Non-integrating viral delivery systems and related methods

Abstract

Non-integrating viral delivery systems and related methods are provided. A non-integrating viral delivery system is disclosed, which includes a viral carrier containing a defective integrase gene, a heterologous viral episomal origin of replication, a sequence encoding at least one initiator protein specific to the heterologous viral episomal origin of replication, where expression of the sequence encoding at least one initiator protein specific to the heterologous viral episomal origin of DNA replication is inducible, and at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest.

Description

[Technical field]

[0001] This application claims priority to U.S. Provisional Patent Application No. 62 / 347,552, entitled "NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS OF USE THEREOF," filed June 8, 2016, and U.S. Provisional Patent Application No. 62 / 431,760, entitled "NON-INTEGRATING VIRAL DELIVERY SYSTEM AND METHODS RELATED THERETO," filed December 8, 2016, the disclosures of which are incorporated herein by reference.

[0002] The present invention relates generally to the field of viral vectors and systems for gene delivery and other therapeutic, diagnostic or research uses. More specifically, embodiments of the present invention relate to the field of non-integrating viral vectors and systems for gene delivery and other therapeutic, diagnostic or research uses. [Background technology]

[0003] Viral vectors have been used to transduce genes and other therapeutic nucleic acid constructs into target cells due to their specific viral envelope-host cell receptor interaction and viral mechanism for gene expression. As a result, viral vectors have been used as vehicles for gene transfer into many different cell types, including but not limited to isolated tissue samples, in situ tissue targets, and cultured cell lines. The ability to introduce and express foreign genes into cells is useful for studying gene expression and elucidating cell lineages and pathways, as well as providing the possibility of therapeutic interventions such as gene therapy and various types of immunotherapy.

[0004] Several viral systems, including lentivirus, murine retrovirus, adenovirus and adeno-associated virus, have been proposed as potential therapeutic gene transfer vectors. However, many hurdles have prevented their widespread use as approved therapeutics. R&D hurdles include, but are not limited to, expression stability and control, genome packaging capacity, and construct-dependent vector stability. In addition, the in vivo application of viral vectors can be limited by host immune responses to viral structural proteins and / or transduced gene products, which can lead to adverse anti-vector immunological effects.

[0005] Researchers have attempted to find stable expression systems as a way to overcome some of these hurdles. One approach is to utilize gene regulatory molecules, including recombinant polypeptides or small RNAs, in such expression systems. These systems employ chromosomal integration of the transduced retroviral genome, or at least a portion of it, into the genome of the host cell. An important limitation of these approaches is that the site of gene integration is generally random, and the number and ratio of genes integrated at any particular site is often unpredictable. Thus, vectors that rely on chromosomal integration provide persistent maintenance of recombinant genes that may exceed the therapeutic interval, whereas plasmids or other non-replicating DNA are not well controlled and may decay before the desired therapeutic interval is completed.

[0006] Another approach is to use a transient expression system. Under a transient expression system, the expression of the gene of interest is based on a non-integrated plasmid, and therefore the expression is typically lost as the cell subsequently divides, or the plasmid vector is destroyed by endogenous nucleases. Therefore, it is generally understood that a transient gene expression system typically does not lead to sufficient expression over time, and typically requires repeated procedures, which is an undesirable feature. Summary of the Invention [Means for solving the problem]

[0007] Stable viral delivery systems and methods are provided. In various aspects, the delivery system comprises a transient expression system. According to one aspect, the delivery system is non-integrating. In another aspect, the delivery system is non-integrating and transient.

[0008] In various aspects and embodiments, the system variously includes one or all of the viral carriers, where the viral carriers include a defective integrase gene, a heterologous virus episomal DNA replication origin, a sequence that codes for at least one initiator protein specific to the heterologous virus episomal DNA replication origin, and the expression of the sequence that codes for at least one initiator protein specific to the heterologous virus episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The viral carriers can be lentiviruses. The heterologous virus episomal DNA replication origins can be derived from papillomaviruses. The heterologous virus episomal DNA replication origins can be derived from human papillomaviruses or bovine papillomaviruses.

[0009] The heterologous viral episomal DNA origin of replication may be derived from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA origin of replication may be derived from the long control region (LCR) of HPV16. The heterologous viral episomal DNA origin of replication may comprise SEQ ID NO:1. Optionally, the heterologous viral episomal DNA origin of replication may comprise a 5' truncation of SEQ ID NO:1. The heterologous viral episomal DNA origin of replication may comprise a 5' truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO:1. The heterologous viral episomal DNA origin of replication may comprise at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, with Frag1 (SEQ ID NO:2) (also referred to herein as fragment 1), or Frag2 (SEQ ID NO:3) (also referred to herein as fragment 2), or Frag3 (SEQ ID NO:4) (also referred to herein as fragment 3), or Frag4 (SEQ ID NO:5) (also referred to herein as fragment 4) of the LCR of HPV16. The heterologous viral episomal DNA origin of replication may comprise Frag1 (SEQ ID NO:2), Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of the LCR of HPV16.

[0010] The at least one initiator protein specific to a heterologous virus episomal DNA replication origin may comprise E1 or an operable fragment thereof. The at least one initiator protein specific to a heterologous virus episomal DNA replication origin may comprise E2 or an operable fragment thereof. The at least one initiator protein specific to a heterologous virus episomal DNA replication origin may comprise EBNA-1 or an operable fragment thereof. Optionally, the system may comprise at least two initiator proteins specific to a heterologous virus episomal DNA replication origin. The at least two initiator proteins specific to a heterologous virus episomal DNA replication origin may comprise E1 and E2, either alone or in combination, or operable fragments thereof. The sequence encoding the at least one initiator protein may be present in a single separate plasmid or in a non-integrating viral vector. Optionally, the system may comprise at least two initiator proteins specific for a heterologous virus episomal DNA replication origin, where the sequences encoding the at least two initiator proteins may be present on a single separate plasmid or non-integrating viral vector. Optionally, the system may comprise at least two initiator proteins specific for a heterologous virus episomal DNA replication origin, where the sequences for the first initiator protein and the second initiator protein may be present on separate plasmids or non-integrating viral vectors.

[0011] For the disclosed non-integrating viral delivery system, the at least one gene product may comprise an antibody, an antibody fragment, or a growth factor. The antibody may comprise an anti-HER2 antibody or a fragment thereof. The growth factor may comprise vascular endothelial growth factor (VEGF) or a variant thereof. The miRNA may comprise a CCR5 miRNA.

[0012] In another aspect, a pharmaceutical composition is disclosed. The pharmaceutical composition comprises the non-integrating viral delivery system disclosed herein and at least one pharma- ceutical acceptable carrier.

[0013] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a cell.The method comprises contacting the cell with an effective amount of a non-integrating viral delivery system, wherein the system comprises a viral carrier, the viral carrier comprises one or all of the defective integrase genes, a heterologous virus episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.

[0014] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a subject in need thereof.The method comprises administering to a subject in need thereof an effective amount of a non-integrating viral delivery system, wherein the system comprises a viral carrier, wherein the viral carrier comprises one or all of the defective integrase genes, a heterologous virus episomal DNA replication origin, a sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.The sequence encoding at least one initiator protein may be present on a single separate plasmid, and the at least one initiator protein may comprise either E1 and E2, either alone or in combination, or an operable fragment thereof. The method may further comprise administering to a subject in need thereof a first amount of a single separate plasmid for initiating a first expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. The method may further comprise administering to a subject in need thereof a second amount of a single separate plasmid for initiating a second expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. In a situation where the second amount is lower than the first amount, the expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may be decreased. In a situation where the second amount is higher than the first amount, the expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may be increased.

[0015] In another embodiment, the non-integrating viral delivery system disclosed herein is optimized to generate low-level basal expression of at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.The heterologous viral episomal DNA replication origin can comprise at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with SEQ ID NO:1 or Frag1 (SEQ ID NO:2) of the LCR of HPV16.

[0016] In another aspect, the non-integrating viral delivery system disclosed herein is optimized such that the system produces low levels of basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and the heterologous viral episomal DNA replication origin may comprise SEQ ID NO:1 or Frag1 (SEQ ID NO:2) of the LCR of HPV16.

[0017] In another embodiment, the non-integrating viral delivery system disclosed herein is optimized to produce a moderate level of basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and the heterologous viral episomal DNA origin of replication may comprise at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. The system may be optimized to produce a moderate level of basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and the heterologous viral episomal DNA origin of replication may comprise Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16.

[0018] In another embodiment, a method for selecting an optimized non-integrating viral delivery system is disclosed. The method includes selecting a basal expression level. Then, when a level X is selected, a corresponding Y is selected, where Y corresponds to a heterologous viral episomal DNA replication origin selected to be incorporated into the non-integrating viral delivery system, and when X=low, Y comprises SEQ ID NO:1 or Frag1 (SEQ ID NO:2), and when X=medium, Y comprises Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of the LCR of HPV16.

[0019] Further embodiments include, for example, methods of treating infectious diseases. Further embodiments include methods of preventing infectious diseases. In another embodiment, a method of enhancing wound healing is disclosed. In another embodiment, a method of treating bone damage is disclosed. Further embodiments include methods of treating genetic diseases using the systems detailed herein.

[0020] The foregoing general description and the following detailed description are exemplary and explanatory and are intended to provide further explanation of the invention as claimed. Other objects, advantages and novel features will be readily apparent to those skilled in the art from the following brief description of the drawings and detailed description of the invention. [Brief description of the drawings]

[0021] [Figure 1] Figure 1 illustrates an exemplary vector-in-vector (VIV) embodiment of the present invention, in which (A) shows a linear form of the vector and (B) shows a circular form of the vector.

[0022] [Diagram 2] FIG. 2 is a diagram illustrating an exemplary vector-in-vector (VIV) embodiment (also referred to herein as Vector 1) containing the E1 initiator protein.

[0023] [Diagram 3]FIG. 3 shows transduction results in 293T cells from three separate experiments using Vector 1.

[0024] [Figure 4] FIG. 4 is a diagram illustrating an exemplary vector-in-vector (VIV) embodiment (also referred to herein as Vector 19) containing both E1 and E2 initiator proteins.

[0025] [Diagram 5] FIG. 5 shows an exemplary vector-in-vector (VIV) embodiment expressing (A) mCherry and (B) VEGF, respectively.

[0026] [Figure 6] FIG. 6 shows expression of mCherry positive cells for the various indicated constructs when E1 and E2 are provided by plasmid (A) or lentivirus (B), respectively.

[0027] [Figure 7] FIG. 7 is a diagram illustrating an exemplary vector-in-vector (VIV) embodiment for use in conjunction with the examples detailed herein.

[0028] [Figure 8] FIG. 8 shows expression levels of VEGF for various described constructs containing fragment 1 of the HPV16 long control region (LCR).

[0029] [Figure 9] FIG. 9 illustrates an exemplary vector-in-vector (VIV) embodiment used in conjunction with the examples detailed herein.

[0030] [Figure 10] FIG. 10 shows an exemplary diagram of an episomal morphology of a non-integrating lentiviral vector according to an embodiment of the present invention.

[0031] [Figure 11] FIG. 11 is a diagram showing the genomic relationship between the LCRs Frag1, Frag2, Frag3 and Frag4 of HPV16.

[0032] [Figure 12] FIG. 12 shows an analysis of episomal copy number of HPV16ori in the integrase-deficient lentiviral vectors described herein.

[0033] [Figure 13] FIG. 13 shows (A) analysis of mCherry expression from integrase-deficient lentiviral vectors containing the HPV LCR and 3′ fragment, and (B) analysis of mCherry expression from integrase-deficient vectors expressing or not expressing HPV16 E1-T2A-E2 from a single vector.

[0034] [Figure 14] FIG. 14 shows analysis of mCherry expression from integrase-deficient lentiviral vectors containing the HPV LCR following addition of E1, E1-C and E2-11.

[0035] [Figure 15] FIG. 15 shows the expression of anti-HER2 antibodies using integrase-deficient lentiviral vectors containing the HPV LCR as determined by (A) immunoblot and (B) IgG concentration.

[0036] [Figure 16] FIG. 16 shows the expression of anti-EGFR antibodies using integrase-deficient lentiviral vectors containing HPV ori sequences.

[0037] [Figure 17] FIG. 17 shows knockdown of CCR5 expression using a lentiviral vector containing the full-length LCR of HPV16.

[0038] [Figure 18] FIG. 18 shows knockdown of CCR5 expression using a lentiviral vector containing Frag2 of the LCR of HPV16.

[0039] [Figure 19] FIG. 19 shows GFP expression in cells transduced with D64V integrase-deficient lentiviral vectors that use Epstein-Barr virus (EBV) oriP sequences.

[0040] [Figure 20] FIG. 20 is a schematic demonstrating basal and E1-E2-induced episomal copy numbers for Frag1, Frag2, Frag3, Frag4 and full-length LCR of HPV16.

[0041] [Figure 21] FIG. 21 shows one embodiment for LCR fragment selection based on relative structure-function activity knowledge, as further described in the Examples detailed herein. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] Disclosed herein are stable viral delivery systems and methods. In various aspects, the delivery system comprises a transient expression system. According to one aspect, the delivery system is non-integrating. In another aspect, the delivery system is non-integrating and transient.

[0043] In further aspects, non-integrative, episomally replicating viral vectors (e.g., lentiviral vectors) and methods of use thereof are provided. The episomally replicating vectors of the present invention may contain viral components of the Papovaviridae (e.g., bovine papillomavirus or BPV) or Herpesviridae (e.g., Epstein-Barr virus or EBV) or Hepadnaviridae (e.g., Hepatitis B virus or HBV) viruses. Episomal replicating vectors derived from these viruses may contain an origin of replication and at least one viral transactivator, such as an initiator protein, such as E1 for BPV polymerase and EBNA-1 for EBV or HBV polymerase, or an adenoviral terminal binding protein. The process of episomal replication typically incorporates both the host cell replication machinery and viral transactivators.

[0044] By using a heterologous viral origin of replication, the new vector can be engineered with an "off" switch for the expression of viral proteins required to recognize the origin of replication. Switching off DNA replication dramatically reduces the level of therapeutic DNA over time. Without wishing to be limited to any particular theory, it is believed that non-replicating DNA simply degrades over time, for example, by nuclease activity and as the host cell undergoes natural apoptotic (cell death) events. Eventually, such non-replicating DNA becomes undetectable and can be completely or nearly eliminated from the patient over time.

[0045] The disclosed system and method includes the ability to reduce or prevent toxicity and any toxic effects resulting from overexpression or prolonged expression of transduced genes.By eliminating genes once DNA replication has stopped, it prevents subsequent undesirable gene expression or knockdown of host gene expression.Similarly, by combining the benefits of episomal replication with heterologous virus system, it provides a platform that can safely and efficiently transduce genes of interest into various cell types. Papillomavirus

[0046] Papillomaviruses replicate primarily episomally in mammalian cells. The action of the viral E1 protein, which functions as a DNA helicase, on the viral DNA origin of replication (ori) drives the production of hundreds to thousands of DNA copies per cell, depending on the differentiation state of the infected epithelial cell. Attempts were made to develop papillomavirus-based gene delivery systems using what have become known as "shuttle plasmids". Many studies were carried out to demonstrate the safety and durability of gene expression, using bacterial DNA replication origins to allow the production of DNA in E. coli and papillomavirus ori to allow episomal replication in mammalian cells. In most cases, the ori was derived from bovine papillomavirus.

[0047] Papillomaviruses have evolved to infect epidermal and epithelial cells. As infected cells differentiate from the basal to luminal surface, papillomaviruses increase their DNA replication and the copy number increases greatly until large amounts of virus are released at the luminal surface. This makes papillomaviruses highly infectious, as is evident from human papillomaviruses. The rapid increase in copy number is mainly due to host factors. However, this feature of papillomaviruses can be exploited for transient gene therapy to target epidermal and epithelial surfaces.

[0048] Particular features of papillomaviruses are used in accordance with various aspects and embodiments of the invention to drive episomal vector expression and replication, as well as to target vector expression to specific cell types. Epstein-Barr virus (EBV)

[0049] Epstein-Barr virus (EBV), also known as human herpesvirus 4, is a member of the herpesvirus family. It is one of the most common human viruses, and most people will be infected with EBV at some point in their lives.

[0050] EBV contains approximately 85 genes and is a double-stranded DNA virus known to infect B cells and epithelial cells. EBV is capable of both lytic and latent replication, which results in the translocation of a circularized form of the EBV genome into the host cell nucleus, where it can be replicated by host cell DNA polymerases.

[0051] EBV can replicate latent through at least three different pathways, each of which involves the expression of Epstein-Barr virus nuclear antigen 1 (EBNA-1), a protein that binds episomal origins of replication and mediates episomal compartmentalization during host cell division. EBNA-1 has essential roles in EBV gene regulation, replication, and episomal maintenance.

[0052] Certain features of EBV are used in accordance with various aspects and embodiments of the present invention. Hepatitis B virus (HBV)

[0053] Hepatitis B virus (HBV) is a member of the hepadnavirus family. It is a common human virus associated with progressive liver fibrosis, hepatitis, and hepatocellular carcinoma.

[0054] HBV is a double-stranded DNA virus that replicates via an RNA intermediate and is dependent on the viral polymerase. Stable maintenance of HBV in hepatocytes is due to the presence of a covalently closed circular form of viral DNA that is difficult to eradicate.

[0055] Thus, particular features of HBV are used in accordance with various aspects and embodiments of the present invention. Retroviruses

[0056] Retroviruses are a family of viruses that are characterized by encoding a reverse transcriptase capable of generating DNA copies from an RNA template and by proviral integration into host cell chromosomes. Lentiviruses are a genus of retroviruses that can deliver large amounts of viral nucleic acid into host cells. Lentiviruses are characterized by their unique ability to infect / transduce non-dividing cells, and after transduction, lentiviruses integrate their nucleic acid into the host cell chromosomes.

[0057] Infectious lentiviruses have three major genes encoding the virulence proteins gag, pol, and env, and two regulatory genes including tat and rev. Depending on the specific serotype and virus, there may be additional accessory genes encoding proteins involved in the regulation, synthesis, and / or processing of viral nucleic acid, as well as other replication functions, including counteracting innate cellular defenses against lentiviral infection.

[0058] Lentiviruses contain a long terminal repeat (LTR) region that can be approximately 600nt long. The LTR can be segmented into U3, R, and U5 regions. The LTR can mediate the integration of retroviral DNA into host chromosomes through the action of integrase. Alternatively, the LTR can be used to circularize viral nucleic acid without functionalizing integrase.

[0059] Viral proteins involved in the early stages of lentivirus replication include reverse transcriptase and integrase. Reverse transcriptase is an RNA-dependent DNA polymerase encoded by the virus. This enzyme uses the viral RNA genome as a template for the synthesis of a complementary DNA copy. Reverse transcriptase also has RNaseH activity for the destruction of the RNA template required for DNA second strand synthesis to complete the production of double-stranded DNA ready for integration. Integrase processes the LTR before inserting the viral genome into the host DNA. tat acts as a transactivator during transcription to enhance the initiation and elongation of the RNA copy made from the viral DNA. The rev-responsive element acts post-transcriptionally to regulate the splicing and transport of mRNA to the cytoplasm.

[0060] Certain features of retroviruses, including lentiviruses, are used in accordance with various aspects and embodiments of the present invention. Vector-in-vector system

[0061] A novel vector-in-vector (VIV) system is provided that allows precise regulation of gene delivery and expression by combining the desired features of various virus species. Many viral vectors can be used, including lentiviral (LV) platforms. Lentiviral transduction, like most other forms of stable transduction, results in chromosomal integration of the LV payload (e.g., gene of interest). According to various embodiments, chromosomal integration is abolished via selective mutations that inactivate the viral integrase gene. Papillomavirus ori plus E1 protein, or EBV ori plus EBNA-1, or hepadnavirus terminus plus viral polymerase are used herein as part of the heterologous viral gene cargo that cannot normally be maintained episomally. Incorporating this heterologous viral replication machinery into a lentiviral vector leaves approximately 5 kb of additional cargo space that can accommodate a therapeutic gene of interest.

[0062] Additionally, other control elements can be incorporated into the disclosed VIV system. As a non-limiting example, the expression of E1 or E2 or EBNA-1 or HBV polymerase can be driven by an inducible promoter. Additionally, as a non-limiting example, E1 and / or E2 can be expressed using a plasmid or a non-integrating viral vector. Many types of inducible promoters are known in the art, and for the purposes of the present invention, inducible promoters can include, but are not limited to, promoters that respond to antibiotics (i.e., tetracycline, aminoglycosides, penicillins, cephalosporins, polymyxins, etc.) or other drugs, copper and other metals, alcohol, steroids, light, oxygen, heat, cold, or other physical or chemical stimuli. For example, a method of using the disclosed viral system includes employing tetracycline-inducible gene expression that relies on a constant supply of drug for the expression of cargo genes. The compound used to induce the inducible promoter can be added once or repeatedly depending on the duration of episomal replication and the timing of desired cargo delivery. DNA replication and episomal maintenance are variously dependent on induction of E1, E2 and / or EBNA-1, which in turn is dependent on the inducer of gene expression (ie, tetracycline).

[0063] An exemplary VIV system is shown in FIG. 1. The disclosed VIV includes at least one gene or nucleotide sequence of interest (e.g., the cargo shown in FIG. 1A). The gene or sequence incorporated into the VIV depends on the purpose of the VIV. With general reference to FIG. 1, the lentivirus is packaged in an integrase-deficient system, or transduction is performed in the presence of clinical drugs used to block integrase activity (e.g., dolutegravir or raltegravir). If integration fails, the linear double-stranded vector DNA is generally circularized using the host's enzymatic machinery (e.g., FIG. 1B). Optionally, a drug-inducible promoter can be activated to express E1 and / or E2 proteins as required, which then drives DNA replication. The therapeutic cargo is expressed from the integrated cassette. In various embodiments, the compound that induces the inducible promoter (also referred to herein as "inducer") is discontinued or stopped. Stopping the inducer downregulates the synthesis of E1 and / or E2. In a further embodiment, production of E1 and / or E2 is effectively shut down. In either event, this reduces the levels of episomal DNA and ultimately eliminates the vector construct.

[0064] Further exemplary diagrams of the VIV system are shown in Figure 2. The E1 initiator protein is present, and the cargo is GFP under the EF1-HTLV promoter. Figures 1 and 2 show a VIV system that contains E1, while Figure 4 shown herein shows a VIV system that contains both E1 and E2 on a single viral vector. In a further embodiment, to express both E1 and E2 from the same mRNA, an internal ribosome entry site (IRES) is added to allow resumption of protein translation. Initiator proteins such as E1 and E2 can also be expressed on separate plasmids or non-integrating lentiviral vectors.

[0065] A further exemplary diagram of the VIV system is shown in FIG. 4. The gene cargo is represented by a CMV / GFP cassette. The cargo gene sequence can be amplified by polymerase chain reaction (PCR). For example, synthetic oligonucleotide primers can be used, such as primers that are identical to the 5' end of the cargo gene and / or complementary to the 3' end of the cargo gene. The 5' primer can be extended from its 5' end with a recognition site for an endonuclease. The 3' primer can also be extended at its 3' end with a complement for endonuclease recognition. The resulting amplified cargo gene sequence can be annealed to a suitable vector, such as a lentiviral vector. Non-limiting examples of gene cargo include CMV / VEGF, CMV / anti-epidermal growth factor receptor (EGFR), anti-HER2 antibody, or miRNA-inhibiting CC chemokine receptor type 5 (CCR5).

[0066] The appropriate expression of the cargo can be determined by a suitable assay. For example, the copy number of DNA can be measured by quantitative PCR. The protein product translated from non-limiting examples such as Vector 1 or Vector 19 (described herein) can be measured, for example, by analytical flow cytometry. ELISA assays can be used to detect the presence of specific cargo, such as secreted proteins such as VEGF. Western blot techniques can also be used to detect specific cargo, such as antibodies such as anti-EGFR. In addition, monitoring the reduction of cell surface expression of cargo proteins, for example chemokine receptors such as CCR5, can also be employed.

[0067] With regard to cargo, and as a non-limiting example, a gene encoding platelet-derived growth factor (PDGF) can be incorporated as a gene into a VIV used to promote wound healing, along with shRNA, siRNA, miRNA, and / or other gene-suppressing RNA of interest. The disclosed VIV system is not limited to the particular type of gene or sequence that can be expressed.

[0068] Disclosed VIVs include, for example, antibodies against antigens associated with infectious disease or cancer (including antigens on replicating pathogens, and antigens that are exogenous toxins, and antigens on tumor cells), platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin or dystrophin-associated complex, phenylalanine hydroxylase, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA or RNA against autoimmune antigens involved in colitis, inflammatory bowel disease, or Crohn's disease, opioids, Many therapeutic or prophylactic genes or sequences may be incorporated, including small interfering RNAs involved in addiction including miRNAs that regulate drug or alcohol addiction, genes that regulate cell survival including tumor suppressor genes, pro- or anti-apoptotic genes and pro- or anti-autophagy genes, genes that code for radiation resistance factors, genes that code for photoproteins used to track tumor cell metastasis or other cellular trafficking events, or sequences that code for a variety of other therapeutically useful sequences that may be used to condition the body for maximum benefit from radiation, surgery, or chemotherapy, or to protect tissue from radiation, surgery, or chemotherapy, improve organ transplantation, or modify host or graft tissue to suppress hyper-responsiveness, particularly in the airways.

[0069] Without limiting any of the foregoing, cargo can include diagnostic proteins such as GFP and mCherry, as well as cDNA, microRNA, shRNA and antibodies.Furthermore, cargo can include specific cargos such as VEGF and BMP as described herein.

[0070] In a further embodiment, it is desirable to maintain genes in episomal form in the VIV system as a "safety switch". For example, when a particular gene product is toxic, DNA replication is reduced or stopped by withdrawal of inducer molecule. Then, episome number is reduced, and gene and vector are eventually eliminated. Unlike traditional regulated gene expression as a safety switch, the disclosed expression construct is degraded by endogenous nucleases and diluted by cell division until it is effectively eliminated, thereby preventing any short-term or long-term breakthrough expression.

[0071] According to further embodiments, by maintaining the gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene-suppressing RNA in an episomal form, it is also possible to regulate copy number over a wide range and at levels much higher than can be achieved by conventional lentiviral transduction.

[0072] The disclosed VIV system exhibits many advantages. For example, episomal DNA is less susceptible to chromosomal alterations, which may result in gene silencing of conventional transduction vectors. Similarly, VIV episomal DNA vectors support active gene delivery for at least short to medium periods of about 1 to about 4 months, and in some cases longer. In other embodiments, the episomal DNA vectors of the present invention support active gene delivery for about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12 weeks or longer. In other embodiments, the episomal DNA vectors support active gene delivery for about 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 12 months, or longer. Any combination of these periods, such as 1 month and 1 week, or 3 months and 2 weeks, can also be used in the methods of the present invention.

[0073] Although there are benefits specifically related to the use of lentivirus carriers for the incorporation of the disclosed VIV system, the disclosed system is not limited to a single type of viral vector.Any DNA virus or virus that uses DNA intermediates can be used as carriers for the incorporation of the VIV system herein, including but not limited to lentivirus, adeno-associated virus (AAV), adenovirus, vaccinia, herpes virus, measles virus, hepadnavirus, parvovirus, and mouse virus.

[0074] Without limiting any of the above, in one aspect of the present invention, a non-integrating viral delivery system is disclosed. The system includes a viral carrier, where the viral carrier includes one or more defective integrase genes, a heterologous virus episomal replication origin, a sequence that codes for at least one initiator protein specific to the heterologous virus episomal replication origin, where the expression of the sequence that codes for at least one initiator protein specific to the heterologous virus episomal DNA replication origin is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. The viral carrier can be a lentivirus. The heterologous virus episomal DNA replication origin can be derived from a papillomavirus. The heterologous virus episomal DNA replication origin can be derived from a human papillomavirus or a bovine papillomavirus.

[0075] The heterologous viral episomal DNA origin of replication may be derived from human papillomavirus type 16 (HPV16). The heterologous viral episomal DNA origin of replication may be derived from the long control region (LCR) of HPV16. The heterologous viral episomal DNA origin of replication may comprise SEQ ID NO:1. Optionally, the heterologous viral episomal DNA origin of replication may comprise a 5' truncation of SEQ ID NO:1. The heterologous viral episomal DNA origin of replication may comprise a 5' truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO:1. The heterologous viral episomal DNA origin of replication may comprise at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity with the LCR Frag1 (SEQ ID NO:2), Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of HPV16. The heterologous viral episomal DNA origin of replication may comprise the LCR Frag1 (SEQ ID NO:2), or Frag2 (SEQ ID NO:3), or Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of HPV16. Without limiting any of the foregoing or the examples detailed herein, the genomic organization of the LCR is shown in FIG. 11. In addition to the fragments detailed herein, further fragments can be generated by deletion of the 5' and 3' regions of the LCR. Furthermore, mutations, substitutions, additions and / or deletions can be made to the full length LCR or related fragments. Furthermore, and without limiting the examples detailed above or herein, it is understood and within the scope of embodiments of the present disclosure that the components of the vectors detailed herein may be used interchangeably to develop new and / or modified vectors.

[0076] The LCR fragments detailed herein can be selected and used according to disease target. As shown in Figure 21 and Table 1, according to the disease target of interest, the LCR fragments that correlate with a particular quadrant (see Figure 21) can be selected. [Table 1-1] [Table 1-2]

[0077] Thus, based on the intended disease target, vector systems can be designed using quadrant 1, 2, 3, or 4 components (see FIG. 21). Selecting quadrant 1 components provides transient basal expression of gene cargo using the described vector system. In most cases, DNA copy number will be approximately 20 times lower than the highest level that can be achieved with this system. Careful selection of the promoter driving the expression of the DNA cargo further increases the flexibility and tissue specificity of the system. Selecting quadrant 2 provides high episomal DNA copy number with potentially very high gene expression levels, again depending on the promoter selection. Furthermore, the use of shorter LCR fragments increases the size of DNA inserts that can be incorporated as cargo. Also selecting quadrant 3 provides high, but slightly lower episomal copy number than can be obtained with quadrant 2. The advantage of quadrant 3 is the very low basal level of episomal DNA creating a highly controllable system by introducing or not E1 / E2 proteins. Selecting the fourth quadrant ensures very low expression that may be required for placebo controls or initial doses of dose escalation trials or dose testing to establish optimal levels for a desired indication.

[0078] Thus, the selection process can be correlated with the LCR fragments employed herein, thus making the disclosed system highly adaptable depending on the disease target and intended biological response.

[0079] The at least one initiator protein specific to the heterologous virus episomal DNA replication origin may comprise E1 or an operable fragment thereof. The at least one initiator protein specific to the heterologous virus episomal DNA replication origin may comprise E2 or an operable fragment thereof. The at least one initiator protein specific to the heterologous virus episomal DNA replication origin may comprise EBNA-1 or an operable fragment thereof. Optionally, the system may comprise at least two initiator proteins specific to the heterologous virus episomal DNA replication origin. The at least two initiator proteins specific to the heterologous virus episomal DNA replication origin may be E1 and E2 or an operable fragment thereof. The sequence encoding at least one initiator protein may be present on a single separate plasmid. Optionally, the system may include at least two initiator proteins specific for a heterologous virus episomal origin of replication, where the sequences encoding the at least two initiator proteins may be present on a single separate plasmid. Optionally, the system may include at least two initiator proteins specific for a heterologous virus episomal origin of replication, where the sequences for the first initiator protein and the second initiator protein may be present on separate plasmids.

[0080] For the disclosed non-integrating viral delivery system, the at least one gene product may comprise an antibody, an antibody fragment, or a growth factor. The antibody may comprise an anti-HER2 antibody or a fragment thereof. The growth factor may comprise vascular endothelial growth factor (VEGF) or a variant thereof. The miRNA may comprise a CCR5 miRNA. method

[0081] Embodiments of the present invention include methods of administering a VIV system to a patient in need thereof, where the VIV system encodes at least one, at least two, at least three, at least four, or at least five genes of interest. Considering the versatility and therapeutic potential of the disclosed VIV system, the VIV system according to the embodiments of the present invention can be used to inhibit or inhibit any of the following: antibodies against an antigen associated with an infectious disease or a toxin produced by an infectious pathogen, platelet-derived growth factor, vascular endothelial growth factor, brain-derived growth factor, nerve growth factor, human growth factor, human chorionic gonadotropin, cystic fibrosis transmembrane conductance regulator (CFTR), dystrophin or dystrophin-associated complex, lipoprotein lipase, α- and / or β-thalassemia, factor VIII, bone morphogenetic proteins 1-4, cyclooxygenase 2, vascular endothelial growth factor, chemokine receptor CCR5, chemokine receptor CXCR4, chemokine receptor CXCR5, antisense DNA against an autoimmune antigen involved in colitis, inflammatory bowel disease, or Crohn's disease, or The nucleic acid sequence may encode genes or nucleic acid sequences that contain RNA, small interfering RNA involved in addiction including miRNAs that regulate neurasthenia to opiates or alcohol, genes that regulate cell survival including tumor suppressor genes, pro- or anti-apoptotic genes and pro- or anti-autophagy genes, genes that encode radiation resistance factors, genes that encode photoproteins used to track tumor cell metastasis or other cellular trafficking events, or a variety of other therapeutically useful sequences that may be used to condition the body for maximum benefit from radiation, surgery, or chemotherapy, or to protect tissue from radiation, surgery, or chemotherapy, improve organ transplantation, or modify host or graft tissue to suppress hyper-reactivity, particularly in the airways.

[0082] Further, without limiting any of the foregoing, in another embodiment, there is provided a method of expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a cell, the method comprising contacting the cell with an effective amount of a non-integrating viral delivery system, the system comprising a viral carrier, the viral carrier comprising a defective integrase gene, a heterologous viral episomal origin of replication, a sequence encoding at least one initiator protein specific for the heterologous viral episomal origin of replication, wherein expression of the sequence encoding at least one initiator protein specific for the heterologous viral episomal DNA origin of replication is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.

[0083] In another embodiment, a method is provided for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a subject in need thereof.The method comprises administering to a subject in need thereof an effective amount of a non-integrating viral delivery system, wherein the system comprises a viral carrier, the viral carrier comprises a defective integrase gene, a heterologous virus episomal origin of replication, a sequence encoding at least one initiator protein specific to the heterologous virus episomal origin of replication, wherein the expression of the sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA origin of replication is inducible, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA.The sequence encoding at least one initiator protein may be present on a single separate plasmid, and the at least one initiator protein may be either E1 or E2, alone or in combination, or fragments thereof. The method optionally comprises administering to a subject in need thereof a first amount of a single separate plasmid for initiating a first expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. The method optionally comprises administering to a subject in need thereof a second amount of a single separate plasmid for initiating a second expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. In a situation where the second amount is lower than the first amount, the expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may be decreased. In a situation where the second amount is higher than the first amount, the expression level of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest may be increased. infectious disease

[0084] Methods for treating or preventing infectious diseases are provided. Prophylactic delivery of monoclonal antibodies to high-risk individuals, such as those at high risk of exposure to infectious diseases due to health conditions or geographic location, is currently practiced. Prophylactic delivery includes delivery of protective antibodies against deadly viral agents, for example, to protect individuals moving within endemic areas (e.g., medics and rescuers entering Ebola-infected areas). Vaccines have been largely untested for diseases such as Ebola or Lassa virus, or Dengue fever, or Chikungunya virus, or Plasmodium spp., the cause of malaria, and chronic expression of prophylactic antibody genes via the use of integrated vectors has unknown health risks. Thus, there is a high medical need for effective antibody expression, which must be high but transient.

[0085] The disclosed VIV system and method for delivering high copy numbers of genes of interest, gene products, shRNA, siRNA, miRNA, and / or other gene silencing RNA for a limited period of time meets this medical need.A non-limiting example of a gene product that can be delivered to treat infectious disease is an antibody specific to the infectious disease in question.

[0086] In one aspect, the present invention relates to a method of treating, preventing, or minimizing conditions, symptoms, or side effects associated with an infectious disease. In certain embodiments, the infectious disease can be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious disease. In some embodiments, the VIV system can be administered prophylactically or after infection with the infectious disease.

[0087] In another embodiment, the VIV system can be used to prevent infectious diseases: A subject suspected of being at increased risk of exposure to a particular infectious disease can be administered a prophylactically effective amount of a VIV encoding an antibody that specifically targets the infectious disease in question.

[0088] In certain embodiments, the infectious disease may be human immunodeficiency virus (HIV), human T-cell leukemia virus, Ebola virus, Lassa virus, dengue fever, Zika virus, malaria, tuberculosis, rabies, vaccinia virus, or other infectious disease. In certain embodiments, the VIV vector may be administered prophylactically or after infection with an infectious disease. wound healing

[0089] wound healing In another embodiment, the present invention relates to a method for treating, preventing, or minimizing conditions, symptoms, or side effects associated with wound healing. The disclosed compositions can be administered systemically or directly to wounds after accidents, injuries, or surgery. In the case of surgery, the VIV system can be administered prophylactically to promote healing. In the case of accidents, injuries, or surgical wounds, the VIV system can be administered some time after wound formation. For example, the VIV system can be administered within about 1, about 2, about 3, about 4, about 5, about 10, about 12, about 24, about 36, about 48, about 60, about 72, about 84, about 96, about 108, about 120, or about 168 hours after wound formation.

[0090] Another application of the methods and compositions of the present invention is the temporary delivery of VIV constructs capable of expressing platelet growth factors to accelerate wound healing. High doses of platelet-derived growth factor (PDGF), related growth factors, fragments thereof, and their related nucleotide variants are required very quickly but temporarily. The disclosed systems and methods are ideal for this type of application.

[0091] Further short term applications include expression of brain derived growth factor for the intermittent treatment of alcohol abuse, nerve growth factor for spinal cord regeneration, and topical application for skin conditions.

[0092] Bone disease or injury In one embodiment, the present invention relates to a method for enhancing bone healing, comprising identifying a subject having a bone injury and administering to the subject a therapeutically effective amount of a viral delivery system according to the present invention. The viral delivery system comprises a viral carrier, a heterologous viral episomal origin of replication, a sequence encoding an initiator protein specific to the heterologous viral episomal origin of replication, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA, where the viral carrier has a defective integrase gene and expression of the sequence encoding the initiator protein specific to the heterologous viral episomal DNA origin of replication is under the control of an inducible promoter. The bone injury may be due to an accident, injury, or surgery, and may be a bone nonunion or an acute fracture or a required spinal fusion. In some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest encodes bone morphogenetic protein 1-4 or cyclooxygenase-2 or vascular endothelial growth factor or a fragment thereof. Moreover, in certain embodiments, the above-mentioned variants are preferred for treating bone injuries or related diseases and are within the scope of the present invention.

[0093] In one embodiment, the present invention relates to a method for enhancing bone healing, comprising identifying a subject with bone disease and administering to the subject a therapeutically effective amount of a viral delivery system according to the present invention. The viral delivery system comprises a viral carrier, a heterologous virus episomal replication origin, a sequence encoding an initiator protein specific to the heterologous virus episomal replication origin, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA, where the viral carrier has a defective integrase gene, and the expression of the sequence encoding the initiator protein specific to the heterologous virus episomal DNA replication origin is under the control of an inducible promoter. The bone disease can be, for example, due to accident, injury, or surgery, and can be a nonunion of bone or an acute fracture or a required spinal fusion. In addition, the bone disease can be low bone density, low blood flow to bone, aging, hereditary conditions, etc. In some embodiments, the gene, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA of interest encodes bone morphogenetic proteins 1-4, or cyclooxygenase-2, or vascular endothelial growth factor. Inherited genetic disorders [Table 2]

[0094] In another embodiment, the present invention relates to a method for treating, preventing, or minimizing conditions, symptoms, or side effects associated with inherited genetic diseases. Some examples of such inherited genetic diseases are disclosed in Table 2 herein, using the following nomenclature, along with the causative type of mutation and the chromosome involved. P- point mutation or any insertion / deletion entirely within one gene D- Deletion of one or more genes C- Gain, loss, or both of entire chromosomes (see Chromosomal Abnormalities) T-trinucleotide repeat disorders: Genes expand in length

[0095] Current gene therapy involves attempting to edit genomic DNA through gene deletion, replacement, or resequencing.Various gene therapy systems known in the art include Talen, CRISPR-Cas9, zinc finger endonucleases, TALEN, etc., which rely on the delivery of genetic material by lentiviral transduction.However, unlike the present invention, these systems may remain active in cells for extended periods of time, as active chromosome modification systems may modify unexpected sites, leading to unexpected results that lead to new genetic diseases, including cancer.A truly practical system for modifying host DNA requires transient and well-regulated expression through methods such as those disclosed herein.

[0096] Thus, in one embodiment, the present invention relates to a method for treating a genetic disease, comprising identifying a subject with a genetic disease and administering to the subject a therapeutically effective amount of a viral delivery system according to the present invention.The viral delivery system comprises one or more of a viral carrier, a heterologous virus episomal origin of replication, a sequence encoding an initiator protein specific to the heterologous virus episomal origin of replication, and at least one gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA, wherein the viral carrier has a defective integrase gene, and the expression of the sequence encoding the initiator protein specific to the heterologous virus episomal DNA origin of replication is under the control of an inducible promoter.The genetic disease may be, for example, a disease listed in Table 2, and in some embodiments, the gene of interest, gene product, shRNA, siRNA, miRNA, and / or other gene silencing RNA encodes the non-mutated form of the gene listed in Table 2. Without limiting the above, the particular inherited genetic disease can be CF and treatment can be followed by expressing a non-mutated form of CFTR, as detailed herein.

[0097] In another embodiment, a guide RNA target sequence is incorporated into the disclosed VIV system. Guide RNA is a sequence used to direct gene editing mechanisms to specific sites in the host genome that are mutated or otherwise require modification. By including guide RNA in the cargo of the VIV system, it is possible to modify the chromosome section that requires modification, and the same modification occurs in the VIV, accelerating host degradation and / or dilution. In a specific embodiment of the present invention, the disclosed viral delivery system comprises one or more of a viral carrier, a heterologous virus episomal origin of replication, a sequence that codes for an initiator protein specific to the heterologous virus episomal origin of replication, at least one gene of interest, shRNA, siRNA, miRNA, and / or other gene silencing RNA, and at least one guide RNA, where the viral carrier has a defective integrase gene, and the expression of the sequence that codes for an initiator protein specific to the heterologous virus episomal DNA origin of replication is under the control of an inducible promoter.

[0098] Ex vivo modification of cells or tissues In another embodiment, the VIV system can be used to modify cells or tissues used in the treatment of disease. The cells can include, but are not limited to, primary cells such as lymphocytes, stem cells, epithelial cells, and neural cells. For example, the VIV system can be used to modify lymphocytes that are redirected to a particular disease, including cancer, infectious disease, or autoimmunity, and when the long-term presence of genetically modified cells poses health risks. For example, the VIV system can be used to program pluripotent stem cells that require high levels of transcription factors for a defined interval and when the long-term presence of an integrated viral vector is undesirable. Suitable epithelial cells include epithelial cells that can be used for synthetic skin or other applications. These may require expression during the initial treatment of trophic or growth factors that are detrimental to normal tissue function after treatment and are best delivered by the VIV system disclosed herein.

[0099] Dosage and Formulation The disclosed VIV system allows short-term, medium-term, or long-term expression of the gene or sequence of interest, and episomal maintenance of the disclosed vector. Thus, dosage regimens can vary based on the condition being treated and the method of administration.

[0100] In one embodiment, VIV can be administered in various doses to a subject in need thereof. 6 The subject may be administered an infectious dose (one dose is required on average to transduce one target cell). More specifically, the subject may be administered > 10 7 , ≧10 8 , ≧10 9 , or ≥ 10 10 It may be administered in infectious doses. Upper limits for VIV dosing will be determined for each disease indication and are based on the toxicity / safety profile for the individual product or product lot.

[0101] Additionally, VIV can be administered once or twice daily. Alternatively, VIV can be administered to a subject in need thereof once a week, once every two weeks, once every three weeks, once a month, every other month, every three months, every six months, every nine months, once a year, every 18 months, every two years, every 36 months, or every three years or longer.

[0102] In various aspects and embodiments, VIV is administered as a pharmaceutical composition.In embodiments, the pharmaceutical composition comprising VIV can be formulated into a wide range of nasal, pulmonary, oral, topical, or parenteral dosage forms for clinical application.Each dosage form can contain various disintegrants, surfactants, fillers, thickeners, binders, diluents such as wetting agents, or other pharma- ceutical acceptable excipients.The pharmaceutical composition comprising VIV can also be formulated for injection.

[0103] The VIV compositions may be administered using any pharma- ceutically acceptable method, such as intranasal, buccal, sublingual, oral, rectal, ocular, parenteral (intravenous, intradermal, intramuscular, subcutaneous, intracisternal, intraperitoneal), pulmonary, vaginal, topical, localized, post-scarring, mucosal, via aerosol, or via buccal or nasal spray formulation.

[0104] Furthermore, the VIV composition can be formulated into any pharma- ceutically acceptable dosage form, such as solid dosage forms, tablets, pills, lozenges, capsules, liquid dispersions, gels, aerosols, pulmonary aerosols, nasal aerosols, ointments, creams, semi-solid dosage forms, and suspensions.Furthermore, the composition can be a controlled release formulation, a sustained release formulation, an immediate release formulation, or any combination thereof.Furthermore, the composition can be a transdermal delivery system.

[0105] In another embodiment, the pharmaceutical composition comprising VIV can be formulated into a solid dosage form for oral administration, and the solid dosage form can be a powder, granule, capsule, tablet, or pill. In yet another embodiment, the solid dosage form can include one or more excipients, such as calcium carbonate, starch, sucrose, lactose, microcrystalline cellulose, or gelatin. Furthermore, the solid dosage form can include a lubricant, such as talc or magnesium stearate, in addition to the excipient. In some embodiments, the oral dosage form can be an immediate release or modified release form. Modified release dosage forms include controlled or extended release, enteric release, and the like. Excipients used in modified release dosage forms are generally known to those skilled in the art.

[0106] In a further embodiment, a pharmaceutical composition comprising VIV may be formulated as a sublingual or buccal dosage form. Such dosage forms include sublingual tablets or solution compositions administered under the tongue, and buccal tablets placed between the cheek and gums.

[0107] In yet a further embodiment, the pharmaceutical composition comprising the VIV can be formulated as a nasal dosage form. Such dosage forms of the present invention include solution, suspension, and gel compositions for nasal delivery.

[0108] In one embodiment, the pharmaceutical composition can be formulated into a liquid dosage form for oral administration, such as a suspension, emulsion, or syrup.In other embodiments, the liquid dosage form can contain various excipients, such as wetting agents, sweeteners, flavorings, or preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.In certain embodiments, the composition comprising VIV or its pharma- ceutically acceptable salt can be formulated to be suitable for administration to pediatric patients.

[0109] In some embodiments, the pharmaceutical composition may be formulated into a dosage form for parenteral administration, such as a sterile aqueous solution, suspension, emulsion, non-aqueous solution, or suppository. In other embodiments, the non-aqueous solution or suspension may include propylene glycol, polyethylene glycol, vegetable oil such as olive oil, or injectable ester such as ethyl oleate. As the base material for the suppository, witepsol, macrogol, tween 61, cacao oil, lauric oil, or glycerinated gelatin may be used.

[0110] The dosage of the pharmaceutical composition may vary according to the patient's weight, age, sex, time and mode of administration, excretion rate, and severity of the disease.

[0111] definition Words not specifically defined herein are understood to have the same meaning as understood by one of ordinary skill in the art.

[0112] As used herein, the term "about" will be understood by those of ordinary skill in the art and will vary to some extent depending on the context in which it is used. If there are uses of a term that are not obvious to those of ordinary skill in the art given the context in which the term is used, "about" will mean up to plus or minus 10% of the particular term.

[0113] The term "administration of" an active agent or "administering" an active agent means providing an active agent of the present invention to a subject in need of treatment in a form that can be introduced into the body of an individual in a therapeutically useful form and in a therapeutically effective amount.

[0114] The terms "expression," "expressed," or "encoding" refer to the process by which a polynucleotide is transcribed into mRNA and / or the transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Expression may include splicing, or other forms of post-transcriptional or post-translational modification, of the mRNA in eukaryotic cells.

[0115] The terms "individual," "host," "subject," and "patient" are used interchangeably herein.

[0116] The term "therapeutically effective amount" refers to a sufficient amount of the active agent of the present invention in a suitable composition and in a suitable dosage form to treat or prevent the symptoms, progression, or onset of complications seen in a patient suffering from a given illness, injury, disease, or condition. The therapeutically effective amount varies depending on the patient's condition or its severity, and the age, weight, etc., of the subject being treated. The therapeutically effective amount can vary depending on any of a number of factors, including, for example, the route of administration, the condition of the subject, and other factors understood by those skilled in the art.

[0117] The term "treatment" or "treating" generally refers to an intervention in an attempt to modify the natural course of the subject being treated, and may be performed for prophylaxis or during the course of clinical pathology. Desired effects include, but are not limited to, preventing the occurrence or recurrence of disease, alleviating symptoms, suppressing, attenuating, or inhibiting any direct or indirect pathological consequences of disease, improving or relieving the condition, and causing remission or improved prognosis.

[0118] As used herein, the term "VIV" refers to a vector-in-vector system for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA. As used herein, the term "VIV" is used synonymously with viral delivery system.

[0119] The following examples are provided to illustrate aspects of the present invention. However, the present invention is not limited to the specific conditions or details described in these examples. All published publications referenced herein are specifically incorporated by reference. EXAMPLES

[0120] Example 1 VIV for Treating Infectious Diseases This example demonstrates exemplary VIV constructs for treating infectious diseases.

[0121] In this example, Figure 1A depicts an exemplary linear VIV construct for treating Ebola virus infectious disease, where at least one of the "cargo" moieties depicted in Figure 1A encodes an antibody that specifically targets Ebola virus. As shown in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acid.

[0122] A therapeutically effective amount of VIV encoding an antibody specifically targeting Ebola virus may be administered to a subject suspected of having or diagnosed as having Ebola virus, alone or in combination with one or more additional agents for treating or preventing Ebola. VIV encoding an antibody specifically targeting Ebola virus and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, locally, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein. Subjects are then evaluated daily for the presence and / or severity of signs and symptoms associated with Ebola virus, including, but not limited to, fever, fatigue, lethargy, weakness, redness of the eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. Treatment is maintained until such time that one or more signs or symptoms of Ebola virus infection are improved or eliminated.

[0123] It is reasonably expected that subjects suspected of being infected with or diagnosed with Ebola virus and administered a therapeutically effective amount of a VIV encoding an antibody specifically targeting the Ebola virus will exhibit a reduction in severity or elimination of one or more symptoms associated with Ebola virus infection.Furthermore, it is reasonably expected that administering a VIV encoding an antibody specifically targeting the Ebola virus in combination with one or more additional agents will have a synergistic effect.

[0124] These results indicate that VIVs encoding antibodies that specifically target Ebola virus are useful in treating Ebola virus. Example 2 VIV to prevent infectious diseases

[0125] This example demonstrates exemplary VIV constructs for preventing infectious disease.

[0126] In this example, Figure 1A depicts an exemplary linear VIV construct for preventing Ebola virus infectious disease infection, where at least one of the "cargo" moieties depicted in Figure 1A encodes an antibody that specifically targets Ebola virus. As shown in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acid.

[0127] A prophylactically effective amount of VIV encoding an antibody specifically targeting Ebola virus may be administered to a subject suspected of having an increased risk of contracting Ebola virus, alone or in combination with one or more additional agents for treating or preventing Ebola, before entering an area with an increased risk of contracting Ebola.The VIV encoding an antibody specifically targeting Ebola virus and / or the additional agent is administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, topically, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to methods known in the art or described herein.Subjects are then evaluated daily for the presence and / or severity of signs and symptoms associated with Ebola virus, including, but not limited to, fever, fatigue, lethargy, weakness, redness of the eyes, joint and muscle pain, headache, nausea, vomiting, bleeding, and death. Treatment is maintained for such a time that one or more signs or symptoms of Ebola are prevented.

[0128] A subject suspected of or diagnosed as having been exposed to the Ebola virus and administered a prophylactically effective amount of a VIV encoding an antibody that specifically targets the Ebola virus is reasonably expected to have a reduced risk of contacting Ebola.Furthermore, it is reasonably expected that administration of a VIV encoding an antibody that specifically targets the Ebola virus in combination with one or more additional agents will have a synergistic effect.

[0129] These results indicate that VIVs encoding antibodies that specifically target Ebola virus are useful in preventing Ebola virus infection. Example 3 VIV to enhance wound healing

[0130] This example demonstrates exemplary VIV constructs for enhancing wound healing.

[0131] In this example, Figure 1A depicts an exemplary linear VIV construct for enhancing wound healing, where at least one of the "cargo" moieties depicted in Figure 1A encodes platelet-derived growth factor (PDGF) (SEQ ID NO: 17). As depicted in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acid.

[0132] A therapeutically effective amount of VIV encoding platelet-derived growth factor (PDGF) can be administered to a subject with a wound (e.g., from accident, injury, or surgery), alone or in combination with one or more additional agents for treating or sterilizing the wound. VIV PDGF and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, locally, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to the method known in the art or described herein. Then, the subject is evaluated daily to determine the condition of the wound. Treatment is maintained until the wound has healed and scarring is minimized.

[0133] It is reasonably expected that a subject having a wound and receiving a therapeutically effective amount of VIV PDGF will exhibit enhanced wound healing.Furthermore, it is reasonably expected that administering VIV encoding PDGF in combination with one or more additional agents will have a synergistic effect.

[0134] These results indicate that VIV encoding PDGF is useful for enhancing wound healing. Example 4 VIV for Treating Bone Injuries

[0135] This example demonstrates an exemplary VIV construct for treating bone injury.

[0136] In this example, Figure 1A depicts an exemplary linear VIV construct for treating bone injury, where at least one of the "cargo" moieties depicted in Figure 1A encodes a bone morphogenetic protein (BMP) (SEQ ID NO: 18). As depicted in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acid.

[0137] The subject suspected of having bone injury or diagnosed as having bone injury is administered a therapeutically effective amount of VIV encoding bone morphogenetic protein (BMP), alone or in combination with one or more additional agents for treating bone injury.The VIV encoding BMP and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, locally, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to the method known in the art or described herein.Subject is then evaluated weekly for the presence and / or severity of signs and symptoms related to bone injury to determine the speed and strength of healing.Treatment is maintained until the time when bone heals.

[0138] It is reasonably expected that the subject suspected of having bone injury or diagnosed as having bone injury and administered a therapeutically effective amount of VIV encoding BMP will show the reduction of injury severity and the enhancement of healing.In addition, it is reasonably expected that the administration of VIV encoding BMP in combination with one or more additional active substances will have synergistic effect.

[0139] These results indicate that VIV encoding BMPs is useful in treating bone injury or disease. Example 5 VIV for Treating Genetic Diseases

[0140] This example demonstrates exemplary VIV constructs for treating cystic fibrosis (CF).

[0141] In this example, Figure 1A depicts an exemplary linear VIV construct for treating the genetic disease CF, where at least one of the "cargo" moieties depicted in Figure 1A encodes the cystic fibrosis transmembrane conductance regulator (CFTR) (NM_000492). As depicted in Figure 1B, the long terminal repeat (LTR) portion of the exemplary VIV construct can be used to circularize viral nucleic acid.

[0142] A therapeutically effective amount of VIV encoding cystic fibrosis transmembrane conductance regulator (CFTR) can be administered to a subject suspected of having (CF) or diagnosed as having (CF), alone or in combination with one or more additional agents for treating CF. VIV encoding CFTR and / or additional agents are administered orally, intranasally, intrathecally, intraocularly, intradermally, transmucosally, iontophoretically, locally, systemically, intravenously, subcutaneously, intraperitoneally, or intramuscularly according to the method known in the art or described herein. Then, the subject is evaluated weekly for the presence and / or severity of signs and symptoms associated with CF, including, but not limited to, poor growth, persistent cough, thick sputum and mucus, wheezing, shortness of breath, reduced ability to exercise, repeated lung infections, nasal inflammation, oily stool, intestinal obstruction, and poor weight gain. Treatment is maintained until such time that one or more signs or symptoms of CF are improved or eliminated.

[0143] It is reasonably expected that a subject suspected of having or diagnosed with CF and administered a therapeutically effective amount of a VIV encoding CFTR will exhibit a reduction in the severity or elimination of one or more symptoms associated with CF. Furthermore, it is reasonably expected that administering a VIV encoding CFTR in combination with one or more additional agents will have a synergistic effect.

[0144] These results indicate that VIV encoding CFTR is useful in the treatment of CF. Example 6 VIV containing E1 for expressing cargo

[0145] A vector according to FIG. 2 was generated containing the green fluorescent protein gene (GFP) as cargo. DNA containing the complete locus control region and E1 protein of human papillomavirus type 16 (NCBI accession number U89348, SEQ ID NO: 19) was chemically synthesized. Individual segments and / or coding sequences were first synthesized. These were amplified by polymerase chain reaction (PCR) using synthetic oligonucleotide primers identical to the 5' end of the green fluorescent protein gene and complementary to the 3' end of the green fluorescent protein. The 5' primer (SEQ ID NO: 20) was extended from its 5' end with a recognition site for BamHI or EcoRI endonuclease. The 3' primer (SEQ ID NO: 21) was extended at its 3' end with the complement of the BamHI or EcoRI endonuclease recognition site. The resulting amplified green fluorescent protein gene sequence was then digested with BamHI and EcoRI restriction endonucleases.

[0146] Lentiviral vectors were obtained from System Biosciences, Inc. The plasmids were cut with BamHI and EcoRI enzymes and mixed with the over-amplified green fluorescent protein gene sequence at a ratio of 1:3 insert to vector.

[0147] Enzyme activity was then stopped by heat inactivation for 20 minutes at 70 degrees C. The above mixture was cooled to room temperature and allowed to anneal.

[0148] The annealing reaction was carried out with bacteriophage T4 DNA ligase for 30 minutes at room temperature. 2.5 microliters of the resulting ligation mixture was added to 25 microliters of STBL3 competent bacterial cells.

[0149] Transfection was then performed by a brief (1 min) heat shock at 42 degrees Celsius.

[0150] Bacterial cells were streaked onto agar plates containing ampicillin to obtain bacterial cultures, which were grown in Luria broth.

[0151] To confirm the insertion of the amplified green fluorescent protein gene sequence into the lentiviral vector packaging plasmid, DNA was extracted from the bacterial culture and purified by standard methods. The purified DNA was digested with the same endonuclease used to generate the construct. The fragment length was analyzed by agarose gel electrophoresis, and the amplified green fluorescent protein gene sequence was verified by DNA sequencing using specific primers obtained from Eurofins MWG Operon LLC.

[0152] Lentiviral vector stocks were generated as follows: At least two lentiviral packaging plasmids plus cargo plasmids were co-transfected into HEK cells expressing viral genes and genomic RNA, assembled into integrase-deficient lentiviral particles, and released into the culture medium. Cell-free supernatants were produced and harvested at intervals of 3-10 days after transfection. Lentiviral particles were purified by standard procedures involving a combination of methods that may include centrifugation, transient flow filtration, size-exclusion chromatography, size-exclusion filtration, or ion-exchange chromatography. The concentration and biological activity (transducing units per ml) for each stock was determined.

[0153] Mammalian cells, including 293T cells, were used to test the formation, copy number, and expression of lentivirus-derived episomes. 293T cells were transduced with integrase-deficient lentiviral particles in the presence of polybrene at a multiplicity of infection ranging from 1 to 10. Unabsorbed virus was removed by washing the cells 3 h after application, and the cells were cultured for 3 days. Cells were observed under a fluorescent microscope, and cells expressing GFP were counted. Non-transduced 293T cells were used as a negative control. Data were reported as GFP-positive cells per 100 viable cells in the culture. A minimum of 300 cells were counted per microscopic field, with 5–10 fields counted in each replicate experiment. Four independent transduction experiments, including one negative control (left-most data column) and three replicate experiments (i.e., data columns designated as experiment 1, experiment 2, and experiment 3), were performed to determine the frequency of transduced cells. Data are presented in Figure 3, showing the expression of GFP across three replicate experiments. Example 7 VIV containing E1 and E2 to express cargo

[0154] Referring to Figure 4, vector 19 can be constructed to contain both the E1 (SEQ ID NO:6) and E2 (SEQ ID NO:7) initiator proteins, where the genetic cargo is a CMV / GFP expression cassette under the control of an inducible promoter.

[0155] 293T cells may be transduced with vector 19 at a multiplicity of infection ranging between 1 and 20 transducing units per cell. After 3 hours, cells are washed with medium to remove unadsorbed virions and returned to culture. 12-24 hours after transduction, cells are treated with at least one dosage of a compound capable of inducing an inducible promoter. Upon addition of a compound capable of inducing an inducible promoter, E1 and E2 mRNAs are transcribed from the episome, combined with locus control region fragment 2 (LCR / F2) (SEQ ID NO:3), and assembled to trigger DNA replication. The lentivirus-derived episome begins to disintegrate approximately 24-36 hours after cessation of promoter induction. Protein products from the cargo within vector 19 are measured by analytical flow cytometry. Example 8 Introduction of E1 and E2 to express cargo

[0156] To determine the effect of E1 and E2 expressing cargo, 293T cells were transduced with a D64V integrase-deficient lentiviral vector (i.e., the vector in Figure 5A) expressing mCherry and the full-length HPV16 (SEQ ID NO:1) long control region (LCR) or the 3' fragments as described herein as fragment 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5).

[0157] With reference to Figure 5A, either the full length LCR or a 3' fragment was utilized in the LCR region shown in Figure 5A. More specifically, illustrations of the designed constructs are demonstrated in Figure 7 herein as vectors 9-13. Additional elements shown in Figure 7 refer to the psi packaging element (SEQ ID NO:22); the rev element (SEQ ID NO:23); the cPPT (central polypurine tract) element (SEQ ID NO:24); and the Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25).

[0158] 24 hours later, cells were transfected with a plasmid containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using Lipofectamine 2000. Two days later, mCherry expression was analyzed by FACS. The results of these experiments are shown in Figure 6A herein.

[0159] To contrast with the above experiments in which E1 and E2 were introduced via plasmids, a second set of experiments was performed as described below. Briefly, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and full-length HPV16 long control region (LCR) (SEQ ID NO: 1) or shorter fragment 1 (SEQ ID NO: 2), based on the generalized vector shown in FIG. 5A herein. At the same time, cells were transduced with a lentivirus expressing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 2 days, mCherry expression was analyzed by FACS, as shown in FIG. 6B herein. As shown in FIG. 6B herein, a greater percentage of mCherry cells was achieved when E1 and E2 were introduced with a D64V integrase-deficient lentiviral vector expressing mCherry and full-length LCR (SEQ ID NO: 1) or shorter fragment 1 (also referred to herein as fragment 1, and also referred to herein as SEQ ID NO: 2).

[0160] The data detailed in this example demonstrate that when E1 and E2 were expressed via lentivirus-mediated expression, there was stronger expression, and therefore greater activation, of HPV ori (LCR) full-length and fragments.

[0161] Second, the data from this example demonstrates that there are differences in HPV ori activation depending on the size of the LCR region. For example, see Figure 6, there was a more significant change in mCherry expression when using the full-length LCR (SEQ ID NO:1) and fragment 1 (SEQ ID NO:2) compared to fragments 2 (SEQ ID NO:3), 3 (SEQ ID NO:4), and 4 (SEQ ID NO:5). Example 9 VEGF expression

[0162] As described herein, VEGF can be selected as a "cargo" region to treat bone injury, among others. To further analyze VEGF expression levels, 293T cells were transduced with D64V integrase-deficient lentiviral vector containing human cDNA for VEGF (SEQ ID NO:26) and fragment 1 (SEQ ID NO:2) of HPV16 long control region (LCR) (see FIG. 5B for a general description of VEGF-containing vectors). At the same time, cells were transduced with lentiviral vector containing HPV16 E1 (SEQ ID NO:6) and E2 (SEQ ID NO:7). After 2 days, cell culture medium was collected and analyzed using an ELISA kit for VEGF (Thermo Scientific). As shown in FIG. 8, there was an increase in VEGF levels using the VEGF expression vector (3594 pg / ml), which was further increased using E1 and E2 (11856 pg / ml).

[0163] In a manner similar to the mCherry results from Example 8 above, the results demonstrate that there was a difference in HPVori activation depending on the size of the LCR region. As shown in Figure 8, there was an approximately 3-fold change in VEGF levels after addition of E1 / E2. Thus, the full-length LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2) express the gene of interest (i.e., VEGF) at low levels, but there was a strong induction of expression when E1 / E2 was introduced. In contrast, the other fragments tested were expressed at higher initial levels, with reduced differences upon introduction of E1 / E2. Example 10 Development of E1- and E2-containing vectors

[0164] Using standard molecular biology techniques (e.g., Sambrook; Molecular Cloning: A Laboratory Manual, 4th Edition) and those described herein, a series of lentiviral vectors containing the HPV LCR and E1 and E2 were developed, as described in more detail below. These vectors are also shown in Figure 9 herein.

[0165] With reference to Figure 9, vector 20 was developed, which is a general lentiviral vector for expressing cDNA, microRNA, or shRNA. With reference to vector 20, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); promoter; cDNA, microRNA, shRNA or other cargo element; woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25), LCR portion that can contain LCR fragments as detailed herein; and long terminal repeat (SEQ ID NO:28).

[0166] Referring to Figure 9, vector 21 was developed, which is a lentiviral vector for expressing E1. Referring to vector 21, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); CMV promoter (SEQ ID NO:29); E1 (SEQ ID NO:6) Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25); and long terminal repeat (SEQ ID NO:28).

[0167] 9, vector 22 was developed, which is a lentiviral vector for expressing E1-C (carboxy terminus) (SEQ ID NO:8). Referring to vector 22, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); CMV promoter (SEQ ID NO:29); E1-C (SEQ ID NO:8); Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) (SEQ ID NO:25); and long terminal repeat (SEQ ID NO:28).

[0168] Referring to Figure 9, vector 23 was developed, which is a lentiviral vector for expressing E2(HPV16) (SEQ ID NO:7). Referring to vector 23, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); UbiC promoter (SEQ ID NO:30); E2(HPV16) (SEQ ID NO:7); Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25); and long terminal repeat (SEQ ID NO:28).

[0169] Referring to Figure 9, vector 24 was developed, which is a lentiviral vector for expressing E2-11 (HPV11) (SEQ ID NO: 9). Referring to vector 24, from left to right, the key components of the developed vector are: the long terminal repeat (SEQ ID NO: 27); the psi packaging element (SEQ ID NO: 22); the rev responsive element (RRE) (SEQ ID NO: 23); the UbiC promoter (SEQ ID NO: 30); E2-11 (HPV11) (SEQ ID NO: 9); the woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25); and the long terminal repeat element (SEQ ID NO: 28).

[0170] 9, vector 25 was developed, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO: 10). Referring to vector 25, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO: 27); psi packaging element (SEQ ID NO: 22); rev responsive element (RRE) (SEQ ID NO: 23); CMV promoter (SEQ ID NO: 29); E1-T2A-E2 (SEQ ID NO: 10); Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO: 25); and long terminal repeat (SEQ ID NO: 28).

[0171] 9, vector 26 was developed, which is a lentiviral vector for expressing E1-T2A-E2 (SEQ ID NO:10) and full-length LCR (SEQ ID NO:1) or fragments thereof (e.g., SEQ ID NOs:2-5). Referring to vector 26, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); CMV promoter (SEQ ID NO:29); E1-T2A-E2 (SEQ ID NO:10); Woodchuck hepatitis virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25), LCR portion; and long terminal repeat (SEQ ID NO:28).

[0172] Still referring to Figure 9, Vector 27 is a general lentiviral vector for expressing, for example, cDNA, antibody, microRNA, or shRNA. Referring to Vector 27, from left to right, the key components of the developed vector are: long terminal repeat (SEQ ID NO:27); psi packaging element (SEQ ID NO:22); rev responsive element (RRE) (SEQ ID NO:23); promoter; cDNA, microRNA, shRNA or other cargo element; Woodchuck Hepatitis Virus post-transcriptional regulatory element (WPRE) (SEQ ID NO:25), EBVori (SEQ ID NO:31); and long terminal repeat element (SEQ ID NO:28).

[0173] The linear vectors detailed herein, for example, circularize within the cell as shown in FIG. 10, which shows the circularization of vector 20 (shown in FIG. 9). For the purposes of the experiments detailed herein, FIG. 10 details a primer set as arrows located at the 3' and 5' long terminal repeats (LTRs). This primer set is designed to amplify the episomal form of the lentiviral vector and not the integrated form of the vector. Suitable primers for detection of lentiviral episomes contain the following sequences: 3'LTR forward CTAATTCACTCCCAACGAAG (SEQ ID NO: 11); and 5'LTR reverse GCCGAGTCCTGCGTCGAGAG (SEQ ID NO: 12).

[0174] In the experiments detailed here, integrase defective lentiviral vector copy number was modulated by combination utilizing Vector 20 in combination with Vector 21, Vector 22, Vector 23, or Vector 24. Alternatively, integrase defective lentiviral vector copy number was modulated by combination utilizing Vector 20 in combination with Vector 25 or Vector 26. Example 11 Development of LCR fragments and related vectors

[0175] As discussed herein, the LCR portions of the vectors detailed herein can be fragments such as fragment 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5), and have been modified through their use.

[0176] The genomic organization of the LCR and fragments described herein is shown in Figure 11, where the full length LCR (top) contains a series of AP1, YY1, E1 and E2 binding sites. For example, as shown in Figure 11, fragment 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5) represent increasing LCRs with increasing 5' truncations that reduce the series of AP1, YY1 and E2 binding sites. Lentiviral vectors utilizing LCR fragments are detailed herein (e.g., Figure 7 and related examples herein). Example 12 Testing of vectors containing LCR fragments and E1 / E2 variants

[0177] To test vectors containing various LCR fragments detailed herein, 293T cells were transduced with D64V integrase-deficient lentiviral vectors containing the full-length HPV16 long control region (LCR) or any of fragments 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5) described herein (see, e.g., FIG. 7 and related examples herein).

[0178] After 24 hours, cells were transfected with a plasmid containing HPV16 E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) using Lipofectamine 2000. After 2 days, DNA was extracted for analysis by qPCR. Episomal copy numbers were determined using primers represented by SEQ ID NO: 11 and SEQ ID NO: 12, which are specific for the episomal form of the lentiviral vector. Note that this primer set only amplified 1- and 2-LTR episomes. Data for this example are shown in Figure 16. In this figure, the numbers associated with the LCR and its fragments reflect the increase in fold change for each of the conditions after E1 and E2 addition.

[0179] In another set of related experiments, mCherry expression from integrase-deficient lentiviral vectors containing the HPV LCR and its 3' fragment was analyzed. Briefly, 293T cells were transduced with D64V integrase-deficient lentiviral vectors expressing mCherry and either the full-length HPV16 long control region (LCR) or fragment 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5). At the same time, cells were transduced with lentiviruses expressing HPV16 E1 (SEQ ID NO:6) and E2 (SEQ ID NO:7). After 2 days, mCherry expression was analyzed by FACS.

[0180] The percentage of mCherry cells was determined for each of the conditions tested, as shown in Figure 13A. The numbers associated with the LCR and its fragments reflect the increase in fold change for each of the conditions following E1 and E2 addition.

[0181] In another set of related experiments, 293T cells were transduced with a D64V integrase-deficient lentiviral vector expressing mCherry and the full-length HPV16 long control region previously identified as SEQ ID NO: 1. At the same time, cells were transduced with a lentivirus expressing HPV16 E1-T2A-E2 (SEQ ID NO: 10) from a single vector (see vector 25 in FIG. 9). After 2 days, mCherry expression was analyzed by FACS. The data are shown in FIG. 13B. As shown in that figure, transduction with HPV16 E1-T2A-E2 (SEQ ID NO: 10) led to a significant increase in positive mCherry cells.

[0182] In another set of related experiments, analysis of mCherry expression was performed using an integrase-deficient lentiviral vector containing HPV LCR after the addition of E1, E1-C and E2-11. Briefly, 293T cells were transduced with D64V integrase-deficient lentiviral vector expressing mCherry and HPV16 LCR (SEQ ID NO: 1) or fragment 1 (SEQ ID NO: 2). At the same time, cells were transduced with HPV16 E1 (i.e., vector 21 in FIG. 9; and SEQ ID NO: 6) or E1 carboxy (C)-terminal fragment (i.e., vector 22 in FIG. 9; and SEQ ID NO: 8) and HPV16 E2 (i.e., vector 23 in FIG. 9; and SEQ ID NO: 7) or HPV11 E2 (i.e., vector 24 in FIG. 9; and SEQ ID NO: 9). After 2 days, mCherry expression was analyzed by FACS. As shown in FIG. 14, the percentage of mCherry cells was determined for each of the conditions tested. The numbers associated with the conditions tested reflect the increase in fold change for each of the conditions following addition of E1 and E2. Example 13 Antibody expression

[0183] As described herein, one of the features of the disclosed system is the usefulness of the disclosed system for expressing antibody.In a series of representative experiments detailed herein, anti-HER2 antibody is expressed using lentiviral vector system.In brief, 293T cells are infected with D64 integrase-deficient lentiviral vector (i.e., vector 20) that contains antibody sequence against HER2 (SEQ ID NO: 13) and HPV LCR (SEQ ID NO: 1) sequence.

[0184] At the same time, cells were infected with a lentiviral vector containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 3 days, cell culture medium was collected. Antibodies were purified from the medium using protein A / G agarose beads. Immunoblotting was performed using sheep anti-human antibody (Thermo Scientific). Antibody production was increased with the addition of E1 and E2, as shown in FIG. 15A. Furthermore, anti-HER2 antibody was also increased with the addition of E1 and E2, as shown in FIG. 15B. IgG concentrations were determined using the EasyTiter IgG kit (Thermo Scientific).

[0185] Additionally, as shown in Figure 16 herein, additional antibodies can also be expressed using the system disclosed herein. In Figure 16, an immunoblot is shown demonstrating the expression of an anti-EGFR antibody (SEQ ID NO: 14). Briefly, 293T cells were infected with a D64 integrase-deficient lentiviral vector containing an antibody sequence against EGFR (see SEQ ID NO: 14 below) and HPV fragment 2 (SEQ ID NO: 3).

[0186] After 24 hours, cells were infected with lentiviral vectors containing E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7). After 3 days, cell lysates and cell culture medium were harvested. Antibodies were purified from the medium using protein A / G agarose beads and extracted from cells by cell lysis. Immunoblotting was performed using sheep anti-human antibody (Thermo Scientific) and anti-actin (Sigma) antibody for protein loading control on cell lysates. Antibody production was increased in both cell lysates and medium supplemented with E1 and E2, as shown in FIG. 16. Example 14 MicroRNA expression and knockdown

[0187] As described herein, one of the features of the disclosed system is the utility of the disclosed system for expressing microRNA.As a non-limiting example, construct is designed to express microRNA for CCR5 based on SEQ ID NO: 15.

[0188] Briefly, HeLa cells expressing CCR5 were infected with D64 integrase-deficient lentiviral vector (i.e., vector 20) containing microRNA sequence against CCR5 (SEQ ID NO: 15) and full-length HPV LCR (SEQ ID NO: 1) sequence. At the same time, cells were infected with lentiviral vector containing E1 and E2. After 3 days, cells were harvested and analyzed for CCR5 expression by FACS analysis using anti-CCR5 APC-conjugated antibody. As shown in Figure 17, the percentage of CCR5-positive cells was reduced from 92.6% to 70.9% with LV-LCR miR-CCR5 and to 44% with LV-LCR miR-CCR5+E1 and E2.

[0189] Related experiments utilized a D64 integrase-deficient lentiviral vector containing a microRNA sequence against CCR5 and the fragment 2 (SEQ ID NO:3) LCR sequence. As shown in Figure 18, there was a similar reduction in CCR5 expression after addition of miR-CCR5, and an even further reduction when E1 and E2 were added.

[0190] Referring more specifically to FIG. 18, the top panel shows the distribution of cells, each represented by a single point, based on the expression level of mCherry. The bottom panel shows the corresponding changes in CCR5 expression, which are related to the level of DNA replication and miRNA production for CCR5. CCR5 is detected by a fluorescent monoclonal antibody used to stain the cell surface. In the absence of any LV vector (left panel), there is no expression of mCherry (all cells are in sector 1) and CCR5 expression is uniformly high at about 200 fluorescence intensity units. By adding LV-LCR (fragment 2; SEQ ID NO: 3) containing miRCCR5, we find cells with basal expression of mCherry (here 55% of cells were found in sector 2) and a partial reduction in CCR5 expression (dashed line in the bottom, middle panel) leading to a new population with fluorescence intensity units centered at about 30 intensity units. By adding both LV-LCR miRCCR5 and a non-integrating lentiviral vector expressing E1 and E2 replication proteins, we find 18.8% of cells with the highest expression of mCherry (sector 3) and a new population with even lower CCR5 expression with less than 20 fluorescence intensity units (curve 3, grey dashed line). These data demonstrate the ability of VIV containing LCR fragment 2 (SEQ ID NO: 3) to express basal levels of miRCCR5, which is biologically active in reducing cell surface expression of CCR5 protein. Furthermore, the results show that the addition of E1 / E2 DNA replication proteins affects vector copy number (related to mCherry expression) and that increased miRCCR5 expression leads to a further reduction in cell surface CCR5 expression. Example 15 EBV-based initiator proteins

[0191] As described herein, initiator proteins such as E1 (SEQ ID NO: 6) and E2 (SEQ ID NO: 7) can be used to enhance the efficacy of the system described herein. An alternative initiator protein that can be used in the current system is EBNA-1 (SEQ ID NO: 32). Thus, in one set of experiments, 293T cells were transduced with a D64V integrase-deficient lentiviral vector (i.e., vector 27) expressing GFP and the Epstein-Barr Virus (EBV) OriP sequence (SEQ ID NO: 31).

[0192] 24 hours later, cells were transfected with a plasmid containing EBV EBNA-1 (SEQ ID NO: 32) using Lipofectamine 2000. Two days later, GFP expression was analyzed by FACS. As shown in the representative data in Figure 19, EBV+EBNA resulted in enhanced GFP expression. Thus, this data demonstrates that initiator protein / ori interactions are not limited to E1 / E2 interactions but may also involve Epstein-Barr virus components. Example 16 LCR fragment combination and analysis

[0193] Based on the data detailed herein, the variation in expression levels as determined by episomal copies per cell can be attributed to the various LCR fragments tested herein. As shown in Figure 20, moving from right to left, data are shown for full length LCR (SEQ ID NO:1), fragment 1 (SEQ ID NO:2), fragment 2 (SEQ ID NO:3), fragment 3 (SEQ ID NO:4) and fragment 4 (SEQ ID NO:5) with and without E1 / E2.

[0194] With reference to both Figures 11 and 20, increasing deletions from the 5' end of the LCR remove important functional elements. As detailed herein, basal activity can be defined by the number of episomal DNA copies measured by quantitative PCR assay when the LCR or LCR fragment is present in a lentivirus-derived episomal vector and in the absence of added E1 / E2 proteins. Inducible activity can be measured by transfecting an expression plasmid containing E1 and E2, then introducing a lentivirus-derived episomal vector and then measuring the number of episomal DNA copies per cell by quantitative PCR assay. Similar results were obtained when the E1 / E2 protein expression construct was delivered as a non-integrating lentivirus vector. As detailed herein, basal activity is determined to be highest for fragments 2, 3 and 4 of the LCR. This indicates that basal activity is suppressed by the presence of the YY1 transcription factor binding site, which is present in both the LCR and fragment 1, but not fragments 2-4, as shown diagrammatically in Figure 11. Among fragments 2-4, fragment 2 showed the highest basal expression, and this fragment was the only fragment that contained both AP1 transcription factor binding sites. Thus, basal transcription is increased when the YY1 site is removed and both AP1 sites are preserved. As detailed herein, inducible activity was determined to be highest for fragments 1 and 3, lower for fragments 2 and 4, and lowest for the intact LCR. There are unidentified elements within the LCR that are absent in fragment 1 that act to suppress inducible DNA replication. When YY1 and AP1 sites are present (fragment 1), episomal DNA levels are lower compared to when YY1 and all AP1 sites are removed (fragment 3). When AP1 sites are present without YY1 (fragment 2), or when YY1, AP1, and two of the four E2 binding sites are removed (fragment 4), inducible episomal DNA formation is moderate and similar to the LCR.

[0195] As summarized in Figure 20, the data detailed herein demonstrates distinct differences in basal levels of expression and the ability to induce expression. Based on this schematic data, at least four quadrants of activity can be defined, as initially shown in Figure 20.

[0196] Turning now to FIG. 21, the four quadrants represent the degree of variability in activity due to the LCR and its fragments. For example, as shown in FIG. 21, quadrant 1 reflects low activity but 3-4 times higher activity than quadrant 4, with small LCR fragments. Quadrant 2 reflects high activity, again with small LCR fragments. Quadrant 3 reflects high activity, but this time with relatively long LCR fragments. Finally, quadrant 4 reflects very low activity, with relatively long LCR fragments.

[0197] As detailed in FIG. 21, each quadrant can be reasonably associated with a particular preferred outcome. As a first example, when the preferred outcome is for use in gene editing, an LCR chosen from the first quadrant can be selected. As a second example, when the preferred outcome is cell reprogramming, an LCR from the second quadrant can be selected. As a third example, when the preferred outcome is immune stimulation, an LCR from the third quadrant can be selected. As a fourth example, when the preferred outcome is placebo effect, an LCR from the fourth quadrant can be selected. Importantly, based on the preferred outcome, various LCR fragments can be employed using the current system. array The following sequences are referenced herein: [Table 3-1] [Table 3-2] [Table 3-3] [Table 3-4]

Table 3-5

Table 3-6

Table 3-7

Table 3-8

Table 3-9

Table 3-10

Table 3-11

Table 3-12

Table 3-13

Table 3-14

Table 3-15

Table 3-16

Table 3-17

Table 3-18

Table 3-19

Table 3-20

Table 3-21

[0198] While certain preferred embodiments of the invention have been described and specifically exemplified herein, it is not intended that the invention be limited to such embodiments, and various modifications thereto may be made without departing from the scope and spirit of the invention. The present invention provides, for example, the following items. (Item 1) (a) a viral carrier containing a defective integrase gene; (b) a heterologous viral episomal DNA replication origin; (c) a sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin, wherein expression of the sequence encoding at least one initiator protein specific to the heterologous virus episomal DNA replication origin is inducible; and (d) at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest; A non-integrating viral delivery system comprising: (Item 2) The non-integrating viral delivery system of item 1, wherein the viral carrier is a lentivirus. (Item 3) 2. The non-integrating viral delivery system of item 1, wherein the heterologous viral episomal DNA replication origin is derived from a papilloma virus. (Item 4) 4. The non-integrating viral delivery system of item 3, wherein the heterologous viral episomal DNA replication origin is derived from a human papillomavirus or a bovine papillomavirus. (Item 5) 5. The non-integrating viral delivery system of item 4, wherein the heterologous viral episomal DNA replication origin is derived from human papillomavirus type 16 (HPV16). (Item 6) 6. The non-integrating viral delivery system of item 5, wherein the heterologous viral episomal DNA replication origin is derived from the long control region (LCR) of HPV16. (Item 7) 7. The non-integrating viral delivery system of item 6, wherein the heterologous viral episomal DNA replication origin comprises SEQ ID NO:1. (Item 8) 7. The non-integrating viral delivery system of item 6, wherein the heterologous viral episomal DNA replication origin comprises a 5' truncation of SEQ ID NO:1. (Item 9) 7. The non-integrating viral delivery system of item 6, wherein the heterologous viral episomal DNA origin of replication comprises a 5' truncation of at least about 200 nucleotides, or at least about 300 nucleotides, or at least about 400 nucleotides, or at least about 500 nucleotides, or at least about 600 nucleotides, or at least about 700 nucleotides of SEQ ID NO:1. (Item 10) 7. The non-integrating viral delivery system of item 6, wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity to Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 11) 7. The non-integrating viral delivery system of item 6, wherein the heterologous viral episomal DNA replication origin comprises Frag1 (SEQ ID NO: 2), Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 12) 2. The non-integrating viral delivery system of item 1, wherein the at least one initiator protein specific for the heterologous viral episomal DNA replication origin comprises E1 or an operable fragment thereof. (Item 13) 2. The non-integrating viral delivery system of item 1, wherein the at least one initiator protein specific for the heterologous viral episomal DNA replication origin comprises E2 or an operable fragment thereof. (Item 14) 2. The non-integrating viral delivery system of item 1, wherein the at least one initiator protein specific for the heterologous viral episomal DNA replication origin comprises EBNA-1 or an operable fragment thereof. (Item 15) 2. The non-integrating viral delivery system of item 1, comprising at least two initiator proteins specific for the heterologous viral episomal DNA replication origin. (Item 16) 16. The non-integrating viral delivery system of item 15, wherein the at least two initiator proteins specific for the heterologous viral episomal DNA replication origin are E1 and E2 or operable fragments thereof. (Item 17) 2. The non-integrating viral delivery system of item 1, wherein the sequence encoding the at least one initiator protein is present in a single separate plasmid or non-integrating viral vector. (Item 18) 2. The non-integrating viral delivery system of item 1, wherein the system comprises at least two initiator proteins specific for the heterologous viral episomal DNA replication origin, and wherein the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-integrating viral vector. (Item 19) 2. The non-integrating viral delivery system of item 1, wherein the system comprises at least two initiator proteins specific for the heterologous viral episomal DNA replication origin, wherein the sequence for the first initiator protein and the sequence for the second initiator protein are present in separate plasmids or non-integrating viral vectors. (Item 20) 2. The non-integrating viral delivery system of item 1, wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor. (Item 21) 21. The non-integrating viral delivery system of item 20, wherein the antibody comprises an anti-HER2 antibody or a fragment thereof. (Item 22) 21. The non-integrating viral delivery system of item 20, wherein the growth factor comprises vascular endothelial growth factor (VEGF) or a variant thereof. (Item 23) The non-integrating viral delivery system of item 1, wherein the miRNA comprises a CCR5 miRNA. (Item 24) A pharmaceutical composition comprising the non-integrating viral delivery system of item 1 and at least one pharma- ceutically acceptable carrier. (Item 25) 1. A method for expressing at least one gene of interest, gene product, shRNA, siRNA, miRNA, or other RNA in a cell, comprising: contacting said cell with an effective amount of a non-integrating viral delivery system. wherein the system comprises: i. A viral carrier containing a defective integrase gene, ii. a heterologous viral episomal DNA replication origin; iii. a sequence encoding at least one initiator protein specific for the heterologous virus episomal DNA replication origin, wherein expression of the sequence encoding at least one initiator protein specific for the heterologous virus episomal DNA replication origin is inducible; and iv. at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest; A method comprising: (Item 26) 1. A method for expressing at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest in a subject in need thereof, comprising: administering to the subject an effective amount of a non-integrating viral delivery system, wherein the system comprises: i. A viral carrier containing a defective integrase gene, ii. a heterologous viral episomal origin of replication; iii. a sequence encoding at least one initiator protein specific for a heterologous virus episomal DNA replication origin, wherein expression of the sequence encoding at least one initiator protein specific for the heterologous virus episomal DNA replication origin is inducible; and iv. at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest; A method comprising: (Item 27) 27. The method of claim 26, wherein the sequences encoding the at least one initiator protein are present on a single separate plasmid, and the at least one initiator protein is E1 or E2. (Item 28) 28. The method of claim 27, further comprising administering to the subject in need thereof a first amount of the single separate plasmid to initiate a first expression level of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. (Item 29) 29. The method of claim 28, further comprising administering to the subject in need thereof a second amount of the single separate plasmid to initiate a second level of expression of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. (Item 30) 30. The method of claim 29, wherein the expression level of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest is decreased when the second amount is lower than the first amount. (Item 31) 30. The method of claim 29, wherein the expression level of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest is increased when the second amount is higher than the first amount. (Item 32) The non-integrating viral delivery system of item 1, wherein the system is optimized to produce low-level basal expression of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity to SEQ ID NO:1 or Frag1 of the LCR of HPV16 (SEQ ID NO:2). (Item 33) 2. The non-integrating viral delivery system of item 1, wherein the system is optimized to produce a low level basal expression of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and the heterologous viral episomal DNA replication origin comprises SEQ ID NO:1 or Frag1 (SEQ ID NO:2) of the LCR of HPV16. (Item 34) 2. The non-integrating viral delivery system of item 1, wherein the system is optimized to produce a moderate level of basal expression of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and wherein the heterologous viral episomal DNA replication origin comprises at least about 80% sequence identity, or at least about 85% sequence identity, or at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity to Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 35) 2. The non-integrating viral delivery system of item 1, wherein the system is optimized to produce a moderate level of basal expression of the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, and the heterologous viral episomal DNA replication origin comprises Frag2 (SEQ ID NO: 3), Frag3 (SEQ ID NO: 4), or Frag4 (SEQ ID NO: 5) of the LCR of HPV16. (Item 36) 1. A method for selecting an optimized non-integrating viral delivery system, comprising: Selecting basal expression levels wherein when a level X is selected, a corresponding Y is selected, where Y corresponds to a heterologous viral episomal DNA origin of replication selected for incorporation into said non-integrating viral delivery system; when X=low, Y comprises SEQ ID NO:1 or Frag1 (SEQ ID NO:2); The method, wherein if X=moderate, Y comprises Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of the LCR of HPV16.

Claims

1. A non-integrating viral delivery system optimized to produce basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, comprising: a) a viral carrier containing a defective integrase gene; b) i. a heterologous episomal human papillomavirus 16 (HPV16) origin of viral DNA replication comprising a 5' truncated HPV16 long control region (LCR), said 5' truncated HPV16 LCR comprising: a. one E1 binding site, two E2 binding sites, and one SP1 binding site; or b. one E1 binding site, three E2 binding sites, and one SP1 binding site; or c. at least two AP1 binding sites, one E1 binding site, three E2 binding sites, and one SP1 binding site, none of said AP1 binding sites being outside said HPV16 LCR enhancer region. contains; or ii. a first sequence encoding a heterologous episomal HPV16 viral DNA replication origin comprising a 5' truncated HPV16 LCR and at least one initiator protein specific for said heterologous episomal HPV16 viral DNA replication origin, wherein expression of said first sequence is inducible; said 5' truncated HPV16 LCR comprising: a. one E1 binding site, two E2 binding sites, and one SP1 binding site; or b. one E1 binding site, three E2 binding sites, and one SP1 binding site; or c. at least two AP1 binding sites, one E1 binding site, three E2 binding sites, and one SP1 binding site, none of said AP1 binding sites being outside said HPV16 LCR enhancer region. contains; or iii. A heterologous episomal HPV16 viral DNA replication origin comprising a 5' truncated HPV16 LCR, said 5' truncated HPV16 LCR comprising: a. at least three AP1 binding sites, one E1 binding site, four E2 binding sites, and one SP1 binding site, wherein one AP1 binding site is outside the HPV16 LCR enhancer region; contains; or iv. a first sequence encoding a heterologous episomal HPV16 viral DNA replication origin comprising a 5' truncated HPV16 LCR and at least one initiator protein specific for said heterologous episomal HPV16 viral DNA replication origin, wherein expression of said first sequence is inducible; said 5' truncated HPV16 LCR comprising: a. at least three AP1 binding sites, one E1 binding site, four E2 binding sites, and one SP1 binding site, wherein one AP1 binding site is outside the HPV16 LCR enhancer region; Including, A heterologous episomal HPV16 viral DNA replication origin; and c) a second sequence encoding the at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest; Including, A non-integrating viral delivery system, wherein the viral carrier is a lentivirus.

2. The non-integrating viral delivery system of claim 1, wherein the 5' truncated HPV16 LCR comprises at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity to SEQ ID NO:1 or SEQ ID NO:

2.

3. The non-integrating viral delivery system of claim 1 , wherein the 5′ truncated HPV16 LCR comprises SEQ ID NO:

2.

4. The non-integrating viral delivery system of claim 1 , wherein the 5′ truncated HPV16 LCR comprises at least about 700 nucleotides of SEQ ID NO:

1.

5. The non-integrating viral delivery system of claim 1 , wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E1 or an operable fragment thereof.

6. The non-integrating viral delivery system of claim 1 , wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E2 or an operable fragment thereof.

7. The non-integrating viral delivery system of claim 1, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises EBNA-1 or an operable fragment thereof.

8. The non-integrating viral delivery system of claim 1 , wherein the system comprises at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin.

9. The non-integrating viral delivery system of claim 8, wherein the at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin are E1 and E2 or operable fragments thereof.

10. The non-integrating viral delivery system of claim 1 , wherein the sequence encoding the at least one initiator protein is present in a single separate plasmid or non-integrating viral vector.

11. The non-integrating viral delivery system of claim 8 , wherein the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-integrating viral vector.

12. The non-integrating viral delivery system of claim 8 , wherein the sequence for the first initiator protein and the sequence for the second initiator protein are present in separate plasmids or non-integrating viral vectors.

13. The non-integrating viral delivery system of claim 1 , wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor.

14. The non-integrating viral delivery system of claim 1 , wherein the miRNA comprises a CCR5 miRNA.

15. A non-integrating viral delivery system optimized to produce basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, comprising: a) a viral carrier containing a defective integrase gene; b) a heterologous episomal human papillomavirus 16 (HPV16) viral DNA replication origin comprising a 5' truncated HPV16 long control region (LCR), said 5' truncated HPV16 LCR comprising: i. one E1 binding site, two E2 binding sites, and one SP1 binding site; or ii. one E1 binding site, three E2 binding sites, and one SP1 binding site; or iii. one E1 binding site, three E2 binding sites, two AP1 binding sites, and one SP1 binding site Including, heterologous episomal HPV16 viral DNA replication origin; c) a first sequence encoding at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin, wherein expression of said first sequence is inducible; and d) a second sequence encoding at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest; Including, A non-integrating viral delivery system, wherein the viral carrier is a lentivirus.

16. The non-integrating viral delivery system of claim 15, wherein the 5' truncated HPV16 LCR comprises at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity to SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:

5.

17. The non-integrating viral delivery system of claim 15, wherein the 5' truncated HPV16 LCR comprises SEQ ID NO:3, SEQ ID NO:4, or SEQ ID NO:

5.

18. 16. The non-integrating viral delivery system of claim 15, wherein the 5' truncated HPV16 LCR comprises at least about 200 nucleotides, at least about 300 nucleotides, or at least about 400 nucleotides of SEQ ID NO:

1.

19. 16. The non-integrating viral delivery system of claim 15, wherein the 5' truncated HPV16 LCR comprises at least one E1 binding site and two E2 binding sites.

20. The non-integrating viral delivery system of claim 15, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E1 or an operable fragment thereof.

21. The non-integrating viral delivery system of claim 15, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E2 or an operable fragment thereof.

22. The non-integrating viral delivery system of claim 15, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises EBNA-1 or an operable fragment thereof.

23. The non-integrating viral delivery system of claim 15, wherein the system comprises at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin.

24. 24. The non-integrating viral delivery system of claim 23, wherein the at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin are E1 and E2 or operable fragments thereof.

25. The non-integrating viral delivery system of claim 15, wherein the sequence encoding the at least one initiator protein is present in a single separate plasmid or non-integrating viral vector.

26. The non-integrating viral delivery system of claim 23 , wherein the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-integrating viral vector.

27. 24. The non-integrating viral delivery system of claim 23, wherein the sequence for the first initiator protein and the sequence for the second initiator protein are present in separate plasmids or non-integrating viral vectors.

28. The non-integrating viral delivery system of claim 15 , wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor.

29. The non-integrating viral delivery system of claim 15 , wherein the miRNA comprises a CCR5 miRNA.

30. 20. The non-integrating viral delivery system of claim 19, wherein the truncated HPV16 LCR further comprises either one additional E2 binding site and / or one or more AP1 binding sites.

31. A non-integrating viral delivery system optimized to produce basal expression of at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest, comprising: (a) a viral carrier comprising a defective integrase gene; (b) a heterologous episomal human papillomavirus 16 (HPV16) origin of viral DNA replication comprising a 5' truncated HPV16 long control region (LCR), said 5' truncated HPV16 LCR comprising one E1 binding site, four E2 binding sites, three AP1 binding sites, and one SP1 binding site; (c) a first sequence encoding at least one initiator protein specific for the heterologous episomal HPV16 viral DNA origin of replication, wherein expression of the first sequence is inducible; and (d) a second sequence encoding at least one gene, gene product, shRNA, siRNA, miRNA, or other RNA of interest. Including, wherein, when expressed, said at least one initiator protein functions to regulate expression of said second sequence; the viral carrier is a lentivirus, A non-integrating viral delivery system, wherein said at least one initiator protein specific for said heterologous episomal HPV16 viral DNA replication origin comprises at least one of an operable fragment of E1-C or an operable fragment of E1-T2A-E2.

32. The non-integrating viral delivery system of claim 31 , wherein the truncated HPV16 LCR further comprises one YY1 binding site.

33. The non-integrating viral delivery system of claim 31, wherein the heterologous episomal HPV16 viral DNA replication origin comprises at least about 90% sequence identity, or at least about 95% sequence identity, or at least about 98% sequence identity, with Frag1 (SEQ ID NO:2), Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of the LCR of HPV16.

34. The non-integrating viral delivery system of claim 31, wherein the heterologous episomal HPV16 viral DNA replication origin comprises Frag1 (SEQ ID NO:2), Frag2 (SEQ ID NO:3), Frag3 (SEQ ID NO:4), or Frag4 (SEQ ID NO:5) of the LCR of HPV16.

35. 32. The non-integrating viral delivery system of claim 31, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E1 or an operable fragment thereof.

36. 32. The non-integrating viral delivery system of claim 31, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises E2 or an operable fragment thereof.

37. The non-integrating viral delivery system of claim 31, wherein the at least one initiator protein specific for the heterologous episomal HPV16 viral DNA replication origin comprises EBNA-1 or an operable fragment thereof.

38. 32. The non-integrating viral delivery system of claim 31, wherein said system comprises at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin.

39. 39. The non-integrating viral delivery system of claim 38, wherein the at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin are E1 and E2 or operable fragments thereof.

40. The non-integrating viral delivery system of claim 31 , wherein the sequence encoding the at least one initiator protein is present in a single separate plasmid or non-integrating viral vector.

41. The non-integrating viral delivery system of claim 31, wherein the system comprises at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin, and wherein the sequences encoding the at least two initiator proteins are present in a single separate plasmid or non-integrating viral vector.

42. The non-integrating viral delivery system of claim 31, wherein the system comprises at least two initiator proteins specific for the heterologous episomal HPV16 viral DNA replication origin, and the sequence for the first initiator protein and the sequence for the second initiator protein are present in separate plasmids or non-integrating viral vectors.

43. The non-integrating viral delivery system of claim 31 , wherein the at least one gene product comprises an antibody, an antibody fragment, or a growth factor.

44. The non-integrating viral delivery system of claim 31 , wherein the miRNA comprises a CCR5 miRNA.

45. A pharmaceutical composition comprising the non-integrating viral delivery system of claim 31 and at least one pharma- ceutically acceptable carrier.

Images