A composite protein monomer carrying a nonstructural protein of a virus, an aggregate of said monomers, and a component vaccine containing said aggregate as an active ingredient

Abstract

The present invention addresses the problem of establishing a means for providing a component vaccine that can elicit immunity to a non-structural protein. The present inventors found that this problem can be solved by providing a component vaccine that comprises, as an active ingredient, an aggregate comprising a trimer and / or a hexamer of a molecular needle on which a non-structural protein of a pathogenic virus is supported.

Description

[Technical field]

[0001] The present invention relates to a functional protein and a vaccine using the same. More specifically, the present invention relates to a composite protein (monomer) of a viral nonstructural protein, which is an immunogen, and a molecular needle, an aggregate of the monomer, and a component vaccine that uses the aggregate as an active ingredient (protective antigen). [Background technology]

[0002] There is provided a technology (Patent Document 1) regarding a "molecular needle" that was invented by focusing on the excellent function of bacteriophages in introducing genes into cells.

[0003] The present inventors have invented a composite polypeptide in which a structural protein of norovirus is carried on this molecular needle, and have provided it as a component vaccine against norovirus, and have filed a patent application for this invention (Patent Document 2). [Prior art documents] [Patent documents]

[0004] [Patent Document 1] JP 2015-163056 A [Patent Document 2] WO2018 / 074558 International Publication Pamphlet DISCLOSURE OF THEINVENTION [Problem to be solved by the invention]

[0005] Vaccines are broadly classified into "live vaccines," which use pathogenic microorganisms such as weakened viruses as protective antigens; "inactivated vaccines," which use the whole of a killed pathogenic microorganism as the protective antigen; "component vaccines," which use the proteins or glycans of a part (component) of a pathogenic microorganism as the protective antigen rather than the actual pathogenic microorganism itself; and "toxoid vaccines," which use toxins produced by denatured pathogens as the protective antigen.

[0006] The norovirus component vaccine described in Patent Document 2 is a vaccine in which a structural protein of norovirus is carried by a molecular needle, and immunity is acquired against the structural protein introduced into cells by the cell introduction function of the molecular needle.

[0007] However, the genes that code for viral structural proteins are highly likely to mutate, and many types of virus strains already exist. It is therefore necessary to anticipate the prevalent virus strains and prepare individual structural proteins that match them in vaccines.

[0008] On the other hand, component vaccines currently in practical use induce acquired immunity based on humoral immunity against the components of pathogens, that is, structures, and cannot induce acquired immunity against the group of microbial enzymes (nonstructural proteins) that pathogens produce when replicating themselves in the host body. In contrast, live vaccines are microorganisms that have been made not to express pathogenicity (attenuated), so they express nonstructural proteins that allow the microorganisms to replicate. Therefore, live vaccines can induce comprehensive acquired immunity (cellular immunity plus humoral immunity) in the recipient's body, targeting the replication mechanism of pathogens as well. On the other hand, live vaccines use live pathogenic viruses themselves, even if they are attenuated, so there are unique risks involved. For example, although extremely rare, there is a risk that attenuated pathogenic viruses will mutate and revert to highly virulent pathogenic viruses. In addition, even attenuated pathogenic viruses can cause toxicity in humans with weakened immune systems.

[0009] Therefore, in general, live vaccines should be administered with greater caution than component vaccines. [Means for solving the problem]

[0010] As a result of studies aimed at solving this problem, the present inventors have come up with the idea that by carrying a "nonstructural protein of a pathogenic virus" (hereinafter also simply referred to as "nonstructural protein") on the molecular needle and using the complex as an active ingredient of a component vaccine, it is possible to induce adaptive immunity targeting the replication mechanism of a microorganism even though it is a component vaccine. By using an assembly (trimer and / or hexamer) of the molecular needle carrying this nonstructural protein alone or in combination with the molecular needle carrying a structural protein as an active ingredient of a component vaccine, it is possible to exert a comprehensive immune effect (humoral immunity and cellular immunity) equivalent to that of a live vaccine while maintaining the safety of the component vaccine. Furthermore, nonstructural proteins are proteins involved in the functions of the pathogenic virus, such as proliferation in the host, and are unlikely to accept amino acid mutations in order to maintain their functions, and are subject to extremely low genetic mutations compared to structural proteins. Therefore, even if the virus strains are different within the same pathogenic virus species, there is a high possibility that they will have common immunogenicity, and it is possible to effectively acquire immunity even with pathogenic virus species in which the structural proteins have a high mutation frequency.

[0011] The subject matter provided by the present invention is (1) a "composite protein" (hereinafter also referred to as the complex protein of the present invention) in which a nonstructural protein that is an immunogen is supported on a molecular needle, (2) an aggregate formed by converting this into a monomer (hereinafter collectively referred to as the aggregate of the present invention), and (3) a "component vaccine" (hereinafter also referred to as the vaccine of the present invention) that contains the aggregate as an active ingredient (protective antigen).

[0012] A "component vaccine" is a component vaccine that requires an active ingredient (immunoprotective antigen), and excludes the above-mentioned live vaccines, inactivated vaccines, and toxoids. The active ingredient of the vaccine of the present invention contains the aggregate of the present invention (containing a trimer and / or hexamer) as a protective antigen.

[0013] (1) The conjugated protein of the present invention The complex protein of the present invention is a complex protein having an amino acid sequence of the following formula (1), and is a precursor molecule of the complex of the present invention. Note that the "-" connecting the predetermined amino acid sequences in the following formulas (1) and (2) represents W, L1, X, n , Y, etc., to clearly distinguish between conceptually grouped amino acid sequences.

[0014] W-L1-X n -Y (1) [In the formula, W represents an amino acid sequence containing one or more parts of a part or the whole of a nonstructural protein of a pathogenic virus that is an immunogen, L1 represents a first linker sequence having 0-100 amino acids, X represents the amino acid sequence of SEQ ID NO: 1, Y represents the amino acid sequence of a cell introduction domain, and the number of repetitions of X, n, is an integer of 1-3.] And, The amino acid sequence of the cell introduction region Y is represented by the following formula (2): Y1-L2-Y2-Y3(2) [In the formula, Y1 represents any one of the amino acid sequences selected from the group consisting of SEQ ID NOs: 2-5, Y2 represents any one of the amino acid sequences selected from the group consisting of SEQ ID NOs: 6-9, L2 represents a second linker sequence having 0-30 amino acids, Y3 represents an amino acid sequence for modification, and Y2 or Y3 may be absent.] Represented by a complex protein.

[0015] Above X n The number of repeats of the amino acid sequence X in the above formula (I) is preferably 1, but may be 2 or 3.

[0016] In the above formula (1), X n, Y1, or Y2, modified amino acid sequences in which one or more amino acids have been deleted, substituted, or added are included in the above formula (1). "Deletion" refers to a state in which any amino acid residue in the amino acid sequence of each SEQ ID NO: defined in the above formula (1) is deleted, and the amino acid residues on the N-terminal side (before) and C-terminal side (after) of the deleted amino acid residue are linked by a peptide bond (in the case of deletion of the N-terminal amino acid residue and the C-terminal amino acid residue, the amino acid residue is simply deleted), and the number of deleted residues is counted as the "number of amino acid deletions." "Substitution" refers to a state in which any amino acid residue in the amino acid sequence of each SEQ ID NO: defined in the above formula (1) is replaced with "another amino acid residue", and the replaced amino acid residue is linked to each amino acid residue on the N-terminus (front) and C-terminus (back) by a peptide bond (in the case of substitution of the N-terminus amino acid residue, only the peptide bond with the amino acid residue on the C-terminus, and in the case of substitution of the C-terminus amino acid residue, only the peptide bond with the amino acid residue on the N-terminus), and the number of the replaced residues is counted as the "number of amino acid substitutions". "Addition" refers to a state in which one or more new amino acid residues are inserted at one or more peptide bond positions in the amino acid sequence of each SEQ ID NO: defined in the above formula (1), forming new peptide bonds. The content and number of these modifications of amino acid residues can be clarified by aligning the amino acid sequence according to the above formula (1) with the amino acid sequence related to the modification manually or on a computer using software capable of analyzing amino acid sequences.

[0017] Furthermore, the linker sequence L1 or L2 defined in the above formula (1), or the modifying amino acid sequence Y3, can be selected from any sequence as necessary within the range of the number of amino acid residues defined above.

[0018] It is preferable that the trimer or hexamer of the modified composite protein of the modified amino acid sequence (described below) has substantially the same immunostimulatory activity as the trimer or hexamer of the composite protein of the above formula (1). "Substantially the same" means a degree of equivalence such that, when an established method for confirming immunostimulatory activity such as a "neutralization test" is used, no significant difference in immunostimulatory activity is observed at a significance level of 5% or less from that of the unmodified composite protein of the amino acid sequence.

[0019] In the above formula (1), X n In the amino acid sequences represented by Y1, Y2, or Y3, one or more amino acids are deleted, substituted, or added, and the number of amino acid modifications in each amino acid sequence is X n is 8n or less, preferably 4n or less, and more preferably 2n or less; Y1 is 30 or less, preferably 20 or less, and more preferably 10 or less; and Y2 is 15 or less, preferably 10 or less, and more preferably 5 or less.

[0020] W is an amino acid sequence containing one or more parts of the whole or part of a nonstructural protein of a pathogenic virus. Proteins encoded by the genes of a pathogenic virus are roughly divided into structural proteins and nonstructural proteins. Structural proteins are proteins that directly constitute the structure of the virus, and examples thereof include capsid proteins, envelope proteins, and core proteins. Nonstructural proteins are proteins encoded by the viral genes other than the structural proteins, and are mainly enzyme proteins involved in the survival and proliferation of the virus in the host, and are proteins expressed after the pathogenic virus invades the host. In "all or part of the nonstructural proteins," "all" means "all of the individual nonstructural proteins of a given virus." For example, in the case of the P protein of the RS virus shown in the examples, the entire amino acid sequence means the above-mentioned "all," and "part" means part of the amino acid sequence of the P protein. In addition, in the case of "part," the content is not limited as long as the antigenicity of the virus is recognized in "part of the individual nonstructural proteins of a given virus."

[0021] The pathogenic virus for which the nonstructural protein is selected as W is not particularly limited. It may be a DNA virus, an RNA virus, or a retrovirus. For example, the pathogenic virus may be not only poliovirus, measles virus, rubella virus, epidemic parotitis virus (mumps virus), chickenpox virus, yellow fever virus, rotavirus, varicella virus (herpes virus), influenza virus, norovirus, rabies virus, Japanese encephalitis virus, hepatitis virus (hepatitis A, hepatitis B, hepatitis C, etc.), human papillomavirus, HIV, Ebola virus, etc., but also includes respiratory syncytial virus (RSV), etc., for which no vaccine is currently available. One of the features of the vaccine of the present invention is that it can be an effective vaccine against infectious disease viruses for which no vaccine is currently available.

[0022] In addition, the types of animals that can be infected by pathogenic viruses are not particularly limited, and examples of animals other than humans that require vaccines include livestock such as cows, horses, sheep, pigs, goats, and chickens, and pets such as dogs and cats.

[0023] The nonstructural proteins to be specifically selected are individually and specifically selected depending on the type of virus of interest, and can be specified and selected from information on known viral nonstructural proteins, such as RNA polymerase, DNA polymerase, reverse transcriptase, protease, Vpg, NTPase, DNA-binding protein, RNA-binding protein, transcription factor, phosphorylation protein, L protein, N protein, etc. In addition, proteins whose functions have not yet been elucidated at present but which may function as nonstructural proteins in the future, and proteins that have the functions of both structural and nonstructural proteins are also included in nonstructural proteins.

[0024] For example, nonstructural proteins of RS virus include NS-1 protein, NS-2 protein, N protein, P protein, M2-1 protein, L protein, etc. The N protein, P protein, M2-1 protein, and L protein are bound to the genomic RNA inside the virus particle, and these function as RNP (a complex of RNA and other viral proteins, a ribonucleoprotein complex called a nucleocapsid). These nonstructural proteins that make up RNP are also contained within RS virus particles, but since they are a group of enzymes that transcribe viral messenger RNA and replicate the genome, they are synthesized in large quantities within cells after infection.

[0025] (2) The aggregate of the present invention The aggregate of the present invention is an aggregate in which the complex protein of the present invention is a monomer, and contains a trimer or hexamer of the complex protein, or contains a mixture of the trimer and hexamer. Hereinafter, the substance of the contents of the aggregate of the present invention may be collectively referred to as "trimer and / or hexamer". In other words, the aggregate of the present invention is an aggregate containing a trimer or hexamer in which the complex protein of the present invention is a monomer. Furthermore, in consideration of the production process of the aggregate of the present invention described below, the aggregate of the present invention can also be defined as an aggregate formed by associating the complex protein of the present invention in an aqueous liquid. Although the aggregate of the present invention may not be formed depending on the compatibility between the protein to be supported and the molecular needle, by contacting the target complex protein in an aqueous liquid and confirming the result by SDS-PAGE or the like, it is possible to easily determine whether the target complex protein forms a trimer or hexamer and can be used as an active ingredient of the vaccine of the present invention. The aggregate of the present invention thus formed can exert an action of penetrating into cells by itself.

[0026] The trimer is a trimeric protein formed from the same or different conjugated proteins of the present invention as monomer proteins, and the hexamer is a hexameric protein formed by association of two molecules of the trimeric protein.

[0027] (3) Vaccine of the Present Invention The vaccine of the present invention is a vaccine containing the aggregate of the present invention as an active ingredient (protective antigen), and is a component vaccine for subcutaneous, intradermal, transdermal, mucosal, or intramuscular administration against a predetermined pathogenic virus. Specifically, it is a component vaccine for subcutaneous, intradermal, transdermal, mucosal, or intramuscular administration, containing as an active ingredient the trimer and / or hexamer, in which W is one or more types of peptides or proteins containing one or more parts or all of the nonstructural proteins of a pathogenic virus. The trimer and / or hexamer used as the active ingredient can be one or more types carrying all or a part of a different nonstructural protein as W, as long as the pathogenic virus strain from which the nonstructural protein W is source is of the same genotype. In addition, two or more types of units of the active ingredients (W is a nonstructural protein) of pathogenic viruses of different genotypes can be combined.

[0028] Furthermore, as an active ingredient, together with the aggregate of the present invention, "an aggregate of molecular needles carrying a 'structural protein' (containing a trimer and / or a hexamer) (Patent Document 2) instead of the trimer and / or hexamer W (non-structural protein) of the present invention" can be used as an additional active ingredient. Furthermore, as this additional active ingredient, an aggregate of structural proteins of pathogenic viruses of different genotypes as W can be combined and added as an active ingredient. Furthermore, the structural protein portion may contain a region to which a neutralizing antibody that eliminates the infectivity of the virus binds, and it is also possible to combine an aggregate in which one or more peptide sequences containing the epitope or its vicinity are W.

[0029] When the types of the above-mentioned aggregates used as active ingredients are diverse, the acquired immunity becomes similar to that of a live vaccine, and when antigenic proteins derived from different pathogenic microorganisms are used, it becomes similar to a mixed vaccine.

[0030] In order to further enhance immunogenicity, it is possible to include an adjuvant in the vaccine of the present invention, for example, as a molecular needle carrying the B subunit of cholera toxin as the above-mentioned W. However, it is preferable that the vaccine of the present invention is able to be made adjuvant-free by excluding the adjuvant, and this is prioritized as an advantage of the vaccine of the present invention.

[0031] When the above-mentioned multiple types of trimer and / or hexamer molecular needles are used, the mixing ratio in the vaccine of the present invention can be selected according to the vaccine design and is not particularly limited.

[0032] (4) Method for Producing the Aggregate of the Present Invention The aggregate of the present invention can be produced by contacting three or more molecules of the complex protein of the present invention via an aqueous liquid, causing the complex proteins to associate with each other as monomers to form a mixture of trimers and hexamers, and then selectively separating and collecting the trimers or hexamers as necessary.

[0033] The complex protein of the present invention itself can be produced by expressing a nucleic acid encoding the complex protein by genetic engineering techniques or by synthesizing the same by peptide synthesis techniques. By contacting the complex proteins with each other in an aqueous liquid, the complex protein trimers and hexamers are spontaneously constructed, and a mixture containing the trimers and hexamers is formed. The trimers or hexamers can then be selectively separated and collected, allowing the trimers and hexamers to be produced separately.

[0034] With regard to "aqueous liquid", particularly when the complex protein of the present invention is produced by genetic engineering techniques, the complex protein is biologically expressed, and spontaneous association occurs in aqueous liquids such as water and various buffer solutions used in the process of exposing the complex protein by, for example, collecting, disrupting or dissolving the expressing cells, and further separating the complex protein by a known separation method, to obtain a mixture containing the trimer and hexamer, which are the aggregate of the present invention. In addition, the complex protein of the present invention produced by, for example, total chemical synthesis or by separate synthesis of parts and bonding by a chemical modification method can be suspended in aqueous liquids such as water and various buffer solutions to spontaneously associate, to obtain a mixture containing the trimer and hexamer, which are the aggregate of the present invention.

[0035] The method for separating and collecting the trimer or hexamer from the mixture containing the trimer and hexamer is not particularly limited, and examples thereof include known molecular weight fractionation methods, such as gel electrophoresis, affinity chromatography, molecular sieves such as molecular exclusion chromatography, and ion exchange chromatography.

[0036] Therefore, one of the most suitable embodiments of the above-mentioned method for producing the complex is "a method for producing a complex protein complex, which comprises culturing a transformant into which a nucleic acid encoding the complex protein of the present invention has been introduced in a liquid medium to express the complex protein, and obtaining a mixture containing trimers and hexamers in which the complex protein is a monomer produced by spontaneous assembly; and further comprising selectively separating and collecting the trimers or hexamers from the mixture."

[0037] The aggregate of the present invention thus produced can be used as an active ingredient of the vaccine of the present invention. Effect of the Invention

[0038] The present invention provides: (1) a composite protein (monomer) in which a molecular needle carries a viral nonstructural protein that is an immunogen, which can be used as a basic unit of an active ingredient (protective antigen) of a component vaccine that efficiently introduces an immunogenic viral nonstructural protein into cells of a target tissue by subcutaneous, intradermal, transdermal, mucosal, or intramuscular administration; (2) an aggregate of the composite protein that can be used as the active ingredient (protective antigen); and (3) a component vaccine that contains the aggregate as an active ingredient. [Brief description of the drawings]

[0039] [Figure 1] 1 is a diagram showing the process of constructing trimers and hexamers, which are assemblies of the present invention, based on the complex protein of the present invention. [Diagram 2] FIG. 1 shows the results of MALDI-TOF mass spectrometry for PN-sRL-VPg, where (a) shows the monomer signal, (b) shows the trimer signal, and (c) shows the hexamer (trimer-dimer) signal, and each shows a schematic diagram showing the association state of the complex protein (monomer) of the present invention. [Diagram 3] FIG. 1 shows the results of MALDI-TOF mass spectrometry for PN-sFL-VPg, where (a) shows the monomer signal, (b) shows the trimer signal, and (c) shows the hexamer (trimer-dimer) signal, and each shows a schematic diagram showing the association state of the complex protein (monomer) of the present invention. [Figure 4] This is a schematic diagram showing the genetic structure of RS virus. [Diagram 5] FIG. 1 shows the results of an investigation into the IgG induction effect of intranasal vaccination of a component vaccine used in Example 2, which contains as an active ingredient an aggregate of the complex protein of the present invention carrying the P protein, one of the nonstructural proteins of RS virus, 3 and 7 weeks after vaccination. [Figure 6]FIG. 1 shows the IgA induction effect of nasal vaccination of a component vaccine containing as an active ingredient an aggregate of the complex protein of the present invention carrying the P protein, one of the nonstructural proteins of RS virus, used in Example 2, 3 and 7 weeks after vaccination. [Figure 7] FIG. 1 shows the effect of suppressing respiratory syncytial virus pulmonary infection by nasal administration of a component vaccine containing as an active ingredient an aggregate of the complex protein of the present invention carrying the P protein, one of the nonstructural proteins of the respiratory syncytial virus, used in Example 2. [Figure 8] FIG. 1 is a schematic diagram of a plasmid expressing the conjugated protein of the present invention, which carries, as an immunogen, a quadruple-ligated peptide corresponding to a region (neutralizing epitope) of the F protein, one of the structural proteins of RS virus, to which a neutralizing antibody binds. [Figure 9] This figure shows the results of investigating the IgG and IgA induction effect 7 weeks after nasal vaccination with a vaccine containing as an active ingredient an aggregate of the complex protein of the present invention carrying a tetramer-linked form of the neutralizing epitope peptide of the above-mentioned F protein as an immunogen. [Figure 10] This figure examines the inhibitory effect of respiratory syncytial virus (RSV) pulmonary infection when a vaccine containing as an active ingredient an aggregate of the complex protein of the present invention carrying the tetramer-linked form of the neutralizing epitope peptide of the above-mentioned F protein as an immunogen is administered intranasally. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0040] (1) The conjugated protein of the present invention The amino acid sequence formula representing the conjugated protein of the present invention is given by Formula (1): W-L1-X n -Y (1) [In the formula, W represents an amino acid sequence containing one or more parts of a part or the whole of a nonstructural protein of a virus that is an immunogen, L1 represents a first linker sequence having 0-100 amino acids, X represents the amino acid sequence of SEQ ID NO: 1, Y represents the amino acid sequence of a cell introduction region, and n is an integer of 1-3.] In The immunogen W can have an amino acid sequence based on the peptide structure of a part or all of a viral nonstructural protein, as described above. Here, the term "based on" refers not only to the original peptide structure itself, but also to modified amino acid sequences obtained by modifying the amino acid sequence.

[0041] A part or the whole of the viral nonstructural proteins is as described above.

[0042] L1, which represents the first linker sequence, is necessary to maintain an appropriate distance between the immunogen W and the molecular needle portion Y to suppress steric hindrance, and the number of amino acid residues is 0 to 100 as described above, and preferably 4 to 40. The specific sequence is not limited, but for example, (GGGGS) m , (PAPAP) m [m is the number of repetitions, and is preferably an integer of 1 to 5, and particularly preferably 1 to 3]. However, these are merely examples.

[0043] X is the amino acid sequence X consisting of the amino acids of SEQ ID NO: 1 n The repeating unit is a sequence of n (integer) repeating units of X in the above. The repeating form is a tandem repeat. For example, if X2, it is "XX" ("-" is a modeled peptide bond). The repeating sequence X n In the above, the above-mentioned amino acid sequence modification is allowed. Here, n is an integer of 1 to 3 as described above, preferably 1, but may be 2 or 3. Repeat sequence X n When n is 2 or 3, the main objective is to stably maintain the distance of the molecular needle Y at an appropriate distance depending on the size and characteristics of the immunogen W.

[0044] The cell introduction region Y corresponds to the basic structure of a molecular needle, and is based on the needle part (cell introduction part) of the tail of a bacteriophage, and is represented by the formula (2): Y1-L2-Y2-Y3(2) [In the formula, Y1 represents an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-5, Y2 represents an amino acid sequence selected from the group consisting of SEQ ID NOs: 6-9, L2 represents a second linker sequence having 0-30 amino acids, Y3 represents an amino acid sequence for a predetermined modification, and Y2 or Y3 may be absent.] It is a protein represented by the formula:

[0045] Of Y1 in formula (2), up to 32 amino acids (32 Leu) on the N-terminus side is the amino acid sequence of the triple helix β-sheet structure of bacteriophage T4. At least the N-terminus amino acid valine (1 Val) may be leucine (1 Leu). The remaining C-terminus side is the amino acid sequence of the C-terminus part of the needle protein of the bacteriophage. Examples of amino acid sequences that can be used on the C-terminus side of this Y1 include the amino acid sequence of gp5 of bacteriophage T4, the amino acid sequence of gpV of bacteriophage P2, the amino acid sequence of gp45 of bacteriophage Mu, and the amino acid sequence of gp138 of bacteriophage φ92. More specifically, examples of Y1 having the amino acid sequence of gp5 of bacteriophage T4 at its C-terminus include the amino acid sequence of SEQ ID NO: 2, Y1 having the amino acid sequence of gpV of bacteriophage P2 at its C-terminus include the amino acid sequence of SEQ ID NO: 3, Y1 having the amino acid sequence of gp45 of bacteriophage Mu at its C-terminus include the amino acid sequence of SEQ ID NO: 4, and Y1 having the amino acid sequence of gp138 of bacteriophage φ92 at its C-terminus include the amino acid sequence of SEQ ID NO: 5. The nucleic acid sequence encoding this amino acid sequence of Y1 can be selected according to the known relationship between amino acids and nucleic acid bases.

[0046] In formula (2), Y2 is the amino acid sequence of the region called foldon of bacteriophage T4, or the amino acid sequence of the region called tip of bacteriophage P2, bacteriophage Mu, or bacteriophage φ92. The foldon or tip is a region that constitutes the tip of the molecular needle structure called fibritin of bacteriophage. Although it is not essential that Y2 exists in formula (2), it is preferable that Y2 is included, since the incorporation efficiency of the molecular needle into the cell membrane can be improved by having the amino acid sequence of this foldon or tip. The amino acid sequence of the foldon of bacteriophage T4 is shown in SEQ ID NO: 6. The nucleic acid sequence encoding this amino acid sequence can be selected according to the known relationship between amino acids and nucleic acid bases.

[0047] The amino acid sequence of the tip of bacteriophage P2 is shown in SEQ ID NO: 7. A nucleic acid sequence encoding this amino acid sequence can be selected according to the known relationships between amino acids and nucleic acid bases. The amino acid sequence of the tip of bacteriophage Mu is shown in SEQ ID NO: 8. A nucleic acid sequence encoding this amino acid sequence can be selected according to the known relationships between amino acids and nucleic acid bases. The amino acid sequence of the tip of bacteriophage φ92 is shown in SEQ ID NO: 9. A nucleic acid sequence encoding this amino acid sequence can be selected according to the known relationships between amino acids and nucleic acid bases.

[0048] L2 is a second linker interposed between Y1 and Y2. The number of amino acids in the linker L2 is 0 to 30, preferably 0 to 5. When the number of amino acids in the linker is 0, this indicates that the second linker L2 is not present.

[0049] Y3 is an amino acid sequence for modification, which can be selectively added to Y. The amino acid sequence for modification is added for the purpose of protein purification or protection, and examples of such sequence include tag peptides such as histidine tag, GST tag, and FLAG tag. A linker sequence can be appropriately added to Y3, and such a linker sequence itself can be a component of the amino acid sequence of Y3.

[0050] The conjugated protein of the present invention can be produced by known methods, specifically, genetic engineering techniques or chemical synthesis methods. It is also possible to produce the entire conjugated protein of the present invention together, or to produce it in parts and then bond the parts to each other later by chemical modification methods. Bonding of polypeptides via a linker (L1 or L2, etc.) is possible by bonding lysine or cysteine ​​residues in each polypeptide to each other via a linker having a succinimide group or maleimide group.

[0051] In genetic engineering techniques, nucleic acids encoding all or part of the conjugated protein of the present invention to be produced can be expressed in host cells such as E. coli, yeast, insect cells, animal cells, etc. as transformants, or in cell-free expression systems such as E. coli extract, rabbit reticulocyte extract, wheat germ extract, etc. Expression vectors incorporating these nucleic acids can be used according to each expression system, and examples of such vectors include pET for E. coli expression, pAUR for yeast expression, pIEx-1 for insect cell expression, pBApo-CMV for animal cell expression, and pF3A for wheat germ extract expression.

[0052] The chemical synthesis method may be a known method for chemically synthesizing peptides. That is, the whole or part of the conjugated protein of the present invention may be produced using a liquid-phase peptide synthesis method or a solid-phase peptide synthesis method, which are established as conventional methods. The solid-phase peptide synthesis method, which is generally recognized as a suitable chemical synthesis method, may be a Boc solid-phase method or an Fmoc solid-phase method, and as described above, a ligation method may be used as necessary. In addition, each amino acid may be produced by a known method, or a commercially available product may be used.

[0053] (2) The aggregate of the present invention Figure 1 shows the process of constructing the trimer and hexamer of the present invention, which are the assemblies of the present invention, based on the complex protein of the present invention. In Figure 1, 10 is the complex protein of the present invention as a monomer, 20 is the trimer of the present invention, and 30 is the hexamer of the present invention.

[0054] The conjugated protein 10 of the present invention is "X n The complex protein 10 of the present invention is composed of a "molecular needle region 13 corresponding to Y in formula (1)" in which a "basic portion 131 corresponding to Y1 in formula (2)" and a "foldon 132 corresponding to Y2 in formula (2)" are bound, and an "immunogen 11 corresponding to W in formula (1)" is bound via a "linker 12 corresponding to L1 in formula (1)". Linkers other than the linker 12 and the modified sequence corresponding to Y3 in formula (2) are omitted from the illustration. The complex protein 10 of the present invention itself does not substantially have the function of passing through the cell membrane of cells in the target tissue.

[0055] The trimer 30 is a trimer formed by spontaneously associating three monomers of the above-mentioned complex protein 10. In the trimer 30, three of the above-mentioned molecular needle regions 13 are grouped together and associated with each other at their C-termini, forming a trimer parallel β-sheet structure and a needle-like structure called a helical structure (triple helix β-sheet structure) by the β-sheet structure itself, forming a molecular needle 13×3. The molecular needle 13×3 is composed of a basic portion 131×3 and a foldon assembly 132×3. In this way, a "molecular needle" that has the function of passing through the cell membrane of cells in the target tissue is formed by trimerization and self-organization, and three linkers (12 1 , 12 2 , 12 3 ) and three immunogens (11 1 , 11 2 , 11 3 ) is present outside this molecular needle 13×3.

[0056] The hexamer 60 is formed by two units of the trimer 30, each of which is connected to the basic part of the molecular needle ((13×3) 1 and (13×3) 2) at the N-terminus, and the hexamer 60 also has the function of passing through the cell membrane of the target tissue. 1 , 12 2 , 12 3 , and 12 5 , 12 6 :12 4 (not shown) and six immunogens (11 1 , 11 2 , 11 3 , and 11 5 , 11 6 :11 4 (not shown) are two molecular needles (13×3) 1 and (13×3) 2 exists outside of

[0057] The trimerization of the complex protein 10 of the present invention to the trimer 30 and the macroscopic dimerization of the trimer 30 to the hexamer 60 proceed spontaneously in an aqueous liquid, and the trimer or hexamer is stable. The stability of the trimer or hexamer is extremely high, and the trimer or hexamer is stable, for example, in an aqueous liquid environment at a temperature of 100° C., an aqueous liquid environment at a pH of 2-11, and an aqueous liquid environment containing 50-70% by volume of an organic solvent, and is also excellent in safety. Even when isolated from an aqueous liquid and dried, the trimer or hexamer exhibits excellent stability and cell membrane permeability.

[0058] As described above, the transition from the complex protein of the present invention to the aggregate proceeds spontaneously, and the majority of the protein usually forms a hexamer, which is the final form, although a portion remains as a trimer.

[0059] (3) Vaccine of the Present Invention The vaccine of the present invention can efficiently transfer a part or all of the nonstructural protein of the virus, which is an immunogen, to cells of a target tissue via subcutaneous, intradermal, transdermal, mucosal, or intramuscular administration due to the excellent cell permeability and immunogenicity of the aggregate of the present invention, which is an active ingredient, and perform immunization. This can improve the efficacy and safety of a component vaccine of a virus administered subcutaneously, intradermal, transdermal, mucosal, or intramuscularly. This is manifested in the fact that it can be used as an adjuvant-free vaccine. The target mucosal tissue for mucosal administration can be freely determined according to the properties of the affected part of the target virus, and examples thereof include, but are not limited to, nasal mucosa, throat mucosa, oral mucosa, bronchial mucosa, digestive tract mucosa, vaginal mucosa, etc. In the case of a virus that causes respiratory tract inflammation (cold), such as RS virus, nasal mucosa, throat mucosa, oral mucosa, bronchial mucosa, sublingual mucosa, lung mucosa, etc. are suitable.

[0060] As a vaccine for mucosal administration, a component vaccine containing only the molecular needle carrying the structural protein of the above-mentioned pathogenic virus as an active ingredient is disclosed herein.

[0061] The vaccine of the present invention is provided as a pharmaceutical composition for subcutaneous, intradermal, transdermal, mucosal or intramuscular administration, which contains the above-mentioned aggregate of the present invention as an active ingredient (protective antigen). Even in the case of direct administration of the aggregate of the present invention, the aggregate is suspended in a buffer solution or the like at the time of use to prepare a liquid for subcutaneous, intradermal, transdermal, mucosal or intramuscular administration, and therefore the form of the aggregate itself is also included in the pharmaceutical composition. Suitable dosage forms for the above-mentioned mucosal administration include aerosols (aerosols, sprays, etc.), capsules, liniments, etc.

[0062] The vaccine of the present invention is prepared in the form of a pharmaceutical composition by blending the aggregate of the present invention, which is an essential active ingredient (protective antigen), and, if necessary, a molecular needle carrying a structural protein of a pathogenic virus, and, if necessary, an adjuvant (including the above-mentioned molecular needle form) and a pharmaceutical formulation carrier. The pharmaceutical carrier can be selected according to the form of use, and excipients or diluents such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants can be used. The composition is basically in the form of a liquid, but it can also be in the form of a desiccant, powder, granules, etc. for dilution with liquid when used.

[0063] The amount of the aggregate of the present invention in the vaccine of the present invention (when an aggregate of molecular needles carrying structural proteins is also included, the combined amount of this) is selected as appropriate and is not constant, but it is usually preferable to use the aggregate of the present invention as a liquid formulation containing 1-10% by mass at the time of administration. An appropriate dosage (inoculation) is about 0.01 μg-10 mg per adult, and it is possible to administer (inoculate) one or more times by appropriately combining a primary inoculation and a booster inoculation as necessary. EXAMPLES

[0064] Examples of the present invention will be disclosed below.

[0065] The purpose of this example is to demonstrate the usefulness of the aggregate of the present invention as an active ingredient of a component vaccine targeting a virus, and respiratory syncytial virus (RSV), also known as orthopneumovirus, was selected as the target for this demonstration in view of the current difficulties and usefulness of vaccine production.

[0066] RS virus is distributed widely throughout the world and causes lifelong overt infection in people of all ages, but is a particularly important pathogen in infants and young children, causing the most severe symptoms in the first few weeks to months after birth, despite the presence of maternal antibodies. Low birth weight infants, those with underlying cardiopulmonary diseases, and those with immunodeficiency are at high risk of developing severe symptoms, and the impact on clinical and public health is significant.

[0067] Currently, there is no approved RSV vaccine. In the past, clinical trials were conducted using a formalin-inactivated vaccine, but the symptoms were worse in the vaccinated group than in the control group, and the trials ended in failure. The only medicine available for preventing RSV infection is the humanized monoclonal antibody Palivizumab, and the emergence of an effective vaccine is eagerly awaited (above, quoted from the National Institute of Infectious Diseases website).

[0068] [Example 1] Production of the aggregate of the present invention and confirmation of its contents (a) Assumptions In this example, a conjugate protein of the present invention was prepared by using genetic engineering techniques, in which the immunogen carried was "Vpg (viral protein genome-linked)," one of the nonstructural proteins of the LM14-2 strain, which is human norovirus GII.4. Vpg is a nonstructural protein contained in open reading frame 1 (ORF1) in the norovirus genome. ORF1 codes for a series of norovirus nonstructural proteins, including the N-terminal protein, NTPase (p48), p22 (3A-like), Vpg, protease, and RNA-dependent RNA polymerase (RdRp). After the entire translation of ORF1, the protease cleaves the nonstructural proteins into the respective proteins, which function as mature products. Of these mature products, VPg has been demonstrated to play an essential role in norovirus genome replication through translation from genomic RNA and subgenomic RNA, and functions as a cap substitute during ribosome recruitment. The amino acid sequence of Vpg of the LM14-2 strain, which was the immunogen used in this example, is as shown in SEQ ID NO: 10 (wherein the N-terminal Met is derived from the start codon ATG). The nucleic acid sequence encoding this can be selected according to the known relationship between amino acids and nucleic acid bases.

[0069] All reagents used in this Example 1 were purchased from commercial sources and used without further purification. The gene fragment of HNV-VPg was used that was contained in the cDNA portion (7640 bases: SEQ ID NO: 12) of the human norovirus LM14-2 strain incorporated in the plasmid pHuNoV-LM14-2F (1-12550 bases: SEQ ID NO: 11) provided by Katayama of the Institute of Virus Infection, Kitasato University. VPg is a 372-base sequence (SEQ ID NO: 13) corresponding to bases 2630 to 3028 of the cDNA portion (7640 bases) of the LM14-2 strain. A start codon ATG was added to the 5' end of this sequence and used for expression.

[0070] UV-vis spectra were measured on a SHIMADZU UV-2400PC UV-vis spectrometer. MALDI-TOF mass spectra were measured on a Bruker ultrafleXtrme. For MALDI-TOF-MS measurements, samples were mixed with an equal volume of 70% (v / v) acetonitrile / water solution containing 0.03% (w / v) sinapinic acid and 0.1% (v / v) trifluoroacetic acid. Gel permeation chromatography (GPC) was performed using an HPLC system and column (Asahipack GF-510HQ, Shodex, Tokyo, Japan).

[0071] (b) Construction and expression of the “PN-Vpg” expression plasmid (b)-1: Overview Here, "PN-Vpg" is the above-mentioned formula (1): W-L1-X n -Y (1) and formula (2) representing the cell introduction region Y of formula (1): Y1-L2-Y2-Y3(2) In Immunogen W is "LM14-2 strain-Vpg" represented by the amino acid sequence of SEQ ID NO: 10; the first linker L1 is the amino acid sequence of SEQ ID NO: 14 (SNSSSVPGG), 15 (GGGGS), 16 (PAPAP); and the repeat sequence X nthe repeating unit is the amino acid sequence of SEQ ID NO: 1, and the number of repeats n is 1; the amino acid sequence of the main body portion Y1 of the molecular needle is the amino acid sequence of SEQ ID NO: 2; the second linker L2 is "SVE"; the amino acid sequence of the foldon Y2 is the amino acid sequence of SEQ ID NO: 6; and the amino acid sequence of the modified sequence Y3 is SEQ ID NO: 17 (VEHHHHHH).

[0072] The PN-VPg plasmid was constructed using a flexible linker (FL:SNSSSVPGG (SEQ ID NO: 14)) as a template, and two types of linkers, a short flexible linker (sFL:GGGGS (SEQ ID NO: 15)) and a short rigid linker (sRL:PAPAP (SEQ ID NO: 16)), were constructed based on this, and these were expressed, and the contents of the spontaneously generated aggregates were analyzed, confirming that they contained trimers and hexamers. Based on these findings, the immediate objective of the present invention, a component vaccine of RS virus, was produced and tested, and it was shown that the aggregate of the present invention using the nonstructural proteins of the virus is very useful as a component vaccine.

[0073] (b)-2: Construction of template plasmid using flexible linker (FL: SNSSSVPGG (SEQ ID NO: 14)) The VPg segment from the LM14-2 plasmid was amplified by polymerase chain reaction (PCR) using a set of gene amplification primers VPg_F (with NdeI restriction enzyme site: ACGCCATATGGGCAAGAAAGGGAAGAACAAGTCC (SEQ ID NO: 18)) and VPg_R (with EcoRI restriction enzyme site: GCTCGAATTCGACTCAAAGTTGAGTTTCTCATTGTAGTCAACAC (SEQ ID NO: 19)).The PCR product was then cloned into plasmid pKN1-1 (GFP-gp5f expression plasmid) (Patent Document 2) digested with NdeI and EcoRI.

[0074] As disclosed in Patent Document 2, the plasmid pKN1-1 was prepared by first amplifying a gene corresponding to residues 461 to 484 of the wac protein of T4 phage by PCR from the T4 phage genome and cloning it into pUC18 to obtain a gene encoding foldon. Then, this plasmid was cleaved with restriction enzymes EcoRI and SalI and inserted into plasmid pET29b (Novagen) treated with EcoRI and XhoI to obtain plasmid pMTf1-3. Also, a gene corresponding to residues 474 to 575 of gp5 of T4 phage was amplified by PCR from the T4 phage genome and cloned into pUC18 to obtain a gene encoding gp5. Then, this plasmid was cleaved with restriction enzymes EcoRI and SalI and inserted into the above-mentioned plasmid pMTf1-3 treated with EcoRI and XhoI to obtain plasmid pKA176. In addition, the GFP expression vector provided by Takahashi of Gunma University was cleaved with the restriction enzymes NdeI and EcoRI to obtain the gene encoding GFP, which was then inserted into the above-mentioned plasmid pKA176 that had been treated with the restriction enzymes NdeI and EcoRI.

[0075] The cloned gene fragment was introduced into competent cells of Escherichia coli BL21(DE3) and confirmed by DNA sequencing, confirming the presence of the plasmid construct "PN-FL-VPg" of PN and VPg with a flexible linker (SNSSSVPGG: sequence number 15).

[0076] (b)-3: Production of complexes using sFL / sRL linkers and confirmation of their contents A set of gene amplification primers VPgPA-F (with XhoI restriction site: CCGGCTCCGGCCCCACTCGAGGGAAGCAATACAATATTTGTACG (SEQ ID NO: 20)) and VPgPA-R (CTCAAAGTTGAGTTTCTCATTGTAGTCAACAC (SEQ ID NO: 21)) for inserting the "short rigid linker" (sRL:PAPAP) of SEQ ID NO: 16 as linker L1, and a set of gene amplification primers VPgPA-R (with XhoI restriction site: CCGGCTCCGGCCCCACTCGAGGGAAGCAATACAATATTTGTACG (SEQ ID NO: 22)) for inserting the "short flexible linker" (sFL:GGGGS) of SEQ ID NO: 15 as linker L1, The set of primers VPgGS-F (containing an XhoI restriction site: GGAGGCGGGGGTTCACTCGAGGGAAGCAATACAATATTTGTACG (sequence number 22) and VPgGS-R (same as VPgPA-R (sequence number 21) above) were used separately as gene amplification primers for inverted PCR using "PN-FL-VPg" as a template to construct the plasmid constructs "PN-sRL-VPg" (L1 is a short rigid linker of sequence number 16) and "PN-sFL-VPg" (L1 is a short flexible linker of sequence number 15).

[0077] These two plasmids were then introduced into DH5α competent cells, and the resulting vectors were verified by DNA sequencing, after which PN-sRL-VPg and PN-sFL-VPg were expressed.

[0078] For the expressed "PN-sRL-VPg" and "PN-sFL-VPg", the proteins after loading onto a Ni affinity column were eluted with a higher imidazole gradient of 20-500 mM imidazole and 1 mM DTT. These fractions containing PN-VPg were combined, the volume reduced to 5 ml, and the buffer was changed by dialysis in a buffer containing 20 mM Tris-HCl pH 8.0 overnight at 4 °C. The concentrate was filtered through a 0.2 μm filter and then loaded onto a HiTrap Q column and eluted with a step gradient of sodium chloride (0-1 M). The PN-VPg (short linker)-containing fractions were identified by Native PAGE and SDS-PAGE.

[0079] SDS PAGE results showed a band with the same molecular weight as the calculated monomer of PN-VPg (sFL / sRL linker), approximately 31 kDa (not shown). In addition, for PN-sRL-VPg, MALDI-TOF mass spectrum results showed signals for the monomer (Figure 2(a): observed m / z: 31955, calculated m / z: 31514), trimer (Figure 2(b): observed m / z: 95257, calculated m / z: 94542), and hexamer (trimer-dimer) (Figure 2(c): observed m / z: 190929, calculated m / z: 189084), respectively. Furthermore, the MALDI-TOF mass spectrum of PN-sFL-VPg showed the PN-sFL-VPg monomer (Figure 3(a): observed m / z: 31266, calculated m / z: 31396), trimer (Figure 3(b): observed m / z: 93857, calculated m / z: 94188), and hexamer (trimer-dimer) (Figure 3(c): observed m / z: 187218, calculated m / z: 188376).

[0080] These results indicate that the aggregates of the present invention contain trimers and hexamers.

[0081] [Example 2] Component vaccine against RS virus (a) Assumptions In this example, a conjugate protein of the present invention was prepared using genetic engineering techniques, in which the immunogen carried was a "P protein (phosphorylated protein: a protein responsible for phosphorylation)," one of the nonstructural proteins of the human respiratory syncytial virus Long strain. The P protein is encoded in the respiratory syncytial virus genome as a template sequence for the messenger RNA of the P protein. The respiratory syncytial virus has a minus strand as its genome inside the virus particle, and complementary strands of the messenger RNA of each protein are present at the positions shown in FIG. 4. When the respiratory syncytial virus infects a cell, the RNP (described above) synthesizes the messenger RNA of each protein using the minus strand genome as a template. Various messenger RNAs have start and stop codons, and are translated in the cell to produce various proteins. The translated viral proteins function as viral proteins after undergoing a maturation process. The P protein forms a tetramer and mediates the binding of the L protein and RNP at the C-terminus by binding to the L protein and RNP. In addition, at the N-terminus, it functions as a chaperone that binds free N protein to RNA in the process of synthesis. RNPs are surrounded by an envelope derived from the host cell membrane, and two types of viral glycoproteins, the receptor-binding protein and the fusion protein (F protein), form spikes on their surface.

[0082] In this example, the P protein was selected as the nonstructural protein W. The amino acid sequence of the P protein (RSV-P) of the RSV Long strain, which is the immunogen actually used, is SEQ ID NO: 23, "MEKFAPEFHGEDANNRATKFLESIKGKFTSPKDPKKKDSIISVNSIDIEVTKESPITSNSTIINPTNETDDNAGNKPNYQRKPLVSFKEDPIPSDNPFSKLYKETIETFDNNEEESSYSYEEINDQTNDNITARLDRIDEKLSEILGMLHTLVVASAGPTSARDGIRDAMVGLREEMIEKIRTEALMTNDRLEAMARLRNEESEKMAKDTSDEVSLNPTSEKLNNLLEGNDSDNDLSLDDF", and the nucleic acid sequence encoding it can be selected according to the known relationship between amino acids and nucleic acid bases.In this example, "(TGA)" (SEQ ID NO: 24) was used.

[0083] All reagents used in this Example 2 were purchased from commercial suppliers and used without further purification. The RSV-P gene fragment was obtained by amplifying a portion of the P protein gene sequence excluding the terminal stop codon (TGA in parentheses above) from the genomic RNA of the RSV-Long strain provided by Sawada, Department of Viral Infection Control I, Institute of Life and Medical Sciences, Kitasato University.

[0084] (b) Construction and expression of the plasmid for expressing the “PN-P protein” In this example, the template plasmid construct "PN-FL-VPg" obtained in "Example 1(b)-2" was used as a template to construct the desired plasmid construct "PN-FL-P" by replacing a gene fragment obtained by removing the terminal stop codon (TGA) from the nucleic acid sequence (SEQ ID NO: 24) encoding the P protein amplified by PCR from the RSV-Long strain with Vpg by the InFusion cloning method.

[0085] That is, InFusion RS-P sense 5'- GGAGATATACAT ATGGAAAAGTTTGCTCCTGA-3' (SEQ ID NO: 25) and InFusion RS-P antisense 5'- TGAACCCCGCCTCC The P region was amplified with GAAATCATCAAGTGATAGAT-3' (SEQ ID NO: 26) to obtain an amplification product of the P region with the underlined portion added. On the other hand, the entire vector portion except for the VPg sequence was amplified by inverted PCR using the template plasmid construct "PN-FL-VPg" as a template and 5'-GGAGGCGGGGGTTCA-3' (SEQ ID NO: 27) and 5'-ATGTATATCTCCTTCTTAAAG-3' (SEQ ID NO: 28) as primers to prepare a vector body. These two fragments were ligated by InFusion cloning to obtain the desired plasmid construct "PN-FL-P".

[0086] This plasmid was then introduced into DH5α competent cells, and the resulting vector was verified by DNA sequencing before expression of PN-sFL-P.

[0087] E. coli BL21(DE3) carrying the "PN-sFL-P" plasmid was cultured overnight at 37°C in LB medium containing 30 μg / ml kanamycin. The OD 600After the pH reached 0.8, 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and arabinose were added. 16-17 hours after the addition of IPTG and arabinose, the bacteria were harvested by centrifugation at 8000 rpm for 5 min and incubated at 20°C at a speed of 180 rpm. The cell pellet was then suspended on ice in a buffer containing 100 mM Tris-HCl pH 8.0, 5 mM imidazole with one tablet of cOmplete, EDTA-free, and lysed by sonication. Cell debris was removed by centrifugation (17,500 rpm for 50 min). The supernatant was filtered through a 0.8 μm filter, loaded onto a Ni affinity column, and eluted with the same buffer with a linear gradient of 5 mM-250 mM imidazole at 4°C. Next, this PN-FL-P aggregate was dialyzed against 20 mM Tris / HCl pH 8.0, 0.2 M NaCl, and then further dialyzed against PBS, and concentrated by ultrafiltration. In this process, PN-sFL-P spontaneously becomes an aggregate containing trimers and / or hexamers. This was used in the immunological test as a "PN-sFL-P aggregate." As a control, a recombinant P protein (hereinafter abbreviated as P protein) was prepared by a conventional method based on the base sequence encoding the above-mentioned P protein, following a series of processes from expression to recovery of "PN-sFL-P."

[0088] The immune test was performed by nasal immunization using a 10 μg / mL PBS solution (purified antigen).

[0089] (c) Immunoassay of Example 2 (1) (measurement of antibody titer) The above PN-sFL-P aggregate (PN(+)) and P protein (PN(-)) were intranasally inoculated into RS virus-susceptible cotton rats. All intranasal inoculations were performed by instilling or aspirating the vaccine solution into the nasal cavity, and 1 mL (10 μg) of purified antigen per rat was aspirated into the nasal cavity under anesthesia. This intranasal inoculation was performed three times in total, at weekly intervals after the first inoculation. Blood samples were taken before the first inoculation, one week after the first inoculation (before the first booster inoculation), two weeks after the first inoculation (before the second booster inoculation), three weeks after the first inoculation (before the third booster inoculation), and seven weeks after the first inoculation. The blood samples were reacted with RSVP protein, and IgG and IgA antibody titers against RSVP protein were measured by ELISA.

[0090] The final booster vaccination was administered 8 weeks after the first vaccination.

[0091] In the ELISA method, the antigen (RSVP protein) was diluted to 2 μg / mL with PBS(-), added to a 96-well ELISA plate at 50 μL / well, incubated overnight at 4°C, washed the plate with PBST (0.1% Tween20 / PBS) three times in total, added 80 μL / well of PBSB (1% BSA / PBS) to each plate, incubated at room temperature for 2 hours, and blocked. Next, the test serum was diluted with PBSB and prepared as a test sample (IgG detection: 5-fold serial dilution from 10-31250 times, IgA detection: 3-fold serial dilution from 10-2430 times). The PBSB in the plate was discarded, and each test sample was added to the plate at 50 μL / well, incubated at room temperature for 2 hours, and washed five times with PBST. HRP substrate solution was added to the plate at 50 μL / well, and incubated at room temperature in the dark until color development was confirmed. The reaction was stopped by adding 25 μL / well of 2 M sulfuric acid to the plate, and the absorbance at 490 nm was measured.

[0092] The results after 3 weeks (3W) and 7 weeks (7W) are shown in Figure 5 (IgG) and Figure 6 (IgA). In both figures, the vertical axis indicates absorbance and the horizontal axis indicates dilution ratio. These figures show the results for each individual cotton rat tested. These results show that direct immunization with P protein did not increase the absorbance, which indicates the antibody titer, for both IgG and IgA, whereas immunization with the aggregate of the present invention significantly increased these values. Moreover, it is noteworthy that the antibody titer increased so significantly even without the use of any adjuvant, indicating that it can be used as an adjuvant-free vaccine.

[0093] RS virus infection occurs when the virus is inhaled through droplet infection. In other words, since the main route of infection is the oral cavity and nasal cavity, nasal inoculation directly penetrates the cell membrane of the aggregates into nasal mucosal cells, injects the P protein into nasal mucosal cells, and induces cellular and humoral immunity in the nasal cavity, eliciting protective immunity against RS virus. In this way, it was revealed that nasal inoculation of molecular needles carrying RS virus nonstructural proteins as immunogens induces local immunity, and provides protection against RS virus infection and reduces symptoms. In particular, induction of IgA against the P protein, a nonstructural protein of RS virus, is expected to bind to the P protein when IgA produced in the blood passes through the cells and is secreted into the mucosal layer, inhibiting the function of the P protein.

[0094] (d) Immunity test of Example 2 (2) (inhibitory effect on pulmonary inflammation) In this study, we directly examined the inhibitory effect of respiratory syncytial virus sensitization on lung inflammation in respiratory syncytial virus-susceptible cotton rats immunized with molecular needles carrying respiratory syncytial virus nonstructural proteins.

[0095] The above PN-sFL-P aggregate (PN(+)) and P protein (PN(-)) were each inoculated intranasally into RS virus-susceptible cotton rats. All nasal inoculations were performed by aspirating 1 mL (10 μg) of purified antigen per rat into the nasal cavity under anesthesia. This nasal inoculation was performed in the same manner as in the above "Immunity Test (1)", with a total of three booster inoculations given at weekly intervals after the initial inoculation, and a final booster inoculation given 8 weeks after the initial inoculation, after which the test rats were infected with RS virus one week later. The infectious dose of RS virus was 2 × 10 5 The vaccination was performed in the same manner as for vaccination (intranasal vaccination) at PFU / mL.

[0096] Four days after infection, lung tissues from the test rats were collected, and the amount of RS virus infection in the lungs was measured by removing the lungs, which are the target tissue for infection, suspending them in culture medium using a homogenizer to release the virus, and determining the amount of infectious virus contained in 50 mg of lung tissue by plaque assay.

[0097] In addition to these, positive controls (the above cotton rats infected with RS virus without prior nasal inoculation) and negative controls (the above cotton rats neither prior nasal inoculation nor infected with RS virus) were used as test rats.

[0098] The results are shown in Figure 7. In Figure 7, the horizontal axis indicates "Not infected" for the negative control (n = 1), PN(+) for the PN-sFL-P aggregate (n = 3), PN(-) for the P protein (n = 3), and "Not immunized" for the positive control (n = 3). The vertical axis indicates the RS virus titer (PFU / 50 mg of lung tissue) in the collected lung tissue. As shown in Figure 7, rats administered with PN-sFL-P aggregate had RS virus infection suppressed by more than half compared to RS virus-infected rats (positive control), with a significant difference (P < 0.0001).

[0099] These results demonstrated that the vaccine of the present invention exerts a substantial effect of suppressing viral infection, particularly by inducing local immunity such as mucosal immunity and cellular immunity.

[0100] [Example 3] When carrying RS virus structural proteins As mentioned above, RSV RNP is surrounded by an envelope derived from the host cell membrane, and two types of viral glycoproteins (structural proteins), a receptor binding protein and a fusion protein (F protein), form spikes on the surface. Here, an assembly was produced that carries a (quadruple) fusion protein in which four peptides (SEQ ID NO: 29: DMPITNDQKKLMS) consisting of 13 amino acids that constitute the neutralizing epitope region of the structural protein F protein are linked in series as immunogen W, and a test similar to the immunological test in the above example was performed on this assembly.

[0101] The F protein of RSV consists of 574 amino acids (SEQ ID NO: 30:: GenBank accession # AY911262). The region from 263rd to 275th amino acids is the epitope region recognized by neutralizing antibodies. A gene encoding a (quadruple) fusion protein in which four epitope regions of this F protein are connected in series via (GGGG) was produced, and a plasmid (pET29b(+) / F-PN) designed to fuse with PN via a linker (GGGGS: SEQ ID NO: 15) was produced, which was transformed into Escherichia coli (BL21 DE3) (FIG. 8), and induced expression was performed with IPTG. The induced expression was collected as a soluble protein, and the above quadruple fusion protein assembly (Fnep×4-PN assembly (PN(+)) was purified by TAIRON, and the immune test of this Example 3 was performed.

[0102] (a) Immunoassay of Example 3 (1) (measurement of antibody titer) The above-mentioned Fnep×4PN complex (PN(+)) and the above-mentioned quadruple fusion protein of neutralizing epitopes of F protein (PN(-)) were intranasally inoculated into RS virus-susceptible cotton rats. All intranasal inoculations were performed by instilling or aspirating the vaccine solution into the nasal cavity, and 1 mL (20 μg) of purified antigen per rat was aspirated into the nasal cavity under anesthesia. This intranasal inoculation was performed three times in total, at weekly intervals after the first inoculation. Blood samples were taken before the first inoculation, one week after the first inoculation (before the first booster inoculation), two weeks after the first inoculation (before the second booster inoculation), three weeks after the first inoculation (before the third booster inoculation), and seven weeks after the first inoculation. The blood samples were reacted with F protein, and IgG and IgA antibody titers against F protein were measured by ELISA.

[0103] The final booster vaccination was administered 9 weeks after the first vaccination.

[0104] The ELISA method was performed in the same manner as in Example 2, except that, as described above, F protein was used as the antigen.

[0105] The results after 3 weeks are shown in Figure 9 (results for IgA and IgG). The vertical axis indicates absorbance, and the horizontal axis indicates dilution ratio. In this figure, the results for each individual cotton rat are shown. These results show that direct immunization with the quadruple fusion protein of neutralizing epitopes of the F protein did not increase the absorbance, which indicates the antibody titer, for both IgG and IgA, whereas immunization with the Fnep x 4PN complex increased these values. This increase in antibody titer was remarkable for IgG, but varied for IgA.

[0106] (b) Immunity test of Example 3 (2) (inhibitory effect on pulmonary inflammation) In this study, we directly examined the inhibitory effect of respiratory syncytial virus (RSV)-induced pulmonary inflammation in RSV-susceptible cotton rats immunized with molecular needles carrying a quadruple fusion protein of neutralizing epitopes of the F protein, a structural protein of RSV.

[0107] The above-mentioned Fnep×4PN complex (PN(+)) and quadruple fusion protein of neutralizing epitopes of F protein (PN(-)) were each inoculated intranasally into RS virus-susceptible cotton rats. All intranasal inoculations were performed by aspirating 1 mL (20 μg) of purified antigen per rat into the nasal cavity under anesthesia. This nasal inoculation was performed in the same manner as in the above "Immunity Test (1)", with a total of three booster inoculations given at weekly intervals after the initial inoculation, and a final booster inoculation given seven weeks after the initial inoculation, and two weeks after this, the test rats were infected with RS virus. The infectious dose of RS virus was 2 × 10 5 The vaccination was performed in the same manner as for vaccination (intranasal vaccination) at PFU / mL.

[0108] Four days after infection, lung tissues from the test rats were collected, and the amount of RS virus infection in the lungs was measured by removing the lungs, which are the target tissue for infection, suspending them in culture medium using a homogenizer to release the virus, and determining the amount of infectious virus contained in 50 mg of lung tissue by plaque assay.

[0109] In addition to these, positive controls (the above cotton rats infected with RS virus without prior nasal inoculation) and negative controls (the above cotton rats neither prior nasal inoculation nor infected with RS virus) were used as test rats.

[0110] The results are shown in Figure 10. In Figure 10, the horizontal axis indicates "Not infected" for the negative control (n = 1), PN(+) for the Fnep x 4PN complex (n = 3), PN(-) for the quadruple fusion protein of neutralizing epitopes of F protein (n = 3), and "Not immunized" for the positive control (n = 3). The vertical axis indicates the RS virus titer (PFU / 50 mg lung tissue) in the collected lung tissue. Figure 10 shows that rats administered the Fnep x 4PN complex had RS virus infection suppressed by approximately 36%, with a significant difference (P < 0.0001), compared with RS virus-infected rats (positive control).

[0111] From these results, it was revealed that the needle vaccine using the quadruple fusion protein complex of the neutralizing epitope of the F protein, which is a structural protein of the RS virus, in Example 3 also induces local immunity such as mucosal immunity and cellular immunity. However, the effect of the vaccine of the present invention using a nonstructural protein was also found to be weaker than that of the vaccine of the present invention using a nonstructural protein. This indicates that the virus neutralizing effect of the secretory IgA (sIgA) secreted into the mucin layer of the mucosal epithelium, which is induced by immunization with the quadruple fusion protein complex of the neutralizing epitope of the F protein, is limited in its ability to suppress the infection and proliferation of the virus. In contrast, the vaccine of the present invention (molecular needle using the P protein, which is a nonstructural protein) can more effectively suppress the infection and proliferation of the RS virus by the action of the cellular immunity induced by immunization with the vaccine of the present invention. Furthermore, when the IgA molecules synthesized in the B cells in the blood are secreted from the basement membrane side of the epithelial cells toward the mucosal epithelium, the formation of the P-polymerase complex formed between the P protein and the viral polymerase on the way through the cells is hindered, which is thought to be a further effect of the vaccine of the present invention.

[0112] However, for example, a component vaccine containing as active ingredients a combination of the aggregate of the present invention carrying the P protein, which is a nonstructural protein of RS virus in Example 2, and a molecular needle carrying a structural protein such as the quadruple fusion protein aggregate of neutralizing epitopes of the F protein, which is a structural protein of RS virus in Example 3, is expected to have a synergistic effect due to the combination.

Claims

1. The amino acid sequence of formula (1): W-L １ -X ｎ -Y (1) [Wherein, W represents an amino acid sequence containing one or more parts or all of a nonstructural protein of a pathogenic virus that is an immunogen, and L １ represents a first linker sequence having 0-100 amino acids, X represents the amino acid sequence of SEQ ID NO: 1, Y represents the amino acid sequence of the cell introduction region, and n, which is the number of repetitions of X, is an integer of 1-3. And, The amino acid sequence of the cell introduction region Y is represented by the following formula (2): Y １ -L ２ -Y ２ -Y ３ () [In the formula, Y １ represents the amino acid sequence of SEQ ID NO:2, and Y ２ represents the amino acid sequence of SEQ ID NO:6, and L ２ represents a second linker sequence having 0-30 amino acids, and Y ３ represents an amino acid sequence for modification, and Y 3 may be absent.] In the above formula, X and Y １ , or Y ２ The composite protein may be a modified amino acid sequence in which one amino acid is deleted, substituted or added from each of the amino acid sequences represented by the formula (I).

2. An amino acid sequence of the following formula (1): W−L 1 −X n −Y (1) [In the formula, W represents an amino acid sequence containing one or more parts of a part or the whole of a nonstructural protein of a pathogenic virus that is an immunogen, L 1 represents a first linker sequence having 0-100 amino acids, X represents the amino acid sequence of SEQ ID NO: 1, Y represents the amino acid sequence of a cell introduction domain, and n, which is the number of repetitions of X, is an integer of 1-3.] And, The amino acid sequence of the cell introduction region Y is represented by the following formula (2): Y 1 -L 2 -Y 2 -Y 3 (2) [In the formula, Y 1 represents the amino acid sequence of SEQ ID NO: 2, Y 2 represents the amino acid sequence of SEQ ID NO: 6, L 2 represents a second linker sequence having 0-30 amino acids, Y 3 represents an amino acid sequence for modification, and Y 3 may be absent.] A complex protein represented by 3. The conjugated protein according to claim 1, wherein Y 3 , the amino acid sequence for modification, comprises a histidine tag.

4. A gene expression vector incorporating a nucleic acid encoding a conjugated protein according to any one of claims 1 to 3.

5. A transformant transformed with a nucleic acid encoding a complex protein described in any one of claims 1 to 3.

6. An aggregate obtained by associating one or more types of complex proteins described in any one of claims 1 to 3 in an aqueous liquid.

7. An assembly containing a trimeric protein and / or a hexameric protein, in which one or more types of conjugated proteins described in any one of claims 1 to 3 are used as monomeric proteins.

8. A component vaccine for mucosal administration, comprising as an active ingredient an aggregate formed by associating one or more types of conjugated proteins described in any one of claims 1 to 3 in an aqueous liquid.

9. A component vaccine for mucosal administration, comprising as an active ingredient an aggregate containing a trimeric protein and / or a hexameric protein in which one or more types of complex proteins described in any one of claims 1 to 3 are used as monomeric proteins.

Images