set of codons in which at least about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons are codons listed in Table 4. In some embodiments, the ORF has minimal nucleotide homopolymers, e.g., repeated strings of the same nucleotide. For example, in some embodiments, when selecting a minimal uridine codon from the codons listed in Table 4, the nucleic acid is constructed by selecting minimal adenine codons that reduce the number and length of nucleotide homopolymers, e.g., selecting GCG instead of GCC for alanine, or selecting GGC instead of GGG for glycine.

[0451] In any of the preceding embodiments, the nucleic acid may be mRNA.

[0452] 2. Codons that increase translation and / or correspond to highly expressed tRNAs, exemplary codon sets In some embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammal, such as a human. In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammalian (e.g., human) organ (e.g., liver). In further embodiments, the nucleic acid comprises an ORF with codons that increase translation in a mammalian (e.g., human) cell type (e.g., hepatocyte). The increase in translation in a mammal, cell type, mammalian organ, human, human organ, etc. can be determined relative to the extent of translation of the wild-type sequence of the ORF, or relative to an ORF with a codon distribution that matches the codon distribution of the organism from which the ORF is derived or the organism containing the most similar ORF at the amino acid level (e.g., S. pyogenes, S. aureus, or, in the case of a Cas nuclease derived from a prokaryote, another prokaryote, e.g., a Cas nuclease derived from another prokaryote described below). Alternatively, in some embodiments, the increase in translation of the Cas9 sequence in a mammal, cell type, mammalian organ, human, human organ, etc. is determined relative to the translation of an ORF having the sequence of SEQ ID NO: 205, all else being equal, including any applicable point mutations, heterologous domains, etc. Codons useful for increasing expression in humans, including human liver and human hepatocytes, may be codons corresponding to highly expressed tRNAs in human liver / hepatocytes, as described in Dittmar KA, PLos Genetics 2(12):e221 (2006). In some embodiments, at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons corresponding to highly expressed tRNAs in a mammal, such as a human (e.g., the highest expressed tRNA for each amino acid). In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNAs for each amino acid) in a mammalian organ, such as a human organ.In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammalian liver, such as human liver. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in the ORF are codons that correspond to highly expressed tRNAs (e.g., the highest expressed tRNA for each amino acid) in mammalian liver cells, such as human hepatocytes.

[0453] Alternatively, codons corresponding to highly expressed tRNAs in an organism (eg, humans) may generally be used.

[0454] Any of the foregoing approaches to codon selection can be combined with the minimal adenine codon set forth above, for example, by starting with a codon in Table 4 and then, if more than one choice is available, using the codon that corresponds to the more highly expressed tRNA, either in the organism in general (e.g., human) or in the organ or cell type of interest, e.g., liver or hepatocyte (e.g., human liver or human hepatocyte).

[0455] In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from a codon set shown in Table 5 (e.g., a low U1, low A, or low A / U codon set). Codons in the low U1, low G, low C, low A, and low A / U sets use codons that minimize the indicated nucleotides while also using codons corresponding to more highly expressed tRNAs when more than one option is available. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from a low U1 codon set shown in Table 5. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from the low-A codon set shown in Table 5. In some embodiments, at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or 100% of the codons in an ORF are from the low-A / U codon set shown in Table 5. [Table 5]

[0456] 3. Exemplary Sequences In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 93% identity to SEQ ID NO: 311, and / or the ORF has at least 93% identity to SEQ ID NO: 311 over at least its first 50, 200, 250, or 300 nucleotides, or at least 95% identity to SEQ ID NO: 311 over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides. and / or the ORF consists of a set of codons where at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% of the codons are codons listed in Table 1, and / or the ORF has an adenine content ranging from its minimum adenine content to 123% of its minimum adenine content, and / or the ORF has an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content.

[0457] In some embodiments, the polynucleotide encoding the RNA-guided DNA binder comprises a sequence having at least 95%, 96%, 97%, 98%, 99%, 99.5%, or 100% identity to SEQ ID NO:377.

[0458] In some embodiments, the ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375. In some embodiments, the mRNA comprises an ORF encoding an RNA-guided DNA binder, wherein the RNA-guided DNA binder comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 203, 206, 208, 213, 216, 219, 222, 225, 228, 268, or 386-396, and wherein the ORF has an adenine content ranging from its minimum adenine content to 150% of its minimum adenine content and / or an adenine dinucleotide content ranging from its minimum adenine dinucleotide content to 150% of its minimum adenine dinucleotide content. In some embodiments, the encoded RNA-guided DNA binder comprises an amino acid sequence having at least 90% identity to any one of SEQ ID NOs: 203, 206, 208, 213, 216, 219, 222, 225, 228, 268, or 386-396, and the ORF has a uridine content ranging from its minimum uridine content to 150% of its minimum uridine content and / or a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 150% of its minimum uridine dinucleotide content. In some such embodiments, both the adenine and uridine nucleotide content are less than or equal to 150% of their respective minimum values. In some embodiments, both the adenine and uridine dinucleotide content are less than or equal to 150% of their respective minimum values. In some embodiments, the mRNA comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267, which sequence comprises an ORF encoding an RNA-guided DNA binder.In some embodiments, the mRNA comprises a sequence having at least 90% identity to any one of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267, which sequence comprises an ORF encoding an RNA-guided DNA binder, omitting the first three nucleotides of SEQ ID NOs: 243, 244, 251, 253, 255-261, or 267. In some embodiments, any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%.

[0459] In some embodiments, an ORF encoding an RNA-guided DNA binder has at least 90% identity over at least its first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides to any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375, where the first 30, 50, 70, 100, 150, 200, 250, or 300 nucleotides are measured from the first nucleotide of the start codon (typically ATG), such that A is nucleotide 1, T is nucleotide 2, and so on. In some embodiments, an open reading frame has at least 90% identity over at least the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of its sequence to any one of SEQ ID NOs: 201, 204, 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375. The length of an ORF sequence is the number of nucleotides from the beginning of the start codon to the end of the stop codon, with the first 10%, 12%, 15%, 20%, 25%, 30%, or 35% of the sequence corresponding to the number of nucleotides starting from the first nucleotide of the start codon that make up a given percentage of the total sequence length.

[0460] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 243, wherein the ORF of SEQ ID NO: 243 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0461] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 244, wherein the ORF of SEQ ID NO: 244 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0462] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO:256, wherein the ORF of SEQ ID NO:256 (i.e., SEQ ID NO:204) is replaced with an alternative ORF of any one of SEQ ID NOs:207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0463] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 257, wherein the ORF of SEQ ID NO: 257 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0464] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 258, wherein the ORF of SEQ ID NO: 258 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0465] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 259, wherein the ORF of SEQ ID NO: 259 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0466] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 260, wherein the ORF of SEQ ID NO: 260 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0467] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 261, wherein the ORF of SEQ ID NO: 261 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0468] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 376, wherein the ORF of SEQ ID NO: 376 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0469] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 377, wherein the ORF of SEQ ID NO: 377 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0470] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 378, wherein the ORF of SEQ ID NO: 378 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0471] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 379, wherein the ORF of SEQ ID NO: 379 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0472] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 380, wherein the ORF of SEQ ID NO: 380 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0473] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 381, wherein the ORF of SEQ ID NO: 381 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0474] In some embodiments, the nucleic acid comprising an ORF encoding the RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 382, ​​wherein the ORF of SEQ ID NO: 382 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0475] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 383, wherein the ORF of SEQ ID NO: 383 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0476] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 384, wherein the ORF of SEQ ID NO: 384 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0477] In some embodiments, the nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises a sequence having at least 90% identity to SEQ ID NO: 385, wherein the ORF of SEQ ID NO: 385 (i.e., SEQ ID NO: 204) is replaced with the ORF of any one of SEQ ID NOs: 207, 209, 210, 211, 212, 214, 215, 217, 218, 220, 221, 223, 224, 226, 227, 229, 230, 250, 252, 254, 265, 266, or 307-375.

[0478] In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO:243, 244, 256-61, or 376-385 is at least 95%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO:243, 244, 256-61, or 376-385 is at least 98%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO:243, 244, 256-61, or 376-385 is at least 99%. In some embodiments, the degree of identity to an optionally substituted sequence of SEQ ID NO:243, 244, 256-61, or 376-385 is 100%.

[0479] 4. Additional Characteristics of Nucleic Acids, mRNAs, and ORFs Any of the additional features described herein may be combined with any of the above-described embodiments to the extent feasible.

[0480] a) Low uridine content In some embodiments, an ORF encoding an RNA-guided DNA binder (e.g., a Cas9 nuclease such as S. pyogenes Cas9) has a uridine content ranging from its minimum uridine content to about 150% of its minimum uridine content. In some embodiments, the uridine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content equal to its minimum uridine content. In some embodiments, the ORF has a uridine content of about 150% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of about 145% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 140% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 135% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 130% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 125% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 120% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 115% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 110% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 105% or less of its minimum uridine content. In some embodiments, an ORF has a uridine content of about 104% or less of its minimum uridine content. In some embodiments, the ORF has a uridine content of about 103% or less of its minimum uridine content, hi some embodiments, the ORF has a uridine content of about 102% or less of its minimum uridine content.In some embodiments, an ORF has a uridine content of about 101% or less of its minimum uridine content.

[0481] In some embodiments, an ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to 200% of its minimum uridine dinucleotide content. In some embodiments, the uridine dinucleotide content of an ORF is about 195% or less, 190% or less, 185% or less, 180% or less, 175% or less, 170% or less, 165% or less, 160% or less, 155% or less, 150% or less, 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 200% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 195% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 190% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 185% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 180% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 175% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 170% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 165% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 160% or less of its minimum uridine dinucleotide content.In some embodiments, an ORF has a uridine dinucleotide content of about 155% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content equal to its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 150% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 145% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 140% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 135% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 130% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 125% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 120% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 115% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 110% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 105% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 104% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 103% or less of its minimum uridine dinucleotide content. In some embodiments, an ORF has a uridine dinucleotide content of about 102% or less of its minimum uridine dinucleotide content.In some embodiments, an ORF has a uridine dinucleotide content of about 101% or less of its minimum uridine dinucleotide content.

[0482] In some embodiments, an ORF has a uridine dinucleotide content ranging from its minimum uridine dinucleotide content to a uridine dinucleotide content that is 90% or less of the maximum uridine dinucleotide content of a reference sequence encoding the same protein as the mRNA in question. In some embodiments, the uridine dinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum uridine dinucleotide content of a reference sequence encoding the same protein as the mRNA in question.

[0483] In some embodiments, the ORF has a uridine trinucleotide content ranging from 0 uridine trinucleotides to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, or 50 uridine trinucleotides (longer numbers of uridines count as the number of unique three-uridine segments therein, e.g., a uridine tetranucleotide contains two uridine trinucleotides, a uridine pentanucleotide contains three uridine trinucleotides, etc.). In some embodiments, an ORF has a uridine trinucleotide content ranging from 0% uridine trinucleotides to 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.5%, or 2% uridine trinucleotides, where the percent uridine trinucleotide content is calculated as the percent of positions in the sequence occupied by uridines that form part of a uridine trinucleotide (or a longer number of uridines), such that the sequences UUUAAA and UUUUAAAA each have a uridine trinucleotide content of 50%. For example, in some embodiments, an ORF has a uridine trinucleotide content of 2% or less. For example, in some embodiments, an ORF has a uridine trinucleotide content of 1.5% or less. In some embodiments, an ORF has a uridine trinucleotide content of 1% or less. In some embodiments, an ORF has a uridine trinucleotide content of 0.9% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.8% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.7% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.6% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.5% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.4% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.3% or less.In some embodiments, the ORF has a uridine trinucleotide content of 0.2% or less. In some embodiments, the ORF has a uridine trinucleotide content of 0.1% or less. In some embodiments, the ORF has no uridine trinucleotides.

[0484] In some embodiments, an ORF has a uridine trinucleotide content ranging from its minimum uridine trinucleotide content to a uridine trinucleotide content that is 90% or less of the maximum uridine trinucleotide content of a reference sequence encoding the same protein as the mRNA in question. In some embodiments, the uridine trinucleotide content of an ORF is about 85% or less, 80% or less, 75% or less, 70% or less, 65% or less, 60% or less, 55% or less, 50% or less, 45% or less, 40% or less, 35% or less, 30% or less, 25% or less, 20% or less, 15% or less, 10% or less, or 5% or less of the maximum uridine trinucleotide content of a reference sequence encoding the same protein as the mRNA in question.

[0485] For example, by using minimal uridine codons in a sufficient fraction of the ORF, a given ORF can have a reduced uridine content, or a uridine dinucleotide content, or a uridine trinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal uridine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are codons listed in Table 6. [Table 6]

[0486] In some embodiments, the ORF consists of a set of codons where at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 6.

[0487] b) Low adenine and uridine content To the extent practicable, any of the features described herein with respect to low adenine content can be combined with any of the features described herein with respect to low uridine content, for example, when the uridine content is in the range of from its minimum uridine content to about 150% of its minimum uridine content (e.g., the uridine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine content), and the adenine content is in the range of from its minimum uridine content to about 150% of its minimum uridine content (e.g., the uridine content of the ORF is about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum uridine content). Nucleic acids (e.g., mRNAs) encoding RNA-guided DNA binders can be provided that include ORFs with an adenine content ranging from about 150% of its minimum adenine content (e.g., about 145% or less, 140% or less, 135% or less, 130% or less, 125% or less, 120% or less, 115% or less, 110% or less, 105% or less, 104% or less, 103% or less, 102% or less, or 101% or less of its minimum adenine content). The same applies to uridine and adenine dinucleotides. Similarly, the content of uridine nucleotides and adenine dinucleotides in the ORF can be as described above. Similarly, the content of uridine dinucleotides and adenine nucleotides in the ORF can be as described above.

[0488] For example, by using minimal uridine and adenine codons in a sufficient fraction of the ORF, a given ORF can have a reduced uridine and adenine nucleotide and / or dinucleotide content. For example, the amino acid sequence of an RNA-guided DNA binder can be reverse-translated into an ORF sequence by converting amino acids to codons, with some or all of the ORF using the exemplary minimal uridine and adenine codons shown below. In some embodiments, at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, about 99%, or about 100% of the codons in the ORF are those listed in Table 7. [Table 7]

[0489] In some embodiments, the ORF is comprised of a set of codons in which at least about 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the codons are codons listed in Table 7. As can be seen from Table 7, each of the three serine codons listed contains either one A or one U. In some embodiments, uridine minimization is preferred by using the AGC codon for serine. In some embodiments, adenine minimization is preferred by using the UCC and / or UCG codons for serine.

[0490] c) UTR, Kozak sequence In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR, a 3' UTR, or a 5' UTR and a 3' UTR. In some embodiments, the polynucleotide (e.g., mRNA) comprises at least one UTR from hydroxysteroid 17-beta dehydrogenase 4 (HSD17B4 or HSD), e.g., a 5' UTR from an HSD. In some embodiments, the polynucleotide (e.g., mRNA) comprises at least one UTR from a globin polynucleotide (e.g., mRNA), e.g., a human alpha globin (HBA) polynucleotide (e.g., mRNA), a human beta globin (HBB) polynucleotide (e.g., mRNA), or a Xenopus laevis beta globin (XBG) polynucleotide (e.g., mRNA). In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR, a 3' UTR, or a 5' and a 3' UTR from a globin polynucleotide (e.g., mRNA), e.g., HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 5' UTR from bovine growth hormone, cytomegalovirus (CMV), mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises a 3' UTR from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, or XBG. In some embodiments, the polynucleotide (e.g., mRNA) comprises 5' and 3' UTRs from bovine growth hormone, cytomegalovirus, mouse Hba-a1, HSD, albumin gene, HBA, HBB, XBG, heat shock protein 90 (Hsp90), glyceraldehyde 3-phosphate dehydrogenase (GAPDH), beta-actin, alpha-tubulin, tumor protein (p53), or epidermal growth factor receptor (EGFR).

[0491] In some embodiments, the polynucleotide (e.g., mRNA) comprises 5' and 3' UTRs from the same source, e.g., a constitutively expressed polynucleotide (e.g., mRNA) such as actin, albumin, or a globin such as HBA, HBB, or XBG.

[0492] In some embodiments, the nucleic acids disclosed herein comprise a 5' UTR having at least 90% identity to any one of SEQ ID NOs: 232, 234, 236, 238, 241, or 275-277. In some embodiments, the nucleic acids disclosed herein comprise a 3' UTR having at least 90% identity to any one of SEQ ID NOs: 233, 235, 237, 239, or 240. In some embodiments, any of the foregoing levels of identity is at least 95%, at least 98%, at least 99%, or 100%. In some embodiments, the nucleic acids disclosed herein comprise a 5' UTR having the sequence of any one of SEQ ID NOs: 232, 234, 236, 238, or 241. In some embodiments, the nucleic acids disclosed herein comprise a 3' UTR having the sequence of any one of SEQ ID NOs: 233, 235, 237, 239, or 240.

[0493] In some embodiments, the polynucleotide (e.g., mRNA) does not include a 5' UTR, e.g., no additional nucleotides between the 5' cap and the start codon. In some embodiments, the polynucleotide (e.g., mRNA) includes a Kozak sequence (described below) between the 5' cap and the start codon, but does not have any additional 5' UTR. In some embodiments, the polynucleotide (e.g., mRNA) does not include a 3' UTR, e.g., no additional nucleotides between the stop codon and the polyA tail.

[0494] In some embodiments, a polynucleotide (e.g., mRNA) contains a Kozak sequence. Kozak sequences can affect translation initiation and overall yield of a polypeptide translated from a nucleic acid. Kozak sequences include a methionine codon that can function as an initiation codon. A minimal Kozak sequence is NNNRUGN, where at least one of the following is true: the first N is A or G and the second N is G. In the context of a nucleotide sequence, R denotes a purine (A or G). In some embodiments, the Kozak sequence is RNNRUGN, NNNRUGG, RNNRUGG, RNNAUGN, NNNAUGG, or RNNAUGG. In some embodiments, the Kozak sequence is rccRUGg with zero, one, or up to two mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is rccAUGg with zero, one, or up to two mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is gccRccAUGG (nucleotides 4-13 of SEQ ID NO: 305) with zero, one, two, or up to three mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is gccAccAUG with zero, one, two, three, or up to four mismatches relative to the lowercase positions. In some embodiments, the Kozak sequence is GCCACCAUG. In some embodiments, the Kozak sequence is gccgccRccAUGG (SEQ ID NO: 305) with zero, one, two, three, or up to four mismatches relative to the lowercase positions.

[0495] d) PolyA tail In some embodiments, a polynucleotide (e.g., mRNA) further comprises a polyadenylation (polyA) tail. In some cases, the polyA tail is "interrupted" with one or more non-adenine nucleotide "anchors" at one or more positions within the polyA tail. The polyA tail can comprise at least eight consecutive adenine nucleotides, but can also comprise one or more non-adenine nucleotides. As used herein, "non-adenine nucleotide" refers to any natural or non-natural nucleotide that does not contain adenine. Guanine, thymine, and cytosine nucleotides are exemplary non-adenine nucleotides. Thus, a polyA tail on a polynucleotide (e.g., mRNA) described herein can comprise consecutive adenine nucleotides located 3' to the nucleotides encoding the RNA-guided DNA-binding agent or sequence of interest. In some cases, a polyA tail on a polynucleotide (e.g., mRNA) comprises non-consecutive adenine nucleotides located 3' to the nucleotides encoding the RNA-guided DNA-binding agent or sequence of interest, with the non-adenine nucleotides interrupting the adenine nucleotides at regular or irregular intervals.

[0496] In some embodiments, the polyA tail is encoded by a plasmid used for in vitro transcription of mRNA and becomes part of the transcription product. The polyA sequence encoded by the plasmid, i.e., the number of consecutive adenine nucleotides in the polyA sequence, may not be precise; for example, 100 polyA sequences in the plasmid may not result in exactly 100 polyA sequences in the transcribed mRNA. In some embodiments, the polyA tail is not encoded by the plasmid but is added by PCR tailing or enzymatic tailing, for example, using E. coli poly(A) polymerase.

[0497] In some embodiments, one or more non-adenine nucleotides are positioned to interrupt consecutive adenine nucleotides so that poly(A) binding proteins can bind to the series of consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8, 9, 10, 11, or 12 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-50 consecutive adenine nucleotides. In some embodiments, one or more non-adenine nucleotides are positioned after at least 8-100 consecutive adenine nucleotides. In some embodiments, the non-adenine nucleotide is positioned after 1, 2, 3, 4, 5, 6, or 7 adenine nucleotides, followed by at least 8 consecutive adenine nucleotides.

[0498] A poly-A tail of the present disclosure may comprise a sequence of consecutive adenine nucleotides followed by one or more non-adenine nucleotides, optionally with additional adenine nucleotides.

[0499] In some embodiments, the poly-A tail comprises or contains one non-adenine nucleotide or a contiguous stretch of 2-10 non-adenine nucleotides. In some embodiments, the non-adenine nucleotide is preceded by at least 8, 9, 10, 11, or 12 contiguous adenine nucleotides. Optionally, the one or more non-adenine nucleotides are preceded by at least 8-50 contiguous adenine nucleotides. In some embodiments, the one or more non-adenine nucleotides are positioned after at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 consecutive adenine nucleotides.

[0500] In some embodiments, the non-adenine nucleotides are guanine, cytosine, or thymine. Optionally, the non-adenine nucleotides are guanine nucleotides. In some embodiments, the non-adenine nucleotides are cytosine nucleotides. In some embodiments, the non-adenine nucleotides are thymine nucleotides. Optionally, when more than one non-adenine nucleotide is present, the non-adenine nucleotides may be selected from a) guanine and thymine nucleotides, b) guanine and cytosine nucleotides, c) thymine and cytosine nucleotides, or d) guanine, thymine, and cytosine nucleotides. An exemplary poly-A tail comprising non-adenine nucleotides is provided as SEQ ID NO: 262.

[0501] e) Modified Nucleotides In some embodiments, a nucleic acid comprising an ORF encoding an RNA-guided DNA binder comprises modified uridines at some or all uridine positions. In some embodiments, the modified uridine is a uridine modified at the 5-position, e.g., with a halogen or a C1-C3 alkoxy. In some embodiments, the modified uridine is a pseudouridine modified at the 1-position, e.g., with a C1-C3 alkyl. The modified uridine can be, for example, pseudouridine, N1-methyl-pseudouridine, 5-methoxyuridine, 5-iodouridine, or a combination thereof. In some embodiments, the modified uridine is 5-methoxyuridine. In some embodiments, the modified uridine is 5-iodouridine. In some embodiments, the modified uridine is pseudouridine. In some embodiments, the modified uridine is N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of N1-methylpseudouridine and 5-methoxyuridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and N1-methyl-pseudouridine. In some embodiments, the modified uridine is a combination of pseudouridine and 5-iodouridine. In some embodiments, the modified uridine is a combination of 5-iodouridine and 5-methoxyuridine.

[0502] In some embodiments, at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, 99%, or 100% of the uridine positions in a nucleic acid are modified uridines. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in a nucleic acid are modified uridines, such as 5-methoxyuridine, 5-iodouridine, N1-methylpseudouridine, pseudouridine, or a combination thereof. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are 5-methoxyuridine, hi some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are pseudouridine. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are N1-methylpseudouridine. In some embodiments, 10% to 25%, 15% to 25%, 25% to 35%, 35% to 45%, 45% to 55%, 55% to 65%, 65% to 75%, 75% to 85%, 85% to 95%, or 90% to 100% of the uridine positions in the nucleic acid are 5-iodouridine. In some embodiments, 10% to 25%, 15 to 25%, 25 to 35%, 35 to 45%, 45 to 55%, 55 to 65%, 65 to 75%, 75 to 85%, 85 to 95%, or 90 to 100% of the uridine positions in the nucleic acid are 5-methoxyuridine, and the remainder are N1-methylpseudouridine.In some embodiments, 10% to 25%, 15 to 25%, 25 to 35%, 35 to 45%, 45 to 55%, 55 to 65%, 65 to 75%, 75 to 85%, 85 to 95%, or 90 to 100% of the uridine positions in the nucleic acid are 5-iodouridine, and the remainder are N1-methylpseudouridine.

[0503] f) 5' cap In some embodiments, a nucleic acid (e.g., mRNA) comprising an ORF encoding an RNA-guided DNA binder comprises a 5'-cap, e.g., Cap0, Cap1, or Cap2. The 5'-cap is generally a 7-methylguanine ribonucleotide (e.g., for ARCA, which may be further modified as described below) linked via a 5'-triphosphate to the 5'-position of the first nucleotide (i.e., the first cap-proximal nucleotide) of the 5'-3' strand of the nucleic acid. In Cap0, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise 2'-hydroxyl. In Cap1, the riboses of the first and second transcribed nucleotides of the mRNA comprise 2'-methoxy and 2'-hydroxy, respectively. In Cap2, the riboses of the first and second cap-proximal nucleotides of the mRNA both comprise 2'-methoxy. See, for example, Katibah et al. (2014) Proc Natl Acad Sci USA 111(33):12025-30 and Abbas et al. (2017) Proc Natl Acad Sci USA 114(11):E2106-E2115. Most endogenous higher eukaryotic mRNAs, including mammalian nucleic acids such as human nucleic acids, contain Cap1 or Cap2. Cap0 and other cap structures distinct from Cap1 and Cap2 are recognized as "non-self" by components of the innate immune system, such as IFIT-1 and IFIT-5, and can be immunogenic in mammals, including humans, leading to elevated levels of cytokines, including type I interferons. Components of the innate immune system, such as IFIT-1 and IFIT-5, can also compete with eIF4E for binding to nucleic acids with caps other than Cap1 or Cap2, potentially inhibiting mRNA translation.

[0504] A cap can be co-transcriptionally incorporated into RNA. For example, ARCA (anti-reverse cap analog, Thermo Fisher Scientific catalog number AM8045) is a cap analog containing 7-methylguanine 3'-methoxy-5'-triphosphate linked to the 5' position of guanine ribonucleotides and can be incorporated into transcripts in vitro at the time of initiation. ARCA results in a Cap0 cap in which the 2' position of the first cap-proximal nucleotide is hydroxyl. See, for example, Stepinski et al. (2001) "Synthesis and properties of mRNAs containing the novel 'anti-reverse' cap analogs 7-methyl(3'-O-methyl)GpppG and 7-methyl(3'deoxy)GpppG," RNA 7:1486-1495. The structure of ARCA is shown below. [ka]

[0505] CleanCap™ AG (m7G(5')ppp(5')(2'OMeA)pG, TriLink Biotechnologies catalog number N-7113) or CleanCap™ GG (m7G(5')ppp(5')(2'OMeG)pG, TriLink Biotechnologies catalog number N-7133) can be used to co-transcriptionally provide the Cap1 structure. 3'-O-methylated versions of CleanCap™ AG and CleanCap™ GG are also available from TriLink Biotechnologies as catalog numbers N-7413 and N-7433, respectively. The structure of CleanCap™ AG is shown below. CleanCap™ structures are sometimes referred to herein using the last three digits of the catalog number listed above (e.g., "CleanCap™ 113" for TriLink Biotechnologies catalog number N-7113). [ka]

[0506] Alternatively, a cap can be added to RNA after transcription. For example, Vaccinia capping enzyme is commercially available (New England Biolabs Catalog No. M2080S), which has RNA triphosphatase and guanylyltransferase activity provided by its D1 subunit, and guanine methyltransferase activity provided by its D12 subunit. Thus, in the presence of S-adenosylmethionine and GTP, 7-methylguanine can be added to RNA to give Cap0. See, for example, Guo, P. and Moss, B. (1990) Proc. Natl. Acad. Sci. USA 87, 4023-4027; Mao, X. and Shuman, S. (1994) J. Biol. Chem. 269, 24472-24479. For additional discussion of caps and capping approaches, see, e.g., WO2017 / 053297 and Ishikawa et al., Nucl. Acids. Symp. Ser. (2009) No. 53, 129-A130.

[0507] F. Determining RNA Efficacy In some embodiments, the efficacy of the gRNA is determined when delivered together with other components, for example, a nucleic acid encoding an RNA-guided DNA-binding agent, such as any of those described herein. In some embodiments, the efficacy of the combination of a corticosteroid and a gRNA, and optionally an RNA-guided DNA-binding agent or a nucleic acid encoding such an agent, is determined.

[0508] As described herein, the use of the RNA-guided DNA binding agent and guide RNA disclosed herein may cause double-strand breaks in DNA, and when repaired by cellular machinery, may cause errors in the form of insertion / deletion (indel) mutations.Many mutations caused by indels alter reading frame or introduce premature stop codons, thus producing non-functional proteins.

[0509] In some embodiments, the efficacy of a particular gRNA, composition, or treatment, including administering a gRNA, a corticosteroid, and optionally an RNA-guided DNA-binding agent or a nucleic acid encoding such an agent, is determined based on an in vitro model. In some embodiments, the in vitro model is HEK293 cells. In some embodiments, the in vitro model is HUH7 human liver cancer cells. In some embodiments, the in vitro model is HepG2 cells. In some embodiments, the in vitro model is primary human hepatocytes. In some embodiments, the in vitro model is primary cynomolgus monkey hepatocytes. Regarding the use of primary human hepatocytes, commercially available primary human hepatocytes can be used to provide greater consistency between experiments. In some embodiments, the number of off-target sites at which deletions or insertions occur in an in vitro model (e.g., in primary human hepatocytes) is determined, for example, by analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA and guide RNA. In some embodiments, such determination involves analyzing genomic DNA from primary human hepatocytes transfected in vitro with Cas9 mRNA, guide RNA, and donor oligonucleotides. An exemplary procedure for such determination is provided in the working examples below.

[0510] In some embodiments, the efficacy of a particular gRNA, composition, or treatment, including administering a gRNA, a corticosteroid, and optionally an RNA-guided DNA-binding agent or a nucleic acid encoding such an agent, is determined across multiple in vitro cell models for the gRNA selection process. In some embodiments, cell line comparisons of data with the selected gRNA are performed. In some embodiments, cross-screening is performed across multiple cell models.

[0511] In some embodiments, the efficacy of a particular gRNA, composition, or treatment, including administering a gRNA, a corticosteroid, and optionally an RNA-guided DNA binding agent or a nucleic acid encoding such an agent, is determined based on an in vivo model. In some embodiments, the in vivo model is a rodent model. In some embodiments, the rodent model is a mouse expressing a human TTR gene, which may be a mutant human TTR gene. In some embodiments, the in vivo model is a non-human primate, such as a cynomolgus monkey.

[0512] In some embodiments, the efficacy of the guide RNA, composition or treatment, comprising administering gRNA, corticosteroid, and optionally administering RNA-guided DNA binding agent or nucleic acid encoding such agent, is measured by the percent editing of TTR.In some embodiments, the percent editing of TTR is compared with the percent editing required to achieve knockdown of TTR protein, for example, in whole cell culture in in vitro model, or in serum or tissue in in vivo model.

[0513] In some embodiments, the efficacy of a gRNA, composition, or treatment comprising administering a gRNA, a corticosteroid, and optionally an RNA-guided DNA-binding agent or a nucleic acid encoding such an agent is measured by the number and / or frequency of indels at off-target sequences within the genome of a target cell type. In some embodiments, effective guide RNAs are provided that generate indels at off-target sites at a very low frequency (e.g., less than 5%) relative to the frequency of indel generation in a cell population and / or at the target site. Accordingly, the present disclosure provides guide RNAs that do not exhibit off-target indel formation in a target cell type (e.g., hepatocytes) or that have a frequency of off-target indel formation of less than 5% relative to the frequency of indel generation in a cell population and / or at the target site. In some embodiments, the present disclosure provides guide RNAs that do not exhibit any off-target indel formation in a target cell type (e.g., hepatocytes). In some embodiments, guide RNAs are provided that generate indels at fewer than five off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, guide RNAs are provided that generate indels at no more than 4, 3, 2, or 1 off-target sites, e.g., as assessed by one or more methods described herein. In some embodiments, the off-target sites do not occur within protein-coding regions in the target cell (e.g., hepatocyte) genome.

[0514] In some embodiments, detecting gene editing events, e.g., the formation of insertion / deletion ("indel") mutations, and homology-guided repair (HDR) events in target DNA utilizes linear amplification using tagged primers and isolation of the tagged amplification products (hereinafter referred to as "LAM-PCR" or "linear amplification (LA)" method), as described in WO2018 / 067447 or Schmidt et al., Nature Methods 4:1051-1057 (2007).

[0515] In some embodiments, the method includes isolating cellular DNA from cells that are induced to have double-strand breaks (DSBs) and optionally provided with HDR templates to repair DSBs; performing at least one cycle of linear amplification of DNA using tagged primers; isolating linear amplification products that contain tags, thereby discarding any amplification products that are amplified with non-tagged primers; optionally further amplifying the isolated products; and analyzing the linear amplification products or further amplification products to determine the presence or absence of editing events, such as double-strand breaks, insertions, deletions, or HDR template sequences in target DNA. In some cases, editing events can be quantified. As used herein, quantification (including the context of HDR and non-HDR editing events such as indels) includes detecting the frequency and / or type of editing events in a collection.

[0516] In some embodiments, only one cycle of linear amplification is performed.

[0517] In some cases, the tagged primer comprises a molecular barcode. In some embodiments, the tagged primer comprises a molecular barcode and only one cycle of linear amplification is performed.

[0518] In some embodiments, detecting gene editing events, such as the formation of insertion / deletion ("indel") mutations, and homology-guided repair (HDR) events in the target DNA further comprises sequencing the linear amplification product or the further amplification product. Sequencing may include any method known to those skilled in the art, including next-generation sequencing, cloning the linear amplification product or the further amplification product into a plasmid, and sequencing the plasmid or a portion of the plasmid. Exemplary next-generation sequencing methods are described, for example, in Shendure et al., Nature 26:1135-1145 (2008). In other embodiments, detecting gene editing events, such as the formation of insertion / deletion ("indel") mutations, and homology-guided repair (HDR) events in the target DNA further comprises performing digital PCR (dPCR) or droplet digital PCR (ddPCR) on the linear amplification product or the further amplification product, or contacting the linear amplification product or the further amplification product with a nucleic acid probe designed to identify DNA containing an HDR template sequence, and detecting the probe bound to the linear amplification product or the further amplification product. In some embodiments, the method further comprises determining the location of the HDR template in the target DNA.

[0519] In certain embodiments, the method further comprises determining the sequence of an insertion site within the target DNA, the insertion site being the position where the HDR template is integrated into the target DNA, and the insertion site may comprise some target DNA sequence and some HDR template sequence.

[0520] In some embodiments, the effectiveness of the guide RNA or combination is measured by TTR secretion. In some embodiments, TTR secretion is measured using an enzyme-linked immunosorbent assay (ELISA) using cell culture medium or serum. In some embodiments, TTR secretion is measured in the same in vitro or in vivo system or model used to measure editing. In some embodiments, TTR secretion is measured in primary human hepatocytes. In some embodiments, TTR secretion is measured in HUH7 cells. In some embodiments, TTR secretion is measured in HepG2 cells.

[0521] ELISA assays are commonly known to those skilled in the art and can be designed to determine serum TTR levels. In an exemplary embodiment, blood is collected and serum is isolated. Total TTR serum levels can be determined using the Mouse Prealbumin (Transthyretin) ELISA Kit (Aviva Systems Biology, Cat. OKIA00111) or a similar kit for measuring human TTR. If a kit is not available, an ELISA can be developed using a plate pre-coated with a capture antibody specific to TTR at the time of measurement. The plate is incubated at room temperature for a predetermined time and then washed. An enzyme-anti-TTR antibody conjugate is added and incubated. Unbound antibody conjugate is removed, the plate is washed, and then a chromogenic substrate solution that reacts with the enzyme is added. The plate is read in an appropriate plate reader at an absorbance specific to the enzyme and substrate used.

[0522] In some embodiments, the amount of TTR in cells (including those derived from tissues) is used to measure the effectiveness of the gRNA or combination. In some embodiments, the amount of TTR in cells is measured using Western blot. In some embodiments, the cells used are HUH7 cells. In some embodiments, the cells used are primary human hepatocytes. In some embodiments, the cells used are primary cells obtained from animals. In some embodiments, the amount of TTR is compared to the amount of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (a housekeeping gene) to control for changes in cell number.

[0523] III. LNP formulations and treatment of ATTR In some embodiments, methods of treating ATTR are provided, comprising administering a corticosteroid and a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to treat ATTR. The guide RNA may be administered together with an RNA-guided DNA nuclease, such as a Cas nuclease (e.g., Cas9), or a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease. In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0524] In some embodiments, methods of treating ATTR are provided, comprising administering a corticosteroid and a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID NOS: 87-113, 115-120, and 122-124). In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs of SEQ ID NOS: 87-113, 115-120, and 122-124, is administered to treat ATTR. The guide RNA is optionally administered in conjunction with an RNA-guided DNA nuclease, such as a Cas nuclease (e.g., Cas9), or a nucleic acid or vector described herein encoding the RNA-guided DNA nuclease. In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0525] In some embodiments, methods for reducing TTR serum concentrations are provided, comprising administering a corticosteroid and a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124). In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOs: 5-82 or any one or more of the sgRNAs of SEQ ID NOs: 87-124 is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP as described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0526] In some embodiments, methods of reducing TTR serum concentrations are provided, comprising administering a guide RNA described herein (e.g., comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124). In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124, is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The guide RNA is optionally administered in conjunction with an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9), or a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease. In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0527] In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising a corticosteroid and a guide RNA described herein (e.g., comprising any one or more of the guide sequences of SEQ ID NOS: 5-82 or any one or more of the sgRNAs of SEQ ID NOS: 87-124). In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising a corticosteroid and any one or more of the sgRNAs of SEQ ID NOS: 87-113. In some embodiments, a gRNA comprising any one or more of the guide sequences of SEQ ID NOS: 5-82 or any one or more of the sgRNAs of SEQ ID NOS: 87-124 is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The gRNA is optionally administered together with a nucleic acid or vector described herein encoding an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9). In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the nucleic acid encoding the guide RNA and the RNA-guided DNA nuclease is administered in an LNP described herein, for example, an LNP comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0528] In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising a guide RNA described herein (e.g., comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-124). In some embodiments, methods are provided for reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject, the methods comprising administering a composition comprising any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124. In some embodiments, a gRNA comprising any one or more of the guide sequences set forth in SEQ ID NOS: 5-72, 74-78, and 80-82, or any one or more of the sgRNAs set forth in SEQ ID NOS: 87-113, 115-120, and 122-124 is administered to reduce or prevent the accumulation of TTR in amyloid or amyloid fibrils. The guide RNA is optionally administered together with an RNA-guided DNA nuclease, e.g., a Cas nuclease (e.g., Cas9), or a nucleic acid or vector described herein encoding the RNA-guided DNA nuclease. In some embodiments, the RNA-guided DNA nuclease is a Cas cleavase. In some embodiments, the RNA-guided DNA nuclease is a Cas from a type II CRISPR / Cas system. In some embodiments, the RNA-guided DNA nuclease is Cas9. In some embodiments, the RNA-guided DNA nuclease is S. pyogenes Cas9 nuclease. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the RNA-guided DNA nuclease are administered in LNPs described herein, e.g., LNPs comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0529] In some embodiments, a gRNA comprising a guide sequence from Table 1 or one or more sgRNAs from Table 2, together with an RNA-guided DNA nuclease, e.g., a Cas nuclease translated from the nucleic acid, induces a DSB, and non-homologous end joining (NHEJ) during repair results in a mutation in the TTR gene. In some embodiments, NHEJ causes a deletion or insertion of nucleotides, inducing a frameshift or nonsense in the TTR gene.

[0530] In some embodiments, administering a corticosteroid and a guide RNA (and optionally an RNA-guided DNA binder or a nucleic acid encoding the RNA-guided DNA binder) (e.g., in a composition provided herein) reduces the level (e.g., serum level) of TTR in a subject, thus preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils.

[0531] In some embodiments, reducing or preventing the accumulation and aggregation of TTR in amyloid or amyloid fibrils in a subject includes reducing or preventing TTR deposition in one or more tissues of the subject, such as the stomach, colon, or nervous tissue. In some embodiments, the nervous tissue includes the sciatic nerve or dorsal root ganglion. In some embodiments, TTR deposition is reduced in two, three, or four of the stomach, colon, sciatic nerve, and dorsal root ganglion. The level of deposition in a given tissue can be determined using a biopsy sample, for example, using immunostaining. In some embodiments, reducing or preventing the accumulation of TTR in amyloid or amyloid fibrils in a subject and / or reducing or preventing TTR deposition is inferred based on reducing serum TTR levels for a predetermined period of time. As discussed in the Examples, it has been found that reducing serum TTR levels according to the methods and uses provided herein can cause the clearance of deposited TTR from tissues such as those discussed above and in the Examples, for example, as measured 8 weeks after administration of the composition.

[0532] In some embodiments, the subject is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject is a cow, pig, monkey, sheep, dog, cat, fish, or poultry.

[0533] In some embodiments, the use of one or more guide RNAs described herein (e.g., comprising any one or more of the guide sequences in Table 1, or one or more sgRNAs from Table 2) (e.g., in the compositions provided herein) and a nucleic acid (e.g., mRNA) described herein encoding an RNA-guided DNA binder is provided for the preparation of a medicament for treating a human subject with ATTR. The RNA-guided DNA binder may be Cas9, e.g., S. pyogenes Cas9. In certain embodiments, the guide RNA is chemically modified.

[0534] In some embodiments, the composition comprising the guide RNA and nucleic acid is administered intravenously. In some embodiments, the composition comprising the guide RNA and nucleic acid is administered into the hepatic circulation.

[0535] In some embodiments, a single administration of a composition comprising a guide RNA (and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein is sufficient to knock down the expression of a mutant protein. In some embodiments, a single administration of a composition comprising a guide RNA (and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein is sufficient to knock down the expression of a mutant protein in a population of cells. In other embodiments, more than one administration of a composition comprising a guide RNA (and optionally an RNA-guided DNA binding agent or a nucleic acid encoding an RNA-guided DNA binding agent) provided herein may be beneficial to maximize editing through a cumulative effect. For example, the compositions provided herein can be administered two, three, four, five, or even more times, for example, two times. Administration can be divided into periods ranging from, for example, 1 day to 2 years, e.g., 1 day to 7 days, 7 days to 14 days, 14 days to 30 days, 30 days to 60 days, 60 days to 120 days, 120 days to 183 days, 183 days to 274 days, 274 days to 366 days, or 366 days to 2 years.

[0536] In some embodiments, the composition is administered in an effective amount of 0.01 to 10 mg / kg (mpk), e.g., 0.01 to 0.1 mpk, 0.1 to 0.3 mpk, 0.3 to 0.5 mpk, 0.5 to 1 mpk, 1 to 2 mpk, 2 to 3 mpk, 3 to 5 mpk, 5 to 10 mpk, or 0.1, 0.2, 0.3, 0.5, 1, 2, 3, 5, or 10 mpk. In some embodiments, the composition is administered in an amount of 2 to 4 mpk, e.g., 2.5 to 3.5 mpk. In some embodiments, the composition is administered in an amount of about 3 mpk. As reported herein, for LNP compositions, dosage or effective amount is assessed by the total RNA administered.

[0537] In some embodiments, the efficacy of treatment with the compositions herein is seen 1, 2, 3, 4, 5, or 10 years after delivery. In some embodiments, the efficacy of treatment with the compositions of the present invention is assessed by measuring serum levels of TTR before and after treatment. In some embodiments, the efficacy of treatment with the compositions, as assessed by reduction in serum levels of TTR, is seen at 1 week, 2 weeks, 3 weeks, 4 weeks, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, or 11 months.

[0538] In some embodiments, treatment slows or stops the progression of the disease.

[0539] In some embodiments, treatment slows or stops the progression of FAP, hi some embodiments, treatment improves, stabilizes, or slows changes in the symptoms of sensorimotor or autonomic neuropathy.

[0540] In some embodiments, treatment improves, stabilizes, or slows the change in symptoms of FAC. In some embodiments, treatment improves, stabilizes, or slows the change in symptoms of restrictive cardiomyopathy or congestive heart failure.

[0541] In some embodiments, the effectiveness of a treatment is measured by an increase in the subject's survival time. In some embodiments, the effectiveness of a treatment is measured by an increase in tolerability of the treatment. In some embodiments, the increase in tolerability is measured, for example, by cytokine, complement, or other immune responses.

[0542] In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of, symptoms of sensorimotor neuropathy or autonomic neuropathy. In some embodiments, the effectiveness of treatment is measured by an increase in, or a delay in the decline of, the ability to move an area of ​​the body or feel in any area of ​​the body. In some embodiments, the effectiveness of treatment is measured by an improvement in, or an increase in, the ability to swallow, breathe, use an arm, hand, leg, or foot, or ambulation. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of, neuralgia. In some embodiments, neuralgia is characterized by pain, burning, numbness, or abnormal sensations. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the increase of, postural hypotension, dizziness, gastrointestinal motility disorders, bladder dysfunction, or sexual dysfunction. In some embodiments, the effectiveness of treatment is measured by an improvement in, or a delay in the progression of weakness. In some embodiments, the effectiveness of treatment is measured using electromyography, nerve conduction studies, or patient-reported outcomes.

[0543] In some embodiments, the effectiveness of treatment is measured by an improvement in or slowing the progression of symptoms of congestive heart failure or CHF. In some embodiments, the effectiveness of treatment is measured by a reduction in or slowing the increase in shortness of breath, difficulty breathing, fatigue, and swelling of the ankles, feet, legs, abdomen, or neck veins. In some embodiments, the effectiveness of treatment is measured by an improvement in or slowing the progression of fluid accumulation in the body, which may be assessed by measures such as weight gain, frequent urination, or nighttime coughing. In some embodiments, the effectiveness of treatment is measured using cardiac biomarker tests (e.g., B-type natriuretic peptide [BNP] or N-terminal pro-brain natriuretic peptide [NT-proBNP]), pulmonary function tests, chest x-rays, or electrocardiograms.

[0544] A. Combination Therapy In some embodiments, the invention includes a combination therapy comprising administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA-guided DNA binder or a nucleic acid described herein encoding an RNA-guided DNA binder), e.g., a nucleic acid (e.g., mRNA) or vector described herein encoding S. pyogenes Cas9 (e.g., in a composition provided herein), along with an additional therapy suitable for alleviating symptoms of ATTR. In certain embodiments, the guide RNA is chemically modified. In some embodiments, the guide RNA and the nucleic acid encoding the RNA-guided DNA nuclease are administered in LNPs described herein, e.g., LNPs comprising a CCD lipid (e.g., an amine lipid such as lipid A), a helper lipid (e.g., cholesterol), a stealth lipid (e.g., a PEG lipid such as PEG2k-DMG), and optionally a neutral lipid (e.g., DSPC).

[0545] In some embodiments, the additional therapy for ATTR is a treatment for sensorimotor neuropathy or autonomic neuropathy. In some embodiments, the treatment for sensorimotor neuropathy or autonomic neuropathy is a nonsteroidal anti-inflammatory drug, an antidepressant, an anticonvulsant, an antiarrhythmic drug, or a narcotic. In some embodiments, the antidepressant is a tricyclic drug or a serotonin-norepinephrine reuptake inhibitor. In some embodiments, the antidepressant is amitriptyline, duloxetine, or venlafaxine. In some embodiments, the anticonvulsant is gabapentin, pregabalin, topiramate, or carbamazepine. In some embodiments, the additional therapy for sensorimotor neuropathy is transcutaneous electrical nerve stimulation.

[0546] In some embodiments, the additional therapy for ATTR is a treatment for restrictive cardiomyopathy or congestive heart failure (CHF). In some embodiments, the treatment for CHF is an ACE inhibitor, an aldosterone antagonist, an angiotensin receptor blocker, a beta-blocker, digoxin, a diuretic, or isosorbide dinitrate / hydralazine hydrochloride. In some embodiments, the ACE inhibitor is enalapril, captopril, ramipril, perindopril, imidapril, or quinapril. In some embodiments, the aldosterone antagonist is eplerenone or spironolactone. In some embodiments, the angiotensin receptor blocker is azilsartan, cadesartan, eprosartan, irbesartan, losartan, olmesartan, telmisartan, or valsartan. In some embodiments, the beta blocker is acebutolol, atenolol, bisoprolol, metoprolol, nadolol, nebivolol, or propranolol. In some embodiments, the diuretic is chlorothiazide, chlorthalidone, hydrochlorothiazide, indapamide, metolazone, bumetanide, furosemide, torsemide, amiloride, or triamethelen.

[0547] In some embodiments, the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA-guided DNA binding agent or a nucleic acid described herein encoding the RNA-guided DNA binding agent) (e.g., in a composition provided herein) together with an siRNA targeting TTR or mutant TTR. In some embodiments, the siRNA is any siRNA capable of further reducing or eliminating expression of wild-type or mutant TTR. In some embodiments, the siRNA is the drug patisiran (ALN-TTR02) or ALN-TTRsc02. In some embodiments, the siRNA is administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e.g., in a composition provided herein). In some embodiments, the siRNA is administered periodically after treatment with any of the gRNA compositions provided herein.

[0548] In some embodiments, the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA-guided DNA binder or a nucleic acid described herein encoding an RNA-guided DNA binder) (e.g., in a composition provided herein) together with an antisense nucleotide targeting TTR or mutant TTR. In some embodiments, the antisense nucleotide is any antisense nucleotide that can further reduce or eliminate expression of wild-type or mutant TTR. In some embodiments, the antisense nucleotide is the drug inotersen (IONS-TTR). Rx). In some embodiments, the antisense nucleotides are administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2, and a nucleic acid encoding an RNA-guided DNA-binding agent (e.g., in a composition provided herein). In some embodiments, the antisense nucleotides are administered periodically after treatment with any of the gRNA compositions provided herein.

[0549] In some embodiments, the combination therapy comprises administering a corticosteroid and any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (and optionally an RNA-guided DNA binder or a nucleic acid described herein encoding an RNA-guided DNA binder) (e.g., in a composition provided herein) together with a small molecule stabilizer that promotes dynamic stabilization of the correctly folded tetrameric form of TTR. In some embodiments, the small molecule stabilizer is the drug tafamidis (Vyndaqel®) or diflunisal. In some embodiments, the small molecule stabilizer is administered after any one of the gRNAs comprising any one or more of the guide sequences disclosed in Table 1 or any one or more of the sgRNAs in Table 2 (e.g., in a composition provided herein). In some embodiments, the small molecule stabilizer is administered periodically after treatment with any of the compositions provided herein.

[0550] In any of the foregoing embodiments, the guide sequence disclosed in Table 1 may be selected from SEQ ID NOs: 5-72, 74-78, and 80-82, and / or the sgRNA in Table 2 may be selected from SEQ ID NOs: 87-113, 115-120, and 122-124, and / or the guide RNA may be a chemically modified guide RNA.

[0551] B. Delivery of Nucleic Acid Compositions In some embodiments, the nucleic acid compositions described herein, which comprise the nucleic acid described herein encoding the gRNA and optionally the RNA-guided DNA binder as RNA, or are encoded on one or more vectors, are formulated in or administered via lipid nanoparticles. See, for example, WO2017 / 173054A1 published on October 5, 2017 and WO2019 / 067992A1 published on April 4, 2019, the contents of which are incorporated herein by reference in their entirety. Any lipid nanoparticle (LNP) known to those skilled in the art that can deliver nucleotides to a subject can be used with the nucleic acid encoding the guide RNA and, optionally, the RNA-guided DNA nuclease described herein.

[0552] Various embodiments of LNP formulations for RNA, including CRISPR / Cas cargo, are disclosed herein. Such LNP formulations may include (i) CCD lipids, e.g., amine lipids; (ii) neutral lipids; (iii) helper lipids; and (iv) stealth lipids, e.g., PEG lipids. Some embodiments of LNP formulations include "amine lipids" along with helper lipids, neutral lipids, and stealth lipids, such as PEG lipids. In some embodiments, the LNP formulations include less than 1% neutral phospholipids. In some embodiments, the LNP formulations include less than 0.5% neutral phospholipids. By "lipid nanoparticle" is meant a particle comprising multiple (i.e., more than one) lipid molecules physically bound to each other by intermolecular forces.

[0553] CCD lipids A liquid composition for delivering CRISPR / Cas mRNA and guide RNA components to target cells (e.g., liver cells) comprises a CCD lipid.

[0554] In some embodiments, the CCD lipid is lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be depicted as follows: [ka]

[0555] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84 to 86).

[0556] In some embodiments, the CCD lipid is lipid B, which is ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate), also known as ((5-((dimethylamino)methyl)-1,3-phenylene)bis(oxy))bis(octane-8,1-diyl)bis(decanoate). Lipid B can be depicted as follows: [ka]

[0557] Lipid B can be synthesized according to WO2014 / 136086 (e.g., pages 107-09).

[0558] In some embodiments, the CCD lipid is lipid C, which is 2-((4-(((3-(dimethylamino)propoxy)carbonyl)oxy)hexadecanoyl)oxy)propane-1,3-diyl(9Z,9'Z,12Z,12'Z)-bis(octadeca-9,12-dienoate). Lipid C can be depicted as follows: [ka]

[0559] In some embodiments, the CCD lipid is lipid D, which is 3-(((3-(dimethylamino)propoxy)carbonyl)oxy)-13-(octanoyloxy)tridecyl 3-octylundecanoate.

[0560] Lipid D can be depicted as follows: [ka]

[0561] Lipid C and lipid D can be synthesized according to WO2015 / 095340.

[0562] The CCD lipid can also be an equivalent to lipid A, lipid B, lipid C, or lipid D. In certain embodiments, the CCD lipid is an equivalent to lipid A, an equivalent to lipid B, an equivalent to lipid C, or an equivalent to lipid D.

[0563] Amine lipids In some embodiments, an LNP composition for delivery of a bioactive agent comprises an "amine lipid," which is defined as lipid A, lipid B, lipid C, lipid D, or an equivalent of lipid A (including the acetal analog of lipid A), an equivalent of lipid B, an equivalent of lipid C, and an equivalent of lipid D.

[0564] In some embodiments, the amine lipid is lipid A, which is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, also known as 3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl(9Z,12Z)-octadeca-9,12-dienoate. Lipid A can be depicted as follows: [ka]

[0565] Lipid A can be synthesized according to WO2015 / 095340 (e.g., pages 84-86). In certain embodiments, the amine lipid is an equivalent to lipid A.

[0566] In certain embodiments, the amine lipid is an analog of lipid A. In certain embodiments, the lipid A analog is an acetal analog of lipid A. In certain LNP compositions, the acetal analog is a C4-C12 acetal analog. In some embodiments, the acetal analog is a C5-C12 acetal analog. In additional embodiments, the acetal analog is a C5-C10 acetal analog. In further embodiments, the acetal analog is selected from C4, C5, C6, C7, C9, C10, C11, and C12 acetal analogs.

[0567] Amine lipids suitable for use in the LNPs described herein are biodegradable in vivo and suitable for delivering bioactive agents (e.g., RNA) to cells. Amine lipids have low toxicity (e.g., RNA cargo at doses of 10 mg / kg or greater is tolerated in animal models without adverse reactions). In certain embodiments, LNPs comprising amine lipids include those in which at least 75% of the amine lipids are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In certain embodiments, LNPs comprising amine lipids include those in which at least 50% of the mRNA or gRNA are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days. In certain embodiments, LNPs comprising amine lipids include those in which at least 50% of the LNPs are cleared from plasma within 8, 10, 12, 24, or 48 hours, or within 3, 4, 5, 6, 7, or 10 days, e.g., by measuring lipid (e.g., amine lipid), RNA (e.g., mRNA), or another component. In certain embodiments, lipid-encapsulated versus free lipid, RNA, or nucleic acid components of the LNPs are measured.

[0568] Lipid clearance may be measured as described in the literature. See Maier, MA, et al. Biodegradable Lipids Enabling Rapidly Eliminated Lipid Nanoparticles for Systemic Delivery of RNAi Therapeutics. Mol. Ther. 2013, 21(8), 1570-78 ("Maier"). For example, in Maier, an LNP-siRNA system containing siRNA targeting luciferase was administered at 0.3 mg / kg via intravenous bolus injection via the lateral tail vein to 6-8 week-old male C57Bl / 6 mice. Blood, liver, and spleen samples were collected at 0.083, 0.25, 0.5, 1, 2, 4, 8, 24, 48, 96, and 168 hours post-administration. Mice were perfused with saline prior to tissue collection, and blood samples were processed to obtain plasma. All samples were processed and analyzed by LC-MS. Furthermore, Maier describes a procedure for assessing the toxicity of LNP-siRNA formulations after administration. For example, siRNA targeting luciferase was administered to male Sprague-Dawley rats at 0, 1, 3, 5, and 10 mg / kg (5 animals / group) via a single intravenous bolus injection at a dose volume of 5 mL / kg. After 24 hours, approximately 1 mL of blood was obtained from the jugular vein of conscious animals, and serum was isolated. Seventy-two hours after administration, all animals were euthanized for necropsy. Clinical signs, body weight, serum chemistry, organ weight, and histopathology were assessed. While Maier describes methods for assessing siRNA-LNP formulations, these methods can be applied to assessing clearance, pharmacokinetics, and toxicity of the LNP compositions of the present disclosure.

[0569] Amine lipids can increase clearance rate. In some embodiments, the clearance rate is the lipid clearance rate, for example, the rate at which lipids are removed from blood, serum, or plasma. In some embodiments, the clearance rate is the RNA clearance rate, for example, the rate at which mRNA or gRNA is removed from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which LNPs are removed from blood, serum, or plasma. In some embodiments, the clearance rate is the rate at which LNPs are removed from tissues such as liver tissue or spleen tissue. In certain embodiments, a high clearance rate results in a safety profile without substantial adverse effects. Amine lipids can reduce LNP accumulation in circulation and tissues. In some embodiments, reduced LNP accumulation in circulation and tissues results in a safety profile without substantial adverse effects.

[0570] The amine lipids of the present disclosure may be ionized (e.g., may form salts) depending on the pH of the medium in which they are contained. For example, in a slightly acidic medium, the amine lipids may be protonated and therefore positively charged. Conversely, in a slightly basic medium, such as blood, which has a pH of approximately 7.35, the amine lipids may not be protonated and therefore uncharged. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 9. In some embodiments, the amine lipids of the present disclosure may be protonated at a pH of at least about 10.

[0571] The pH at which an amine lipid is largely protonated is related to its inherent pKa. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.1 to about 7.4. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.5 to about 6.6. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.6 to about 6.4. In some embodiments, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.8 to about 6.2. For example, the amine lipids of the present disclosure may each independently have a pKa in the range of about 5.8 to about 6.5. Because cationic lipids with a pKa in the range of about 5.1 to about 7.4 have been found to be effective in delivering cargo in vivo, for example, to the liver, the pKa of the amine lipid can be an important consideration when formulating LNPs. Additionally, cationic lipids having a pKa in the range of about 5.3 to about 6.4 have been shown to be effective for delivery in vivo, for example, to tumors. See, e.g., WO2014 / 136086.

[0572] Additional fats

[0573] Suitable "neutral lipids" for use in the lipid compositions of the present disclosure include, for example, a variety of neutral, uncharged, or zwitterionic lipids. Examples of neutral phospholipids suitable for use in the present disclosure include 5-heptadecylbenzene-1,3-diol (resorcinol), dipalmitoylphosphatidylcholine (DPPC), distearoylphosphatidylcholine (DSPC), pohsphocholine (DOPC), dimyristoylphosphatidylcholine (DMPC), phosphatidylcholine (PLPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DAPC), phosphatidylethanolamine (PE), egg phosphatidylcholine (EPC), dilauryloylphosphatidylcholine (DLPC), dimyristoylphosphatidylcholine (DMPC), 1-myristoyl-2-palmitoylphosphatidylcholine (MPPC), 1-palmitoyl-2-myristoylphosphatidylcholine (PMPC), 1-palmitoyl-2-stearo ...

[0033] Examples of phosphatidylcholine include, but are not limited to, 1,2-diarachidoyl-sn-glycero-3-phosphocholine (PSPC), 1,2-diarachidoyl-sn-glycero-3-phosphocholine (DBPC), 1-stearoyl-2-palmitoylphosphatidylcholine (SPPC), 1,2-dieicosenoyl-sn-glycero-3-phosphocholine (DEPC), palmitoyloleoylphosphatidylcholine (POPC), lysophosphatidylcholine, dioleoylphosphatidylethanolamine (DOPE), dilinoleoylphosphatidylcholine, distearoylphosphatidylethanolamine (DSPE), dimyristoylphosphatidylethanolamine (DMPE), dipalmitoylphosphatidylethanolamine (DPPE), palmitoyloleoylphosphatidylethanolamine (POPE), lysophosphatidylethanolamine, and combinations thereof. In one embodiment, the neutral phospholipid may be selected from the group consisting of distearoylphosphatidylcholine (DSPC) and dimyristoylphosphatidylethanolamine (DMPE). In another embodiment, the neutral phospholipid may be distearoylphosphatidylcholine (DSPC). In another embodiment, the neutral phospholipid may be dipalmitoylphosphatidylcholine (DPPC).

[0574] "Helper lipids" include steroids, sterols, and alkylresorcinols. Helper lipids suitable for use in the present disclosure include, but are not limited to, cholesterol, 5-heptadecylresorcinol, and cholesterol hemisuccinate. In one embodiment, the helper lipid may be cholesterol. In one embodiment, the helper lipid may be cholesterol hemisuccinate.

[0575] A "stealth lipid" is a lipid that modifies the length of time that nanoparticles can exist in vivo (e.g., in blood). Stealth lipids are useful in formulation processes, for example, by reducing particle aggregation and controlling particle size. Stealth lipids used herein can adjust the pharmacokinetic properties of LNPs. Stealth lipids suitable for use in the lipid compositions of the present disclosure include, but are not limited to, stealth lipids with a hydrophilic head group linked to the lipid moiety. Information regarding stealth lipids suitable for use in the lipid compositions of the present disclosure and the biochemistry of such lipids can be found in Romberg et al., Pharmaceutical Research, Vol. 25, No. 1, 2008, pp. 55-71, and Hoekstra et al., Biochimica et Biophysica Acta 1660 (2004) 41-52. Additional suitable PEG lipids are disclosed in WO2006 / 007712.

[0576] In one embodiment, the hydrophilic head group of the stealth lipid comprises a polymer moiety selected from a PEG-based polymer. The stealth lipid may comprise a lipid moiety. In some embodiments, the stealth lipid is a PEG-lipid. The PEG-lipid may aid in the formulation process, for example, by reducing particle aggregation and controlling particle size. The PEG-lipid used herein may regulate the pharmacokinetic properties of LNP. Typically, the PEG-lipid comprises a lipid moiety and a PEG-based polymer moiety.

[0577] In one embodiment, the stealth lipid comprises a polymer moiety selected from PEG-based polymers (sometimes referred to as poly(ethylene oxide)), poly(oxazoline), poly(vinyl alcohol), poly(glycerol), poly(N-vinylpyrrolidone), polyamino acids, and poly[N-(2-hydroxypropyl)methacrylamide].

[0578] In one embodiment, the PEG lipid comprises a PEG-based polymer moiety (sometimes referred to as poly(ethylene oxide)).

[0579] The PEG-lipid further comprises a lipid moiety. In some embodiments, the lipid moiety may be derived from a diacylglycerol or diacylglycamide, including those comprising a dialkylglycerol or dialkylglycamide group having an alkyl chain length independently comprising from about C4 to about C40 saturated or unsaturated carbon atoms, and the chain may comprise one or more functional groups (e.g., amide or ester). In some embodiments, the alkyl chain length comprises from about C10 to C20. The dialkylglycerol or dialkylglycamide group may further comprise one or more substituted alkyl groups. The chain length may be symmetric or asymmetric.

[0580] Unless otherwise indicated, the term "PEG" as used herein refers to any polyethylene glycol or other polyalkylene ether polymer. In one embodiment, PEG is a linear or branched polymer of optionally substituted ethylene glycol or ethylene oxide. In one embodiment, PEG is unsubstituted. In one embodiment, PEG is substituted, for example, with one or more alkyl, alkoxy, acyl, hydroxy, or aryl groups. In one embodiment, the term includes PEG copolymers such as PEG-polyurethane or PEG-polypropylene (see, e.g., J. Milton Harris, Poly(ethylene glycol) chemistry: biotechnical and biomedical applications (1992)). In another embodiment, the term does not include PEG copolymers. In one embodiment, the PEG has a molecular weight of about 130 to about 50,000, in a subembodiment, about 150 to about 30,000, in a subembodiment, about 150 to about 20,000, in a subembodiment, about 150 to about 15,000, in a subembodiment, about 150 to about 10,000, in a subembodiment, about 150 to about 6,000, in a subembodiment, about 150 to about 5,000, in a subembodiment, about 150 to about 4,000, in a subembodiment, about 150 to about 3,000, in a subembodiment, about 300 to about 3,000, in a subembodiment, about 1,000 to about 3,000, and in a subembodiment, about 1,500 to about 2,500.

[0581] In certain embodiments, the PEG (e.g., conjugated to a lipid moiety or lipid, such as a stealth lipid) is "PEG-2K," also known as "PEG 2000," which has an average molecular weight of about 2,000 daltons. PEG-2K is represented herein by the following formula (I), where n is 45, meaning that the number-average degree of polymerization comprises about 45 subunits. However, other PEG embodiments known in the art may be used, for example, having a number-average degree of polymerization of about 23 subunits (n=23) and / or 68 subunits (n=68). In some embodiments, n may range from about 30 to about 60. In some embodiments, n may range from about 35 to about 55. In some embodiments, n may range from about 40 to about 50. In some embodiments, n may range from about 42 to about 48. In some embodiments, n may be 45. In some embodiments, R may be selected from H, substituted alkyl, and unsubstituted alkyl. In some embodiments, R may be unsubstituted alkyl. In some embodiments, R can be methyl.

[0582] In any of the embodiments described herein, the PEG lipid may be PEG-dilaurylglycerol, PEG-dimyristoylglycerol (PEG-DMG) (catalog number GM-020 from NOF, Tokyo, Japan), PEG-dipalmitoylglycerol, PEG-distearoylglycerol (PEG-DSPE) (catalog number DSPE-020CN, NOF, Tokyo, Japan), PEG-dilaurylglycamide, PEG-dimyristylglycamide, PEG-dipalmitoylglycamide, and PEG-distearoylglycamide, PEG-cholesterol (1-[8'-(cholesterol)-1-methyl-2-methyl-1-propanol), PEG-cholesterol (1-[8'-(cholesterol)-1 ... [ter-5-ene-3[beta]-oxy)carboxamido-3',6'-dioxaoctanyl]carbamoyl-[omega]-methyl-poly(ethylene glycol), PEG-DMB (3,4-ditetradecoxylbenzyl-[omega]-methyl-poly(ethylene glycol) ether), 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DMG), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSPE) (Avanti The PEG lipid may be selected from Polar Lipids, Alabaster, Alabama, USA, catalog number 880120C), 1,2-distearoyl-sn-glycerol, methoxypolyethylene glycol (PEG2k-DSG, GS-020, NOF Tokyo, Japan), poly(ethylene glycol)-2000-dimethacrylate (PEG2k-DMA), and 1,2-distearyloxypropyl-3-amine-N-[methoxy(polyethylene glycol)-2000] (PEG2k-DSA). In one embodiment, the PEG lipid may be PEG2k-DMG. In some embodiments, the PEG lipid may be PEG2k-DSG. In one embodiment, the PEG lipid may be PEG2k-DSPE. In one embodiment, the PEG lipid may be PEG2k-DMA. In one embodiment, the PEG lipid may be PEG2k-C-DMA.In one embodiment, the PEG lipid may be compound S027 disclosed in WO2016 / 010840 (paragraphs

[0240] to

[0244] ). In one embodiment, the PEG lipid may be PEG2k-DSA. In one embodiment, the PEG lipid may be PEG2k-C11. In some embodiments, the PEG lipid may be PEG2k-C14. In some embodiments, the PEG lipid may be PEG2k-C16. In some embodiments, the PEG lipid may be PEG2k-C18.

[0583] LNP formulation LNPs may contain (i) amine lipids for encapsulation and endosomal escape, (ii) neutral lipids for stabilization, (iii) helper lipids, also for stabilization, and (iv) stealth lipids, e.g., PEG lipids. Neutral lipids may be omitted.

[0584] In some embodiments, the LNP composition may include an RNA component comprising one or more of an RNA-guided DNA binder, a Cas nuclease mRNA, a Class 2 Cas nuclease mRNA, a Cas9 mRNA, and a gRNA. In some embodiments, the LNP composition includes an mRNA encoding a Class 2 Cas nuclease (S. pyogenes Cas9) and a gRNA as the RNA component. In certain embodiments, the LNP composition may include an RNA component, an amine lipid, a helper lipid, a neutral lipid, and a stealth lipid. In certain LNP compositions, the helper lipid is cholesterol. In other compositions, the neutral lipid is DSPC. In additional embodiments, the stealth lipid is PEG2k-DMG or PEG2k-C11. In certain embodiments, the LNP composition includes lipid A or an equivalent of lipid A, a helper lipid, a neutral lipid, a stealth lipid, and a guide RNA. In certain compositions, the amine lipid is lipid A. In certain compositions, the amine lipid is lipid A or its acetal analog, the helper lipid is cholesterol, the neutral lipid is DSPC, and the stealth lipid is PEG2k-DMG.

[0585] In certain embodiments, lipid compositions are described according to the respective molar ratios of the lipid components in the formulation. Embodiments of the present disclosure provide lipid compositions described according to the respective molar ratios of the lipid components in the formulation. In one embodiment, the mol% of the amine lipids can be about 30 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 40 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 45 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 55 mol% to about 60 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol% to about 55 mol%. In one embodiment, the mol% of the amine lipids can be about 50 mol%. In one embodiment, the mol% of the amine lipids can be about 55 mol%. In some embodiments, the amine lipid mol% of an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the target mol%. In some embodiments, the amine lipid mol% of an LNP batch is ±4 mol%, ±3 mol%, ±2 mol%, ±1.5 mol%, ±1 mol%, ±0.5 mol%, or ±0.25 mol% of the target mol%. All mol% numbers are expressed as fractions of the lipid component of the LNP composition. In certain embodiments, the variability of amine lipid mol% between LNP lots will be less than 15%, less than 10%, or less than 5%.

[0586] In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 5 mol% to about 15 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 7 mol% to about 12 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 0 mol% to about 5 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 0 mol% to about 10 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 5 mol% to about 10 mol%. In one embodiment, the mol% of the neutral lipid, for example, the neutral phospholipid, can be about 8 mol% to about 10 mol%.

[0587] In one embodiment, the mol% of the neutral lipid, e.g., the neutral phospholipid, can be about 5 mol%, about 6 mol%, about 7 mol%, about 8 mol%, about 9 mol%, about 10 mol%, about 11 mol%, about 12 mol%, about 13 mol%, about 14 mol%, or about 15 mol%. In one embodiment, the mol% of the neutral lipid, e.g., the neutral phospholipid, can be about 9 mol%.

[0588] In one embodiment, the mol% of the neutral lipid, e.g., neutral phospholipid, can be about 1 mol% to about 5 mol%. In one embodiment, the mol% of the neutral lipid can be about 0.1 mol% to about 1 mol%. In one embodiment, the mol% of the neutral lipid, e.g., neutral phospholipid, can be about 0.1 mol%, about 0.2 mol%, about 0.5 mol%, 1 mol%, about 1.5 mol%, about 2 mol%, about 2.5 mol%, about 3 mol%, about 3.5 mol%, about 4 mol%, about 4.5 mol%, or about 5 mol%.

[0589] In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be less than about 1 mol%. In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be less than about 0.5 mol%. In one embodiment, the mol% of neutral lipids, e.g., neutral phospholipids, can be about 0 mol%, about 0.1 mol%, about 0.2 mol%, about 0.3 mol%, about 0.4 mol%, about 0.5 mol%, about 0.6 mol%, about 0.7 mol%, about 0.8 mol%, about 0.9 mol%, or about 1 mol%. In some embodiments, the formulations disclosed herein do not contain neutral lipids (i.e., 0 mol% neutral lipids). In some embodiments, the formulations disclosed herein are essentially free of neutral lipids (i.e., about 0 mol% neutral lipids). In some embodiments, the formulations disclosed herein do not contain neutral phospholipids (i.e., 0 mol% neutral phospholipids). In some embodiments, the formulations disclosed herein are essentially free of neutral phospholipids (ie, about 0 mol % neutral phospholipids).

[0590] In some embodiments, the mol% neutral lipid of an LNP batch is ±30%, ±25%, ±20%, ±15%, ±10%, ±5%, or ±2.5% of the mol% target neutral lipid. In certain embodiments, the variability between lots of LNPs will be less than 15%, less than 10%, or less than 5%.

[0591] In one embodiment, the mol% of the helper lipid may be about 20 mol% to about 60 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 55 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 50 mol%. In one embodiment, the mol% of the helper lipid may be about 25 mol% to about 40 mol%. In one embodiment, the mol% of the helper lipid may be about 30 mol% to about 50 mol%. In one embodiment, the mol% of the helper lipid may be adjusted based on the concentrations of the amine lipid, neutral lipid, and PEG lipid to make the lipid component 100 mol%. In one embodiment, the mol% of the helper lipid may be adjusted based on the concentrations of the amine lipid and PEG lipid t...

Claims

1. (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9; (ii) a single guide RNA (sgRNA), a. a guide sequence comprising the sequence of SEQ ID NO:23; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of the sequence of SEQ ID NO:23; or c. comprising a guide sequence that is at least 90% identical to the sequence of SEQ ID NO:23; The sgRNA, A composition comprising: The composition for use in combination with a corticosteroid to treat TTR-associated amyloidosis (ATTR).

2. (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9; (ii) a single guide RNA (sgRNA), a. a guide sequence comprising the sequence of SEQ ID NO:23; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of the sequence of SEQ ID NO:23; or c. comprising a guide sequence that is at least 90% identical to the sequence of SEQ ID NO:23; The sgRNA, A composition comprising: The composition for use in combination with a corticosteroid to reduce TTR serum concentrations.

3. (i) a nucleic acid comprising an open reading frame (ORF) encoding Cas9; (ii) a single guide RNA (sgRNA), a. a guide sequence comprising the sequence of SEQ ID NO:23; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of the sequence of SEQ ID NO:23; or c. comprising a guide sequence that is at least 90% identical to the sequence of SEQ ID NO:23; The sgRNA, A composition comprising: The composition for use in combination with a corticosteroid to reduce amyloid or amyloid fibril accumulation.

4. (i) A single guide RNA (sgRNA) comprising the following a to c: a. a guide sequence comprising the sequence of SEQ ID NO:23; b. a guide sequence that is at least 17, 18, 19, or 20 contiguous nucleotides of the sequence of SEQ ID NO:23; or c. A guide sequence that is at least 90% identical to the sequence of SEQ ID NO:

23. In the 5' to 3' order, The sgRNA, (ii) a nucleic acid comprising an open reading frame (ORF) encoding Cas9, a. the open reading frame comprises the sequence of SEQ ID NO: 311, or b. the open reading frame comprises a sequence having at least 99% identity to SEQ ID NO:311; The nucleic acid; A composition comprising: The composition for use in combination with a corticosteroid in a method for inducing a double strand break (DSB) in the TTR gene in a subject, modifying the TTR gene in a cell or subject, treating TTR-associated amyloidosis (ATTR) in a subject, reducing TTR serum concentrations in a subject, and / or reducing or preventing amyloid or amyloid fibril accumulation in a subject.

5. The composition of any one of claims 1 to 4, wherein the composition is formulated to be administered by infusion for greater than 30 minutes.

6. The composition of any one of claims 1 to 5, wherein the sgRNA comprises a guide sequence of SEQ ID NO:

23.

7. 7. The composition of any one of claims 1 to 6, wherein the corticosteroid is dexamethasone, betamethasone, prednisone, prednisolone, methylprednisolone, cortisone, hydrocortisone, triamcinolone, or etamethazoneb.

8. The composition of any one of claims 1 to 7, wherein the corticosteroid is dexamethasone.

9. The composition of any one of claims 1 to 8, wherein the corticosteroid is administered prior to the composition.

10. The composition of any one of claims 1 to 9, wherein the corticosteroid is administered after the composition.

11. The composition of any one of claims 1 to 10, wherein the corticosteroid is administered simultaneously with the composition.

12. The composition of any one of claims 1 to 11, wherein at least two doses of the corticosteroid are administered before or after administration of the composition.

13. The composition of any one of claims 1 to 12, wherein at least two doses of the corticosteroid and at least two doses of the composition are administered.

14. 14. The composition of any one of claims 1 to 13, wherein the corticosteroid is administered to the subject at a dose of 0.75 mg to 20 mg, or at a dose of 0.01 to 0.4 mg / kg, 0.1 to 0.35 mg / kg, or 0.25 to 0.35 mg / kg.

15. The composition of any one of claims 1 to 14, wherein the corticosteroid is administered to the subject via intravenous injection.

16. The composition of any one of claims 1 to 15, wherein the corticosteroid is administered orally to the subject.

17. The composition of claim 16, wherein the corticosteroid is administered orally to the subject before the composition is administered to the subject by intravenous injection.

18. 18. The composition of claim 16 or 17, wherein the corticosteroid is dexamethasone, and the dexamethasone is administered orally to the subject in an amount of 20 mg 6 to 12 hours before the composition is administered to the subject, or the dexamethasone is administered intravenously to the subject in an amount of 20 mg 30 minutes 6 to 12 hours before the composition is administered to the subject.

19. 19. The composition of any one of claims 1 to 18, wherein the composition is further used in combination with infusion prophylaxis, the infusion prophylaxis comprising one or more of acetaminophen, an H1 blocker, or an H2 blocker.

20. The composition of claim 19, wherein one or more of the acetaminophen, H1 blocker, or H2 blocker are administered simultaneously with the corticosteroid and / or prior to the composition.

21. 21. The composition of claim 19 or 20, wherein each of the acetaminophen, an H1 blocker, or an H2 blocker is administered.

22. A composition according to any one of claims 19 to 21, wherein the H1 blocker is diphenhydramine or the H2 blocker is ranitidine.

23. (a) a first dose of the corticosteroid is administered 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered 1-2 hours before the composition is administered; (b) a first dose of the corticosteroid is administered orally 8-24 hours before the composition is administered and a second dose of the corticosteroid is administered intravenously 1-2 hours before the composition is administered; (c) a first dose of said corticosteroid is administered orally 8-24 hours before said composition is administered and a second dose of said corticosteroid is administered intravenously, simultaneously with administration of acetaminophen, an H1 blocker and an H2 blocker, 1-2 hours before said composition is administered; (d) the corticosteroid is dexamethasone, and a first dose of the dexamethasone is administered orally to the subject in an amount of 6-10 mg 8-24 hours before the composition is administered to the subject, and a second dose of the dexamethasone is administered intravenously to the subject in an amount of 8-12 mg, concurrently with oral administration of acetaminophen and intravenous administration of an H1 blocker and an H2 blocker 1-2 hours before the composition is administered to the subject; (e) the corticosteroid is dexamethasone, and a first dose of the dexamethasone is administered orally to the subject in an amount of 8 mg 8-24 hours before the composition is administered to the subject, and a second dose of the dexamethasone is administered intravenously to the subject in an amount of 10 mg 1-2 hours before the composition is administered to the subject, simultaneously with oral administration of acetaminophen and intravenous administration of an H1 blocker and an H2 blocker; or (f) the composition is administered by infusion in an amount of 3 mg / kg for 1.5 to 6 hours, a first dose of the corticosteroid being administered orally 8 to 24 hours before the composition is injected, and a second dose of the corticosteroid being administered intravenously 1 to 2 hours before the composition is injected. The composition according to any one of claims 1 to 22.

24. The use of said corticosteroid (a) improving the tolerability of the composition comprising the sgRNA; (b) reducing the incidence or severity of one or more of inflammation, nausea, vomiting, elevated blood ALT levels, hyperthermia, and / or hyperalgesia in response to the composition comprising the sgRNA; (c) reducing or inhibiting the production or activity of one or more interferons and / or proinflammatory cytokines in response to the composition comprising the sgRNA; or (d) A combination of two or more of (a) to (c); The composition according to any one of claims 1 to 23.

25. 25. The composition of any one of claims 1 to 24, wherein the composition reduces serum TTR levels or causes editing of the TTR gene.

26. The composition of any one of claims 1 to 25, wherein the sgRNA comprises, from 5' to 3', (1) a guide sequence and (2) a nucleotide sequence of SEQ ID NO:

125.

27. 27. The composition of any one of claims 1 to 26, wherein the sgRNA comprises, from 5' to 3', (1) a guide sequence and (2) a modified nucleotide sequence of SEQ ID NO:

3.

28. 28. The composition of any one of claims 1 to 27, wherein the sgRNA comprises a guide sequence that is at least 97% identical to the sequence of SEQ ID NO:

87.

29. The composition of any one of claims 1 to 28, wherein the sgRNA comprises the sequence of SEQ ID NO:

87.

30. The sgRNA comprises at least one modification, the at least one modification being (a) 2'-O-methyl (2'-O-Me) modified nucleotides, phosphorothioate internucleotide (PS) linkages, or 2'-fluoro (2'-F) modified nucleotides; (b) a modification in one or more of the first five nucleotides at the 5' end and one or more of the last five nucleotides at the 3' end; (c) a PS bond between the first four nucleotides; (d) a PS bond between the last four nucleotides; (e) 2'-O-Me modified nucleotides in the first three nucleotides at the 5' end; (f) 2'-O-Me modified nucleotides in the last three nucleotides at the 3' end; or (g) A combination of two or more of (a) to (f) above. The composition of any one of claims 1 to 26, comprising:

31. 31. The composition of Claim 30, wherein the sgRNA comprises modified nucleotides of SEQ ID NO:

3.

32. The composition of any one of claims 1 to 31, wherein the composition is a lipid nanoparticle (LNP) formulation.

33. The composition described in claim 32, wherein the LNP comprises an ionizable lipid, a helper lipid, a stealth lipid, and a neutral lipid.

34. The composition of claim 33, wherein the ionizable lipid is (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyloctadeca-9,12-dienoate.

35. The LNP, (i) (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate, (ii) distearoylphosphatidylcholine (DSPC); (iii) cholesterol, and (iv) Polyethylene glycol-dimyristoyl glycerol (PEG-DMG) 33. The composition of claim 32, comprising:

36. The LNP formulation, (i) 50 mol % of (9Z,12Z)-3-((4,4-bis(octyloxy)butanoyl)oxy)-2-((((3-(diethylamino)propoxy)carbonyl)oxy)methyl)propyl octadeca-9,12-dienoate; (ii) 9 mol% distearoylphosphatidylcholine (DSPC); (iii) 38 mol % cholesterol, and (iv) 3 mol% polyethylene glycol-dimyristoyl glycerol (PEG-DMG) 33. The composition of claim 32, comprising:

37. 37. Use of a composition according to any one of claims 1 to 36 for the preparation of a medicament for treating a human subject having ATTR.

Images