Targeted RNA editing by endogenous ADARs using engineered RNA

Abstract

The present application provides a method for editing RNA by introducing a deaminase-recruiting RNA into a host cell to deaminate adenosine in a target RNA. The present application also provides the deaminase-recruiting RNA used in the RNA editing method, as well as compositions and kits containing the same.

Description

[Technical field]

[0001] (CROSS REFERENCE TO RELATED APPLICATIONS) This application claims priority to International Patent Application No. PCT / CN2019 / 095802, filed July 12, 2019, the contents of which are incorporated herein by reference in their entirety.

[0002] (Submit sequence listing as ASCII text file) The contents of the following submitted ASCII text file are incorporated by reference in their entirety into this application: Computer Readable Form (CRF) of the Sequence Listing (Filename: FD00254PCT-ST25.txt, Recorded Date: July 10, 2020, Size: 16KB).

[0003] The present disclosure relates generally to methods and compositions for editing RNA using engineered RNA capable of recruiting adenosine deaminase to deaminate one or more adenosines in a target RNA. [Background technology]

[0004] Genome editing is a powerful tool used in biomedical research and therapeutic development of diseases. Editing techniques using engineered nucleases (e.g., zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), and Cas proteins of the CRISPR system) have been applied to manipulate genomes in many organisms. Recently, new tools for RNA editing using deaminase proteins such as RNA-specific adenosine deaminases (ADARs) have been developed. There are three types of ADAR proteins in mammalian cells, namely, Adar1 (two isotypes, p110 and p150), Adar2, and Adar3 (without catalytic activity). The catalytic substrate of ADAR proteins is double-stranded RNA, and ADARs can remove the -NH2 group from adenosine (A) nucleobases, thereby changing A to inosine (I). (I) is recognized as guanosine (G) and paired with cytidine (C) during the subsequent cellular transcription and translation processes. To achieve targeted RNA editing, ADAR proteins or their catalytic domains are fused with lambda peptides, SNAP tags, or Cas proteins (dCas13b), and guide RNAs are designed to recruit the chimeric ADAR proteins to the target site. Alternatively, it has been reported that overexpressed ADAR1 and ADAR2 proteins can perform targeted RNA editing together with guide RNAs that contain R / G motifs.

[0005] However, currently available ADAR-mediated RNA editing technologies have certain limitations. For example, in the case of gene therapy, the most effective in vivo delivery is via viral vectors, but the highly ideal adeno-associated viral (AAV) vector is limited in size of payload (~4.5 kb), making it difficult to carry both protein and guide RNA. In addition, it has been recently reported that overexpression of ADAR1 causes oncogenicity in multiple myeloma by aberrant over-editing to RNA, resulting in massive global off-target editing. In addition, ectopic expression of the protein or its non-human-derived domains has the potential risk of inducing immunogenicity. Moreover, pre-existing adaptive immunity and p53-mediated DNA damage response can impair the efficacy of therapeutic proteins (e.g., Cas9). [Prior art documents] [Non-patent literature]

[0006] [Non-Patent Document 1] Porteus, MH & Carroll, D. Gene targeting using zinc finger nucleases. Nat Biotechnol 23, 967-973 (2005). [Non-Patent Document 2] Boch, J. et al. Breaking the code of DNA binding specificity of TAL-type III effectors. Science 326, 1509-1512 (2009). [Non-Patent Document 3] Moscou, MJ & Bogdanove, AJ A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501 (2009). [Non-Patent Document 4] Miller, JC et al. A TALE nuclease architecture for efficient genome editing. Nat Biotechnol 29, 143-148 (2011). [Non-Patent Document 5] Jinek, M. et al. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337, 816-821 (2012). [Non-Patent Document 6] Cong, L. et al. Multiplex genome engineering using CRISPR / Cas systems. Science 339, 819-823 (2013). [Non-Patent Document 7] Mali, P. et al. RNA-guided human genome engineering via Cas9. Science 339, 823-826 (2013). [Non-Patent Document 8] Komor, AC, Kim, YB, Packer, MS, Zuris, JA & Liu, DR Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533, 420-424 (2016). [Non-Patent Document 9] Ma, Y. et al. Targeted AID-mediated mutagenesis (TAM) enables efficient genomic diversification in mammalian cells. Nat Methods 13, 1029-1035 (2016). [Non-Patent Document 10] Gaudelli, NM et al. Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551, 464-471 (2017). [Non-Patent Document 11] Tan, MH et al. Dynamic landscape and regulation of RNA editing in mammals. Nature 550, 249-254 (2017). [Non-Patent Document 12] Nishikura, K. Functions and regulation of RNA editing by ADAR deaminases. Annu Rev Biochem 79, 321-349 (2010). [Non-Patent Document 13] Bass, BL & Weintraub, H. An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 55, 1089-1098 (1988). [Non-Patent Document 14] Wong, SK, Sato, S. & Lazinski, DW Substrate recognition by ADAR1 and ADAR2. RNA 7, 846-858 (2001). [Non-Patent Document 15] Montiel-Gonzalez , MF , Vallecillo-Viejo , I , Yudowski , GA & Rosenthal , JJ Correction of mutations within the cystic fibrosis transmembrane conductance regulator by site-directed RNA editing . Proc Natl Acad Sci USA 110, 18285–18290 (2013).

Outdoor Tools 16

Outdoor Track 17

Outdoor Tools 18

Outdoor Tools 19

Direct Entries 25

Direct Accounts 26

Direct Accounts 27

Direct Environment 28

Direct Account 29

[0007] The present application provides a method for RNA editing using ADAR-recruited RNA ("dRNA" or "arRNA"), which can utilize endogenous RNA-specific adenosine deaminase ("ADAR") protein to perform RNA editing. The present application also provides a construct that includes engineered dRNA or the nucleic acid that encodes engineered dRNA used in these methods, as well as compositions and kits that include them. The present application also provides a method for treating or preventing a disease or condition in an individual, comprising editing a target RNA associated with the disease or condition in the cells of the individual.

[0008] In one aspect, the present disclosure provides a method for producing a method for manufacturing a semiconductor device comprising: 1. A method for editing a target RNA in a host cell, comprising introducing into the host cell a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to a target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The method provides a method, wherein the dRNA is a circular RNA or is capable of forming a circular RNA.

[0009] In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA. In some embodiments, the dRNA further comprises a 3' ligation sequence and a 5' ligation sequence. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are about 20 to about 75 nucleotides in length. In some embodiments, the dRNA is circularized by an RNA ligase. In some embodiments, the RNA ligase is RNA ligase RtcB. In some embodiments, the RNA ligase RtcB is endogenously expressed in a host cell. In some embodiments, the dRNA is a circular RNA.

[0010] In some embodiments, the method includes introducing a construct comprising a nucleic acid encoding the dRNA into the host cell. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. In some embodiments, the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1.

[0011] In another aspect, the present disclosure provides a method for producing a method for the preparation of ... composition comprising: 1. A method for editing a target RNA in a host cell comprising introducing into said host cell a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, The dRNA is (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence; The dRNA can recruit RNA-specific adenosine deaminase (ADAR).

[0012] In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). In some embodiments, the snoRNA sequence is at least about 70 nucleotides in length. In some embodiments, the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the snoRNA sequence is a C / D box snoRNA sequence. In some embodiments, the snoRNA sequence is an H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is a composite C / D box and H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is an orphan snoRNA sequence. In some embodiments, the method comprises introducing into the host cell a construct comprising a nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a promoter operably linked to the nucleic acid encoding the dRNA. In some embodiments, the promoter is a polymerase II promoter ("Pol II promoter"). In some embodiments, the construct is a viral vector or a plasmid. In some embodiments, the construct is an AAV vector.

[0013] In another aspect, the present disclosure provides a method for producing a method for the preparation of ... composition comprising: 1. A method for editing a target RNA in a host cell comprising introducing into said host cell a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA), (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The construct includes a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0014] In some embodiments, the pol II promoter is a CMV promoter. In some embodiments, the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:3.

[0015] The following embodiments are applicable to all three aspects described above. In some embodiments, the construct is a viral vector or a plasmid. In some embodiments, the construct is an AAV vector. In some embodiments, the ADAR is endogenously expressed by a host cell. In some embodiments, the host cell is a T cell. In some embodiments, the target RNA sequence is greater than 50 nucleotides in length. In some embodiments, the target RNA sequence is about 100 to about 180 nucleotides in length. In some embodiments, the target RNA sequence is about 100 to about 150 nucleotides in length. In some embodiments, the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite a target adenosine in the target RNA. In some embodiments, the target RNA sequence comprises a cytidine mismatch directly opposite a target adenosine in the target RNA. In some embodiments, the cytidine mismatch is at least 20 nucleotides from the 3' end of the target RNA sequence and at least 5 nucleotides from the 5' end of the target RNA sequence. In some embodiments, the target RNA sequence further comprises one or more guanosines opposite each non-target adenosine in the target RNA, hi some embodiments, the target RNA sequence comprises two or more consecutive mismatch nucleotides opposite a non-target adenosine in the target RNA.

[0016] In some embodiments, the 5'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A, and G, with a preference of U>C≈A>G, and the 3'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A, and U, with a preference of G>C>A≈U. In some embodiments, the target adenosine in the target RNA is a three base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU. In some embodiments, the three base motif is UAG, and the target RNA includes an A directly opposite the uridine in the three base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine, or uridine directly opposite the guanosine in the three base motif. In some embodiments, the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA and small RNA. In some embodiments, the target RNA is a pre-messenger RNA.

[0017] In some embodiments, the method further comprises introducing an ADAR3 inhibitor into the host cell. In some embodiments, the method further comprises introducing an interferon stimulant into the host cell. In some embodiments, the method further comprises introducing multiple dRNAs or constructs, each of which targets a different target RNA. In some embodiments, the method further comprises introducing an ADAR (e.g., an exogenous ADAR) into the host cell. In some embodiments, the editing efficiency of the target RNA is at least 40%. In some embodiments, the construct or the dRNA does not induce an immune response. In some embodiments, the ADAR is an ADAR1 comprising an E1008 mutation.

[0018] In some embodiments, deamination of the target adenosine in the target RNA causes a missense mutation, a premature stop codon, aberrant splicing or alternative splicing in the target RNA, or a reversal of the missense mutation, premature stop codon, aberrant splicing or alternative splicing in the target RNA. In some embodiments, deamination of the target adenosine in the target RNA causes a point mutation, truncation, elongation and / or misfolding of the protein encoded by the target RNA, or a functional, full-length, correctly folded and / or wild-type protein due to a missense mutation, a premature stop codon, aberrant splicing or alternative splicing in the target RNA. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell or a mouse cell. The present specification also provides an edited RNA produced by the method provided by any one of the above three aspects, or a host cell having the edited RNA.

[0019] In another aspect, the present disclosure provides a method for treating or preventing a disease or condition of an individual, comprising editing the target RNA associated with said disease or condition in the cell of said individual according to any one of the methods described above.In some embodiments, said disease or condition is a hereditary genetic disease or a disease or condition associated with one or more acquired genetic mutations.In some embodiments, said target RNA has GA mutation.In some embodiments, said disease or condition is a single gene disease or condition.In some embodiments, said disease or condition is a polygenic disease or condition.

[0020] In some embodiments, the target RNA is TP53 and the disease or condition is cancer. In some embodiments, the target RNA is IDUA and the disease or condition is mucopolysaccharidosis type I (MPSI). In some embodiments, the target RNA is COL3A1 and the disease or condition is Ehlers-Danlos syndrome. In some embodiments, the target RNA is BMPR2 and the disease or condition is Joubert syndrome. In some embodiments, the target RNA is FANCC and the disease or condition is Fanconi anemia. In some embodiments, the target RNA is MYBPC3 and the disease or condition is primary familial hypertrophic cardiomyopathy. In some embodiments, the target RNA is IL2RG and the disease or condition is X-linked severe combined immunodeficiency.

[0021] In another aspect, the present specification provides a deaminase-recruiting RNA (dRNA) for editing a target RNA, the deaminase-recruiting RNA comprising a target RNA sequence at least partially complementary to the target RNA, the dRNA being capable of recruiting an RNA-specific adenosine deaminase (ADAR), and the dRNA being circular or capable of forming a circular RNA. In some embodiments, the dRNA is a linear RNA capable of forming a circular RNA. In some embodiments, the dRNA further comprises a 3' ligation sequence and a 5' ligation sequence. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are about 20 to about 75 nucleotides in length. In some embodiments, the dRNA is a circular RNA. In some embodiments, the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA. The present specification also provides a construct comprising a nucleic acid encoding a dRNA according to this aspect. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. In some embodiments, the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1. The present specification also provides a host cell comprising the construct or dRNA according to this aspect. The present specification also provides a kit for editing a target RNA in a host cell comprising the construct or dRNA according to this aspect.

[0022] In another aspect, the present disclosure also provides a deaminase recruiting RNA (dRNA) for editing a target RNA, comprising: (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence at the 3' and / or 5' end of the target RNA sequence; The dRNA provides a deaminase-recruiting RNA (dRNA) that can recruit RNA-specific adenosine deaminase (ADAR).

[0023] In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). In some embodiments, the snoRNA sequence is at least about 70 nucleotides in length. In some embodiments, the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the snoRNA sequence is a C / D box snoRNA sequence. In some embodiments, the snoRNA sequence is an H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is a composite snoRNA sequence with a C / D box and an H / ACA box. In some embodiments, the snoRNA sequence is an orphan snoRNA sequence. The present specification also provides a construct comprising a nucleic acid encoding a dRNA according to this aspect. In some embodiments, the construct further comprises a promoter operably linked to the nucleic acid encoding the dRNA. In some embodiments, the promoter is a polymerase II promoter ("Pol II promoter"). In some embodiments, the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA. The present specification also provides a host cell comprising the construct or dRNA of this aspect. The present specification also provides a kit for editing a target RNA in a host cell comprising the construct or dRNA of this aspect.

[0024] In another aspect, the present disclosure provides a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA) that is introduced into a host cell, comprising: (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0025] In some embodiments, the pol II promoter is a CMV promoter. In some embodiments, the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:3. In some embodiments, the construct is a viral vector or a plasmid. In some embodiments, the construct is an AAV vector. In some embodiments, the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA. The present specification also provides a host cell comprising the construct of this aspect. The present specification also provides a kit for editing a target RNA in a host cell comprising the construct of this aspect.

[0026] It should be noted that one, some, or all of the features of the various embodiments described herein may be combined to form other embodiments described in the present application. These and other embodiments of the present application are further described in the detailed description below. [Brief description of the drawings]

[0027] [Figure 1] FACS analysis after 48 h transfection with a plasmid expressing arRNA driven by a pol II promoter (CMV) and a plasmid expressing arRNA driven by a pol III promoter (U6) is shown. The EGFP positive percentage was normalized by the transfection efficiency, which is determined by the mCherry positive percentage. Data are means ± sd (n = 3). [Figure 2A]Figure 2 shows the mediation of targeted RNA editing on reporter mRNA by sno-arRNA151 flanked by snoRNA ends. Figure 2A shows a schematic diagram of the plasmid expressing arRNA. 151-ntarRNA of target fluorescent reporter-1 is expressed under the human U6 promoter. Figure 2B shows the FACS results for the results of sno-arRNA or arRNA transfection. sno-arRNA151, arRNA151, sno-Ctrl RNA151 or Ctrl RNA151 were transfected into HEK293T cells together with the plasmid expressing the reporter. Figure 2C shows the quantification of the FACS results in Figure 2B. [Figure 2B] Figure 2 shows the mediation of targeted RNA editing on reporter mRNA by sno-arRNA151 flanked by snoRNA ends. Figure 2A shows a schematic diagram of the plasmid expressing arRNA. 151-ntarRNA of target fluorescent reporter-1 is expressed under the human U6 promoter. Figure 2B shows the FACS results for the results of sno-arRNA or arRNA transfection. sno-arRNA151, arRNA151, sno-Ctrl RNA151 or Ctrl RNA151 were transfected into HEK293T cells together with the plasmid expressing the reporter. Figure 2C shows the quantification of the FACS results in Figure 2B. [Figure 2C] Figure 2 shows the mediation of targeted RNA editing on reporter mRNA by sno-arRNA151 flanked by snoRNA ends. Figure 2A shows a schematic diagram of the plasmid expressing arRNA. 151-ntarRNA of target fluorescent reporter-1 is expressed under the human U6 promoter. Figure 2B shows the FACS results for the results of sno-arRNA or arRNA transfection. sno-arRNA151, arRNA151, sno-Ctrl RNA151 or Ctrl RNA151 were transfected into HEK293T cells together with the plasmid expressing the reporter. Figure 2C shows the quantification of the FACS results in Figure 2B. [Figure 3A] The editing effect of sno-arRNA expressed by CMV promoter and sno-arRNA expressed by hU6 promoter is plotted. Figure 3A shows quantitative FACS results of sno-arRNA or arRNA derived from hU6 at different time points. Figure 3B shows quantitative FACS results of arRNA derived from CMV or hU6 at different time points. Figure 3C shows quantitative FACS results of sno-arRNA derived from CMV or hU6 at different time points. [Figure 3B] The editing effect of sno-arRNA expressed by CMV promoter and sno-arRNA expressed by hU6 promoter is plotted. Figure 3A shows quantitative FACS results of sno-arRNA or arRNA derived from hU6 at different time points. Figure 3B shows quantitative FACS results of arRNA derived from CMV or hU6 at different time points. Figure 3C shows quantitative FACS results of sno-arRNA derived from CMV or hU6 at different time points. [Figure 3C] The editing effect of sno-arRNA expressed by CMV promoter and sno-arRNA expressed by hU6 promoter is plotted. Figure 3A shows quantitative FACS results of sno-arRNA or arRNA derived from hU6 at different time points. Figure 3B shows quantitative FACS results of arRNA derived from CMV or hU6 at different time points. Figure 3C shows quantitative FACS results of sno-arRNA derived from CMV or hU6 at different time points. [Figure 4A]The editing effect when using circular arRNA in the LEAPER system is shown. Figure 4A shows a schematic diagram of circular arRNA expression. The circular arRNA transcript is flanked by 5' and 3' ligation sequences, which after self-cleavage are flanked by 5'-twister P3U2A and 3'-twister P1 ribozymes, respectively. The resulting RNA ends are recognized and ligated by RtcB. Figure 4B shows a schematic diagram of reporter-1 and reporter-3. The mChery and EGFP genes are linked by a sequence containing a 3x (for reporter-1) or 1x (for reporter-3) GGGGS coding region and an in-frame UAG stop codon. Cells reporting molecular expression only produce mCherry protein, whereas editing targeted to the UAG stop codon of the reporter transcript converts UAG to UIG, thereby allowing downstream EGFP expression. Figure 4C shows the experimental results of transfecting HEK293T cells stably expressing reporter-1 by seeding them in a 12-well plate (3 × 105 cells / well) with 1 μg of plasmids expressing circular arRNA71, circular arRNA25-71-25, circular arRNA50-71-50, circular arRNA111, circular arRNA25-111-25, circular arRNA50-111-50, circular Ctrl RNA123 (non-target sequence), arRNA71, Ctrl RNA71, arRNA111, and Ctrl RNA111. FACS analysis was performed 2 and 7 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. Figure 4D shows the results of an experiment in which HEK293T cells stably expressing reporter-3 were transfected in 12-well plates (3 × 105 cells / well) with 1 μg of plasmid expressing Ctrl RNA151 (circular), 31-, 51-, 71-, 91-, 111-, 131-, and 151-nt circular arRNA. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency.Figure 4E shows the results of co-transfection of HeLa and A549 cells seeded in 12-well plates (2 x 105 cells / well) with 0.5 μg of plasmid expressing reporter-1 and 0.5 μg of plasmid expressing circular arRNA111, respectively. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. [Figure 4B]The editing effect when using circular arRNA in the LEAPER system is shown. Figure 4A shows a schematic diagram of circular arRNA expression. The circular arRNA transcript is flanked by 5' and 3' ligation sequences, which after self-cleavage are flanked by 5'-twister P3U2A and 3'-twister P1 ribozymes, respectively. The resulting RNA ends are recognized and ligated by RtcB. Figure 4B shows a schematic diagram of reporter-1 and reporter-3. The mChery and EGFP genes are linked by a sequence containing a 3x (for reporter-1) or 1x (for reporter-3) GGGGS coding region and an in-frame UAG stop codon. Cells reporting molecular expression only produce mCherry protein, whereas editing targeted to the UAG stop codon of the reporter transcript converts UAG to UIG, thereby allowing downstream EGFP expression. Figure 4C shows the experimental results of transfecting HEK293T cells stably expressing reporter-1 by seeding them in a 12-well plate (3 × 105 cells / well) with 1 μg of plasmids expressing circular arRNA71, circular arRNA25-71-25, circular arRNA50-71-50, circular arRNA111, circular arRNA25-111-25, circular arRNA50-111-50, circular Ctrl RNA123 (non-target sequence), arRNA71, Ctrl RNA71, arRNA111, and Ctrl RNA111. FACS analysis was performed 2 and 7 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. Figure 4D shows the results of an experiment in which HEK293T cells stably expressing reporter-3 were transfected in 12-well plates (3 × 105 cells / well) with 1 μg of plasmid expressing Ctrl RNA151 (circular), 31-, 51-, 71-, 91-, 111-, 131-, and 151-nt circular arRNA. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency.Figure 4E shows the results of co-transfection of HeLa and A549 cells seeded in 12-well plates (2 x 105 cells / well) with 0.5 μg of plasmid expressing reporter-1 and 0.5 μg of plasmid expressing circular arRNA111, respectively. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. [Figure 4C]The editing effect when using circular arRNA in the LEAPER system is shown. Figure 4A shows a schematic diagram of circular arRNA expression. The circular arRNA transcript is flanked by 5' and 3' ligation sequences, which after self-cleavage are flanked by 5'-twister P3U2A and 3'-twister P1 ribozymes, respectively. The resulting RNA ends are recognized and ligated by RtcB. Figure 4B shows a schematic diagram of reporter-1 and reporter-3. The mChery and EGFP genes are linked by a sequence containing a 3x (for reporter-1) or 1x (for reporter-3) GGGGS coding region and an in-frame UAG stop codon. Cells reporting molecular expression only produce mCherry protein, whereas editing targeted to the UAG stop codon of the reporter transcript converts UAG to UIG, thereby allowing downstream EGFP expression. Figure 4C shows the experimental results of transfecting HEK293T cells stably expressing reporter-1 by seeding them in a 12-well plate (3 × 105 cells / well) with 1 μg of plasmids expressing circular arRNA71, circular arRNA25-71-25, circular arRNA50-71-50, circular arRNA111, circular arRNA25-111-25, circular arRNA50-111-50, circular Ctrl RNA123 (non-target sequence), arRNA71, Ctrl RNA71, arRNA111, and Ctrl RNA111. FACS analysis was performed 2 and 7 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. Figure 4D shows the results of an experiment in which HEK293T cells stably expressing reporter-3 were transfected in 12-well plates (3 × 105 cells / well) with 1 μg of plasmid expressing Ctrl RNA151 (circular), 31-, 51-, 71-, 91-, 111-, 131-, and 151-nt circular arRNA. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency.Figure 4E shows the results of co-transfection of HeLa and A549 cells seeded in 12-well plates (2 x 105 cells / well) with 0.5 μg of plasmid expressing reporter-1 and 0.5 μg of plasmid expressing circular arRNA111, respectively. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. [Figure 4D]The editing effect when using circular arRNA in the LEAPER system is shown. Figure 4A shows a schematic diagram of circular arRNA expression. The circular arRNA transcript is flanked by 5' and 3' ligation sequences, which after self-cleavage are flanked by 5'-twister P3U2A and 3'-twister P1 ribozymes, respectively. The resulting RNA ends are recognized and ligated by RtcB. Figure 4B shows a schematic diagram of reporter-1 and reporter-3. The mChery and EGFP genes are linked by a sequence containing a 3x (for reporter-1) or 1x (for reporter-3) GGGGS coding region and an in-frame UAG stop codon. Cells reporting molecular expression only produce mCherry protein, whereas editing targeted to the UAG stop codon of the reporter transcript converts UAG to UIG, thereby allowing downstream EGFP expression. Figure 4C shows the experimental results of transfecting HEK293T cells stably expressing reporter-1 by seeding them in a 12-well plate (3 × 105 cells / well) with 1 μg of plasmids expressing circular arRNA71, circular arRNA25-71-25, circular arRNA50-71-50, circular arRNA111, circular arRNA25-111-25, circular arRNA50-111-50, circular Ctrl RNA123 (non-target sequence), arRNA71, Ctrl RNA71, arRNA111, and Ctrl RNA111. FACS analysis was performed 2 and 7 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. Figure 4D shows the results of an experiment in which HEK293T cells stably expressing reporter-3 were transfected in 12-well plates (3 × 105 cells / well) with 1 μg of plasmid expressing Ctrl RNA151 (circular), 31-, 51-, 71-, 91-, 111-, 131-, and 151-nt circular arRNA. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency.Figure 4E shows the results of co-transfection of HeLa and A549 cells seeded in 12-well plates (2 x 105 cells / well) with 0.5 μg of plasmid expressing reporter-1 and 0.5 μg of plasmid expressing circular arRNA111, respectively. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. [Figure 4E]The editing effect when using circular arRNA in the LEAPER system is shown. Figure 4A shows a schematic diagram of circular arRNA expression. The circular arRNA transcript is flanked by 5' and 3' ligation sequences, which after self-cleavage are flanked by 5'-twister P3U2A and 3'-twister P1 ribozymes, respectively. The resulting RNA ends are recognized and ligated by RtcB. Figure 4B shows a schematic diagram of reporter-1 and reporter-3. The mChery and EGFP genes are linked by a sequence containing a 3x (for reporter-1) or 1x (for reporter-3) GGGGS coding region and an in-frame UAG stop codon. Cells reporting molecular expression only produce mCherry protein, whereas editing targeted to the UAG stop codon of the reporter transcript converts UAG to UIG, thereby allowing downstream EGFP expression. Figure 4C shows the experimental results of transfecting HEK293T cells stably expressing reporter-1 by seeding them in a 12-well plate (3 × 105 cells / well) with 1 μg of plasmids expressing circular arRNA71, circular arRNA25-71-25, circular arRNA50-71-50, circular arRNA111, circular arRNA25-111-25, circular arRNA50-111-50, circular Ctrl RNA123 (non-target sequence), arRNA71, Ctrl RNA71, arRNA111, and Ctrl RNA111. FACS analysis was performed 2 and 7 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. Figure 4D shows the results of an experiment in which HEK293T cells stably expressing reporter-3 were transfected in 12-well plates (3 × 105 cells / well) with 1 μg of plasmid expressing Ctrl RNA151 (circular), 31-, 51-, 71-, 91-, 111-, 131-, and 151-nt circular arRNA. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency.Figure 4E shows the results of co-transfection of HeLa and A549 cells seeded in 12-well plates (2 x 105 cells / well) with 0.5 μg of plasmid expressing reporter-1 and 0.5 μg of plasmid expressing circular arRNA111, respectively. FACS analysis was performed 2 days after transfection. The percentage of EGFP+ cells was normalized by transfection efficiency. [Diagram 5] FACS analysis after co-transfection of multiple circular arRNAs for 48 and 96 hours is shown, with the percentage of EGFP positive normalized to transfection efficiency determined by mCherry positivity. Data are means ± sd (n = 3). [Figure 6A] FACS analysis of HEK293T cells after co-transfection of multiple circular arRNAs for 48 and 96 hours. EGFP-positive percentages are normalized by transfection efficiency determined by mCherry-positive. Data are means ± sd (n=3). [Figure 6B] FACS analysis of HEK293T cells after co-transfection of multiple circular arRNAs for 48 and 96 hours. EGFP-positive percentages are normalized by transfection efficiency determined by mCherry-positive. Data are means ± sd (n=3). [Figure 7] Quantification of EGFP-positive (EGFP+) cells is shown. Cells stably expressing reporter-1 were infected with Tornado-Ctrl RNA111 viruses of various lengths and target Tornado-arRNA viruses, and FACS was performed 2 days after infection. Data are means ± sem (n = 2). DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0028] Provided herein are methods for RNA editing (referred to herein as the "improved LEAPER" method), as well as constructs comprising specifically designed RNAs, herein deaminase recruiting RNAs ("dRNAs") or ADAR recruiting RNAs ("arRNAs"), or nucleic acids encoding these dRNAs, for editing a target RNA in a host cell.

[0029] The inventors of the present application have developed "LEAPER" (Programmable RNA Editing with Endogenous ADARs) that utilizes endogenous ADARs to edit target RNAs using dRNAs (also called "arRNAs"). The LEAPER method is described in PCT / CN2018 / 110105 and PCT / CN2020 / 084922, the contents of which are incorporated herein by reference in their entirety. Specifically, a target RNA that is partially complementary to the target transcript is used to recruit native ADAR1 or ADAR2, which changes adenosine to inosine at specific sites in the target RNA. In this way, RNA editing can be achieved in a system without ectopically or overexpressing ADAR proteins in the host cell.

[0030] The present application provides an improved LEAPER method, which allows for improving the efficiency of RNA editing, for example by increasing the level of dRNA in a target cell. Meanwhile, the improved LEAPER method relates to the use of a circular dRNA or a dRNA capable of forming a circular RNA. In another aspect, the improved LEAPER method relates to the use of a dRNA comprising one or more small nucleolar RNAs (snoRNAs) linked to the 3' or 5' end of a target RNA sequence. In another aspect, the improved LEAPER method relates to a dRNA placed under the control of a polymerase II promoter ("Pol II promoter"). The improved LEAPER method has been demonstrated to significantly improve the efficiency of dRNA editing compared to the LEAPER method. Without being bound by theory, it is believed that the increased stability and amount of dRNA used in the improved LEAPER method contribute to such an improvement in RNA editing efficiency.

[0031] Thus, one aspect of the present application provides a method for editing a target RNA by one or more improved LEAPER methods.

[0032] In another embodiment, dRNAs and constructs for the improved LEAPER method are provided.

[0033] The present specification also provides methods and compositions for treating or preventing a disease or condition in an individual using the RNA editing methods.

[0034] I. Definition Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. All patents, applications, disclosed applications and other publications cited herein are incorporated herein in their entirety. If the definitions set forth in this section conflict or are inconsistent with the definitions set forth in the patents, applications or other publications incorporated herein by reference, the definitions set forth in this section shall take precedence over the definitions incorporated herein by reference.

[0035] It should be noted that some features of the disclosure described in the context of separate embodiments may be provided in combination in separate embodiments for clarity. Conversely, for brevity, various features of the disclosure described in the context of separate embodiments may be provided separately or as any suitable subset. All combinations of embodiments relating to specific method steps, reagents, or conditions are expressly encompassed by the disclosure and are disclosed herein as if each and every combination were separately and expressly disclosed.

[0036] As used in this specification and the appended claims, the singular forms "a / an" and "the" include plural referents unless the context clearly dictates otherwise. It is noted that the claims may be written to exclude any element. As such, such statements are intended as a predicate for using exclusive language such as "only," "only," and the like in conjunction with the specification of the claim elements, or as a "negative" limitation.

[0037] The terms "deaminase-recruiting RNA," "dRNA," "ADAR-recruiting RNA," and "arRNA" are used interchangeably herein and refer to engineered RNA that can recruit ADAR to deaminate a targeted adenosine in RNA.

[0038] The terms "polynucleotide," "nucleotide sequence," and "nucleic acid" are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides, ribonucleotides, or analogs thereof.

[0039] As used herein, the terms "adenine," "guanine," "cytosine," "thymine," "uracil," and "hypoxanthine" refer to nucleobases by themselves. The terms "adenosine," "guanosine," "cytidine," "thymidine," "uridine," and "inosine" refer to nucleobases partially linked to ribose or deoxyribose. The term "nucleoside" refers to nucleobases linked to ribose or deoxyribose. The term "nucleotide" refers to nucleobase-ribosyl-phosphate or nucleobase-deoxyribosyl-phosphate, respectively. The terms adenosine and adenine (abbreviated as "A"), guanosine and guanine (abbreviated as "G"), cytosine and cytidine (abbreviated as "C"), uracil and uridine (abbreviated as "U"), thymine and thymidine (abbreviated as "T"), inosine and hypoxanthine (abbreviated as "I") may be used interchangeably to mean the corresponding nucleobase, nucleoside, or nucleotide. In some cases, the terms nucleobase, nucleoside, and nucleotide may be used interchangeably unless the context clearly requires otherwise.

[0040] As used herein, the term "introducing / introduction" refers to the delivery of one or more polynucleotides (e.g., dRNA, or one or more constructs including the vectors described herein), one or more transcripts thereof, to a host cell. The present invention is used as a basic platform for targetable RNA editing, where the RNA is, for example, pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA (e.g., miRNA). The method of the present application can employ many delivery systems, including but not limited to viruses, liposomes, electroporation, microinjection, and conjugation, to introduce the dRNA or constructs described herein into a host cell. Conventional viral and non-viral based gene transfer methods are useful for nucleic acid transfer into mammalian cells or target tissues. Such methods can be used to administer nucleic acids encoding the dRNA of the present application to cells in cultured organisms or host organisms. Non-viral vector delivery systems include DNA plasmids, RNA (e.g., transcripts of the constructs described herein), bare nucleic acid, and nucleic acid complexed with a delivery vector such as a liposome. Viral vector delivery systems include DNA and RNA viruses with free or integrated genomes for delivery to a host cell.

[0041] In the context of this application, "target RNA" refers to an RNA sequence that deaminase recruiting RNA sequence is designed to have perfect or substantial complementarity, and the hybridization between the target sequence and dRNA forms a target adenosine-containing double-stranded RNA (dsRNA) region that recruits RNA-specific adenosine deaminase (ADAR) to deaminate the target adenosine.In some embodiments, the ADAR is naturally present in a host cell, such as a eukaryotic cell (e.g., a mammalian cell, such as a human cell).In some embodiments, the ADAR is introduced into a host cell.

[0042] As used herein, "complementarity" refers to the ability of a nucleic acid to form hydrogen bonds with another nucleic acid via conventional Watson-Crick base pairing. The percentage of complementarity represents the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (i.e., Watson-Crick base pairs) with a second nucleic acid (e.g., about 5, 6, 7, 8, 9, 10 in 10, i.e., about 50%, 60%, 70%, 80%, 90%, 100% complementarity). "Fully complementary" means that all contiguous residues of a nucleic acid sequence form hydrogen bonds with the same number of contiguous residues of the second nucleic acid sequence. As used herein, "substantially complementary" refers to a degree of complementarity of at least about 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or 100% over a region of about 40, 50, 60, 70, 80, 100, 150, 200, 250 or more nucleotides, or two nucleic acids that hybridize under stringent conditions.

[0043] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having a complementarity to a target sequence hybridizes primarily to said target sequence and does not substantially hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on many factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques In Biochemistry And Molecular Biology- Hybridization With Nucleic Acid Probes Part I, Second Chapter "Overview of principles of hybridization and the strategy of nucleic acid probe assay," Elsevier, N,Y.

[0044] "Hybridization" refers to a reaction in which one or more polynucleotides react to form a complex stabilized by hydrogen bonds between the bases of the nucleotide residues. The binding by hydrogen bonds may occur by Watson-Crick base pairing, Hoogstein binding, or other sequence-specific methods. A sequence that can hybridize to a given sequence is called the "complement" of the given sequence.

[0045] As used herein, the terms "comprising," "containing," and "including" are used in an open and non-limiting sense, and aspects and embodiments of the present application described herein may include aspects and embodiments that "consist of" and / or "consist essentially of."

[0046] It should be noted that, whether or not the term "about" is explicitly used, each numerical quantity given in this specification refers to the actual given value, as well as to approximations of the given value that would be reasonably estimated by one of ordinary skill in the art, including equivalents and approximations of experimental and / or measurement conditions based on the given value.

[0047] As used herein, a "carrier" includes a pharma- ceutically acceptable carrier, excipient, or stabilizer that is non-toxic to cells or mammals exposed thereto at the dosages and concentrations used. Physiologically acceptable carriers are usually pH-buffered aqueous solutions. Non-limiting examples of physiologically acceptable carriers include buffers such as phosphate, citrate, and other organic acids; antioxidants, including ascorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, and immunoglobulins; hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugar alcohols, such as mannitol and sorbitol; salt-forming counterions, such as sodium; and / or non-ionic surfactants, such as TWEEN®, polyethylene glycol (PEG), and PLURONICS®.

[0048] As used herein, the term "effective amount" or "therapeutically effective amount" of a substance is at least the minimum concentration required to bring about a measurable improvement or prevention of a particular disease. The effective amount herein may vary depending on factors such as the state of the disease, the age, sex, and weight of the patient, and the ability of the substance to cause a desired response in an individual. An effective amount is also an amount in which the therapeutic beneficial effects outweigh any toxic or detrimental effects of the treatment. In the context of cancer, an effective amount includes an amount sufficient to cause tumor shrinkage and / or reduce the rate of tumor growth (e.g., inhibit tumor growth), or prevent or delay the proliferation of other undesirable cells in the cancer. In some embodiments, an effective amount is an amount sufficient to delay the progression of the cancer. In some embodiments, an effective amount is an amount sufficient to prevent or delay recurrence. In some embodiments, an effective amount is an amount sufficient to reduce the recurrence rate of an individual. An effective amount can be administered in one or more doses. An effective amount of an agent or composition is one that (i) reduces the number of cancer cells, (ii) reduces the size of a tumor, (iii) inhibits, slows, reduces to some extent, and preferably stops, the invasion of cancer cells into surrounding organs, (iv) inhibits (i.e., reduces to some extent, and preferably stops) the metastasis of tumors, (v) inhibits the growth of tumors, (vi) prevents or delays the onset and / or recurrence of tumors, (vii) reduces the recurrence rate of tumors, and / or (viii) relieves to some extent one or more symptoms associated with cancer. An effective amount can be administered in one or more administrations. For purposes of this disclosure, an effective amount of an agent, compound, or pharmaceutical composition is an amount sufficient to directly or indirectly achieve prevention or treatment. As understood in the clinical context, an effective amount of an agent, compound, or pharmaceutical composition may or may not be achieved when combined with other agents, compounds, or pharmaceutical compositions. Thus, an "effective amount" is considered when administering one or more therapeutic agents, and an effective amount of a single agent may be considered to have been administered if the desired result is or has been achieved in combination with one or more other agents.

[0049] As used herein, "host cell" refers to any kind of cell that can be used as a host cell if it can be modified as described herein. For example, the host cell may be a host cell that has endogenously expressed RNA-specific adenosine deaminase (ADAR), or a host cell into which RNA-specific adenosine deaminase (ADAR) has been introduced by methods known in the art. The host cell may be, for example, a prokaryotic cell, a eukaryotic cell, or a plant cell. In some embodiments, the host cell is derived from a previously established cell line, such as a mammalian cell line, including a human cell line or a non-human cell line. In some embodiments, the host cell is derived from an individual, such as a human individual.

[0050] "Recombinant AAV vector (rAAV vector)" refers to a polynucleotide vector that contains one or more heterologous sequences (i.e., non-AAV derived nucleic acid sequences) flanked by at least one (in some embodiments, two) AAV inverted terminal repeat (ITR). Such rAAV vectors can replicate and package as infectious viral particles when present in a host cell that is infected with a suitable helper virus (or expresses suitable helper functions) and expresses the AAV rep and cap gene products (i.e., AAV Rep and Cap proteins). When the rAAV vector is integrated into a larger polynucleotide (e.g., in a chromosome or in another vector such as a plasmid for cloning or transfection), the rAAV vector may be referred to as a "pro-vector" and can be "rescued" by replication and encapsidation in the presence of AAV packaging functions and suitable accessory functions. rAAV vectors may be in any of a variety of forms, including, but not limited to, plasmids, linear artificial chromosomes, complexed with lipids, encapsulated in liposomes, and encapsidated into viral particles, particularly AAV particles. rAAV vectors may be packaged into AAV viral capsids to generate "recombinant adeno-associated viral particles (rAAV particles)."

[0051] The term "AAV inverted terminal repeat (ITR)" sequence is a sequence of about 145 nucleotides present at both ends of the naturally occurring single-stranded AAV genome and is widely known in the art. The outermost 125 nucleotides of the ITR can be in one of two arbitrary orientations, thereby providing heterogeneity between different AAV genomes and between the two ends of a single AAV genome. The outermost 125 nucleotides also contain several short self-complementary regions (referred to as A, A', B, B', C, C' and D regions), which allow intrastrand base pairing to occur within this portion of the ITR.

[0052] "Protocol" means instructions normally included in a commercial drug package that contain information regarding the indications normally included in a commercial drug package, including information regarding the indications, directions for use, dosage, method of administration, contraindications, other drugs used in combination with the packaged product, and / or warnings concerning the use of the drug.

[0053] A "subject," "patient," or "individual" includes a mammal, such as a human or other animal, typically a human. In some embodiments, a subject, such as a patient, to whom the therapeutic agents and compositions are administered is a mammal, typically a primate, such as a human. In some embodiments, the primate is a monkey or an ape. The subject may be male or female and of any suitable age, including infants, juveniles, adolescents, adults, and seniors. In some embodiments, the subject is a non-primate mammal, e.g., a farm animal, such as a rodent, dog, cat, cow, or horse.

[0054] As used herein, the term "treatment" refers to a clinical intervention designed to have a beneficial and desirable effect on the natural process of the individual or cells being treated in a clinical pathological process. For the purposes of this disclosure, the desirable effects of treatment include, but are not limited to, slowing the rate of progression of the disease, improving or reducing the disease state, and alleviating or improving the prognosis. For example, one or more symptoms associated with cancer are alleviated or eliminated, including, but not limited to, reducing the proliferation of cancer cells (or destroying cancer cells), increasing the killing of cancer cells, reducing symptoms of the disease, preventing the spread of the disease, preventing the recurrence of the disease, improving the quality of life of people affected by the disease, reducing the dosage of other drugs required to treat the disease, delaying the progression of the disease, and / or prolonging the survival of the individual, in which case the individual is considered to be successfully "treated."

[0055] II. RNA editing methods Provided herein are methods for editing a target RNA in a host cell (e.g., a eukaryotic cell) comprising introducing into the host cell a construct comprising a deaminase-recruiting RNA (dRNA) or a nucleic acid encoding the dRNA, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, and (2) the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR).

[0056] Circular dRNA In one aspect, the present specification provides a method for editing a target RNA in a host cell (e.g., a eukaryotic cell), comprising introducing into the host cell a construct comprising a deaminase-recruiting RNA (dRNA) or a nucleic acid encoding the dRNA, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR), and (3) the dRNA is a circular RNA or is capable of forming a circular RNA.

[0057] In some embodiments, the present disclosure provides a method for editing a target RNA in a host cell, comprising introducing a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA into the host cell, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA can recruit an ADAR endogenously expressed in the host cell to deaminate a target adenosine residue in the target RNA, and (3) the dRNA is a circular RNA or can form a circular RNA. In some embodiments, the method does not include introducing a construct comprising a nucleic acid encoding any protein or this protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas) into the host cell.

[0058] In some embodiments, a method for editing a target RNA in a host cell is provided, comprising introducing a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA into the host cell, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA can recruit an ADAR endogenously expressed in the host cell to deaminate a target adenosine residue in the target RNA, and (3) the dRNA is a circular RNA. In some embodiments, the method does not comprise introducing a construct comprising a nucleic acid encoding any protein or this protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas) into the host cell.

[0059] In some embodiments, the present disclosure provides a method for editing target RNA in a host cell, comprising introducing a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA into the host cell, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA can recruit an ADAR endogenously expressed in the host cell to deaminate a target adenosine residue in the target RNA, and (3) the dRNA is a linear RNA that can form a circular RNA. In some embodiments, the method does not include introducing a construct comprising a nucleic acid encoding any protein or this protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas) into the host cell.

[0060] In some embodiments, the present disclosure provides a method for editing a target RNA in a host cell, comprising introducing a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA into the host cell, and introducing an ADAR or a construct comprising a nucleic acid encoding the ADAR into the host cell, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA can recruit an ADAR to deaminate a target adenosine ("A") residue in the target RNA, and (3) the dRNA is a circular RNA or can form a circular RNA. In some embodiments, the ADAR is an endogenously encoded ADAR of a host cell, and introducing the ADAR comprises overexpressing an ADAR in the host cell. In some embodiments, the ADAR is exogenous to the host cell. In some embodiments, the construct comprising the nucleic acid encoding the ADAR is a vector, such as a plasmid or a viral vector (e.g., AAV or lentiviral vector).

[0061] In one aspect, the present application provides a method for editing multiple target RNAs (e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more) in a host cell by introducing multiple dRNAs or one or more constructs encoding said dRNAs into the host cell.

[0062] In one aspect, the dRNA is a linear RNA that can form a circular RNA. In some embodiments, circularization is performed using the Tornado expression system ("Twister-optimized RNA for sustained overexpression") described in Litke, JL and Jaffrey, SR Highly efficient expression of circular RNA aptamers in cells using autocatalytic transcripts. Nat Biotechnol 37,667-675 (2019), which is incorporated by reference in its entirety. In short, the transcript of Tornado expression contains a target RNA flanked by a twister ribozyme. A twister ribozyme is any catalytic RNA sequence capable of self-cleavage. The ribozyme undergoes rapid self-catalytic degradation, and the remaining ends are ligated with an RNA ligase.

[0063] In some embodiments, the dRNA is introduced by a construct comprising a nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. In some embodiments, the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1. In some embodiments, the dRNA is autocatalytically cleaved. In some embodiments, the catalyzed dRNA product comprises a 5'-hydroxyl group and a 2',3'-cyclic phosphate at the 3' end. In some embodiments, the catalyzed dRNA product is ligated by a generally present endogenous RNA ligase (e.g., RNA ligase RtcB). In some embodiments, the construct is a plasmid or a viral vector.

[0064] In some embodiments, the dRNA transcript further comprises a 5' and / or a 3' ligation sequence flanking it, respectively, a 5'-twister ribozyme and / or a 3'-twister ribozyme. In some embodiments, the dRNA comprises a 3' ligation sequence. In some embodiments, the dRNA comprises a 5' ligation sequence. In some embodiments, the dRNA further comprises a 3' ligation sequence and a 5' ligation sequence. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are completely complementary to each other.

[0065] In some embodiments, the length of the 3' ligation sequence and the 5' ligation sequence are, independently, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides. In some embodiments, the length of the 3' ligation sequence and the 5' ligation sequence are independently about 20-30 nucleotides, about 30-40 nucleotides, about 40-50 nucleotides, about 50-60 nucleotides, about 60-70 nucleotides, about 70-80 nucleotides, about 80-90 nucleotides, about 90-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 20-50 nucleotides, about 50-100 nucleotides, or about 100-150 nucleotides.

[0066] In some embodiments, the dRNA is circularized by RNA ligase.Non-limiting examples of RNA ligase include RtcB, T4RNA ligase 1, T4RNA ligase 2, Rnl3 and Trl1.In some embodiments, the RNA ligase is endogenously expressed in the host cell.In some embodiments, the RNA ligase is RNA ligase RtcB.In some embodiments, the method further comprises introducing RNA ligase (e.g., RtcB) into the host cell.

[0067] In some embodiments, the dRNA is cyclized before being introduced into a host cell. In some embodiments, the dRNA is chemically synthesized. In some embodiments, the dRNA is cyclized by in vitro enzymatic ligation (e.g., using RNA or DNA ligase) or chemical ligation (e.g., using cyanogen bromide or similar condensing agent).

[0068] dRNA with one or two snoRNA ends In another aspect, the application provides a method of editing a target RNA in a host cell (e.g., a eukaryotic cell) comprising introducing into the host cell a construct comprising a deaminase-recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that is at least partially complementary to said target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of said target RNA sequence, wherein said dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR).

[0069] In some embodiments, the present disclosure provides a method for editing a target RNA in a host cell (e.g., a eukaryotic cell), comprising introducing into the host cell a construct comprising a deaminase-recruiting RNA (dRNA) or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that is at least partially complementary to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA can recruit an endogenously expressed RNA-specific adenosine deaminase (ADAR) of the host cell to deaminate a target adenosine residue in the target RNA. In some embodiments, the method does not comprise introducing into the host cell a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas).

[0070] In some embodiments, the present disclosure provides a method for editing a target RNA in a host cell (e.g., a eukaryotic cell), comprising: (a) a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA; and (b) a construct comprising an ADAR or a nucleic acid encoding the ADAR, wherein the dRNA comprises (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA can recruit an ADAR to deaminate a target adenosine residue in the target RNA. In some embodiments, the ADAR is an ADAR that is endogenously encoded in the host cell, and the introduction of the ADAR comprises overexpression of the ADAR in the host cell. In some embodiments, the ADAR is exogenous to the host cell. In some embodiments, the construct comprising the nucleic acid encoding the ADAR is a vector, such as a plasmid or a viral vector (e.g., an AAV or lentiviral vector).

[0071] In one aspect, the present application provides a method for editing multiple target RNAs (e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more) in a host cell by introducing multiple dRNAs or one or more constructs encoding said dRNAs into the host cell.

[0072] Small nucleolar RNAs (snoRNAs) are small non-coding RNA molecules known to direct chemical modifications of other RNAs (e.g., ribosomal RNAs, transfer RNAs, and small nuclear RNAs). snoRNAs are divided into two types, box C / D and box H / ACA, according to their specific secondary structure features. The two structural features allow snoRNAs to bind to their corresponding RNA-binding proteins (RBPs) together with auxiliary proteins to form functional small nucleolar ribonucleoprotein (snoRNP) complexes. Box C / D snoRNAs are thought to be associated with methylation, while H / ACA box snoRNAs are thought to be associated with pseudouridylation. Other families of snoRNAs include, for example, complex H / ACA and C / D box snoRNAs, and orphan snoRNAs. The snoRNA sequences described herein may include naturally occurring snoRNAs, parts thereof, or variants thereof.

[0073] In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence") and a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). In some embodiments, the length of the snoRNA sequence is at least about 50 nucleotides, at least 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, or at least about 200 nucleotides. In some embodiments, the length of the snoRNA sequence is about 50-75 nucleotides, about 75-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 150-175 nucleotides, about 175-200 nucleotides, about 50-100 nucleotides, about 100-150 nucleotides, about 150-200 nucleotides, about 125-175 nucleotides, or about 100-200 nucleotides.

[0074] In some embodiments, the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1 (5'-AAGATTGTGTGGATCGATGATGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATTCTCGTCGAACTGAGGTCCAGCACATTACTCCAACAG-3'). In some embodiments, the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 2 (5'- GAGTGAGATCTTGGACCAATGATGACTTCCATACATGCATTCCTTGGAAAGCTGAACAAAATGAGTGGGAACTCTGTACTATCATCTTAGTTGAACTGAGGTCCACCGGGGGCTAA-3'). In some embodiments, the snoRNA sequence is a C / D box snoRNA sequence. In some embodiments, the snoRNA sequence is an H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is a composite snoRNA sequence of C / D box and H / ACA box. In some embodiments, the snoRNA sequence is an orphan snoRNA sequence.

[0075] Constructs with Pol II promoters In another aspect, the description provides a method of editing a target RNA in a host cell comprising introducing into the host cell a construct comprising a nucleic acid encoding a deaminase-recruiting RNA (dRNA), wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR), and (3) the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0076] In some embodiments, a method of editing a target RNA in a host cell is provided, comprising introducing into the host cell a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA), (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA is capable of recruiting an endogenously expressed RNA-specific adenosine deaminase (ADAR) of the host cell to deaminate a target adenosine residue in the target RNA, and (3) the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA. In some embodiments, the method does not comprise introducing into the host cell a construct comprising a nucleic acid encoding any protein or protein (e.g., Cas, ADAR, or a fusion protein of ADAR and Cas).

[0077] In some embodiments, the present disclosure provides a method for editing a target RNA in a host cell, comprising: (a) a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA); (b) a construct comprising an ADAR or a nucleic acid encoding the ADAR, wherein (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA; (2) the dRNA can recruit an RNA-specific adenosine deaminase (ADAR) and deaminate a target adenosine residue in the target RNA; and (3) the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA. In some embodiments, the ADAR is an endogenously encoded ADAR of a host cell, and the introduction of the ADAR comprises overexpression of an ADAR in the host cell. In some embodiments, the ADAR is exogenous to the host cell. In some embodiments, the construct comprising a nucleic acid encoding an ADAR is a vector, such as a plasmid or a viral vector (e.g., an AAV or lentiviral vector).

[0078] In one aspect, the present application provides a method of editing multiple target RNAs (e.g., at least about 2, 3, 4, 5, 10, 20, 50, 100, 1000 or more) in a host cell by introducing multiple dRNAs or one or more constructs encoding said dRNAs into the host cell. In some embodiments, one Pol II promoter (e.g., CMV) drives expression of two or more dRNAs.

[0079] Non-limiting examples of Pol II promoters include CMV, SV40, EF-1α, CAG, and RSV. In some embodiments, the Pol II promoter is a CMV promoter. In some embodiments, the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:3: (5'- CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGAC TTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGA CGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCT-3').

[0080] In some embodiments of any one of the methods described herein, the host cell is a prokaryotic cell. In some embodiments, the host cell is a eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell. In some embodiments, the host cell is a murine cell. In some embodiments, the host cell is a plant cell or a fungal cell.

[0081] In some embodiments of any one of the methods or uses described herein, the host cell is a cell line, such as HEK293T, HT29, A549, HepG2, RD, SF268, SW13 and HeLa cells. In some embodiments, the host cell is a primary cell, such as a fibroblast, an epithelial cell or an immune cell. In some embodiments, the host cell is a T cell. In some embodiments, the host cell is a post-mitotic cell. In some embodiments, the host cell is a cell of the central nervous system (CNS), such as a brain cell, e.g., a cerebellar cell.

[0082] In some embodiments of any one of the methods described herein, the ADAR is endogenous to the host cell. In some embodiments, the RNA-specific adenosine deaminase (ADAR) is naturally or endogenously present in the host cell, e.g., in a eukaryotic cell. In some embodiments, the ADAR is endogenously expressed by the host cell. In some embodiments, the ADAR is exogenously introduced into the host cell. In some embodiments, the ADAR is ADAR1 and / or ADAR2. In some embodiments, the ADAR is one or more ADARs selected from the group of hADAR1, hADAR2, mouse ADAR1, and ADAR2. In some embodiments, the ADAR is ADAR1, e.g., isotyped as p110 of ADAR1 ("ADAR1"). p110 " ) and / or the p150 isotype of ADAR1 (" ADAR1 p150" In some embodiments, the ADAR is ADAR2. In some embodiments, the ADAR is ADAR2 expressed by a host cell, for example, ADAR2 expressed by a cerebellar cell.

[0083] In some embodiments, the ADAR is an exogenous ADAR to host cell.In some embodiments, the ADAR is a hyperactive mutant of naturally occurring ADAR.In some embodiments, the ADAR is ADAR1 comprising E1008Q mutation.In some embodiments, the ADAR is not a fusion protein comprising a binding domain.In some embodiments, the ADAR does not comprise a genetically engineered double-stranded nucleic acid binding domain.In some embodiments, the ADAR does not comprise an MCP domain that is bound to an MS2 hairpin that is fused to a complementary RNA sequence in the dRNA.In some embodiments, the ADAR does not comprise DSB.

[0084] In some embodiments of any one of the methods described herein, the host cell has a high ADAR1 expression level (e.g., ADAR1 p110 and / or ADAR1 p150 ), e.g., at least about any one of 10%, 20%, 50%, 100%, 2x, 3x, 5x or more relative to the protein expression level of β-tubulin. In some embodiments, the host cell has a high ADAR2 expression level, e.g., at least about 10%, 20%, 50%, 100%, 2x, 3x, 5x or more relative to the protein expression level of β-tubulin. In some embodiments, the host cell has a low ADAR3 expression level, e.g., at least about 5x, 3x, 2x, 100%, 50%, 20% or less relative to the protein expression level of β-tubulin.

[0085] In some embodiments of any one of the methods described herein, the dRNA comprises at least about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In some embodiments of any one of the methods described herein, the dRNA comprises no more than about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In some embodiments, the length of the dRNA is any one of about 40 to 260, 45 to 250, 50 to 240, 60 to 230, 65 to 220, 70 to 220, 70 to 210, 70 to 200, 70 to 190, 70 to 180, 70 to 170, 70 to 160, 70 to 150, 70 to 140, 70 to 130, 70 to 120, 70 to 110, 70 to 100, 70 to 90, 70 to 80, 75 to 200, 80 to 190, 85 to 180, 90 to 170, 95 to 160, 100 to 200, 100 to 150, 100 to 175, 110 to 200, 110 to 175, 110 to 150, or 105 to 140 nucleotides.

[0086] In some embodiments of any one of the methods or uses described herein, the dRNA does not include an ADAR-recruitment domain. An "ADAR recruitment domain" may be a nucleotide sequence or structure that binds to ADAR with high affinity, or may be a nucleotide sequence that binds to a binding partner of ADAR fused to an engineered ADAR construct. Exemplary ADAR recruitment domains include, but are not limited to, GluR-2, GluR-B(R / G), GluR-B(Q / R), GluR-6(R / G), 5HT2C, and FlnA(Q / R) domains, see, for example, Wahlstedt, Helene, and Marie, "Site-selective versus promiscuous A-to-I editing. " Wiley Interdisciplinary Reviews: RNA 2.6 (2011): 20 761-771, which is incorporated herein by reference. In some embodiments, the dRNA does not include a double-stranded portion. In some embodiments, the dRNA does not include a hairpin such as an MS2 stem loop. In some embodiments, the dRNA is single stranded. In some embodiments, the dRNA does not comprise a DSB binding domain. In some embodiments, the dRNA consists of (or consists essentially of) a complementary RNA sequence.

[0087] In some embodiments of any one of the methods described herein, the dRNA does not contain chemical modifications. In some embodiments, the dRNA does not contain chemically modified nucleotides, such as 2'-O-methyl nucleotides or nucleotides with phosphorothioate linkages. In some embodiments, the dRNA contains 2'-O-methyl and phosphorothioate linkage modifications at only the first three and last three residues. In some embodiments, the dRNA is not an antisense oligonucleotide (ASO).

[0088] The dRNA described herein comprises a target RNA sequence that is at least partially complementary to the target RNA. In some embodiments of any one of the methods described herein, the target RNA sequence in the dRNA comprises at least about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In some embodiments of any one of the methods described herein, the target RNA sequence in the dRNA comprises no more than about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In some embodiments, the nucleotide length of the target RNA sequence in the dRNA is about 40 to 260, 45 to 250, 50 to 240, 60 to 230, 65 to 220, 70 to 220, 70 to 210, 70 to 200, 70 to 190, 70 to 180, 70 to 170, 70 to 160, 1070 to 150, 70 to 140, 70 to 130, 70 to 120, 70 to 110, 70 to 150, 70 to 160, 70 to 180, 70 to 190, 70 to 200, 70 to 220, 70 to 230, 70 to 240, 70 to 250, 70 to 260, 70 to 270, 70 to 280, 70 to 290, 70 to 300, 70 to 310, 70 to 320, 70 to 330, 70 to 340, 70 to 350, 70 to 360, 70 to 370, 70 to 380, 70 to 390, 70 to 400, 70 to 410, 70 to 420, 70 to 430, 70 to 440, 70 to 450, 70 to 460, 70 to 470, 70 to 480, 70 to 490, 70 to 500, 70 to 500, 70 to 510, 70 to 520, 70 The length of the target RNA sequence in the dRNA is any one of 0 to 100, 70 to 90, 70 to 80, 75 to 200, 80 to 190, 85 to 180, 90 to 170, 95 to 160, 100 to 200, 100 to 150, 100 to 175, 110 to 200, 110 to 160, 110 to 175, 110 to 150, 140 to 160, 105 to 140, or 105 to 155 nucleotides. In some embodiments, the length of the target RNA sequence in the dRNA is about 71 nucleotides. In some embodiments, the length of the dRNA is about 111 nucleotides. In some embodiments, the length of the dRNA is about 151 nucleotides.

[0089] In some embodiments, the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite a target adenosine residue in the target RNA. In some embodiments, the target RNA sequence comprises a cytidine mismatch directly opposite a target adenosine residue in the target RNA. In some embodiments, the cytidine mismatch is at least 5 nucleotides, e.g., at least 10, 15, 20, 25, 30 or more nucleotides, from the 5' end of the target RNA sequence. In some embodiments, the cytidine mismatch is at least 20 nucleotides, e.g., at least 25, 30, 35 or more nucleotides, from the 3' end of the complementary RNA sequence. In some embodiments, the cytidine mismatch is not present within 20 (e.g., 15, 10, 5 or less) nucleotides from the 3' end of the target RNA sequence. In some embodiments, the cytidine mismatch is present at least 20 nucleotides (e.g., at least 25, 30, 35 or more nucleotides) from the 3' end of the target RNA sequence and at least 5 nucleotides (e.g., at least 10, 15, 20, 25, 30 or more nucleotides) from the 5' end of the target RNA sequence. In some embodiments, the cytidine mismatch is located in the center of the target RNA sequence. In some embodiments, the cytidine mismatch is located within 20 nucleotides (e.g., 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide) of the center of the target sequence in the dRNA.

[0090] In some embodiments of any one of the methods described herein, the target RNA sequence further comprises one or more guanosines (G), such as 1, 2, 3, 4, 5, 6, or multiple Gs, i.e., each G is opposite a non-target adenosine in the target RNA. In some embodiments, the target RNA sequence comprises two or more consecutive mismatched nucleotides (e.g., 2, 3, 4, 5 or more mismatched nucleotides) opposite a non-target adenosine (A) in the target RNA.

[0091] In some embodiments, the target RNA comprises about 20 or less non-targeting A, for example, about 15, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 non-targeting A. A mismatched nucleotide that is contiguous with a G opposite the non-targeting A can reduce the off-target editing effect of ADAR.

[0092] In some embodiments of any one of the methods described herein, the 5'-most adjacent to the target adenosine residue is a nucleotide selected from U, C, A, and G, with a preference of U>C≈A>G, and the 3'-most adjacent to the target adenosine residue is a nucleotide selected from G, C, A, and U, with a preference of G>C>A≈U. In some embodiments, the target adenosine residue is in a three base motif in the target RNA selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU. In some embodiments, the three base motif is UAG, and the dRNA includes an A directly opposite the U in the three base motif, a C directly opposite the target A, and a C, G, or U directly opposite the G in the three base motif. In some embodiments, the three-base motif is UAG in the target RNA, and the dRNA comprises ACC, ACG, or ACU opposite the UAG of the target RNA. In some embodiments, the three-base motif is UAG in the target RNA, and the dRNA comprises ACC opposite the UAG of the target RNA.

[0093] In some embodiments of any one of the methods described herein, the target RNA is any one RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA, and small RNA (e.g., miRNA). In some embodiments, the target RNA is pre-messenger RNA. In some embodiments, the target RNA is messenger RNA.

[0094] In some embodiments of any one of the methods described herein, the method further comprises introducing an inhibitor of ADAR3 into the host cell. In some embodiments, the inhibitor of ADAR3 is an RNAi against ADAR3, such as an shRNA against ADAR3 or an siRNA against ADAR3. In some embodiments, the method further comprises introducing an interferon stimulant into the host cell. In some embodiments, the ADAR may be induced by interferon, e.g., the ADAR may be induced by ADAR p150 In some embodiments, the interferon stimulator is IFN. In some embodiments, the ADAR3 inhibitor and / or the interferon stimulator is encoded by the same construct (e.g., vector) that encodes the dRNA.

[0095] In some embodiments of any one of the methods described herein, the editing efficiency of the target RNA is at least about 10%, e.g., at least about any one of 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or more. In some embodiments, the editing efficiency of the target RNA is at least about 40%. In some embodiments, the editing efficiency is determined by Sanger sequencing. In some embodiments, the editing efficiency is determined by next generation sequencing. In some embodiments, the editing efficiency is determined by assessing expression of a reporter gene (e.g., a fluorescent reporter such as EGFP).

[0096] In some embodiments of any one of the methods described herein, the method has a low off-target editing rate. In some embodiments, the method has an editing efficiency of less than about 1% (e.g., about any one of 0.5%, 0.1%, 0.05%, 0.01%, 0.001% or less) for non-target A in the target RNA. In some embodiments, the method does not edit non-target A in the target RNA. In some embodiments, the method has an editing efficiency of less than about 0.1% (e.g., about any one of 0.5%, 0.1%, 0.05%, 0.01%, 0.001% or less) for A in the non-target RNA.

[0097] In some embodiments of any one of the methods described herein, the method does not induce an immune response, such as an innate immune response. In some embodiments, the method does not induce expression of interferon and / or interleukin in a host cell. In some embodiments, the method does not induce expression of IFN-β and / or IL-6 in a host cell.

[0098] Also provided is an edited RNA or a host cell having an edited RNA produced by any one of the methods described herein. In some embodiments, the edited RNA comprises inosine. In some embodiments, the host cell comprises an RNA having a missense mutation, a premature stop codon, an alternative splicing site, or an aberrant splicing site. In some embodiments, the host cell comprises a mutated protein, a truncated protein, or a misfolded protein.

[0099] Non-viral delivery methods of nucleic acids include lipofection, nucleofection, microinjection, biolistic techniques, virosomes, liposomes, immunoliposomes, polycation or lipid:nucleic acid conjugates, electroporation, nanoparticles, exomers, microbubbles or gene guns, naked DNA, and artificial virus particles.

[0100] RNA or DNA virus-based systems for nucleic acid delivery are efficient in targeting viruses to specific cells and transporting the viral payload to the cell nucleus.

[0101] In some embodiments of any one of the methods described herein, the method includes introducing a viral vector (e.g., an AAV or lentiviral vector) encoding the dRNA into a host cell. In some embodiments, the vector is a recombinant adeno-associated viral (rAAV) vector. In some embodiments, the construct is flanked by one or more AAV inverted terminal repeat (ITR) sequences. In some embodiments, the construct is flanked by two AAV ITRs. In some embodiments, the AAV ITR is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAVDJ, caprine AAV, bovine AAV, or murine AAV serotype ITR. In some embodiments, the AAV ITR is an AAV2 ITR. In some embodiments, the vector further comprises a stuffer nucleic acid. In some embodiments, the stuffer nucleic acid is located upstream or downstream of the nucleic acid encoding the dRNA. In some embodiments, the vector is a self-complementary rAAV vector. In some embodiments, the vector comprises a first nucleic acid sequence encoding the dRNA and a second nucleic acid sequence encoding the complementary sequence of the dRNA, and the first nucleic acid sequence can form intrastrand base pairs with the second nucleic acid sequence along most or all of its length. In some embodiments, the first nucleic acid sequence and the second nucleic acid sequence are linked by a mutated AAV ITR, and the mutated AAV ITR comprises a deletion of the D region and a mutation of the terminal release sequence. In some embodiments, the vector is packaged in the rAAV particle by a capsid.In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, 15AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAVDJ, AAV2N587A, AAV2E548A, AAV2N708A, AAV2V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, caprine AAV, AAV1 / AAV2 chimera, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid.

[0102] In some embodiments, the method includes introducing a plasmid encoding the dRNA into a host cell. In some embodiments, the method includes electroporating the dRNA (e.g., a synthetic dRNA) into a host cell. In some embodiments, the method includes transfecting the dRNA into a host cell.

[0103] After deamination, modification of the target RNA and / or the protein encoded by said target RNA can be determined using different methods depending on the location of the target adenosine in the target RNA. For example, to determine whether "A" in the target RNA has been edited to "I", RNA sequencing methods known in the art can be used to detect the modification of the RNA sequence. The RNA editing can result in a change in the amino acid sequence encoded by the mRNA if the target adenosine is located in the coding region of the mRNA. For example, a point mutation can be introduced into the native mRNA by transformation of "A" to "I", or an acquired point mutation in the mRNA can be reversed to generate a wild-type gene product. Sequencing of amino acids by methods known in the art is useful for discovering changes in amino acid residues in the encoded protein. Modification of a stop codon can be determined by evaluating the presence of functional, extendible, truncated, full-length and / or wild-type proteins. For example, modifications to a target adenosine residue (UGA or UAG) or A (UAA) can generate read-through mutations and / or extended proteins if the target adenosine is located at a UGA, UAG or UAA stop codon, or can reverse a truncated protein encoded by the target RNA to generate a functional, full-length and / or wild-type protein. Editing of a target RNA can also generate aberrant and / or alternative splicing sites in the target RNA, thereby generating an extended, truncated or misfolded protein, or reverse an aberrant or alternative splicing site encoded in the target RNA to generate a functional, correctly folded, full-length and / or wild-type protein. In some embodiments, the present application contemplates editing of congenital and acquired genetic alterations, such as missense mutations, premature stop codons, aberrant or alternative splicing sites encoded by a target RNA.Known methods can be used to assess the function of the protein encoded by the target RNA to find out whether the RNA editing achieves the desired effect. Since the deamination of adenosine (A) to inosine (I) can correct the mutation A at the target site in the mutant RNA encoding the protein, the identification of the deaminated inosine can assess the presence or absence of a functional protein, or whether the RNA associated with disease or drug resistance due to the presence of the mutant adenosine is reversed or partially reversed. Similarly, the deamination of adenosine (A) to inosine (I) can introduce a point mutation in the resulting protein, so identifying the deamination to inosine can provide a functional indicator for identifying the cause of a disease or a disease-related factor.

[0104] This read-out can be the evaluation of the occurrence and frequency of aberrant splicing, if the presence of target adenosine causes aberrant splicing.On the other hand, if it is desired to deaminate target adenosine to introduce a splicing site, similar methods can be used to check whether the desired type of splicing occurs.Exemplary methods suitable for identifying the presence of inosine after deamination of target adenosine, using methods known to those skilled in the art, are RT-PCR and sequencing.

[0105] The deamination of the target adenosine includes, for example, point mutations, premature stop codons, aberrant splice sites, alternative splice sites, and misfolding of the resulting protein. These effects can induce changes in the structure and function of RNA and / or proteins associated with disease, whether inherited or resulting from acquired genetic mutations, or associated with the development of drug resistance. Thus, the dRNAs, constructs encoding said dRNAs, and RNA editing methods of the present application are useful for preventing or treating inherited genetic diseases or conditions, or diseases or conditions associated with acquired genetic mutations, by altering the structure and / or function of RNA and / or proteins associated with the disease.

[0106] In some embodiments, the target RNA is a regulatory RNA. In some embodiments, the target RNA to be edited is a ribosomal RNA, a transfer RNA, a long non-coding RNA, or a small RNA (e.g., miRNA, pri-miRNA, pre-miRNA, piRNA, siRNA, snoRNA, snRNA, exRNA, or scaRNA). The deamination of the target adenosine includes, for example, a change in the structure and function of the ribosomal RNA, transfer RNA, long non-coding RNA, or small RNA (e.g., miRNA), for example, a change in the three-dimensional structure and / or a loss of function or a gain of function of the target RNA. In some embodiments, the deamination of target A in the target RNA changes the expression level of one or more downstream molecules (e.g., proteins, RNAs, and / or metabolites) of the target RNA. The change in the expression level of the downstream molecule may be an increase or decrease in expression level.

[0107] Some embodiments of the present application relate to multiplex editing of target RNA in a host cell, which is useful for screening different variants of a target gene or different genes in a host cell. In some embodiments, the method includes introducing multiple dRNAs into a host cell, where at least two of the multiple dRNAs have different sequences and / or different target RNAs. In some embodiments, each dRNA has a different sequence and / or a different target RNA. In some embodiments, the method generates multiple (e.g., at least 2, 3, 5, 10, 50, 100, 1000 or more) modifications in a single target RNA in a host cell. In some embodiments, the method generates modifications in multiple (e.g., at least 2, 3, 5, 10, 50, 100, 1000 or more) target RNAs in a host cell. In some embodiments, the method includes editing multiple target RNAs in multiple host cell populations. In some embodiments, each population of host cells receives a different dRNA or a dRNA with a different target RNA from other host cell populations.

[0108] III. Deaminase-Recruiting RNAs, Constructs and Libraries In addition, the present specification also provides a deaminase recruiting RNA or construct that can be used in any of the methods described herein. Any of the dRNAs or constructs described in this section can be used to edit and process RNA as described herein. It is intended that any features and parameters for the dRNAs or constructs described herein can be combined with each other as if each combination was described separately. The dRNAs described herein do not include tracrRNA, crRNA, or gRNA used in CRISPR / Cas system. In some embodiments, a deaminase recruiting RNA (dRNA) is provided that recruits ADAR to deaminate target adenosine in target RNA, the dRNA comprising a complementary RNA sequence that hybridizes to the target RNA.

[0109] In one aspect, the present invention provides a construct comprising any one of the deaminase-recruiting RNAs described herein. In some embodiments, the construct is a viral vector (e.g., a lentiviral vector) or a plasmid. In some embodiments, the construct encodes a single dRNA. In some embodiments, the construct encodes multiple (e.g., about 1, 2, 3, 4, 5, 10, 20 or more) dRNAs.

[0110] In one aspect, the present application provides a library comprising a plurality of deaminase recruiting RNAs or a plurality of constructs described herein.

[0111] In one aspect, the present application provides a composition or a host cell comprising a deaminase recruiting RNA or a construct described herein. In some embodiments, the host cell is a prokaryotic or eukaryotic cell. In some embodiments, the host cell is a mammalian cell. In some embodiments, the host cell is a human cell.

[0112] Circular dRNA and constructs In one aspect, the present specification provides a deaminase-recruiting RNA (dRNA) that edits a target RNA, wherein the target RNA comprises a target RNA sequence that is at least partially complementary to the target RNA, the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR), and the dRNA is circular or capable of forming a circular RNA.

[0113] In some embodiments, the dRNA is a linear RNA that can form a circular RNA. In some embodiments, the dRNA is circularized by the Tornado method. In some embodiments, the dRNA transcript is also flanked by 5' and / or 3' ligation sequences, which are 5'-twister ribozymes and / or 3'-twister ribozymes, respectively. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% complementary to each other. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are perfectly complementary to each other.

[0114] In some embodiments, the length of the 3' ligation sequence and the 5' ligation sequence are independently at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, at least about 40 nucleotides, at least about 45 nucleotides, at least about 50 nucleotides, at least about 55 nucleotides, at least about 60 nucleotides, at least about 65 nucleotides, at least about 70 nucleotides, at least about 75 nucleotides, at least about 80 nucleotides, at least about 85 nucleotides, at least about 90 nucleotides, at least about 95 nucleotides, or at least about 100 nucleotides. In some embodiments, the 3' ligation sequence and the 5' ligation sequence are independently about 20 to 30 nucleotides, about 30 to 40 nucleotides, about 40 to 50 nucleotides, about 50 to 60 nucleotides, about 60 to 70 nucleotides, about 70 to 80 nucleotides, about 80 to 90 nucleotides, about 90 to 100 nucleotides, about 100 to 125 nucleotides, about 125 to 150 nucleotides, about 20 to 50 nucleotides, or about 50 to 100 nucleotides, or about 100 to 150 nucleotides.

[0115] In some embodiments, the dRNA is cyclized by RNA ligase. In some embodiments, the RNA ligase is endogenously expressed in host cells. In some embodiments, the RNA ligase is RNA ligase RtcB. In some embodiments, the RNA ligase RtcB is endogenously expressed in host cells. In some embodiments, the dRNA is cyclized by in vitro enzymatic ligation (e.g., using RNA or DNA ligase) or chemical ligation (e.g., using cyanogen bromide or similar condensing agent).

[0116] The present specification also provides a construct comprising a nucleic acid encoding the dRNA. In some embodiments, the dRNA is introduced by a construct comprising a nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. In some embodiments, the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. In some embodiments, the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1. In some embodiments, the dRNA is autocatalytically cleaved. In some embodiments, the catalyzed dRNA product comprises a 5'-hydroxyl and a 2',3'-cyclic phosphate at the 3' end. In some embodiments, the catalyzed dRNA product is ligated by a generally present endogenous RNA ligase (e.g., RNA ligase RtcB). In some embodiments, the construct is a plasmid or a viral vector.

[0117] dRNAs and constructs with one or two snoRNA ends In another aspect, the present specification provides a deaminase-recruiting RNA (dRNA) that edits a target RNA, the dRNA comprising: (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence located at the 3' and / or 5' end of the target RNA sequence, the dRNA being capable of recruiting an RNA-specific adenosine deaminase (ADAR).

[0118] In some embodiments, the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). In some embodiments, the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). In some embodiments, the length of the snoRNA sequence is at least 50 nucleotides, at least 60 nucleotides, at least about 70 nucleotides, at least about 80 nucleotides, at least about 90 nucleotides, at least about 100 nucleotides, at least about 110 nucleotides, at least about 120 nucleotides, at least about 130 nucleotides, at least about 140 nucleotides, at least about 150 nucleotides, at least about 160 nucleotides, at least about 170 nucleotides, at least about 180 nucleotides, at least about 190 nucleotides, or at least about 200 nucleotides. In some embodiments, the length of the snoRNA sequence is about 50-75 nucleotides, about 75-100 nucleotides, about 100-125 nucleotides, about 125-150 nucleotides, about 150-175 nucleotides, about 175-200 nucleotides, about 50-100 nucleotides, about 100-150 nucleotides, about 150-200 nucleotides, about 125-175 nucleotides, or about 100-200 nucleotides.

[0119] In some embodiments, the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 1. In some embodiments, the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO: 2. In some embodiments, the snoRNA sequence is a C / D box snoRNA sequence. In some embodiments, the snoRNA sequence is a H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is a composite C / D box and H / ACA box snoRNA sequence. In some embodiments, the snoRNA sequence is an orphan snoRNA sequence.

[0120] Constructs with Pol II promoters In another aspect, the description provides a construct comprising a nucleic acid encoding a deaminase-recruiting RNA (dRNA) to be introduced into a host cell, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, (2) the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR), and (3) the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0121] In some embodiments, a Pol II promoter is operably linked to a coding nucleotide sequence such that the promoter controls the transcription or expression of the coding nucleotide sequence. The Pol II promoter may be 5' (upstream) of the coding nucleotide sequence under its control. The distance between the Pol II promoter and the coding sequence may be approximately the same as the distance between the promoter and the gene it controls from the gene from which the promoter is derived. As is known in the art, variations in this distance can be accommodated without loss of promoter function. In some embodiments, the construct comprises a 5'UTR and / or a 3'UTR that regulate the transcription or expression of the coding nucleotide sequence. In some embodiments, the Pol II promoter is a CMV promoter. In some embodiments, the CMV promoter comprises the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, one Pol II promoter (e.g., CMV) drives the expression of two or more dRNAs.

[0122] In some embodiments of any one of the dRNAs, constructs, libraries, or compositions described herein, the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite the target adenosine to be edited in the target RNA. In some embodiments, the target RNA sequence further comprises one or more guanosines directly opposite each of the non-target adenosines in the target RNA. In some embodiments, the 5'-nearest neighbor of the target adenosine residue is a nucleotide selected from U, C, A, and G, with a preference of U>C≈A>G, and the 3'-nearest neighbor of the target adenosine residue is a nucleotide selected from G, C, A, and U, with a preference of G>C>A≈U. In some embodiments, the 5'-nearest neighbor of the target adenosine residue is U. In some embodiments, the 5'-nearest neighbor of the target adenosine residue is C or A. In some embodiments, the 3'-nearest neighbor of the target adenosine residue is G. In some embodiments, the 3'-most neighbor of the target adenosine residue is a C.

[0123] In some embodiments of any one of the dRNAs, constructs, libraries, or compositions described herein, the target adenosine residue in the target RNA is in a three base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU. In some embodiments, the three base motif is UAG, and the dRNA comprises an A directly opposite the U in the three base motif, a C directly opposite the target A, and a C, G, or U directly opposite the G in the three base motif. In some embodiments, the three base motif in the target RNA is UAG, and the dRNA comprises an ACC, ACG, or ACU opposite the UAG in the target RNA.

[0124] In some embodiments, the dRNA comprises a cytidine mismatch directly opposite the target adenosine residue in the target RNA.In some embodiments, the cytidine mismatch is near the center of the complementary RNA sequence, such as within 20, 15, 10, 5, 4, 3, 2, or 1 nucleotide from the center of the complementary RNA sequence.In some embodiments, the cytidine mismatch is at least 5 nucleotides from the 5' end of the complementary RNA sequence.In some embodiments, the cytidine mismatch is at least 20 nucleotides from the 3' end of the complementary RNA sequence.

[0125] In some embodiments of any one of the dRNAs, constructs, libraries, or compositions described herein, the dRNA comprises any one of greater than about 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, or 250 nucleotides. In some embodiments, the length of the dRNA is any one of about 40 to 260, 45 to 250, 50 to 240, 60 to 230, 65 to 220, 70 to 210, 70 to 200, 70 to 190, 70 to 180, 70 to 170, 70 to 160, 70 to 150, 70 to 140, 70 to 130, 70 to 120, 70 to 110, 70 to 100, 70 to 90, 70 to 80, 75 to 200, 80 to 190, 85 to 180, 90 to 170, 95 to 160, 100 to 150, or 105 to 140 nucleotides.

[0126] The dRNA of the present application comprises a target RNA sequence that hybridizes to the target RNA. The target RNA sequence is fully complementary or substantially complementary to the target RNA, allowing the target RNA sequence to hybridize to the target RNA. In some embodiments, the target RNA sequence has 100% sequence complementarity with the target RNA. In some embodiments, the target RNA sequence is complementary to at least about 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% or more of a continuous stretch of at least about 20, 40, 60, 80, 100, 150, 200 or more nucleotides in the target RNA. In some embodiments, the dsRNA formed by hybridization between the target RNA sequence and the target RNA has one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) non-Watson-Crick base pairs (i.e., mismatches).

[0127] ADARs, such as human ADAR enzymes, edit double-stranded RNA (dsRNA) structures with different specificities depending on many factors. One important factor is the degree of complementarity of the two strands that make up the dsRNA sequence. Perfect complementarity between the dRNA and the target RNA usually results in non-discriminatory deamination of adenosines by the catalytic domain of the ADAR. The specificity and efficiency of the ADAR can be modified by introducing mismatches into the dsRNA region. For example, AC mismatches are preferably recommended because they increase the specificity and efficiency of deamination of the adenosine to be edited. Conversely, GA mismatches can reduce off-target editing at other A (adenosine) positions other than the target adenosine residue (i.e., "non-target A"). The formation of dsRNA between a dRNA and its target RNA does not necessarily require perfect complementarity, as long as the hybridization and formation of dsRNA between the dRNA and the target RNA has basic complementarity. In some embodiments, the dRNA sequence or single stranded RNA region thereof has 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity with the target RNA when optimally aligned. Optimal alignment may be determined using any suitable algorithm used for sequence alignment, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wimsch algorithm, and algorithms based on the Burrows-Wheeler transformation (e.g., Burrows Wheeler Aligner).

[0128] The nucleotide adjacent to the target adenosine also affects the specificity and efficiency of deamination.For example, with regard to the specificity and efficiency of adenosine deamination, the priority of the 5'-nearest neighbor of the target adenosine to be edited in the target RNA sequence is U>C≒A>G, and the priority of the 3'-nearest neighbor of the target adenosine to be edited in the target RNA sequence is G>C>A≒U.In some embodiments, when the target adenosine in the target RNA can be in a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU, the specificity and efficiency of adenosine deamination is higher than that of adenosines in other three-base motifs. In some embodiments, when the target adenosine to be edited is in a three-base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, AAG, AAC or AAA, the deamination efficiency of adenosine is much higher than that of adenosines in other motifs.For the same three-base motif, different dRNA designs may also have different deamination efficiency.Take the three-base motif UAG as an example, in some embodiments, when the dRNA contains cytidine (C) directly opposite the target adenosine to be edited, adenosine (A) directly opposite uridine, and cytidine (C), guanosine (G) or uridine (U) directly opposite guanosine, the target adenosine is deaminated more efficiently than when using other dRNA sequences. In some embodiments, when the dRNA contains ACC, ACG, or ACU opposite UAG of the target RNA, the editing efficiency of A in UAG of the target RNA can reach about 25 to 90% (e.g., about 25 to 80%, 25% to 70%, 25% to 60%, 25% to 50%, 25% to 40%, or 25% to 30%).

[0129] In addition to the target adenosine, one or more adenosines that do not want to be edited may be present in the target RNA. It is preferable that these adenosines have as low an editing efficiency as possible. According to the present disclosure, it has been found that when guanosine and adenosine face each other in the target RNA, the efficiency of deamination is significantly reduced. Therefore, in order to reduce off-target deamination, dRNA may be designed to include one or more guanosines directly opposite one or more adenosines other than the target adenosine to be edited in the target RNA.

[0130] The level of specificity and efficiency required to edit the target RNA sequence depends on the application. Following the instructions of this patent application, a person skilled in the art can design a dRNA with a sequence that is complementary or substantially complementary to the target RNA sequence as needed, and after some trial and error, can obtain the desired result. As used herein, the term "mismatch" refers to a nucleotide that is opposite to a double-stranded RNA (dsRNA) and does not form a perfect base pair according to the Watson-Crick base pairing rules. Mismatch base pairs include, for example, GA, CA, UC, AA, GG, CC, UU base pairs. Take AC matching as an example, in which a target adenosine residue is edited in the target RNA, the dRNA is designed to contain a C opposite the A to be edited, which results in an AC mismatch in the dsRNA formed by hybridization of the target RNA and the dRNA.

[0131] In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA does not contain mismatch.In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA contains one or more mismatches, such as 1, 2, 3, 4, 5, 6, 7 or more mismatches (e.g., the same type of different types of mismatches).In some embodiments, the dsRNA formed by hybridization between dRNA and target RNA contains one or more mismatches, such as 1, 2, 3, 4, 5, 6 and 7 types of mismatches selected from GA, CA, UC, AA, GG, CC and UU.

[0132] The mismatched nucleotide in dsRNA formed by hybridization of dRNA and target RNA can form a protrusion, thus improving the editing efficiency of target RNA.There may be one (formed only on target adenosine) or multiple protrusions formed by said mismatch.The mismatch induced by other protrusions can be upstream and / or downstream of target adenosine.The protrusion can be a single mismatch protrusion (caused by one mismatched base pair) or multiple mismatch protrusions (caused by multiple consecutive mismatched base pairs, for example, two or three consecutive mismatched base pairs).

[0133] The target RNA sequence in the dRNA is single-stranded.The dRNA may be completely single-stranded, or may have one or more (for example, 1, 2, 3 or more) double-stranded regions and / or one or more stem-loop regions.In some embodiments, the target RNA sequence is at least about any one of 40, 45, 50, 55, 60, 65, 70, 75, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200 or more nucleotides. In some embodiments, the length of the target RNA sequence is about 40-260, 45-250, 50-240, 60-230, 65-220, 70-220, 70-210, 70-200, 570-190, 70-180, 70-170, 70-160, 70-150, 70-140, 70-130, 70-120, 70-110, 70 The length of the target RNA sequence in the dRNA is any one of 100, 70-90, 70-80, 75-200, 80-190, 85-180, 90-170, 95-160, 100-200, 100-150, 100-175, 110-200, 110-160, 110-175, 110-150, 140-160, 105-140, or 105-155 nucleotides. In some embodiments, the length of the target RNA sequence in the dRNA is about 71 nucleotides. In some embodiments, the length of the dRNA is about 111 nucleotides. In some embodiments, the length of the dRNA is about 151 nucleotides.

[0134] In some embodiments, the dRNA comprises, in addition to the target RNA sequence, a region for stabilizing the dRNA, for example, one or more double-stranded regions and / or stem-loop regions.In some embodiments, the double-stranded region or stem-loop region of the dRNA comprises any one of about 200 or less, 150 or less, 100 or less, 50 or less, 40 or less, 30 or less, 20 or less, or 10 or less base pairs.In some embodiments, the dRNA does not comprise a stem-loop or double-stranded region.In some embodiments, the dRNA comprises an ADAR recruitment domain.In some embodiments, the dRNA does not comprise an ADAR recruitment domain.

[0135] The dRNA may include one or more modifications. In some embodiments, the dRNA has one or more modified nucleotides, including nucleobase modifications and / or backbone modifications. Exemplary RNA modifications include, but are not limited to, phosphorothioate backbone modifications, 2'-substitutions in ribose (e.g., 2'-O-methyl and 2'-fluoro substitutions), LNA and L-RNA. In some embodiments, the dRNA has no modifications to nucleobase or backbone.

[0136] The present application also contemplates constructs comprising dRNAs as described herein, including, but not limited to, any one of the constructs described in the above sections. As used herein, the term "construct" refers to a DNA or RNA molecule that comprises a coding nucleotide sequence that can be transcribed as RNA or expressed as a protein. In some embodiments, the construct comprises one or more regulatory elements operably linked to the nucleotide sequence that codes for the RNA or protein. When the construct is introduced into a host cell, the coding nucleotide sequence in the construct can be transcribed or expressed under appropriate conditions.

[0137] In some embodiments, the construct comprises a promoter operably linked to a coding nucleotide sequence, whereby the promoter controls the transcription or expression of the coding nucleotide sequence. The promoter may be located 5' (upstream) of the coding nucleotide sequence under its control. The distance between the promoter and the coding sequence may be approximately the same as the distance between the promoter and the gene it controls in the gene from which it is derived. As is known in the art, this distance can be accommodated without loss of promoter function. In some embodiments, the construct comprises a 5'UTR and / or a 3'UTR that regulate the transcription or expression of the coding nucleotide sequence. In some embodiments, the promoter is a U6 promoter. In some embodiments, the promoter is a Poly II promoter as described in the above section.

[0138] In some embodiments, the construct is a vector encoding any one of the dRNAs disclosed in this application. The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has already been linked. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules that may or may not have one or more free ends (e.g., circular); nucleic acid molecules that contain DNA, RNA, or both; and other polynucleotide variants known in the art. One type of vector is a "plasmid," which refers to a circular double-stranded DNA loop into which other DNA segments may be inserted by standard molecular cloning techniques. Some vectors can replicate autonomously in a host cell into which they are introduced (e.g., bacterial vectors with a bacterial origin of replication and episomal mammalian vectors). After introduction into a host cell, other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of the host cell and are replicated along with the host genome. Additionally, some vectors can direct the transcription or expression of a coding nucleotide sequence operably linked to them. Such vectors are referred to herein as "expression vectors."

[0139] A recombinant expression vector may include the nucleic acid of the present application in a form suitable for transcribing or expressing the nucleic acid in a host cell. In some embodiments, the recombinant expression vector may be selected based on the host cell for transcription or expression and includes one or more regulatory elements operably linked to the nucleic acid sequence to be transcribed or expressed. In a recombinant expression vector, "operably linked" means that the nucleotide sequence of interest is linked to a regulatory element to allow expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or in a host cell after the vector is introduced into the host cell).

[0140] In some embodiments, the vector is a rAAV vector.In some embodiments, the rAAV vector is a vector derived from an AAV serotype, and AAV ITRs can be, but are not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or mouse AAV capsid serotype. In some embodiments, the nucleic acid in the AAV comprises ITRs such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrh10, AAV11, AAV12, AAV2R471A, AAV DJ, caprine AAV, bovine AAV or mouse AAV capsid serotype. In some embodiments, the nucleic acid in the AAV also encodes dRNA as described herein. Within the scope of this disclosure, the use of any AAV serotype is considered. In some embodiments, the vector is enveloped in a rAAV particle by a capsid. In some embodiments, the AAV viral particle comprises an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAVrh8R, AAV9, AAV10, AAVrhlO, AAV11, AAV12, AAV2R471A, AAV2 / 2-7m8, AAV DJ, AAV2 N587A, AAV2 E548A, AAV2 N708A, AAV2 V708K, AAV2-HBKO, AAVDJ8, AAVPHP.B, AAVPHP.eB, AAVBR1, AAVHSC15, AAVHSC17, caprine AAV, AAV1 / AAV2 chimera, bovine AAV, murine AAV, or rAAV2 / HBoV1 serotype capsid.

[0141] In some embodiments, a construct (e.g., a vector such as a viral vector) is provided that includes a nucleotide sequence encoding the dRNA. In some embodiments, a construct (e.g., a vector such as a viral vector) is provided that includes a nucleotide sequence encoding the ADAR. In some embodiments, a construct is provided that includes a first nucleotide sequence encoding the dRNA and a second nucleotide sequence encoding the ADAR. In some embodiments, the first nucleotide sequence and the second nucleotide sequence are operably linked to the same promoter. In some embodiments, the first nucleotide sequence and the second nucleotide sequence are operably linked to different promoters. In some embodiments, the promoter is inducible. In some embodiments, the construct does not encode the ADAR. In some embodiments, the vector further includes a nucleic acid sequence encoding an inhibitor of ADAR3 (e.g., ADAR3 shRNA or siRNA) and / or a stimulator of interferon (e.g., IFN-α).

[0142] IV. Treatment method The RNA editing methods and compositions described herein are useful for treating or preventing a disease or condition in an individual, including, but not limited to, inherited genetic diseases and drug resistance.

[0143] In some embodiments, a method is provided for editing a target RNA ex vivo in a cell of an individual (e.g., a human individual), comprising editing the target RNA using any one of the RNA editing methods described herein.

[0144] In some embodiments, a method is provided for ex vivo editing of a target RNA in a cell of an individual (e.g., a human individual), comprising introducing into a cell of the individual a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA, said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein said dRNA is a circular RNA or is capable of forming a circular RNA.

[0145] In some embodiments, a method is provided for ex vivo editing of a target RNA in a cell of an individual (e.g., a human individual), comprising introducing into the cell of the individual a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0146] In some embodiments, a method for ex vivo editing of target RNA in a cell of an individual (e.g., a human individual) is provided, comprising introducing a construct comprising a nucleic acid encoding a dRNA into a cell of the individual, wherein the dRNA comprises a target RNA sequence that hybridizes to a target RNA, the dRNA can recruit an ADAR to deaminate a target adenosine residue in the target RNA, and the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA. In some embodiments, the ADAR is endogenously expressed. In some embodiments, the method further comprises introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into a cell.

[0147] In some embodiments, the target RNA is associated with a disease or condition of the individual. In some embodiments, the disease or condition is a hereditary genetic disease or a disease or condition associated with one or more acquired genetic mutations (e.g., drug resistance). In some embodiments, the method further comprises obtaining cells from the individual.

[0148] In some embodiments, provided are methods of treating or preventing a disease or condition in an individual (e.g., a human individual), comprising editing a target RNA associated with the disease or condition in a cell of the individual using any one of the RNA editing methods described herein.

[0149] In some embodiments, a method is provided for treating or preventing a disease or condition in an individual (e.g., a human individual), comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with said disease or condition, wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and wherein said dRNA is a circular RNA or is capable of forming a circular RNA.

[0150] In some embodiments, a method is provided for treating or preventing a disease or condition in an individual (e.g., a human individual), comprising introducing ex vivo into a cell isolated from the individual a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to a target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0151] In some embodiments, a method is provided for treating or preventing a disease or condition in an individual (e.g., a human individual) comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to a target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0152] In some embodiments, the ADAR is an ADAR that is endogenously expressed in isolated cells.In some embodiments, the method comprises introducing a construct that comprises an ADAR or a nucleic acid encoding the ADAR into isolated cells.In some embodiments, the method further comprises culturing the cell that has the edited RNA.In some embodiments, the method further comprises administering the cell that has the edited RNA to an individual.In some embodiments, the disease or condition is a hereditary genetic disease, or a disease or condition that is associated with one or more acquired genetic mutations (e.g., drug resistance).

[0153] In some embodiments, a method is provided for treating or preventing a disease or condition in an individual (e.g., a human individual), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with the disease or condition, wherein said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein said dRNA is a circular RNA or is capable of forming a circular RNA.

[0154] In some embodiments, there is provided a method of treating or preventing a disease or condition in an individual (e.g., a human individual), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to a target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0155] In some embodiments, a method is provided for treating or preventing a disease or condition in an individual (e.g., a human individual) comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to a target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0156] In some embodiments, the ADAR is the ADAR that is endogenously expressed in the cell of the individual.In some embodiments, the method comprises administering to the individual the construct that comprises ADAR or the nucleic acid that encodes the ADAR.In some embodiments, the disease or condition is hereditary genetic disease or the disease or condition that is associated with one or more acquired genetic mutations (e.g., drug resistance).

[0157] Diseases and conditions suitable for treatment using the methods of the present application include diseases associated with mutations such as GA mutations, e.g., missense mutations in RNA transcripts, premature stop codons, aberrant or alternative splicing, etc. Examples of disease-associated mutations that can be ameliorated by the methods of the present application include TP53 , which is associated with cancer, W53X (e.g., 158G>A), IDUA associated with mucopolysaccharidosis type I (MPSI) W402X(e.g., TGG>TAG mutation in exon 9), which is associated with Ehlers-Danlos syndrome, COL3A1 W1278X (e.g., 3833G>A mutation), BMPR2 associated with primary pulmonary hypertension W298X (e.g., 893G>A), AHI1 associated with Joubert syndrome W725X (e.g., 2174G>A), FANCC associated with Fanconi anemia W506X (e.g., 1517G>A), MYBPC3 associated with primary familial hypertrophic cardiomyopathy W1098X (e.g., 3293GA), and IL2RG, which is associated with X-linked severe combined immunodeficiency W237X (e.g., 710G>A). In some embodiments, the disease or condition is cancer. In some embodiments, the disease or condition is a monogenic disease. In some embodiments, the disease or condition is a polygenic disease.

[0158] In some embodiments, a method is provided for treating a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0159] In some embodiments, a method is provided for treating a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA can recruit ADAR to deaminate a target adenosine residue in the target RNA.

[0160] In some embodiments, a method is provided for treating a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0161] In some embodiments, the ADAR is an ADAR that is endogenously expressed in isolated cells.In some embodiments, the method comprises introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into isolated cells ex vivo.In some embodiments, the target RNA is TP53 W53X (e.g., 158G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO: 4 (5'-GGGAGCAGCCUCUGGCAUUCUGGGAGCUUCAUCUGGACCUGGGUCUUCAGUGAACCAUUGUUCAAUAUCGUCCGGGGACAGCAUCAAAUCAUCCAUUGCUUGGGACGGCAA-3').

[0162] In some embodiments, a method is provided for treating or preventing a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising administering to the individual an effective amount of a dRNA or a construct comprising a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0163] In some embodiments, a method is provided for treating or preventing a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0164] In some embodiments, a method is provided for treating or preventing a cancer associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0165] In some embodiments, the ADAR is an ADAR endogenously expressed in the cells of the individual. In some embodiments, the method comprises administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is TP53W53X (e.g., 158G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:4.

[0166] In some embodiments, a method is provided for treating an MPS I (e.g., Hurler syndrome or Scheie syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0167] In some embodiments, a method is provided for treating an MPS I (e.g., Hurler Syndrome or Scheie Syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0168] In some embodiments, a method is provided for treating an MPS I (e.g., Hurler Syndrome or Scheie Syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0169] In some embodiments, the ADAR is an ADAR endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is an IDUA. W402X (e.g., a TGG>TAG mutation in exon 9). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:5 (5'- GACGCCCACCGUGUGGUUGCUGUCCAGGACGGUCCCGGCCUGCGACACUUCGGCCCAGAGCUGCUCCUCAUCUGCGGGGCGGGGGGGGGCCGUCGCCGCGUGGGGUCGUUG-3').

[0170] In some embodiments, a method is provided for treating or preventing an MPS I (e.g., Hurler syndrome or Scheie syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0171] In some embodiments, a method is provided for treating or preventing an MPS I (e.g., Hurler syndrome or Scheie syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0172] In some embodiments, a method is provided for treating or preventing an MPS I (e.g., Hurler syndrome or Scheie syndrome) associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0173] In some embodiments, the ADAR is an ADAR endogenously expressed in the cells of the individual. In some embodiments, the method includes administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is an IDUA. W402X (e.g., a TGG>TAG mutation in exon 9). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:5.

[0174] In some embodiments, a method is provided for treating Ehlers-Danlos syndrome, a disease or condition associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding the dRNA into a cell isolated from the individual, wherein the dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with the disease or condition, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the dRNA is a circular RNA or is capable of forming a circular RNA.

[0175] In some embodiments, a method is provided for treating Ehlers-Danlos syndrome, a disease or condition associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo into a cell isolated from the individual a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0176] In some embodiments, a method is provided for treating Ehlers-Danlos syndrome, a disease or condition associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0177] In some embodiments, the ADAR is an ADAR endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is COL3A1. W1278X (e.g., a 3833G>A mutation). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO: 6 (5'-CAUAUUACAGAAUACCUUGAUAGCAUCCAAUUUGCAUCCUUGGUUAGGGUCAACCCAGUAUUCUCCACUCUUGAGUUCAGGAUGGCAGAAUUUCAGGUCUCUGCAGUUUCU-3').

[0178] In some embodiments, a method is provided for treating or preventing Ehlers-Danlos Syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the dRNA is a circular RNA or is capable of forming a circular RNA.

[0179] In some embodiments, a method is provided for treating or preventing Ehlers-Danlos syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0180] In some embodiments, a method is provided for treating or preventing Ehlers-Danlos Syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0181] In some embodiments, the ADAR is an ADAR endogenously expressed in a cell of the individual. In some embodiments, the method includes administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is COL3A1. W1278X (e.g., a 3833G>A mutation). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:6.

[0182] In some embodiments, a method is provided for treating primary pulmonary hypertension associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0183] In some embodiments, a method is provided for treating primary pulmonary hypertension associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0184] In some embodiments, a method is provided for treating primary pulmonary hypertension associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0185] In some embodiments, the ADAR is an ADAR endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is BMPR2. W298X (e.g., 893G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO: 7 (5'-GUGAAGAUAAGCCAGUCCUCUAGUAACAGAAUGAGCAAGACGGCAAGAGCUUACCCAGUCACUUGUGUGGAGACUUAAAUACUUGCAUAAAGAUCCAUUGGGAUAGUACUC-3').

[0186] In some embodiments, a method of treating or preventing primary pulmonary hypertension in an individual having a target RNA containing a mutation (e.g., a G>A mutation) is provided, comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0187] In some embodiments, a method is provided for treating or preventing primary pulmonary hypertension in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0188] In some embodiments, a method is provided for treating or preventing primary pulmonary hypertension in an individual having a target RNA containing a mutation (e.g., a G>A mutation) comprising administering to the individual an effective amount of a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0189] In some embodiments, the ADAR is an ADAR endogenously expressed in the cells of the individual. In some embodiments, the method comprises administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is BMPR2. W298X (e.g., 893G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:7.

[0190] In some embodiments, a method is provided for treating Joubert syndrome associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0191] In some embodiments, a method is provided for treating Joubert syndrome associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0192] In some embodiments, a method is provided for treating Joubert syndrome associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0193] In some embodiments, the ADAR is an ADAR that is endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is AHI1. W725X (e.g., 2174G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:8 (5'-GUGAACGUCAAACUGUCGGACCAAUAUGGCAGAAUCUUCUCUCAUCUCAACUUUCCAUAUCCGUAUCAUGGAAUCAUAGCAUCCUGUAACUACUAGCUCUCUUACAGCUGG-3').

[0194] In some embodiments, a method is provided for treating or preventing Joubert syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0195] In some embodiments, a method is provided for treating or preventing Joubert syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0196] In some embodiments, a method is provided for treating or preventing Joubert syndrome in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0197] In some embodiments, the ADAR is an ADAR endogenously expressed in the cells of the individual. In some embodiments, the method comprises administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is AHI1. W725X (e.g., 2174G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:8.

[0198] In some embodiments, a method is provided for treating Fanconi anemia associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0199] In some embodiments, a method is provided for treating Fanconi anemia associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0200] In some embodiments, a method is provided for treating Fanconi anemia associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0201] In some embodiments, the ADAR is an ADAR that is endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is FANCC W506X (e.g., 1517G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:9 (5'-GCCAAUGAUCUCGUGAGUUAUCUCAGCAGUGUGAGCCAUCAGGGUGAUGACAUCCCAGGCGAUCGUGUGGCCUCCAGGAGCCCAGAGCAGGAAGUUGAGGAGAAGGUGCCU-3').

[0202] In some embodiments, a method is provided for treating or preventing Fanconi anemia in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a dRNA or a construct comprising a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0203] In some embodiments, a method is provided for treating or preventing Fanconi anemia in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0204] In some embodiments, a method is provided for treating or preventing Fanconi anemia in an individual having a target RNA that contains a mutation (e.g., a G>A mutation) comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0205] In some embodiments, the ADAR is an ADAR endogenously expressed in the cells of the individual. In some embodiments, the method comprises administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is FANCC W506X (e.g., 1517G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:9.

[0206] In some embodiments, a method is provided for treating primary familial hypertrophic cardiomyopathy associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising exhydrointroducing a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0207] In some embodiments, a method is provided for treating primary familial hypertrophic cardiomyopathy associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising exhydrointroducing a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA can recruit ADAR to deaminate a target adenosine residue in the target RNA.

[0208] In some embodiments, a method is provided for treating primary familial hypertrophic cardiomyopathy associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising exhydrointroducing into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0209] In some embodiments, the ADAR is an ADAR endogenously expressed in the isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into the isolated cell. In some embodiments, the target RNA is MYBPC3 W1098X (e.g., 3293G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO: 10 (5'-CAAGACGGUGAACCACUCCAUGGUCUUCUUGUCGGCUUUCUGCACUGUGUACCCCCAGAGCUCCGUGUUGCCGACAUCCUGGGGUGGCUUCCACUCCAGAGCCACAUUAAG-3').

[0210] In some embodiments, a method is provided for treating or preventing primary familial hypertrophic cardiomyopathy in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0211] In some embodiments, a method is provided for treating or preventing primary familial hypertrophic cardiomyopathy in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0212] In some embodiments, a method is provided for treating or preventing primary familial hypertrophic cardiomyopathy in an individual having a target RNA containing a mutation (e.g., a G>A mutation) comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, and wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to the nucleic acid encoding the dRNA.

[0213] In some embodiments, the ADAR is an ADAR endogenously expressed in a cell of the individual. In some embodiments, the method includes administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is MYBPC3 W1098X (e.g., 3293G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:10.

[0214] In some embodiments, a method is provided for treating X-linked severe combined immunodeficiency associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vitro a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0215] In some embodiments, a method is provided for treating X-linked severe combined immunodeficiency associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual, comprising introducing ex vivo a construct comprising a dRNA or a nucleic acid encoding said dRNA into a cell isolated from the individual, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and wherein said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0216] In some embodiments, a method is provided for treating X-linked severe combined immunodeficiency associated with a target RNA having a mutation (e.g., a G>A mutation) in an individual comprising introducing ex vivo into a cell isolated from the individual a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0217] In some embodiments, the ADAR is an ADAR endogenously expressed in an isolated cell. In some embodiments, the method includes introducing a construct comprising an ADAR or a nucleic acid encoding the ADAR into an isolated cell. In some embodiments, the target RNA is IL2RG W237X (e.g., 710G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO: 11 (5'-AGGAUUCUCUUUUGAAGUAUUGCUCCCCCAGUGGAUUGGGUGGCUCCAUUCACUCCAAUGCUGAGCACUUCCACAGAGUGGGUUAAAGCGGCUCCGAACACGAAACGUGUA-3').

[0218] In some embodiments, a method is provided for treating or preventing X-linked severe combined immunodeficiency in an individual having a target RNA that contains a mutation (e.g., a G>A mutation) comprising administering to the individual an effective amount of a dRNA or a construct comprising a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0219] In some embodiments, a method is provided for treating or preventing X-linked severe combined immunodeficiency in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA, and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, wherein said dRNA can recruit ADAR to deaminate a target adenosine residue in the target RNA.

[0220] In some embodiments, a method is provided for treating or preventing X-linked severe combined immunodeficiency in an individual having a target RNA containing a mutation (e.g., a G>A mutation), comprising administering to the individual an effective amount of a construct comprising a nucleic acid encoding a dRNA, wherein the dRNA comprises a target RNA sequence that hybridizes to the target RNA, wherein the dRNA is capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, and wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0221] In some embodiments, the ADAR is an ADAR endogenously expressed in a cell of the individual. In some embodiments, the method includes administering to the individual a construct comprising an ADAR or a nucleic acid encoding the ADAR. In some embodiments, the target RNA is IL2RG W237X (e.g., 710G>A). In some embodiments, the dRNA comprises the nucleic acid sequence of SEQ ID NO:11.

[0222] Generally, the dosage, schedule, and route of administration of the composition (e.g., a construct comprising a dRNA or a nucleic acid encoding the dRNA) can be determined according to standard pharmacological practices depending on the size and condition of the individual. Exemplary administration routes include intravenous, intraarterial, intraperitoneal, intrapulmonary, intravesicular, intramuscular, intratracheal, subcutaneous, intraocular, intrathecal, or transdermal.

[0223] The RNA editing methods of the present application can be used to modify RNA in animals (e.g., mammalian cells), as well as in plants or fungi, for example, in plants or fungi in which ADARs are endogenously expressed. The methods described herein can be used to generate genetically engineered plants and fungi with improved properties.

[0224] Further provided are any one of the dRNAs, constructs, cells with edited RNA, and compositions described herein for use in any one of the therapeutic methods described herein, and any one of the dRNAs, constructs, edited cells, and compositions described herein for use in the manufacture of a medicament for treating a disease or condition.

[0225] V. Compositions, Kits and Articles of Manufacture The present specification also provides a composition (e.g., a pharmaceutical composition) comprising any one of the dRNA, constructs, libraries, or host cells harboring the edited RNA described herein.

[0226] In some embodiments, a pharmaceutical composition is provided that includes any one of the dRNAs or constructs encoding said dRNAs described herein and a pharma- ceutically acceptable carrier, excipient, or stabilizer (Remington's Pharmaceutical Sciences 16th ed., Osol, A. Ed. (1980)). Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (octadecyldimethylbenzylammonium chloride, hexamethonium chloride; benzalkonium chloride, benzethonium chloride, phenol, butanol, or benzyl alcohol; alkyl p-hydroxybenzoates such as methyl or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol, and m-cresol); low molecular weight (less than about 10 residues) polysaccharides; The pharmaceutical composition may include peptides; proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN®, PLURONICS®, or polyethylene glycol (PEG). In some embodiments, lyophilized formulations are provided. Pharmaceutical compositions used for in vivo administration must be sterile. This can be achieved, for example, by filtration through a sterile filtration membrane.

[0227] Further provided are kits that can be used for any one of the RNA editing methods or therapeutic methods described herein, comprising any one of the dRNAs, constructs, compositions, libraries, or edited host cells described herein.

[0228] In some embodiments, a kit is provided for editing a target RNA in a host cell comprising a construct comprising a dRNA or a nucleic acid encoding said dRNA, wherein said dRNA comprises a target RNA sequence that hybridizes to a target RNA associated with a disease or condition, said dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA, and said dRNA is a circular RNA or is capable of forming a circular RNA.

[0229] In some embodiments, a kit is provided for editing a target RNA in a host cell, comprising a construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA comprises (1) a target RNA sequence that hybridizes to the target RNA and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence, and the dRNA is capable of recruiting ADAR to deaminate a target adenosine residue in the target RNA.

[0230] In some embodiments, a kit is provided for editing a target RNA in a host cell, comprising a construct comprising a nucleic acid encoding a dRNA, the dRNA comprising a target RNA sequence that hybridizes to a target RNA, the dRNA capable of recruiting an ADAR to deaminate a target adenosine residue in the target RNA, the construct comprising a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA.

[0231] In some embodiments, the kit further comprises a construct comprising an ADAR or a nucleic acid encoding an ADAR. In some embodiments, the kit further comprises an inhibitor of ADAR3 or a construct thereof. In some embodiments, the kit further comprises a stimulator of interferon or a construct thereof. In some embodiments, the kit further comprises instructions for carrying out any one of the RNA editing methods or treatment methods described herein.

[0232] The kits of the present application are in suitable packaging, including but not limited to vials, bottles, jars, flexible packaging (e.g., sealed polyester film (Mylar) or plastic bags), etc. The kits may optionally provide additional components, such as transfection or transduction reagents, cell culture media, buffers, and interpretive information.

[0233] Thus, the application also provides an article of manufacture. The article of manufacture may include a container and a label or protocol on or associated with the container. Suitable containers include vials (such as sealed vials), bottles, jars, flexible packaging, and the like. In some embodiments, the container contains a pharmaceutical composition and may have a sterile access port (e.g., the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic needle). The container containing the pharmaceutical composition may be a multi-use vial that allows for repeated administration (e.g., 2-6 administrations) of a reconstituted formulation. A protocol refers to instructions typically included in commercial packaging of a therapeutic product and includes information such as indications, usage, dosage, administration, contraindications, and / or warnings regarding the use of such a product. The article of manufacture may further include a second container containing a pharma- ceutically acceptable buffer, such as bacteriostatic water for injection (BWFI), phosphate buffered saline, Ringer's solution, and dextrose solution. It may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.

[0234] The kit or article of manufacture may include a number of unit doses of the pharmaceutical composition packaged in an amount sufficient for storage and use in a pharmacy (eg, a hospital pharmacy and a compounding pharmacy) and instructions for use.

[0235] The following exemplary embodiments and examples are intended as pure examples of this application and are not to be construed as limiting the present invention in any manner. The following exemplary embodiments and examples, as well as the detailed description, are provided by way of illustration and not by way of limitation.

[0236] Exemplary embodiments The present application provides the following embodiments. 1. A method for editing a target RNA in a host cell, comprising introducing into the host cell a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The method, wherein the dRNA is a circular RNA or is capable of forming a circular RNA. 2. The method of embodiment 1, wherein the dRNA further comprises a 3' ligation sequence and a 5' ligation sequence. 3. The method of embodiment 2, wherein the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. 4. The method of embodiment 2 or 3, wherein the length of the 3' ligation sequence and the 5' ligation sequence is from about 20 to about 75 nucleotides. 5. The method of any one of embodiments 1 to 4, wherein the dRNA is circularized by RNA ligase RtcB. 6. The method of embodiment 4, wherein the RNA ligase RtcB is endogenously expressed in the host cell. 7. The method of any one of embodiments 1 to 6, wherein the dRNA is a circular RNA. 8. The method of any one of embodiments 1 to 6, wherein the dRNA is a linear RNA capable of forming a circular RNA. 9. The method of any one of embodiments 1 to 6, comprising introducing into said host cell a construct comprising a nucleic acid encoding said dRNA. 10. The method of claim 9, wherein the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. 11. The method of embodiment 10, wherein the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. 12. The method of embodiment 10, wherein the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1. 13. A method for editing a target RNA in a host cell, comprising introducing into the host cell a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding the dRNA, wherein the dRNA comprises: (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence; The method, wherein the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR). 14. The method of embodiment 13, wherein the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). 15. The method of embodiment 13 or 14, wherein the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence ("3' snoRNA sequence"). 16. The method according to any one of embodiments 13 to 15, wherein the snoRNA sequence is at least about 70 nucleotides in length. 17. The method according to any one of embodiments 13 to 16, wherein the 3'snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:1. 18. The method according to any one of embodiments 13 to 17, wherein the 5'snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:2. 19. The method according to any one of embodiments 13 to 18, wherein said snoRNA sequence is a C / D box snoRNA sequence. 20. The method according to any one of embodiments 13 to 18, wherein the snoRNA sequence is an H / ACA box snoRNA sequence. 21. The method according to any one of embodiments 13 to 18, wherein the snoRNA sequence is a composite snoRNA sequence with a C / D box and an H / ACA box. 22. The method according to any one of embodiments 13 to 18, wherein the snoRNA sequence is an orphan snoRNA sequence. 23. The method according to any one of embodiments 13 to 22, comprising introducing into said host cell a construct comprising a nucleic acid encoding said dRNA. 24. The method of any one of embodiments 9 to 12 and 23, wherein the construct further comprises a promoter operably linked to the nucleic acid encoding the dRNA. 25. The method of embodiment 24, wherein the promoter is a polymerase II promoter ("Pol II promoter"). 26. A method for editing a target RNA in a host cell, comprising introducing into said host cell a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA), (1) the dRNA comprises a target RNA sequence that is at least partially complementary to a target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The method, wherein the construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA. 27. The method of embodiment 25 or 26, wherein the Pol II promoter is a CMV promoter. 28. The method of embodiment 27, wherein the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:3. 29. The method of any one of embodiments 9 to 12 and 23 to 28, wherein the construct is a viral vector or a plasmid. 30. The method of embodiment 29, wherein the construct is an AAV vector. 31. The method of any one of embodiments 1 to 30, wherein the ADAR is endogenously expressed by the host cell. 32. The method of embodiment 31, wherein the host cell is a T cell. 33. The method of any one of embodiments 1 to 32, wherein the length of the target RNA sequence is greater than 50 nucleotides. 34. The method of embodiment 33, wherein the target RNA sequence is about 100 to about 150 nucleotides in length. 35. The method of any one of embodiments 1 to 34, wherein the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite a target adenosine in the target RNA. 36. The method of embodiment 35, wherein the target RNA sequence comprises a cytidine mismatch directly opposite a target adenosine in the target RNA. 37. The method of embodiment 36, wherein the cytidine mismatch is located at least 20 nucleotides away from the 3' end of the target RNA sequence and at least 5 nucleotides away from the 5' end of the target RNA sequence. 38. The method of any one of embodiments 1-37, wherein the target RNA sequence further comprises one or more guanosines opposite each non-target adenosine in the target RNA. 39. The method of any one of embodiments 1 to 38, wherein the target RNA sequence comprises two or more consecutive mismatched nucleotides opposite non-target adenosines in the target RNA. 40. The method of any one of embodiments 1 to 39, wherein the 5'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A and G, with a preference of U>C≈A>G, and the 3'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A and U, with a preference of G>C>A≈U. 41. The method of any one of embodiments 1 to 40, wherein the target adenosine in the target RNA is located at a three base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA, and GAU. 42. The method of embodiment 41, wherein the three base motif is UAG and the target RNA comprises an A directly opposite the uridine in the three base motif, a cytidine directly opposite the target adenosine, and a cytidine, guanosine, or uridine directly opposite the guanosine in the three base motif. 43. The method according to any one of the preceding embodiments, wherein the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA and small RNA. 44. The method of embodiment 43, wherein the target RNA is a pre-messenger RNA. 45. The method according to any one of the preceding embodiments, further comprising introducing into said host cell an ADAR3 inhibitor. 46. ​​The method of any one of embodiments 1 to 45, further comprising introducing an interferon stimulating agent into the host cell. 47. The method of any one of embodiments 1 to 46, comprising introducing multiple dRNAs or constructs, each of which targets a different target RNA. 48. The method of any one of embodiments 1 to 47, wherein the editing efficiency of the target RNA is at least 40%. 49. The method of any one of embodiments 1 to 48, wherein the construct or the dRNA does not induce an immune response. 50. The method of any one of embodiments 1 to 49, further comprising introducing an ADAR (e.g., an exogenous ADAR) into the host cell. 51. The method of embodiment 50, wherein the ADAR is ADAR1 comprising an E1008 mutation. 52. The method of any one of embodiments 1 to 51, wherein deamination of the target adenosine in the target RNA results in a missense mutation, a premature stop codon, aberrant or alternative splicing in the target RNA, or a reversal of a missense mutation, a premature stop codon, aberrant or alternative splicing in the target RNA. 53. The method of embodiment 52, wherein deamination of the target adenosine in the target RNA causes point mutation, truncation, elongation and / or misfolding of the protein encoded by the target RNA, or generates a functional, full-length, correctly folded and / or wild-type protein by missense mutation, premature stop codon, aberrant splicing or reversal of alternative splicing in the target RNA. 54. The method of any one of embodiments 1 to 53, wherein the host cell is a eukaryotic cell. 55. The method of embodiment 54, wherein the host cell is a mammalian cell. 56. The method of embodiment 55, wherein the host cell is a human cell or a mouse cell. 57. A host cell comprising an edited RNA or an edited RNA produced by the method of any one of embodiments 1 to 56. 58. A method for treating or preventing a disease or condition in an individual, comprising editing a target RNA associated with said disease or condition in a cell of said individual according to a method according to any one of embodiments 1 to 57. 59. The method of embodiment 58, wherein the disease or condition is an inherited genetic disease or a disease or condition associated with one or more acquired genetic mutations. 60. The method of embodiment 58 or 59, wherein the target RNA has a GA mutation. 61. The method of any one of embodiments 58-60, wherein the disease or condition is a monogenic disease or condition. 62. The method of any one of embodiments 58-61, wherein the disease or condition is a polygenic disease or condition. 63. (i) the target RNA is TP53 and the disease or condition is cancer; (ii) the target RNA is IDUA and the disease or condition is mucopolysaccharidosis type I (MPSI); (iii) the target RNA is COL3A1 and the disease or condition is Ehlers-Danlos syndrome; (iv) the target RNA is BMPR2 and the disease or condition is Joubert syndrome; (v) the target RNA is FANCC and the disease or condition is Fanconi anemia; (vi) the target RNA is MYBPC3 and the disease or condition is primary familial hypertrophic cardiomyopathy; or (vii) The method of any one of embodiments 58-62, wherein the target RNA is IL2RG and the disease or condition is X-linked severe combined immunodeficiency. 64. A deaminase recruiting RNA (dRNA) for editing a target RNA, comprising: The dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, the dRNA is capable of recruiting an RNA-specific adenosine deaminase (ADAR), and the dRNA is circular or capable of forming a circular RNA, a deaminase-recruiting RNA (dRNA). 65. The dRNA of embodiment 64, wherein the dRNA further comprises a 3' ligation sequence and a 5' ligation sequence. 66. The dRNA according to embodiment 65, wherein the 3' ligation sequence and the 5' ligation sequence are at least partially complementary to each other. 67. The dRNA according to embodiment 65 or 66, wherein the length of the 3' ligation sequence and the 5' ligation sequence is from about 20 to about 75 nucleotides. 68. The dRNA according to any one of embodiments 64 to 67, wherein the dRNA is a circular RNA. 69. The dRNA according to any one of embodiments 64 to 67, wherein the dRNA is a linear RNA capable of forming a circular RNA. 70. A construct comprising a nucleic acid encoding a dRNA according to any one of embodiments 64 to 69. 71. The construct of embodiment 70, wherein the construct further comprises a 3' twister ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twister ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA. 72. The construct according to embodiment 71, wherein the 3' twister sequence is twister P3U2A and the 5' twister sequence is twister P1. 73. The construct according to embodiment 72, wherein the 5' twister sequence is twister P3U2A and the 3' twister sequence is twister P1. 74. A deaminase recruiting RNA (dRNA) that edits a target RNA, (1) a target RNA sequence that is at least partially complementary to the target RNA; and (2) a small nucleolar RNA (snoRNA) sequence at the 3' and / or 5' end of the target RNA sequence; The dRNA is a deaminase-recruiting RNA (dRNA) that can recruit RNA-specific adenosine deaminase (ADAR). 75. The dRNA of embodiment 74, wherein the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence ("5' snoRNA sequence"). 76. The dRNA according to embodiment 75, wherein the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence (3' snoRNA sequence). 77. The dRNA according to any one of embodiments 74 to 76, wherein the length of the snoRNA sequence is at least about 70 nucleotides. 78. The dRNA according to any one of embodiments 76 to 77, wherein the 3'snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:1. 79. The dRNA according to any one of embodiments 75 to 78, wherein the 5'snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:2. 80. The dRNA according to any one of embodiments 74 to 79, wherein the snoRNA sequence is a C / D box snoRNA sequence. 81. The dRNA according to any one of embodiments 74 to 79, wherein said snoRNA sequence is an H / ACA box snoRNA sequence. 82. The dRNA according to any one of embodiments 74 to 79, wherein the snoRNA sequence is a composite snoRNA sequence with a C / D box and an H / ACA box. 83. The dRNA according to any one of embodiments 74 to 79, wherein the snoRNA sequence is an orphan snoRNA sequence. 84. A construct comprising a nucleic acid encoding a dRNA according to any one of embodiments 74 to 83. 85. The construct according to any one of embodiments 70 to 73 and 84, further comprising a promoter operably linked to the nucleic acid encoding the dRNA. 86. The construct described in embodiment 85, wherein the promoter is a polymerase II promoter ("Pol II promoter"). 87. A construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA) that is introduced into a host cell, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to a target RNA; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The construct comprises a polymerase II promoter ("Pol II promoter") operably linked to a nucleic acid encoding the dRNA. 88. The construct of embodiment 86 or 87, wherein the Pol II promoter is a CMV promoter. 89. The construct described in embodiment 88, wherein the CMV promoter comprises the nucleic acid sequence of SEQ ID NO:3. 90. The construct according to any one of embodiments 70 to 73 and 84 to 89, wherein the construct is a viral vector or a plasmid. 91. The construct described in embodiment 90, wherein the construct is an AAV vector. 92. The construct or dRNA according to any one of embodiments 64 to 91, wherein the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA and small RNA. 93. A host cell comprising a construct or a dRNA according to any one of embodiments 64 to 91. 94. A kit for editing a target RNA in a host cell, comprising a construct or a dRNA according to any one of embodiments 64 to 91.

[0237] Working Example material and method Plasmid construction The dual fluorescent reporter was cloned by amplifying DNA encoding mCherry and EGFP (the first codon ATG of EGFP was deleted) by PCR, and a 3×GS linker and targeting DNA sequence were added via primers during PCR. The PCR product was then cut and ligated with type II restriction enzyme BsmB1 (Thermo) and T4 DNA ligase (NEB) and inserted into the pLenti backbone (pLenti-CMV-MCS-SV-Bsd, Stanley Cohen Lab, Stanford University).

[0238] dLbuCas13 DNA was amplified by PCR from the Lbu plasmid (Addgene #83485). ADAR1DD and ADAR2DD were amplified from Adar1(p150) cDNA and Adar2 cDNA from Han's lab at Xiamen University. ADAR1DD or ADAR2DD was fused to dLbuCas13 DNA by overlapping PCR, and the fused PCR product was inserted into the pLenti backbone.

[0239] For expression of dRNAs in mammalian cells, dRNA sequences (in the case of short dRNAs) were either directly synthesized and annealed by synthesizing overlapping ssDNA or PCR amplified and cloned into the corresponding vector under U6 expression by Golden-gate cloning.

[0240] Full-length ADAR1(p110) and ADAR1(p150) were PCR amplified from ADAR1(p150) cDNA, and full-length ADAR2 was PCR amplified from ADAR2 cDNA, and each was cloned into the pLenti backbone.

[0241] For two versions of the dual fluorescent reporter (reporter-1 and -3), mCherry and EGFP (with the ATG start codon of EGFP deleted) were PCR amplified and digested using BsmBI (Thermo Fisher Scientific, ER0452), followed by ligation with a GGGGS linker via T4 DNA ligase (NEB, M0202L), and the ligation product was inserted into the pLenti-CMV-MCS-PURO backbone.

[0242] dLbuCas13-ADAR DD For the construct expressing (E1008Q), ADAR1 DD The gene is ADAR1 p150 The construct was amplified from the dLbuCas13 gene (a gift from Jiahui Han lab, Xiamen University). The dLbuCas13 gene was amplified by PCR from the Lbu_C2c2_R472A_H477A_R1048A_H1053A plasmid (Addgene #83485). ADAR1 DD (hyperactive E1008Q mutant) was generated by overlap PCR and fused to dLbuCas13. The ligation product was inserted into the pLenti-CMV-MCS-BSD backbone.

[0243] For constructs expressing arRNA, the sequence of arRNA was synthesized and cloned into the pLenti-sgRNA-lib 2.0 (Addgene #89638) backbone by golden-gate, and transcription of arRNA was driven by the hU6 promoter. For constructs expressing ADAR, full-length ADAR1 was used. p110 and ADAR1 p150 ADAR1 p150 The full-length ADAR2 was PCR amplified from the ADAR2 construct (a gift from the Jiahui Han lab at Xiamen University). The amplified product was then cloned into the pLenti-CMV-MCS-BSD backbone.

[0244] For constructs expressing genes with pathogenic mutations, the full-length coding sequence of TP53 (purchased from Vigenebio) and six other disease-associated genes (COL3A1, BMPR2, AHI1, FANCC, MYBPC3 and IL2RG, gifts from Jianwei Wang's lab at the Institute of Pathogen Biology, Chinese Academy of Medical Sciences) were amplified by inducible PCR from constructs encoding the corresponding genes into which the G>A mutation was introduced. The amplified products were cloned into the pLenti-CMV-MCS-mCherry backbone by the Gibson cloning method.

[0245] Mammalian cell lines and cell culture Mammalian cell lines were cultured at 37°C and 5% CO2 in Dulbecco's Modified Eagle Medium (10-013-CV, Corning, Tewksbury, MA, USA) supplemented with 10% fetal bovine serum (Lanzhou Bailing Biotechnology Co., Ltd., Lanzhou, China) and 1% penicillin-streptomycin. ADAR1-KO cell lines were purchased from EdiGene China, and genotyping results were also provided by EdiGene China.

[0246] HeLa and B16 cell lines were from Z. Jiang's laboratory (Peking University), and HEK293T cell line was from C. Zhang's laboratory (Peking University). RD cell line was from J Wang's laboratory (Peking Union Medical College and Institute of Pathogen Biology, Chinese Academy of Medical Sciences). SF268 cell line was obtained from Cell Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences. A549 and SW13 cell lines were obtained from EdiGene Inc. HepG2, HT29, NIH3T3, and MEF cell lines were maintained in our laboratory at Peking University. These mammalian cell lines were cultured at 37 °C under 5% CO2 in Dulbecco's modified Eagle's medium (Corning, 10-013-CV) containing 10% fetal bovine serum (CellMax, SA201.02), further supplemented with 1% penicillin-streptomycin. Unless otherwise stated, cells were transfected with X-tremeGENE HP DNA Transfection Reagent (Roche, 06366546001) according to the manufacturer's instructions.

[0247] Human primary lung fibroblasts (#3300) and human primary bronchial epithelial cells (#3210) were purchased from ScienCell Research Laboratories, Inc. and cultured in fibroblast medium (ScienCell, #2301) and bronchial epithelial cell medium (ScienCell, #3211), respectively. Both media were supplemented with 15% fetal bovine serum (BI) and 1% penicillin-streptomycin, respectively. GM06214 and GM01323 primary cells were ordered from the Coriell Institute for Medical Research and cultured in Dulbecco's modified Eagle's medium (Corning, 10-013-CV) containing 15% fetal bovine serum (BI) and 1% penicillin-streptomycin. All cells were cultured at 37°C under 5% CO2.

[0248] Transfection of reporter systems, FACS analysis and Sanger sequencing For dual fluorescent reporter editing experiments, 293T-WT or 293T-Adar1-KO cells were seeded in 6-well plates (6 × 10 5 cells / well), and after 24 h, 1.5 μg of reporter plasmid and 1.5 μg of dRNA plasmid were co-transfected using X-tremeGENE HP DNA Transfection Reagent (06366546001; Roche, Mannheim, Germany), according to the supplier's protocol. After 48–72 h, cells were collected and FACS analysis was performed. To further confirm reporter mRNA editing, EGFP-positive cells from 293T-WT cells transfected with reporter and dRNA plasmids were sorted using a FACS Aria flow cytometer (BD Biosciences), followed by total RNA isolation (TIANGEN, DP430). Then, RNA was reverse transcribed into cDNA via RT-PCR (TIANGEN, KR103-04), the target locus was PCR amplified with the corresponding primer pair (23 PCR cycles), and the PCR product was purified for Sanger sequencing.

[0249] For rescue and overexpression experiments of ADAR1(p110), ADAR1(p150), or ADAR2, 293T-WT or 293T-ADAR1-KO cells were cultured in 12-well plates (2.5 × 10 5 Cells were seeded onto the 20-well plates (100 x 100 cells / well) and 24 h later, they were co-transfected with 0.5 μg of reporter plasmid, 0.5 μg of dRNA plasmid and 0.5 μg of ADAR1 / 2 plasmid (with pLenti backbone as control) using X-tremeGENE HP DNA Transfection Reagent (06366546001, Roche, Mannheim, Germany). After 48–72 h, cells were harvested and FACS analysis was performed.

[0250] For endogenous mRNA experiments, 293T-WT cells were seeded in 6-well plates (6 × 10 5When approximately 70% confluent, 3 μg of dRNA plasmids were transfected using X-tremeGENE HP DNA Transfection Reagent (06366546001, Roche, Mannheim, Germany). After 72 h, cells were harvested and sorted via FACS for GFP- or BFP-positive cells (by the corresponding fluorescent marker) for subsequent RNA isolation.

[0251] Isolation and culture of human primary T cells Primary human T cells were isolated from leukapheresis products from healthy human donors. Briefly, peripheral blood mononuclear cells (PBMCs) were separated by Ficoll centrifugation (Dakewei, AS1114546), and T cells were isolated from PBMCs by magnetic negative selection using the EasySep Human T Cell Isolation Kit (STEMCELL, 17951). After separation, T cells were cultured in X-vivo15 medium, 10% FBS and IL2 (1000 U / ml) and stimulated with CD3 / CD28 DynaBeads (ThermoFisher, 11131D) for 2 days. Leukapheresis products from healthy donors were purchased from AllCells LLC China. All healthy donors provided informed consent.

[0252] Lentiviral packaging and construction of reporter cell lines The expression plasmids were co-transfected into HEK293T-WT cells with two viral packaging plasmids, pR8.74 and pVSVG (Addgene), via X-tremeGENE HP DNA Transfection Reagent. After 72 hours, the supernatant virus was harvested and stored at -80°C. HEK293T-WT cells were infected with lentivirus, and after 72 hours, mCherry-positive cells were FACS sorted and cultured, and a single clonal cell line stably expressing the dual fluorescent reporter system with a very low EGFP background was selected by limiting dilution.

[0253] For stable reporter cell lines, the reporter construct (pLenti-CMV-MCS-PURO backbone) was co-transfected into HEK293T cells with two viral packaging plasmids, pR8.74 and pVSVG. After 72 hours, the supernatant virus was harvested and stored at -80°C. After infection of HEK293T cells with lentivirus, mCherry-positive cells were FACS sorted and cultured to select a single clonal cell line stably expressing the dual fluorescent reporter system without detectable EGFP background. HEK293T ADAR1 - / - and TP53 - / - Cell lines were cultured as previously reported. 60 The PCR-amplified donor DNA containing the sgRNA targeting ADAR1 and the CMV-driven puromycin resistance gene was co-transfected into HEK293T cells. The cells were then treated with puromycin 7 days after transfection. Single clones were isolated from the puromycin-resistant cells, followed by sequencing and validation by Western blot.

[0254] RNA editing of endogenously or exogenously expressed transcripts To assess RNA editing in dual fluorescent reporters, we used HEK293T cells or HEK293T ADAR1 - / - Cells were cultured in 6-well plates (6 × 10 5 After 24 hours, the cells were co-transfected with 1.5 μg of reporter plasmid and 1.5 μg of arRNA plasmid. p110 , ADAR1 p150 To examine the effect of ADAR2 protein expression, the editing efficiency was assayed by EGFP positivity rate and deep sequencing.

[0255] HEK293T ADAR1 - / - Cells were seeded in 12-well plates (2.5 × 10 5After 24 h, cells were co-transfected with 0.5 μg of reporter plasmid, 0.5 μg of arRNA plasmid and 0.5 μg of ADAR1 / 2 plasmid (pLenti backbone as control). Editing efficiency was analyzed by EGFP positivity rate and deep sequencing.

[0256] To assess RNA editing of endogenous mRNA transcripts, HEK293T cells were seeded in 6-well plates (6 × 10 5 Cells / well). After 24 hours, cells were transfected with 3 μg of arRNA plasmid. Editing efficiency was analyzed by deep sequencing.

[0257] To evaluate RNA editing efficiency in multiple cell lines, 8–9 × 10 4 (RD, SF268, HeLa) or 1.5 × 10 5 (HEK293T) cells were seeded in 12-well plates. For difficult-to-transfect cells such as HT29, A549, HepG2, SW13, NIH3T3, MEF, and B16, 2–2.5 × 10 5 The cells were seeded in a 6-well plate. After 24 hours, reporter and arRNA plasmids were co-transfected into these cells. Editing efficiency was analyzed by the EGFP positivity rate.

[0258] To evaluate the EGFP-positive rate, cells were sorted and collected by fluorescence-activated cell sorting (FACS) analysis 48–72 h after transfection. The mCherry signal served as a fluorescent selection marker for reporter / arRNA-expressing cells, whereas the EGFP-positive cells were sorted and collected by FACS analysis. + / mCherry + The percentage of cells was calculated as a readout of editing efficiency.

[0259] For NGS quantification of A to I editing rates, 48–72 h after transfection, cells were sorted and collected by FACS assay for RNA isolation (TIANGEN, DP420). Then, total RNA was reverse transcribed into cDNA via RT-PCR (TIANGEN, KR103-04), and the targeted loci were PCR amplified using the corresponding primers listed in the following table.

[0260] [Table 1]

[0261] PCR products were purified for Sanger sequencing or NGS (Illumina HiSeq X Ten).

[0262] Testing in multiple cell lines HEK293T (positive control) and HEK293T ADAR1 - / - In addition to the (negative control) cells, one mouse cell line (NIH3T3) and seven human cell lines (RD, HeLa, SF268, A549, HepG2, HT-29, SW13) derived from various tissues and organs were selected for the experiments. The cell lines with high transfection efficiency were approximately 8–9 × 10 4 Cells (RD, HeLa, SF268) or 1.5 × 10 5 (HEK293T) were seeded into each well of a 12-well plate, and for difficult-to-transfect ones (A549, HepG2, HT-29, SW13, NIH3T3), 2–2.5x10 5Cells were seeded in 6-well plates, and all of these cells were maintained in Dulbecco's modified Eagle's medium (DMEM, Corning) supplemented with 10% fetal bovine serum (FBS, CellMax) at 37 °C and 5% CO2. After 24 h, the CG2 reporter and 71nt dRNA (35-C-35) plasmids were co-transfected into different types of cells with X-tremeGENE HP DNA Transfection Reagent (Roche). 48 h after transfection, cells were treated with trypsin and analyzed by FACS (BD). Because there were very few mCherry- and BFP-positive cells in cells with low transfection efficiency, the total cell number for FACS analysis was reduced to 1 × 10 for cells seeded in 6-well plates. 5 was increased to.

[0263] Example 1: Optimization of LEAPER by driving arRNA expression with a CMV promoter To examine whether RNA polymerase II (Pol II) enhances the editing efficiency, we constructed a plasmid expressing arRNA driven by the Pol II promoter (CMV). 51 ) were compared using a reporter system based on EGFP expression (Reporter 1, Figure 4B). Untreated cells were used as mock controls (Mock). Cells transfected with non-targeting RNA were also used as controls (Ctrl RNA). The results showed that CMV-arRNA was superior to U6-arRNA in RNA editing (Figure 1).

[0264] [Table 2]

[0265] Example 2: sno-arRNA-mediated RNA editing To stabilize the arRNA and enhance its nuclear localization, the arRNA was engineered to have snoRNA ends. The snoRNA ends were flanked by a 151-nt arRNA targeting fluorescent reporter-1 (Figure 2A): 5' end: GAGTGAGATCTTGGACCAATGATGACTTCCATACATGCATTCCTTGGAAAGCTGAACAAAATGAGTGGGAACTCTGTACTATCATCTTAGTTGAACTGAGGTCCACCGGGGGCTAA (SEQ ID NO: 19); 3' terminal: AAGATTGTGTGTGGATCGATGATGACTTCCATATATACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCTATACCGTCATTCTCGTCGAACTGAGGTCCAGCACATTACTCCAACAG (SEQ ID NO: 20) The name was sno-arRNA151. Dual fluorescent reporter-1 contains the sequence of mChery (SEQ ID NO: 21), the sequence targeting 3xGS linker and A (SEQ ID NO: 22), and the sequence of eGFP (SEQ ID NO: 23). ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCTG CCCTTCGCCTGGGACATCCTGTCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTG CAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCAC TACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAG (mCherry sequence) (SEQ ID NO: 21)

[0266] [ka]

[0267] (The sequence includes a 3xGS linker (shown in italics and bold) and target A (shown with a large bold A) (SEQ ID NO:22)

[0268] GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA (Sequence of eGFP) (SEQ ID NO: 23).

[0269] Next, human U6-driven sno-arRNA151, arRNA151, sno-Ctrl RNA151 or Ctrl RNA151 were transfected into HEK293T cells together with a plasmid expressing a reporter. 48 hours after transfection, the EGFP positivity rate was quantified by FACS analysis. FACS results showed that sno-arRNA151 flanked by snoRNA ends could mediate target RNA editing on the reporter mRNA with an EGFP positivity rate of approximately 38%, lower than that of linear arRNA (Figure 2B-2C). To investigate whether snoRNA ends stabilize arRNAs, we measured the EGPF positivity at different time points. 151、 arRNA 151、 sno-Ctrl RNA 151 or Ctrl RNA 151 were transfected into HEK293T-reporter cells. The EGFP positivity was measured at three time points: 3, 6, and 12 days after transfection. The results showed that sno-arRNA showed higher editing efficiency than arRNA over an extended period of time, and that the snoRNA ends protected arRNA from degradation and enhanced the abundance of sno-arRNA (Figure 3A). To further increase the expression level of arRNA, we expressed arRNA or sno-arRNA using a strong virus-based promoter, CMV. As a result, we found that arRNA expressed by the CMV promoter (CMV_arRNA) showed higher editing efficiency than arRNA expressed by the U6 promoter (U6_arRNA). In addition, the EGFP-positive rate of the U6_arRNA group decreased over time, but the EGFP-positive rate of CMV_arRNA increased even 6 days after transfection. Similarly, sno-arRNA expressed by the CMV promoter (CMV_sno-arRNA) achieved higher editing efficiency than sno-arRNA expressed by the U6 promoter (U6_sno-arRNA) (Figure 3B, and Figure 3C). These results suggest that snoRNA ends can stabilize arRNA and increase the expression of arRNA or sno-arRNA driven by the CMV promoter. Both of these strategies significantly increased the efficiency of arRNA editing.

[0270] Example 3: Circular arRNA-mediated RNA editing Circular arRNA targeting reporter-1 71 and circular arRNA 111 HEK293T cells stably expressing reporter-1, which contains an in-frame stop codon between mCherry and EGFP, were transfected with a plasmid expressing both mCherry and EGFP (Figure 4B). EGFP fluorescence indicates the efficiency of target editing on the RNA. To investigate the most effective arRNA structure, the circular arRNA was flanked by 25-nt or 50-nt linkers connected to ligation sequences at both ends (Figure 4A). For comparison, linear (non-circular) arRNA was 71 and arRNA 111 The results showed that circular arRNA expressed less EGFP than linear arRNA. + It was found to strongly improve the cell ratio and EGFP intensity (Fig. 4C), whereas the circular arRNA with a 25-nt or 50-nt linker reduced the efficiency improvement (Fig. 4C). We further tested the effect of length on editing efficiency in HEK293T stably expressing reporter-3 (Figure 4B). Based on the reporter-EGFP ratio, the length of the circular arRNA was positively correlated with the editing efficiency, peaking between 111-nt and 151-nt (Figure 4D), and 71-nt was the minimal length for circular arRNA activity (Figure 4D). Dual fluorescent reporter-3 comprises an mChery sequence (SEQ ID NO:21), a 1xGS linker (shown in italics and bold) and a sequence comprising target A (SEQ ID NO:24), and eGFP (SEQ ID NO:23).

[0271] [ka]

[0272] (The sequence includes a 3xGS linker (shown in italics and bold) and target A (shown with a large bold A) (SEQ ID NO:24)

[0273] Using circular arRNA in HeLa and A549 cells, the efficiency of LEAPER was relatively reduced among multiple cell lines we tested due to low expression of ADAR1 or high expression of ADAR3. The results revealed that circular arRNA significantly improved the editing efficiency in both cell lines based on EGFP reporter assays ( Figure 4E ).

[0274] [Table 3]

[0275] [Table 4]

[0276] Example 4: Correction of premature stop codons using the LEAPER system with circular arRNA Many diseases are caused by premature termination codons (PTCs). To test the potential of LEAPER-circular arRNAs in treating PTC-related diseases, we constructed one in-frame UAA termination codon reporter. Three types of circular arRNAs (i.e., Tornado-arRNAs) were A111-A1 , Tornado-arRN A111-A2 and Tornado-arRN A111-2A We designed a novel reporter gene, Tornado-arRNA, to target the UAA site of this reporter and compared the EGFP-positive rates of three different arRNAs. A111-A2 was more effective (Figure 5).

[0277] Example 5: Regulation of mRNA splicing using the LEAPER system with circular arRNA Manipulating mRNA splicing to generate new splicing products is a therapeutic strategy for diseases such as Duchenne muscular dystrophy. We used the RG6 splicing reporter to measure whether LEAPER circular arRNA can alter splicing acceptor sites. We used Tornado-arRNA to target splice acceptor sites. 71 (71-nt), Tornado-arRNA 71 (111-nt) and Tornado-arRNA 71+BP We designed three types of circular arRNAs, including (111-nt targeting both the acceptor site and the branch point). We report that in HEK293T cells, when the splicing pattern is changed by LEAPE-Tornado, the RG6 reporter expresses more dsRNA protein than EGFP protein (Figure 6A). We found that LEAPER-circular arRNA can effectively target the cellular splicing machinery (Figure 6B).

[0278] Example 6: Lentiviral delivery by the LEAPER system using circular arRNA Continuous administration of therapeutic RNA is important for its efficacy. We tested whether RNA editing was possible by lentiviral delivery of LEAPER with circular arRNA. The results showed that LEAPER with circular arRNA was functional through lentiviral delivery, which allowed diverse Tornado-arRNAs to be integrated into the genome and stably expressed. The length of Tornado-arRNA was positively correlated with editing efficiency (Figure 7).

Claims

1. 1. A method for editing a target RNA in a host cell in vitro, comprising introducing into the host cell a construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA), (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, and the target RNA sequence is at least 71 nucleotides in length; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) the dRNA forms a circular RNA in the host cell, and the circular RNA recruits ADAR to deaminate a target adenosine in the target RNA; The method, wherein the dRNA further comprises (i) a 3' ligation sequence and a 5' ligation sequence, or (ii) a 3' twisted ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twisted ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA.

2. The method of claim 1, wherein the dRNA is circularized by RNA ligase RtcB in the host cell.

3. 1. A method for editing a target RNA in a host cell, comprising introducing a deaminase recruiting RNA (dRNA) into the host cell in vitro, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, and the target RNA sequence is at least 71 nucleotides in length; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The method, wherein the dRNA is a circular RNA, and the circular RNA recruits an ADAR to deaminate a target adenosine in the target RNA.

4. 1. A method for editing a target RNA comprising a target adenosine in a host cell, comprising introducing into the host cell in vitro a construct comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, The dRNA is (1) a target RNA sequence that is at least partially complementary to the target RNA and that is at least 71 nucleotides in length; (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence; The method, wherein the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR).

5. (i) the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence (the "5' snoRNA sequence"); (ii) the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence (the "3' snoRNA sequence"); (iii) the length of said snoRNA sequence is at least 70 nucleotides; (iv) the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:1; (v) the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:2; and / or (vi) The method of claim 4, wherein the snoRNA sequence is a C / D box snoRNA sequence, an H / ACA box snoRNA sequence, a composite snoRNA sequence of C / D box and H / ACA box, or an orphan snoRNA sequence.

6. 6. The method of any one of claims 1, 2, 4, and 5, wherein the construct further comprises a promoter operably linked to the nucleic acid encoding the dRNA, the promoter being a polymerase II promoter ("Pol II promoter") or a polymerase III promoter ("Pol III promoter").

7. 7. The method of claim 6, wherein the Pol II promoter is a CMV promoter or the Pol III promoter is a U6 promoter.

8. The method of any one of claims 1, 2, 4, and 5, wherein the construct is a viral vector or a plasmid.

9. The method of claim 8, wherein the construct is an AAV vector.

10. The method of any one of claims 1 to 9, wherein the ADAR is endogenously expressed by the host cell.

11. (i) the target RNA sequence is 71-220 nucleotides in length; (ii) the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite a target adenosine of the target RNA sequence; (iii) the target RNA sequence further comprises one or more guanosines opposite each non-target adenosine in the target RNA; (iv) the target RNA sequence comprises two or more consecutive mismatch nucleotides opposite a non-target adenosine in the target RNA; (v) the 5'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from U, C, A and G, with a preference of U>C≈A>G, and the 3'-closest neighbor of the target adenosine in the target RNA is a nucleotide selected from G, C, A and U, with a preference of G>C>A≈U; (vi) the target adenosine in the target RNA is a three base motif selected from the group consisting of UAG, UAC, UAA, UAU, CAG, CAC, CAA, CAU, AAG, AAC, AAA, AAU, GAG, GAC, GAA and GAU; and / or (vii) The method according to any one of claims 1 to 10, wherein the target RNA is an RNA selected from the group consisting of pre-messenger RNA, messenger RNA, ribosomal RNA, transfer RNA, long non-coding RNA and small RNA.

12. The method of any one of claims 1 to 11, comprising introducing multiple dRNAs or constructs, each targeting a different target RNA.

13. The method of any one of claims 1 to 12, further comprising introducing an ADAR into the host cell.

14. 14. The method of any one of claims 1 to 13, wherein deamination of the target adenosine in the target RNA causes a missense mutation, a premature stop codon, aberrant splicing or alternative splicing in the target RNA, or a missense mutation, a premature stop codon, aberrant splicing, modulation of splicing or reversal of alternative splicing in the target RNA.

15. The method according to any one of claims 1 to 14, wherein the host cell is a eukaryotic cell.

16. A construct comprising a nucleic acid encoding a deaminase recruiting RNA (dRNA) for editing a target RNA containing a target adenosine, (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, and the target RNA sequence is at least 71 nucleotides in length; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) the dRNA forms a circular RNA in the host cell, and the circular RNA recruits ADAR to deaminate a target adenosine in the target RNA; The dRNA further comprises (i) a 3' ligation sequence and a 5' ligation sequence, or (ii) a 3' twisted ribozyme sequence linked to the 3' end of the nucleic acid encoding the dRNA and a 5' twisted ribozyme sequence linked to the 5' end of the nucleic acid encoding the dRNA.

17. The construct of claim 16, wherein the dRNA is circularized by RNA ligase RtcB in the host cell.

18. A deaminase recruiting RNA (dRNA) for editing a target RNA containing a target adenosine in a host cell, comprising: (1) the dRNA comprises a target RNA sequence that is at least partially complementary to the target RNA, and the target RNA sequence is at least 71 nucleotides in length; (2) the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR); and (3) The dRNA is a circular RNA, and the circular RNA recruits an ADAR to deaminate a target adenosine in the target RNA.

19. 1. A construct for editing a target RNA containing a target adenosine in a host cell, comprising a deaminase recruiting RNA (dRNA) or a nucleic acid encoding said dRNA, The dRNA is (1) a target RNA sequence that is at least partially complementary to the target RNA and that is at least 71 nucleotides in length; (2) a small nucleolar RNA (snoRNA) sequence linked to the 3' and / or 5' end of the target RNA sequence; A construct comprising a dRNA or a nucleic acid encoding the dRNA, wherein the dRNA is capable of recruiting RNA-specific adenosine deaminase (ADAR).

20. (i) the dRNA comprises a snoRNA sequence linked to the 5' end of the target RNA sequence (the "5' snoRNA sequence"); (ii) the dRNA comprises a snoRNA sequence linked to the 3' end of the target RNA sequence (the "3' snoRNA sequence"); (iii) the length of said snoRNA sequence is at least 70 nucleotides; (iv) the 3' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:1; (v) the 5' snoRNA sequence comprises the nucleic acid sequence of SEQ ID NO:2; and / or (vi) A construct comprising the dRNA or a nucleic acid encoding the dRNA according to claim 19, wherein the snoRNA sequence is a C / D box snoRNA sequence, an H / ACA box snoRNA sequence, a composite snoRNA sequence of a C / D box and an H / ACA box, or an orphan snoRNA sequence.

21. 21. The construct of any one of claims 16, 17, 19, and 20, wherein the construct further comprises a promoter operably linked to the nucleic acid encoding the dRNA, the promoter being a polymerase II promoter ("Pol II promoter") or a polymerase III promoter ("Pol III promoter").

22. 22. The construct of claim 21 , wherein the Pol II promoter is a CMV promoter or the Pol III promoter is a U6 promoter.

23. 21. The construct of any one of claims 16, 17, 19, and 20, wherein the construct is a viral vector or a plasmid.

24. (i) the target RNA sequence is 71-220 nucleotides in length; (ii) the target RNA sequence comprises a cytidine, adenosine, or uridine directly opposite a target adenosine of the target RNA sequence; (iii) the target RNA sequence further comprises one or more guanosines opposite each non-target adenosine in the target RNA; and / or (iv) the target RNA sequence contains two or more consecutive mismatch nucleotides opposite a non-target adenosine in the target RNA; 24. A dRNA or construct according to any one of claims 16 to 23.

Images