Filamentous fungal strains containing enhanced protein productivity phenotypes and methods thereof

Abstract

The present disclosure generally relates to modified filamentous fungal strains (cells) that comprise a phenotype of enhanced protein productivity, which is particularly suitable for growth in submerged culture (e.g., large-scale production of proteins for industrial / commercial applications). Accordingly, certain embodiments of the present disclosure relate to such mutant (modified) strains of filamentous fungi that are derived from (obtained from) a parent strain that contains a gene encoding a native GEF1 protein, and that comprise a genetic modification that disrupts or deletes the gene encoding the native GEF1 protein, and that comprise a phenotype of increased protein productivity (i.e., relative to the parent strain) when grown / cultured / fermented under the same conditions.

Description

[Technical field]

[0001] The present disclosure relates generally to the fields of biology, molecular biology, filamentous fungi, yeast, fermentation, genetics, industrial protein production, etc. More specifically, the strains and methods of the disclosure relate to genetic modifications in filamentous fungi that result in mutant (modified) strains with modified phenotypes, which are particularly suitable for growth in submerged culture (e.g., large-scale production of proteins for industrial / commercial applications).

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Patent Application No. 62 / 932,525, filed November 08, 2019, which is incorporated by reference in its entirety.

[0003] Sequence Listing Reference The contents of the electronic submission of the sequence listing text file entitled "NB41383-WO-PCT_SequenceListing.txt" was created on October 27, 2020, is 55KB in size, and is incorporated by reference herein in its entirety. [Background technology]

[0004] Filamentous fungi (e.g., Aspergillus spp., Penicillium spp., Talaromyces spp., Fusarium spp., Myceliophthora spp., Neurospora spp., Candida spp., Trichoderma spp., etc.) can be adapted to express native and heterologous proteins at high levels and to mass-produce proteins (e.g., enzymes, antibodies, peptides, etc.) and / or metabolites for industrial and / or commercial applications, such as pharmaceutical, animal health, food, beverage, laundry, and textile applications. Filamentous fungi are typically grown in mycelial submerged culture in bioreactors (fermenters) adapted for the introduction and distribution of oxygen and nutrients to the culture medium (i.e., culture broth). For example, the filamentous fungus Trichoderma reesei (T. reesei; an anamorph of the fungus Hypocrea jecorina) is known to be an efficient producer of cellulase enzymes. Summary of the Invention [Problem to be solved by the invention]

[0005] Thus, filamentous fungi have been exploited for their ability to produce proteins (e.g., enzymes) useful in the manufacture of everyday products such as cellulosic ethanol, fiber processing, grain processing, detergents, fiber / pulp / paper, food additives, feed additives, etc. For example, recombinant gene expression in such fungal host strains is a common method for the production of proteins (i.e., for industrial and commercial purposes), and thus improving protein productivity of fungal host strains is a significant economic driver of protein production costs. Thus, as will be appreciated by those skilled in the art, such novel compositions and methods for enhancing protein production in filamentous fungal strains are of great commercial interest. [Means for solving the problem]

[0006] The present disclosure generally relates to modified filamentous fungal strains (cells) that comprise a phenotype of enhanced protein productivity, which is particularly suitable for growth in submerged culture (e.g., large-scale production of proteins for industrial / commercial applications). Accordingly, certain embodiments of the present disclosure relate to such mutant (modified) strains of filamentous fungi that are derived from (derived from) a parent strain that comprises a gene encoding a native GEF1 protein, which comprises a genetic modification that disrupts or deletes the gene encoding the native GEF1 protein, and which comprise a phenotype of increased protein productivity (i.e., relative to the parent strain) when grown / cultured / fermented under the same conditions.

[0007] A brief description of biological sequences SEQ ID NO:1 is a T. reesei polynucleotide sequence encoding the native GEF1 protein comprising SEQ ID NO:2.

[0008] SEQ ID NO:2 is the amino acid sequence of the native full-length GEF1 protein encoded by the polynucleotide of SEQ ID NO:1.

[0009] SEQ ID NO:3 is an open reading frame (ORF) encoding the native full-length GEF1 protein of SEQ ID NO:2.

[0010] SEQ ID NO:4 is a C-terminally truncated GEF1 mutant protein containing amino acids 1 to 1,244 of SEQ ID NO:2.

[0011] SEQ ID NO:5 is the amino acid sequence of the GEF1 domain present in SEQ ID NO:2.

[0012] SEQ ID NO:6 is the amino acid sequence of the BAR domain present in SEQ ID NO:2.

[0013] SEQ ID NO:7 is the amino acid sequence of the conserved unknown domain present in SEQ ID NO:2.

[0014] SEQ ID NO:8 is the target site 3 (TS3) RNA sequence within the T. reesei GEF1 gene.

[0015] SEQ ID NO:9 is the nucleic acid sequence of primer AL950.

[0016] SEQ ID NO:10 is the nucleic acid sequence of primer AL952.

[0017] SEQ ID NO:11 is the nucleic acid sequence of primer RhoF1.

[0018] SEQ ID NO:12 is the nucleic acid sequence of primer RhoR1.

[0019] SEQ ID NO:13 is the target site 4 (TS4) RNA sequence within the T. reesei GEF1 gene.

[0020] SEQ ID NO:14 is the nucleic acid sequence of the hygromycin phosphotransferase marker gene.

[0021] SEQ ID NO:15 is the nucleic acid sequence of the Neurospora crassa cpc1 promoter.

[0022] SEQ ID NO:16 is the nucleic acid sequence of the Aspergillus nidulans trpC terminator.

[0023] SEQ ID NO:17 is the nucleic acid sequence of primer HygF1.

[0024] SEQ ID NO:18 is the nucleic acid sequence of primer HygR1.

[0025] SEQ ID NO:19 is the nucleic acid sequence of the pyr2 marker gene. [Brief description of the drawings]

[0026] [Figure 1]1A-1B ) depicts a polynucleotide sequence (SEQ ID NO:1; FIGS. 1A-1B ) encoding a native Trichoderma sp. GEF1 protein homologue, comprising the amino acid sequence of SEQ ID NO:2. As shown in FIGS. 1A and 1B , the DNA sequence (SEQ ID NO:2) encoding the GEF1 protein comprises two introns represented in lowercase (nucleotides) and three exons represented in uppercase (nucleotides), with the Cas9 target site 3 (TS3) nucleotides represented as double underlined uppercase letters, the Cas9 target site 4 (TS4) nucleotides represented as single underlined uppercase letters, and the codon GAG in the wild-type sequence (SEQ ID NO:1) represented as bold uppercase letters, which is mutated to a premature stop codon (TAG) in the mutant strain, thereby encoding a C-terminally truncated GEF1 protein ( FIG. 1B ).

[0027] [Diagram 2] The open reading frame (ORF) sequence encoding the native GEF1 protein of SEQ ID NO:2 (SEQ ID NO:3; Figures 2A to 2B) is shown.

[0028] [Diagram 3] The amino acid sequence of the native GEF1 protein (SEQ ID NO:2; FIG. 3A) and the mutant (C-terminal truncated) GEF1 protein (SEQ ID NO:4; FIG. 3B) are shown. Also shown in FIG. 3 are the GEF1 domain (FIG. 3C; SEQ ID NO:5), the BAR domain (FIG. 3D; SEQ ID NO:6) and the unknown domain (FIG. 3E; SEQ ID NO:7) of the native GEF1 protein of SEQ ID NO:2. For example, the amino acid sequence of the native GEF1 protein (SEQ ID NO:2; FIG. 3A) contains the Pfam predicted GEF1 domain (FIG. 3A, light grey shaded amino acids; PF00621) and the BAR domain (FIG. 3A, bold amino acids; PF03114). As shown in FIG. 3B, the mutant GEF1 protein (SEQ ID NO:4) is C-terminally truncated, with the truncation occurring near the N-terminus of the GEF1 domain (e.g., residue "VIK"). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] As described and illustrated herein, the present disclosure generally relates to genetically modified filamentous fungal strains (cells) and their use in industrial protein production. More specifically, the present strains and methods of the present disclosure relate to genetic modifications in filamentous fungi that result in mutant strains with modified phenotypes, which are particularly suitable for growth in submerged culture (e.g., large-scale production of proteins for industrial / commercial applications). Thus, as described herein, certain embodiments of the present disclosure relate to genetically modified strains of filamentous fungi and methods thereof, which include phenotypes that enhance protein productivity, such as improved volumetric efficiency, higher specific productivity, improved yield relative to carbon source, and reduced operating costs of bioreactors (fermenters).

[0030] I. Definition Before describing the present strains and methods in detail, the following terms are defined for clarity. Terms not defined are intended to abide by their usual meanings as used in the relevant art. Unless otherwise defined, all technical and scientific terms used herein have the same meanings as commonly understood by those of ordinary skill in the art applying the present compositions and methods.

[0031] All publications and patents cited herein are hereby incorporated by reference.

[0032] Where a range of values ​​is given, unless the context clearly dictates otherwise, it is understood that each intervening value, to the tenth of the unit of the lower limit between the upper and lower limits of that range, and any other stated or intervening value in that stated range, is encompassed within the scope of the compositions and methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges, and are also encompassed within the scope of the compositions and methods of the invention, subject to any specifically excluded limit in the stated range. When the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the compositions and methods.

[0033] In this specification, some ranges are indicated by numerical values ​​preceded by the term "about". In this specification, the term "about" is used to provide literal support for the exact number preceding it and a number that is close or approximate to the number preceding the term. In determining whether a number is close or approximate to a specifically recited number, the unrecited close or approximate number may be a number that, in the context in which it is presented, provides a substantially equivalent number to the specifically recited number. For example, with respect to a numerical value, the term "about" means a range of -10% to +10% of this numerical value, unless the term is specifically defined otherwise in the context. In another example, the phrase "a pH value of about 6" means a pH value of 5.4 to 6.6, unless the pH value is specifically defined otherwise.

[0034] The headings provided herein are not intended to be limitations of the various aspects or embodiments of the compositions and methods that can be had by reference to the specification as a whole, and therefore the terms defined immediately below are more fully defined by reference to the specification as a whole.

[0035] In accordance with this detailed description, the following abbreviations and definitions apply. It should be noted that the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "an enzyme" includes a plurality of such enzymes, reference to "a dose of the" includes one or more doses and equivalents thereof known to those skilled in the art, and so forth.

[0036] It should be further noted that the claims may be drafted to exclude optional elements, and thus, this statement is intended to serve as an antecedent basis for using exclusive terminology such as "solely," "only," "except," "not including," and the like in connection with the recitation of claim elements or for using a "negative" limitation.

[0037] Further, it should be noted that the term "comprises" as used herein means "including, but not limited to" the element following the term "comprises." The element following the term "comprises" is required or essential, but a composition including this element may further include other non-essential or optional elements.

[0038] It should also be noted that the term "consisting of" as used herein means "including and limited to" the element following the term "consisting of." Thus, the element following the term "consisting of" is required or essential, and other elements are not present in the composition.

[0039] As will be apparent to one of ordinary skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has distinct components and features which may be readily separated or combined with any of the features of some of the other embodiments without departing from the scope or spirit of the compositions and methods described herein. Any of the methods described can be carried out in the order of events recited or in any other order which is logically possible.

[0040] The filamentous fungal cells for the manipulations, constructions and uses described herein are generally derived from fungi of the phylum Ascomycota, subphylum Pezizomycotina, particularly those with a vegetative mycelial state. Such organisms include filamentous fungal cells used to produce commercially important industrial and pharmaceutical proteins, including, but not limited to, Trichoderma spp., Aspergillus spp., Fusarium spp., Penicillium spp., Chrysosporium spp., Cephalosporium spp., Talaromyces spp., Geosmithia spp., Neurospora spp., Myceliophthora spp., and the like.

[0041] For example, in certain embodiments, the species of Trichoderma reesei (previously classified as Trichoderma longibrachiatum and Hypocrea jecorina), Aspergillus niger, Aspergillus fumigatus, Aspergillus itaconicus, Aspergillus oryzae, Aspergillus nidulans, Aspergillus terreus, Aspergillus sojae, Aspergillus japonicus, Neurospora crassa, ... and filamentous fungal cells and strains thereof, including, but not limited to, Penicillium crassa, Penicillium funiculosum, Penicillium chrysogenum, Talaromyces (Geosmithia) emersonii, Fusarium venenatum, Myceliophthora thermophila, and Chrysosporium lucknowense (C1).

[0042] As used herein, terms and phrases such as, for example, "filamentous fungus strain(s)", "filamentous fungal strain(s)", "fungus strain(s)", "fungal strains(s)", "filamentous fungus cell(s)", "filamentous fungal cell(s)", "fungus cell(s)", "fungal cell(s)", and the like, may be used interchangeably for convenience of description and are not intended to limit the scope of the present disclosure.

[0043] As used herein, "yeast" and / or "yeast strain" include, but are not limited to, Saccharomyces species (e.g., S. cerevisiae, S. pastorianus, S. carlsbergensis), Schizosaccharomyces species (e.g., S. pombe), Yarrowia species (e.g., Y. lipolytica), and the like.

[0044] As used herein, the term "gene" is synonymous with the term "allele," which refers to a nucleic acid (polynucleotide) that encodes and directs the expression of a protein or RNA. Vegetative forms of filamentous fungi are generally haploid, so that a single copy of a particular gene (i.e., a single allele) is sufficient to confer a particular phenotype.

[0045] As used herein, the phrases "parent cell," "parent fungal cell," "parent strain," "parent fungal strain," "parent strain of filamentous fungal cells," "reference strain," and the like, may be used interchangeably and refer to an "unmodified" parent filamentous fungal cell. For example, a "parent strain of filamentous fungal cells" refers to any cell or strain of filamentous fungus in which the genome of the "parent" cell has been modified (e.g., by a genetic modification introduced into the parent cell) to generate mutant (daughter) strains of filamentous fungal cells such that the "parent" cell and the "daughter" cells differ.

[0046] As used herein, the phrases "mutant cell," "daughter cell," "mutant strain," "daughter strain," "mutant or daughter fungal strain," "mutant or daughter strain of filamentous fungal cell," and the like, may be used interchangeably to refer to a modified strain of filamentous fungal cell that is derived from (i.e., obtained or derivable from) a parent (or reference) strain of filamentous fungal cell, where the mutant strain includes a genetic modification not present in the parent strain, such that phenotypic differences between the "parent" and "mutant" strains can be attributed to the genetic modification by comparison. In other words, the parent and mutant strains are otherwise isogenic, except for the genetic modification "introduced" into the mutant strain.

[0047] Thus, a parent "strain" and a mutant "strain" may be described as having certain characteristics such as genetic modifications, expression phenotypes, morphological phenotypes, etc.; however, one of skill in the art will understand that it is the "cells" of the parent or mutant strain that have such characteristics in the art and are referred to as "strains" for convenience.

[0048] As used herein, the terms "wild-type" and "native" are used interchangeably and refer to a gene, protein, protein mixture, or strain as found in nature.

[0049] As used herein, an "endogenous filamentous fungal gene" encoding a protein of interest, as is known and understood by those skilled in the art, includes, but is not limited to, endogenous genes encoding glycoside hydrolase (GH) family enzymes (e.g., EC numbers 3.2.1.1 to 3.2.1.206, etc.), endogenous genes encoding proteases, endogenous genes encoding esterases, endogenous genes encoding lipases, etc.

[0050] As used herein, the terms "lignocellulolytic enzymes," "cellulase enzymes," and "cellulases" are used interchangeably and include glycoside hydrolase (GH) enzymes, such as cellobiohydrolases, xylanases, endoglucanases, and β-glucosidases, which hydrolyze the β-(1,4) glycosidic bonds of cellulose (hemicellulose) to produce glucose.

[0051] In certain embodiments, cellobiohydrolases include enzymes classified under EC 3.2.1.91, endoglucanases include enzymes classified under EC 3.2.1.4, endo-β-1,4 xylanases include enzymes classified under EC 3.2.1.8, β-xylosidases include enzymes classified under EC 3.2.1.37, and β-glucosidases include enzymes classified under EC 3.2.1.21.

[0052] As used herein, an "endoglucanase" protein may be abbreviated as "EG," a "cellobiohydrolase" protein may be abbreviated as "CBH," a "β-glucosidase" protein may be abbreviated as "BG," and a "xylanase" protein may be abbreviated as "XYL." Thus, as used herein, a gene (or ORF) encoding an EG protein may be abbreviated as "eg," a gene (or ORF) encoding a CBH protein may be abbreviated as "cbh," a gene (or ORF) encoding a BG protein may be abbreviated as "bg," and a gene (or ORF) encoding an XYL protein may be abbreviated as "xyl."

[0053] In certain embodiments, filamentous fungal cells for engineering, construction and use as described herein are generally derived from the subphylum Pezizomycotina, particularly fungi having a vegetative hyphal state and containing a GEF1 gene or a homolog thereof.

[0054] As used herein, a "gene or polynucleotide encoding a native GEF1 protein" comprises sequence homology with SEQ ID NO:1. In certain embodiments, a gene or polynucleotide encoding a native GEF1 protein comprises about 70%-100% sequence identity with SEQ ID NO:1 or SEQ ID NO:3. In certain other embodiments, a gene or polynucleotide encoding a native GEF1 protein comprises about 70%-100% sequence identity with SEQ ID NO:1 or SEQ ID NO:3 and encodes a GEF1 domain comprising at least 90% sequence identity with SEQ ID NO:5. In certain other embodiments, a gene or polynucleotide encoding a native GEF1 protein hybridizes to the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0055] In certain embodiments, the promoter sequence of the upstream (5') cellulase gene includes, but is not limited to, the promoter sequence of the cellobiohydrolase (cbh) gene, the promoter sequence of the endoglucanase (eg) gene, the promoter sequence of the β-glucosidase (bg) gene, the promoter sequence of the xylanase (xyl) gene, and the like.

[0056] As used herein, an "open reading frame (ORF) nucleic acid sequence encoding a native Trichoderma species GEF1 protein" includes sequence homology to the ORF nucleic acid sequence of SEQ ID NO:3. In certain other embodiments, the ORF nucleic acid sequence encodes a native Trichoderma species GEF1 protein that includes about 70%-100% sequence identity to SEQ ID NO:2. In other embodiments, the ORF nucleic acid sequence encodes a native Trichoderma species GEF1 protein that includes about 70%-100% sequence identity to SEQ ID NO:2 and includes a GEF1 domain having at least 90% sequence identity to SEQ ID NO:5. In certain other embodiments, the ORF encoding a native GEF1 protein hybridizes to the nucleic acid sequence of SEQ ID NO:1 or SEQ ID NO:3 under moderate to stringent hybridization conditions.

[0057] As used herein, the "positions" of amino acid residues within a "given amino acid sequence" are numbered herein using the numbering (positions) of amino acid residues in the naturally occurring Trichoderma spp. GEF1 protein of SEQ ID NO:2. For example, FIG. 3A depicts the amino acid sequence of the naturally occurring Trichoderma spp. GEF1 protein (SEQ ID NO:2). Thus, in phrases such as "comprising a glutamic acid (E; Glu) residue at a sequence position corresponding to position 1,244 of SEQ ID NO:2" or "comprising a GEF1 domain at sequence positions corresponding to positions 1,242-1,454 of SEQ ID NO:2," the amino acid sequence of the naturally occurring (Trichoderma spp.) GEF1 protein (SEQ ID NO:2) serves as the reference (parent) protein sequence. For example, as shown in FIG. 3A, a given amino acid sequence described herein can be aligned with the amino acid sequence of a native Trichoderma species GEF1 protein (SEQ ID NO:2) using the alignment algorithms described herein (and / or alignment algorithms known to those of skill in the art), and amino acid residues in the given amino acid sequence that align (preferably optimally align) with amino acid residues in the native sequence can be conveniently numbered by reference to the corresponding amino acid residues in the GEF1 sequence.

[0058] Similarly, to establish sequence homology or sequence identity with the primary (1°) sequence of the GEF1 protein of Trichoderma species (SEQ ID NO:2), one of skill in the art can easily compare the primary sequence of SEQ ID NO:2 to the homologous / orthologous sequences of one or more candidate GEF1 proteins using sequence alignment algorithms, software and methods known to those of skill in the art. Thus, after aligning conserved residues, allowing for necessary insertions and deletions to maintain alignment (i.e., avoiding the elimination of conserved residues by any deletions and insertions), residues equivalent to specific amino acids in the primary sequence of the candidate filamentous fungal GEF1 protein are defined. Alignment of conserved residues should preferably conserve 100% of such residues. However, alignment of conserved residues of 98%, 95%, 90%, 85%, 80%, 75%, 70%, 50% or at least more than 45% are sufficient to define equivalent residues.

[0059] As used herein, Trichoderma strains designated "T4" have been continuously grown under selective conditions to identify and isolate those mutant strains capable of producing proteins at high temperatures without adversely affecting specific productivity (Qp).

[0060] As used herein, a mutant Trichoderma strain designated "T4-E1" (i.e., derived from the parent "T4" strain) was identified and isolated under selective temperatures, and the T4-E1 mutant strain has a similar specific productivity (Qp) at 28°C to the Qp of the T4 strain at 25°C.

[0061] As used herein, the mutant Trichoderma strain designated "T4-ΔRho#22D" is derived from the T4 parent strain, and the mutant T4-ΔRho#22D strain contains a pyr2 marker gene introduced at the Cas9 cleavage site (TS3) to disrupt the GEF1 coding sequence.

[0062] As used herein, the Trichoderma strain designated "t-ATV84" contains three copies of the S. coccosporum gene encoding the DXST endoglucanase and contains deletions (or disruptions) of the native cellulase genes encoding the CBHI, CBHII, EGI and EGII proteins.

[0063] As used herein, the Trichoderma strain designated "t-AWC88" is derived from the t-ATV84 strain and further contains the introduction of a disruption in the GEF1 gene.

[0064] As used herein, "STCE1," an endoglucanase from Staphylotrichum coccosporum, is described in U.S. Patent No. 7,595,182, the entirety of which is incorporated herein by reference.

[0065] As used herein, "S. coccosporum STCE1 endoglucanase" may also be referred to as "S. coccosporum DXST endoglucanase," and thus the terms STCE1 and DXST are interchangeable. In certain embodiments, the polynucleotide sequence encoding the DXST protein is under the control of a promoter, such as cbhI.

[0066] As used herein, the phrase "high fermentation (cultivation) temperature" refers to a fermentation temperature above 25° C. In certain embodiments, the high fermentation temperature is at least about 25.5° C. to about 28° C. In certain embodiments, the high fermentation temperature is at least about 25.1° C. to about 25.9° C.

[0067] As used herein, the terms "polypeptide" and "protein" (and / or their respective plurals) are used interchangeably and refer to a polymer of any length comprising amino acid residues linked by peptide bonds. The conventional one-letter or three-letter codes for amino acid residues are used herein. The polymers may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acids. The term also encompasses amino acid polymers that are naturally or interveningly modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the scope of this definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids, etc.), as well as other modifications known in the art.

[0068] The term "derivative polypeptide / protein" as used herein refers to a protein derived or derivable from a protein by the addition of one or more amino acids to either or both of the N-terminus and C-terminus, the substitution of one or more amino acids at one or many different sites in the amino acid sequence, the deletion of one or more amino acids at either or both termini of the protein or at one or more sites in the amino acid sequence, and / or the insertion of one or more amino acids at one or more sites in the amino acid sequence. Preparation of a protein derivative can be accomplished by modifying a DNA sequence encoding the native protein, transforming the DNA sequence into a suitable host and expressing the modified DNA sequence to form the derivative protein.

[0069] Related (and derivative) proteins include "mutated proteins." Mutant proteins differ from a reference / parent protein (e.g., a wild-type protein) by substitutions, deletions and / or insertions in a small number of amino acid residues. The number of amino acid residues that differ between a mutant protein and a parent protein can be one or more, such as 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or more amino acid residues. A mutant protein may share at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% or more amino acid sequence identity with a reference protein. A mutant protein may also differ from a reference protein in selected motifs, domains, epitopes, conserved regions, etc.

[0070] The term "analogous sequence" as used herein refers to a sequence in a protein that provides similar function, tertiary structure and / or conserved residues as the protein of interest (i.e. typically the original protein of interest). For example, in epitope regions that contain an alpha helix or beta sheet structure, the substituted amino acids in the analogous sequence preferably maintain the same specific structure. The term refers to amino acid sequences as well as nucleotide sequences. In some embodiments, analogous sequences occur such that amino acid substitutions result in mutant enzymes that exhibit similar or improved function. In some embodiments, the tertiary structure and / or conserved residues of amino acids in the protein of interest are located in or near the segment or fragment of interest. Thus, if the segment or fragment of interest contains, for example, an alpha helix or beta sheet structure, the substituted amino acids preferably maintain that specific structure.

[0071] The term "homologous protein" as used herein refers to a protein that has a similar activity and / or structure as a reference protein. Homologs are not necessarily intended to be evolutionarily related. Thus, the term is intended to encompass identical, similar, or corresponding (i.e., with respect to structure and function) proteins obtained from different organisms. In some embodiments, it is desirable to identify homologs that have a quaternary, tertiary, and / or primary structure similar to the reference protein.

[0072] The degree of homology between sequences can be determined using any suitable method known in the art (see, for example, Smith and Waterman, 1981; Needleman and Wunsch, 1970; Pearson and Lipman, 1988; programs such as GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al., 1984).

[0073] For example, PILEUP is a useful program for determining sequence homology levels. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive pairwise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplified version of the progressive alignment method of Feng and Doolittle (1987). This method is similar to the method described by Higgins and Sharp (1989). Useful PILEUP parameters include a default gap weight of 3.00, a default gap length weight of 0.10, and weighted end gaps. Another example of a useful algorithm is the BLAST algorithm described by Altschul et al., 1990 and Karlin et al., 1993. One particularly useful BLAST program is the WU-BLAST-2 program (see, e.g., Altschul et al., 1996). The parameters "W", "T" and "X" determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a wordlength (W) of 11, a BLOSUM62 scoring matrix (see, e.g., Henikoff and Henikoff, 1989) of 50, alignment (B), expectation (E) of 10, M'5, N'-4 and a comparison of both strands.

[0074] As used herein, the phrases "substantially similar" and "substantially identical," when referring to at least two nucleic acids or polypeptides, typically mean that the polynucleotide or polypeptide comprises a sequence having at least about 70% identity, at least about 75% identity, at least about 80% identity, at least about 85% identity, at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity or greater, as compared to a reference (i.e., wild-type) sequence. Sequence identity can be determined using known programs such as BLAST, ALIGN and CLUSTAL using standard parameters (see, e.g., Altschul, et al., 1990; Henikoff et al., 1989; Karlin et al., 1993; and Higgins et al., 1988). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. FASTA (Pearson et al., 1988) can also be used to search databases. One indication that two polypeptides are substantially identical is that a first polypeptide is immunologically cross-reactive with a second polypeptide. Typically, polypeptides that differ by conservative amino acid substitutions are immunologically cross-reactive. Thus, a polypeptide is substantially identical to a second polypeptide, for example, if the two peptides differ only by conservative substitutions. Another indication that two nucleic acid sequences are substantially identical is that the two molecules hybridize to each other under stringent conditions (eg, within the range of moderate to high stringency).

[0075] "Nucleic acid" as used herein refers to a nucleotide or polynucleotide sequence, and fragments or portions thereof, as well as DNA, cDNA and RNA of genomic or synthetic origin, which may be double-stranded or single-stranded, whether representing the sense or antisense strand.

[0076] The term "expression" as used herein refers to the transcription and stable accumulation of sense (mRNA) or antisense RNA derived from a nucleic acid molecule of the present disclosure. Expression may also refer to the translation of mRNA into a polypeptide. Thus, the term "expression" includes any step involved in the production of a polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, secretion, etc.

[0077] As used herein, the compound term "express / produce" used in phrases such as "the mutant strain of a filamentous fungal cell expresses / produces "increased" amounts of a protein of interest (POI) (i.e. relative to the parent cell)" is meant to include any steps involved in the expression and production of a protein in such mutant filamentous fungal strains of the present disclosure.

[0078] In certain embodiments, a gene, polynucleotide, or nucleic acid sequence encoding a native GEF1 protein that contains "sequence homology" refers to a DNA or RNA (nucleic acid) sequence that has very minor sequence variations from the corresponding nucleic acid sequence (to which it is compared) and retains substantially the same biological function as the corresponding nucleic acid sequence (to which it is compared). For example, in certain embodiments, a nucleic acid sequence that contains substantial sequence homology to a gene, polynucleotide, or nucleic acid encoding a native GEF1 protein is assessed by identifying the encoded gene product (the native GEF1 protein) as described herein.

[0079] In certain other embodiments, gene, polynucleotide or nucleic acid sequences that contain sequence homology to a gene, polynucleotide or nucleic acid encoding a native GEF1 protein are determined / identified using nucleic acid hybridization methods. For example, in certain embodiments, DNA / RNA sequences that contain substantial sequence homology to a gene encoding a native GEF1 protein (e.g., SEQ ID NO:2) are identified by the ability of such DNA / RNA sequences to hybridize under stringent conditions with specific nucleic acid sequences of the present disclosure.

[0080] As used herein, "hybridizes under stringent conditions" is intended to describe hybridization and washing conditions under which nucleotide sequences that are significantly identical or homologous to each other remain hybridized to each other. Such stringent conditions are well known to those of skill in the art (see, e.g., Ausubel et al., 1995; Sambrook et al., 1989). For example, in certain embodiments, non-limiting examples of stringent hybridization conditions include hybridization in 4x sodium chloride / sodium citrate (SSC) at about 65-70°C (or hybridization in 4x SSC + 50% formamide at about 42-50°C), followed by one or more washes in 1x SSC at about 65-70°C. Similarly, non-limiting examples of highly stringent hybridization include hybridization in 1×SSC at about 65-70° C. (or hybridization in 4×SSC+50% formamide at about 42-50° C.), followed by one or more washes in 0.3×SSC at about 65-70° C. Thus, highly stringent hybridization conditions include hybridization in 4×SSC at about 50-60° C. (or alternatively hybridization in 6×SSC+50% formamide at about 40-45° C.), followed by one or more washes in 2×SSC at about 50-60° C. Intermediate ranges between the values ​​recited above, such as 65-70° C. or 42-50° C., are also intended to be encompassed by the present disclosure. In certain embodiments, SSPE (1×SSPE is 0.15 M NaCl, 10 mM NaH2PO4, and 1.25 mM EDTA, pH 7.4) can be substituted for SSC (1×SSPE is 0.15 M NaCl and 15 mM sodium citrate) in the hybridization and wash buffers; washes are performed for 15 minutes each after hybridization is complete. The hybridization temperature for hybrids expected to be less than 50 base pairs in length should be 5-10° C. lower than the melting temperature (Tm) of the hybrid, where Tm is calculated according to the following formula:For hybrids less than 18 base pairs in length, Tm(°C)=2(number of A+T bases)+4(number of G+C bases). For hybrids 18-49 base pairs in length, Tm(°C)=81.5+16.6(log10[Na+])+0.41(G+C%)-(600 / N), where N is the number of bases in the hybrid and [Na+] is the concentration of sodium ions in the hybridization buffer ([Na+]=0.165M for 1×SSC). It will also be recognized by those skilled in the art that additional reagents may be added to the hybridization buffer and / or wash buffer to reduce non-specific hybridization of nucleic acid molecules to membranes, such as nitrocellulose or nylon membranes, including, but not limited to, blocking agents (e.g., BSA or salmon or herring sperm carrier DNA), detergents (e.g., SDS), chelating agents (e.g., EDTA), ficoll, PVP, and the like. When using nylon membranes, additional non-limiting examples of particularly stringent hybridization conditions are hybridization in 0.25-0.5 M NaH2PO4, 7% SDS at about 65°C, followed by one or more washes in 0.02 M NaH2PO4, 1% SDS at 65°C or alternatively in 0.2xSSC, 1% SDS (see, e.g., Church and Gilbert, 1984).

[0081] Thus, as outlined above, certain embodiments of the present disclosure relate to mutant strains of filamentous fungal cells that contain a genetic modification of a gene encoding a native GEF1 protein. As used herein, the terms "modification" and "genetic modification" are used interchangeably and include, but are not limited to, (a) introduction, replacement or removal of one or more nucleotides in a gene or introduction, replacement or removal of one or more nucleotides in a regulatory element required for transcription or translation of a gene, (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene downregulation (e.g., antisense RNA, siRNA, miRNA, etc.), (f) directed mutagenesis (including, but not limited to, CRISPR / Cas9-mediated mutagenesis), and / or (g) random mutagenesis of any one or more genes disclosed herein.

[0082] As used herein, a mutant strain of filamentous fungus comprising a genetic modification includes, but is not limited to, a genetic modification of the gene encoding the native GEF1 protein disclosed herein. Thus, as described in more detail below, various molecular biology methods are well known and can be utilized by a person skilled in the art to generate / construct such mutant strains of filamentous fungal cells.

[0083] As used herein, "the introduction, substitution or removal of one or more nucleotides in a gene encoding a protein" refers to such genetic modifications including the coding sequences (i.e., exons) and the non-coding intervening (intron) sequences of the gene.

[0084] As used herein, "gene disruption", "gene disruption", "gene inactivation" and "gene inactivation" are used interchangeably and broadly refer to any genetic modification that substantially disrupts / inactivates a target gene. Exemplary gene disruption methods include, but are not limited to, complete or partial deletion or mutagenesis of any portion of a gene, including a polypeptide coding sequence (CDS), promoter, enhancer or another regulatory element, where mutagenesis encompasses substitutions, insertions, deletions, inversions and any combinations and variations thereof that disrupt / inactivate the target gene and substantially reduce or prevent expression / production of a functional gene product. In certain embodiments of the present disclosure, such gene disruption prevents the host cell from expressing / producing the encoded lov gene product.

[0085] In certain embodiments, a gene, polynucleotide or nucleic acid sequence encoding a native GEF1 protein is genetically modified using established gene editing techniques such as CRISPR / Cas9 gene editing, zinc finger nuclease (ZFN) gene editing, transcription activator-like effector nuclease editing (TALEN), or homing (mega)nuclease editing.

[0086] In other embodiments, mutant strains of filamentous fungi are constructed (ie, genetically modified) by the process of gene conversion (see, for example, Iglesias and Trautner, 1983).

[0087] In other embodiments, the protein of interest (e.g., endogenous POI or heterologous POI) expressed / produced by the fungal cells of the present disclosure is detected, measured, assayed, etc. by protein quantification methods, gene transcription methods, mRNA translation methods, etc., including, but not limited to, protein migration / mobility (SDS-PAGE), mass spectrometry, HPLC, size exclusion, ultracentrifugation sedimentation velocity analysis, transcriptomics, proteomics, fluorescent tags, epitope tags, fluorescent protein (GFP, RFP, etc.) chimeras / hybrids, etc.

[0088] As used herein, functionally and / or structurally similar proteins are considered to be "related proteins." Such related proteins may be from organisms of different genera and / or species or from different classes of organisms (e.g., bacteria and fungi). Related proteins further encompass homologs and / or orthologues as determined by primary sequence analysis, by secondary or tertiary structure analysis, or by immunological cross-reactivity.

[0089] The term "promoter" as used herein refers to a nucleic acid sequence capable of controlling the expression of a coding sequence or functional RNA. Generally, the coding sequence is located 3' (downstream) of the promoter sequence. Promoters may be derived in their entirety from a native gene, or may be composed of different elements derived from different promoters found in nature, or may include synthetic nucleic acid segments. It is understood by those skilled in the art that different promoters may induce the expression of a gene in different cell types, or at different developmental stages, or in response to different environmental or physiological conditions. The promoters that most often cause the expression of a gene in many cell types are generally referred to as "constitutive promoters". Furthermore, it is recognized that DNA fragments of different lengths may have the same promoter activity, since in most cases the exact boundaries of regulatory sequences have not been completely defined.

[0090] The term "operably linked" as used herein refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one affects the other. For example, a promoter is operably linked to a coding sequence (e.g., ORF) if it is capable of affecting the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). A coding sequence can be operably linked to a regulatory sequence in a sense or antisense orientation. A nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA encoding a secretory leader (i.e., signal peptide) is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of that polypeptide. A promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. In general, "operably linked" means that the DNA sequences being linked are contiguous, and in the case of a secretory leader, contiguous and in reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, synthetic oligonucleotide adaptors or linkers are used in accordance with conventional practice.

[0091] As defined herein, a "suitable regulatory sequence" refers to a nucleotide sequence located upstream (5' non-coding sequences), within or downstream (3' non-coding sequences) of a coding sequence that influences the transcription, RNA processing or RNA stability or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, RNA processing sites, effector binding sites and stem-loop structures.

[0092] As defined herein, the term "introducing", when used in phrases such as "introducing at least one open reading frame (ORF) of a polynucleotide or a gene thereof or a vector thereof into a fungal cell", includes methods known in the art for introducing polynucleotides into a cell, including, but not limited to, protoplast fusion, natural or artificial transformation (e.g., calcium chloride, electroporation), transduction, transfection, and the like.

[0093] As used herein, "transformed" or "transformation" means that a cell has been transformed using recombinant DNA techniques. Transformation typically occurs by inserting one or more nucleotide sequences (e.g., polynucleotides, ORFs, or genes) into a cell. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e., a sequence that is not naturally present in the cell being transformed).

[0094] As used herein, "transformation" refers to the introduction of exogenous DNA into a host cell such that the DNA is maintained as a chromosomal integrant or a self-replicating extrachromosomal vector. As used herein, "transforming DNA," "transforming sequence," and "DNA construct" refer to DNA used to introduce sequences into a host cell. This DNA can be generated in vitro by PCR or any other suitable technique. In some embodiments, the transforming DNA includes the incoming sequence, while in other embodiments, the transforming DNA further includes the incoming sequence flanked by homology boxes. In yet other embodiments, the transforming DNA includes other non-homologous sequences (i.e., stuffer sequences or flanking sequences) added to the ends. The ends can be closed, such as, for example, by insertion into a vector, such that the transforming DNA forms a closed circle.

[0095] As used herein, "incoming sequence" refers to a DNA sequence that is introduced into a fungal cell chromosome. In some embodiments, the incoming sequence is part of a DNA construct. In other embodiments, the incoming sequence encodes one or more proteins of interest. In some embodiments, the incoming sequence comprises a sequence that may or may not already be present in the genome of the cell to be transformed (i.e., it may be a homologous or non-homologous sequence). In some embodiments, the incoming sequence encodes one or more proteins of interest, genes and / or mutant or modified genes. In alternative embodiments, the incoming sequence encodes a functional wild-type gene or operon, a functional mutant gene or operon, or a non-functional gene or operon. In some embodiments, the incoming sequence is a non-functional sequence that is inserted into a gene to disrupt the function of the gene. In another embodiment, the incoming sequence comprises a selectable marker. In a further embodiment, the incoming sequence comprises two homology boxes.

[0096] A "homology box" as used herein refers to a nucleic acid sequence that is homologous to a sequence in a fungal cell chromosome. More specifically, a homology box is an upstream or downstream region that has about 80-100% sequence identity, about 90-100% sequence identity, or about 95-100% sequence identity with the immediately adjacent coding region of a gene or portion of a gene to be deleted, disrupted, inactivated, downregulated, etc., according to the present invention. These sequences direct where in the fungal cell chromosome the DNA construct is integrated and direct the site of the fungal cell chromosome that is replaced by the incoming sequence. Without intending to limit the disclosure, a homology box can include from about 1 base pair (bp) to 200 kilobases (kb). Preferably, the homology box includes from about 1 bp to 10.0 kb; 1 bp to 5.0 kb; 1 bp to 2.5 kb; 1 bp to 1.0 kb, and 0.25 kb to 2.5 kb. The homology box may also comprise about 10.0 kb, 5.0 kb, 2.5 kb, 2.0 kb, 1.5 kb, 1.0 kb, 0.5 kb, 0.25 kb, and 0.1 kb. In some embodiments, the 5' and 3' ends of the selectable marker are flanked by homology boxes that contain nucleic acid sequences that are immediately adjacent to the coding region of the gene.

[0097] As used herein, the term "nucleotide sequence encoding a selectable marker" refers to a nucleotide sequence capable of being expressed in a host cell, where expression of the selectable marker confers on a cell containing the expressed gene the ability to grow in the presence of a corresponding selection agent or in the absence of an essential nutrient.

[0098] The terms "selectable marker" and "selective marker" as used herein refer to a nucleic acid (e.g., a gene) that can be expressed in a host cell, thereby allowing easy selection of those hosts that contain the vector. Examples of such selectable markers include, but are not limited to, antimicrobial agents. Thus, the term "selectable marker" refers to a gene that provides an indication that a host cell has taken up an incoming DNA of interest or that some other reaction has occurred. Typically, a selectable marker is a gene that confers antimicrobial resistance or a metabolic advantage to a host cell, making it possible to distinguish between cells that have not received any foreign sequence during transformation and cells that contain foreign DNA.

[0099] As defined herein, a host cell "genome," a fungal cell "genome," or a filamentous fungal cell "genome" includes chromosomal genes and extrachromosomal genes.

[0100] The terms "plasmid," "vector," and "cassette" as used herein often refer to extrachromosomal elements that carry genes that are not typically part of the central metabolism of the cell and are usually in the form of circular double-stranded DNA molecules. Such elements can be autonomously replicating sequences, genome-integrating sequences, phage, or nucleotide sequences from any source, linear or circular, single-stranded or double-stranded DNA or RNA, in which multiple nucleotide sequences have been joined or recombined into a unique structure that can introduce into a cell a promoter fragment and DNA sequence for a selected gene product along with appropriate 3' untranslated sequences.

[0101] The term "vector" as used herein refers to any nucleic acid that can replicate (multiply) in a cell and carry a new gene or DNA segment (e.g., an "incoming sequence") into the cell. Thus, the term refers to a nucleic acid construct designed for transfer between different host cells. Vectors include viruses, bacteriophages, proviruses, plasmids, phagemids, transposons, and artificial chromosomes, such as YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes), and PLACs (plant artificial chromosomes), that are "episomal" (i.e., autonomously replicating) or can be integrated into the chromosomes of a host cell.

[0102] As used herein, a "transformation cassette" refers to a specific vector that contains a gene (or its ORF) and has elements in addition to that gene that facilitate transformation of a particular host cell.

[0103] As used herein, "expression vector" refers to a vector capable of incorporating and expressing heterologous DNA in a cell. Many prokaryotic and eukaryotic expression vectors are commercially available and known to those skilled in the art. The selection of an appropriate expression vector is within the knowledge of a person skilled in the art.

[0104] The terms "expression cassette" and "expression vector" as used herein refer to a nucleic acid construct that is recombinantly or synthetically produced with a set of specific nucleic acid elements that allow for transcription of a specific nucleic acid in a target cell (i.e., they are vectors or vector elements as described above). The recombinant expression cassette can be incorporated into a plasmid, a chromosome, mitochondrial DNA, plastid DNA, a virus, or a nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid sequence to be transcribed and a promoter. In some embodiments, the DNA construct also includes a set of specific nucleic acid elements that allow for transcription of a specific nucleic acid in a target cell. In certain embodiments, the DNA construct of the present disclosure includes a selectable marker and an inactivated chromosomal segment or gene segment or DNA segment as defined herein.

[0105] As used herein, a "targeting vector" is a vector that contains a polynucleotide sequence that is homologous to a region in a host cell chromosome that the targeting vector is transformed into, and can promote homologous recombination at that region. For example, a targeting vector is used to introduce a genetic modification into a host cell chromosome by homologous recombination. In some embodiments, the targeting vector contains other non-homologous sequences (i.e., stuffer sequences or flanking sequences) that are added, for example, to the ends. The ends can be closed, such as, for example, by insertion into a vector, so that the targeting vector forms a closed circle.

[0106] As used herein, a mutant cell (or strain) comprising an "enhanced protein productivity phenotype" includes, but is not limited to, a mutant cell (or strain) comprising an enhanced / increased volumetric productivity, a mutant cell (or strain) comprising an enhanced / increased carbon conversion efficiency, a mutant cell (or strain) comprising an enhanced / increased protein yield, a mutant cell (or strain) comprising an enhanced / increased specific protein productivity, etc. For example, in certain embodiments, a mutant cell or strain comprising an enhanced protein productivity phenotype expresses / produces at least 0.1% or more total protein (g) per gram of sugar feed (relative to the parent strain), where the sugar feed can be represented by the mass of sugar added to the fermentor during the production phase (i.e., after feeding has started).

[0107] As defined herein, the phrases "enhanced protein productivity phenotype" and "increased protein productivity phenotype" can be used interchangeably.

[0108] As used herein, when speaking of an "enhanced / increased protein productivity phenotype" in an unmodified (parent) cell versus a modified (mutated / daughter) cell, it will be understood that the "parent" and "mutated" cells are grown / cultured / fermented under the same conditions (e.g., the same conditions of medium, temperature, pH, etc.). Similarly, when speaking of the "expression / production" of the same protein of interest (POI) in a modified (mutated / daughter) cell versus an unmodified (mutated / daughter) cell, it will be understood that the "parent" and "mutated" cells are grown / cultured / fermented under essentially the same conditions (e.g., the same conditions of medium, temperature, pH, etc.).

[0109] As used herein, "aerobic fermentation" refers to growth in the presence of oxygen.

[0110] As used herein, the terms "broth," "cell broth," "fermentation broth," and / or "culture broth" are used interchangeably and refer collectively to (i) the fermentation (culture) medium, and (ii) cells in liquid (submerged) culture.

[0111] The term "cell mass" as used herein refers to the cellular components present in liquid (submerged) culture, including intact and lysed cells. Cell mass can be expressed as dry cell weight (DCW) or wet cell weight (WCW).

[0112] II. Fungal strains containing phenotypes of enhanced protein productivity at high cultivation temperatures As generally described and illustrated in the Examples section below, Applicants have continuously grown a whole cellulase strain of Trichoderma reesei, designated T4, under selective conditions and identified and isolated these mutant strains capable of producing protein at high temperatures (i.e., without adversely affecting specific productivity (Qp); see, e.g., Example 1). More specifically, a mutant T. reesei strain, designated "T4-E1," has been identified and isolated under such selective conditions (Example 2) that has a similar specific productivity at 28°C relative to the parent T4 strain at 25°C (Table 1). Applicants have identified a mutant gene in the T4-E1 strain, and the deduced amino acid sequence of the encoded protein (SEQ ID NO:2; PID:120482) contains a region with sequence homology to the GEF1 protein domain (SEQ ID NO:5). As described in detail in Example 2, the mutation in the T4-E1 strain replaces a glutamic acid codon (Glu; amino acid position 1,245) with a premature stop codon, thereby truncating the (GEF1) protein near the beginning of the "GEF1 domain" (see, e.g., the native sequence in Figure 3A versus the C-terminal truncated sequence in Figure 3B).

[0113] As described in Example 3 of the present disclosure, the applicant further constructed a mutant (modified) Trichoderma strain (designated "T4-ΔRho#22D") derived from the T4 parent strain, where the mutant T4-ΔRho#22D strain contains a pyr2 marker gene introduced into the Cas9 cleavage site (TS3) to disrupt the GEF1 coding sequence. For example, the fermentation performance of the wild-type (parent) T4 strain, the mutant T4-E1 strain, and the constructed mutant T4-ΔRho#22D strain is shown in Table 1, where the mutant T4-E1 strain and the constructed mutant T4-ΔRho#22D strain show improved total protein production rate at 28° C. relative to the total protein production rate at 25° C. of the parent T4 strain.

[0114] As further described in Example 4, Applicants constructed a Trichoderma sp. production strain transformed with a copy of the gene encoding the S. coccosporum DXST (STCE1) endoglucanase. More specifically, a parent Trichoderma DXST production strain designated "t-ATV84" was transformed with a copy of the gene encoding the S. coccosporum DXST endoglucanase and further containing deletions of the native cellulase genes encoding the CBHI, CBHII, EGI and EGII proteins. Similarly, a mutant (modified) Trichoderma DXST production strain designated "t-AWC88" was derived from the t-ATV84 strain and further contains the introduction of a disruption in the GEF1 gene. For example, as shown in Table 2, a mutant Trichoderma strain (t-AWC88) containing a disrupted GEF1 gene exhibits greater amounts of DXST endoglucanase produced at 25°C, 26°C, and 27°C relative to the amount of DXST endoglucanase produced at 25°C by the parent strain (t-ATV84) containing the native GEF1 gene.

[0115] III.Molecular biology As outlined above, certain embodiments of the present disclosure relate to modified filamentous fungal strains that comprise a phenotype for enhanced protein productivity. In certain preferred embodiments, the modified (mutated) filamentous fungal strain comprises a phenotype for enhanced protein productivity at high fermentation (cultivation) temperatures. In another embodiment, the present disclosure relates to modified yeast strains that comprise a phenotype for enhanced ethanol productivity. In certain preferred embodiments, the modified (mutated) yeast strain comprises a phenotype for enhanced ethanol productivity at high fermentation (cultivation) temperatures.

[0116] Thus, certain other embodiments of the present disclosure relate to molecular biology, genetic modification, polynucleotides, genes, ORFs, vectors, expression cassettes, etc. In certain embodiments, the present disclosure relates to a recombinant nucleic acid (polynucleotide) comprising a gene or ORF encoding a protein of interest (POI). In certain embodiments, the recombinant nucleic acid (polynucleotide) comprises an expression cassette of a polynucleotide encoding a POI.

[0117] In certain embodiments, the polynucleotide of the present disclosure comprises one or more selection markers. Selection markers used in filamentous fungi include, but are not limited to, alsl, amdS, hygR, pyr2, pyr4, pyrG, sucA, bleomycin resistance marker, blasticidin resistance marker, pyrithiamine resistance marker, chlorimuron ethyl resistance marker, neomycin resistance marker, adenine pathway genes, tryptophan pathway genes, thymidine kinase marker, etc. In certain embodiments, the selection marker is pyr2, the compositions and methods of use of which are outlined in WO2011 / 153449.

[0118] To transform the fungal host cell of the present disclosure, standard methods for transforming filamentous fungi and culturing fungi are used, which are well known to those skilled in the art. Thus, the method of introducing DNA constructs or vectors into fungal host cells includes transformation, electroporation, nuclear microinjection, transduction, transfection (e.g., lipofection-mediated and DEAE-dextrin-mediated transfection), incubation with calcium phosphate DNA precipitate, high-velocity gun using DNA-coated microparticles, gene gun or biolistic transformation, protoplast fusion, etc. General transformation methods are known in the art (see, for example, Ausubel et al., 1987, Sambrook et al., 2001 and 2012, and Campbell et al., 1989). Expression of heterologous proteins in Trichoderma has been described, for example, in U.S. Patent Nos. 6,022,725; 6,268,328; Harkki et al., 1991 and Harkki et al., 1989. For transformation of Aspergillus strains, see also Cao et al. (2000).

[0119] In general, transformation of Trichoderma species typically takes place over a period of 10 5 ~10 7 / mL, especially 2 × 10 6 Permeabilized protoplasts or cells are used at a density of 100 μL / mL. A volume of 100 μL of these protoplasts or cells in an appropriate solution (e.g., 1.2 M sorbitol and 50 mM CaCl2) is mixed with the desired DNA. Generally, a high concentration of polyethylene glycol (PEG) is added to the uptake solution. Additives such as dimethyl sulfoxide, heparin, spermidine, potassium chloride, etc. may also be added to the uptake solution to facilitate transformation. Similar procedures can be used for other fungal host cells (see, e.g., U.S. Pat. Nos. 6,022,725 and 6,268,328, both of which are incorporated by reference).

[0120] Thus, the methods and compositions of the present disclosure generally rely on routine techniques in the field of recombinant genetics. For example, in certain embodiments, a heterologous gene or ORF encoding a protein of interest is introduced into a filamentous fungal (host) cell. In certain embodiments, the heterologous gene or ORF is typically cloned into an intermediate vector before being transformed into a filamentous fungal (host) cell for replication and / or expression. These intermediate vectors may be, for example, prokaryotic vectors such as plasmids or shuttle vectors. In certain embodiments, the expression of the heterologous gene or ORF is under the control of its native promoter. In other embodiments, the expression of the heterologous gene or ORF is placed under the control of a heterologous promoter, which may be a heterologous constitutive promoter or a heterologous inducible promoter.

[0121] Those skilled in the art will recognize that a native promoter can be modified by replacing, substituting, adding, or deleting one or more nucleotides without altering its function, and the practice of the present invention encompasses, but is not limited to, such modifications to promoters.

[0122] An expression vector typically contains a transcription unit or "expression cassette" that contains all the additional elements required for the expression of a heterologous sequence. For example, a typical expression cassette contains a 5' promoter operably linked to a heterologous nucleic acid sequence encoding a protein of interest, and may further contain sequence signals required for efficient polyadenylation of the transcript, a ribosome binding site, and a translation termination sequence. Additional elements of the cassette may include enhancers, and, if genomic DNA is used as the structural gene, may include introns with functional splice donor and acceptor sites.

[0123] In addition to the promoter sequence, the expression cassette may also contain a transcription termination region downstream of the structural gene to provide efficient termination. The termination region may be obtained from the same gene as the promoter sequence or from a different gene. While any fungal terminator is believed to function in the present invention, preferred terminators include those derived from the cbhI gene of Trichoderma, the trpC gene of Aspergillus nidulans (Yelton et al., 1984; Mullaney et al., 1985), and the glucoamylase gene of Aspergillus awamori or Aspergillus niger (Nunberg et al., 1984; Boel et al., 1984).

[0124] The specific expression vector used to transport genetic information into cells is not critical. Any conventional vector used for expression in eukaryotic or prokaryotic cells can be used. Standard bacterial expression vectors include bacteriophage lambda and M13, as well as plasmids based on pBR322, pSKF, pET23D, and fusion expression systems, such as MBP, GST, and LacZ. Epitope tags, such as c-myc, can also be added to recombinant proteins to provide convenient isolation methods.

[0125] Elements that can be included in the expression vector can also be a replicon, a gene encoding antibiotic resistance to allow for selection of bacteria carrying the recombinant plasmid, or a unique restriction site in a non-essential region of the plasmid to allow for the insertion of a heterologous sequence. The particular antibiotic resistance gene selected is not critical, as any of the many resistance genes known in the art can be suitable. Prokaryotic sequences are preferably selected so as not to interfere with DNA replication or integration in Trichoderma reesei.

[0126] The transformation method of the present invention results in stable integration of all or part of the transformation vector into the filamentous fungal genome. However, transformation resulting in the maintenance of an autonomously replicating extrachromosomal transformation vector is also envisioned. To produce Trichoderma reesei cell strains expressing large amounts of heterologous proteins, many standard transfection methods can be used, and thus any known procedure for introducing foreign nucleotide sequences into fungal host cells may be used. These include the use of calcium phosphate transfection, polybrene, protoplast fusion, electroporation, biolistic methods, liposomes, microinjection, plasma vectors, viral vectors, and any other known method for introducing cloned genomic DNA, cDNA, synthetic DNA, or other foreign genetic material into host cells. Agrobacterium-mediated transfection methods, such as those described in U.S. Pat. No. 6,255,115, are also useful.

[0127] After the expression vector is introduced into the cells, the transformed cells are cultured under conditions favoring expression of the gene. Large batches of transformed cells can be cultured as described herein. Finally, the protein product is recovered from the culture using standard techniques. Thus, the disclosure herein provides for expression of a desired protein of interest and enhanced productivity of the desired protein of interest, particularly at the high fermentation (cultivation) temperatures described herein.

[0128] In certain other embodiments, the present disclosure relates to genetically modified filamentous fungal strains (cells) that comprise a phenotype of enhanced protein productivity. In certain embodiments, the modified fungal strains of the present disclosure comprise a phenotype of enhanced protein productivity at high fermentation temperatures. For example, in certain embodiments, the mutant strain of filamentous fungi comprises a genetic modification of the gene encoding the GEF1 protein, including, but not limited to, (a) introduction, replacement or removal of one or more nucleotides in the GEF1 gene (or its ORF) or introduction, replacement or removal of one or more nucleotides in a regulatory element required for transcription or translation of the GEF1 gene (or its ORF), (b) gene disruption, (c) gene conversion, (d) gene deletion, (e) gene downregulation, (f) directed mutagenesis, and / or (g) random mutagenesis of the gene encoding the GEF1 protein, including sequence identity to SEQ ID NO:2.

[0129] Thus, in certain embodiments, a mutant strain of filamentous fungus containing a genetic modification is constructed by gene deletion to eliminate expression / production of the GEF1 protein.

[0130] In other embodiments, mutant strains of filamentous fungi containing genetic modifications are constructed by partial gene deletion or gene disruption to eliminate expression / production of the native GEF1 protein. For example, as described below in Example 3 (FIG. 3B), inactivation of the native GEF1 gene of a parent filamentous fungal strain by introducing a premature stop codon (i.e., truncating the GEF1 protein by its C-terminus; SEQ ID NO: 4) resulted in mutant (daughter) strains that contained an enhanced protein productivity phenotype relative to the parental cells when fermented at 25° C. More specifically, when the parent (T4) and daughter (T4-ΔRho #22D) strains were fermented at a high fermentation temperature (28° C.), the mutant (daughter) strains exhibited an increased protein productivity phenotype relative to the parental strain (Table 1, protein production rate).

[0131] Thus, in certain embodiments, the modified filamentous fungal strain comprises a partial deletion of the GEF1 gene, where the partial deletion comprises a partial deletion of any portion of the coding sequence of the GEF1 gene, and such mutant strains comprise a phenotype of enhanced protein productivity. Thus, in certain other embodiments, such mutant strains do not express / produce the GEF1 protein, or such mutant strains express / produce reduced amounts of the GEF1 protein relative to the parental strain.

[0132] Thus, as outlined herein and described above, a person skilled in the art can readily carry out one or more genetic modifications to construct these mutant filamentous fungal strains by reference to one or more of the nucleic acid and / or protein sequences disclosed herein.

[0133] For example, gene deletion techniques allow for partial or complete removal of a gene, thereby eliminating or reducing expression / production of the protein and / or eliminating or reducing expression / production of the encoded protein (e.g., GEF1). In such methods, deletion of the gene can be achieved by homologous recombination using an integrating plasmid / vector constructed to contain adjacent 5' and 3' regions flanking the gene. The flanking 5' and 3' regions can be introduced into a filamentous fungal cell, for example, on an integrating plasmid / vector with a selectable marker, such that the plasmid can be integrated into the cell.

[0134] In other embodiments, the mutant strain of filamentous fungus comprises a genetic modification that disrupts or inactivates a gene encoding a protein (e.g., GEF1). Exemplary methods of gene disruption / inactivation include disrupting any portion of the gene, including the polypeptide coding sequence (CDS), promoter, enhancer, or another regulatory element (see, e.g., Figures 1-3), including substitutions, insertions, deletions, inversions, and combinations and variations thereof. Non-limiting examples of gene disruption techniques include inserting (integrating) an integration plasmid containing a nucleic acid fragment homologous to a gene (e.g., GEF1) into one or more genes of the present disclosure, resulting in an overlap of the region of homology between the overlapping regions and the DNA of the integration (insertion) vector. In certain other non-limiting examples, gene disruption techniques include inserting an integration plasmid containing a nucleic acid fragment homologous to a gene (e.g., a gene encoding a GEF1 protein) into a gene, resulting in overlap of the region of homology with the DNA of an integration (insertion) vector between the overlapping regions, where the DNA of the inserted vector separates, for example, the promoter of the GEF1 gene from the GEF1 protein coding region, or interrupts (disrupts) the coding or non-coding sequence of the GEF1 gene, resulting in a phenotype of enhanced protein productivity. Thus, the disruption construct can be a selection marker gene (e.g., pyr2) with 5' and 3' regions homologous to the GEF1 gene. The selection marker allows for the identification of transformants containing the disrupted gene. Thus, in certain embodiments, gene disruption includes modification of regulatory elements of the gene, such as promoters, ribosome binding sites (RBS), untranslated regions (UTRs), codon changes, etc.

[0135] In other embodiments, mutant strains of filamentous fungi are constructed (i.e., genetically modified) by introducing, substituting, or removing one or more nucleotides in genes or regulatory elements required for their transcription or translation. For example, nucleotides may be inserted or removed to introduce a premature stop codon, remove an initiation codon, or cause a frameshift in an open reading frame (ORF). Such modifications can be performed by site-directed mutagenesis or PCR-generated mutagenesis according to methods known in the art (see, for example, Botstein and Shortle, 1985; Lo et al., 1985; Higuchi et al., 1988; Shimada, 1996; Ho et al., 1989; Horton et al., 1989, and Sarkar and Sommer, 1990).

[0136] In another embodiment, mutant strains of filamentous fungi are constructed by the process of gene conversion (see, for example, Iglesias and Trautner, 1983). For example, in gene conversion methods, a nucleic acid sequence corresponding to a target gene is mutagenized in vitro to generate a defective nucleic acid sequence, which is then transformed into a parent cell to generate mutant cells containing the defective gene. By homologous recombination, the defective nucleic acid sequence is replaced with the endogenous gene. It may be desirable for the defective gene or defective gene fragment to also encode a marker that can be used to select transformants containing the defective gene. For example, the defective gene can be introduced on a non-replicating or temperature-sensitive plasmid with a selection marker. Selection for integration of the plasmid is performed by selecting for the marker under conditions in which plasmid replication is not possible. Selection for a second recombination event resulting in gene replacement is performed by examining colonies for loss of the selection marker and acquisition of a mutant gene (Perego, 1993).

[0137] In another embodiment, mutant strains of filamentous fungi are constructed by established antisense (gene silencing) techniques using nucleotide sequences complementary to the nucleic acid sequence of the GEF1 gene (Parish and Stoker, 1997). More specifically, expression of a gene by a filamentous fungal strain can be reduced (downregulated) or eliminated by introducing a nucleotide sequence complementary to the nucleic acid sequence of the gene, capable of hybridizing to the mRNA transcribed and produced in the cell. In this way, under conditions in which the complementary antisense nucleotide sequence is capable of hybridizing to the mRNA, the amount of protein translated is reduced or eliminated. Such antisense techniques include, but are not limited to, RNA interference (RNAi), small interfering RNA (siRNA), microRNA (miRNA), antisense oligonucleotides, etc., all of which are well known to those skilled in the art.

[0138] In other embodiments, mutant strains of filamentous fungi are constructed by random or directed mutagenesis using methods well known in the art, including, but not limited to, chemical mutagenesis and translocation (see, e.g., Youngman et al., 1983). Genetic modification can be performed by subjecting parent cells to mutagenesis and screening for mutant cells in which expression of the GEF1 gene is reduced or eliminated. Mutagenesis can be directed or random mutagenesis, for example, by using suitable physical or chemical mutagenizing agents, by using suitable oligonucleotides, or by subjecting the DNA sequence to PCR-generated mutagenesis. Furthermore, mutagenesis can be performed by using any combination of these mutagenesis methods. Examples of physical or chemical mutagenic agents suitable for the purposes of the present invention include ultraviolet (UV) irradiation, hydroxylamine, N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), N-methyl-N'-nitrosoguanidine (NTG), O-methylhydroxylamine, nitrous acid, ethyl methanesulfonate (EMS), sodium bisulfite, formic acid and nucleotide analogs. When such agents are used, mutagenesis is typically performed by incubating the parent cells to be mutagenized in the presence of the selected mutagenic agent under suitable conditions and selecting mutant cells that show reduced or no expression of the gene.

[0139] In certain other embodiments, the mutant strain of filamentous fungus is constructed by site-specific gene editing technology. For example, in certain embodiments, the mutant strain of filamentous fungus is constructed (i.e., genetically modified) by using transcription activator-like endonuclease (TALEN), zinc finger endonuclease (ZFN), homing (mega) endonuclease, etc. More specifically, a part of the gene to be modified (e.g., coding region, non-coding region, leader sequence, propeptide sequence, signal sequence, transcription terminator, transcription activator, or other regulatory element required for expressing the coding region) is genetically modified by ZFN gene editing, TALEN gene editing, homing (mega) endonuclease, etc., and these modification methods are well known and available to those skilled in the art.

[0140] In certain other embodiments, mutant strains of filamentous fungi are constructed by CRISPR / Cas9 editing (see, for example, the Examples herein). More specifically, compositions and methods for modifying fungal genomes by the CRISPR / Cas9 system are described and well known in the art (see, for example, PCT Publication Nos. WO 2016 / 100571, WO 2016 / 100568, WO 2016 / 100272, WO 2016 / 100562, etc.). Thus, genes encoding GEF1 proteins can be disrupted, deleted, mutated, or otherwise genetically modified by nucleic acid-guided endonucleases that find their target DNA by binding either guide RNA (e.g., Cas9) or guide DNA (e.g., NgAgo) that recruits the endonucleases to a target sequence on the DNA, where the endonucleases can create single-strand or double-strand breaks in the DNA. This target DNA break can serve as a substrate for DNA repair and recombine with the provided editing template to disrupt or delete the gene. For example, a gene encoding a nucleic acid-guided endonuclease (e.g., Cas9 from S. pyogenes or a codon-optimized gene encoding a Cas9 nuclease) is operably linked to a promoter active in a filamentous fungal cell and a terminator active in a filamentous fungal cell, thereby creating a filamentous fungal Cas9 expression cassette. Similarly, one or more target sites unique to a gene of interest can be easily identified by one of skill in the art.

[0141] For example, to construct a DNA construct encoding a gRNA that directs to a target site in a gene of interest, a variable targeting domain (VT) contains the nucleotides of the target site that are 5' of the (PAM) protospacer adjacent motif (TGG), which are fused to DNA encoding the Cas9 endonuclease recognition (CER) domain for S. pyogenes Cas9. The DNA encoding the VT domain and the DNA encoding the CER domain are combined to generate DNA encoding the gRNA. Thus, a filamentous fungal expression cassette for a gRNA is made by operably linking the DNA encoding the gRNA to a promoter active in a filamentous fungal cell and a terminator active in a filamentous fungal cell.

[0142] In certain embodiments, the DNA break induced by endonuclease is repaired / replaced with the incoming sequence.For example, to accurately repair the DNA break caused by the Cas9 expression cassette and the gRNA expression cassette described above, a nucleotide editing template is provided so that the DNA repair mechanism of the cell can utilize the editing template.For example, the 5' of about 500bp of the target gene can be fused to the 3' of about 500bp of the target gene to generate an editing template, which is used by the mechanism of the filamentous fungal host to repair the DNA break caused by RGEN (RNA-guided endonuclease).

[0143] The Cas9 expression cassette, the gRNA expression cassette and the editing template can be co-delivered into filamentous fungal cells using a number of different methods (e.g., protoplast fusion, electroporation, natural competence or induced competence). Transformed cells are screened by PCR by amplifying the target locus using forward and reverse primers. These primers can amplify the wild-type locus or the modified locus edited by RGEN. These fragments are then sequenced using sequencing primers to identify edited colonies.

[0144] Another way in which the gene encoding the GEF1 protein of the present disclosure can be genetically modified is by altering the expression level of the gene of interest. For example, nuclease-deficient mutants of such nucleotide-guided endonucleases (e.g., Cas9 D10A, N863A or Cas9 D10A, H840A) can be used to modulate gene expression levels by enhancing or attenuating transcription of the target gene. These Cas9 mutants are inactive against all nuclease domains present in the protein sequence, but retain RNA-guided DNA binding activity (i.e., these Cas9 mutants cannot cleave either strand of DNA when bound to the cognate target site). Thus, the nuclease-deficient protein (i.e., Cas9 mutant) can be expressed as a fungal expression cassette, and upon binding to a fungal gRNA expression cassette, the resulting Cas9 mutant protein is directed to a specific target sequence in the cell. Binding of the Cas9 (mutant) protein to a specific gene target site can block binding or translocation of the transcription machinery on the cell's DNA, thereby reducing the amount of gene product produced. Therefore, using this method, any of the genes disclosed herein can be targeted to reduce gene expression. Using methods such as RNAseq, gene silencing can be observed in cells containing nuclease-defective Cas9 expression cassettes and gRNA expression cassettes.

[0145] V. Protein of interest As briefly mentioned in the previous section, the strains and methods of the present invention are utilized for the production of commercially important proteins in submerged culture of filamentous fungi. The protein of interest (POI) of the present disclosure can be any endogenous or heterologous protein, it can be a mutant of such a POI. The protein is a protein that can contain one or more disulfide bridges or whose functional form is monomeric or multimeric, i.e., the protein has a quaternary structure and is composed of multiple identical (homologous) or non-identical (heterologous) subunits, where the POI or mutant POI thereof is preferably a protein with a property of interest.

[0146] In certain embodiments, the variant strain of filamentous fungus exhibits increased protein titer relative to the (unmodified) parent strain, where protein titer is defined as the amount of protein per volume (g / L). For example, titer can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in certain embodiments, the variant strain of filamentous fungus comprises an increase in protein titer of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.

[0147] In certain embodiments, the variant strain of filamentous fungus exhibits increased volumetric productivity relative to the (unmodified) parent strain, where volumetric productivity is defined as the amount of protein (g) produced during fermentation per nominal volume (L) per total fermentation time (h). For example, volumetric productivity can be measured by methods known in the art (e.g., ELISA, HPLC, Bradford assay, LC / MS, etc.). Thus, in certain embodiments, the variant strain of filamentous fungus comprises an increase in volumetric productivity of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.

[0148] In certain other embodiments, the mutant strain of filamentous fungus exhibits increased total protein yield relative to the (unmodified) parent strain, where total protein yield is defined as the amount (g) of protein produced per gram of carbohydrate fed. Thus, as used herein, total protein yield (g / g) is calculated according to the following formula: Y f =T p / T c

[0149] (In the formula, “Y f " is the total protein yield (g / g) and "T p " is the total protein (g) produced during fermentation, and "T c " is the total carbohydrate (g) fed during the fermentation (bioreactor) run. In certain embodiments, the increase in total protein yield of the engineered strain is at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more increase compared to the unmodified (parental) cell.

[0150] Total protein yield can also be described as carbon conversion efficiency / carbon yield, e.g., as the percentage (%) of the supplied carbon that is incorporated into total protein. Thus, in certain embodiments, the variant strain of filamentous fungus comprises an increased carbon conversion efficiency (e.g., an increase in the percentage (%) of the supplied carbon that is incorporated into total protein) relative to the (unmodified) parent strain. In certain embodiments, the increase in carbon conversion efficiency of the variant strain (i.e., relative to the parent strain) is an increase of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.

[0151] In certain embodiments, the mutant strain of filamentous fungus exhibits an increased specific productivity (Qp) of the POI relative to the (unmodified) parent strain. For example, determining the specific productivity (Qp) is a suitable method for assessing the production rate of a protein. The specific productivity (Qp) is calculated according to the following formula: "Qp = gP / gDCW·hr" where "gP" is the grams of protein produced in the tank, "gDCW" is the grams of dry cell weight (DCW) in the tank, and "hr" is the fermentation time (in hours) from the time of inoculation, including production time and growth time. Thus, in certain embodiments, the variant strain of filamentous fungus comprises an increase in specific productivity (Qp) of at least about 0.1%, at least about 1%, at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, or at least about 10% or more compared to the unmodified (parent) cell.

[0152] In certain embodiments, the POI or a variant thereof is an acetyl esterase, an aminopeptidase, an amylase, an arabinase, an arabinofuranosidase, a carbonic anhydrase, a carboxypeptidase, a catalase, a cellulase, a chitinase, a chymosin, a cutinase, a deoxyribonuclease, an epimerase, an esterase, an α-galactosidase, a β-galactosidase, an α-glucanase, a glucan lyase, an endo-β-glucanase, a glucoamylase, a glucose oxidase, an α-glucosidase, a β-glucosidase, a glucuronidase, a glycosyl hydrolase, a hemicellulase, a hexose oxidase, a hydrolase, an isoform ... Invertase, isomerase, laccase, ligase, lipase, lyase, mannanase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetyl esterase, pectin depolymerase, pectin methyl esterase, pectin degrading enzyme, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnogalacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase, hexose oxidase, and combinations thereof.

[0153] In certain embodiments, the POI or variant POI thereof is selected from an Enzyme Class (EC) number selected from the group consisting of EC1, EC2, EC3, EC4, EC5 or EC6.

[0154] For example, in certain embodiments, the POI is selected from the group consisting of EC 1.10.3.2 (e.g., laccase), EC 1.10.3.3 (e.g., L-ascorbate oxidase), EC 1.1.1.1 (e.g., alcohol dehydrogenase), EC 1.11.1.10 (e.g., chloride peroxidase), EC 1.11.1.17 (e.g., peroxidase), EC 1.1.1.27 (e.g., L-lactate dehydrogenase), , EC 1.1.1.47 (e.g., glucose 1-dehydrogenase), EC 1.1.3.X (e.g., glucose oxidase), EC 1.1.3.10 (e.g., pyranose oxidase), EC 1.13.11.X (e.g., dioxygenase), EC 1.13.11.12 (e.g., linoleic acid 13S-lipoxygenase), EC 1.1.3.13 (e.g., alcohol oxidase), EC 1.14 and EC 1.1.99.18 (e.g., cellobiose dehydrogenase), EC 1.1.99.29 (e.g., pyranose dehydrogenase), EC 1.2.1.X (e.g., fatty acid reductase), EC 1.2.1.10 (e.g., acetaldehyde dehydrogenase), EC 1.5.3.X (e.g., fructosylamine reductase), EC 1.8.1.X (e.g., disulfide reductase), and EC 1.8.3.2 (e.g., thiol oxidase).

[0155] In certain embodiments, the POI is selected from the group consisting of EC 2.3.2.13 (e.g., transglutaminase), EC 2.4.1.X (e.g., hexosyltransferase), EC 2.4.1.40 (e.g., alternansucrase), EC 2.4.1.18 (e.g., 1,4α-glucan branching enzyme), EC 2.4.1.19 (e.g., cyclomaltodextrin glucanotransferase), EC 2.4.1.2 (e.g., dextrin dextranase), EC 2.4.1.20 (e.g., cellobiose phosphorylase), EC 2.4.1.25 (e.g., 4-α-glucanotransferase), EC 2.4.1.333 (e.g., 1,2-β-oligoglucan phosphotransferase), E and EC 2.7.9.4 (e.g., alpha-glucan kinase) and EC 2.7.9.5 (e.g., phosphoglucan kinase).

[0156] In other embodiments, the POI is selected from the group consisting of EC 3.1.XX (e.g., esterases), EC 3.1.1.1 (e.g., pectinases), EC 3.1.1.14 (e.g., chlorophyllases), EC 3.1.1.20 (e.g., tannases), EC 3.1.1.23 (e.g., glycerol ester acyl hydrolases), EC 3.1.1.26 (e.g., galactolipases), EC 3.1.1.32 (e.g., phospholipase A1), EC 3.1.1.4 (e.g., phospholipase A2), EC 3.1.1.6 (e.g., acetyl esterases), EC 3.1.1.7 (e.g., acetyl esterases), EC 3.1.1.8 (e.g., acetyl esterases), EC 3.1.1.9 (e.g., acetyl esterases), EC 3.1.1.10 (e.g., acetyl esterases), EC 3.1.1.11 (e.g., acetyl esterases), EC 3.1.1.12 (e.g., acetyl esterases), EC 3.1.1.13 (e.g., acetyl esterases), EC 3.1.1.14 (e.g., acetyl esterases), EC 3.1.1.15 (e.g., acetyl esterases), EC 3.1.1.16 (e.g., acetyl esterases), EC 3.1.1.17 (e.g., acetyl esterases), EC 3.1.1.18 (e.g., acetyl esterases), EC 3.1.1.72 (e.g., acetyl xylan esterase), EC 3.1.1.73 (e.g., feruloyl esterase), EC 3.1.1.74 (e.g., cutinase), EC 3.1.1.86 (e.g., rhamnogalacturonan acetyl esterase), EC 3.1.1.87 (e.g., fumonisin B1 esterase), EC 3.1.26.5 (e.g., ribonuclease P), EC 3.1.3.X (e.g., phosphate monoester hydrolase), EC 3.1.30.1 (e.g., Aspergillus nuclease S1), EC 3.1.30.2 (e.g., Aspergillus nuclease S2), EC 3.1.30.3 (e.g., Aspergillus nuclease S3), EC 3.1.30.4 (e.g., Aspergillus nuclease S4), EC 3.1.30.5 (e.g., Aspergillus nuclease S5), EC 3.1.30.6 (e.g., Aspergillus nuclease S6), EC 3.1.30.7 (e.g., Aspergillus nuclease S7), EC 3.1.30.8 (e.g., Aspergillus nuclease S8), EC 3.1.30.9 (e.g., Aspergillus nuclease S9), EC 3.1.30.10 (e.g., Aspergillus nuclease S1), EC 3.1.30.11 (e.g., Aspergillus nuclease S1), EC 3.1.30 Serratia marcescens nuclease), EC 3.1.3.1 (e.g. alkaline phosphatase), EC 3.1.3.2 (e.g. acid phosphatase), EC 3.1.3.8 (e.g. 3-phytase), EC 3.1.4.1 (e.g. phosphodiesterase I), EC 3.1.4.11 (e.g. phosphoinositide phospholipase C), EC 3.1.4.3 (e.g. phospholipase C), EC 3.1.4.4 (e.g. phospholipase D), EC 3.1.6.1 (e.g. arylsulfatases), EC 3.1.8.2 (e.g. For example, diisopropyl fluorophosphatase), EC 3.2.1.10 (e.g., oligo-1,6-glucosidase), EC 3.2.1.101 (e.g., mannan endo-1,6-α-mannosidase), EC 3.2.1.11 (e.g., α-1,6-glucan-6-glucanohydrolase), EC 3.2.1.131 (e.g., xylan α-1,2-glucuronosidase), EC 3.2.1.132 (e.g., chitosan N-acetylglucosaminohydrolase), EC 3.2.1.139 (e.g., α-glucuronidase), EC 3.2.1.14 (e.g., chitinases), EC 3.2.1.151 (e.g., xyloglucan-specific endo-β-1,4-glucanases), EC 3.2.1.155 (e.g., xyloglucan-specific exo-β-1,4-glucanases), EC 3.2.1.164 (e.g., galactan endo-1,6-β-galactosidases), EC 3.2.1.17 (e.g., lysozymes), EC 3.2.1.171 (e.g., rhamnogalacturonan hydrolases), EC 3.2.1.174 (e.g., rhamnogalacturonan rhamnohydrolases), EC 3.2.1.2 (e.g., For example, β-amylase), EC 3.2.1.20 (for example, α-glucosidase), EC 3.2.1.22 (for example, α-galactosidase), EC 3.2.1.25 (for example, β-mannosidase), EC 3.2.1.26 (for example, β-fructofuranosidase), EC 3.2.1.37 (for example, xylan 1,4-β-xylosidase), EC 3.2.1.39 (for example, glucan endo-1,3-β-D-glucosidase), EC 3.2.1.40 (for example, α-L-rhamnosidase), EC 3.2.1.51 (for example, α-L-fucosidase), ), EC 3.2.1.52 (e.g., β-N-acetylhexosaminidase), EC 3.2.1.55 (e.g., α-N-arabinofuranosidase), EC 3.2.1.58 (e.g., glucan 1,3-β-glucosidase), EC 3.2.1.59 (e.g., glucan endo-1,3-α-glucosidase), EC 3.2.1.67 (e.g., galacturan 1,4-α-galacturonidase, EC 3.2.1.68 (e.g., isoamylase), EC 3.2.1.7 (e.g., 1-β-D-fructan fructanohydrolase), EC 3.2.1.7 4 (e.g., glucan 1,4-β-glucosidase), EC 3.2.1.75 (e.g., glucan endo-1,6-β-glucosidase), EC 3.2.1.77 (e.g., mannan 1,2-(1,3)-α-mannosidase), EC 3.2.1.80 (e.g., fructan β-fructosidase), EC 3.2.1.82 (e.g., exo-poly-α-galacturonosidase), EC 3.2.1.83 (e.g., κ-carrageenase), EC 3.2.1.89 (e.g., arabinogalactan endo-1,4-β-galactosidase), EC 3.2.1.91 (e.g., cellulose 1,4-β-cellobiosidase), EC 3.2.1.96 (e.g., mannosyl-glycoprotein endo-β-N-acetylglucosaminidase), EC 3.2.1.99 (e.g., arabinan endo-1,5-α-L-arabinase), EC 3.4.XX (e.g., peptidases), EC 3.4.11.X (e.g., aminopeptidases), EC 3.4.11.1 (e.g., leucyl aminopeptidase), EC 3.4.11.18 (e.g., methionyl aminopeptidase), EC 3.4.13.9 (e.g., Xaa-Pr o-dipeptidase), EC 3.4.14.5 (e.g. dipeptidyl peptidase IV), EC 3.4.16.X (e.g. serine-type carboxypeptidase), EC 3.4.16.5 (e.g. carboxypeptidase C), EC 3.4.19.3 (e.g. pyroglutamyl peptidase I), EC 3.4.21.X (e.g. serine endopeptidase), EC 3.4.21.1 (e.g. chymotrypsin), EC 3.4.21.19 (e.g. glutamyl endopeptidase), EC 3.4.21.26 (e.g. prolyl oligopeptidase), EC 3.4.21.4 (e.g., trypsin), EC 3.4.21.5 (e.g., thrombin), EC 3.4.21.63 (e.g., oryzen), EC 3.4.21.65 (e.g., thermomycolin), EC 3.4.21.80 (e.g., streptoglycin A), EC 3.4.22.X (e.g., cysteine ​​endopeptidase), EC 3.4.22.14 (e.g., actinidain), EC 3.4.22.2 (e.g., papain), EC 3.4.22.3 (e.g., ficain), EC 3.4.22.32 (e.g., stem bromelain), EC 3. EC 3.4.22.33 (e.g. fruit bromelain), EC 3.4.22.6 (e.g. chymopapain), EC 3.4.23.1 (e.g. pepsin A), EC 3.4.23.2 (e.g. pepsin B), EC 3.4.23.22 (e.g. endothiapepsin), EC 3.4.23.23 (e.g. mucorpepsin), EC 3.4.23.3 (e.g. gastricin), EC 3.4.24.X (e.g. metalloendopeptidases), EC 3.4.24.39 (e.g. deuterolysin), EC 3.4.24.40 (e.g. serralysin), EC 3.5.1.1 (e.g., asparaginase), EC 3.5.1.11 (e.g., penicillin amidase), EC 3.5.1.14 (e.g., N-acyl-aromatic-L-amino acid amidohydrolase), EC 3.5.1.2 (e.g., L-glutamine amidohydrolase), EC 3.5.1.28 (e.g., N-acetyl-L-alanine amidase), EC 3.5.1.4 (e.g., amidase), EC 3.5.1.44 (e.g., protein-L-glutamine amidohydrolase), and EC 3.5.1.5 (e.g., urease), EC 3.5.1.52 (e.g., peptide-N(4)-(N-acetyl-β-glucosaminyl) asparagine amidase), EC 3.5.1.81 (e.g., N-acyl-D-amino acid deacylases), EC 3.5.4.6 (e.g., AMP deaminase), and EC 3.5.5.1 (e.g., nitrilase).

[0157] In other embodiments, the POI is a lyase enzyme, including but not limited to an EC 4 (lyase) enzyme selected from EC 4.1.2.10 (e.g., mandelonitrile lyase), EC 4.1.3.3 (e.g., N-acetylneuraminic acid lyase), EC 4.2.1.1 (e.g., carbonic anhydrase), EC 4.2.2.- (e.g., rhamnogalacturonan lyase), EC 4.2.2.10 (e.g., pectin lyase), EC 4.2.2.22 (e.g., pectate trisaccharide lyase), EC 4.2.2.23 (e.g., rhamnogalacturonan endolyase), and EC 4.2.2.3 (e.g., mannuronate-specific alginate lyase).

[0158] In certain other embodiments, the POI is an isomerase enzyme, including, but not limited to, an EC 5 (isomerase) enzyme selected from EC 5.1.3.3 (e.g., aldose 1-epimerase), EC 5.1.3.30 (e.g., D-psicose 3-epimerase), EC 5.4.99.11 (e.g., isomaltulose synthase), and EC 5.4.99.15 (e.g., (1→4)-α-D-glucan 1-α-D-glucosylmutase).

[0159] In still other embodiments, the POI is a ligase enzyme, including but not limited to an EC6 (ligase) enzyme selected from EC 6.2.1.12 (e.g., 4-coumarate:coenzyme A ligase) and EC 6.3.2.28 (e.g., L-amino acid α-ligase).

[0160] These and other aspects and embodiments of the strains and methods of the present invention will become apparent to those of skill in the art in light of this specification and the examples below.

[0161] VII. Fermentation In certain embodiments, the disclosure provides a method for producing a protein of interest comprising fermenting filamentous fungal cells, where the fungal cells secrete the protein of interest. In other embodiments, the disclosure provides a method for producing increased amounts of ethanol in yeast strains. Generally, fermentation methods well known in the art are used to ferment fungal cells. In some embodiments, the fungal cells are grown under batch or continuous fermentation conditions. Classical batch fermentation is a closed system where the composition of the medium is set at the beginning of the fermentation and is not changed during the fermentation. The medium is inoculated with the desired organism at the beginning of the fermentation. In this method, fermentation can be carried out without adding any components to the system. Typically, batch fermentation is considered to be "batch" with respect to the addition of the carbon source, and attempts are frequently made to control factors such as pH and oxygen concentration. The metabolic products and biomass composition of a batch system are constantly changing until the time the fermentation is stopped. Cells progress through a static lag phase in batch cultures to a high growth log phase and eventually to a stationary phase where the growth rate is reduced or stopped. Without treatment, cells in the stationary phase will eventually die. Generally, cells in log phase are responsible for the majority of product production.

[0162] A suitable variation of the standard batch system is the "fed-batch fermentation" system. In this variation of the typical batch system, substrate is added gradually as the fermentation proceeds. Fed-batch systems are useful when catabolite repression is likely to inhibit the metabolism of the cells and when a limited amount of substrate in the medium is desired. In fed-batch systems, it is difficult to measure the actual substrate concentration, so the substrate concentration is estimated based on changes in measurable factors such as pH, dissolved oxygen, and partial pressure of waste gases such as CO2. Batch and fed-batch fermentation are common and well known in the art.

[0163] Continuous fermentation is an open system in which a defined fermentation medium is continuously added to a bioreactor and an equal amount of conditioned medium is simultaneously removed for processing. Continuous fermentation generally maintains the culture at a constant high density where the cells are primarily in logarithmic growth phase. Continuous fermentation allows for the modulation of one or more factors that affect cell growth and / or product concentration. For example, in one embodiment, a limiting nutrient such as the carbon or nitrogen source is maintained at a constant ratio and all other parameters can be adjusted. In other systems, a number of factors that affect growth can be continuously varied while the cell concentration, measured by the turbidity of the medium, is kept constant. Continuous systems attempt to maintain steady-state growth conditions. Thus, cell loss caused by removed medium must be balanced with the cell growth rate during fermentation. Methods for modulating nutrients and growth factors for continuous fermentation processes and techniques for maximizing the rate of product formation are well known in the art of industrial microbiology.

[0164] Certain embodiments of the present disclosure relate to fermentation procedures for culturing fungi. Fermentation procedures for producing cellulase enzymes are known in the art. For example, cellulase enzymes can be produced by either solid-state or submerged culture, including batch, fed-batch and continuous-flow processes. Cultivation is generally carried out in a growth medium that includes an aqueous inorganic salts medium, organic growth factors, carbon and energy source materials, molecular oxygen, and of course a starting inoculum of the filamentous fungal host used.

[0165] To ensure proper microbial growth, maximize the uptake of carbon and energy sources by the cells in the microbial conversion process, and achieve maximum cell yield at maximum cell density in the fermentation medium, suitable amounts of inorganic nutrients must be supplied in appropriate proportions in addition to the carbon and energy sources, oxygen, assimilable nitrogen, and microbial inoculum.

[0166] The composition of the aqueous mineral medium can vary over a wide range depending in part on the microorganism and substrate used, as is known in the art. In addition to nitrogen, the mineral medium should contain suitable amounts of phosphorus, magnesium, calcium, potassium, sulfur, and sodium in suitable soluble, absorbable ionic and complex forms, and also preferably certain trace elements such as copper, manganese, molybdenum, zinc, iron, boron, and iodine, all again in suitable soluble, absorbable forms, as is known in the art.

[0167] Fermentation reactions are aerobic processes in which the necessary molecular oxygen is supplied by a gas containing molecular oxygen, such as air, oxygen-enriched air, or substantially pure molecular oxygen, to maintain the contents of the fermenter at a suitable oxygen pressure effective to promote active growth of the microbial species.

[0168] Microorganisms also require an assimilable nitrogen source. The assimilable nitrogen source can be any nitrogen-containing compound or any compound capable of releasing nitrogen in a form suitable for metabolic utilization by the microorganism. A variety of organic nitrogen source compounds, such as protein hydrolysates, can be used, but typically inexpensive nitrogen-containing compounds, such as ammonia, ammonium hydroxide, urea, and various ammonium salts, such as ammonium phosphate, ammonium sulfate, ammonium pyrophosphate, ammonium chloride, or various other ammonium compounds, can be utilized. Ammonia gas itself is convenient for large-scale operations and can be used by bubbling the aqueous fermentation product (fermentation medium) in a suitable amount. At the same time, such ammonia can also be used to assist in pH control.

[0169] The pH range of the aqueous microbial fermentation (fermentation mixture) should be in the exemplary range of about 2.0 to 8.0. For filamentous fungi, the pH is typically in the range of about 2.5 to 8.0, and for Trichoderma reesei, the pH is typically in the range of about 3.0 to 7.0. The preferred pH range for a microorganism will depend to some extent on the medium and the particular microorganism used, and will therefore vary somewhat with changes in the medium, as can be readily determined by one of skill in the art.

[0170] It is preferred to carry out the fermentation in such a way that the carbon-containing substrate can be controlled as a limiting factor, resulting in good conversion of the carbon-containing substrate to the cells and avoiding contamination of the cells with significant amounts of unconverted substrate, which is not a problem with water-soluble substrates since trace amounts of residual unconverted substrate can be easily washed away, however, it can be a problem with water-insoluble substrates and requires additional product processing steps, such as suitable washing steps.

[0171] As noted above, the time to reach this level is not critical and may vary depending on the particular microorganism and fermentation process being performed, however, methods for measuring the carbon source concentration in a fermentation medium and determining whether a desired carbon source level has been achieved are well known in the art.

[0172] Fermentation can be carried out as a batch or continuous operation, with fed-batch operations being highly preferred for ease of control, production of uniform amounts of product and the most economical use of all equipment.

[0173] If necessary, some or all of the carbon and energy source substances and / or a portion of the assimilable nitrogen source, such as ammonia, can be added to the aqueous mineral medium before it is fed to the fermenter.

[0174] Each of the streams introduced into the reactor is preferably controlled at a predetermined rate or according to needs that can be measured by monitoring, such as the concentrations of carbon and energy substrates, pH, dissolved oxygen, oxygen or carbon dioxide in the gas evolving from the fermenter, cell density as measured by dry cell weight, light transmittance, etc. The feed rates of the various materials can be varied to obtain the fastest possible cell growth rate consistent with efficient utilization of the carbon and energy sources, and the highest possible yield of microbial cells relative to the substrate feed.

[0175] In a batch or, preferably, fed-batch operation, all equipment, reactors or fermentation means, tanks or vessels, piping, associated circulation or cooling equipment, etc., are first sterilized, usually using steam, for example at about 121° C. for at least about 15 minutes. The sterilized reactor is then inoculated with a culture of the selected microorganism in the presence of all necessary nutrients, including oxygen, and a carbon-containing substrate. The type of fermenter used is not critical.

[0176] Recovery and purification of the protein from the fermentation broth can also be carried out by procedures known to those of skill in the art. The fermentation broth generally contains cellular debris, e.g., cells, various suspended solids and other biomass contaminants, as well as the desired cellulase enzyme product, which are preferably removed from the fermentation broth by means known in the art.

[0177] Suitable processes for such removal include conventional solid-liquid separation techniques, such as, for example, centrifugation, filtration, dialysis, microfiltration, rotary vacuum filtration or other known processes, to produce a cell-free filtrate. Prior to crystallization, it may be preferable to further concentrate the fermentation broth or cell-free filtrate using techniques such as ultrafiltration, evaporation or precipitation.

[0178] Precipitation of the protein components of the supernatant or filtrate with a salt, such as ammonium sulfate, can be followed by purification by various chromatographic techniques, such as ion exchange chromatography, affinity chromatography, or similar art-recognized methods.

[0179] VIII. Representative Embodiments Non-limiting embodiments of the present disclosure include, but are not limited to, the following.

[0180] 1. A mutant (or modified) strain of a filamentous fungus derived from a parent filamentous fungal strain containing a gene encoding a native GEF1 protein, the mutant (or modified) strain containing a genetic modification that disrupts or deletes the gene encoding the native GEF1 protein, and which contains a phenotype of enhanced protein productivity relative to the parent strain when cultured under the same conditions.

[0181] 2. The mutant strain of embodiment 1, wherein the phenotype of enhanced protein productivity is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency, and increased specific productivity.

[0182] 3. The mutant strain of embodiment 1, wherein the filamentous fungus is a Pezizomycotina.

[0183] 4. The mutant strain of embodiment 1, wherein the filamentous fungus is selected from the group consisting of Trichoderma spp. strains, Aspergillus spp. strains, Fusarium spp. strains, Penicillium spp. strains, Candida spp. strains, Chrysosporium spp. strains, Cephalosporium spp. strains, Talaromyces spp. strains, Neurospora spp. strains, and Myceliophthora spp. strains.

[0184] 5. The variant strain of embodiment 1, comprising a phenotype of increased protein productivity relative to the parent strain when the variant strain and the parent strain are fermented under the same conditions at 25° C.

[0185] 6. The variant strain of embodiment 1, comprising a phenotype of increased protein productivity relative to the parent strain when the variant strain and the parent strain are fermented under the same conditions at 26° C.

[0186] 7. The variant strain of embodiment 1, comprising a phenotype of increased protein productivity relative to the parent strain when the variant strain and the parent strain are fermented under the same conditions at 27° C.

[0187] 8. The variant strain of embodiment 1, comprising a phenotype of increased protein productivity relative to the parent strain when the variant strain and the parent strain are fermented under the same conditions at 28° C.

[0188] 9. The mutant strain of embodiment 1, comprising a gene encoding an endogenous protein of interest (POI).

[0189] 10. The mutant strain of embodiment 9, wherein the endogenous POI is a lignocellulolytic enzyme.

[0190] 11. The mutant strain of embodiment 1, comprising an expression construct encoding a heterologous protein of interest (POI).

[0191] 12. The mutant strain of embodiment 11, wherein the heterologous POI is selected from an enzyme, an antibody or fragment thereof, a receptor protein and a peptide.

[0192] 13. The mutant strain of embodiment 12, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.

[0193] 14. Heterologous POIs include acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endo-β-glucanase, glucoamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, 13. The mutant strain of embodiment 12, wherein the enzyme is selected from the group consisting of enzymes such as glyceryl esterase, laccase, ligase, lipase, lyase, mannanase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetyl esterase, pectin depolymerase, pectin methyl esterase, pectin degrading enzyme, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnogalacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase and hexose oxidase.

[0194] 15. A protein of interest produced by the mutant strain of embodiment 1.

[0195] 16. The mutant strain of embodiment 1, wherein the encoded GEF1 protein comprises at least 70% sequence identity to SEQ ID NO:2.

[0196] 17. The mutant strain of embodiment 1, wherein the encoded GEF1 protein comprises at least 90% sequence identity to the GEF1 domain of SEQ ID NO:5.

[0197] 18. The mutant strain of embodiment 1, wherein the gene encoding the GEF1 protein comprises at least 70% sequence identity with the GEF1 polynucleotide sequence of SEQ ID NO:1.

[0198] 19. The mutant strain of embodiment 1, wherein the gene encoding the GEF1 protein comprises at least 70% sequence identity with the open reading frame (ORF) sequence of SEQ ID NO:3.

[0199] 20. A mutant strain according to embodiment 1, wherein the gene encoding the GEF1 protein hybridizes under moderate to stringent hybridization conditions with the GEF1 gene of SEQ ID NO: 1 or with the ORF of GEF1 of SEQ ID NO: 3.

[0200] 21. The mutant strain of embodiment 1, wherein the genetic modification truncates at least the first 20 amino acid residues at the N-terminus of GEF1 or truncates at least the last 20 amino acid residues at the C-terminus of GEF1.

[0201] 22. The mutant strain of embodiment 1, wherein the genetic modification truncates at least the first 200 amino acid residues at the N-terminus of GEF1 or truncates at least the last 200 amino acid residues at the C-terminus of GEF1.

[0202] 23. The mutant strain of embodiment 1, wherein the genetic modification truncates at least the first 500 amino acid residues at the N-terminus of GEF1 or truncates at least the last 500 amino acid residues at the C-terminus of GEF1.

[0203] 24. The mutant strain of embodiment 1, wherein the genetic modification truncates at least 700-750 amino acid residues at the C-terminus of GEF1.

[0204] 25. The mutant strain of embodiment 1, wherein the gene encoding the GEF1 protein has been deleted.

[0205] 26. A method for producing increased amounts of an endogenous protein of interest (POI) in an engineered filamentous fungal strain, comprising: (a) genetically modifying the filamentous fungal strain by disrupting or deleting the native GEF1 gene; and (b) fermenting the engineered strain under conditions suitable for production of the POI, wherein the engineered strain produces increased amounts of the POI relative to the parent strain when cultured at 25°C under the same conditions.

[0206] 27. The method of embodiment 26, wherein the filamentous fungus is a Pezizomycotina.

[0207] 28. The method of embodiment 26, wherein the filamentous fungus is selected from the group consisting of Trichoderma spp. strains, Aspergillus spp. strains, Fusarium spp. strains, Penicillium spp. strains, Candida spp. strains, Chrysosporium spp. strains, Cephalosporium spp. strains, Talaromyces spp. strains, Neurospora spp. strains, and Myceliophthora spp. strains.

[0208] 29. The method of embodiment 26, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 26°C.

[0209] 30. The method of embodiment 26, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 27°C.

[0210] 31. The method of embodiment 26, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 28°C.

[0211] 32. The method of embodiment 26, wherein the endogenous POI is a lignocellulolytic enzyme.

[0212] 33. The method of embodiment 26, wherein the modified strain further comprises an expression construct encoding a heterologous POI.

[0213] 34. The method of embodiment 26, wherein the encoded GEF1 protein comprises at least 70% sequence identity with SEQ ID NO:2.

[0214] 35. The method of embodiment 26, wherein the encoded GEF1 protein comprises at least 90% sequence identity with the GEF1 protein of SEQ ID NO:5.

[0215] 36. The method of embodiment 26, wherein the gene encoding the GEF1 protein comprises at least 70% sequence identity with the GEF1 polynucleotide sequence of SEQ ID NO:1.

[0216] 37. The method of embodiment 26, wherein the gene encoding the GEF1 protein comprises at least 70% sequence identity with the open reading frame (ORF) sequence of SEQ ID NO:3.

[0217] 38. The method according to embodiment 26, wherein the gene encoding the GEF1 protein hybridizes under moderate to stringent hybridization conditions to the GEF1 gene of SEQ ID NO: 1 or to the ORF of GEF1 of SEQ ID NO: 3.

[0218] 39. The method of embodiment 26, wherein the genetic modification truncates at least the first 20 amino acid residues at the N-terminus of GEF1 or truncates at least the last 20 amino acid residues at the C-terminus of GEF1.

[0219] 40. The method of embodiment 26, wherein the genetic modification truncates at least the first 200 amino acid residues at the N-terminus of GEF1 or truncates at least the last 200 amino acid residues at the C-terminus of GEF1.

[0220] 41. The method of embodiment 26, wherein the genetic modification truncates at least the first 500 amino acid residues at the N-terminus of GEF1 or truncates at least the last 500 amino acid residues at the C-terminus of GEF1.

[0221] 42. The method of embodiment 26, wherein the genetic modification truncates at least 700 to 750 amino acid residues at the C-terminus of GEF1.

[0222] 43. The method of embodiment 26, wherein the gene encoding the GEF1 protein is deleted.

[0223] 44. A method for producing increased amounts of a heterologous protein of interest (POI) in an engineered filamentous fungal strain, comprising: (a) genetically modifying the filamentous fungal strain by disrupting or deleting the native GEF1 gene and by introducing an expression cassette encoding the heterologous POI; and (b) fermenting the engineered strain under conditions suitable for production of the heterologous POI, wherein the engineered strain produces increased amounts of the POI relative to the parental strain when cultured at 25°C under the same conditions.

[0224] 45. The method of embodiment 44, wherein the filamentous fungus is a Pezizomycotina.

[0225] 46. ​​The method of embodiment 44, wherein the filamentous fungus is selected from the group consisting of Trichoderma spp. strains, Aspergillus spp. strains, Fusarium spp. strains, Penicillium spp. strains, Candida spp. strains, Chrysosporium spp. strains, Cephalosporium spp. strains, Talaromyces spp. strains, Neurospora spp. strains, and Myceliophthora spp. strains.

[0226] 47. The method of embodiment 44, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 26°C.

[0227] 48. The method of embodiment 44, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 27°C.

[0228] 49. The method of embodiment 44, wherein the modified strain produces an increased amount of POI relative to the parent strain when cultured under the same conditions at 28°C.

[0229] 50. The method according to embodiment 44, wherein the heterologous POI is selected from an enzyme, an antibody or a fragment thereof, a receptor protein and a peptide.

[0230] 51. The method of embodiment 44, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.

[0231] 52. Heterologous POIs include acetyl esterase, aminopeptidase, amylase, arabinase, arabinofuranosidase, carbonic anhydrase, carboxypeptidase, catalase, cellulase, chitinase, chymosin, cutinase, deoxyribonuclease, epimerase, esterase, α-galactosidase, β-galactosidase, α-glucanase, glucan lyase, endo-β-glucanase, glucoamylase, glucose oxidase, α-glucosidase, β-glucosidase, glucuronidase, glycosyl hydrolase, hemicellulase, hexose oxidase, hydrolase, invertase, isomerase, and glyceryl oxidase. 45. The method of embodiment 44, wherein the enzyme is selected from the group consisting of: glyceryl esterase, laccase, ligase, lipase, lyase, mannanase, mannosidase, oxidase, oxidoreductase, pectate lyase, pectin acetyl esterase, pectin depolymerase, pectin methyl esterase, pectinolytic enzyme, perhydrolase, polyol oxidase, peroxidase, phenol oxidase, phytase, polygalacturonase, protease, peptidase, rhamnogalacturonase, ribonuclease, transferase, transport protein, transglutaminase, xylanase and hexose oxidase.

[0232] 53. A protein of interest produced by the method according to embodiment 26 or embodiment 44.

[0233] 54. A method for producing increased amounts of ethanol in a yeast fermentation process, comprising: (a) genetically modifying a yeast strain by deleting or disrupting the native GEF1 gene; and (b) fermenting the modified strain under conditions suitable for the production of ethanol, wherein the modified strain produces an increased amount of ethanol at the end of fermentation (EOF) relative to the amount of ethanol produced by the parent strain at EOF when cultured under the same conditions.

[0234] 55. A mutant yeast strain derived from a parent strain containing a gene encoding a GEF1 protein homologue, the mutant yeast strain comprising a genetic modification that deletes or disrupts the gene encoding a GEF1 protein homologue and comprising a phenotype of increased ethanol productivity relative to the parent strain when cultured under the same conditions. EXAMPLES

[0235] Certain aspects of the disclosure can be further understood in light of the following examples, which should not be construed as limiting. Modifications to materials and methods will be apparent to those skilled in the art.

[0236] Example 1 Identification of mutant Trichoderma strains containing phenotypes with enhanced protein productivity at high cultivation temperatures A total cellulase (T4) strain of Trichoderma reesei was grown continuously under selective conditions to isolate mutant strains capable of producing proteins at high temperatures without adversely affecting specific productivity. A mutant T. reesei strain, designated "T4-E1," was identified and isolated that had a similar specific productivity (Qp) at 28°C to the parent T. reesei T4 strain at 25°C. For example, the T4 parent strain was sporulated on BIRD agar and 1 × 10 7Spores / mL were harvested, suspended in water, and treated with 0.15 mg / mL 1-methyl-3-nitro-1-nitrosoguanidine (Sigma 112,994-1) for 2 h at room temperature until only 1% of spores remained viable. Spores were inoculated into developmental medium containing 0.5% of either microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (CMC; Sigma-Aldrich C5678, St. Louis, MO) or acid-swollen cellulose (for its preparation, see, e.g., Wood, 1988) as the sole carbon source. Also included per liter were ammonium sulfate (4 g), monobasic sodium phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g), and 2.5 ml of 400x trace element solution.

[0237] More specifically, in the first method, approximately 1 million chemically mutagenized spores were inoculated into a 250 ml hollow-bottom flask containing the development medium described above with Avicel® as the sole carbon source. The flask was incubated at 31° C. for 5 days at 180 rpm. At this point, a 10% volume / volume transfer was made to a second identical flask, which was incubated in the same manner. Successive transfers were continued for 11 passages (P) as follows: P1=5 days, P2=5 days, P3=4 days, P4=4 days, P5=4 days, P6=4 days, P7=4 days, P8=4 days, P9=3 days, P10=3 days, and P11=2 days. The P11 broth from the P11 shake flask was centrifuged at 4,000 rpm for 10 minutes. The supernatant was discarded and the cells were suspended in water and plated on BIRD medium.

[0238] Individual colony forming units were assessed for total protein BCA (product no. 23228, Thermo Scientific, Rockford, IL) after incubation in slow release lactose microtiter plates (srMTPs; see, e.g., PCT Publication WO 2014 / 047520) for 4 days at 31° C., 200 rpm and 80% humidity, thereby allowing mutant strains producing equivalent amounts of total protein at 31° C. to that produced by the parent strain at 25° C. to be further assessed for protein production at elevated temperatures in fermentors.

[0239] In the second method, mutant spores of the T. reesei T4 parent strain were encapsulated in water and oil emulsion droplets using the method described by Bachmann et al. (2013). The droplets contained developmental medium with 0.5% of either microcrystalline cellulose (EMCOCEL, JRS Pharma, Rosenburg, Germany), carboxymethylcellulose (Sigma-Aldrich C5678, St. Louis, MO) or acid-swollen cellulose (Wood, 1988) as the sole carbon source. Also included per liter were ammonium sulfate (4 g), monobasic sodium phosphate (4.5 g), magnesium sulfate heptahydrate (1 g), calcium chloride dihydrate (1 g) and 2.5 ml of 400x trace element solution. Droplets were incubated in tubes at 31°C for 3 days, at which time they were encapsulated in water and oil emulsion droplets using the method described in Bachmann et al. (2013). Cells were harvested and sporulated on agar plates, then reencapsulated and incubated at 31°C for 3 days. This process was repeated 10 times. After the final transfer, cells were suspended in water and plated on BIRD medium. Individual colony forming units were assessed for total BCA protein (product no. 23228, Thermo Scientific, Rockford, IL) after incubation in srMTP lactose plates (PCT Publication WO 2014 / 047520) for 4 days at 31°C, 200 rpm and 80% humidity. Mutant strains producing equivalent amounts of total protein at 31°C relative to the amount of total protein produced by the parent strain at 25°C were further evaluated for protein production at high temperatures in fermenters. This led to the identification of a mutant T. reesei (T4) strain designated "T4-E1" as a high temperature mutant capable of optimal protein production at 28°C, as compared to the parent T4 strain, whose proteins are optimally produced at 25°C, as outlined above and shown below.

[0240] Example 2 Characterization of mutant Trichoderma strains containing mutated GEF1 genes The gene mutated in the Trichoderma mutant strain described above in Example 1 is present at scaffold position 3:1532639-1538781 in the v2.0 genome sequence assembly of wild-type T. reesei QM6a, which is available at the Joint Genomes Institute (JGI) website (genome.jgi.doe.gov). For example, the deduced amino acid sequence (PID:120482; SEQ ID NO:2) contains a region of sequence homology (e.g., SEQ ID NO:4) to a Rho / Rac / Cdc42-like guanine nucleotide exchange factor domain (GEF1 domain; Pfam PF00621, also known as the Dbl homology domain or DH domain). This region of homology is present at amino acid residues 1,242-1,454 in the deduced amino acid sequence (i.e., PID:120482; SEQ ID NO:2). Rho family GTPases regulate many different intracellular processes and are activated by releasing bound GDP and then binding GTP, which is catalyzed by guanine exchange factors of the GEF1 family. A mutation in the mutant T4-E1 strain replaces a glutamic acid codon (Glu(E); amino acid position 1,245) with a premature stop codon, thereby truncating the protein near the beginning of the GEF1 domain (see, e.g., Figures 3A-C).

[0241] Similarly, the deduced amino acid sequence (PID:120482; SEQ ID NO:2) also contains homology to a BAR or AH / BAR domain (e.g., SEQ ID NO:5; Pfam PF03114) at residues 1,576-1,677 of SEQ ID NO:2. AH / BAR domains are found in a variety of proteins. AH / BAR domains have been shown to optionally interact with membranes and dimerize or bind to Arf and Rho family GTPases, including ARF1, a small GTPase involved in vesicle budding to the Golgi complex. The AH / BAR domain (SEQ ID NO:5) has not been observed in the other four T. reesei GEF1 domain proteins.

[0242] Unlike several other GEF1 domain proteins, SEQ ID NO:2 (PID:120482) does not display a pleckstrin homology domain (PH domain, Pfam PF00169). PH domains are associated with signal transduction pathways by their ability to bind membrane phosphatidylinositol to the β / γ subunits of heterotrimeric G proteins or protein kinase C. There are four other putative protein sequences found in the QM6a genome of T. reesei that contain GEF1 domains, two of which also contain PH domains.

[0243] In addition, the deduced amino acid sequence (PID:120482; SEQ ID NO:2) contains a C-terminal sequence (e.g., SEQ ID NO:6) at residues 1,918-1,990 of SEQ ID NO:2 that is highly conserved by GEF1 domain proteins from some other filamentous fungi, including Fusarium fujikuroi, Fusarium graminearum, Thielavia terrestris, Podospora anserina, Penicillium rubens, and Aspergillus niger. However, this C-terminal sequence domain (SEQ ID NO:6) is not present in the other four GEF1 domain proteins identified in the T. reesei genome.

[0244] Example 3 Inactivation of the GEF1 gene in Trichoderma strains by inserting the pyr2 gene. Inactivation of the GEF1 gene (JGI T. reesei v2.0 scaffold 3:1532639-1538781), encoding the GEF1 protein of SEQ ID NO:2 (PID:120482), was performed in a T. reesei strain using a Cas9-based method. More specifically, purified Cas9 protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA), and modified crRNA was synthesized by Synthego containing the following sequence (TS3; SEQ ID NO:7) at the 5' end specific for a target site (TS3) in the T. reesei GEF1 gene. TS3: CAUUCAUCCAAGAAUCCGAG (SEQ ID NO: 7)

[0245] The Cas9 target site (TS) of the GEF1 gene, as determined by the RNA sequence above (SEQ ID NO: 7), is located at nucleotides 3,659-3,678 of the coding sequence, adjacent to the mutation at nucleotide 3,733 observed in the T4-E1 mutant strain (Example 2). Following the manufacturer's instructions, the tracrRNA and crRNA were annealed to form a guide RNA (gRNA), which was then combined with the Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Prior to use, the Cas9:RNP was mixed with Lipofectamine CRISPR-MAX purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0246] A linear DNA fragment containing the T. reesei pyr2 gene including the native promoter and terminator sequences and flanked by 492 bp T. reesei repeat sequences (SEQ ID NO: 18) was amplified by PCR using primers AL950 (SEQ ID NO: 8) and AL952 (SEQ ID NO: 9). The resulting PCR product was purified using a Qiagen QIAquick PCR Purification Kit. AL950: CCTAACTAACGTCTGACATCG (SEQ ID NO: 8) AL952: CGTACCATTTGACTGATACGATG (SEQ ID NO: 9)

[0247] Protoplasts of the T. reesei parent strain were transformed with Cas9:RNP plus the pyr2 PCR product. Transformants were selected by uridine auxotrophy. Transformants were screened for the desired insertion of pyr2 into the GEF1 gene by PCR using the forward and reverse primer pair RhoF1 (SEQ ID NO:10) and RhoR1 (SEQ ID NO:11), which amplify across the Cas9 site of GEF1. RhoF1: GAGCTAGACACGGGCGAAG (SEQ ID NO: 10) RhoR1: AGGAACCCTTCGTGAGCAAG (SEQ ID NO: 11)

[0248] The insertion of pyr2 increased the size of the PCR product from 755 bp to approximately 2.8 kb. The DNA sequence of the 2.8 kb PCR product from a transformant designated "ΔRho #22D" was determined by Sanger sequencing using RhoF1 and RhoR1 primers to confirm the insertion of pyr2 at the Cas9 cleavage site and the disruption of the GEF1 coding sequence.

[0249] The fermentation performance of the ΔRho #22D transformant was compared between the parent T4 strain and a mutant designated T4-E1 strain described in Example 1, as shown in Table 1. For example, the final specific productivity (Qp) rates of the T4, T4-E1 and T4-ΔRho #22D strains at 28° C. relative to the final Qp rate of the control strain T4 at 25° C. are shown in Table 1 as percentages (%). [Table 1]

[0250] Example 4 Inactivation of the GEF1 gene by partial deletion in Trichoderma strains containing heterologous cellulase expression constructs As described in this example, a Trichoderma strain designated "T4-DXST" was derived / constructed from a parent T. reesei T4 strain in which the native cellulase genes encoding the CBHI, CBHII, EGI and EGII proteins have been inactivated by deletion or disruption (i.e., using conventional molecular biology techniques known to those of skill in the art) and transformed with a copy of the gene encoding Staphylotrichum coccosporum endoglucanase 1 (STCE1) under the control of the highly efficient cbhI promoter.

[0251] Methods for transformation of T. reesei with exogenously added plasmid DNA have been published (Penttila et al., 1986; Gruber et al., 1990; Smith et al., 1991). Stable transformants result from integration of the plasmid DNA into the host chromosome. Integration can occur at a site in the genome that has homology to a region of the plasmid DNA or can occur at a non-homologous site.

[0252] A Cas9-based method was used to inactivate the gene encoding GEF1 (see, e.g., U.S. Pat. No. 7,595,182) in a parental T. reesei strain containing an introduced copy of the STCE1 cellulase construct. More specifically, purified Cas9-2NLS protein and modified EZ tracrRNA were purchased from Synthego Corporation (Redwood City, CA). Modified crRNA was synthesized by Synthego containing the following RNA sequence at its 5' end specific for target sites 3 and 4 (TS3 / TS4) in the T. reesei GEF1 gene: TS3: CAUUCAUCCAAGAAUCCGAG (SEQ ID NO: 7) TS4: AUUGUGGAGGAAAUCUACAA (SEQ ID NO: 12)

[0253] The Cas9 target sites (TS3 / TS4) in the GEF1 gene, as determined by the RNA sequence above, are located at nucleotide positions 3,659-3,678 and 3,775-3794 of the coding sequence, proximal to the mutation at nucleotide position 3,733 observed in the T4-E1 mutant strain. Following the manufacturer's instructions, the tracrRNA and crRNA were annealed to form guide RNA (gRNA) and then combined with Cas9-2NLS to form a ribonucleoprotein complex (Cas9:RNP). Prior to use, the Cas9:RNP was mixed with Lipofectamine CRISPR-MAX purchased from ThermoFisher Scientific, Inc. (Waltham, MA).

[0254] A linear DNA fragment containing the bacterial hygromycin phosphotransferase gene (SEQ ID NO:13) operably linked to the Neurospora crassa cpc1 promoter (SEQ ID NO:14) and the Aspergillus nidulans trpC terminator (SEQ ID NO:15) was amplified by PCR using primers HygF1 (SEQ ID NO:16) and HygR1 (SEQ ID NO:17). HygF1: TGGCTTTCCGTCTCCATTG (SEQ ID NO: 16) HygR1: AGTGTACCTGTGCATTCTGGG (SEQ ID NO: 17)

[0255] Protoplasts of the T. reesei parental strain were transformed with both the linear DNA fragment and the mixture of Cas9:RNP (both containing crRNA). Transformants were selected by hygromycin resistance on appropriate agar media, except that smaller, slower growing transformed colonies were selected from the selective agar plates and transferred to agar plates containing non-selective medium. Transformants were selected after growth on non-selective medium, and hygromycin was dropped onto the medium. Transformants that did not grow in the presence of hygromycin were selected for further testing. These transformants were presumed to have exhibited transient hygromycin resistance and subsequently lost the hygromycin resistance DNA marker fragment without integration into the T. reesei genome. Transformants sensitive to hygromycin were screened using PCR with RhoF1 (SEQ ID NO: 10) and RhoR1 (SEQ ID NO: 11) primers.

[0256] A transformant was identified that yielded a PCR product of approximately 630 bp, as would be expected if a deletion occurred between the Cas9 target sites TS3 and TS4. The size of this PCR product in wild-type cells is 756 bp. The PCR product was sequenced from both ends using primers RhoF1 (SEQ ID NO: 10) and RhoR1 (SEQ ID NO: 11). Transformant #89 (t-AWC88) had a deletion of 125 bp (i.e., nucleotides 3,668 to 3,791 of the coding sequence) with no insertion between TS3 and TS4. Trichoderma transformant #89 (t-AWC88) was subsequently fermented and compared (contrasted) with the parental strain (t-AVT84) for STCE / DXST protein production at 25°C and 28°C, as shown in Table 2. [Table 2]

[0257] More specifically, as shown in Table 2 above, the T4-DXST daughter strain (t-AWC88) has an optimal protein production temperature that is at least 2-3°C higher than the parent strain (t-AVT84).

[0258] References PCT Application No. PCT / US Patent Publication No. 2019 / 27590 PCT International Publication No. 2011 / 153449 Pamphlet PCT International Publication No. 2011 / 153449 Pamphlet PCT International Publication No. 2012 / 145584 Brochure PCT International Publication No. 2012 / 145595 Brochure PCT International Publication No. 2016 / 100272 Brochure PCT International Publication No. 2016 / 100562 Brochure PCT International Publication No. 2016 / 100568 Brochure U.S. Patent No. 6,022,725 U.S. Patent No. 6,255,115 U.S. Patent No. 6,268,328 U.S. Pat. No. 7,595,182 U.S. Provisional Patent Application No. 62 / 711,846, filed July 30, 2018 Altschul et al., J. Mol. Biol. 215:403-10, 1990. Altschul et al., Meth. Enzymol. 266: 460-80, 1996. Ausubel et al., “Current Protocols in Molecular Biology”, Green Publishing Associates / Wiley Interscience, New York, 1994. Bachmann et al., “Availability of public goods shapes the evolution of competing metabolic strategies”, PNAS, 110(35); 14302-14307, 2013. Boel et al.,EMBO J.3:1581-1585,1984.Botstein and Shortle,Science 229;4719,1985. Campbell et al.,Curr.Genet.,16;53-56,1989. Cao et al.,Science,9;991-1001,2000. Devereux et al.,Nucleic Acids Res.12:387-395,1984. Gruber et al.,1990 Hakkinen et al.,“Screening of candidate regulators for cellulase and hemicellulase production in Trichoderma reesei and identification of a factor essential for cellulase production”,Biotechnol Biofuels 7,14,2014. Harkki et al.,BioTechnol.,7;596-603,1989. Harkki et al.,Enzyme Microb.Technol.,13;227-233,1991.Henikoff and Henikoff,Proc.Natl.Acad.Sci.USA 89:10915,1989.Higgins and Sharp,CABIOS 5:151-53,1989. Higuchi et al.,Nucleic Acids Research 16;7351,1988. Ho et al.,Gene 77;61,1989. Horton et al.,Gene 77;61,1989. Iglesias and Trautner,Molecular General Genetics 189;73-76,1983.Joint Genomes Institute(JGI)website(www.genome.jgi.doe.gov). Karlin et al.,Proc.Natl.Acad.Sci.USA 90:5873-87,1993. Lo et al.,Proceedings of the National Academy of Sciences USA 81;2285,1985.Mullaney et al.,MGG 199:37-45,1985. Needleman and Wunsch,J.Mol.Biol.,48:443,1970.Nunberg et al.,Mol.Cell Biol.4:2306,1984. Parish and Stoker,FEMS Microbiology Letters 154;151-157,1997.Pearson and Lipman,1988 Penttila et al.,“A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei”,Gene 61,155-164,1987. Perego,1993,In A.L.Sonneshein,J.A.Hoch,and R.Losick,editors,Bacillus subtilis and Other Gram-Positive Bacteria,Chapter 42,American Society of Microbiology,Washington,D.C. Sambrook et al.,“Molecular Cloning,A Laboratory Manual”,4th Edition,Cold Spring Harbor Laboratory Press,Cold Spring,New York,2012. Sarkar and Sommer,BioTechniques 8;404,1990. Shimada,Meth.Mol.Biol.57;157;1996. Smith and Waterman,Adv.Appl.Math.2:482,1981. Wood,“Preparation of crystalline,amorphous,and dyed cellulase substrates”,Methods in Enzymology,Vol.160,pages 19-25,1988. Yelton et al.,PNAS USA 81:1470-1474,1984. Youngman et al.,1983

Claims

1. A mutant Trichoderma cell derived from a parent Trichoderma cell containing a gene encoding a GEF1 protein, the mutant Trichoderma cell comprising a genetic modification that disrupts or deletes the gene encoding the GEF1 protein, the mutant Trichoderma cell comprising a phenotype of enhanced protein productivity relative to the parent Trichoderma cell when fermented under the same conditions.

2. 2. The mutant Trichoderma cell of claim 1, wherein the enhanced protein productivity phenotype is selected from the group consisting of increased protein productivity, increased total protein productivity, increased volumetric productivity, increased carbon conversion efficiency and increased specific productivity.

3. 2. The mutant Trichoderma cell of claim 1, comprising a phenotype of increased protein productivity relative to the parent Trichoderma cell when the mutant Trichoderma cell and the parent Trichoderma cell are fermented under the same conditions at 26°C.

4. 2. The mutant Trichoderma cell of claim 1, comprising a gene encoding an endogenous protein of interest (POI) and / or comprising an expression cassette encoding a heterologous POI.

5. The mutant Trichoderma cell of claim 4 , wherein the endogenous POI is a lignocellulolytic enzyme.

6. 6. The mutant Trichoderma cell of claim 5, wherein the lignocellulolytic enzyme is selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases and β-glucosidases.

7. The mutant Trichoderma cell of claim 4, wherein the expression cassette encodes a heterologous POI selected from an enzyme, an antibody, a receptor, and a peptide.

8. 8. The mutant Trichoderma cell of claim 7, wherein the enzyme is selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.

9. 1. A method for producing increased amounts of an endogenous protein of interest (POI) in an engineered Trichoderma cell, comprising: (a) genetically modifying a parent Trichoderma cell by disrupting or deleting the native GEF1 gene; (b) fermenting the modified Trichoderma cells under conditions suitable for the production of the POI, wherein the modified Trichoderma cells produce an increased amount of the POI relative to the parent Trichoderma cells when fermented under the same conditions at 25° C.; The method includes:

10. The method of claim 9 , wherein the endogenous POI is a lignocellulolytic enzyme.

11. The method of claim 10, wherein the lignocellulolytic enzyme is selected from the group consisting of cellobiohydrolases, xylanases, endoglucanases and β-glucosidases.

12. The method of claim 9, wherein the modified Trichoderma cell further comprises an expression construct encoding a heterologous POI.

13. 1. A method for producing increased amounts of a heterologous protein of interest (POI) in an engineered Trichoderma cell, comprising: (a) genetically modifying a Trichoderma cell by disrupting or deleting the native GEF1 gene and by introducing an expression cassette encoding a heterologous POI; (b) fermenting the modified Trichoderma cells under conditions suitable for the production of the heterologous POI, wherein the modified Trichoderma cells produce an increased amount of the POI relative to the parent Trichoderma cells when fermented under the same conditions at 25° C.; The method includes:

14. The method of claim 13, wherein the heterologous POI is selected from an enzyme, an antibody or fragment thereof, a receptor protein and a peptide.

15. 14. The method of claim 13, wherein the heterologous POI is an enzyme selected from the group consisting of oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases.

Images