Parthenogenetic haploid induction gene DMP and its uses

Abstract

The present invention provides a parthenogenetic haploid-inducing gene DMP and its use, and clones the parthenogenetic haploid-inducing genes AtDMP8 and AtDMP9 from Arabidopsis thaliana, enabling dicotyledonous plants to be induced to haploid form by parthenogenesis. The present invention also provides a tomato S1DMP that is capable of inducing parthenogenetic haploids.

Description

[Technical field]

[0001] The present invention relates to the fields of agricultural biotechnology and crop genetic breeding, mainly involving genome editing technology, and in particular to a method for preparing a plant female parent haploid induction system and its use, in particular to the use of a mutant of DMP, a parthenogenetic haploid induction gene obtained by gene editing technology, as a plant haploid induction system in inducing the production of female parent haploids in plants. [Background technology]

[0002] The selection of superior inbred lines is the basis and key for crops to utilize hybrid dominance and to select superior hybrid species. However, while traditional breeding methods can obtain stable inbred lines in 7-8 generations, haploid breeding technology requires only 2 generations (WeberDF, 2014), significantly shortening the breeding cycle. Currently, the generation of haploids in dicotyledonous crops mainly relies on in vitro culture of flower medicinal plants, which is inefficient and highly genotype-dependent on materials, making it difficult to realize large-scale application. The generation of haploids can be induced by introducing a genetically modified centromere-specific histone 3 variant (CENH3) into the Arabidopsis cenh3 mutant, but this method produces a large number of euploids during the induction process (Ravi, M, et al, 2010).

[0003] At present, the system of gene editing technology is very mature and stable, but genetic transformation cannot exert any further effects due to the limitations of its dependence on materials and genotypes. Editing is possible by introducing a gene editing vector into a recipient material that is easy to transform, and then hybridizing it with the target that needs editing (Li C et al., 2017), and a long backcrossing is required to restore the background, and it is not 100%. By combining haploid induction and gene editing technology, we have achieved editing of the genes of the target material, the haploid, and obtained an editing system to obtain homozygosity, greatly shortening and expanding the application range of haploid and gene editing technology (Kelliher, T et al., 2019; Wang, B et al., 2019; Hu, N et al., 2019). However, in dicotyledonous plants, due to the lack of a method for generating haploids by biological induction, it cannot be combined with gene editing technology. Summary of the Invention

[0004] An object of the present invention is to provide a method for preparing a plant haploid inducible system.

[0005] The present invention provides a method for preparing a plant haploid induction system, comprising the steps of: A1) is to silence or suppress the expression and / or activity of DMP gene in plant genome, or to knock out DMP gene, and obtain a plant haploid induction system; A2) is to suppress the activity of DMP protein in plants and obtain a plant haploid induction system; The plant is a dicotyledonous plant; The DMP protein is a protein shown in B1), B2), B3), or B4) below: B1) is a protein whose amino acid sequence is represented by SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6; B2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:2, SEQ ID NO:4, or SEQ ID NO:6; B3) is a protein having the same function as the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6, obtained by substituting and / or deleting and / or adding one or several amino acid residues; B4) is a protein having 75% or more identity to the amino acid sequence shown in SEQ ID NO:2 or SEQ ID NO:4 or SEQ ID NO:6 and having the same function; The DMP protein has the following functions: when the DMP protein activity in a dicotyledonous plant is suppressed, the dicotyledonous plant becomes a plant haploid inducible system; the DMP protein activity is suppressed so as not to express the DMP protein or to inactivate the DMP protein.

[0006] In the above B2), the tag refers to a polypeptide or protein that is expressed by fusing with a protein of interest using in vitro DNA recombinant technology in order to facilitate expression, detection, tracing and / or purification of the protein of interest. The protein tag can be a Flag tag, a His tag, a MBP tag, a HA tag, a myc tag, a GST tag, and / or a SUMO tag, etc.

[0007] In the above B3), the substitution and / or deletion and / or addition of one or more amino acid residues is the substitution and / or deletion and / or addition of 10 or less amino acid residues.

[0008] In the above B4), the 75% or more identity can be 80%, 85%, 90% or 95% or more identity.

[0009] In the above-mentioned method for preparing a plant haploid induction system, the DMP gene is a gene shown in C1), C2), C3), or C4) below: C1) is a cDNA molecule or a genomic DNA molecule shown in SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:5; C2) is a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in C1); C3) is a cDNA molecule or a genomic DNA molecule derived from a dicotyledonous plant and having 75% or more identity to the nucleotide sequence defined in C1); C4) is a cDNA molecule or a genomic DNA molecule that hybridizes under stringent conditions with a nucleotide sequence defined in C1) or C2) or C3); The DMP gene has the following function: when the DMP gene in a dicotyledonous plant is silenced or inhibited or knocked out, the dicotyledonous plant becomes a haploid derived lineage plant.

[0010] The term "identity" as used herein refers to sequence similarity with a natural nucleic acid sequence. "Identity" includes nucleotide sequences that have 75% or more, 85% or more, 90% or more, or 95% or more identity with the nucleotide sequence of a protein consisting of the amino acid sequence shown in the coding sequence 2 or sequence 4 or sequence 6 of the present invention. Identity can be evaluated by eye or computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0011] In the above-mentioned method for preparing a plant haploid induction system, the method for silencing or suppressing the expression and / or activity of the DMP gene in the plant genome or knocking out the DMP gene is to reduce the expression level of the DMP gene in the plant genome or to cause a deletion mutation, insertion mutation or base substitution in the DMP gene in the plant genome.

[0012] Furthermore, when the dicotyledonous plant is Arabidopsis thaliana, the DMP gene is an AtDMP8 gene and / or an AtDMP9 gene; and the DMP protein is an AtDMP8 protein and / or an AtDMP9 protein.

[0013] The method silences or suppresses the expression and / or activity of the AtDMP8 gene and / or AtDMP9 gene in the Arabidopsis genome, or knocks out the AtDMP8 gene and / or AtDMP9 gene, or suppresses the activity of the AtDMP8 protein and / or AtDMP8 protein, to obtain an inducible Arabidopsis haploid system.

[0014] When the dicotyledonous plant is tomato, the DMP gene is the S1DMP gene; the DMP protein is the S1DMP protein; and the method silences or suppresses the S1DMP gene in the tomato genome, or knocks out the S1DMP gene, or suppresses the activity of the S1DMP protein, to obtain an inducible tomato haploid system.

[0015] Furthermore, silencing or suppressing the expression and / or activity of the AtDMP8 gene and / or AtDMP9 gene in the Arabidopsis genome, or knocking out the AtDMP8 gene and / or AtDMP9 gene, reduces the expression level of the AtDMP8 gene and / or AtDMP9 gene in the Arabidopsis genome, or causes a deletion mutation, insertion mutation, or base substitution of the AtDMP8 gene and / or AtDMP9 gene in the Arabidopsis genome.

[0016] Silencing or suppressing the expression and / or activation of the S1DMP gene in the tomato genome or knocking out the S1DMP gene reduces S1DMP gene expression in the tomato genome or causes a deletion mutation, insertion mutation, or base substitution of the S1DMP gene in the tomato genome.

[0017] The method for reducing the expression level of the DMP gene in the plant genome may be RNAi interference. The RNAi interference may be single-stranded RNA interference such as miRNA, or double-stranded RNA interference such as siRNA, dsRNA, shRNA, etc.

[0018] The method for causing a deletion mutation or insertion mutation or base substitution of the DMP gene in the plant genome may be mutagenesis by CRISPR / Cas9 or TELLEN or T-DNA insertion or EMS.

[0019] Furthermore, the method for causing deletion mutation, insertion mutation, or base substitution of the DMP gene in the plant genome is CRISPR / Cas9. The method for causing deletion mutation, insertion mutation, or base substitution of the DMP gene in the plant genome includes the step of introducing a CRISPR / Cas9 vector containing the target sequence into a plant to obtain a plant haploid induction system.

[0020] In a specific embodiment of the present invention, when the dicotyledonous plant is Arabidopsis thaliana, the target sequences of CRISPR / Cas9 are positions 98-117 of sequence 1, positions 290-309 of sequence 3, positions 368-387 of sequence 3, and positions 509-528 of sequence 1. The CRISPR / Cas9 vector containing the target sequence is a recombinant vector in which the DNA molecule (sgRNA expression element) shown in sequence 7, the DNA molecule (Cas9 expression element) shown in sequence 9, and the DNA molecule (fluorescent protein expression element) shown in sequence 10 are linked to the pICSL4723 vector by the golden gate method.

[0021] In one specific embodiment of the present invention, when the dicotyledonous plant is tomato, the target sequence of CRISPR / Cas9 is positions 76-95 and 247-266 of sequence 5. The CRISPR / Cas9 vector containing the target sequence is a recombinant vector in which the DNA molecule (sgRNA expression element) shown in sequence 8, the DNA molecule (Cas9 expression element) shown in sequence 11, the DNA molecule (fluorescent protein expression element) shown in sequence 10, and the DNA molecule (NptII expression element) shown in sequence 12 are linked to a pICS4723 vector by the golden gate method.

[0022] Another object of the present invention is to provide a method for preparing a plant haploid inducible line, comprising the step of inbreeding said plant haploid inducible line.

[0023] The number of inbreedings is at least one, and can be specifically one.

[0024] Any of the above methods for preparing a plant haploid induction system further comprises a step of screening for a DMP gene mutant, the DMP gene mutant being a plant in which the DMP gene is mutated, the DMP gene mutant being a DMP gene heterozygous mutant or a DMP gene homozygous mutant.

[0025] In any of the above-mentioned methods for preparing the plant haploid induction system, the plant haploid induction system is specifically Arabidopsis mutant line T1-34, Arabidopsis mutant line T1-6, Arabidopsis mutant line T1-11, Arabidopsis mutant line T1-19, Arabidopsis mutant line T1-24, Arabidopsis mutant line T1-28, Arabidopsis mutant line T1-32, Arabidopsis mutant line T2-33, Arabidopsis mutant line T2-38, tomato mutant line sldmp-1 or tomato mutant line sldmp-2; The only difference between the genomic DNA of the Arabidopsis mutant line T1-34 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-512 of sequence 1, and an insertion of the base T is located between positions 114-115 of sequence 1 in the other chromosome; The only difference between the genomic DNA of the Arabidopsis mutant line T1-6 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-512 in SEQ ID NO:1, and in the other chromosome, a fragment is deleted, and the deleted fragment is located at positions 113-114 in SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a fragment is inserted in both chromosomes, and the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:13, and the inserted fragment is located between positions 160-161 in SEQ ID NO:3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-11 and the wild-type Arabidopsis Col-0 is that an insertion of one base T occurs in the gene encoding the AtDMP8 protein, and the insertion position of the base T is located between positions 114-115 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, an insertion of the base T occurs in one chromosome, and the insertion position of the base T is located between positions 160-161 of SEQ ID NO:3; and an insertion of a fragment occurs in another chromosome, and the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:13, and the insertion position of the fragment is located between positions 160-161 of SEQ ID NO:3; The only difference between the genomes of the Arabidopsis mutant line T1-19 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion of one base T, the deleted base being located at position 114 in sequence 1, and in the other chromosome, a fragment deletion is located at positions 115-511 in sequence 1; and in the gene encoding the AtDMP9 protein, one chromosome has a fragment deletion, the deleted fragment being located at positions 161-560 in sequence 3, and in the other chromosome, a fragment deletion is located at positions 161-564 in sequence 3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-24 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a segment deletion occurs in one chromosome, and the deleted fragment is located at positions 115-512 of sequence 1, and in the other chromosome, a base T is inserted, and the insertion position of the base T is located between positions 114-115 of sequence 1, and in the gene encoding the AtDMP9 protein, a segment deletion occurs in one chromosome, and the deleted fragment is located at positions 161-560 of sequence 3; and in the other chromosome, a segment deletion occurs, and the deleted fragment is located at positions 159-160 of sequence 3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-25 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion of one base T, the deleted base being located at position 114 of sequence 1, and in the other chromosome, the insertion of the fragment CGT is located between positions 114-115 of sequence 1; and in the gene encoding the AtDMP9 protein, one chromosome has a deletion of a fragment, the deleted fragment being located at positions 161-162 of sequence 3, and in the other chromosome, one chromosome has an insertion of one base A, the insertion of the fragment A is located between positions 160-161 of sequence 3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-28 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, the deleted fragment is located at positions 115-512 in sequence 1, and in the other chromosome, a single base T is deleted, the deleted base is located at position 114 in sequence 1; and in the gene encoding the AtDMP9 protein, a single base A is inserted in both chromosomes, the inserted position of the base A is located between positions 160-161 in sequence 3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-32 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-511 of sequence 1, and in the other chromosome, a base T is inserted, and the insertion position of the base T is located between positions 114-115 of sequence 1, and in the gene encoding the AtDMP9 protein, a base C is deleted in both chromosomes, and the deleted base is located at position 161 of sequence 3; The only difference between the genomic DNA of the Arabidopsis mutant line T1-33 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP9 protein, an insertion of the base T occurs in both chromosomes, and the insertion position of the base T is located between positions 160-161 of SEQ ID NO:3; and in the gene encoding the AtDMP9 protein, an insertion of a fragment occurs in both chromosomes, and the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:14, and the insertion position of the fragment is located between positions 561-562 of SEQ ID NO:3; The only difference between the genomic DNA of the Arabidopsis mutant line T2-38 and the wild-type Arabidopsis Col-0 is that a segment deletion occurs in two chromosomes of the gene encoding AtDMP8 protein, the segment is located at positions 115-127 of sequence 1, and an insertion of a base T and a base G occurs at two positions of the gene encoding AtDMP9 protein in two chromosomes, the two positions being located between positions 160-161 of sequence 3 and between positions 562-563 of sequence 3, respectively; The only difference between the genomic DNA of the tomato mutant sldmp-1 and the wild-type tomato AC is that the gene encoding the S1DMP protein has an insertion of a single C base in both chromosomes, and the inserted base is located between positions 92 and 93 of sequence 5.

[0026] The only difference between the genomic DNA of the tomato mutant sldmp-2 and the wild-type tomato AC is that a segmental deletion has occurred in both chromosomes in the gene encoding the S1DMP protein, and the deleted fragment is located at positions 93-249 of sequence 5.

[0027] Another object of the present invention is to provide a method for adjusting haploidity in a plant.

[0028] The method for preparing a plant haploid provided by the present invention comprises the steps of: inbreeding or hybridizing the plant haploid derivative line or its progeny prepared by the above method with other plant material as a male parent to obtain a selfed progeny or hybrid progeny, i.e., the plant haploid; the plant is a dicotyledonous plant.

[0029] Furthermore, the above-mentioned method for preparing a haploid plant further includes the following steps: performing fluorescent labeling identification and / or haploid character identification and / or leaf ploidy identification and / or marker identification on a single plant of the self-fertilized progeny or the hybrid progeny, and selecting at least one method to identify the progeny single plant as a haploid is a haploid plant.

[0030] Furthermore, the fluorescent labeling identification method can be carried out in the following manner: the above-mentioned plant haploid induction system carrying fluorescent protein expression elements is hybridized with female parent as male parent to obtain hybrid progeny, and the hybrid progeny seeds are detected to determine whether the measured seeds are haploid or diploid: if the measured seeds are non-fluorescent or weakly fluorescent, the seeds are haploid or candidate haploid; if the measured seeds show strong fluorescence, the seeds are diploid or candidate. Furthermore, the measured seeds are detected to have fluorescence by fluorescent lamp. Furthermore, since the male plant carries the TagRFP fluorescent protein expression element driven by promoter AtOLEO 1, it can be determined whether the hybrid progeny seeds are haploid or diploid based on whether they have red fluorescence.

[0031] The method for identifying the haploid characteristics can be carried out according to the following method: if the plant body to be measured has characteristics such as a low plant body, narrow leaves that face upward, a compact plant type, and male sterility, the plant body is haploid or a candidate haploid; if the plant body to be measured has characteristics such as a high plant body, wide and spreading leaves, and normal growth, the plant body is diploid or a candidate diploid.

[0032] The leaf ploidy identification method can be carried out according to the following method: extract the cell nuclei of the young leaves of the plant body to be measured, and use the leaves of diploid plants as a control; and use a flow cytometer to detect signals, first detect the diploid cell nucleus signal, and set the peak of the diploid cell nucleus signal to 50 (since the genetic material in diploid cells is twice as much as the genetic material in haploid cells, the peak of the haploid cell nucleus signal appears around 25). If the cell nucleus signal peak of the plant body to be measured appears around 25, the plant body is haploid or a candidate haploid; if the signal peak of the plant to be measured appears around 50, which is the same as the concentrated position of the diploid cell nucleus signal intensity, the plant is diploid or a candidate diploid.

[0033] The marker identification can be carried out according to the following method: PCR amplification is performed using polymorphic primers between the male parent (male parent haploid induction system) and the female parent, and whether the plant body to be measured is haploid or diploid is determined based on the PCR amplification product; if the amplification product of the plant body to be measured has only the band type of the female parent and the band type of the male parent is not present, the plant body is haploid or a candidate haploid; if the amplification product of the plant body to be measured has a heterozygous band type of the male parent and the female parent, the plant body is diploid or a candidate diploid.

[0034] The plant haploid induction system and plant haploid prepared by the above method also fall within the scope of the present invention.

[0035] The plant haploid induction system and the plant haploid include not only cells, tissues, organs, such as seeds, leaves, fruits, stems, flowers, and roots derived from the plant haploid induction system and the plant haploid, but also propagation materials derived from said plant haploid induction system and the plant haploid, such as pollen, ovaries, ovules, germs, endosperm, egg cells, cuttings, roots, root tips, hypocotyls, cotyledons, stems, leaves, flowers, anthers, seeds, meristematic cells, protoplasts, and populations from cell tissue culture.

[0036] In the above method, the AtDMP8 gene in the Arabidopsis mutant line, or the AtDMP9 gene in the Arabidopsis mutant line, or the S1DMP gene in the tomato mutant line also fall within the scope of protection of the present invention.

[0037] Any of the following uses D1)-D5) are within the scope of the present invention: D1) is the use of the plant haploid induction system prepared by the above method in cultivating plant haploids; D2) is the use of a substance that silences or suppresses the expression and / or activity of the AtDMP8 gene and / or the AtDMP9 gene in a plant genome, or that knocks out the AtDMP8 gene and / or the AtDMP9 gene, or that suppresses the activity of the AtDMP8 protein and / or the AtDMP8 protein in a plant haploid induction system or in cultivating a plant haploid; D3) is the use of a substance that silences or suppresses the expression and / or activity of the S1DMP gene in a plant genome, or knocks out the S1DMP gene, or a substance that suppresses S1DMP protein activity in a plant haploid induction system or in cultivating plant haploids; D4) is the use of the AtDMP8 protein or its related biological material and / or the AtDMP9 protein or its related biological material in controlling the induction rate of a plant haploid induction system, or increasing the induction rate of a plant haploid induction system, or in cultivating a plant haploid induction system or a plant haploid; D5) Use of the S1DMP protein or related biological material in controlling the induction rate of a plant haploid induction system, or increasing the induction rate of a plant haploid induction system, or in cultivating a plant haploid induction system or a plant haploid.

[0038] In any of the above uses or methods, the AtDMP8 protein is a protein as shown in a1), a2), a3), or a4) below: a1) is a protein whose amino acid sequence is shown in SEQ ID NO:2; a2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in sequence 2; a3) is a protein having the same function as the amino acid sequence shown in sequence 2, obtained by substituting and / or deleting and / or adding one or several amino acid residues; a4) is a protein having 75% or more identity to the amino acid sequence shown in sequence 2 and having the same function.

[0039] The AtDMP9 protein is a protein shown in b1), b2), b3), or b4) below: b1) is a protein whose amino acid sequence is shown in SEQ ID NO: 4; b2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:4; b3) is a protein having the same function as the amino acid sequence shown in sequence 4, obtained by substituting and / or deleting and / or adding one or several amino acid residues; b4) is a protein having 75% or more identity with the amino acid sequence shown in sequence 4 and having the same function.

[0040] The S1DMP protein is a protein shown in c1), c2), c3), or c4) below: c1) is a protein whose amino acid sequence is set forth in SEQ ID NO:6; c2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:6; c3) is a protein having the same function as the amino acid sequence shown in sequence 6, obtained by substituting and / or deleting and / or adding one or several amino acid residues; c4) is a protein having 75% or more identity with the amino acid sequence shown in sequence 6 and having the same function.

[0041] The biological material related to the AtDMP8 protein, AtDMP9 protein, or S1DMP protein is any one of the following d1) to d12): d1) is a nucleic acid molecule encoding the AtDMP8 protein, the AtDMP9 protein, or the S1DMP protein; d2) is an expression cassette comprising the nucleic acid molecule defined in d1); d3) is a recombinant vector comprising the nucleic acid molecule defined in d1); d4) is a recombinant vector comprising the expression cassette defined in d2); d5) is a recombinant microorganism comprising a nucleic acid molecule as defined in d1); d6) is a recombinant microorganism comprising an expression cassette as defined in d2); d7) is a recombinant microorganism comprising a recombinant vector as defined in d3); d8) is a recombinant microorganism comprising a recombinant vector as defined in d4); d9) a transgenic plant cell line comprising a nucleic acid molecule as defined in d1); d10) is a transgenic plant cell line containing the expression cassette defined in d2); d11) is a transgenic plant cell line containing a recombinant vector as defined in d3); d12) is a transgenic plant cell line containing the recombinant vector defined in d4).

[0042] Furthermore, the nucleic acid molecule according to d1) is a gene according to 1), 2), 3), or 4) below: 1) is a cDNA molecule or a genomic DNA molecule whose coding sequence is shown in SEQ ID NO:1 or SEQ ID NO:3 or SEQ ID NO:5; 2) is a cDNA molecule or a genomic DNA molecule having 75% or more identity to the nucleotide sequence defined in 1) and encoding the AtDMP8 protein, AtDMP9 protein, or S1DMP protein; 3) is a cDNA molecule or genomic DNA molecule derived from a dicotyledonous plant and having 75% or more identity with the nucleotide sequence defined in 1), and encoding the AtDMP8 protein, AtDMP9 protein, or S1DMP protein; 4) is a cDNA molecule or genomic DNA molecule which hybridizes under stringent conditions with the nucleotide sequence defined in 1), 2), or 3), and encodes the AtDMP8 protein, AtDMP9 protein, or S1DMP protein.

[0043] Among them, sequence 1 is a nucleic acid molecule encoding the AtDMP8 protein, sequence 3 is a nucleic acid molecule encoding the AtDMP9 protein, and sequence 5 is a nucleic acid molecule encoding the S1DMP protein.

[0044] Furthermore, the substance that knocks out the AtDMP8 gene and / or the AtDMP9 gene or the substance that knocks out the S1DMP gene is a CRISPR / Cas9 vector containing the target sequence described above.

[0045] In any of the above described uses or methods or plants, said plant is a dicotyledonous plant; said dicotyledonous plant may specifically be Arabidopsis thaliana or tomato; said Arabidopsis thaliana may specifically be wild type Arabidopsis thaliana (Col-0) or ms1; said tomato may specifically be F1 generation material obtained from wild type tomato AC or Micro-Tom or a hybrid of tomato AC and Micro-Tom. [Brief description of the drawings]

[0046] [Figure 1] A comparison of Arabidopsis thaliana haploid and diploid plants. The plant indicated by the arrow is haploid. [Diagram 2] FIG. 1 is a comparative diagram of Arabidopsis thaliana haploid and diploid plants after bolting. [Diagram 3] FIG. 1 is a comparison of flow cytometry results for Arabidopsis thaliana haploids and diploids. [Figure 4] Fluorescence identification diagram of Arabidopsis thaliana haploid. In Fig. 4, a shows the phenotype of Arabidopsis thaliana seeds under white light, and b shows the phenotype of Arabidopsis thaliana seeds under fluorescent light. The seeds indicated by the arrows are haploid. [Diagram 5] Validation gel diagram of Arabidopsis haploid and diploid markers. M is 2K marker, I is female parental material banding type, II is paternal material banding type, III is haploid banding type, and IV is diploid banding type. [Figure 6] 6 is a comparison of plants and fruits of wild-type tomato and sldmp mutant, Fig. 6A and B are wild-type tomato and sldmp mutant plants, respectively, and Fig. 6C and D are self-pollinated fruits of wild-type tomato and sldmp mutant, respectively. [Figure 7] Fluorescence representation of tomato seeds. Figure 7, a and b, are representations of ungerminated and germinated tomato seeds photographed in a bright place, respectively, and c and d are representations of ungerminated and germinated tomato seeds photographed in fluorescent light, respectively. [Figure 8] FIG. 10. Comparison of tomato haploid and diploid flow cytometry results. [Figure 9] 9 is a schematic diagram of the structure of the main elements in the recombinant vector, and Fig. 9(a) and (b) are schematic diagrams of the vector structures of Arabidopsis thaliana and tomato, respectively. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0047] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. Unless otherwise stated, the experimental methods in the following examples are conventional methods. Unless otherwise stated, the test materials used in the following examples are all purchased from ordinary biochemical reagent stores. The quantitative tests in the following examples are all repeated three times, and the results are averaged.

[0048] The pICSL4723 vector in the following examples is described in the literature "Castel, B. and L. Tomlinson, et al. (2019). Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. PloS one, 14(1)." and is available to the public from China Agricultural University. The test materials are only used to repeat the experiments related to the present invention and cannot be used for other purposes.

[0049] The wild-type Arabidopsis Col-0 and ms1 in the following examples are both described in the literature "Rosso, MG and Y. Li, et al. (2003). An Arabidopsis thaliana T-DNA mutagenized population (GABI-Kat) for flanking sequence tag-based reverse genetics. Plant Mol Biol 53 (1-2): 247-59." and are publicly available from China Agricultural University. The biological materials are used only to repeat the experiments related to the present invention and cannot be used for other purposes.

[0050] The wild-type tomato AC in the following examples is described in the literature "Yuan, G. and C. Jia, et al. (2010). Effect of brassinosteroids on drought resistance and abscisic acid concentration in tomato under water stress. Scientia Horticulturae 126 (2): 103-108." and is publicly available from China Agricultural University. The biomaterial is used only to repeat experiments related to the present invention and cannot be used for other purposes.

[0051] The wild-type tomato Micro-Tom in the following examples is described in the literature "Sun, H. and S. Uchii, et al. (2006). A highly efficient transformation protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant and Cell Physiology 47 (3): 426-431." and is publicly available from China Agricultural University. The biomaterial is used only to repeat the experiments related to the present invention and cannot be used for other purposes.

[0052] The CDS sequence of the AtDMP8 gene in the present invention is shown in positions 95-826 of Sequence 1 in the Sequence Listing, and the amino acid sequence of the protein encoded by the AtDMP8 gene is shown in Sequence 2.

[0053] The CDS sequence of the AtDMP9 gene of the present invention is shown in positions 141-875 of Sequence 3 in the Sequence Listing, and the amino acid sequence of the protein encoded by the AtDMP9 gene is shown in Sequence 4.

[0054] The CDS sequence of the S1DMP gene in the present invention is shown in positions 1-678 of Sequence 5 in the sequence listing, and the amino acid sequence of the protein encoded by the S1DMP gene is shown in Sequence 6. EXAMPLES

[0055] Example 1. Preparation of Arabidopsis thaliana mutants with AtDMP8 and / or AtDMP9 genes knocked out and their uses 1. Using the CRISPR / Cas9 system to knock out the AtDMP8 and / or AtDMP9 genes.

[0056] The AtDMP8 and / or AtDMP9 genes are knocked out using the CRISPR / Cas9 system to obtain Arabidopsis mutants in which the AtDMP8 and / or AtDMP9 genes are knocked out. The specific steps are as follows:

[0057] 1. Selection of sgRNA sequence The AtDMP8 and AtDMP9 genes were each provided with a target site sequence of 20 bp in length.

[0058] Target site 1 is located at positions 98-11 of sequence 1 and 144-163 of sequence 3, and the target site 1 sequence of the sgRNA is GAGAAAACAGAGGAAAGCGT.

[0059] Target site 2 is located at positions 290-309 of sequence 3, and the sgRNA target site 2 sequence is AAGAGGTCGAAACGTCGCA.

[0060] Target site 3 is located at positions 368-387 of sequence 3, and the sgRNA target site 3 sequence is TCAAGAGTGTTCCTGTCGGA.

[0061] Target site 4 is located at positions 509-528 of sequence 1 and 558-577 of sequence 3, and the sgRNA target site 4 sequence is ATGAACACCGCGAGTCCACG.

[0062] 2. Construction of CRISPR / Cas9 Vectors The CRISPR / Cas9 vector is a recombinant vector (vector structure diagram is shown in FIG. 9a) obtained after ligating the DNA molecule (sgRNA expression element) shown in SEQ ID NO:7, the DNA molecule (Cas9 expression element) shown in SEQ ID NO:9, and the DNA molecule (fluorescent protein expression element) shown in SEQ ID NO:10 to the pICSL4723 vector by the golden gate method. The DNA molecule shown in SEQ ID NO:7 sequentially contains the coding sequence of the sgRNA targeting target site 1, the coding sequence of the sgRNA targeting target site 2, the coding sequence of the sgRNA targeting target site 2, and the coding sequence of the sgRNA targeting target site 4, and the coding sequence of each sgRNA is preceded by an AtU 6-26 promoter for initiating expression of the coding sequence of the sgRNA.

[0063] 3. Obtaining transgenic plants The CRISPR / Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 by heat shock transformation (Agrobacterium GV3101 competent cells were purchased from Beijing Osen Dingxin Biological Technology Co., Ltd. and can be obtained by the public for purchase), and the recombinant bacterium GV3101 / CRISPR / Cas9 was obtained.

[0064] Furthermore, the recombinant bacteria GV3101 / CRISPR / Cas9 was infected into wild-type Arabidopsis Col-0 inflorescences using a transformation method in which Agrobacterium infects Arabidopsis inflorescences (the recombinant Agrobacterium was grown at 28°C, and the grown bacterial solution was used to infect Arabidopsis inflorescences), and after red fluorescence screening, T1 generation transgenic Arabidopsis plants were obtained.

[0065] 4. Identification of transgenic plants carrying mutations in the AtDMP8 and / or AtDMP9 genes.

[0066] Leaves were collected from the T1 generation transgenic Arabidopsis plants obtained in step 3, and genomic DNA was extracted as a template. PCR amplification was performed using the following two pairs of primers to obtain PCR amplification products from different strains.

[0067] The sequences of the primers for detecting the AtDMP8 mutant sequence are as follows: DMP8F1:TGCGAAATGAGATTGGTTTTGGG; DMP8R1:AAACACCCTGTGACTCTCCG.

[0068] The sequences of the AtDMP9 mutant sequence detection primers are as follows: DMP9F1:ATAACCGTCAATAACCGCCG; DMP9R2:CCAGTCATGCAACCAACACC.

[0069] The PCR amplification products of the different strains were Sanger sequenced, and the sequencing results were aligned with AtDMP8 and AtDMP9 of wild-type Arabidopsis thaliana Col-0, respectively. The AtDMP8 and AtDMP9 genotypes were identified according to the following principles.

[0070] If the sequence has a double-peak characteristic from the target site sequence, the genotype of the line is a heterozygous genotype (the AtDMP8 and / or AtDMP9 genes on one chromosome of two homologous chromosomes are mutated, and the AtDMP8 and / or AtDMP9 genes on the other chromosome are not mutated), and the line is a heterozygous mutant line of T1 generation transgenic Arabidopsis; If the sequence having a specific single peak characteristic from the target site sequence is the same as the AtDMP8 and AtDMP9 gene sequences of wild-type Arabidopsis thaliana Col-0, the genotype of the line is wild-type, i.e., no mutation occurs in the AtDMP8 and AtDMP9 gene sequences; if it is different from the AtDMP8 and AtDMP9 gene sequences of wild-type Arabidopsis thaliana Col-0, the genotype of the line is a homozygous genotype (the AtDMP8 and / or AtDMP9 genes on the two homologous chromosomes are both mutated), and the line is a T1 generation transgenic Arabidopsis thaliana homozygous mutant line.

[0071] The results of the identification are shown in Tables 1 and 2 (Tables 1 and 2 are the AtDMP8 and AtDMP9 gene mutation statuses of the T1 generation transgenic Arabidopsis, respectively): In 41 T1 generation transgenic Arabidopsis plants, 33 T1 generation transgenic plants had AtDMP8 gene mutations, of which 2 had homozygous mutations in the AtDMP8 gene and 17 had biallelic mutations in the AtDMP8 gene. Mutations occurred in the AtDMP9 gene of 28 T1 generation transgenic plants, of which 5 had homozygous mutations in the AtDMP9 gene and 7 had biallelic mutations in the AtDMP9 gene. There were 12 homozygous / biallelic mutations in both AtDMP8 and AtDMP9. For phenotype identification, single homozygous / biallelic mutations causing frameshift mutations (deletions were not multiples of 3) were further selected. There were three types in total: AtDMP8 homozygous mutation / biallelic mutation, AtDMP9 homozygous mutation / biallelic mutation, and both AtDMP8 and AtDMP9 homozygous mutation / biallelic mutation. TIFF0007665532000001.tif226170TIFF0007665532000002.tif29170TIFF0007665532000003.tif255170TIFF0007665532000004.tif77170

[0072] The resulting T1 generation transgenic Arabidopsis AtDMP8 gene mutant line had T1-34, with the specific mutations being as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 gene mutant line T1-34 had a segmental deletion in one chromosome in the gene encoding the AtDMP8 protein, with the deleted fragment located at positions 115-512 of SEQ ID NO:1; and an insertion of base T located between positions 114-115 of SEQ ID NO:1 had occurred in the other chromosome.

[0073] The obtained T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant lines included T1-6, T1-11, T1-19, T1-24, T1-25, T1-28, and T1-32, with the specific mutations as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-6 had a segment deletion in one chromosome in the gene encoding AtDMP8 protein, with the deleted fragment located at positions 115-512 of Sequence 1; a segment deletion in the other chromosome, with the deleted fragment located at positions 113-114 of Sequence 1; and an insertion of a fragment in the gene encoding AtDMP9 protein, with the nucleotide sequence of the inserted fragment being GTTTACACGGCGACTC (Sequence 13), and the insertion position of the fragment located between positions 160-161 of Sequence 3.

[0074] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 double mutant line T1-11 had an insertion of one T nucleotide in the gene encoding AtDMP8 protein, the insertion position of the T nucleotide was located between positions 114-115 of sequence 1, and in the gene encoding AtDMP9 protein, an insertion of T nucleotide was located between positions 160-161 of sequence 3 in one chromosome, and an insertion of a fragment was located between positions 160-161 of sequence 3 in the other chromosome, the nucleotide sequence of the inserted fragment was GTTTACACGGCGACTC (sequence 13), and the insertion position of the fragment was located between positions 160-161 of sequence 3.

[0075] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-19 had a deletion of one base T in the gene encoding the AtDMP8 protein in one chromosome, with the deleted base located at position 114 in sequence 1, and a fragment deletion in the other chromosome, with the deleted fragment located at positions 115-511 in sequence 1; and a fragment deletion in the gene encoding the AtDMP9 protein in one chromosome, with the deleted fragment located at positions 161-560 in sequence 3, and a fragment deletion in the other chromosome, with the deleted fragment located at positions 161-564 in sequence 3.

[0076] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-24 had a segment deletion in one chromosome in the gene encoding the AtDMP8 protein, the deleted fragment was located at positions 115-512 in sequence 1, and a T insertion occurred in the other chromosome, the insertion position of the T fragment was located between positions 114-115 in sequence 1; and, in the gene encoding the AtDMP9 protein, a segment deletion occurred in one chromosome, the deleted fragment was located at positions 161-560 in sequence 3, and a segment deletion occurred in the other chromosome, the deleted fragment was located at positions 159-160 in sequence 3.

[0077] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-25 had a deletion of one base T in the gene encoding AtDMP8 protein in one chromosome, with the deleted base located at position 114 of sequence 1, and an insertion of a fragment CGT in the other chromosome, with the insertion position of the fragment located between positions 114-115 of sequence 1; and a deletion of a fragment in the gene encoding AtDMP9 protein in one chromosome, with the deleted fragment located at positions 161-162 of sequence 3, and an insertion of one base A in the other chromosome, with the insertion position of the fragment A located between positions 160-161 of sequence 3.

[0078] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-28 had a fragment deletion in one chromosome in the gene encoding AtDMP8 protein, with the deleted fragment located at positions 115-512 of sequence 1, a single base T deletion in the other chromosome, with the deleted base located at position 114 of sequence 1, and an insertion of a single base A in the encoding AtDMP9 protein, with the insertion position of the base A located between positions 160-161 of sequence 3.

[0079] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene double mutant line T1-32 had a deletion of a fragment in one chromosome in the gene encoding the AtDMP8 protein, with the deleted fragment located at positions 115-511 of sequence 1, an insertion of one base T in the other chromosome, with the insertion position of the base T located at positions 114-115 of sequence 1, and a deletion of the base C in the gene encoding the AtDMP9 protein, with the deleted base located at position 161 of sequence 3.

[0080] 5. Genotyping of T2 generation transgenic Arabidopsis The T1 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene mutant strains T1-19, T1-33 and T1-38 obtained in step 4 were inbred, and the seeds were harvested and sowed to obtain T2 generation transgenic Arabidopsis. The genotypes of the AtDMP8 and AtDMP9 genes of the T2 generation transgenic Arabidopsis were identified, and the specific method is as follows: the genomic DNA of the T2 generation transgenic Arabidopsis was used as a template, and the mutant sequences of AtDMP8 (DMP8F1 and DMP8R1) and AtDMP9 (DMP9F1 and DMP9R2) were used to detect primers, respectively, to identify the genotypes of the AtDMP8 and AtDMP9 genes of the T2 generation transgenic Arabidopsis according to the method in step 4.

[0081] The obtained T2 generation transgenic Arabidopsis AtDMP8 gene mutant homozygous lines include T2-33-1, T2-33-2 and T2-33-3, the mutation sequences of the three lines are similar, and the specific mutations are as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T2 generation transgenic Arabidopsis AtDMP8 gene mutant homozygous lineages T2-33-1, T2-33-2 and T2-33-3 had a fragment replacement in the gene encoding the AtDMP8 protein, which replaced the fragment shown at positions 115-511 of SEQ ID NO: 1 with a fragment of 202 bp in size. The nucleotide sequence of the fragment of 202 bp in size is specifically as follows: GAAATTGACGAGCATTGATGTCTTCGAAACCGTTTTTTGAACTCCTTTCGCCACCATGCGACGTTTTCTACCTTTTCCTCCTCCCGCGGCGGCTCCTGCCGGAAGCATAGGCAGTGAAGAGAGAGGGACAGGTTTGGGCGACCGAGACGATGTTGGTGACGGATTTTGCGTCGTTGTCGTCGTGTAAACTCTGATTCCGACG.

[0082] The obtained T2 generation transgenic Arabidopsis AtDMP9 gene mutant homozygous lines include T2-33-4, T2-33-5 and T2-33-6, the mutation sequences of the three lines are similar, and the specific mutations are as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T2 generation transgenic Arabidopsis AtDMP9 gene mutant homozygous lines T2-33-4, T2-33-5 and T2-33-6 had a single T base insertion in the gene encoding AtDMP9 protein, the insertion position of the T base was located between positions 160-161 of SEQ ID NO:3, and a fragment insertion occurred in the gene encoding AtDMP9 protein, and the nucleotide sequence of the inserted fragment was specifically as follows: CGTCGGAATCAGAGTTTACACGGCGACTCCGCCGCAAAAACCATCACCATCACCACCTTCTCGTTCACCAAAACCCGTCTTAATCTCTTCATTGCC TTCCCTCCCGTCAGGAGCCGCCGCTGGAGGAGGAAGAGGTCGAAAACGTCGCATGGTGGCGCAAGGAGTTCAAAAAACGGTTTCGAAGACATCAATGCTCGTCAACTTCCTTCCGACAGGAACACTCTTGATGTTCGAAATGGTTCTTCCATCAATATACCGTGACGGAGACTGTAACGGAATCAACACACTCATGATTCATCTCCTCTTGCTTCTTTGCGCAATGTCTTGTTTCTTCTTCCATTTTACCGACAGTTTCAAAGCATCCGATGGGAAGATCTACTACGGTTTCGTGACGCCACGTG (Sequence 14), the insertion position of the fragment is between positions 561 and 562 of Sequence 3.

[0083] The obtained T2 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene mutant homozygous lines include T2-19, T2-38-1 and T2-38-2, and the mutation types of each line are as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T2 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene mutant homozygous line T2-19 had a deletion of a fragment in the gene encoding the AtDMP9 protein, the deletion of the fragment being located at positions 115-511 of sequence 1, and a deletion of a fragment in the gene encoding the AtDMP9 protein, the deletion of the fragment being located at positions 161-564 of sequence 3.

[0084] Sequencing identification showed that, compared with the genomic DNA of wild-type Arabidopsis Col-0, the T2 generation transgenic Arabidopsis AtDMP8 and AtDMP9 gene mutant homozygous lineages T2-38-1 and T2-38-2 had a deletion of a fragment in the gene encoding the AtDMP8 protein, the deletion of the fragment was located at positions 115-127 of sequence 1, and the base T and the base G were inserted at two positions in the gene encoding the AtDMP9 protein, located between positions 160-161 of sequence 3 and between positions 562-563 of sequence 3, respectively.

[0085] The above T1 and T2 generation transgenic Arabidopsis mutant lines are selected for use in the following experiment to analyze haploid induction ability.

[0086] Second, the use of Arabidopsis mutants in which the AtDMP8 and / or AtDMP9 genes have been knocked out in the inducible production of haploid plants. (1) Identification of the haploid inbreeding inducibility of Arabidopsis mutants in which the AtDMP8 and / or AtDMP9 genes were knocked out. Three mutants derived from the AtDMP8 and AtDMP9 genes were inbred to obtain inbred progeny, and haploids were identified for the inbred progeny by the following method (since wild Arabidopsis Col is a homozygous inbred line, haploids of the inbred progeny of mutants obtained by knocking out the AtDMP8 and AtDMP9 genes in this background cannot be identified by molecular markers):

[0087] 1. Plant phenotype identification After cultivating the inbred seeds, the phenotype of the single plant was observed. The haploid plants had low plant body, narrow leaves, and a compact plant shape, and were male sterile. The diploid plants had high plant body, wide and spreading leaves, and normal growth (Figures 1 and 2).

[0088] 2. Identification of Leaves by Flow Cytometry Detection Flow cytometry detection was performed on the plant body expressing haploid characteristics obtained in step 1 above, and the specific method is as follows: the cell nuclei of the young leaves of the plant body to be measured were extracted, and diploid Arabidopsis leaves were used as a control; and the signal was detected using a flow cytometer, and the diploid cell nucleus signal was first detected, and the peak of the diploid cell nucleus signal was set to 50 (since the genetic material in a diploid cell is twice that in a haploid cell, the peak of the haploid cell nucleus signal appears around 25). If the cell nucleus signal peak of the plant body to be measured appears around 25, the plant body to be measured is considered to be a haploid plant body. If the signal peak of the plant body to be measured appears around 50, it is considered to be the same as the concentrated position of the diploid cell nucleus signal intensity, and the plant body to be measured is diploid (Figure 3).

[0089] The identification results are statistically analyzed and the induction rate is calculated according to the following formula: induction rate (%) = (number of haploid strains / total number of strains) x 100. It can be seen that after the AtDMP8 and AtDMP9 genes are mutated simultaneously, haploids are obtained in the inbred progeny. TIFF0007665532000005.tif61170

[0090] (2) Identification of haploid hybrid-inducing ability of AtDMP8 and AtDMP9 knockout mutants of Arabidopsis thaliana Three mutants derived from the AtDMP8 and AtDMP9 genes were hybridized with Arabidopsis ms1 material to obtain hybrid progenies, and haploids in the hybrid progenies were identified by the following method:

[0091] 1. Identification by fluorescent labeling The CRISPR / Cas9 vector carries an expression element in which the promoter AtOLEO1 drives TagRFP (Entacmaea quadricolor). The promoter AtOLEO1 is specifically expressed in mature seed embryos, so the fluorescent signal of TagRFP can be observed under fluorescent lamps. Therefore, a mutant carrying the expression element was hybridized with a female parent material that did not carry other fluorescence as a paternal parent, and in the resulting seeds, the diploid seed embryos showed strong red fluorescence because they had the paternal genome, but the haploid seed embryos showed no fluorescence or weak fluorescence because they were derived from the female parent (Figure 4).

[0092] 2. Identification by molecular markers The non-fluorescent and weakly fluorescent seeds identified in step 1 above were further planted, and their genomic DNA was extracted. PCR amplification was performed using the primers 092B02-F (092B02-F: CAGCTGAGATGAACGAGTTGTCTT), 092B02-R (092B02-R: TCTTTTGAGTCACTCCGTATGTCC) and LB-o8474 (LB-o8474: ATAATAACGCTGCGGACATCTACATTTT) between Arabidopsis ms1 and the AtDMP8 and AtDMP9 knocked-out Arabidopsis mutants. The amplified products were then subjected to agarose band type detection. If the amplified product of the target single plant was 500 bp in size and appeared as one band, the band of the single plant was considered to be the Arabidopsis ms1 band type. If the band type of the male material was not present, the single plant was a female parent haploid. The sizes of the amplified products of the measured single line were 500 bp and 1094 bp. When they appeared as two bands, the bands of the single line were considered to be heterozygous band types of Arabidopsis ms1 and transgenic Arabidopsis mutant line, and the single line was a normal hybrid progeny and diploid (Figure 5).

[0093] 3. Identification of mature plant phenotypes The phenotype of the plants identified in steps 1 and 2 above is further observed, and haploids have characteristics such as low plant body, narrow leaves that face upward, compact plant form, and male sterility, while diploids have the phenotype of tall plant body, wide, spreading leaves, and normal growth.

[0094] 4. Leaf Identification by Flow Cytometry Detection Flow cytometry detection is performed on the plant body expressing haploid characteristics obtained in step 3 above, and the specific method is as follows: the cell nuclei of the young leaves of the measurement target plant body are extracted, and diploid Arabidopsis leaves are used as a control; and the signal is detected using a flow cytometer, and the diploid cell nucleus signal is first detected, and the peak of the diploid cell nucleus signal is set to 50 (since the genetic material in diploid cells is twice that of haploid cells, the peak of the haploid cell nucleus signal appears around 25). If the cell nucleus signal peak of the measurement target plant body appears around 25, the measurement target plant body is considered to be a haploid plant body. If the signal peak of the measurement target plant body appears around 50, which is the same as the concentrated position of the diploid cell nucleus signal intensity, the measurement target plant body is considered to be a diploid.

[0095] The above identification results were statistically analyzed and the induction rate was calculated according to the following formula: induction rate (%) = (number of female parent haploid plants / total number of plants) × 100. It can be seen that after AtDMP8 gene mutation, AtDMP9 gene mutation, and simultaneous mutation of AtDMP8 and AtDMP9 genes, hybridization with other materials results in female parent haploids in the progeny. TIFF0007665532000006.tif204170

[0096] Example 2. Preparation of S1DMP gene knockout tomato mutants and their uses 1. Knockout of the S1DMP gene using the CRISPR / Cas9 system The CRISPR / Cas9 system was used to knock out the S1DMP gene in tomato, and to obtain a tomato mutant with the S1DMP gene knocked out. The specific steps are as follows: 1. Selection of sgRNA sequence A target site sequence of 20 bp in length was designed in the S1DMP gene.

[0097] Target site 1 is located at positions 76-9595 of sequence 5, and the sgRNA target site 1 sequence is TATCCTACTAATTTACCACA.

[0098] Target site 2 is located at positions 247-266 of sequence 5, and the sgRNA target site 2 sequence is TCTCCTTTACCAAATACTGA.

[0099] 2. Construction of CRISPR / Cas9 Vectors The CRISPR / Cas9 vector is a recombinant vector (vector structure diagram is shown in FIG. 9b) obtained after linking the DNA molecule (sgRNA expression element) shown in SEQ ID NO:8, the DNA molecule (Cas9 expression element) shown in SEQ ID NO:11, the DNA molecule (fluorescent protein expression element) shown in SEQ ID NO:10, and the DNA molecule (NptII expression element) shown in SEQ ID NO:12 to the pICSL4723 vector by the golden gate method. The DNA molecule shown in SEQ ID NO:8 contains the coding sequence of the sgRNA targeting target site 1 and the coding sequence of the sgRNA targeting target site 2 in sequence, and the coding sequence of each sgRNA is preceded by the AtU 6-26 promoter for initiating expression of the coding sequence of the sgRNA.

[0100] 3. Obtaining transgenic plants The CRISPR / Cas9 vector obtained in step 2 was transformed into Agrobacterium competent cells GV3101 by heat shock transformation (Agrobacterium GV3101 competent cells were purchased from Beijing Osen Dingxin Biological Technology Co., Ltd. and can be obtained by the public for purchase), and the recombinant bacterium GV3101 / CRISPR / Cas9 was obtained.

[0101] Furthermore, the recombinant GV3101 / CRISPR / Cas9 was used to infect tomato cotyledon explants with Agrobacterium (the recombinant Agrobacterium was grown at 28°C, and the grown bacterial solution was used on tomato cotyledon explants), and wild-type tomato AC cotyledon explants were infected with the recombinant GV3101 / CRISPR / Cas9. After Kana resistance screening, T0 generation transgenic tomato plants were obtained.

[0102] 4. Identification of transgenic plants with S1DMP gene mutations Leaves of the T0 generation transgenic tomato plants obtained in step 3 were collected, and genomic DNA was extracted as a template. PCR amplification was performed using the following primers to obtain PCR amplification products of different strains.

[0103] The sequence of the S1DMP gene mutation detection primer is as follows: S1DMPF2:ACTGCTTAGGATATTAACTGACCC; S1DMPR1:TTTTGGCACATCGACACCAAG.

[0104] The PCR amplification products of the different strains were Sanger sequenced, and the sequencing results were compared with the S1DMP gene of wild-type tomato AC. The genotype of S1DMP was identified according to the following principles.

[0105] If the sequence has a double-peak characteristic from the target site sequence, the genotype of the line is a hybrid genotype (the S1DMP gene on one chromosome of the two homologous chromosomes is mutated, and the S1DMP gene on the other chromosome is not mutated), and the line is a T0 generation transgenic tomato heterozygous mutant line; If the sequence having a specific single peak characteristic from the target site sequence is the same as the S1DMP gene sequence of the wild-type tomato AC, the genotype of the line is wild-type, i.e., no mutation occurs in the S1DMP gene sequence; if it is different from the S1DMP gene sequence of the wild-type tomato AC, the genotype of the line is a homozygous genotype (the S1DMP genes on the two homologous chromosomes are mutated), and the line is a T0 generation transgenic tomato homozygous mutant line. TIFF0007665532000007.tif243170TIFF0007665532000008.tif139170

[0106] 5. Genotyping of T1 generation transgenic tomatoes The T0 generation transgenic tomato S1DMP gene mutant lines T0-12 and T0-34 obtained in step 4 were inbred, the seeds were harvested and then sowed to obtain T1 generation transgenic tomatoes. The genotype of the S1DMP gene in the T1 generation transgenic tomatoes was identified, and the specific method is as follows: the genomic DNA of the T1 generation transgenic tomatoes was used as a template, and the S1DMP (S1DMPF2 and S1DMPR1) mutant sequence detection primers were used to identify the genotype of the S1DMP gene in the T1 generation transgenic tomato according to the method in step 4.

[0107] The finally obtained T1 generation transgenic tomato S1DMP gene mutant homozygous lines had sldmp-1 and sldmp-2, and the mutation types of each line were as follows: Sequencing identification showed that, compared with the genomic DNA of wild-type tomato AC, the T1 generation transgenic tomato S1DMP gene mutant homozygous line sldmp-1 had a single C base insertion in the gene encoding the S1DMP protein, and the inserted base was located between bases 92-93 of sequence 5.

[0108] Sequencing identification showed that, compared with the genomic DNA of wild-type tomato AC, the T1 generation transgenic tomato S1DMP gene mutant homozygous line sldmp-2 had a fragment deletion in the gene encoding the S1DMP protein, and the fragment deletion was located at positions 93-249 of sequence 5.

[0109] 2. Use of S1DMP gene knockout tomato mutants in the induced production of haploid plants (1) Analysis of plant phenotype and fruit set rate of S1DMP gene knockout tomato mutants Comparing the expression of wild-type tomato AC and tomato mutant plants with S1DMP gene knocked out in AC background, it can be seen that the growth of the plant is not affected after the S1DMP gene is knocked out (Figure 6). The number of seeds per inbred fruit of each tomato was statistically calculated, and the wild-type inbred fruit produced about 79.5 seeds on average, while the sldmp mutant produced only 17 seeds, which is significantly lower than the wild-type (Table 6). This indicates that the S1DMP gene mutation causes a decrease in fruit set rate, suggesting that the sldmp mutant has the ability of haploid induction. TIFF0007665532000009.tif39170

[0110] (2) Identification of haploid hybrid-inducing ability of tomato mutants in which the S1DMP gene was knocked out The sldmp mutant was hybridized with tomato AC and Micro-Tom, and the resulting F1 generation material was hybridized to obtain hybrid progeny, and haploids in the hybrid progeny were identified by the following method:

[0111] 1. Identification by fluorescent labeling The CRISPR / Cas9 vector carries an expression element in which the promoter AtOLEO1 drives TagRFP (Entacmaea quadricolor). The promoter AtOLEO1 was specifically expressed in mature seed embryos, so the fluorescent signal of TagRFP can be observed under fluorescent lamps. Therefore, a mutant carrying the expression element was hybridized with a female parent material that did not carry other fluorescence as a paternal parent, and in the resulting seeds, the diploid seed embryo showed red fluorescence because it had the paternal genome, but the haploid seed embryo showed no fluorescence or weak fluorescence because it was derived from the female parent (Figure 7).

[0112] 2. Identification by molecular markers The non-fluorescent seeds identified in step 1 are further planted, their genomic DNA is extracted, and PCR amplification is performed using the polymorphism primers S1DMPF2+S1DMPR1 between the F1 generation obtained by hybridizing tomato AC and Micro-Tom and the tomato mutant with the S1DMP gene knocked out, and the amplified product is subjected to agarose band type detection or sequencing. If the amplification product of the single plant to be measured shows one band or the sequencing result shows a single peak, the band of the single plant is considered to be the female parent band type, and if there is no band type of the male material, the single plant is considered to be a female parent haploid. If the amplification product of the single plant to be measured shows two bands or the sequencing result shows a heterozygote peak type, the band of the single plant is considered to be the hybrid band type of the F1 generation obtained by hybridizing tomato AC and Micro-Tom and the tomato mutant with the S1DMP gene knocked out, and the single plant is a normal hybrid progeny and diploid.

[0113] 3. Identification of mature plant phenotypes The phenotype of the plants identified in steps 1 and 2 above is further observed, and haploids have characteristics such as low plant body, narrow leaves that face upward, compact plant form, and male sterility, while diploids have the phenotype of tall plant body, wide, spreading leaves, and normal growth.

[0114] 4. Flow Cytometry Detection and Lobe Identification Flow cytometry detection was performed on the plant expressing the haploid characteristics obtained in step 3 above, and the specific method is as follows: the cell nuclei of the young leaves of the plant to be measured were extracted, and diploid tomato leaves were used as a control; and the signal was detected using a flow cytometer, and the diploid cell nucleus signal was first detected, and the peak of the diploid cell nucleus signal was set to 100 (since the genetic material in a diploid cell is twice that in a haploid cell, the peak of the haploid cell nucleus signal appears around 50). If the cell nucleus signal peak of the plant to be measured appears around 50, the plant to be measured is considered to be a haploid plant. If the signal peak of the plant to be measured appears around 100, it is considered to be the same as the concentrated position of the diploid cell nucleus signal intensity, and the plant to be measured is diploid (Figure 8).

[0115] The above identification results were statistically analyzed and the induction rate was calculated according to the following formula: induction rate (%) = (female parent haploid lineage / total lineage) × 100. After the mutation of the S1DMP gene, the hybrid was hybridized with other materials, and maternal haploid was obtained in the hybrid hybrid progeny. TIFF0007665532000010.tif39170 [Industrial Applicability]

[0116] The present invention clones parthenogenetic haploid induction genes AtDMP8 and AtDMP9 from Arabidopsis thaliana. Experiments show that mutations of AtDMP8 and AtDMP9 can produce parthenogenetic haploid induction ability, which makes it possible to extend the application of haploid induction production by parthenogenetic method to dicotyledonous crops. The present invention further validates in tomato and finds that mutations of S1DMP in tomato can also produce parthenogenetic haploid induction ability. The present invention lays an important foundation for extending the use of haploid breeding technology to dicotyledonous plants and elucidating the biological mechanism of parthenogenetic haploid. Considering the wide application of haploid breeding technology in the breeding industry at present, the present invention has a very wide range of application space and market prospects.

Claims

1. 1. A method for preparing a plant haploid derivative line, comprising: A1) knocking out the AtDMP8 gene and / or the AtDMP9 gene in the Arabidopsis genome to obtain a transgenic Arabidopsis that is an Arabidopsis haploid derivative line; or A2) knocking out the S1DMP gene in the tomato genome to obtain a transgenic tomato that is a tomato haploid derivative line; and The protein encoded by the AtDMP8 gene is a protein shown in SEQ ID NO: 2, or a protein having 90% or 95% or more identity to the amino acid sequence shown in SEQ ID NO: 2 and having the same function, or a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of SEQ ID NO: 2; The protein encoded by the AtDMP9 gene is a protein shown in SEQ ID NO: 4, or a protein having 90% or 95% or more identity to the amino acid sequence shown in SEQ ID NO: 4 and having the same function, or a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of SEQ ID NO: 4; The protein encoded by the S1DMP gene is a protein shown in SEQ ID NO: 6, a protein having 90% or 95% or more identity with the amino acid sequence shown in SEQ ID NO: 6 and having the same function, or a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of SEQ ID NO:

6. method.

2. The AtDMP8 gene is a cDNA or genomic DNA molecule set forth in SEQ ID NO:1, or a cDNA or genomic DNA molecule having 90% or 95% or more identity to SEQ ID NO:1, or a cDNA or genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence set forth in SEQ ID NO:1; The AtDMP9 gene is a cDNA or genomic DNA molecule set forth in SEQ ID NO:3, or a cDNA or genomic DNA molecule having 90% or 95% or more identity to SEQ ID NO:3, or a cDNA or genomic DNA molecule that hybridizes under stringent conditions to the nucleotide sequence set forth in SEQ ID NO:3; The S1DMP gene is a cDNA molecule or a genomic DNA molecule set forth in SEQ ID NO:5, or a cDNA molecule or a genomic DNA molecule having 90% or 95% or more identity with SEQ ID NO:5, or a cDNA molecule or a genomic DNA molecule that hybridizes under stringent conditions with the nucleotide sequence set forth in SEQ ID NO:5; The AtDMP8 gene and the AtDMP9 gene have the following functions: when the AtDMP8 gene and / or the AtDMP9 gene in Arabidopsis thaliana are knocked out, the Arabidopsis thaliana becomes an Arabidopsis thaliana haploid derivative line; The S1DMP gene has the following function: when the S1DMP gene in tomato is knocked out, the tomato becomes a tomato haploid derivative line; 2. The method according to claim 1 .

3. The method according to claim 1 or 2, characterized in that the method for knocking out the AtDMP8 gene and / or the AtDMP9 gene, or the method for knocking out the S1DMP gene, is CRISPR / Cas9.

4. The method according to claim 3, wherein when Arabidopsis thaliana is selected, the target sequences of CRISPR / Cas9 are positions 98-117 of SEQ ID NO: 1, positions 290-309 of SEQ ID NO: 3, positions 368-387 of SEQ ID NO: 3, and positions 509-528 of SEQ ID NO:

1.

5. The method according to claim 3, wherein the target sequence of CRISPR / Cas9 is positions 76-95 and 247-266 of SEQ ID NO:5 when selecting tomato.

6. The plant haploid derivative line is Arabidopsis mutant line T1-34, Arabidopsis mutant line T1-6, Arabidopsis mutant line T1-11, Arabidopsis mutant line T1-19, Arabidopsis mutant line T1-24, Arabidopsis mutant line T1-25, Arabidopsis mutant line T1-28, Arabidopsis mutant line T1-32, tomato mutant line sldmp-1 or tomato mutant line sldmp-2; The difference between the genomic DNA of the Arabidopsis mutant line T1-34 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-512 of SEQ ID NO:1, and an insertion of the base T is located between positions 114-115 of SEQ ID NO:1 in the other chromosome; The difference between the genomic DNA of the Arabidopsis mutant line T1-6 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-512 of SEQ ID NO:1, and in the other chromosome, a fragment is deleted, and the deleted fragment is located at positions 113-114 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a fragment is inserted in both of the two chromosomes, and the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:13, and the insertion position of the fragment is located between positions 160-161 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T1-11 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, an insertion of one base T occurs, and the insertion position of the base T is between positions 114-115 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, an insertion of the base T occurs in one chromosome, and the insertion position of the base T is between positions 160-161 of SEQ ID NO:3; and an insertion of a fragment occurs in another chromosome, and the nucleotide sequence of the inserted fragment is shown in SEQ ID NO:13, and the insertion position of the fragment is between positions 160-161 of SEQ ID NO:3; The difference between the genomes of the Arabidopsis mutant line T1-19 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a deletion of one base T occurs in one chromosome, the deleted base being located at position 114 of SEQ ID NO:1, and a fragment deletion occurs in the other chromosome, the deleted fragment being located at positions 115-511 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a fragment deletion occurs in one chromosome, the deleted fragment being located at positions 161-560 of SEQ ID NO:3, and a fragment deletion occurs in the other chromosome, the deleted fragment being located at positions 161-564 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T1-24 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 115-512 of SEQ ID NO:1, and in the other chromosome, a base T is inserted, and the position of the inserted base T is between positions 114-115 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a fragment is deleted in one chromosome, and the deleted fragment is located at positions 161-560 of SEQ ID NO:3, and in the other chromosome, a fragment is deleted, and the deleted fragment is located at positions 159-160 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T1-25 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, one chromosome has a deletion of one base T, the deleted base being located at position 114 of SEQ ID NO:1, and in the other chromosome, an insertion of a fragment CGT occurs, the insertion position of the fragment being located between positions 114-115 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, one chromosome has a deletion of a fragment, the deleted fragment being located at positions 161-162 of SEQ ID NO:3, and in the other chromosome, an insertion of one base A occurs, the insertion position of the base A being located between positions 160-161 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T1-28 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, the deleted fragment is located at positions 115-512 of SEQ ID NO:1, and in the other chromosome, a single base T is deleted, the deleted base is located at position 114 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a single base A is inserted in both chromosomes, the inserted position of the base A is located between positions 160-161 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T1-32 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP8 protein, a fragment is deleted in one chromosome, the deleted fragment being located at positions 115-511 of SEQ ID NO:1, and in the other chromosome, a base T is inserted, the position of which is between positions 114-115 of SEQ ID NO:1; and in the gene encoding the AtDMP9 protein, a base C is deleted in both chromosomes, the deleted base being located at position 161 of SEQ ID NO:3; The difference between the genomic DNA of the tomato mutant sldmp-1 and the wild-type tomato AC is that in the gene encoding the S1DMP protein, an insertion of a base C occurs in both chromosomes, and the inserted base is located between positions 92-93 of SEQ ID NO:5; The difference between the genomic DNA of the tomato mutant sldmp-2 and the wild-type tomato AC is that a fragment is deleted in both chromosomes in the gene encoding the S1DMP protein, and the deleted fragment is located at positions 93-249 of SEQ ID NO:

5.

6. The method according to claim 1 , characterized in that

7. A method for preparing a plant haploid derivative, comprising self-pollinating the plant haploid derivative of any one of claims 1 to 6.

8. The plant haploid derivative line prepared by self-pollination is Arabidopsis thaliana mutant line T2-33 or Arabidopsis thaliana mutant line T2-38; The difference between the genomic DNA of the Arabidopsis mutant line T2-33 and the wild-type Arabidopsis Col-0 is that in the gene encoding the AtDMP9 protein, an insertion of the base T occurs in both of the two chromosomes, and the insertion position of the base T is located between positions 160-161 of SEQ ID NO:3; and in the gene encoding the AtDMP9 protein, an insertion of a fragment occurs in both of the two chromosomes, and the nucleotide sequence of the inserted fragment is set forth in SEQ ID NO:14, and the insertion position of the fragment is located between positions 561-562 of SEQ ID NO:3; The difference between the genomic DNA of the Arabidopsis mutant line T2-38 and the wild-type Arabidopsis Col-0 is that a fragment deletion occurs in both chromosomes in the gene encoding the AtDMP8 protein, and the deleted fragment is located at positions 115-127 of SEQ ID NO:1; and an insertion of a base T and a base G occurs in both positions in the gene encoding the AtDMP9 protein, and the two positions are located between positions 160-161 and 562-563 of SEQ ID NO:3, respectively.

8. The method of claim 7.

9. 9. A method for preparing a haploid plant, comprising self-pollinating or hybridizing the plant haploid derivative or its progeny with other plant material as a male parent, as a haploid plant, to obtain a selfed progeny or hybrid progeny, i.e., a haploid plant; the plant is Arabidopsis or tomato.

10. The method according to claim 9, further comprising subjecting a single plant of the selfed progeny or the hybrid progeny to fluorescent labelling identification and / or haploid characterisation and / or leaf ploidy identification and / or molecular marker identification, whereby the single progeny plant identified as haploid is a plant haploid.

11. Use of any one of the following D1) to D3): D1) Use of a plant haploid derivative prepared by the method according to any one of claims 1 to 8 in the development of a plant haploid; D2) Use of a substance that knocks out the AtDMP8 gene and / or the AtDMP9 gene according to any one of claims 1 to 8 in the development of a plant haploid derivative or a plant haploid; D3) Use of a substance that knocks out the S1DMP gene according to any one of claims 1 to 8 in the development of a plant haploid derivative or a plant haploid; and The protein encoded by the AtDMP8 gene is a protein shown in a1), a2), or a3) below: a1) is a protein whose amino acid sequence is shown in SEQ ID NO:2; a2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:2; a3) is a protein having 90% or 95% or more identity to the amino acid sequence shown in SEQ ID NO: 2 and having the same function; The protein encoded by the AtDMP9 gene is a protein shown in b1), b2), or b3) below; b1) is a protein whose amino acid sequence is shown in SEQ ID NO:4; b2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:4; b3) is a protein having 90% or 95% or more identity to the amino acid sequence shown in SEQ ID NO: 4 and having the same function; The protein encoded by the S1DMP gene is a protein shown in c1), c2), or c3) below; c1) is a protein whose amino acid sequence is set forth in SEQ ID NO:6; c2) is a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID NO:6; c3) is a protein having 90% or 95% or more identity to the amino acid sequence shown in SEQ ID NO: 6 and having the same function; use.

Images