5'-Modified Nucleosides and Nucleotides Using The Same

Abstract

Disclosed are a 5'-modified nucleoside and a nucleotide using the same. The nucleoside of the present invention is a compound represented by formula (I) or a salt thereof. The nucleoside of the present invention has suitable duplex-forming ability for a target RNA and excellent nuclease resistance and can be produced efficiently without requiring a diastereomer separation operation in its synthesis pathway. The nucleoside of the present invention is usable as a substitute for a phosphorothioate-modified nucleic acid with concerns of accumulation in a specific organ, etc. Moreover, this nucleoside has high industrial productivity.

Description

[Technical field]

[0001] The present invention relates to a 5'-modified nucleoside and a nucleotide using the same. More specifically, the present invention relates to a 5'-modified nucleoside and a nucleotide using the same that have appropriate double-strand formation ability and excellent nuclease resistance and can be efficiently produced. [Background technology]

[0002] Various artificial nucleic acids have been developed as materials for nucleic acid medicines. Among them, 2',4'-BNA (bridged nucleic acid, also known as LNA), in which the sugar conformation of the nucleic acid is fixed by crosslinking, has been reported to have excellent binding affinity to single-stranded RNA (ssRNA) (Non-Patent Documents 1 and 2), and is expected to be applied to various nucleic acid medicines such as antisense methods.

[0003] On the other hand, it has been reported that artificial nucleic acids with a methyl group introduced at the 5' position of the nucleic acid have excellent properties in terms of nuclease resistance (Patent Documents 1 to 3). For this reason, artificial nucleic acids with a substituent introduced at the 5' position are also expected to be applied to diagnosis and medicine. However, such artificial nucleic acids require separation of diastereomers during their synthesis (Non-Patent Documents 3 and 4), making the overall manufacturing process complicated.

[0004] In response to this, in recent years, artificial nucleic acids that do not require separation of diastereomers and have a specific cyclopropane structure introduced at the 5' position (hereinafter, sometimes referred to as "5'-cp modified nucleic acid" or simply "5'-cp") have been proposed (Patent Document 4). 5'-cp modified nucleic acids have enzyme resistance equal to or greater than that of phosphorothioate modified nucleic acids (Non-Patent Document 5), which are currently widely used in nucleic acid drug development, and are expected to be used as an alternative to the phosphorothioate modified nucleic acids, which have been pointed out to be associated with hepatotoxicity.

[0005] However, the 5'-cp modified nucleic acid is not satisfactory in terms of, for example, its ability to form a double strand with a target RNA, and further improvement is desired. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] International Publication No. 2010 / 048549 [Patent Document 2] International Publication No. 2010 / 048585 [Patent Document 3] International Publication No. 2010 / 077578 [Patent Document 4] International Publication No. 2020 / 158910 [Non-patent literature]

[0007] [Non-Patent Document 1] S. Obika et al., T. Tetrahedron Lett. 1997, 38, 8735-8738. [Non-Patent Document 2] S. Singh et al., J. Chem. Commun. 1998, 455-456. [Non-Patent Document 3] AMY Wawman et al., J. Org. Chem. 1995, 60, 788-789. [Non-Patent Document 4] M. Manoharan et al., J. Org. Chem. 2016, 81, 2261-2279. [Non-Patent Document 5] S.T. Crooke et al., J. Am. Chem. Soc. 2020, 142, 14754-15771. Summary of the Invention [Problem to be solved by the invention]

[0008] The present invention solves the above-mentioned problems, and an object of the present invention is to provide a 5'-modified nucleoside and a nucleotide using the same, which have appropriate double-stranded strand forming ability with respect to a target RNA and excellent nuclease resistance, and can be efficiently produced without requiring a diastereomer separation procedure in the synthetic route. [Means for solving the problem]

[0009] The present invention relates to a compound represented by the following formula (I) or a salt thereof:

[0010] [ka]

[0011] (In formula (I), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 1 and R 2each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 9 )R 10 [In the formula, R 9 and R 10 each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 5 and R 6 is a hydrogen atom, or R 5 and R 6 together form a single bond, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R8 Let's get together -CH 2 O- or -OCH 2 -represents a divalent group represented by the formula:

[0012] In one embodiment, the above formula (I) is represented by the following formula (Ia):

[0013] [ka]

[0014] (In formula (Ia), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 1 and R 2 each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 9 )R 10 [In the formula, R 9 and R 10each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R 3 and R 4 each independently represents a hydrogen atom or an alkyl group having 1 or 2 carbon atoms, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -representing a divalent group represented by

[0015] In one embodiment, the above formula (I) is represented by the following formula (Ib):

[0016] [ka]

[0017] (In formula (Ib), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R1 and R 2 each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 9 )R 10 [In the formula, R 9 and R 10 each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms; R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -represents a divalent group represented by the formula: It is expressed as:

[0018] In one embodiment, in the above formula (I), the above Base is selected from the group consisting of 6-aminopurin-9-yl group, 2,6-diaminopurin-9-yl group, 2-amino-6-chloropurin-9-yl group, 2-amino-6-fluoropurin-9-yl group, 2-amino-6-bromopurin-9-yl group, 2-amino-6-hydroxypurin-9-yl group, 6-amino-2-methoxypurin-9-yl group, 6-amino-2-chloropurin-9-yl group, 6-amino-2-fluoropurin-9-yl group, 2,6-dimethoxypurin-9-yl group, 2,6-dichloropurin-9-yl group, 6-mercaptopurin-9-yl group, 2-oxo-4-amino-1 ,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

[0019] In one embodiment, in the above formula (I), the Base is represented by the following formula:

[0020] [ka]

[0021] It is a group represented by the following formula:

[0022] The present invention also relates to an oligonucleotide containing at least one nucleoside structure represented by the following formula (II) or a pharmacologically acceptable salt thereof:

[0023] [ka]

[0024] (In formula (II), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 5 and R 6 is a hydrogen atom, or R 5 and R 6 together form a single bond, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -represents a divalent group represented by the formula:

[0025] In one embodiment, the above formula (II) is represented by the following formula (IIa):

[0026] [ka]

[0027] (In formula (IIa), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 3 and R 4 each independently represents a hydrogen atom or an alkyl group having 1 or 2 carbon atoms, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -representing a divalent group represented by

[0028] In one embodiment, the above formula (II) is represented by the following formula (IIb):

[0029] [ka]

[0030] (In formula (IIb), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -representing a divalent group represented by

[0031] The present invention also provides a method for producing the above-mentioned oligonucleotide or a pharmacologically acceptable salt thereof, comprising the steps of: A compound represented by the following formula (I) or a salt thereof:

[0032] [ka]

[0033] (In formula (I), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 1 and R 2 each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 9 )R 10 [In the formula, R 9 and R 10 each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 5 and R6 is a hydrogen atom, or R 5 and R 6 together form a single bond, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -represents a divalent group represented by The method includes synthesizing an oligonucleotide using Effect of the Invention

[0034] According to the present invention, there are provided 5'-modified nucleosides having excellent double-stranded chain forming ability and enzyme resistance, and nucleotides using the same, which can be used in pharmaceutical development. The 5'-modified nucleosides of the present invention can also be used as an alternative to phosphorothioate-modified nucleic acids, which are concerned about accumulation in specific organs. The 5'-modified nucleosides of the present invention are also excellent in industrial productivity, since no diastereomer separation step is required in the production thereof. [Brief description of the drawings]

[0035] [Figure 1] The figure shows an evaluation of the resistance of five types of oligonucleotides (PO (natural), PS, cp, cp2nd, cp3rd) to an enzyme (3'-exonuclease), with the upper left column showing a schematic diagram of 3'-exonuclease and the sequences used in the test, the lower left column showing a graph showing the evaluation results, and the right column showing the structure of the (artificial) nucleic acid mounted in the T portion of each oligonucleotide used in the test. [Diagram 2]1 is a graph showing the results of the target gene (GR(NR3C1)) suppression effect of test oligonucleotides. The results are expressed as mean ± standard error (SE). [Diagram 3] 1 is a graph showing the results of evaluation of AST (U / L) and ALT (U / L) in the blood of each test oligonucleotide administration group. The results are expressed as mean ± standard error (SE). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0036] First, the terms used in this specification are defined.

[0037] In this specification, the term "straight-chain alkyl group having 1 to 6 carbon atoms" refers to any straight-chain alkyl group having 1 to 6 carbon atoms, specifically, a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, or an n-hexyl group. On the other hand, the term "alkyl group having 1 to 6 carbon atoms" refers to any straight-chain, branched-chain, or cyclic alkyl group having 1 to 6 carbon atoms.

[0038] In this specification, the term "straight-chain alkoxy group having 1 to 6 carbon atoms" includes an alkoxy group having any straight-chain alkyl group having 1 to 6 carbon atoms. Examples include a methoxy group, an ethoxy group, and an n-propoxy group. On the other hand, the term "alkoxy group having 1 to 6 carbon atoms" refers to any straight-chain, branched, or cyclic alkoxy group having 1 to 6 carbon atoms. In addition, the term "straight-chain alkoxy group having 1 to 6 carbon atoms which may be substituted with a straight-chain alkoxy group having 1 to 6 carbon atoms" refers to the above-mentioned "straight-chain alkoxy group having 1 to 6 carbon atoms" as well as an alkoxy group in which one or more hydrogen atoms constituting the "straight-chain alkoxy group having 1 to 6 carbon atoms" are substituted with other "straight-chain alkoxy groups having 1 to 6 carbon atoms" which may be the same or different. Examples of such a "straight-chain alkoxy group having 1 to 6 carbon atoms which may be substituted with a straight-chain alkoxy group having 1 to 6 carbon atoms" include a methoxy group, an ethoxy group, an n-propoxy group, a methoxymethoxy group, an ethoxymethoxy group, an n-propoxymethoxy group, a methoxyethoxy group (e.g., a 2-methoxyethoxy group), an ethoxyethoxy group (e.g., a 2-ethoxyethoxy group), and an n-propoxyethoxy group.

[0039] In this specification, the term "cyanoalkoxy group having 1 to 6 carbon atoms" refers to any straight-chain, branched-chain, or cyclic alkoxy group having 1 to 6 carbon atoms in which at least one hydrogen atom has been substituted with a cyano group.

[0040] In this specification, the term "straight-chain alkylthio group having 1 to 6 carbon atoms" includes alkylthio groups having any straight-chain alkyl group having 1 to 6 carbon atoms. Examples include methylthio group, ethylthio group, n-propylthio group, etc. On the other hand, the term "alkylthio group having 1 to 6 carbon atoms" refers to any straight-chain, branched, or cyclic alkylthio group having 1 to 6 carbon atoms.

[0041] In this specification, the term "straight-chain alkylamino group having 1 to 6 carbon atoms" includes alkylamino groups having one or two alkylamino groups having any straight-chain alkyl group having 1 to 6 carbon atoms. Examples include a methylamino group, a dimethylamino group, an ethylamino group, a methylethylamino group, and a diethylamino group.

[0042] In the present specification, the term "an alkyl group having 1 to 7 carbon atoms, which may be branched or cyclic" includes any linear alkyl group having 1 to 7 carbon atoms, any branched alkyl group having 3 to 7 carbon atoms, and any cyclic alkyl group having 3 to 7 carbon atoms. It may also be simply referred to as "lower alkyl group". For example, any linear alkyl group having 1 to 7 carbon atoms includes a methyl group, an ethyl group, an n-propyl group, an n-butyl group, an n-pentyl group, an n-hexyl group, and an n-heptyl group, any branched alkyl group having 3 to 7 carbon atoms includes an isopropyl group, an isobutyl group, a tert-butyl group, an isopentyl group, and the like, and any cyclic alkyl group having 3 to 7 carbon atoms includes a cyclobutyl group, a cyclopentyl group, a cyclohexyl group, and the like.

[0043] In this specification, the term "alkenyl group having 2 to 7 carbon atoms which may be branched or cyclic" includes any linear alkenyl group having 2 to 7 carbon atoms, any branched alkenyl group having 3 to 7 carbon atoms, and any cyclic alkenyl group having 3 to 7 carbon atoms. It may also be simply referred to as a "lower alkenyl group". For example, any linear alkenyl group having 2 to 7 carbon atoms may include an ethenyl group, a 1-propenyl group, a 2-propenyl group, a 1-butenyl group, a 2-butenyl group, a 1-pentenyl group, a 2-pentenyl group, a 3-pentenyl group, a 4-pentenyl group, and a 1-hexenyl group. Any branched alkenyl group having 3 to 7 carbon atoms may include an isopropenyl group, a 1-methyl-1-propenyl group, a 1-methyl-2-propenyl group, a 2-methyl-1-propenyl group, a 2-methyl-2-propenyl group, and a 1-methyl-2-butenyl group. Any cyclic alkenyl group having 3 to 7 carbon atoms may include a cyclobutenyl group, a cyclopentenyl group, and a cyclohexenyl group.

[0044] In this specification, the term "aryl group having 3 to 10 carbon atoms which may contain a heteroatom" includes any aryl group having 6 to 10 carbon atoms composed only of hydrocarbons, and any heteroaryl group having 3 to 12 carbon atoms in which at least one carbon atom constituting the ring structure of the aryl group is replaced with a heteroatom (e.g., a nitrogen atom, an oxygen atom, a sulfur atom, or a combination thereof). The aryl group having 6 to 10 carbon atoms includes a phenyl group, a naphthyl group, an indenyl group, an azulenyl group, etc., and the heteroaryl group having 3 to 12 carbon atoms includes a pyridyl group, a pyrrolyl group, a quinolyl group, an indolyl group, an imidazolyl group, a furyl group, a thienyl group, etc.

[0045] In this specification, examples of the term "aralkyl group having an aryl moiety having 3 to 12 carbon atoms which may contain a heteroatom" include a benzyl group, a phenethyl group, a naphthylmethyl group, a 3-phenylpropyl group, a 2-phenylpropyl group, a 4-phenylbutyl group, a 2-phenylbutyl group, a pyridylmethyl group, an indolylmethyl group, a furylmethyl group, a thienylmethyl group, a pyrrolylmethyl group, a 2-pyridylethyl group, a 1-pyridylethyl group, and a 3-thienylpropyl group.

[0046] In this specification, examples of the term "acyl group" include aliphatic acyl group and aromatic acyl group.Specifically, examples of the aliphatic acyl group include formyl group, acetyl group, propionyl group, butyryl group, isobutyryl group, pentanoyl group, pivaloyl group, valeryl group, isovaleryl group, octanoyl group, nonanoyl group, decanoyl group, 3-methylnonanoyl group, 8-methylnonanoyl group, 3-ethyloctanoyl group, 3,7-dimethyloctanoyl group, undecanoyl group, dodecanoyl group, tridecanoyl group, tetradecanoyl group, pentadecanoyl group, hexadecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, heptadecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, 1-methylpentadecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, 14-methylpentadecanoyl group, 13,13-dimethyltetradecanoyl group, 13-methylpentadecano ... Examples of lower alkylcarbonyl groups include alkylcarbonyl groups such as enoyl, 15-methylhexadecanoyl, octadecanoyl, 1-methylheptadecanoyl, nonadecanoyl, eicosanoyl, and henaicosanoyl groups; carboxylated alkylcarbonyl groups such as succinoyl, glutaroyl, and adipoyl groups; halogeno lower alkylcarbonyl groups such as chloroacetyl, dichloroacetyl, trichloroacetyl, and trifluoroacetyl groups; lower alkoxy lower alkylcarbonyl groups such as methoxyacetyl; and unsaturated alkylcarbonyl groups such as (E)-2-methyl-2-butenoyl groups. Examples of aromatic acyl groups include arylcarbonyl groups such as benzoyl, α-naphthoyl, and β-naphthoyl groups; halogenoarylcarbonyl groups such as 2-bromobenzoyl and 4-chlorobenzoyl groups; lower alkylated arylcarbonyl groups such as 2,4,6-trimethylbenzoyl and 4-toluoyl groups; lower alkoxylated arylcarbonyl groups such as 4-anisoyl groups; carboxylated arylcarbonyl groups such as 2-carboxybenzoyl, 3-carboxybenzoyl, and 4-carboxybenzoyl groups; nitrated arylcarbonyl groups such as 4-nitrobenzoyl and 2-nitrobenzoyl groups; lower alkoxycarbonylated arylcarbonyl groups such as 2-(methoxycarbonyl)benzoyl groups; and arylated arylcarbonyl groups such as 4-phenylbenzoyl groups.Preferred are a formyl group, an acetyl group, a propionyl group, a butyryl group, an isobutyryl group, a pentanoyl group, a pivaloyl group, and a benzoyl group.

[0047] In the present specification, examples of the term "silyl group" include tri-lower alkylsilyl groups such as trimethylsilyl group, triethylsilyl group, isopropyldimethylsilyl group, t-butyldimethylsilyl group, methyldiisopropylsilyl group, methyldi-t-butylsilyl group, and triisopropylsilyl group; and tri-lower alkylsilyl groups substituted with one or two aryl groups such as diphenylmethylsilyl group, butyldiphenylbutylsilyl group, diphenylisopropylsilyl group, and phenyldiisopropylsilyl group. Preferred are trimethylsilyl group, triethylsilyl group, triisopropylsilyl group, t-butyldimethylsilyl group, and t-butyldiphenylsilyl group, and more preferred is trimethylsilyl group.

[0048] In the present specification, the term "halogen atom" includes, for example, a fluorine atom, a chlorine atom, a bromine atom, or an iodine atom. A fluorine atom or a chlorine atom is preferable.

[0049] In this specification, the "protecting group" in the terms "protecting group for amino group in nucleic acid synthesis", "protecting group for hydroxyl group in nucleic acid synthesis", "hydroxyl group protected by a protecting group in nucleic acid synthesis", "phosphate group protected by a protecting group in nucleic acid synthesis", and "mercapto group protected by a protecting group in nucleic acid synthesis" is not particularly limited as long as it can stably protect an amino group, a hydroxyl group, a phosphate group, or a mercapto group during nucleic acid synthesis. Specifically, it refers to a protecting group that is stable under acidic or neutral conditions and can be cleaved by a chemical method such as hydrogenolysis, hydrolysis, electrolysis, and photolysis. Examples of such protecting groups include lower alkyl groups, lower alkenyl groups, acyl groups, tetrahydropyranyl or tetrahydrothiopyranyl groups, tetrahydrofuranyl or tetrahydrothiofuranyl groups, silyl groups, lower alkoxymethyl groups, lower alkoxylated lower alkoxymethyl groups, halogeno lower alkoxymethyl groups, lower alkoxylated ethyl groups, halogenated ethyl groups, methyl groups substituted with 1 to 3 aryl groups, "methyl groups substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom or a cyano group", lower alkoxycarbonyl groups, "aryl groups substituted with a halogen atom, a lower alkoxy group or a nitro group", "lower alkoxycarbonyl groups substituted with a halogen atom or a tri-lower alkylsilyl group", alkenyloxycarbonyl groups, and "aralkyloxycarbonyl groups in which the aryl ring may be substituted with a lower alkoxy or nitro group".

[0050] More specifically, the tetrahydropyranyl group or tetrahydrothiopyranyl group includes tetrahydropyran-2-yl group, 3-bromotetrahydropyran-2-yl group, 4-methoxytetrahydropyran-4-yl group, tetrahydrothiopyran-4-yl group, 4-methoxytetrahydrothiopyran-4-yl group, etc. The tetrahydrofuranyl group or tetrahydrothiofuranyl group includes tetrahydrofuran-2-yl group and tetrahydrothiofuran-2-yl group. The lower alkoxymethyl group includes methoxymethyl group, 1,1-dimethyl-1-methoxymethyl group, ethoxymethyl group, propoxymethyl group, isopropoxymethyl group, butoxymethyl group, t-butoxymethyl group, etc. The lower alkoxylated lower alkoxymethyl group includes 2-methoxyethoxymethyl group, etc. The halogeno lower alkoxymethyl group includes 2,2,2-trichloroethoxymethyl group, bis(2-chloroethoxy)methyl group, etc. Examples of lower alkoxylated ethyl groups include 1-ethoxyethyl and 1-(isopropoxy)ethyl groups. Examples of halogenated ethyl groups include 2,2,2-trichloroethyl groups. Examples of methyl groups substituted with 1 to 3 aryl groups include benzyl, α-naphthylmethyl, β-naphthylmethyl, diphenylmethyl, triphenylmethyl, α-naphthyldiphenylmethyl, and 9-anthrylmethyl groups. Examples of the "methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl group, a lower alkoxy group, a halogen atom, or a cyano group" include 4-methylbenzyl group, 2,4,6-trimethylbenzyl group, 3,4,5-trimethylbenzyl group, 4-methoxybenzyl group, 4-methoxyphenyldiphenylmethyl group, 4,4'-dimethoxytriphenylmethyl group, 2-nitrobenzyl group, 4-nitrobenzyl group, 4-chlorobenzyl group, 4-bromobenzyl group, 4-cyanobenzyl group, etc. Examples of the lower alkoxycarbonyl group include a methoxycarbonyl group, an ethoxycarbonyl group, a t-butoxycarbonyl group, an isobutoxycarbonyl group, etc.Examples of "aryl groups substituted with halogen atoms, lower alkoxy groups, or nitro groups" include 4-chlorophenyl groups, 2-fluorophenyl groups, 4-methoxyphenyl groups, 4-nitrophenyl groups, and 2,4-dinitrophenyl groups. Examples of "lower alkoxycarbonyl groups substituted with halogen atoms or tri-lower alkylsilyl groups" include 2,2,2-trichloroethoxycarbonyl groups and 2-trimethylsilylethoxycarbonyl groups. Examples of alkenyloxycarbonyl groups include vinyloxycarbonyl groups and aryloxycarbonyl groups. Examples of "aralkyloxycarbonyl groups in which the aryl ring may be substituted with lower alkoxy or nitro groups" include benzyloxycarbonyl groups, 4-methoxybenzyloxycarbonyl groups, 3,4-dimethoxybenzyloxycarbonyl groups, 2-nitrobenzyloxycarbonyl groups, and 4-nitrobenzyloxycarbonyl groups.

[0051] In one embodiment, examples of the "protecting group for a hydroxyl group in nucleic acid synthesis" include an aliphatic acyl group, an aromatic acyl group, a methyl group substituted with 1 to 3 aryl groups, a "methyl group substituted with 1 to 3 aryl groups in which the aryl ring is substituted with a lower alkyl, lower alkoxy, halogen, or cyano group", and a silyl group. Alternatively, in one embodiment, examples of the "protecting group for hydroxyl groups in nucleic acid synthesis" include, for example, an acetyl group, a benzoyl group, a benzyl group, a p-methoxybenzoyl group, a dimethoxytrityl group, a monomethoxytrityl group, a tert-butyldiphenylsilyl group, a tert-butyldimethylsilyl (TBDMS) group, a [(triisopropylsilyl)oxy]methyl (TOM) group, a [(2-nitrobenzyl)oxy]methyl (NBOM) group, a bis(acetoxyethoxy)methyl ether (ACE) group, a tetrahydro-4-methoxy-2H-pyran-2-yl (Mthp) group, a 1-(2-cyanoethoxy)ethyl (CEE) group, a 2-cyanoethoxymethyl (CEM) group, a tert-butyldithiomethyl (DTM) group, a 2-(4-tolylsulfonyl)ethoxymethyl (TEM) group, and a 4-(N-dichloroacetyl-N-methylamino)benzyloxymethyl (4-MABOM) group.

[0052] In one embodiment, the protecting group of the "hydroxyl group protected by a protecting group in nucleic acid synthesis" includes, for example, an aliphatic acyl group, an aromatic acyl group, a "methyl group substituted with 1 to 3 aryl groups", an "aryl group substituted with a halogen atom, a lower alkoxy group, or a nitro group", a lower alkyl group, and a lower alkenyl group. Alternatively, in one embodiment, the protecting group of the "hydroxyl group protected by a protecting group in nucleic acid synthesis" includes, for example, a benzoyl group, a benzyl group, a 2-chlorophenyl group, a 4-chlorophenyl group, and a 2-propenyl group.

[0053] In one embodiment, the "protecting group for an amino group in nucleic acid synthesis" is, for example, an acyl group, preferably a benzoyl group.

[0054] In one embodiment, the "protecting group" of the "phosphate group protected by a protecting group in nucleic acid synthesis" includes, for example, a lower alkyl group, a lower alkyl group substituted with a cyano group, an aralkyl group, an "aralkyl group in which an aryl ring is substituted with a nitro group or a halogen atom," and an "aryl group substituted with a lower alkyl group, a halogen atom, or a nitro group." Alternatively, in one embodiment, the "protecting group" of the "phosphate group protected by a protecting group in nucleic acid synthesis" includes, for example, a 2-cyanoethyl group, a 2,2,2-trichloroethyl group, a benzyl group, a 2-chlorophenyl group, and a 4-chlorophenyl group.

[0055] In one embodiment, the "protecting group" in the "mercapto group protected by a protecting group in nucleic acid synthesis" includes, for example, an aliphatic acyl group and an aromatic acyl group, preferably a benzoyl group.

[0056] As used herein, -P(R 4 )R 5 [In the formula, R 4 and R 5each independently represents a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected by a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms] 4 OR 4a And R 5 NR 5a A group where R 4a is, for example, a cyanoalkoxy group having 1 to 6 carbon atoms, and R 5a is, for example, an alkyl group having 1 to 6 carbon atoms. The phosphoramidite group is preferably a group represented by the formula -P(OC 2 H 4 CN)(N(iPr) 2 ), or a group represented by the formula -P(OCH 3 )(N(iPr) 2 ) where iPr represents an isopropyl group.

[0057] As used herein, the terms "nucleoside" and "nucleoside analogue" refer to non-natural "nucleosides" in which a purine or pyrimidine base is bound to a sugar, as well as nucleosides in which a sugar is bound to an aromatic heterocycle and an aromatic hydrocarbon ring other than purine and pyrimidine that can be substituted for a purine or pyrimidine base.

[0058] As used herein, the terms "artificial oligonucleotide" and "oligonucleotide analog" refer to a non-natural derivative of an "oligonucleotide" in which, for example, 2 to 50 identical or different "nucleosides" or "nucleoside analogs" are linked by phosphodiester bonds. Suitable examples of such analogs include sugar derivatives in which the sugar moiety is modified; thioate derivatives in which the phosphodiester moiety is thioated; esters in which the terminal phosphate moiety is esterified; and amides in which the amino group on the purine base is amidated, and more suitable examples include sugar derivatives in which the sugar moiety is modified.

[0059] In this specification, the term "salt thereof" refers to the salt of the compound represented by formula (I) of the present invention. Examples of such salts include metal salts such as alkali metal salts (e.g., sodium salt, potassium salt, lithium salt), alkaline earth metal salts (e.g., calcium salt, magnesium salt), aluminum salt, iron salt, zinc salt, copper salt, nickel salt, cobalt salt, etc.; inorganic salts (e.g., ammonium salt), t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetrahydrofuran ... Examples of the salt include amine salts, such as organic salts like methylammonium salts and tris(hydroxymethyl)aminomethane salts; inorganic salts like hydrohalogen salts like hydrofluoride, hydrochloride, hydrobromide and hydroiodide, nitrates, perchlorates, sulfates and phosphates; organic salts like lower alkane sulfonates like methanesulfonate, trifluoromethanesulfonate and ethanesulfonate, arylsulfonates like benzenesulfonate and p-toluenesulfonate, acetates, malates, fumarates, succinates, citrates, tartrates, oxalates and maleates; and amino acid salts like glycine salts, lysine salts, arginine salts, ornithine salts, glutamate salts and aspartate salts.

[0060] In this specification, the term "pharmacologically acceptable salt thereof" refers to a salt of an oligonucleotide containing at least one nucleoside structure represented by formula (II) of the present invention. Such salts include, for example, metal salts such as alkali metal salts such as sodium salt, potassium salt, and lithium salt, alkaline earth metal salts such as calcium salt and magnesium salt, aluminum salt, iron salt, zinc salt, copper salt, nickel salt, and cobalt salt; inorganic salts such as ammonium salt, t-octylamine salt, dibenzylamine salt, morpholine salt, glucosamine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt, piperazine salt, tetrahydrofuran ... Examples of the salt include amine salts, such as organic salts like methylammonium salts and tris(hydroxymethyl)aminomethane salts; inorganic salts like hydrohalogen salts like hydrofluoride, hydrochloride, hydrobromide and hydroiodide, nitrates, perchlorates, sulfates and phosphates; organic salts like lower alkane sulfonates like methanesulfonate, trifluoromethanesulfonate and ethanesulfonate, arylsulfonates like benzenesulfonate and p-toluenesulfonate, acetates, malates, fumarates, succinates, citrates, tartrates, oxalates and maleates; and amino acid salts like glycine salts, lysine salts, arginine salts, ornithine salts, glutamate salts and aspartate salts.

[0061] The present invention will be described in detail below.

[0062] The 5'-modified nucleoside of the present invention is a compound represented by the following formula (I) or a salt thereof:

[0063] [ka]

[0064] (In formula (I), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 1 and R 2 each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R 9 )R 10 [In the formula, R 9 and R 10 each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R 3 and R 4 each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 5 and R6 is a hydrogen atom, or R 5 and R 6 together form a single bond, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -represents a divalent group represented by the formula:

[0065] In the above formula (I), "Base" is, for example, a purine base (i.e., a purine-9-yl group) or a pyrimidine base (i.e., a 2-oxo-1,2-dihydropyrimidin-1-yl group). These bases may have one or more optional substituents selected from the α group consisting of a hydroxyl group, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, and a halogen atom.

[0066] Specific examples of the above-mentioned "Base" include an adenyl group, a guanyl group, a cytosinyl group, a uracinyl group, and a thyminyl group, as well as a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, Examples of such groups include 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl, and 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl groups.

[0067] Alternatively, from the viewpoint of introduction into nucleic acid medicines, "Base" has the following structural formula:

[0068] [ka]

[0069] As well as the groups represented by the following formulae, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl, 2-oxo-4-amino-1,2-dihydropyrimidin-1-yl, 6-aminopurin-9-yl, 2-amino-6-hydroxypurin-9-yl, 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl, and 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl are preferred. In addition, the "Base" is preferably one in which the hydroxyl and amino groups constituting the above group are protected by protective groups during the synthesis of oligonucleotides.

[0070] The 5'-modified nucleoside of the present invention has a five-membered ring structure, such as a cyclopentene structure or a cyclopentane structure, at the 5'-position of formula (I). Because of this structure, the nucleoside of the present invention cannot have a diastereomeric structure at the 5'-position, and is free from the need to separate diastereomers during synthesis, as compared with conventional artificial nucleic acids in which a substituent has been introduced at the 5'-position.

[0071] Here, in one embodiment, R 5 and R 6 In terms of the combination, examples of the above formula (I) include:

[0072] [ka]

[0073] (In formulas (Ia) and (Ib), Base, R 1 , R 2 , R 3 , R 4 , R 7 and R 8 is the same as defined in the above formula (I). Further specific examples of the above formula (I) include:

[0074] [ka]

[0075] (In formulas (Ia') and (Ib'), Base, R 1 , R 2 , R 7 and R 8 is the same as defined in the above formula (I). In this specification, the compound represented by the above formula (Ia') may be referred to as "5'-cp2 (modified nucleic acid)" and the compound represented by the above formula (Ib') may be referred to as "5'-cp3 (modified nucleic acid)".

[0076] Alternatively, in one embodiment, R in formula (I) above 7 and R 8 In terms of the combination, examples of the above formula (I) include:

[0077] [ka]

[0078] (In the formula, Base, R 1 , R 2 , R 3 , R 4 , R 5 and R 6 is as defined in the above formula (I).

[0079] Alternatively, in one embodiment, R in formula (I) above 5 , R 6 , R 7 and R 8 In terms of the combination, examples of the above formula (I) include:

[0080] [ka]

[0081] (In the formula, Base, R 1 , R 2 , R 3 , and R 4 is as defined in the above formula (I).

[0082] The 5'-modified nucleoside of the present invention has a specific 5-membered ring structure introduced at the 5'-position of formula (I) as described above, which improves the nuclease resistance of the oligonucleotide described below. In addition, the ring distortion in such a 5-membered ring structure is small, and the effect on the phosphate backbone is small. Therefore, the oligonucleotide equipped with the 5'-modified nucleoside of the present invention exhibits excellent double-strand formation ability with the target RNA.

[0083] In the present invention, oligonucleotides can be easily prepared using such 5'-modified nucleosides of formula (I) via, for example, the amidite method well known in the art, or via triphosphorylation as described in M. Kuwahara et al., Nucleic Acids Res., 2008, Vol. 36, No. 13, pp. 4257-4265.

[0084] The oligonucleotide of the present invention or a pharmacologically acceptable salt thereof (hereinafter, these may be collectively referred to as "the oligonucleotide of the present invention") has the following formula (II):

[0085] [ka]

[0086] (In formula (II), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R 3 and R 4each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R 5 and R 6 is a hydrogen atom, or R 5 and R 6 together form a single bond, R 7 is a hydrogen atom and R 8 is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR 11 [In the formula, R 11 is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R 7 and R 8 Let's get together -CH 2 O- or -OCH 2 -representing a divalent group represented by the formula (I).

[0087] Here, in one embodiment, the above R 6 and R 7 In view of the above combination, examples of nucleoside structures of formula (II) contained in the oligonucleotides of the present invention include:

[0088] [ka]

[0089] (In formula (IIa) and (IIb), Base, R 3 , R 4 , R 7 and R 8 is the same as defined in the above formula (I). Further specific examples of the nucleoside structure of the above formula (II) contained in the oligonucleotide of the present invention include:

[0090] [ka]

[0091] (In formula (IIa') and (IIb'), Base, R 7 and R 8 is as defined in the above formula (I).

[0092] Alternatively, in one embodiment, R in formula (II) above 7 and R 8 In view of the above combination, examples of nucleoside structures of formula (II) contained in the oligonucleotides of the present invention include:

[0093] [ka]

[0094] (In the formula, Base, R 3 , R 4 , R 5 and R 6 is as defined in the above formula (I).

[0095] Alternatively, in one embodiment, R in formula (II) above 5 , R 6 , R 7 and R 8 In view of the above combination, examples of nucleoside structures of formula (II) contained in the oligonucleotides of the present invention include:

[0096] [ka]

[0097] (In the formula, Base, R 3 , and R 4 is as defined in the above formula (I).

[0098] The oligonucleotide of the present invention has at least one of the above nucleoside structures at any position. The position and number of the nucleoside structures are not particularly limited and can be appropriately designed depending on the purpose.

[0099] The oligonucleotides (antisense molecules) containing such nucleoside structures have a significantly improved nuclease resistance compared to the conventional 2',4'-BNA / LNA. They also have a suitable duplex formation ability with respect to the target RNA. Furthermore, the oligonucleotides can reduce liver toxicity without impairing the antisense activity.

[0100] For these reasons, the oligonucleotide of the present invention synthesized using the above 5'-modified nucleoside is expected to be useful as a pharmaceutical (antisense molecule) that inhibits or restores the function of a specific gene to treat a disease, including an antitumor agent and an antiviral agent. An example of a pharmaceutical that is expected to be useful in this way is a drug for treating muscular dystrophy.

[0101] In particular, the antisense method requires both binding affinity (duplex forming ability) to complementary sense strand RNA and resistance to endogenous nucleic acid degrading enzymes (nucleases). In particular, imparting nuclease resistance is essential for the pharmaceutical application of nucleic acid molecules. The 5'-modified nucleic acid of the present invention has nuclease resistance equivalent to or greater than that of phosphorothioate-modified nucleic acids, which are currently widely used in the development of nucleic acid medicines, and is expected to be used as an alternative to the phosphorothioate-modified nucleic acids, which have been shown to be associated with hepatotoxicity.

[0102] The oligonucleotide of the present invention can be mixed with auxiliary agents commonly used in the pharmaceutical formulation technical field, such as excipients, binders, preservatives, oxidation stabilizers, disintegrants, lubricants, flavoring agents, etc., to prepare parenteral preparations or liposome preparations. Also, for example, it can be mixed with pharmaceutical carriers commonly used in the technical field to prepare topical preparations such as liquids, creams, ointments, etc. EXAMPLES

[0103] The present invention will be described in more detail below with reference to examples, but the present invention is not limited to these examples.

[0104] (Example 1: Synthesis of 5'-modified nucleosides (1))

[0105] [ka]

[0106] (1-1) Synthesis of Compound 2

[0107] [ka]

[0108] Cerium chloride (III) (1287 mg, 5.22 mmol) was added to compound 1 (500 mg, 1.30 mmol) prepared by the method described in Patent Document 4 (International Publication No. 2020 / 158910), and after azeotropic distillation with toluene, anhydrous tetrahydrofuran (13 mL) was added to form a suspension, and 1.0 M allylmagnesium bromide-diethyl ether solution (5.2 mL, 5.2 mmol) was added dropwise at room temperature under a nitrogen stream. After the dropwise addition, the mixture was stirred for another 1 hour. After the reaction was completed, a saturated aqueous ammonium chloride solution was added, and the mixture was filtered through Celite, and the filtrate was extracted with ethyl acetate. The organic layer was washed with water and saturated saline, then dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified using a 2:1 mixture of hexane and ethyl acetate to give compound 2 (463 mg, 82%) as a yellow solid. The physical property data of compound 2 thus obtained are shown in Table 1.

[0109] [Table 1]

[0110] (1-2) Synthesis of Compound 3

[0111] [ka]

[0112] Under a nitrogen stream, the second generation Grubbs catalyst (71.6 mg, 0.0840 mmol) was added to a deoxygenated dichloromethane solution (56 mL) of the compound 2 obtained above (736 mg, 1.69 mmol). After stirring at 40°C for 3 hours, the dichloromethane was distilled off under reduced pressure, and the resulting crude product was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified with a hexane:ethyl acetate=3:2 mixture to give compound 3 (660 mg, 96%) as a white solid. The physical property data of the obtained compound 3 are shown in Table 2.

[0113] [Table 2]

[0114] (1-3) Synthesis of Compound 4

[0115] [ka]

[0116] Palladium hydroxide-activated carbon (Pd20%) (100 mg, 50 wt%) was added to a solution (4.9 mL) of compound 3 (200 mg, 0.488 mmol) obtained above in ethyl acetate. The atmosphere in the flask was replaced with hydrogen, and the reaction solution was stirred at room temperature for 0.5 hours. After completion of the reaction, the reaction solution was filtered, and the ethyl acetate was distilled off under reduced pressure. The obtained residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified with a hexane:ethyl acetate=3:2 mixture to give compound 4 (166 mg, 83%) as a white solid. The physical property data of the obtained compound 4 are shown in Table 3.

[0117] [Table 3]

[0118] (1-4) Synthesis of Compound 5

[0119] [ka]

[0120] Silver trifluoromethanesulfonate (2060 mg, 8.02 mmol) was added to anhydrous dichloromethane solution (13 mL) of trityl chloride (2242 mg, 8.04 mmol) and mixed. The orange suspension was stirred at room temperature for 3 hours, and silver chloride was precipitated. The supernatant trityl triflate solution (6 mL) was added to anhydrous 2,6-lutidine solution (6 mL) of compound 4 (488 mg, 1.19 mmol) obtained above at 0°C. After stirring at 80°C for 39 hours, a saturated aqueous solution of sodium bicarbonate was added to the reaction solution. A saturated aqueous solution of copper sulfate was further added to emulsify the lutidine, and the mixture was filtered through Celite using ethyl acetate. The solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified using a hexane:ethyl acetate=7:3 mixture containing 0.5% triethylamine to give compound 5 (523 mg, 67%) as a yellow solid. The physical property data of the obtained compound 5 are shown in Table 4.

[0121] [Table 4]

[0122] (1-5) Synthesis of Compound 6

[0123] [ka]

[0124] To a solution (3.8 mL) of compound 5 (225 mg, 0.345 mmol) obtained above in tetrahydrofuran, 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (345 μL, 0.345 mmol) was added, and the mixture was stirred at room temperature for 39 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO2 The mixture was purified with a 30:1 mixture of chloroform:methanol (containing 0.5% triethylamine) and hexane:ethyl acetate (containing 1:1 hexane:ethyl acetate) to give compound 6 (161 mg, 87%) as a white solid. The physical property data of compound 6 obtained are shown in Table 5.

[0125] [Table 5]

[0126] (1-6) Synthesis of Compound 7 (Amidite Block 7)

[0127] [ka]

[0128] Under a nitrogen stream, N,N-diisopropylethylamine (400 μL, 2.30 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (245 μL, 1.10 mmol) were added successively to a solution (7.4 mL) of compound 6 (397 mg, 0.737 mmol) obtained above in anhydrous acetonitrile at 0° C., and the mixture was stirred at room temperature for 2.5 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The residue was purified using a hexane / ethyl acetate (containing 0.5% triethylamine, hexane:ethyl acetate = 3:2). Compound 7 (344 mg, 63%, diastereomeric ratio 3:2) was obtained as a white solid by further reprecipitation (toluene / hexane). The physical property data of the obtained compound 7 are shown in Table 6.

[0129] [Table 6]

[0130] (Example 2: Synthesis of 5'-modified nucleosides (2))

[0131] [ka]

[0132] (2-1) Synthesis of Compound 8

[0133] [ka]

[0134] Under a nitrogen stream, chlorotriethylsilane (320 μL, 2.48 mmol) was added to a pyridine solution (6.2 mL) of compound 6 (333 mg, 0.618 mmol) obtained above, and the mixture was stirred at room temperature for 1 hour. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate was added, the mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 The mixture was purified with hexane:ethyl acetate=3:1 (containing 0.5% triethylamine) to give compound 8 (332 mg, 82%) as a white solid. The physical property data of the obtained compound 8 are shown in Table 7.

[0135] [Table 7]

[0136] (2-2) Synthesis of Compound 9

[0137] [ka]

[0138] Under a nitrogen stream, triethylamine (160 μL, 1.15 mmol), 1,2,4-triazole (79 mg, 1.15 mmol), and phosphoryl chloride (21 μL, 0.230 mmol) were added in sequence to anhydrous dichloromethane solution (760 μL) of compound 8 (50 mg, 0.0766 mmol) obtained above at 0° C., and the mixture was stirred for 2.5 hours. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate was added, the mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. Next, 1,2-dioxane (760 μL) and 28% aqueous ammonia (95 μL, 1.53 mmol) were added, and the mixture was stirred at room temperature for 2.5 hours. After the reaction was completed, the reaction solution was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified using a 50:1 mixture of chloroform and methanol (containing 0.5% triethylamine) to give compound 9 (46.4 mg, 93%) as a white solid. The physical property data of the obtained compound 9 are shown in Table 8.

[0139] [Table 8]

[0140] (2-3) Synthesis of Compound 10

[0141] [ka]

[0142] Under a nitrogen stream, anhydrous benzoyl (176 mg, 0.778 mmol) was added to a pyridine solution (5.1 mL) of compound 9 (331 mg, 0.508 mmol) obtained above, and the mixture was stirred at room temperature for 14 hours. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate was added, the mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2The resulting mixture was purified using a hexane:ethyl acetate=11:1 mixture containing 0.5% triethylamine to give compound 10 (373 mg, 97%) as a white solid. The physical property data of the obtained compound 10 are shown in Table 9.

[0143] [Table 9]

[0144] (2-4) Synthesis of Compound 11

[0145] [ka]

[0146] To a solution (2.4 mL) of compound 10 (157 mg, 0.208 mmol) obtained above in tetrahydrofuran, 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (208 μL, 0.208 mmol) was added, and the mixture was stirred at room temperature for 1 hour. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified with hexane:ethyl acetate=3:1 (containing 0.5% triethylamine) to give compound 11 (105 mg, 79%) as a white solid. The physical property data of the obtained compound 11 are shown in Table 10.

[0147] [Table 10]

[0148] (2-5) Synthesis of compound 12 (amidite block 12)

[0149] [ka]

[0150] Under a nitrogen stream, N,N-diisopropylethylamine (86 μL, 0.741 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (82 μL, 0.378 mmol) were added successively to a solution (1.6 mL) of compound 11 (105 mg, 0.164 mmol) obtained above in anhydrous dichloromethane at 0° C., and the mixture was stirred at room temperature for 5.5 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The mixture was purified with hexane:ethyl acetate=3:1 (containing 0.5% triethylamine) to obtain compound 12 (115 mg, 83%, diastereomeric ratio 1:1) as a white solid. The physical property data of the obtained compound 12 are shown in Table 11.

[0151] [Table 11]

[0152] (Example 3: Synthesis of 5'-modified nucleosides (3))

[0153] [ka]

[0154] (3-1) Synthesis of Compound 13

[0155] [ka]

[0156] Silver trifluoromethanesulfonate (1152 mg, 4.48 mmol) was added to anhydrous dichloromethane solution (7.3 mL) of trityl chloride (1254 mg, 4.50 mmol) and mixed. The orange suspension was stirred at room temperature for 1.5 hours, and silver chloride was precipitated. The supernatant trityl triflate solution (3.6 mL) was added to anhydrous 2,6-lutidine solution (3.6 mL) of compound 3 (300 mg, 0.734 mmol) obtained above at 0°C. After stirring at 80°C for 22.5 hours, a saturated aqueous solution of sodium bicarbonate was added to the reaction solution. A saturated aqueous solution of copper sulfate was further added to emulsify lutidine, and the mixture was filtered through Celite using ethyl acetate. The solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The mixture was purified with hexane:ethyl acetate=5:1→7:3 (containing 0.5% triethylamine) to obtain compound 13 (382 mg, 80%) as a yellow solid. The physical property data of the obtained compound 13 are shown in Table 12.

[0157] [Table 12]

[0158] (3-2) Synthesis of compound 14

[0159] [ka]

[0160] To a solution (5.5 mL) of compound 13 (218 mg, 0.335 mmol) obtained above in tetrahydrofuran, 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (335 μL, 0.335 mmol) was added, and the mixture was stirred at room temperature for 19 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The mixture was purified with 0.5% triethylamine-containing chloroform:methanol=15:1) to obtain compound 14 (180 mg, quantitative) as a white solid. The physical property data of the obtained compound 14 are shown in Table 13.

[0161] [Table 13]

[0162] (3-3) Synthesis of compound 15 (amidite block 15)

[0163] [ka]

[0164] Under a nitrogen stream, N,N-diisopropylethylamine (290 μL, 1.66 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (190 μL, 0.852 mmol) were added successively to a solution (5.6 mL) of compound 14 (300 mg, 0.559 mmol) obtained above in anhydrous acetonitrile at 0° C., and the mixture was stirred at room temperature for 1.25 hours. After completion of the reaction, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (SiO 2 The residue was purified using a 2:1 aqueous hexane / ethyl acetate solution (containing 0.5% triethylamine). Compound 15 (306 mg, 76%, diastereomeric ratio 1:1) was obtained as a white solid by reprecipitation (toluene / hexane). The physical property data of the obtained compound 15 are shown in Table 14.

[0165] [Table 14]

[0166] (Example 4: Synthesis of 5'-modified nucleosides (4))

[0167] [ka]

[0168] (4-1) Synthesis of Compound 16

[0169] [ka]

[0170] Under a nitrogen atmosphere, a solution of compound 5 (750.7 mg, 1.15 mmol) obtained above in anhydrous toluene (11 mL) was added with N 2 After adding N,O-isobutyrylguanine (381 mg, 1.73 mmol) and N,O-bistrimethylsilylacetamide (2.0 mL, 8.05 mmol), trimethylsilyl trifluoromethaneate (21 μL, 0.115 mmol) was added at 0°C, and the mixture was stirred at 80°C for 2 hours. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate was added, and insoluble matters were removed by filtration through Celite. The mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified with chloroform:methanol=300:1 (containing 0.5% triethylamine) to give compound 16 (332 mg, 39%) as a white solid. The physical property data of the obtained compound 16 are shown in Table 15.

[0171] [Table 15]

[0172] (4-2) Synthesis of compound 17

[0173] [ka]

[0174] A 1.0M tetrabutylammonium fluoride-tetrahydrofuran solution (609μL, 0.609mmol) was added to a tetrahydrofuran solution (7.0mL) of compound 16 (456mg, 0.609mmol) obtained above, and the mixture was stirred at 50℃ for 6.5 hours. After the reaction was completed, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (Diol Silica, containing 1.0% triethylamine, chloroform:methanol=200:1) to obtain compound 17 (367.3mg, 95%) as a white solid. The physical property data of the obtained compound 17 are shown in Table 16.

[0175] [Table 16]

[0176] (4-3) Synthesis of compound 18 (amidite block 18)

[0177] [ka]

[0178] Under a nitrogen stream, N,N-diisopropylethylamine (42μL, 0.238mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (27μL, 0.119mmol) were added successively to anhydrous dichloromethane solution (794μL) of compound 17 (50.3mg, 0.0794mmol) obtained above at 0℃, and the mixture was stirred at room temperature for 5 hours. After the reaction was completed, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (Diol Silica, containing 1.0% triethylamine, hexane:ethyl acetate=1:1). Furthermore, compound 18 (34.4mg, 52%, diastereomeric ratio 1:1) was obtained as a white solid by reprecipitation (chloroform / ethyl acetate). The physical property data of the obtained compound 18 are shown in Table 17.

[0179] [Table 17]

[0180] (Example 5: Synthesis of 5'-modified nucleosides (5))

[0181] [ka]

[0182] (5-1) Synthesis of Compound 19

[0183] [ka]

[0184] Under a nitrogen stream, a solution of compound 5 (912.4 mg, 1.40 mmol) obtained above in anhydrous toluene (14 mL) was added to 6 After adding N,O-benzoyladenine (501 mg, 2.10 mmol) and N,O-bistrimethylsilylacetamide (2.1 mL, 8.38 mmol), trimethylsilyl trifluoromethaneate (25 μL, 0.140 mmol) was added at 0°C, and the mixture was stirred at 80°C for 1.5 hours. After the reaction was completed, a saturated aqueous solution of sodium bicarbonate was added, and insoluble matters were removed by filtration through Celite. The mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (SiO 2 The resulting mixture was purified using a solvent containing 0.5% triethylamine (chloroform) to give compound 19 (303 mg, 28%) as a white solid. The physical property data of the obtained compound 19 are shown in Table 18.

[0185] [Table 18]

[0186] (5-2) Synthesis of compound 20

[0187] [ka]

[0188] A 1.0 M tetrabutylammonium fluoride-tetrahydrofuran solution (199 μL, 0.199 mmol) was added to a tetrahydrofuran solution (2.3 mL) of compound 19 (153 mg, 0.199 mmol) obtained above, and the mixture was stirred at 50° C. for 3.5 hours. After the reaction was completed, the solvent was distilled off under reduced pressure, and the resulting residue was purified by silica gel column chromatography (Diol Silica, containing 1.0% triethylamine, hexane:ethyl acetate=1:1→chloroform) to obtain compound 20 (130 mg, quantitative) as a white solid. The physical property data of the obtained compound 20 are shown in Table 19.

[0189] [Table 19]

[0190] (5-3) Synthesis of compound 21 (amidite block 21)

[0191] [ka]

[0192] Under a nitrogen stream, N,N-diisopropylethylamine (41 μL, 0.233 mmol) and 2-cyanoethyl-N,N-diisopropylphosphorochloridate (26 μL, 0.117 mmol) were added successively to anhydrous dichloromethane solution (778 μL) of compound 20 (50.7 mg, 0.0778 mmol) obtained above at 0° C., and the mixture was stirred at room temperature for 5 hours. After the reaction was completed, water was added, the mixture was extracted with ethyl acetate, washed with water and saturated saline, dried over anhydrous sodium sulfate, and the solvent was distilled off under reduced pressure. The resulting residue was purified by silica gel column chromatography (Diol Silica, containing 1.0% triethylamine, hexane:ethyl acetate=3:2). Furthermore, compound 21 (34.0 mg, 51%, diastereomeric ratio 3:2) was obtained as a white solid by reprecipitation (ethyl acetate / hexane). The physical property data of the obtained compound 21 are shown in Table 20.

[0193] [Table 20]

[0194] Example 6: Synthesis and purification of oligonucleotides For the synthesis of the oligonucleotides used in the examples described later, the amidite blocks 7, 15, 18 and 21 obtained above were prepared as 0.1 M anhydrous dichloromethane solutions, and the synthesis was carried out under trityl-on conditions using an nS-8 Oligonucleotides Synthesizer (manufactured by Gene Design Co., Ltd.). Activator 42 (registered trademark) (0.25 M acetonitrile solution) was used as the activator, and the condensation time of the amidite blocks 7, 15, 18 and 21 and the amidite body introduced next was extended to 240 seconds x 4. The capping time was set to 200 seconds. In addition, the deblocking time was also extended to 150 seconds x 2. The other operations were performed according to the conventional phosphoramidite method known per se. After the synthesis was completed, the oligonucleotides were cut out from the column carrier by treating with 23% aqueous ammonia at room temperature for 4 hours, and then left to stand at 55 ° C for 5 hours or more for deprotection. Subsequently, the trityl group was removed using a simple reverse phase column (Waters Sep-Pak (registered trademark) Plus C18 Environmental Cartridges) for purification, and further purification was performed by reverse phase HPLC.

[0195] (Example 7) Composition confirmation and quantification An oligonucleotide solution (50 μM, 1 μL) was placed on the anchor chip on which the matrix (10 mg / mL 3-hydroxypicolinic acid solution: 1 mg / mL diammonium citrate solution = 1:1, 1 μL) had been dried, and the oligonucleotide composition was confirmed by MALDI-TOF MS. The molecular weight was measured in negative mode, and oligothymidylic acid (7mer, 9mer, 11mer, and 13mer) was used as an external standard. The oligonucleotide was quantified by measuring the ultraviolet absorption at 260 nm using an absorbance meter.

[0196] (Example 8) Melting temperature (T m ) Measurement A mixture of each oligonucleotide (final concentration 4 μM) and sodium chloride (final concentration 100 mM) in phosphate buffer (10 mM, pH 7.2, 130 μL) was placed in boiling water and slowly cooled to room temperature. Then, it was cooled to 5°C under a nitrogen stream and measurement was started. The temperature was raised to 90°C at 0.5°C / min, and the absorbance at 260 nm was plotted at 0.5°C intervals. m The value was calculated by the midline method and was the average value of three independent measurements. The results are shown in Table 21. In Table 21 (I), the sequence of ssRNA is 5'-r(AGCAAAAAACGC)-3' (SEQ ID NO: 19), and the upper right letters 1 to 3 respectively indicate 5'-cp, 2 indicates 5'-cp2, and 3 indicates 5'-cp3. In Table 21 (II), the sequence of ssRNA is 5'-r(AGCAAAGAACGC)-3' (SEQ ID NO: 26), and m C cp3 In Table 21 (III), the sequence of the ssRNA is 5'-r(AGCAAAUAACGC)-3' (SEQ ID NO: 27), and A cp3 In Table 21 (IV), the sequence of the ssRNA is 5'-r(AGCAAACAACGC)-3' (SEQ ID NO: 28), and G cp3 indicates 5′-cp3-guanine.

[0197] [Table 21]

[0198] As can be seen from Table 21, the T of the oligonucleotide carrying the conventional artificial nucleic acid represented by SEQ ID NO: 2 m The T of the oligonucleotides carrying the artificial nucleic acids of the present invention represented by SEQ ID NOs: 3 and 4 was compared with the T m The results show that the artificial nucleic acid having 5'-cp2 and 5'-cp3 of the present invention has a higher and more excellent ability to form a double strand with RNA than the artificial nucleic acid having the conventional 5'-cp.

[0199] (Example 9) Enzyme resistance evaluation 1.5μg / mL 3′-exonuclease (snake venom phosphodiesterase, svPDE) was added to 50mM Tris-HCl buffer (pH 8.0) containing 7.5μM oligonucleotide and 10mM magnesium chloride, and incubated at 37℃. 10μL of each sample was taken at 0, 2.5, 5.0, 10, 20, and 40 minutes, and the proportion of uncleaved oligonucleotide was calculated by analyzing it by reverse phase HPLC. Evaluation was performed by three independent measurements. The oligonucleotides used in this evaluation are shown in Table 22.

[0200] [Table 22]

[0201] This experiment demonstrated that oligonucleotides carrying the artificial nucleic acids of the present invention represented by sequence numbers 10 and 11 have higher stability against 3'-exonuclease than the phosphorothioate (PS)-modified oligonucleotide represented by sequence number 8, which is commonly used in nucleic acid drugs (Figure 1).

[0202] Example 10: Animal testing The test oligonucleotide (100 nmol) was administered to the tail vein of 6-week-old mice (C57BL / 6NCrl, male; purchased from Jackson Laboratory Japan, Inc.) (n=5). Physiological saline was administered as a control. After 96 hours, blood was collected under inhalation anesthesia (isoflurane) and the mice were euthanized by exsanguination. Then, each organ was collected, liver weight was measured, and RNA was extracted (RNeasy Mini Kit: QIAGEN). Aspartate transaminase (AST) and alanine transaminase (ALT) activities in the blood were measured using an automatic analyzer (Canon Medical Systems Corporation, TBA-2000FR). In addition, the mRNA expression levels of the target gene GR (NR3C1) and the housekeeping gene GAPDH were measured by real-time PCR (kit used: One Step PrimeScript RT-PCR Kit (Takara Bio Inc.), primer sequences: NR3C1 forward (actgtccagcatgccgctat) (sequence number 12), NR3C1 reverse (gcagtggcttgctgaattcc) (sequence number 13), GAPDH forward (gtgtgaacggatttggccgt) (sequence number 14), GAPDH reverse (gacaagcttcccattctcgg) (sequence number 15)).

[0203] [Table 23]

[0204] (Results of target gene suppression effect) This test demonstrated that the antisense effect of the oligonucleotides carrying the artificial nucleic acids of the present invention represented by SEQ ID NO: 17 and 18 was equal to or greater than that of the phosphorothioate (PS) modification commonly used in nucleic acid drugs represented by SEQ ID NO: 16, and that they could be an alternative to the commonly used PS modification (Figure 2). It was also demonstrated that they could exert a superior antisense effect in the liver, large intestine, and skeletal muscle compared to the commonly used PS modification (Figure 2).

[0205] (AST / ALT evaluation results) It was found that AST (U / L) and ALT (U / L), which are indicators of liver toxicity, were significantly reduced in the oligonucleotides carrying the artificial nucleic acids of the present invention represented by SEQ ID NO: 17 and 18, compared with the phosphorothioate (PS)-modified oligonucleotides commonly used in nucleic acid drugs represented by SEQ ID NO: 16 (Figure 3). From these results, it can be seen that the artificial nucleic acids of the present invention and the oligonucleotides carrying the artificial nucleic acids are capable of exerting the desired antisense effect while suppressing toxicity to the living body, compared with the phosphorothioate (PS)-modified oligonucleotides commonly used in pharmaceuticals. [Industrial Applicability]

[0206] Oligonucleotides obtained using the 5'-modified nucleosides of the present invention are useful, for example, as materials for nucleic acid medicines.

Claims

1. A compound represented by the following formula (I) or a salt thereof: 【Chemistry 1】 (In formula (I), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R １ and R ２ each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R ９ ) R １０ [In the formula, R ９ and R １０ each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R ３ and R ４ each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R ５ and R ６ is a hydrogen atom, or R ５ and R ６ together form a single bond, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ - represents a divalent group.

2. The formula (I) is the following formula (Ia): 【Chemistry 2】 (In formula (Ia), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R １ and R ２ each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R ９ ) R １０ [In the formula, R ９ and R １０ each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R ３ and R ４ each independently represents a hydrogen atom or an alkyl group having 1 or 2 carbon atoms, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ 2. The compound according to claim 1, wherein R is a 1- or 2-membered divalent group represented by R 1 -R 2 .

3. The formula (I) is the following formula (Ib): 【Chemistry 3】 (In formula (Ib), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R １ and R ２ each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R ９ ) R １０ [In the formula, R ９ and R １０ each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R ３ and R ４ each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ - represents a divalent group. The compound according to claim 1 , or a salt thereof,

4. In the formula (I), the Base is a 6-aminopurin-9-yl group, a 2,6-diaminopurin-9-yl group, a 2-amino-6-chloropurin-9-yl group, a 2-amino-6-fluoropurin-9-yl group, a 2-amino-6-bromopurin-9-yl group, a 2-amino-6-hydroxypurin-9-yl group, a 6-amino-2-methoxypurin-9-yl group, a 6-amino-2-chloropurin-9-yl group, a 6-amino-2-fluoropurin-9-yl group, a 2,6-dimethoxypurin-9-yl group, a 2,6-dichloropurin-9-yl group, a 6-mercaptopurin-9-yl group, a 2-oxo-4-amino-1,2-dihydropyrimidine-1 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-fluoro-1,2-dihydropyrimidin-1-yl group, 4-amino-2-oxo-5-chloro-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-methoxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-mercapto-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-1,2-dihydropyrimidin-1-yl group, 2-oxo-4-hydroxy-5-methyl-1,2-dihydropyrimidin-1-yl group, or 4-amino-5-methyl-2-oxo-1,2-dihydropyrimidin-1-yl group.

5. In the formula (I), the Base is represented by the following formula: 【Chemistry 4】 The compound according to claim 1 or a salt thereof, wherein

6. An oligonucleotide containing at least one nucleoside structure represented by the following formula (II) or a pharmacologically acceptable salt thereof: 【Chemistry 5】 (In formula (II), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R ３ and R ４ each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R ５ and R ６ is a hydrogen atom, or R ５ and R ６ together form a single bond, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ - represents a divalent group.

7. The formula (II) is the following formula (IIa): 【Chemistry 6】 (In formula (IIa), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R ３ and R ４ each independently represents a hydrogen atom or an alkyl group having 1 or 2 carbon atoms, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ 7. The oligonucleotide according to claim 6, or a pharmacologically acceptable salt thereof, wherein R is an integer from 1 to 6;

8. The formula (II) is the following formula (IIb): 【Chemistry 7】 (In formula (IIb), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R ３ and R ４ each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ 7. The oligonucleotide according to claim 6, or a pharmacologically acceptable salt thereof, wherein R is an integer from 1 to 6;

9. A method for producing the oligonucleotide or a pharmacologically acceptable salt thereof according to claim 6, comprising the steps of: A compound represented by the following formula (I) or a salt thereof: 【Chemistry 8】 (In formula (I), Base represents a purine-9-yl group or a 2-oxo-1,2-dihydropyrimidin-1-yl group which may have one or more optional substituents selected from group α, wherein group α consists of a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a linear alkyl group having 1 to 6 carbon atoms, a linear alkoxy group having 1 to 6 carbon atoms, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, a linear alkylthio group having 1 to 6 carbon atoms, an amino group, a linear alkylamino group having 1 to 6 carbon atoms, an amino group protected with a protecting group for nucleic acid synthesis, and a halogen atom; R １ and R ２ each independently represents a hydrogen atom, a protecting group for a hydroxyl group in nucleic acid synthesis, an alkyl group having 1 to 7 carbon atoms which may form a branched or cyclic ring, an alkenyl group having 2 to 7 carbon atoms which may form a branched or cyclic ring, an aryl group having 3 to 10 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an aralkyl group having an aryl portion having 3 to 12 carbon atoms which may have one or more optional substituents selected from the α group and which may contain a heteroatom, an acyl group which may have one or more optional substituents selected from the α group, a silyl group which may have one or more optional substituents selected from the α group, a phosphate group which may have one or more optional substituents selected from the α group, a phosphate group protected by a protecting group in nucleic acid synthesis, -P(R ９ ) R １０ [In the formula, R ９ and R １０ each independently represents a hydroxyl group, a hydroxyl group protected with a protecting group for nucleic acid synthesis, a mercapto group, a mercapto group protected with a protecting group for nucleic acid synthesis, an amino group, an alkoxy group having 1 to 6 carbon atoms, an alkylthio group having 1 to 6 carbon atoms, a cyanoalkoxy group having 1 to 6 carbon atoms, or a dialkylamino group having an alkyl group having 1 to 6 carbon atoms; R ３ and R ４ each independently represents a hydrogen atom, a hydroxyl group, a hydroxyl group protected by a protecting group for nucleic acid synthesis, an amino group, an amino group protected by a protecting group for nucleic acid synthesis, or an alkyl group having 1 or 2 carbon atoms, R ５ and R ６ is a hydrogen atom, or R ５ and R ６ together form a single bond, R ７ is a hydrogen atom and R ８ is a hydrogen atom, a halogen atom; a linear alkoxy group having 1 to 6 carbon atoms which may be substituted with a linear alkoxy group having 1 to 6 carbon atoms; or -OR １１ [In the formula, R １１ is a hydrogen atom or a protecting group for a hydroxyl group in nucleic acid synthesis, or R ７ and R ８ Let's get together -CH ２ O- or -OCH ２ represents a divalent group represented by - The method of claim 1, further comprising synthesizing an oligonucleotide using

Images