Micellar nanoparticles and uses thereof

Abstract

The present disclosure provides a cationic carrier unit comprising (i) a water-soluble polymer, (ii) a positively charged carrier, and (iii) an adjuvant moiety, wherein when the cationic carrier unit is mixed with an anionic payload (e.g., an antisense oligonucleotide) that electrostatically interacts with the cationic carrier unit, the resulting composition self-assembles into micelles encapsulating the anionic payload in the core. The cationic carrier unit may also comprise a tissue-specific targeting moiety, which is presented on the surface of the micelle. The present disclosure also provides micelles comprising the cationic carrier unit of the present disclosure, methods for making the cationic carrier unit and micelles, pharmaceutical compositions comprising the micelles, and methods for treating a disease or condition comprising administering the micelles to a subject in need thereof.

Description

[Technical field]

[0001] Reference to Electronically Submitted Sequence Listing The contents of the electronically submitted Sequence Listing in ASCII text file submitted with this application (name: "4366_002PC02_Seqlisting_ST25", size: 5,392 bytes, and creation date: June 26, 2020) are hereby incorporated by reference in their entirety.

[0002] Field The present disclosure provides cationic carrier units and micelle systems that can be used to deliver anionic payloads (eg, oligonucleotides) across physiological permeability barriers (eg, the blood-brain barrier). [Background technology]

[0003] In the body, there are certain barriers that limit the permeability of drugs through membranes. Thus, only certain substances can pass through this type of membrane. Among the important and special physiological barriers are the blood-brain barrier and cell membranes. The blood-brain barrier (BBB) ​​is a highly selective semi-permeable boundary that separates the circulating blood from the brain and extracellular fluid in the central nervous system (CNS). The blood-brain barrier is formed by endothelial cells of the capillary walls, the astrocyte endfeet that cover the capillaries, and pericytes embedded in the capillary basement membrane. This system allows the passage of water, some gases, and lipid-soluble molecules by passive diffusion, as well as the selective transport of molecules such as glucose and amino acids that are important for neurological function.

[0004] The blood-brain barrier restricts the passage of pathogens into the cerebrospinal fluid (CSF), solutes in the blood, and the diffusion of large or hydrophilic molecules, while allowing the diffusion of O2, CO2, hydrophobic molecules (e.g., hormones), and small polar molecules (Johansen et al., (2017) Journal of Cerebral Blood Flow and Metabolism. Epub(4):659-668). The BBB excludes nearly 100% of large molecule neurotherapeutics and more than 98% of all molecular drugs from the brain. Daneman & Prat (2015) “The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412. Overcoming the difficulty of delivering therapeutics to specific regions of the brain is a major challenge for the treatment of most brain disorders. Thus, therapeutic molecules that would otherwise be effective for diagnosis and treatment do not cross the BBB in adequate quantities.

[0005] Intracellular targeting is also often difficult because exogenous molecules must first cross the cell membrane to reach the cytosol. The cell membrane is selectively permeable to non-polar therapeutic agents that are lipid-soluble and can pass through the cell membrane. On the other hand, highly charged therapeutic agents such as oligonucleotides are effectively excluded by the cell membrane.

[0006] Polynucleotides do not easily penetrate cell membranes due to charge repulsion between the negatively charged membrane and the high negative charge of polynucleotides. As a result, polynucleotides have poor bioavailability and poor cellular uptake (typically less than 1%) (Dheur et al, Nucleic Acid Drug Dev., 9:522 (1999); Park et al, J Controlled Release, 93:188 (2003)). Generally, most polynucleotides exceed 5,000 Da, so they cannot easily diffuse through cell membranes, and cellular uptake is mainly limited to pinocytosis or endocytosis processes. Once inside the cell, polynucleotides may accumulate in lysosomal compartments, limiting their access to the cytoplasm or nucleus. Parenterally administered polynucleotides are also highly susceptible to rapid degradation by nucleases both inside and outside the cytoplasm. Studies have shown rapid degradation of polynucleotides in the blood following intravenous administration, with a half-life of approximately 30 minutes (Geary et al, J. Pharmacol. Exp. Ther. 296:890-897 (2001)).

[0007] Thus, the problems facing the delivery of polynucleotides, such as antisense oligonucleotides, can be roughly divided into two parts.First, therapeutic polynucleotides must be formulated so that they can be delivered to the cytoplasm, and second, intact and fully functional polynucleotides must reach the cell nucleus.Despite the progress in the application of oligonucleotides and oligonucleotide analogues as therapeutic agents, there is a need for a delivery system that provides improved pharmacological properties, such as serum stability, delivery to the correct organ, tissue or cell, and membrane-permeable delivery. Attempts aimed at improving transmembrane delivery of nucleic acids and oligonucleotides have utilized protein carriers, antibody carriers, liposome delivery systems, electroporation, direct injection, cell fusion, viral vectors, and calcium phosphate-mediated transformation. However, many of these techniques are limited by the cell types for which transmembrane transport is available and the conditions required to achieve such transport. Thus, there is a need for a delivery system that can selectively direct charged therapeutic agents (e.g., antisense oligonucleotides such as antimiR) to specific target cells or tissues and across permeability barriers (e.g., plasma membrane or BBB), while improving serum stability and / or resistance to endogenous degradative enzymes (e.g., RNases). [Prior art documents] [Non-patent literature]

[0008] [Non-Patent Document 1] Johansen et al.,(2017)Journal of Cerebral Blood Flow and Metabolism.Epub(4):659-668 [Non-Patent Document 2] Daneman & Prat (2015) “The Blood Brain Barrier” Cold Spring Harbor Perspectives in Biology 7(1):a020412 [Non-Patent Document 3] Dheur et al, Nucleic Acid Drug Dev.,9:522(1999) Summary of the Invention [Means for solving the problem]

[0009] The present disclosure provides a cationic carrier unit comprising the formula: [WP]-L1-[CC]-L2-[AM] (Scheme I) or [WP]-L1-[AM]-L2-[CC] (Scheme II) During the ceremony, WP is a water-soluble biopolymer moiety; CC is a positively charged carrier moiety, AM is the adjuvant moiety, L1 and L2 are independently an optional linker; The cationic carrier units form micelles when mixed with nucleic acids in an ionic ratio of about 1:1. A cationic carrier unit is provided.

[0010] In some embodiments, the water soluble polymer comprises a poly(alkylene glycol), a poly(oxyethylated polyol), a poly(olefinic alcohol), a poly(vinylpyrrolidone), a poly(hydroxyalkyl methacrylamide), a poly(hydroxyalkyl methacrylate), a poly(saccharide), a poly(α-hydroxy acid), a poly(vinyl alcohol), a polyglycerol, a polyphosphazene, a polyoxazoline ("POZ"), a poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water soluble polymer comprises a polyethylene glycol ("PEG"), a polyglycerol, or a poly(propylene glycol) ("PPG"). In some embodiments, the water soluble polymer comprises the formula: [ka] In the formula, n is 1 to 1,000.

[0011] In some embodiments, n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some embodiments, n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, or about 150 to about 160.

[0012] In some embodiments, the water-soluble polymer is linear, branched, or dendritic. In some embodiments, the cationic carrier moiety comprises one or more basic amino acids. In some embodiments, the cationic carrier moiety comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.

[0013] In some embodiments, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some embodiments, the basic amino acids comprise arginine, lysine, histidine, or any combination thereof. In some embodiments, the cationic carrier moiety comprises about 40 lysine monomers.

[0014] In some aspects, the adjuvant moiety can modulate the immune response, the inflammatory response, or the tissue microenvironment. In some aspects, the adjuvant moiety can modulate the immune response. In some aspects, the adjuvant moiety can modulate the tumor microenvironment in a tumor-bearing subject.

[0015] In some aspects, the adjuvant moiety is capable of inhibiting or reducing hypoxia in the tumor microenvironment, hi some aspects, the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.

[0016] In some embodiments, the adjuvant moiety comprises the formula: [ka] During the ceremony, (i) each of G1 and G2 is independently selected from H, an aromatic ring, or 1-10 alkyl; (ii) G1 and G2 together form an aromatic ring, n is 1 to 10.

[0017] In some embodiments, the adjuvant moiety comprises a nitroimidazole. In some embodiments, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazole, azanidazole, benznidazole, or any combination thereof. In some embodiments, the adjuvant moiety comprises an amino acid. In some embodiments, the adjuvant moiety comprises the formula: [ka] In the formula, Ar is [ka] and Each of Z1 and Z2 is independently selected from H and OH.

[0018] In some embodiments, the adjuvant moiety can inhibit or reduce an inflammatory response. In some embodiments, the adjuvant moiety is a vitamin. In some embodiments, the vitamin includes a cyclic ring or a cyclic heteroatom ring and a carboxyl group or a hydroxyl group.

[0019] In some embodiments, the vitamin comprises the formula: [ka] wherein each of Y1 and Y2 is independently selected from C, N, O, and S; and n is 1 or 2.

[0020] In some embodiments, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some embodiments, the vitamin is vitamin B3.

[0021] In some embodiments, the adjuvant portion comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3 units. In some embodiments, the adjuvant portion comprises at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, or at least about 50 vitamin B3 units. In some embodiments, the adjuvant portion comprises about 10 vitamin B3 units. In some embodiments, the adjuvant portion comprises about 20 vitamin B3 units. In some embodiments, the adjuvant portion comprises about 30 vitamin B3 units. In some embodiments, the adjuvant portion comprises about 40 vitamin B3 units.

[0022] In some embodiments, the cationic carrier unit comprises a water soluble biopolymer portion having about 120 to about 130 PEG units, a cationic carrier portion comprising polylysine having about 30 to about 40 lysine units, and an adjuvant portion having about 5 to about 10 vitamin B3 units. In some embodiments, the cationic carrier unit further comprises an anionic payload that interacts with the cationic carrier unit through an ionic bond.

[0023] In some embodiments, the cationic carrier unit comprises a water soluble biopolymer portion having about 120 to about 130 PEG units, a cationic carrier portion comprising a polylysine having about 70 to about 90 lysine units, e.g., about 80 lysine units, and an adjuvant portion having about 20 to about 40 vitamin B3 units, e.g., about 30 vitamin B3 units. In some embodiments, the cationic carrier unit further comprises an anionic payload that interacts with the cationic carrier unit through an ionic bond.

[0024] The present disclosure also provides a micellar comprising a cationic carrier unit and an anionic payload as disclosed herein, wherein the cationic carrier moiety and the anionic payload of the cationic carrier complex are associated with each other. In some aspects, the association is a covalent bond. In other aspects, the association is a non-covalent bond. In some aspects, the association is an ionic bond.

[0025] In some embodiments, the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form micelles when mixed with an anionic payload in solution, where the overall ionic ratio of the positive charge of the cationic carrier moiety of the cationic carrier unit and the negative charge of the anionic payload in solution is about 1:1. In some embodiments, the cationic carrier unit can protect the anionic payload from degradation by DNase and / or RNase. In some embodiments, the anionic payload is not covalently conjugated to the cationic carrier unit, and / or the anionic payload interacts with the cationic carrier moiety of the cationic carrier unit only through ionic interactions.

[0026] In some embodiments, the half-life of the anionic payload is extended compared to the half-life of a free anionic payload not incorporated into a micelle. In some embodiments, the ratio of the positive charge of the cationic carrier moiety of the cationic carrier unit in the micelle and the negative charge of the anionic payload is about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.8:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.8 ... About 1.5:1, about 1.4:1, about 1.3:1, about 1.2:1, about 1.1:1, about 1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, or about 1:3 ionic ratio. In some embodiments, the positive charge of the cationic carrier portion of the cationic carrier unit in the micelle and the negative charge of the anionic payload are in an ionic ratio of about 3:1 to about 1:3. In some embodiments, the positive charge of the cationic carrier portion of the cationic carrier unit in the micelle and the negative charge of the anionic payload are in a charge ratio of 1:1. In some embodiments, the diameter of the micelle is about 1 nm to 100 nm, about 10 nm to about 100 nm, about 10 nm to about 90 nm, about 10 nm to about 80 nm, about 10 nm to about 70 nm, about 20 nm to about 100 nm, about 20 nm to about 90 nm, about 20 nm to about 80 nm, about 20 nm to about 70 nm, about 30 nm to about 100 nm, about 30 nm to about 90 nm, about 30 nm to about 80 nm, about 30 nm to about 70 nm, about 40 nm to about 100 nm, about 40 nm to about 90 nm, about 40 nm to about 80 nm, or about 40 nm to about 70 nm.

[0027] In some embodiments, the anionic payload comprises a nucleic acid. In some embodiments, the nucleic acid comprises an mRNA, miRNA, miRNA sponge, tough decoy miRNA, antimiR, small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof. In some embodiments, the nucleic acid comprises at least one nucleoside analog. In some embodiments, the nucleoside analog comprises locked nucleic acid (LNA); 2'-O-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabino nucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-O-methyl nucleic acid (2'-OMe), 2'-O-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0028] In some embodiments, the nucleic acid comprises a nucleotide sequence having a length of 5-30 nucleotides. In some embodiments, the nucleotide sequence is 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides in length. In some embodiments, the nucleotide sequence has a backbone comprising phosphodiester bonds, phosphotriester bonds, methylphosphonate bonds, phosphoramidate bonds, phosphorothioate bonds, and combinations thereof. In some embodiments, the cationic carrier unit further comprises a targeting moiety, which is optionally linked to the water-soluble polymer by a linker.

[0029] In some embodiments, the targeting moiety can target a tissue. In some embodiments, the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof. In some embodiments, the tissue is cancer tissue. In some embodiments, the tissue is liver. In some embodiments, the liver targeting moiety comprises cholesterol. In some embodiments, the tissue is pancreas. In some embodiments, the pancreas targeting moiety comprises a ligand that binds to an integrin receptor.

[0030] In some embodiments, the targeting moiety targets the central nervous system. In some embodiments, the brain targeting moiety can be transported by large neutral amino acid transporter 1 (LAT1). In some embodiments, the brain targeting moiety is an amino acid. In some embodiments, the brain targeting moiety comprises a branched chain or aromatic amino acid. In some embodiments, the amino acid is valine, leucine, and / or isoleucine. In some embodiments, the amino acid is tryptophan and / or tyrosine.

[0031] The present disclosure also provides compositions comprising the cationic carrier units and negatively charged molecules disclosed herein. Pharmaceutical compositions comprising the cationic carrier units, compositions, or micelles disclosed herein and a pharma- ceutically acceptable carrier are also provided.

[0032] The present disclosure also provides a method for preparing the cationic carrier unit disclosed herein, comprising synthesizing the cationic carrier unit. In some embodiments, the method for preparing the micelle disclosed herein comprises mixing the cationic carrier unit with a negatively charged molecule in a solution at a 1:1 ionic ratio. In some embodiments, the method further comprises purifying the micelle.

[0033] The present disclosure also provides a method of treating a disease or condition in a subject in need thereof, the method comprising administering to the subject a micelle of the present disclosure. In some embodiments, the anionic payload in the core of the micelle exhibits a longer half-life than a corresponding anionic payload that is not incorporated in the micelle. In some embodiments, the subject is a mammal.

[0034] The present disclosure also provides a method of treating cancer in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein. In some embodiments, the cancer is glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer. In some embodiments, the pancreatic cancer is pancreatic adenocarcinoma.

[0035] The present disclosure also provides a method of reducing inflammation in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0036] The present disclosure also provides a method of restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0037] The present disclosure also provides a method of improving cognitive function in a subject suffering from a neurodegenerative disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0038] In some aspects, the neurodegenerative disease is Alzheimer's disease.

[0039] The present disclosure also provides a method of reducing amyloid plaque burden in a subject suffering from Alzheimer's disease, the method comprising administering to the subject a therapeutically effective amount of a micelle disclosed herein.

[0040] In some embodiments, the micelle comprises a cationic carrier unit targeting LAT1 and a payload comprising an antisense oligonucleotide targeting miRNA-485-3p, e.g., an antisense oligonucleotide of SEQ ID NO: 18, or a fragment, variant, or derivative thereof. In some embodiments, the fragment comprises 14, 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides of SEQ ID NO: 18. In some embodiments, the variant has at least 70% sequence identity to SEQ ID NO: 18. In some embodiments, the derivative comprises at least one sugar modification and / or at least one backbone modification. [Brief description of the drawings]

[0041] [Figure 1] Figure 1 shows an exemplary structure of the carrier unit of the present disclosure. The exemplary carrier unit includes an optional tissue-specific targeting moiety, a water-soluble polymer, and a cationic or anionic carrier unit (which can interact with an anionic or cationic payload, respectively). In some embodiments, the cationic / anionic carrier and the anionic / cationic payload are untethered and interact electrostatically. In some embodiments, the cationic / anionic carrier and the anionic / cationic payload are tethered and interact electrostatically. For simplicity, the adjuvant moiety that may be present between the water-soluble polymer and the cationic / anionic carrier or at the terminal end of the cationic / anionic carrier is not shown in the drawing. [Diagram 2] An alternative method for loading a neutral payload using the carrier units of the present disclosure is shown, in which a neutral payload (e.g., a hydrophobic therapeutic agent) is covalently attached to an adaptor, which can then electrostatically interact with the cationic or anionic carrier moieties of the carrier unit. [Diagram 3]4 shows an exemplary structure of the carrier unit of the present disclosure. The example shown includes a cationic carrier portion that can electrostatically interact with an anionic payload, such as a nucleic acid, such as an antisense oligonucleotide that targets a gene, such as miRNA (antimiR). In some embodiments, the AM can be located between the WP and the CC. The CC and AM components are depicted in a linear arrangement for simplicity. However, as illustrated in FIG. 4, the CC and AM can be arranged like a scaffold. [Figure 4] 1H-NMR characteristics of carrier units containing brain targeting moieties that can form micellar structures after binding to anionic payloads are shown. The 1H-NMR chart corresponding to the brain targeting moiety (labeled "brain targeting molecule") shows that the brain targeting moiety (an amino acid moiety containing a cyclic structure that binds to the LAT1 target of brain endothelial cells) was successfully synthesized. The second 1H-NMR chart (labeled "polymer") shows that a cationic PEG block copolymer (also containing a cationic carrier moiety and an adjuvant moiety) was also synthesized. [Diagram 5] FIG. 1 is a schematic diagram showing how the carrier units of the present disclosure are inserted into micelles where tissue-specific targeting moieties decorate the exterior surface of the micelle and the nucleic acid payload is present, for example, in the core of the micelle (polyion complex antisense oligonucleotide). [Figure 6] It is shown how the shape and size of the micelles of the present disclosure, and therefore the loading capacity, can be modified by changing the ratio between the water-soluble biopolymer (e.g., PEG) and the cationic carrier (e.g., polylysine). Depending on the ratio, the carrier units can be organized as small particles, small micelles, micelles, rod-shaped structures, or polymersomes. It should be understood that the term "micelles of the present disclosure" encompasses not only typical micelles, but also small particles, small micelles, micelles, rod-shaped structures, or polymersomes. [Figure 7]1 shows a schematic diagram of the mechanism by which payloads contained in micelles of the present disclosure are delivered to target locations in the central nervous system. Micelles cross the blood-brain barrier by receptor-mediated transcytosis followed by intracellular uptake by brain cells, such as neurons, astrocytes, or microglia. Micelles are degraded in the cytoplasm, resulting in the release of payloads, such as anti-miRNAs, which, upon binding to target mRNAs, suppress or downregulate the expression of proteins encoded by the target mRNAs. [Figure 8] We show increased stability (increased plasma half-life) resulting from encapsulation of a payload in micelles of the present disclosure. Without micelles, anti-microRNA (antimiR) has a plasma half-life of less than 5 minutes. After incorporation into micelles of the present disclosure, the plasma half-life of antimiR increases to 80-120 minutes. After encapsulation, the half-life of the antimiR disclosed in the Examples increases from less than 5 minutes to about 93 minutes (i.e., about a 20-fold increase in plasma half-life). [Figure 9] 1 shows the particle size distribution of oligonucleotide (e.g., anti-miRNA)-loaded micelles of the present disclosure in PBS. The oligonucleotide (e.g., anti-miRNA)-loaded micelles show a particle size of 32 nm with a low PDI (polydispersity index) distribution, indicating that the population of micelles is homogeneous. [Figure 10] Distribution of LAT1 (SLC7A5, solute carrier family 7 member 5 [Homo sapiens (human)]) in various tissues. Data was obtained from NCBI. This corresponds to RNA sequencing of total RNA from 20 human tissues. [Figure 11] 1 shows in vivo LAT1 expression levels in different mouse tissues. [Figure 12] 1 shows LAT1 targeting using the brain-targeting carrier unit of the present disclosure. Fluorescent (Cy5.5) labeled brain-targeting carrier unit binds to LAT1 expressed in brain parenchyma and shows higher accumulation than non-targeting Cy5.5 molecules. [Figure 13]Intracellular uptake of Cy5.5-labeled anti-microRNA-loaded micelles by human microglia, astrocytes, neuroblast-like SH-5Y cells, and primary hepatocytes. After incubating each type of cell with Cy5.5, the cells were transfected with the labeled anti-microRNA, and fluorescence images were tracked for 48 hours using the IncuCyte imaging platform. Anti-microRNA uptake was significant in human brain cells (microglia, astrocytes, SH-5Y), but no uptake was observed in hepatocytes (liver cell line). [Figure 14] Figure 1 shows a comparison of LAT1 targeting in GL-26 cells overexpressing LAT1 on the cell surface. The figure shows cells with and without LAT1 inhibitor treatment. The uptake of targeted micelles was 3-fold higher than that observed with non-targeted micelles. When LAT1 was inhibited, no significant difference in uptake was observed between non-targeted and targeted micelles. [Figure 15] Figure 1 shows a comparison of the biodistribution of Cy5.5-labeled free anti-microRNA and Cy5.5-labeled anti-microRNA loaded in micelles (ASO-MDS (antisense oligonucleotide-micelle delivery system)) of the present disclosure after intravenous injection. After administration of both samples to mice by injection, whole-body fluorescence images were acquired at time intervals of 16 hours. [Figure 16] Figure 1 shows brain accumulation of anti-miRNA-loaded micelles (ASO-MDS) of the present disclosure compared to naked anti-miRNA (naked ASO) administration. Cy5.5-labeled anti-miRNA-loaded micelles were injected intravenously and the remaining fluorescence intensity was measured after dissolution of brain tissue. Brain-targeted micelles showed significant brain accumulation compared to non-targeted micelles. [Figure 17]Schematic diagram of experimental procedure is shown. ASO-MDS micelles, i.e., micelles of the present disclosure containing LAT1 targeting moiety and antimiR payload for miRNA485-3p, were injected into 8-month-old 5XFAD transgenic mice once a week for 4 weeks. ASO-MDS contains (i) antimiR for miR485-3p and (ii) 100 cationic carrier units, where each of 50 cationic carrier units is linked to phenylalanine (targeting moiety) and each of 50 cationic carrier units is not linked to any targeting moiety. Each of the cationic carrier units in ASO-MDS contains (PEG)5000 fused to 47 lysines, where each of 10 lysines is linked to nicotinamide, i.e., a total of 10 nicotinamides in the cationic carrier unit. [Figure 18A] 1 shows enhanced phagocytosis of Aβ in mouse primary glial cells following ASO-MDS treatment. [Figure 18B] 1 shows enhanced phagocytosis of Aβ in mouse primary microglial cells following ASO-MDS treatment. [Figure 18C] Enhanced phagocytosis of Aβ in mouse primary microglial cells after ASO-MDS treatment. Images show immunocytometry of Iba1 (microglia) and β-amyloid 1-16 (6E10, to detect Aβ plaques) in control or ASO-MDS-treated primary microglia. [Figure 19A] Figure 1 shows that ASO-MDS delivery reduces neuroinflammation in the hippocampus of 5XFAD mice. Images show immunohistochemical staining with anti-TNF-α (upper panel) and GFAP (lower panel) in coronal brain sections from 5XFAD mice treated with Mock (miR only and micelles only (left and center panels, respectively)) and ASO-MDS (right panel). (x20) n=3. [Figure 19B] A bar graph of the same data is shown in Figure 19A: the left bar is miR only, the middle bar is micelles only, and the right bar is micelles + miR. [Figure 20A]Figure 1 shows that ASO-MDS delivery reduces neuroinflammation in the cortex of 5XFAD mice. Images show immunohistochemical staining with anti-TNF-α (upper panel) and GFAP (lower panel) in coronal brain sections from 5XFAD mice treated with Mock (miR only and micelles only (left and center panels, respectively)) and ASO-MDS (right panel). (x20) n=3. [Figure 20B] A bar graph of the same data is shown in Figure 20A: the left bar is miR only, the middle bar is micelles only, and the right bar is micelles + miR. [Figure 21A] Figure 1 shows that ASO-MDS delivery reduces amyloid plaque burden in 5XFAD. Immunohistochemistry analysis of the dentate gyrus after administration of mock (miR only and micelles only (left and middle panels, respectively)) or ASO-MDS (right panel). Scattered plaques in brain sections were stained with anti-amyloid beta (clone 6E10) and nuclei. [Figure 21B] A bar graph of the same data is shown in Figure 21 A. The left bar is miR only, the middle bar is micelles only, and the right bar is micelles + miR. [Figure 22A] Figure 1 shows that administration of ASO-MDS restores neurogenesis in 5XFAD. Immunohistochemistry analysis of lateral ventricles after administration of mock (miR only and micelles only (left and middle panels, respectively)) or ASO-MDS (right panel). Neurogenesis in brain sections was identified by anti-DCX staining. The graph shows the average number of cells stained with DCX per mm2. The upper panel shows staining with anti-DCX staining (i.e., a neurogenesis marker). The lower panel shows staining with DAPI (4',6-diamidino-2-phenylindole). [Figure 22B] A bar graph of the same data shown in FIG. 22A is shown. [Figure 23A] Figure 2 shows that ASO-MDS delivery improves cognitive function (Y-maze) in 5XFAD mice. [Figure 23B]Figure 23 shows that ASO-MDS delivery improves cognitive function (passive avoidance test) in 5XFAD mice. Y-maze test and passive avoidance test in Figure 23A and Figure 23B were performed in 5XFAD mice injected with Mock (miR only and micelles only (left and middle panels, respectively)) and ASO-MDS (right panels) (n=5 for 8-10 month old 5XFAD mice treated with Mock, n=7 for 8-10 month old 5XFAD mice injected with ASO-MDS). [Figure 24] 1 shows the role of miRNA 485-3p in Alzheimer's disease. [Diagram 25] 1 shows a schematic diagram of the application of the disclosed micelle delivery system to cancer targeting. The micelle system disclosed herein is a versatile delivery system for cancer treatment and brain disease. Various cancer targeting ligands can be applied to this carrier system for the delivery of therapeutic agents, such as polynucleotides, to cancer cells. [Figure 26A] Figure 1 shows the effect of K-Ras gene silencing in pancreatic cancer using the micelle delivery system of the present disclosure.Figure 2 shows the timeline of the effect of K-Ras gene silencing. [Figure 26B] Figure 26A shows a bar graph of K-Ras mRNA relative amount after K-Ras gene silencing treatment. For both Figures 26A and 26B, oligonucleotides capable of inhibiting K-Ras were loaded into the micelle delivery system of the present disclosure. To target different tissues, the micelle delivery system of the present disclosure was fused to a cyclic RGD peptide (targeting α(v)β(3) integrin) or X (targeting). [Figure 27] Figure 1. Comparison of biodistribution after intramuscular injection of Cy5.5-labeled anti-microRNA (naked ASO, left mouse) and Cy5.5-labeled anti-microRNA-loaded micelles (ASO-MDS, right mouse). Whole-body fluorescence images were acquired up to 120 hours after injection of both samples into mice. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0042] The present disclosure is directed to carrier units that include a water-soluble biopolymer moiety (e.g., PEG) and a charged moiety (e.g., polylysine). Due to electrostatic interactions between the charged moiety and a charged payload (e.g., oligonucleotide) with opposite charge and similar or equal charge amount (i.e., the number of charges on the charged payload of the carrier unit and on the charged payload are similar or the same), the charge of the charged moiety of the carrier unit and the charge of the charged payload neutralize each other, resulting in a carrier unit:payload complex. The carrier unit:payload complex can self-associate to result in a micelle in which the payload is present in the core of the micelle and the water-soluble biopolymer moiety faces the solvent. In some aspects, the carrier unit includes a charged cationic moiety that can interact with an anionic payload. Conversely, the carrier unit can include a charged anionic moiety that can interact with a cationic payload. Non-limiting examples of various aspects are provided in the present disclosure.

[0043] Before the present disclosure is described in more detail, it should be understood that the present disclosure is not limited to the specific compositions or process steps described, which may of course vary. As will be apparent to one skilled in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has distinct components and features that may be easily separated from or combined with the features of any of the other several aspects without departing from the scope or spirit of the present disclosure. Any recited method may be carried out in the order of events recited or in any other order that is logically possible.

[0044] The headings provided herein are not intended to limit the various aspects of the disclosure, which may be defined by reference to the entire specification. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting, since the scope of the disclosure is limited only by the appended claims.

[0045] Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0046] I. Definition In order that this specification may be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed description.

[0047] It should be noted that the term "a" or "an" refers to one or more of that entity. For example, a "nucleotide sequence" is understood to represent one or more nucleotide sequences. Thus, the terms "a" (also "an"), "one or more," and "at least one" may be used interchangeably herein. It should be further noted that the claims may be drafted to exclude optional elements. Thus, this statement is intended as a prelude to the use of exclusive terminology such as "solely," "only," and the like, or the use of a "negative" limitation in connection with the recitation of claim elements.

[0048] Furthermore, "and / or" as used herein is to be considered as a specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and / or" as used herein in phrases such as "A and / or B" is intended to include "A and B", "A or B", "A" (single), and "B" (single). Similarly, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (single); B (single); and C (single).

[0049] Where an embodiment is described herein using the term "comprising," it will be understood that other similar embodiments described using the words "consisting of" and / or "consisting essentially of" are also provided.

[0050] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this disclosure pertains. For example, Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and Oxford Dictionary of Biochemistry and Molecular Biology, Revised, 2000, Oxford University Press provide those skilled in the art with a general dictionary of many of the terms used in this disclosure.

[0051] Units, prefixes, and symbols are expressed in their International System of Units (SI) accepted form. Numeric ranges are inclusive of the numerical values ​​that define the range. When a range of values ​​is listed, it is understood that each intervening integer value between the upper and lower limit values ​​listed for that range, and each fractional part thereof, is also expressly disclosed, along with each subrange between such values. The upper and lower limits of any range may be independently included or excluded from the range, and each range that includes either the upper or lower limit, each range that does not include either, or each range that includes both, is also encompassed by the present disclosure. Thus, ranges listed herein are understood to be shorthand for all values ​​within the range, including the recited endpoints. For example, a range of 1 to 10 is understood to include any number, combination of numbers, or subrange from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0052] When a value is explicitly recited, it is understood that values ​​of approximately the same quantity or amount as the recited value are also within the scope of this disclosure.When a combination is disclosed, each subcombination of the elements of the combination is also expressly disclosed and within the scope of this disclosure.Conversely, when different elements or groups of elements are disclosed separately, their combinations are also disclosed.When any element of a disclosure is disclosed as having multiple alternatives, the disclosed examples in which each alternative is excluded, alone or in any combination with other alternatives, are also disclosed herein, and two or more elements of a disclosure may have such an exclusion, and all combinations of elements with such exclusions are disclosed herein.

[0053] Nucleotides are represented by the commonly accepted single-letter symbols for nucleotides. Unless otherwise indicated, nucleotide sequences are written from left to right in a 5' to 3' orientation. Nucleotides are represented herein by the commonly known single-letter symbols for nucleotides recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Thus, "a" represents adenine, "c" represents cytosine, "g" represents guanine, "t" represents thymine, and "u" represents uracil.

[0054] Unless otherwise specified, amino acid sequences are written from left to right in amino to carboxy orientation. Amino acids are represented herein by the commonly known three-letter symbols or one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.

[0055] The term "about" is used herein to mean approximately, roughly, approximately, or in the range of. When the term "about" is used in conjunction with a range of numerical values, the term modifies that range by extending the upper and lower boundaries of the numerical values ​​set forth. In general, the term "about" can modify a numerical value above and below the stated value, for example, by up to or down (higher or lower) a variance of 10 percent.

[0056] The terms "administration", "administering" and grammatical variations thereof refer to the introduction of a composition, such as a micelle, of the present disclosure, into a subject by a pharma- ceutically acceptable route. The introduction of a composition, such as a micelle, of the present disclosure into a subject is by any suitable route, including intratumoral, oral, pulmonary, intranasal, parenteral (intravenous, intraarterial, intramuscular, intraperitoneal, or subcutaneous), rectal, intralymphatic, intrathecal, periocular, or topical. Administration includes self-administration and administration by another human. A suitable route of administration allows the composition or agent to perform its intended function. For example, if the suitable route is intravenous, the composition is administered by introducing the composition or agent into the subject's vein.

[0057] As used herein, the term "approximately" as applied to one or more values ​​of interest refers to a value that is comparable to a specified reference value. In certain embodiments, the term "approximately" refers to a range of values ​​that is within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less (more than or less than a number) in either direction of a specified reference value, unless otherwise specified or otherwise clear from the context (except when such number exceeds 100% of the possible values).

[0058] As used herein, the term "conserved" refers to nucleotides or amino acid residues of polynucleotide or polypeptide sequences, respectively, that are invariably found in the same position in two or more sequences that are being compared. Relatively conserved nucleotides or amino acids are those that are more conserved between related sequences than nucleotides or amino acids that occur in other parts of the sequences.

[0059] In some embodiments, two or more sequences are said to be "fully conserved" or "identical" if they are 100% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to each other. In some embodiments, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Sequence conservation can apply to the entire length of a polynucleotide or polypeptide, or to portions, regions, or features thereof.

[0060] As used herein, the term "derived from" refers to a component that is isolated or produced from a particular molecule or organism using a particular molecule or organism or information (e.g., amino acid or nucleic acid sequence). For example, a nucleic acid sequence derived from a second nucleic acid sequence may contain a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of a nucleotide or polypeptide, the derived species may be obtained, for example, by naturally occurring mutagenesis, artificially directed mutagenesis, or artificially random mutagenesis. The mutagenesis used to derive a nucleotide or polypeptide may be intentionally directed or intentionally random, or a combination of each. Mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first one may be a random event (e.g., caused by polymerase infidelity), and identification of the derived nucleotide or polypeptide may be made, for example, by a suitable screening method described herein. Mutagenesis of a polypeptide usually involves the manipulation of a polynucleotide that encodes the polypeptide.In some embodiments, a nucleotide or amino acid sequence derived from a second nucleotide or amino acid sequence has a similar sequence identity to the second nucleotide or amino acid sequence, respectively, of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 100%, at least about 101%, at least about 102%, at least about 103%, at least about 104%, at least about 105%, at least about 106%, at least about 107%, at least about 108%, at least about 109%, at least about 110%, at least about 111%, at least about 112%, at least about 113%, at least about 114%, at least %, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity, where the first nucleotide or amino acid sequence retains the biological activity of the second nucleotide or amino acid sequence.

[0061] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each containing a nucleobase sequence) related to each other by Watson-Crick base pairing rules, or between an oligomer and a target gene. For example, the nucleobase sequence "TGA(5'→3')" is complementary to the nucleobase sequence "ACT(3'→5')". Complementarity can be "partial", in which fewer than all of the nucleobases of a given nucleobase sequence match another nucleobase sequence according to the base pairing rules. For example, in some embodiments, the complementarity between a given nucleobase sequence and another nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Or, as an example, "perfect" or "complete" (100%) complementarity can exist between a given nucleobase sequence and another nucleobase sequence. The degree of complementarity between nucleobase sequences significantly affects the efficiency and strength of hybridization between the sequences.

[0062] The term "downstream" refers to a nucleotide sequence that is located 3' of a reference nucleotide sequence. In certain embodiments, the downstream nucleotide sequence relates to a sequence that follows the transcription start point. For example, the translation start codon of a gene is located downstream of the transcription start site.

[0063] The terms "excipient" and "carrier" are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound.

[0064] As used herein, the term "homology" refers to the overall relatedness between polymer molecules, e.g., between nucleic acid molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. In general, the term "homology" refers to the evolutionary relationship of two molecules. Thus, two homologous molecules have a common evolutionary ancestry. In the context of this disclosure, the term homology encompasses both identity and similarity.

[0065] In some embodiments, polymer molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecules are identical (exactly the same monomers) or similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (polynucleotide or polypeptide sequences).

[0066] As used herein, the term "identity" refers to the overall monomer conservation between polymer molecules, e.g., between polypeptide molecules or polynucleotide molecules (e.g., DNA molecules and / or RNA molecules). The term "identical" without any additional modifiers, e.g., "protein A is identical to protein B," means that the sequences are 100% identical (100% sequence identity). For example, describing two sequences as "70% identical" is equivalent to describing them as having, e.g., "70% sequence identity."

[0067] The calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed, for example, by aligning the two sequences for optimal comparison (e.g., gaps can be introduced into one or both of the first and second polypeptide or polynucleotide sequences for optimal alignment, and non-identical sequences can be ignored for comparison). In certain embodiments, the length of the sequence aligned for comparison is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, or about 100% of the full length of the reference sequence. The amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared.

[0068] If a position in the first sequence is occupied by the same amino acid as the corresponding position in the second sequence, the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps that need to be introduced for optimal alignment of the two sequences and the length of each gap. The comparison of sequences and the determination of the percent identity between two sequences can be accomplished using a mathematical algorithm.

[0069] Suitable software programs for alignment of both protein and nucleotide sequences are available from a variety of sources. One suitable program for determining percent sequence identity is bl2seq, which is part of the BLAST suite of programs available from the BLAST website of the U.S. Government's National Center for Biotechnology Information (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, whereas BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS bioinformatics suite of programs and available from the European Bioinformatics Institute (EBI) at www.ebi.ac.uk / Tools / psa.

[0070] Sequence alignment can be performed using methods known in the art, such as MAFFT, Clustal (ClustalW, Clustal X, or Clustal Omega), MUSCLE, and the like.

[0071] Different regions in a single polynucleotide or polypeptide target sequence that are aligned with a polynucleotide or polypeptide reference sequence can each have their own sequence identity percentage.Please note that the sequence identity percentage value is rounded to one decimal place.For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2.Please also note that the length value is always an integer.

[0072] In certain embodiments, the percentage identity (%ID) or identity of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID=100×(Y / Z), where Y is the number of amino acid residues (or nucleic acid bases) that are evaluated as perfect matches in an alignment of the first and second sequences (aligned by visual inspection or by a specific sequence alignment program), and Z is the total number of residues in the second sequence. If the length of the first sequence is greater than the length of the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence.

[0073] Those skilled in the art will understand that the creation of sequence alignment for calculating percent sequence identity is not limited to the comparison between two sequences driven solely by primary sequence data. It will also be understood that sequence alignment can be generated by integrating sequence data with data from heterogeneous sources, such as structural data (e.g., protein crystal structures), functional data (e.g., mutation locations), or phylogenetic data. A suitable program for integrating heterogeneous data to generate multiple sequence alignment is available at www.tcoffee.org, alternatively, for example, T-Coffee available from EBI. It will also be understood that the final alignment used to calculate percent sequence identity can be managed either automatically or manually.

[0074] As used herein, the terms "isolated," "purified," "extracted," and grammatical variations thereof are used interchangeably and refer to a preparation of the desired composition of the present disclosure that has undergone one or more purification processes. In some aspects, as used herein, isolation or purification is a process of removing, partially removing (e.g., a fraction of), the composition of the present disclosure from a sample containing contaminants. In some aspects, the isolated composition has no detectable undesirable activity, or alternatively, the level or amount of the undesirable activity is below an acceptable level or amount. In other aspects, the isolated composition has an amount and / or concentration of the desired composition of the present disclosure that is above an acceptable amount and / or concentration and / or activity. In other aspects, the isolated composition is concentrated compared to the starting material from which the composition is obtained. This enrichment can be at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or more than 99.9999% compared to the starting material. In some embodiments, the isolated preparation is substantially free of residual biological products. In some embodiments, the isolated preparation is 100%, at least about 99%, at least about 98%, at least about 97%, at least about 96%, at least about 95%, at least about 94%, at least about 93%, at least about 92%, at least about 91%, or at least about 90% free of any contaminating biological material. Residual biological products may include abiotic substances (including chemicals), or undesirable nucleic acids, proteins, lipids, or metabolic products.

[0075] As used herein, the term "linked" refers to a first amino acid sequence or polynucleotide sequence that is covalently or non-covalently linked to a second amino acid sequence or polynucleotide sequence, respectively. The first amino acid or polynucleotide sequence may be directly linked or juxtaposed to the second amino acid or polynucleotide sequence, or alternatively, an intervening sequence may be covalently linked from the first sequence to the second sequence. The term "linked" does not only mean the fusion of the first polynucleotide sequence to the second polynucleotide sequence at the 5' or 3' end, but also includes the insertion of the entire first polynucleotide sequence (or the second polynucleotide sequence, respectively) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence). The first polynucleotide sequence may be linked to the second polynucleotide sequence by a phosphodiester bond or a linker. The linker may be, for example, a polynucleotide.

[0076] The terms "miRNA" or "miR" or "microRNA" are used interchangeably and refer to microRNA molecules found in eukaryotes that are involved in RNA-based gene regulation. The term is used to refer to single-stranded RNA molecules processed from precursors. The names of miRNAs and their sequences relevant to this disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing, resulting in destabilization or translational inhibition of the target mRNA, thereby downregulating target gene expression. Conversely, targeting of miRNAs with molecules that contain miRNA binding sites (generally molecules that contain sequences complementary to the seed region of the miRNA) can reduce or inhibit the translational inhibition induced by the miRNA, resulting in upregulation of the target gene.

[0077] The term "mismatch" or "multiple mismatches" refers to one or more nucleobases (whether contiguous or separated) in an oligomer nucleobase sequence that do not match the target pre-mRNA according to base pairing rules. While perfect complementarity is often desired, some embodiments may include one or more, but preferably six, five, four, three, two, or one mismatches to the target pre-mRNA. Variations at any position within the oligomer are included. In certain embodiments, the antisense oligomers of the present disclosure include variations in nucleobase sequence near the ends, variations internally, and when present, are usually within about 6, 5, 4, 3, 2, or 1 subunit of the 5' and / or 3' ends. In certain embodiments, one, two, or three nucleobases may be removed and still provide accurate binding.

[0078] As used herein, the terms "modulate" and "modify" and grammatical variations thereof, when applied to a particular concentration, level, expression, function, or behavior, generally refer to the ability to increase or decrease, e.g., directly or indirectly, by promoting / stimulating / upregulating or interfering with / inhibiting / downregulating, a particular concentration, level, expression, function, or behavior, e.g., to act as an antagonist or agonist. In some cases, a modulator may increase and / or decrease a particular concentration, level, activity, or function compared to a control, or compared to an average level of activity generally expected, or compared to a control level of activity.

[0079] "Nucleic acid", "nucleic acid molecule", "nucleotide sequence", "polynucleotide", and grammatical variations thereof, are used interchangeably and refer to ribonucleosides (adenosine, guanosine, uridine, or cytidine; "RNA molecule") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, thymidine, or deoxycytidine; "DNA molecule") in the phosphate polymeric form, either in single-stranded form or double-stranded helices, or any phosphoester analogs thereof, such as phosphorothioates and thioesters. A single-stranded nucleic acid sequence refers to single-stranded DNA (ssDNA) or single-stranded RNA (ssRNA). Double-stranded DNA-DNA, DNA-RNA, and RNA-RNA helices are possible. The terms nucleic acid molecule, and in particular DNA or RNA molecule, refer only to the primary and secondary structure of the molecule and are not limited to any particular tertiary form. Thus, the term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA, and chromosomes. When describing the structure of a particular double-stranded DNA molecule, the sequence may be described herein according to the normal convention of providing only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to mRNA). A "recombinant DNA molecule" is a DNA molecule that has been subjected to molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. A "nucleic acid composition" of the present disclosure comprises one or more nucleic acids as described herein.

[0080] As used herein, the phrases "parenteral administration" and "administered parenterally" refer to modes of administration other than enteral and topical administration, usually by injection, including, but not limited to, intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0081] The terms "pharmaceutical acceptable carrier", "pharmaceutical acceptable excipient", and grammatical variations thereof, include any agent approved by a regulatory agency of the United States Federal Government for use in animals, including humans, or listed in the US Pharmacopeia, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to an extent that would prohibit administration of the composition to a subject, and does not suppress the biological activity and properties of the compound being administered. Included are generally safe, non-toxic, and desirable excipients and carriers that are useful in preparing pharmaceutical compositions.

[0082] As used herein, the term "pharmaceutical composition" refers to one or more of the compounds described herein, such as, for example, the micelles of the present disclosure, mixed or admixed with or suspended in one or more other chemical components, such as pharma- ceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate administration of a micelle preparation to a subject.

[0083] As used herein, the term "polynucleotide" refers to a polymer of any length of nucleotides, including ribonucleotides, deoxyribonucleotides, their analogs, or mixtures thereof. The term refers to the primary structure of the molecule. Thus, the term includes triple-, double-, and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double-, and single-stranded ribonucleic acid ("RNA"). The term also includes modified polynucleotides, for example, by alkylation and / or capping, as well as unmodified forms of polynucleotides.

[0084] More specifically, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, hRNA, siRNA, and mRNA, whether spliced ​​or unspliced, any other type of polynucleotide that is an N- or C-glycoside of purine or pyrimidine bases, as well as other polymers that contain non-nucleotide backbones, such as polyamides (e.g., peptide nucleic acids, "PNAs") and polymorpholino polymers, and other sequence-specific synthetic nucleic acid polymers, provided they contain nucleobases in an arrangement that allows for base pairing and base stacking as found in DNA and RNA.

[0085] In some embodiments of the present disclosure, polynucleotide can be an oligonucleotide, such as, for example, antisense oligonucleotide.In some embodiments, oligonucleotide is RNA.In some embodiments, RNA is synthetic RNA.In some embodiments, synthetic RNA comprises at least one non-natural nucleobase.In some embodiments, all nucleobases of a certain type are replaced with non-natural nucleobases (for example, all uridines in the polynucleotides disclosed herein can be replaced with non-natural nucleobases, such as 5-methoxyuridine).

[0086] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymers may include modified amino acids. The term also encompasses amino acid polymers that are naturally modified or modified by intervention, such as disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. For example, polypeptides containing one or more amino acid analogs (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), and other modifications known in the art, are also included within the definition. As used herein, the term "polypeptide" refers to proteins, polypeptides, and peptides of any size, structure, or function. Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the above. A polypeptide may be a single polypeptide or may be a multi-molecular complex, such as a dimer, trimer, or tetramer. They may also include single-chain or multi-chain polypeptides. Most commonly, disulfide bonds are found in multi-chain polypeptides. The term polypeptide may also be applied to amino acid polymers in which one or more amino acid residues are artificial chemical analogs of corresponding naturally occurring amino acids. In some embodiments, a "peptide" may be 50 amino acids or less in length, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids in length.

[0087] As used herein, the terms "prevent", "preventing", and variations thereof, refer to partially or completely delaying the onset of a disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or clinical signs of a particular disease, disorder, and / or condition; partially or completely delaying the onset of one or more symptoms, characteristics, or signs of a particular disease, disorder, and / or condition; partially or completely delaying the progression of a particular disease, disorder, and / or condition; and / or reducing the risk of developing a pathology associated with a disease, disorder, and / or condition. In some embodiments, preventing an outcome is achieved by a prophylactic treatment.

[0088] As used herein, "prophylaxis" refers to a therapeutic action or course of action used to prevent the onset of a disease or condition or to prevent or delay the symptoms associated with a disease or condition.

[0089] As used herein, "prophylaxis" refers to measures taken to maintain health, prevent or delay the onset of bleeding episodes, or prevent or delay symptoms associated with a disease or condition.

[0090] As used herein, the term "similarity" refers to the overall relatedness between polymer molecules, e.g., between polynucleotide molecules (e.g., DNA molecules and / or RNA molecules) and / or between polypeptide molecules. Calculation of percent similarity of polymer molecules to each other can be performed similarly to calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as understood in the art. It will be understood that the percentage of similarity depends on the comparison measure used, i.e., whether amino acids are compared according to, for example, their evolutionary proximity, charge, volume, mobility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or a combination thereof.

[0091] The terms "subject," "patient," "individual," and "host," and variations thereof, are used interchangeably herein and refer to any mammalian subject for which diagnosis, treatment, or therapy is desired, including, but not limited to, humans, domestic animals (e.g., dogs, cats, etc.), livestock (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., monkeys, rats, mice, rabbits, guinea pigs, etc.), particularly humans. The methods described herein are applicable to human therapy and veterinary applications.

[0092] As used herein, the phrase "subject in need thereof" includes subjects, such as mammalian subjects, who would benefit from administration of the micelles of the present disclosure, for example, to improve hemostasis.

[0093] As used herein, the expressions "systemic administration," "systemically administered," "peripheral administration," and "administered peripherally" refer to administration of a compound, drug, or other substance other than directly into the central nervous system, such that it enters the patient's system and is therefore subject to metabolism and other similar processes, e.g., subcutaneous administration.

[0094] As used herein, the term "therapeutically effective amount" refers to an amount of a reagent or pharmaceutical compound, including a micelle of the present disclosure, sufficient to produce a desired therapeutic, pharmacological, and / or physiological effect on a subject in need thereof. A therapeutically effective amount may be a "prophylactically effective amount" where prevention may be considered treatment.

[0095] As used herein, the terms "treat", "treatment" or "treating" refer to, for example, reducing the severity of a disease or condition, reducing the duration of a disease course, improving or eliminating one or more symptoms associated with a disease or condition, providing a beneficial effect to a subject having a disease or condition without necessarily curing the disease or condition. The terms also include prevention or prophylaxis of a disease or condition or symptoms thereof. In one embodiment, the term "treat" or "treatment" refers to eliciting an immune response to an antigen in a subject.

[0096] The term "upstream" refers to a nucleotide sequence that is 5' to a reference nucleotide sequence.

[0097] II. Carrier Unit The present disclosure provides a carrier unit that can self-assemble into a micelle or can be incorporated into a micelle. The carrier unit of the present disclosure includes a water-soluble biopolymer moiety (e.g., PEG) and a charged carrier moiety. As illustrated in Figure 1, in some embodiments, the charged carrier moiety is cationic (e.g., polylysine), while in other embodiments, the charged carrier moiety is anionic (e.g., polyglutamic acid).

[0098] The carrier units of the present disclosure can be used to deliver a charged payload (e.g., a therapeutic or diagnostic agent). Carrier units with cationic charged carrier moieties can be used to deliver anionic payloads (e.g., polynucleotides). Carrier units with anionic charged carrier moieties can be used to deliver cationic payloads (e.g., positively charged small molecule drugs). See FIG. 1.

[0099] Neutral or hydrophobic payloads can also be delivered using the carrier units of the present disclosure by using an adaptor (e.g., a cationic or anionic adaptor, as illustrated in FIG. 2). The adaptor is covalently attached, for example, to a hydrophobic payload, providing such payload with an appropriate charge mass for interacting with the charged carrier moiety of the carrier unit of the present disclosure. Thus, in some embodiments, the payloads of the present disclosure can include a charged moiety (an "adapter" moiety) that can interact (e.g., via electrostatic interaction) with the charged carrier moiety of the carrier unit of the present disclosure and a biologically active moiety (e.g., a therapeutic moiety). In some embodiments, the adaptor moiety and the biologically active moiety are directly linked, while in some other embodiments, they can be linked by a linker.

[0100] (i) a charged carrier moiety; and (ii) electrostatic interactions between a charged payload (e.g., a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, etc.) or a charged portion thereof (e.g., an adapter portion), a. the charged carrier moiety and the charged payload or charged portion thereof have different net charges (i.e., one is cationic and the other is anionic); b. The net charge amounts are comparable or the same (i.e., the number of charges on the charged portion of the carrier unit and the charged payload or charged portion thereof are comparable or the same), during electrostatic interaction; The charges of the charged moiety and the charged payload neutralize each other, resulting in a carrier unit:payload complex.

[0101] The resulting carrier unit:payload conjugate is amphiphilic, having a hydrophilic "head" comprising the water-soluble biopolymer moiety and a hydrophobic "tail" comprising the charged carrier moiety that is electrostatically bound to the payload.

[0102] The carrier unit:payload complexes, alone or in combination with other amphiphilic molecules, may self-assemble to result in micelles in which the payload resides in the core of the micelle and the water-soluble biopolymer portion faces the solvent. The term "micelles of the present disclosure" encompasses not only typical micelles but also small particles, small micelles, micelles, rod-shaped structures, or polymersomes. Given that polymersomes contain a lumen, it should be understood that all disclosures related to the "core" of a typical micelle apply equally to the lumen in polymersomes that contain carrier units of the present disclosure. Thus, in some aspects, micelles of the present disclosure may include payload molecules bound to carrier units of the present disclosure and payload molecules in the lumen of the micelle (e.g., the lumen of the polymersome). In some aspects, the payload bound to the carrier unit and the payload in the lumen are the same. In some aspects, the payload bound to the carrier unit and the payload in the lumen are different.

[0103] The carrier units of the present disclosure may include a targeting moiety covalently attached to a water-soluble biopolymer moiety by one or more optional linkers. Once the micelle is formed, the targeting moiety may be located on the surface of the micelle and may deliver the micelle to a specific target tissue, a specific cell type, and / or facilitate transport across a physiological barrier (e.g., cell plasma membrane or BBB). In some embodiments, the micelles of the present disclosure may include more than one type of targeting moiety.

[0104] The carrier units of the present disclosure may also include an adjuvant moiety covalently attached to the charged carrier moiety. The adjuvant moiety may serve two purposes: it may provide a charge for electrostatic interaction with the payload and / or it may have, for example, a therapeutic effect, a supplemental therapeutic effect, or it may positively affect the homeostasis of a target cell or tissue.

[0105] In some embodiments, the payload is not covalently attached to the carrier unit, as shown in the schematic diagram of Figure 1. However, in other embodiments, the payload may be covalently attached to the carrier unit, e.g., a linker, such as a cleavable linker.

[0106] Non-limiting examples of various aspects are given in the present disclosure.The present disclosure is particularly related to the use of cationic carrier units to deliver anionic payloads, such as nucleic acids.However, it will be clear to those skilled in the art that the present disclosure can be similarly applied to the delivery of cationic payloads or neutral payloads by reversing the charge of the carrier moiety and the payload (i.e., using an anionic carrier moiety in the carrier unit to deliver cationic payloads), or by using a neutral payload linked to a cationic or anionic adaptor that electrostatically interacts with the anionic or cationic carrier moiety, respectively.

[0107] Thus, in one aspect, the present disclosure provides a cationic carrier unit of Formula I or Formula II, [WP]-L1-[CC]-L2-[AM] (Scheme I) [WP]-L1-[AM]-L2-[CC] (Scheme II) During the ceremony, WP is a water soluble biopolymer moiety (e.g., PEG); CC is a cationic carrier moiety, e.g., polylysine; AM is an adjuvant moiety, e.g., a vitamin, e.g., vitamin B3; L1 and L2 are independently an optional linker, providing a cationic carrier unit.

[0108] The present disclosure provides an anionic carrier unit of Formula III or Formula IV, [WP]-L1-[AC]-L2-[AM] (Scheme III) [WP]-L1-[AM]-L2-[AC] (Scheme IV) During the ceremony, WP is a water soluble biopolymer moiety (e.g., PEG); AC is an anionic carrier moiety, AM is the adjuvant moiety, L1 and L2 are independently an optional linker, providing a cationic carrier unit.

[0109] The present disclosure provides cationic and anionic carrier units of formulas V-VIII, [WP]-L1-[AC]-L2-[AM]-L3-[P] (Scheme V) [WP]-L1-[AM]-L2-[AC]-L3-[P] (Scheme VI) [WP]-L1-[AC]-L2-[AM]-L3-[P] (Scheme VII) [WP]-L1-[AM]-L2-[AC]-L3-[P] (Scheme VIII) During the ceremony, WP is a water soluble biopolymer moiety (e.g., PEG); AC is an anionic carrier moiety, CC is a cationic carrier moiety; AM is the adjuvant moiety, L1 and L2 are independently an optional linker; L3 is an optional linker, which may be cleavable; P also provides the payload, the cationic and anionic carrier units.

[0110] In some embodiments of the constructs of Schemes I-VIII above, the [WP] component comprises at least one targeting moiety, i.e., [T] n -[WP]-..., where n is an integer, e.g., 1, 2, or 3.

[0111] Figure 3 shows a schematic diagram of a cationic carrier unit of the present disclosure. For simplicity, the unit in Figure 3 is shown linearly. However, in some embodiments, the carrier unit may include CC and AM moieties, for example, configured in a branched scaffold arrangement (see Figures 4 and 5) with a polymeric CC moiety containing a positively charged unit and an AM attached at one or more positions along the CC moiety. In other embodiments, the CC and AM may be attached to the scaffold moiety as shown in Figure 5.

[0112] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] A is a targeting moiety, e.g., a molecule that targets the LAT1 transporter; B is a cationic polymer block in the cationic carrier moiety; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X is an adjuvant moiety, e.g., a vitamin, e.g., [ka] and Y1 is C, N, O, or S, Y2 is C, N, O, or S, and n is 1 or 2. In some embodiments, X can be -SH (e.g., sulfanyl group, alkanethiol, or alkylthiol). In some embodiments, the micelles of the present disclosure include one type of cationic carrier unit conjugated to a vitamin, e.g., vitamin B3, and another type of cationic carrier unit conjugated to a sulfanyl group (e.g., alkanethiol or alkylthiol). In some embodiments, the micelles of the present disclosure include a first type of cationic carrier unit conjugated to a vitamin, e.g., vitamin B3, a second type of cationic carrier unit conjugated to a sulfanyl group (e.g., alkanethiol or alkylthiol), and a third type of cationic carrier unit that is a free base.

[0113] When the cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) in an ionic ratio of about 1:about 1, i.e., when the number of negative charges in the anionic payload and the number of positive charges in the cationic carrier moiety are approximately the same, neutralization of the negative charges in the anionic payload by the positive charges in the cationic carrier moiety, primarily via electrostatic interactions, results in the formation of a cationic carrier unit:anionic payload complex having an unchanged hydrophilic portion (including the WP moiety) and a substantially more hydrophobic portion (due to the association between the cationic carrier moiety plus the adjuvant moiety and the anionic payload).

[0114] In some embodiments, the adjuvant moiety may contribute its own positive charge to the positive charge of the cationic carrier moiety which interacts with the negative charge of the anionic payload. It should be understood that reference to an interaction (e.g., an electrostatic interaction) between the cationic carrier moiety and the anionic payload also encompasses the interaction between the charges of the adjuvant moiety plus the cationic carrier moiety and the charge of the anionic payload.

[0115] The increased hydrophobicity of the cationic carrier moiety of the cationic carrier unit due to neutralization of the positive charge by electrostatic interaction with the negative charge of the anionic payload results in an amphiphilic complex. Such an amphiphilic complex can self-assemble into a micelle, either alone or in combination with other amphiphilic components. The resulting micelle contains the WP moiety facing the solvent (i.e., the WP moiety faces the outer surface of the micelle), while the CC and AM moieties and associated payload (e.g., a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimiR", or any combination thereof) reside in the center of the micelle.

[0116] In some particular embodiments, the cationic carrier unit is (a) a WP moiety, wherein the water soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), where n is about 120 to about 130 (e.g., PEG is PEG5000 or PEG6000); (b) a CC moiety, the cationic carrier moiety comprising, for example, about 30 to about 40 lysines (e.g., linear poly(L-lysine), where n is about 30 to about 40), polyethyleneimine (PEI), or chitosan; (c) an AM portion, wherein the adjuvant portion has about 5 to about 10 vitamin B3 units (eg, about 5 to about 10 linked vitamin B3 units).

[0117] In some particular embodiments, the cationic carrier unit is (a) a WP moiety, wherein the water soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), where n is about 120 to about 130 (e.g., PEG is PEG5000 or PEG6000); (b) a CC moiety, the cationic carrier moiety comprising, for example, about 60 to about 100 lysines (e.g., linear poly(L-lysine)n, where n is about 60 to about 100), for example, about 70 to 90 lysines, about 80 lysines, polyethyleneimine (PEI), or chitosan; (c) an AM portion, wherein the adjuvant portion has about 10 to about 50 vitamin B3 units (e.g., about 10 to about 50 linked vitamin B3 units, e.g., about 20 to 40 units, e.g., about 30 units).

[0118] In some embodiments, the cationic carrier unit further comprises at least one targeting moiety attached to the WP portion of the cationic carrier unit, hi some embodiments, the number and / or density of targeting moieties presented on the surface of the micelle can be controlled by using a particular ratio of cationic carrier units with a targeting moiety to cationic carrier units without a targeting moiety. In some embodiments, the ratio of cationic carrier units with a targeting moiety to cationic carrier units without a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.

[0119] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water soluble polymer that is PEG; and (iii) a cationic carrier moiety comprising a cationic polymer block that is lysine; and (iv) two or more adjuvant moieties that are vitamin B3.

[0120] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block, e.g., polylysine; (iv) Contains two or more adjuvant moieties, e.g., vitamin B3.

[0121] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block, for example, 10 to 100 lysines, for example, 10 to 50 lysines, for example, 30 to 40 lysines, for example, 70 to 80 lysines; (iv) Two or more adjuvant moieties, e.g., vitamin B3, e.g., 25-30 moieties of vitamin B3.

[0122] In some embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, where n=100 to 200, for example, 100 to 150, for example, 120 to 130; and (iii) a cationic carrier moiety comprising a cationic polymer block, for example, 10 to 100 lysines, for example, 10 to 50 lysines, for example, 30 to 40 lysines, for example, 70 to 80 lysines; (iv) Two or more adjuvant moieties, for example, 5 to 50 vitamin B3, for example, 5 to 30 vitamin B3, for example, 5 to 20 vitamin B3, for example, 5 to 15 vitamin B3, for example, 5 to 10 vitamin B3, for example, 25 to 30 vitamin B3.

[0123] As illustrated in Scheme I, the CC moiety can be a polymer comprising several B units (where each B unit can be, for example, lysine), and the AM moiety can be a non-discrete molecular entity comprising several X units (e.g., vitamin units) covalently attached to side chain attachment points on the CC moiety. Thus, in certain embodiments, the cationic carrier unit is (i) a targeting moiety (A) that targets the transporter LAT1 (e.g., phenylalanine); (ii) a water-soluble polymer which is PEG, n=120 to 130; (iii) a cationic carrier moiety comprising a cationic polymer block of 30-40, 40-50, 50-60, or 70-80 B units that are lysine; (iv) an adjuvant moiety of 5-10, 10-20, 20-25, or 25-30 X units that is vitamin B3.

[0124] In some embodiments, the cationic carrier unit of the present disclosure interacts with an antisense oligonucleotide payload targeting miR-485-3p, such as AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18). In some embodiments, the carrier unit complexed with the payload forms a micelle.

[0125] In some embodiments, a vitamin B3 unit is introduced onto the side chain of the CC moiety by a coupling reaction between, for example, the NH2 group of lysine and the COOH group of vitamin B3 in the presence of suitable conjugation reagents, such as 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxysuccinimide (NHS).

[0126] The present disclosure provides compositions comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure. In other aspects, the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure non-covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimiR", or any combination thereof), where the carrier unit and the payload interact electrostatically. In other aspects, the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure covalently bound to a payload (e.g., an anionic payload such as a nucleotide sequence, e.g., an oligonucleotide, siRNA, shRNA, "antimiR", or any combination thereof), where the carrier unit and the payload interact electrostatically. In some aspects, the carrier unit and the payload can be linked by a cleavable linker. In some aspects, the carrier unit and the payload can covalently interact in addition to electrostatically interacting (e.g., after electrostatic interaction, the carrier unit and the payload can be "locked" by a disulfide bond or a cleavable bond).

[0127] In some specific embodiments, the cationic carrier unit comprises a water soluble polymer comprising PEG having about 120 to about 130 units, a cationic carrier moiety comprising polylysine having about 30 to about lysine units, and an adjuvant moiety comprising about 5 to about 10 vitamin B3 units.

[0128] In some embodiments, the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, such as an oligonucleotide (e.g., an antisense oligonucleotide), an siRNA, an shRNA, an "antimiR," or any combination thereof) that interacts with the cationic carrier unit through at least one ionic bond (i.e., through an electrostatic interaction with the cationic carrier moiety of the cationic carrier unit).

[0129] In some embodiments, micelles of the present disclosure may be constructed based on the formula shown in Figure 6. In some embodiments, mB / (nA+mB) of the micelles is greater than 0 and less than 1, for example, about 0.25 to about 1, about 0.3 to about 1, about 0.4 to about 1, about 0.5 to about 1, about 0.25 to about 0.9, about 0.3 to about 0.9, about 0.4 to about 0.9, about 0.5 to about 0.9, about 0.25 to about 0.8, about 0.3 to about 0.8, about 0.4 to about 0.8, about 0.5 to about 0.8, about 0.25 to about 0.75, about 0.3 to about 0.75, about 0.4 to about 0.75, about 0.5 to about 0.75, about 0.25 to about 0.7, about 0.3 to about 0.7, about 0.4 to about 0.7, about 0.5 to about 0.7, about 0.25 to about 0.6, about 0.3 to about 0.6, about 0.4 to about 0.6, about 0.5 to about 0.6, about 0.45 to about 0.55, about 0.4 to about 0.65, or about 0.5 to about 0.65, In the formula, nA is

number

number

[0130] In some embodiments, the mB / (nA+mB) of the micelles is about 0.4 to about 0.6, about 0.5 to about 0.6, or about 0.4 to about 0.5; In the formula, nA is

number

number

number

number

[0131] Particular components of the cationic carrier units of the present disclosure are disclosed in detail below.

[0132] A water-soluble biopolymer In some embodiments, the cationic carrier unit of the present disclosure comprises at least one water-soluble biopolymer. As used herein, the term "water-soluble biopolymer" refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, such as PEG.

[0133] In some embodiments, the water soluble polymer comprises poly(alkylene glycol), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkyl methacrylamide), poly(hydroxyalkyl methacrylate), poly(saccharide), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazoline ("POZ"), poly(N-acryloylmorpholine), or any combination thereof. In some embodiments, the water soluble biopolymer is linear, branched, or dendritic.

[0134] In some embodiments, the water-soluble biopolymer comprises polyethylene glycol ("PEG"), polyglycerol ("PG"), or poly(propylene glycol) ("PPG"). Many biologics are now manufactured with PPG instead of PEG because PPG is less toxic than PEG.

[0135] In some embodiments, the water soluble biopolymer has the formula: 3 -(O-CH2-CH2) n - or R 3 -(0-CH2-CH2) n -O-(wherein, R 3is hydrogen, methyl, or ethyl, and n has a value from 2 to 200. In some embodiments, the PEG has the formula: [ka] In the formula, n is 1 to 1,000.

[0136] In some embodiments, n of PEG is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 201, 201, 202, 203, 204 8, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0137] In some embodiments, n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,Or about 1000.

[0138] In some embodiments, n is from about 50 to about 100, from about 100 to about 150, from about 150 to about 200, from about 200 to about 250, from about 250 to about 300, from about 300 to about 350, from about 350 to about 400, from about 400 to about 450, from about 450 to about 500, from about 500 to about 550, from about 550 to about 600, from about 600 to about 650, from about 650 to about 700, from about 700 to about 750, from about 750 to about 800, from about 800 to about 850, from about 850 to about 900, from about 900 to about 950, or from about 950 to about 1000.

[0139] In some embodiments, n is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0140] In some embodiments, n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0141] In some embodiments, n is about 100 to about 150. In some embodiments, n is about 100 to about 140. In some embodiments, n is about 100 to about 130. In some embodiments, n is about 110 to about 150. In some embodiments, n is about 110 to about 140. In some embodiments, n is about 110 to about 130. In some embodiments, n is about 110 to about 120. In some embodiments, n is about 120 to about 150. In some embodiments, n is about 120 to about 140. In some embodiments, n is about 120 to about 130. In some embodiments, n is about 130 to about 150. In some embodiments, n is about 130 to about 140.

[0142] Thus, in some embodiments, the PEG is a branched PEG. Branched PEG has 3-10 PEG chains extending from a central core group. In certain embodiments, the PEG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPEG) is a PEG having a single, defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PEG moiety is assigned the abbreviation mdPEG.

[0143] In some embodiments, the PEG is a Star PEG. Star PEG has 10-100 PEG chains extending from a central core group. In some embodiments, the PEG is a Comb PEG. Comb PEG typically has multiple PEG chains grafted onto a polymer backbone.

[0144] In certain embodiments, the PEG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0145] In some embodiments, the PEG is 100 , PEG 200 , PEG 300 , PEG 400 , PEG 500 , PEG 600 , PEG 700 , PEG 800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500、PEG 2600 、PEG 2700 、PEG 2800 、PEG 2900 、PEG 3000 、PEG 3100 、PEG 3200 、PEG 3300 、PEG 3400 、PEG 3500 、PEG 3600 、PEG 3700 、PEG 3800 、PEG 3900 、PEG 4000 、PEG 4100 、PEG 4200 、PEG 4300 、PEG 4400 、PEG 4500 、PEG 4600 、PEG 4700 、PEG 4800 、PEG 4900 、PEG 5000 、PEG 5100 、PEG 5200 、PEG 5300 、PEG 5400 、PEG 5500 、PEG 5600 、PEG 5700 、PEG 5800 、PEG 5900 、PEG 6000 、PEG 6100 、PEG 6200 、PEG 6300 、PEG 6400 、PEG 6500 、PEG 6600 、PEG 6700 、PEG 6800 、PEG 6900 、PEG 7000 、PEG 7100 、PEG 7200 、PEG 7300 、PEG 7400 、PEG 7500 、PEG 7600 、PEG 7700 、PEG 7800 、PEG 7900 、or PEG 8000 In some cases, PEG is PEG 5000 In some cases, PEG is PEG6000 In some embodiments, the PEG is 4000 It is.

[0146] In some embodiments, the PEG is monodisperse, e.g., mPEG. 100 , mPEG 200 , mPEG 300 , mPEG 400 , mPEG 500 , mPEG 600 , mPEG 700 , mPEG 800 , mPEG 900 , mPEG 1000 , mPEG 1100 , mPEG 1200 , mPEG 1300 , mPEG 1400 , mPEG 1500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 1600 , mPEG 1700 , mPEG 1800 , mPEG 1900 , mPEG 2000 , mPEG 2100 , mPEG 2200 , mPEG 2300 , mPEG 2400 , mPEG 2500 , mPEG 2600 , mPEG 2700 , mPEG 2800 , mPEG 2900 , mPEG 3000 , mPEG 3100 , mPEG 3200 , mPEG 3300 , mPEG 3400 , mPEG 3500 , mPEG 3600 , mPEG 3700 , mPEG 3800 , mPEG 3900 , mPEG4000 , mPEG 4100 , mPEG 4200 , mPEG 4300 , mPEG 4400 , mPEG 4500 , mPEG 4600 , mPEG 4700 , mPEG 4800 , mPEG 4900 , mPEG 5000 , mPEG 5100 , mPEG 5200 , mPEG 5300 , mPEG 5400 , mPEG 5500 , mPEG 5600 , mPEG 5700 , mPEG 5800 , mPEG 5900 , mPEG 6000 , mPEG 6100 , mPEG 6200 , mPEG 6300 , mPEG 6400 , mPEG 6500 , mPEG 6600 , mPEG 6700 , mPEG 6800 , mPEG 6900 , mPEG 7000 , mPEG 7100 , mPEG 7200 , mPEG 7300 , mPEG 7400 , mPEG 7500 , mPEG 7600 , mPEG 7700 , mPEG 7800 , mPEG 7900 , or mPEG 8000 In some embodiments, the mPEG is 5000 In some embodiments, the mPEG is 6000 In some embodiments, the mPEG is 4000 It is.

[0147] In some embodiments, the water soluble biopolymer moiety has the formula ((R 3 -O-(CH2-CHOH-CH2O) n-), where R3 is hydrogen, methyl, or ethyl, and n has a value from 3 to 200. In some embodiments, the water-soluble biopolymer portion is represented by the formula (R 3 -O-(CH2-CHOR 5 -CH2-O) n -) and R 5 or a branched polyglycerol of the formula (R 3 -O-(CH2-CHOH-CH 2 -O) n -) is a linear glycerol chain, and R 3 is hydrogen, methyl, or ethyl. In some embodiments, the water soluble biopolymer moiety has the formula (R 3 -O-(CH2-CHOR 5 -CH2-O) n -) and R 5 is hydrogen, or a hyperbranched polyglycerol of the formula (R 3 -O-(CH2-CHOR 6 -CH2-O) n -) and R 6 is hydrogen, or a glycerol chain of the formula (R 3 -O-(CH2-CHOR 7 -CH2-O) n -) and R 7 A glycerol chain, which is hydrogen, or a glycerol chain of the formula (R 3 -O-(CH2-CHOH-CH2-O) n -) is a linear glycerol chain, and R 3 is hydrogen, methyl, or ethyl. Hyperbranched glycerol and methods for its synthesis are described in Oudshorn et al. (2006) Biomaterials 27:5471-5479; Wilms et al. (20100 Acc. Chem. Res. 43, 129-41, and references cited therein.

[0148] In certain embodiments, PG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0149] In some embodiments, PG is 100 , P.G. 200 , P.G. 300 , P.G. 400 , P.G. 500 , P.G. 600 , P.G. 700 , P.G. 800 , P.G. 900 , P.G. 1000 , P.G. 1100 , P.G. 1200 , P.G. 1300 , P.G. 1400 , P.G. 1500 , P.G. 1600 , P.G. 1700 , P.G. 1800 , P.G. 1900 , P.G. 2000 , P.G. 2100 , P.G. 2200 , P.G. 2300 , P.G. 2400 , P.G. 2500 , P.G. 1600 , P.G. 1700 , P.G. 1800 , P.G. 1900 , P.G. 2000 , P.G. 2100 , P.G. 2200 , P.G. 2300 , P.G. 2400 , P.G. 2500 , P.G. 2600 , P.G. 2700 , P.G. 2800 , P.G. 2900 , P.G. 3000 , P.G. 3100 , P.G. 3200 , P.G. 3300 , P.G. 3400 , P.G. 3500 , P.G. 3600 , P.G. 3700 , P.G. 3800, P.G. 3900 , P.G. 4000 , P.G. 4100 , P.G. 4200 , P.G. 4300 , P.G. 4400 , P.G. 4500 , P.G. 4600 , P.G. 4700 , P.G. 4800 , P.G. 4900 , P.G. 5000 , P.G. 5100 , P.G. 5200 , P.G. 5300 , P.G. 5400 , P.G. 5500 , P.G. 5600 , P.G. 5700 , P.G. 5800 , P.G. 5900 , P.G. 6000 , P.G. 6100 , P.G. 6200 , P.G. 6300 , P.G. 6400 , P.G. 6500 , P.G. 6600 , P.G. 6700 , P.G. 6800 , P.G. 6900 , P.G. 7000 , P.G. 7100 , P.G. 7200 , P.G. 7300 , P.G. 7400 , P.G. 7500 , P.G. 7600 , P.G. 7700 , P.G. 7800 , P.G. 7900 , or P.G. 8000 In some embodiments, the PG is 5000 In some embodiments, the PG is 6000 In some embodiments, the PG is 4000 It is.

[0150] In some embodiments, the PG is monodisperse, e.g., mPG. 100 , mPG 200 , mPG 300 , mPG 400 , mPG 500 , mPG 600 , mPG 700 , mPG 800 , mPG 900 , mPG1000 、mPG 1100 、mPG 1200 、mPG 1300 、mPG 1400 、mPG 1500 、mPG 1600 、mPG 1700 、mPG 1800 、mPG 1900 、mPG 2000 、mPG 2100 、mPG 2200 、mPG 2300 、mPG 2400 、mPG 2500 、mPG 1600 、mPG 1700 、mPG 1800 、mPG 1900 、mPG 2000 、mPG 2100 、mPG 2200 、mPG 2300 、mPG 2400 、mPG 2500 、mPG 2600 、mPG 2700 、mPG 2800 、mPG 2900 、mPG 3000 、mPG 3100 、mPG 3200 、mPG 3300 、mPG 3400 、mPG 3500 、mPG 3600 、mPG 3700 、mPG 3800 、mPG 3900 、mPG 4000 、mPG 4100 、mPG 4200 、mPG 4300 、mPG 4400 、mPG 4500 、mPG 4600 、mPG 4700 、mPG 4800 、mPG 4900 、mPG 5000 、mPG 5100 、mPG 5200 、mPG 5300 、mPG 5400 、mPG 5500 、mPG 5600 、mPG 5700 、mPG 5800 、mPG5900 , mPG 6000 , mPG 6100 , mPG 6200 , mPG 6300 , mPG 6400 , mPG 6500 , mPG 6600 , mPG 6700 , mPG 6800 , mPG 6900 , mPG 7000 , mPG 7100 , mPG 7200 , mPG 7300 , mPG 7400 , mPG 7500 , mPG 7600 , mPG 7700 , mPG 7800 , mPG 7900 , or mPG 8000 It is.

[0151] In some embodiments, the water soluble biopolymer comprises poly(propylene glycol) ("PPG"). In some embodiments, the PPG is characterized by the following formula, where n has a value of 1 to 1000: [ka]

[0152] In some embodiments, n in PPG is 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58 , 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113 , 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 20A, 201, 201, 202, 203, 204 8, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200.

[0153] In some embodiments, n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990,Or about 1000.

[0154] In some embodiments, n of PPG is about 50 to about 100, about 100 to about 150, about 150 to about 200, about 200 to about 250, about 250 to about 300, about 300 to about 350, about 350 to about 400, about 400 to about 450, about 450 to about 500, about 500 to about 550, about 550 to about 600, about 600 to about 650, about 650 to about 700, about 700 to about 750, about 750 to about 800, about 800 to about 850, about 850 to about 900, about 900 to about 950, or about 950 to about 1000.

[0155] In some embodiments, n of PPG is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, at least about 141, at least about 142, at least about 143, at least about 144, at least about 145, at least about 146, at least about 147, at least about 148, at least about 149, at least about 150, at least about 151, at least about 152, at least about 153, at least about 154, at least about 155, at least about 156, at least about 157, at least about 158, at least about 159, or at least about 160.

[0156] In some embodiments, n of PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.

[0157] Thus, in some embodiments, the PPG is a branched PPG. Branched PPG has 3-10 PPG chains extending from a central core group. In certain embodiments, the PPG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPPG) is a PPG having a single, defined chain length and molecular weight. mdPEG is typically produced by separation from a polymerization mixture by chromatography. In certain formulas, the monodisperse PPG moiety is assigned the abbreviation mdPPG.

[0158] In some embodiments, the PPG is a Star PPG. Star PPG has 10 to 100 PPG chains extending from a central core group. In some embodiments, the PPG is a Comb PPG. Comb PPG typically has multiple PPG chains grafted onto the polymer backbone.

[0159] In certain embodiments, the PPG has a molar mass of about 1000 g / mol to about 2000 g / mol, about 2000 g / mol to about 3000 g / mol, about 3000 g / mol to about 4000 g / mol, about 4000 g / mol to about 5000 g / mol, about 5000 g / mol to about 6000 g / mol, about 6000 g / mol to about 7000 g / mol, or 7000 g / mol to about 8000 g / mol.

[0160] In some embodiments, the PPG is 100 , P.P.G.200 、PPG 300 、PPG 400 、PPG 500 、PPG 600 、PPG 700 、PPG 800 、PPG 900 、PPG 1000 、PPG 1100 、PPG 1200 、PPG 1300 、PPG 1400 、PPG 1500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 1600 、PPG 1700 、PPG 1800 、PPG 1900 、PPG 2000 、PPG 2100 、PPG 2200 、PPG 2300 、PPG 2400 、PPG 2500 、PPG 2600 、PPG 2700 、PPG 2800 、PPG 2900 、PPG 3000 、PPG 3100 、PPG 3200 、PPG 3300 、PPG 3400 、PPG 3500 、PPG 3600 、PPG 3700 、PPG 3800 、PPG 3900 、PPG 4000 、PPG 4100 、PPG 4200 、PPG 4300 、PPG 4400 、PPG 4500 、PPG 4600 、PPG 4700 、PPG 4800 、PPG 4900 、PPG 5000 、PPG5100 , P.P.G. 5200 , P.P.G. 5300 , P.P.G. 5400 , P.P.G. 5500 , P.P.G. 5600 , P.P.G. 5700 , P.P.G. 5800 , P.P.G. 5900 , P.P.G. 6000 , P.P.G. 6100 , P.P.G. 6200 , P.P.G. 6300 , P.P.G. 6400 , P.P.G. 6500 , P.P.G. 6600 , P.P.G. 6700 , P.P.G. 6800 , P.P.G. 6900 , P.P.G. 7000 , P.P.G. 7100 , P.P.G. 7200 , P.P.G. 7300 , P.P.G. 7400 , P.P.G. 7500 , P.P.G. 7600 , P.P.G. 7700 , P.P.G. 7800 , P.P.G. 7900 , or PPG 8000 In some embodiments, the PPG is 5000 In some embodiments, the PPG is 6000 In some embodiments, the PPG is 4000 It is.

[0161] In some embodiments, the PPG is monodisperse, e.g., mPPG. 100 , mPPG 200 , mPPG 300 , mPPG 400 , mPPG 500 , mPPG 600 , mPPG 700 , mPPG 800 , mPPG 900 , mPPG 1000 , mPPG 1100 , mPPG 1200 , mPPG 1300 , mPPG 1400 , mPPG 1500 , mPPG 1600 , mPPG 1700 , mPPG 1800、mPPG 1900 、mPPG 2000 、mPPG 2100 、mPPG 2200 、mPPG 2300 、mPPG 2400 、mPPG 2500 、mPPG 1600 、mPPG 1700 、mPPG 1800 、mPPG 1900 、mPPG 2000 、mPPG 2100 、mPPG 2200 、mPPG 2300 、mPPG 2400 、mPPG 2500 、mPPG 2600 、mPPG 2700 、mPPG 2800 、mPPG 2900 、mPPG 3000 、mPPG 3100 、mPPG 3200 、mPPG 3300 、mPPG 3400 、mPPG 3500 、mPPG 3600 、mPPG 3700 、mPPG 3800 、mPPG 3900 、mPPG 4000 、mPPG 4100 、mPPG 4200 、mPPG 4300 、mPPG 4400 、mPPG 4500 、mPPG 4600 、mPPG 4700 、mPPG 4800 、mPPG 4900 、mPPG 5000 、mPPG 5100 、mPPG 5200 、mPPG 5300 、mPPG 5400 、mPPG 5500 、mPPG 5600 、mPPG 5700 、mPPG 5800 、mPPG 5900 、mPPG 6000 、mPPG 6100 、mPPG 6200 、mPPG 6300 、mPPG6400 , mPPG 6500 , mPPG 6600 , mPPG 6700 , mPPG 6800 , mPPG 6900 , mPPG 7000 , mPPG 7100 , mPPG 7200 , mPPG 7300 , mPPG 7400 , mPPG 7500 , mPPG 7600 , mPPG 7700 , mPPG 7800 , mPPG 7900 , or mPPG 8000 In some embodiments, the mPPG is 5000 In some embodiments, the mPPG is 6000 In some embodiments, the mPPG is 4000 It is.

[0162] b. Cationic carrier In some embodiments, the cationic carrier unit of the present disclosure comprises at least one cationic carrier moiety. The term "cationic carrier" refers to a portion or part of the cationic carrier unit of the present disclosure that comprises a plurality of positive charges that can electrostatically interact and bind with an anionic payload (or an anionic carrier bound to a payload). In some embodiments, the number of positive charges or positively charged groups of the cationic carrier is comparable to the number of negative charges or negatively charged groups of the anionic payload (or an anionic carrier bound to a payload). In some embodiments, the cationic carrier comprises a biopolymer, such as a peptide (e.g., polylysine).

[0163] In some embodiments, the cationic carrier comprises one or more basic amino acids (e.g., lysine, arginine, histidine, or a combination thereof). In some embodiments, the cationic carrier comprises at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about 55, at least about 56, at least about 57, at least about 58, at least about 59, at least about 60, at least about 61, at least about 62, at least about 63, at least about 64, at least about 65, at least about 66, at least about 67, at least about 68, at least about 69, at least about 70, at least about 71, at least about 72, at least about 73, at least about 74, at least about 75, at least about 76, at least about 77, at least about 78, at least about 79, at least about 80 basic amino acids, e.g., lysine, arginine, or a combination thereof.

[0164] In some embodiments, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysine. In some embodiments, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysine.

[0165] In some embodiments, the cationic carrier unit comprises about 30 to about 1000, about 30 to about 900, about 30 to about 800, about 30 to about 700, about 30 to about 600, about 30 to about 500, about 30 to about 400, about 30 to about 300, about 30 to about 200, about 30 to about 100, about 40 to about 1000, about 40 to about 900, about 40 to about 800, about 40 to about 700, about 40 to about 600, about 40 to about 500, about 40 to about 400, about 40 to about 300, about 40 to about 200, or about 40 to about 100 basic amino acids, e.g., lysine.

[0166] In some embodiments, the cationic carrier unit comprises about 30 to about 100, about 30 to about 90, about 30 to about 80, about 30 to about 70, about 30 to about 60, about 30 to about 50, about 30 to about 40, about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 70 to about 80, about 75 to about 85, about 65 to about 75, about 65 to about 80, about 60 to about 85, or about 40 to about 500 basic amino acids, e.g., lysine.

[0167] In some embodiments, the cationic carrier unit is about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500 About 500, about 300 to about 400, about 400 to about 1000, about 400 to about 900, about 400 to about 800, about 400 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 900, about 500 to about 800, about 500 to about 700, about 500 to about 600, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 700 to about 1000, about 700 to about 900, about 700 to about 800, about 800 to about 1000, about 800 to about 900, or about 900 to about 1000 basic amino acids, for example, lysine.

[0168] In some embodiments, the number of basic amino acids, such as lysine, arginine, histidine, or combinations thereof, can be adjusted based on the length of the anionic payload. For example, an anionic payload with a longer sequence can be combined with a higher number of basic amino acids (e.g., lysine). In some embodiments, the number of basic amino acids, such as lysine, in the cationic carrier unit can be calculated so that the molar ratio (N / P) of protonated amines in the polymer to phosphates in the anionic payload, such as an oligonucleotide, such as antimiR, is about 1.0, about 1.1, about 1.2, about 1.3, about 1.4, about 1.5, about 1.6, about 1.7, about 1.8, about 1.9, about 2.0, about 2.1, about 2.2, about 2.3, about 2.4, about 2.5, about 2.6, about 2.7, about 2.8, about 2.9, or about 3. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P) of the protonated amines in the polymer to the phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimiR, is about 1.3 to about 1.7, e.g., about 1.5. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P) of the protonated amines in the polymer to the phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimiR, is about 1.4. In some embodiments, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio (N / P) of the protonated amines in the polymer to the phosphates in the anionic payload, e.g., oligonucleotide, e.g., antimiR, is about 1.6. In some embodiments, the number of basic amino acids, e.g., lysines, in a cationic carrier unit is calculated so that the molar ratio (N / P) of protonated amines in the polymer to phosphates in an anionic payload, e.g., an oligonucleotide, e.g., an antimiR, is about 1.3.In some embodiments, the number of basic amino acids, e.g., lysines, in a cationic carrier unit is calculated so that the molar ratio (N / P) of protonated amines in the polymer to phosphates in an anionic payload, e.g., an oligonucleotide, e.g., an antimiR, is about 1.7.

[0169] One of skill in the art will understand that since the role of the cationic carrier moiety is to neutralize the negative charges of the payload (e.g., the negative charges in the phosphate backbone of an antisense oligonucleotide) through electrostatic interactions, in some embodiments (e.g., when the payload is a nucleic acid such as an antimiR), the length of the cationic carrier, the number of positively charged groups on the cationic carrier, and the distribution and arrangement of the charges present on the cationic carrier will depend on the length and charge distribution of the payload molecule.

[0170] In other aspects, for example, when the payload is a plurality of small molecules (e.g., anionic small molecule drugs), the length of the cationic carrier and the number of positively charged groups of the cationic carrier correlate with the desired payload. For example, the number of small molecule drugs transported by the cationic carrier unit of the present disclosure will depend on the number of charges on the cationic carrier moiety.

[0171] In some embodiments, the cationic carrier comprises about 5 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about to about 70, about 70 to about 75, or about 75 to about 80 basic amino acids. In some specific embodiments, the positively charged carrier comprises about 30 to about 50 basic amino acids. In some specific embodiments, the positively charged carrier comprises about 70 to about 80 basic amino acids.

[0172] In some embodiments, the basic amino acids include arginine, lysine, histidine, or any combination thereof. In some embodiments, the basic amino acids are D-amino acids. In some embodiments, the basic amino acids are L-amino acids. In some embodiments, the positively charged carrier comprises D-amino acids and L-amino acids. In some embodiments, the basic amino acids include at least one unnatural amino acid or a derivative thereof. In some embodiments, the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4-aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4-guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolidine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof. In certain embodiments, the positively charged carrier comprises about 40 lysines. In certain embodiments, the positively charged carrier comprises about 50 lysines. In certain embodiments, the positively charged carrier comprises about 60 lysines. In certain embodiments, the positively charged carrier comprises about 70 lysines. In certain embodiments, the positively charged carrier comprises about 80 lysines.

[0173] In other embodiments, the cationic carrier is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least an alkyl chain comprising at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 67, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups), e.g., C3-C 50 In some embodiments, the cationic carrier comprises an alkyl chain, such as a C3 to C6 alkyl chain, containing about 5 to about 10, about 10 to about 15, about 15 to about 20, about 20 to about 25, about 25 to about 30, about 30 to about 35, about 35 to about 40, about 40 to about 45, about 45 to about 50, about 50 to about 55, about 55 to about 60, about 60 to about 65, about 65 to about 70, about 70 to about 75, or about 75 to about 80 cationic groups (e.g., amino groups), 50 In some particular embodiments, the cationic carrier comprises an alkyl chain containing 30 to about 50 cationic groups (e.g., amino groups), e.g., C3 to C 50In some particular embodiments, the cationic carrier comprises an alkyl chain containing 70 to about 80 cationic groups (e.g., amino groups), e.g., C3 to C 50 Includes.

[0174] In other embodiments, the cationic carrier is at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups). In some embodiments, the cationic carrier comprises a polymer or copolymer comprising from about 5 to about 10 cationic groups, from about 10 to about 15 cationic groups, from about 15 to about 20 cationic groups, from about 20 to about 25 cationic groups, from about 25 to about 30 cationic groups, from about 30 to about 35 cationic groups, from about 35 to about 40 cationic groups, from about 40 to about 45 cationic groups, from about 45 to about 50 cationic groups, from about 50 to about 55 cationic groups, from about 55 to about 60 cationic groups, from about 60 to about 65 cationic groups, from about 65 to about 70 cationic groups, from about 70 to about 75 cationic groups, or from about 45 to about 50 cationic groups (e.g., amino groups).In some specific embodiments, the cationic carrier comprises a polymer or copolymer containing 30 to about 50 cationic groups (e.g., amino groups). In some specific embodiments, the cationic carrier comprises a polymer or copolymer containing 70 to about 80 cationic groups (e.g., amino groups). In some embodiments, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide.

[0175] In some embodiments, a cationic carrier moiety is attached to a single payload molecule, while in other embodiments, a cationic carrier moiety may be attached to multiple payload molecules, which may be the same or different.

[0176] In some embodiments, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are about 3:1, about 2.9:1, about 2.8:1, about 2.7:1, about 2.6:1, about 2.5:1, about 2.4:1, about 2.3:1, about 2.2:1, about 2:1, about 2:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.6:1, about 1.5:1, about 1.4:1, about 1.3:1, about 1.5:1, about 1.6:1, about 1.7:1, about 1.8:1, about 1.9:1, about 1.8:1, about 1.7:1, about 1.8 ... The ionic ratio is about 2:1, about 1.1:1, about 1:1, about 1:1.1, about 1:1.2, about 1:1.3, about 1:1.4, about 1:1.5, about 1:1.6, about 1:1.7, about 1:1.8, about 1:1.9, about 1:2, about 1:2.1, about 1:2.2, about 1:2.3, about 1:2.4, about 1:2.5, about 1:2.6, about 1:2.7, about 1:2.8, about 1:2.9, or about 1:3. In some embodiments, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are in a charge ratio of 1:1. In some embodiments, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are in a charge ratio of 3:2. In some embodiments, the positive charges of the cationic carrier moiety and the negative charges of the nucleic acid payload are in a charge ratio of 2:3.

[0177] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] wherein A is tryptophan or phenylalanine and B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X is [ka] and Y1 is C, N, O, or S, Y2 is C, N, O, or S, and n is 1 or 2. In some embodiments, X can be -SH (e.g., sulfanyl group, alkanethiol, or alkylthiol). In some embodiments, the micelles of the present disclosure include one type of cationic carrier unit conjugated to a vitamin, e.g., vitamin B3, and another type of cationic carrier unit conjugated to a sulfanyl group (e.g., alkanethiol or alkylthiol). In some embodiments, the micelles of the present disclosure include a first type of cationic carrier unit conjugated to a vitamin, e.g., vitamin B3, a second type of cationic carrier unit conjugated to a sulfanyl group (e.g., alkanethiol or alkylthiol), and a third type of cationic carrier unit that is a free base.

[0178] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] wherein A is tryptophan or phenylalanine and B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) k is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X1 is, [ka] wherein Y1 is C, N, O, or S, Y2 is C, N, O, or S, n is 1 or 2, and X2 is [ka] and p=0 to 5. In some embodiments, p is 0. In some embodiments, X2 is SH.

[0179] In some embodiments, the cationic carrier moiety has a free end, where the terminal group is a reactive group. In some embodiments, the cationic carrier moiety has a free end (e.g., the C-terminus in a polylysine cationic carrier moiety), where the terminal group is an amino (-NH2) group. In some embodiments, the cationic carrier moiety has a free end, where the terminal group is a sulfhydryl group. In some embodiments, the reactive group of the cationic carrier moiety is attached to an adjuvant moiety, e.g., a vitamin B3 adjuvant moiety.

[0180] C. Adjuvant portion In some embodiments, the cationic carrier unit of the present disclosure comprises at least one adjuvant moiety. As used herein, the term "adjuvant moiety" refers to a molecular entity that can, for example, (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and / or prophylactic agent in a target tissue or cell, (iv) facilitate the transport of the cationic carrier unit through a physiological barrier, such as the BBB and / or the plasma membrane, (v) improve the homeostasis of a target tissue or cell, (vi) provide a positively charged group to the cationic carrier moiety, or (vii) any combination thereof.

[0181] In some embodiments, the adjuvant moiety can modulate, for example, the immune response, the inflammatory response, or the tissue microenvironment.

[0182] In some embodiments, the adjuvant moiety capable of modulating immune response may include, for example, tyrosine or dopamine. Tyrosine may be converted to L-dopa, which is then converted to dopamine by a two-step enzymatic reaction. Normally, dopamine levels are low in Parkinson's disease patients. Thus, in some embodiments, tyrosine is the adjuvant moiety in the cationic carrier unit used to treat Parkinson's disease. Tryptophan may be converted to serotonin, a neurotransmitter believed to play a role in appetite, emotion, and motor, cognitive, and autonomic functions. Thus, in some embodiments, the cationic carrier unit of the present disclosure used to treat diseases or conditions associated with low serotonin levels includes tryptophan as an adjuvant moiety.

[0183] In some aspects, the adjuvant moiety may modulate the tumor microenvironment in a tumor-bearing subject, for example, by inhibiting or reducing hypoxia in the tumor microenvironment.

[0184] In some embodiments, the adjuvant moiety includes, for example, an imidazole derivative, an amino acid, a vitamin, or any combination thereof.

[0185] In some embodiments, the adjuvant moiety is an imidazole derivative comprising the formula: [ka] wherein each of G1 and G2 is independently H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring and n is 1-10.

[0186] In some embodiments, the adjuvant moiety comprises nitroimidazole. Nitroimidazole functions as an antibiotic. The nitroheterocycle in nitroimidazole can be reductively activated in hypoxic cells, and then can undergo redox recycling or decompose into cytotoxic products. Reduction usually only occurs in anaerobic bacteria or anoxic tissues, so their effect on human cells or aerobic bacteria is relatively small. In some embodiments, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazole, azanidazole, benznidazole, nitroimidazole, or any combination thereof.

[0187] In some embodiments, the adjuvant moiety comprises an amino acid. In some embodiments, the adjuvant moiety comprises the formula: [ka] In the formula, Ar is [ka] and Each of Z1 and Z2 is H or OH.

[0188] In some aspects, the adjuvant moiety is capable of inhibiting or reducing an inflammatory response.

[0189] In some embodiments, the adjuvant moiety is a vitamin. In some embodiments, the vitamin comprises a cyclic ring or a cyclic heteroatom ring and a carboxyl or hydroxyl group. In some embodiments, the vitamin comprises the formula: [ka] wherein each of Y1 and Y2 is C, N, O, or S, and n is 1 or 2.

[0190] In some embodiments, the vitamin is selected from the group consisting of vitamin A (retinol), vitamin B1 (thiamine chloride), vitamin B2 (riboflavin), vitamin B3 (niacinamide), vitamin B6 (pyridoxal), vitamin B7 (biotin), vitamin B9 (folic acid), vitamin B12 (cobalamin), vitamin C (ascorbic acid), vitamin D2, vitamin D3, vitamin E (tocopherol), vitamin M, vitamin H, derivatives thereof, and any combination thereof.

[0191] In some embodiments, the vitamin is the following vitamin B3 (also known as niacin or nicotinic acid). [ka]

[0192] In some embodiments, the adjuvant portion comprises at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, or at least about 30 vitamin B3. In some embodiments, the adjuvant portion comprises about 10 vitamin B3. In some embodiments, the adjuvant portion comprises about 7 vitamin B3. In some embodiments, the adjuvant portion comprises about 8 vitamin B3. In some embodiments, the adjuvant portion comprises about 9 vitamin B3. In some embodiments, the adjuvant portion comprises about 10 vitamin B3. In some embodiments, the adjuvant portion comprises about 11 vitamin B3. In some embodiments, the adjuvant portion comprises about 12 vitamin B3. In some embodiments, the adjuvant portion comprises about 13 vitamin B3. In some embodiments, the adjuvant portion comprises about 14 vitamin B3. In some embodiments, the adjuvant portion comprises about 15 vitamin B3. In some embodiments, the adjuvant portion comprises about 20 vitamin B3. In some embodiments, the adjuvant portion comprises about 25 vitamin B3. In some embodiments, the adjuvant portion comprises about 30 vitamin B3.

[0193] In some embodiments, the adjuvant portion comprises about 5 to about 10 vitamin B3, about 10 to about 15 vitamin B3, about 15 to about 20 vitamin B3, about 20 to about 25 vitamin B3, about 25 to about 30 vitamin B3, about 30 to about 35 vitamin B3, about 35 to about 40 vitamin B3, about 40 to about 45 vitamin B3, or about 45 to about 50 vitamin B3. In some embodiments, the adjuvant portion comprises about 10 to about 20 vitamin B3, about 20 to about 30 vitamin B3, about 30 to about 40 vitamin B3, about 40 to about 50 vitamin B3, about 5 to about 15 vitamin B3, about 15 to about 25 vitamin B3, about 25 to about 35 vitamin B3, about 35 to about 45 vitamin B3, or about 45 to about 55 vitamin B3.

[0194] Niacin is the precursor of the coenzymes nicotinamide adenine dinucleotide (NAD) and nicotinamide adenine dinucleotide phosphate (NADP) in vivo. NAD is converted to NADP by phosphorylation in the presence of the enzyme NAD+ kinase. NADP and NAD are coenzymes for many dehydrogenases involved in many hydrogen transfer processes. NAD is important in the catabolism of fats, carbohydrates, proteins, and alcohol, as well as cell signaling and DNA repair, while NADP is primarily important in anabolic reactions, e.g., fatty acid and cholesterol synthesis. Organs with high energy requirements (brain) or high metabolic turnover rates (gut, skin) are usually the most sensitive to their deficiency.

[0195] Niacin exerts a significant anti-inflammatory effect by activating NIACR1 in various tissues, including the brain, gastrointestinal tract, skin, and vascular tissue. Niacin has been shown to attenuate neuroinflammation and may have efficacy in treating neuroimmune disorders such as multiple sclerosis and Parkinson's disease. See Offermanns&Schwaninger(2015)Trends in Molecular Medicine 21:245-266;Chai et al(2013)Current Atherosclerosis Reports 15:325;Graff et al.(2016)Metabolism 65:102-13;and Wakade&Chong(2014)Journal of the Neurological Sciences 347:34-8, which are incorporated herein by reference in their entirety.

[0196] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] Wherein X is vitamin B3; A is a targeting moiety, B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200.

[0197] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] Wherein X is vitamin B3; A is a targeting moiety, B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) k is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X1 is, [ka] wherein Y1 is C, N, O, or S, Y2 is C, N, O, or S, n is 1 or 2, and X2 is [ka] and p=0 to 5. In some embodiments, p is 0. In some embodiments, X2 is SH.

[0198] d. Targeting moiety In some embodiments, the cationic carrier unit comprises a targeting moiety, which is optionally linked to the water-soluble polymer by a linker. As used herein, the term "targeting moiety" refers to a biorecognition molecule that binds to a specific biological substance or site. In some embodiments, the targeting moiety is specific for a certain target molecule (e.g., a ligand that targets a receptor or an antibody that targets a surface protein), tissue specific (e.g., a molecule that preferentially transports micelles to a specific organ or tissue, such as the liver, brain, or endothelium), or facilitates transport through physiological barriers (e.g., a peptide or other molecule that can facilitate transport through the blood-brain barrier or plasma membrane).

[0199] To target a payload (e.g., a nucleotide molecule, e.g., an antisense oligonucleotide that binds to a microRNA) in accordance with the present disclosure, the targeting moiety can be linked to a cationic carrier unit and thereby to the outer surface of the micelle, while the micelle has the payload encapsulated within its core.

[0200] In some embodiments, the targeting moiety is a targeting moiety that can target the micelle of the present disclosure to tissue.In some embodiments, the tissue is liver, brain, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.In some embodiments, the tissue is cancer tissue, such as liver cancer, brain cancer, kidney cancer, lung cancer, ovarian cancer, pancreatic cancer, thyroid cancer, breast cancer, stomach cancer, or any combination thereof.

[0201] In certain embodiments, the tissue is the liver. In certain embodiments, the targeting moiety that targets the liver is cholesterol. In other embodiments, the targeting moiety that targets the liver is a ligand that binds to the asialoglycoprotein receptor targeting moiety. In some embodiments, the asialoglycoprotein receptor targeting moiety comprises a GalNAc cluster. In some embodiments, the GalNAc cluster is a monovalent, bivalent, trivalent, or tetravalent GalNAc cluster.

[0202] In another embodiment, the tissue is pancreas.In some embodiments, the targeting moiety that targets pancreas comprises a ligand that targets αvβ3 integrin receptor on pancreatic cells.In some embodiments, the targeting moiety comprises an arginylglycyl aspartic acid (RGD) peptide sequence (L-arginyl-glycyl-L-aspartic acid, Arg-Gly-Asp).

[0203] In some embodiments, the tissue is a tissue of the central nervous system, for example, a nervous tissue. In some embodiments, the targeting moiety that targets the central nervous system can be transported by large neutral amino acid transporter 1 (LAT1). LAT1 (SLC7A5) is a transporter for the uptake of both large neutral amino acids and some pharmaceuticals. LAT1 can transport drugs such as L-dopa or gabapentin.

[0204] In some embodiments, the targeting moiety comprises glucose, e.g., D-glucose, which can bind to glucose transporter 1 (or GLUT1) and cross the BBB. GLUT1, also known as solute transporter family 2 facilitative glucose transporter member 1 (SLC2A1), is a uniporter protein that is encoded by the SLC2A1 gene in humans. GLUT1 facilitates the transport of glucose through the plasma membrane of mammalian cells. This gene encodes the main glucose transporter in the mammalian blood-brain barrier.

[0205] In some embodiments, the targeting moiety comprises galactose (e.g., D-galactose) that can bind to the GLUT1 transporter and cross the BBB. In some embodiments, the targeting moiety comprises glutamate that can bind to an acetylcholinesterase inhibitor (AChEI) and / or an EAAT inhibitor and cross the BBB. Acetylcholinesterase is an enzyme that is a major member of the cholinesterase enzyme family. Acetylcholinesterase inhibitors (AChEIs) are inhibitors that inhibit acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia, and neuromuscular junctions, where acetylcholine receptors are abundant. Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors, the other being butyrylcholinesterase inhibitors.

[0206] In some embodiments, the targeting moiety is GABA, which can bind to GABA receptors and cross the BBB.GABA receptors are a class of receptors that respond to the neurotransmitter gamma-aminobutyric acid (GABA), the main inhibitory compound in the central nervous system of mature vertebrates.There are two classes of GABA receptors: GABAA and GABAB.GABA receptors are ligand-gated ion channels (also known as ionotropic receptors), while GABAB receptors are G protein-coupled receptors, also known as metabotropic receptors.

[0207] In some embodiments, the targeting moiety comprises a tyrosine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a lysine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a glutamine that can bind to LAT1 and cross the BBB. In some embodiments, the targeting moiety comprises a phenylalanine that can bind to GABA receptors, LAT1, CNS reverse transcriptase inhibitors, and / or dopamine (DA) receptors and cross the BBB. Dopamine receptors are a class of G protein-coupled receptors that are prominent in the vertebrate central nervous system (CNS). Dopamine receptors activate different effectors not only by G protein coupling but also by signal transduction through different protein (dopamine receptor-interacting protein) interactions. The neurotransmitter dopamine is the major endogenous ligand of dopamine receptors.

[0208] Dopamine receptors are believed to be involved in many neurological processes, including motivation, pleasure, cognition, memory, learning, and fine motor control, as well as regulating neuroendocrine signaling.Abnormal dopamine receptor signaling and dopaminergic neuronal function have been implicated in several neuropsychiatric disorders.Therefore, dopamine receptors are a common target of neurological drugs, and antipsychotic drugs are often dopamine receptor antagonists, while psychostimulants are usually indirect agonists of dopamine receptors.

[0209] In some embodiments, the targeting moiety comprises a valine capable of binding to a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a tryptophan capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a leucine capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a methionine capable of binding to a GABA receptor and / or a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a histidine capable of binding to a GABA receptor and crossing the BBB. In some embodiments, the targeting moiety comprises an isoleucine capable of binding to a CNS reverse transcriptase inhibitor and crossing the BBB. In some embodiments, the targeting moiety comprises a glutathione capable of binding to a GSH transporter and crossing the BBB. In some embodiments, the targeting moiety comprises a glutathione-Met capable of binding to a GSH transporter and crossing the BBB. In some embodiments, the targeting moiety comprises urea / thiourea, which can bind to nitric oxide synthase (NOS) and can bind to the BBB. In some embodiments, the targeting moiety comprises NAD+ / NADH, which can cross the BBB by redox mechanism. In some embodiments, the targeting moiety comprises purine and can cross the BBB. Additional examples of targeting moieties for CNS targeting are provided in Sutera et al. (2016): Small endogenous molecules as moiety to improve targeting of CNS drugs, Expert Opinion on Drug Delivery, DOI:10.1080 / 17425247.2016.1208651, which is incorporated herein by reference in its entirety.

[0210] In some embodiments, the tissue targeted by the targeting moiety is skeletal muscle. In some embodiments, the targeting moiety that targets skeletal muscle can be transported by large neutral amino acid transporter 1 (LAT1).

[0211] LAT1 is expressed in many cell types, including T cells, cancer cells, and brain endothelial cells. LAT1 is consistently expressed at high levels in brain microvascular endothelial cells. Targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB, since solute transporters are primarily present in the BBB. In some embodiments, the targeting moiety that targets the micelles of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched or aromatic amino acid. In some embodiments, the amino acid is valine, leucine, and / or isoleucine. In some embodiments, the amino acid is tryptophan and / or tyrosine. In some embodiments, the amino acid is tryptophan. In other embodiments, the amino acid is tyrosine.

[0212] In some embodiments, the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-dopa, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.

[0213] In some embodiments, the LAT1 ligand is selected from the group consisting of: [1] l-phenylalanine, [2] o-sarcolysine, [3] m-sarcolysine, [4] melphalan, [5] 2-amino-2-norbornane carboxylic acid (BCH), [6] (±)-2-amino-1,2,3,4-tetrahydro-2-naphthoic acid, [7] dl-2-NAM-5, [8] dl-2-NAM-6, [9] dl-2-NAM-7, and

[10] dl-2-NAM-8,

[11] dl-Dechlorinated NAM,

[12] dl-1-NAM-7,

[13] (±)-2-aminoindan-2-carboxylic acid,

[14] (±)-2-aminobenzo-bicyclo-[2.2.1]heptane-2'-exo-carboxylic acid,

[15] (±)-2-amino-(bis-2-chloroethyl)-5-aminoindan-2-carboxylic acid,

[16] (±)-2-endo-amino-bis(2-chloroethyl)-7'-aminobenzobicyclo[2.2.1]heptane-2'-exo-carboxylic acid butane-2-exo-carboxylic acid,

[17] l-6-diazo-5-oxo-norleucine (l-DON),

[18] acivicin,

[19] azaserine,

[20] buthionine sulfoximine (BSO),

[21] l-1-naphthylalanine,

[22] o-benzyl-l-tyrosine,

[23] l-2-amino-nonanoic acid,

[24] l-tyrosine,

[25] α-methyltyrosine,

[26] l-DOPA,

[27] α-methyldopa,

[28] 3-o-methyl dopa,

[29] droxidopa,

[30] carbidopa,

[31] dopamine,

[32] tyramine,

[33] α-methylphenylalanine,

[34] N-methylphenylalanine,

[35] phenylalanine methyl ester,

[36] gabapentin,

[37] 3,3'-diiodothyronine,

[38] l-T3,

[39] 3',5',3-triiodothyronine (reverse l-T3), or

[40] l-T4, or any combination thereof. [ka] [ka] Or any combination thereof.

[0214] In some embodiments, the LAT1 ligand is a LAT1-targeted prodrug as shown below. [ka] Or any combination thereof.

[0215] See Singh & Ecker (2018) “Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1,” Int. J. Mol. Sci. 19:1278; Geier et al. (2013) “Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1,” Proc. Natl. Acad. Sci. USA 110:5480-85; and Chien et al. (2018) “Reevaluating the Substrate Specificity of the L-type Amino Acid Transporter (LAT1),” J. Med. Chem. 61:7358-73, which are incorporated by reference in their entireties.

[0216] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] wherein A is tryptophan or phenylalanine and B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X is [ka] where n is 1 or 2, Y1 is C, N, O, or S, Y2 is C, N, O, or S, and n is 1 or 2, e.g., vitamin B3.

[0217] In some aspects, a carrier unit of the present disclosure comprises the formula: [ka] wherein A is tryptophan or phenylalanine and B is a cationic carrier moiety, e.g., lysine; During the ceremony, (i) l is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; (ii) m is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iii) k is an integer of 1 to 150, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, or about 140 to about 150; (iv) n is an integer of about 1 to about 200, for example, about 2 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 160 to about 170, about 170 to about 180, about 180 to about 190, or about 190 to about 200; X1 is, [ka] wherein Y1 is C, N, O, or S, Y2 is C, N, O, or S, n is 1 or 2, and X2 is [ka] and p=0 to 5. In some embodiments, p is 0. In some embodiments, X2 is SH.

[0218] Non-limiting examples of targeting moieties are described below.

[0219] i. Ligand A ligand serves as a type of targeting moiety, defined as a substance capable of selectively binding with selective (or specific) affinity to another substance. A ligand is usually, but not necessarily, recognized and bound by a larger specific binding entity or "binding partner" or "receptor". Examples of ligands suitable for targeting are, among others, antigens, haptens, biotin, biotin derivatives, lectins, galactosamine and fucosylamine moieties, receptors, substrates, coenzymes, and cofactors.

[0220] As applied to the micelles of the present disclosure, the ligands include antigens or haptens that can be bound by or to their corresponding antibodies or fragments thereof. Viral antigens or hemagglutinins and neuraminidases and nucleocapsids, including those from any DNA and RNA virus, AIDS, HIV, and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses, and viroids; Gram-negative and Gram-positive bacteria, Acinetobacter spp., Achromobacter spp., Bacteroides spp., C. cerevisiae ... Also included are any bacterial antigens, including those of the genera Lostridium, Chlamydia, Enterobacteriaceae, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptoccocus; any fungal antigens, including those of the genera Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeast; any mycoplasma antigen; any rickettsia antigen; any protozoan antigen; any parasitic antigen; any human antigen, including those of blood cells, virus-infected cells, genetic markers, heart disease, oncoproteins, plasma proteins, complement factors, and rheumatoid factors. Also included are cancer and tumor antigens, such as alpha-fetoprotein, prostate-specific antigen (PSA) and CEA, cancer markers, and oncoproteins, among others.

[0221] Other substances that can serve as ligands for targeting the micelles of the present disclosure include certain vitamins (i.e., folic acid, B 12 ), steroids, prostaglandins, carbohydrates, lipids, antibiotics, drugs, digoxin, insecticides, narcotics, neurotransmitters, and substances that are used or modified to function as ligands.

[0222] In some embodiments, the targeting moiety includes proteins or protein fragments (e.g., hormones, toxins) and synthetic or natural polypeptides that have cell affinity. Ligands also include various substances that have selective affinity for ligators, which are produced by recombinant DNA, genetic engineering, and molecular engineering. Except as otherwise indicated, the ligands of the present disclosure also include those defined in U.S. Patent No. 3,817,837, which is incorporated herein by reference in its entirety.

[0223] ii. Ligator Ligators function as a type of targeting moiety, which is defined in this disclosure as a specific binding entity or "partner" or "receptor" that is usually, but not necessarily, larger than the ligand that can bind. For the purposes of this disclosure, a ligator can be a specific substance or material or chemical or "reactant" that can selectively bind with a specific ligand by affinity. Ligators can be proteins such as antibodies, non-protein binding entities, or "specifically reactive entities."

[0224] Ligators, as applied to this disclosure, include antibodies, which are defined to include all classes of antibodies, monoclonal antibodies, chimeric antibodies, Fab fragments, fragments and derivatives thereof. The term "antibody" encompasses immunoglobulins and fragments thereof, whether natural or wholly or partially synthetically produced. The term also encompasses any protein having a binding domain that is homologous to an immunoglobulin binding domain. "Antibody" further includes polypeptides comprising a framework region derived from an immunoglobulin gene or fragments thereof that specifically bind and recognize an antigen. The use of the term antibody includes full length, polyclonal, monoclonal, and recombinant antibodies, fragments thereof, and is further intended to include single chain antibodies, humanized antibodies, murine antibodies, chimeric, mouse / human, mouse / primate, primate / human monoclonal antibodies, anti-idiotypic antibodies, antibody fragments, such as scFv, scFab, (scFab)2, (scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments, diabodies, and antibody related polypeptides. Antibodies include bispecific and multispecific antibodies, so long as they exhibit the desired biological activity or function. In some aspects of the present disclosure, the targeting moiety is an antibody or molecule, including an antigen-binding fragment thereof. In some aspects, the antibody is a nanobody. In some aspects, the antibody is an ADC. The terms "antibody drug conjugate" and "ADC" are used interchangeably and refer to, for example, an antibody covalently linked to a therapeutic agent (sometimes referred to herein as a drug, agent, or active pharmaceutical ingredient) or agent. In some aspects of the disclosure, the targeting moiety is an antibody drug conjugate.

[0225] In certain circumstances, the present disclosure is also applicable to the use of other substances as ligators. For example, other ligators suitable for targeting include naturally occurring receptors, any hemagglutinin and cell membrane and nucleus derivatives that specifically bind to hormones, vitamins, drugs, antibiotics, cancer markers, genetic markers, viruses, and histocompatibility markers. Another class of ligators includes any RNA and DNA binding substances, such as polyethyleneimine (PEI) and polypeptides or proteins, such as histones and protamines.

[0226] Other ligators include enzymes, especially cell surface enzymes such as neuraminidase, plasma proteins, avidin, streptavidin, chiron, cavitand, thyroglobulin, intrinsic factor, globulins, chelating agents, detergents, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.

[0227] Targeting moieties also include any protein, protein fragment, or polypeptide that has an affinity for the surface of any cell, tissue, or microorganism, produced by various substances, such as recombinant DNA, genetic engineering, and molecular engineering. Thus, in some embodiments, the targeting moiety directs the micelles of the present disclosure to a particular tissue (i.e., liver tissue or brain tissue), a particular type of cell (e.g., certain types of cancer cells), or a physiological compartment or barrier (e.g., the BBB).

[0228] e. Linker As mentioned above, the cationic carrier unit disclosed herein may include one or more linkers, for example, as shown in FIG. 3. As used herein, the term "linker" refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence), or a non-peptide linker whose main function is to link two moieties in the cationic carrier unit disclosed herein. In some embodiments, the cationic carrier unit of the present disclosure may include at least one linker linking a tissue-specific targeting moiety (TM) with a water-soluble polymer (WS), at least one linker linking a water-soluble biopolymer (WP) with a cationic carrier (CC) or an adjuvant moiety (AM), at least one linker linking a cationic carrier (CC) with an adjuvant moiety (AM), or any combination thereof. In some embodiments, two or more linkers may be linked in series.

[0229] When multiple linkers are present in the cationic carrier unit disclosed herein, each of the linkers can be the same or different.In general, linkers provide flexibility to cationic carrier unit.Linkers are not usually cleaved, but in certain embodiments, such cleavage may be desirable.Thus, in some embodiments, linkers can include one or more protease cleavable sites, which can be present within the linker sequence or can be adjacent to the linker at either end of the linker sequence.

[0230] In one embodiment, the linker is a peptide linker. In some embodiments, the peptide linker can comprise at least about 2, at least about 3, at least about 4, at least about 5, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 amino acids.

[0231] In some embodiments, the peptide linker can comprise at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 amino acids.

[0232] In other embodiments, the peptide linker can comprise at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1,000 amino acids.

[0233] The peptide linker can contain 1 to about 5 amino acids, 1 to about 10 amino acids, 1 to about 20 amino acids, about 10 to about 50 amino acids, about 50 to about 100 amino acids, about 100 to about 200 amino acids, about 200 to about 300 amino acids, about 300 to about 400 amino acids, about 400 to about 500 amino acids, about 500 to about 600 amino acids, about 600 to about 700 amino acids, about 700 to about 800 amino acids, about 800 to about 900 amino acids, or about 900 to about 1000 amino acids.

[0234] Examples of peptide linkers are well known in the art. In some embodiments, the linker is a glycine / serine linker. In some embodiments, the peptide linker is a glycine / serine linker according to the formula [(Gly)n-Ser]m, where n is any integer between 1 and 100, and m is any integer between 1 and 100. In other embodiments, the glycine / serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 1), where x is an integer between 1 and 4, y is 0 or 1, and z is an integer between 1 and 50. In one embodiment, the peptide linker comprises the sequence Gn, where n can be an integer between 1 and 100. In a particular embodiment, the sequence of the peptide linker is GGGG (SEQ ID NO: 2).

[0235] In some embodiments, the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO:3), where n is an integer from 1 to 100. In other embodiments, the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO:4), where n is an integer from 1 to 100.

[0236] In other embodiments, the peptide linker comprises the sequence (GGGS)n (SEQ ID NO:5). In yet other embodiments, the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO:6). In these examples, n can be an integer from 1 to 100. In other examples, n can be an integer from 1 to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

[0237] Examples of linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO: 7), GGSGGSGGSGGSGGG (SEQ ID NO: 8), GGSGGSGGGGSGGGGS (SEQ ID NO: 9), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 10), or GGGGSGGGGSGGGGGS (SEQ ID NO: 11). In other embodiments, the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 12), where n can be an integer from 1 to 100.

[0238] In one embodiment, the peptide linker is synthetic, i.e., non-natural. In one embodiment, the peptide linker comprises a peptide (or polypeptide) (e.g., a natural or non-natural peptide) that comprises an amino acid sequence that links or genetically fuses a first linear amino acid sequence to a second linear amino acid sequence that is not naturally linked or genetically fused in nature. For example, in one embodiment, the peptide linker may comprise a non-natural polypeptide that is a modified form of a naturally occurring polypeptide (e.g., includes mutations such as additions, substitutions, or deletions). In another embodiment, the peptide linker may comprise a non-natural amino acid. In another embodiment, the peptide linker may comprise a naturally occurring amino acid that occurs in a linear sequence that does not occur in nature. In yet another embodiment, the peptide linker may comprise a naturally occurring polypeptide sequence.

[0239] In some embodiments, the linker comprises a non-peptide linker. In other embodiments, the linker consists of a non-peptide linker. In some embodiments, the non-peptide linker can be, for example, maleimidocaproyl (MC), maleimidopropanoyl (MP), methoxyl polyethylene glycol (MPEG), 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate succinimidyl (SMCC), m-maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), 4-(p-maleimidophenyl)butyrate succinimidyl (SMPB), (4-iodoacetyl)aminobenzoate N-succinimidyl (SIAB), 6-[3-(2-pyridyldithio)-propionamido]hexanoate succinimidyl (LC-SPDP), 4-succinimidyloxycarbonyl-α-methyl-α-(2-pyridyldithio)toluene (SMPT), and the like (see U.S. Pat. No. 7,375,078).

[0240] The linker can be introduced into the polypeptide sequence using techniques known in the art (e.g., chemical conjugation, recombinant technology, or peptide synthesis). The modification can be confirmed by DNA sequence analysis. In some embodiments, the linker can be introduced using recombinant technology. In other embodiments, the linker can be introduced using solid-phase peptide synthesis. In certain embodiments, the cationic carrier unit disclosed herein can simultaneously contain one or more linkers introduced using recombinant technology and one or more linkers introduced using solid-phase peptide synthesis or chemical conjugation methods known in the art. In some embodiments, the linker comprises a cleavage site.

[0241] III. Payload As used herein, the term "payload" refers to a biologically active molecule, such as a therapeutic agent, or a compound that may be interactive with the cationic carrier unit of the present disclosure, either by itself or via an adaptor, and may be included within the core of the micelle of the present disclosure. Payloads contemplated in the present disclosure include, but are not limited to, therapeutic agents, such as prodrugs, anticancer drugs, antineoplastic drugs, antifungal drugs, antibacterial drugs, antiviral drugs, cardiac drugs, neurological drugs, and addictive drugs; alkaloids, antibiotics, bioactive peptides, steroids, steroid hormones, polypeptide hormones, interferons, interleukins, narcotics, nucleic acids including antisense oligonucleotides, insecticides, and prostaglandins. Biologically active molecules also include any toxin, including aflatoxin, ricin, bungarotoxin, irinotecan, ganciclovir, furosemide, indomethacin, chlorpromazine, methotrexate, sevin derivatives and analogs including sebazine, desertrin, and veratridine, among others.

[0242] Bioactive molecules include, but are not limited to, various flavone derivatives and analogs, including dihydroxyflavone (chrysin), trihydroxyflavone (apigenin), pentahydroxyflavone (morin), hexahydroxyflavone (myricetin), flavylium, quercetin, and fisetin; derivatives and analogs, such as penicillin antibiotics (i.e., ampicillin), anthracyclines (i.e., doxorubicin, daunorubicin, mitoxantrone), butoconazole, camptothecin, chalcomycin, chartreucin, chrysomycin (V and M), chloramphenicol, chlorotetracycline, chromocycline, cyclosporine, ellipticine, filipin, fungichromine, griseofulvin, griseoviridin, guamecycline, macrolides (i.e., amphotericin, , chlorotricin), methicillin, nystatin, climtacin, elsamycin, gilvocarcin, rabidomycin, lankacidin class antibiotics (i.e., lankamycin), mitomycin, terramycin, tetracycline, wortmannin; various antibacterial agents including reserpine, spironolactone, sodium sulfacetamide, sulfonamides, thiamphenicol, thiolutin; various purine and pyrimidine derivatives and analogs including 5'-fluorouracil, 5'-fluoro-2'-deoxyuridine, and allopurinol; various photosensitizers including mesochlorin e6 monoethylenediamine (Mce6), phthalocyanines, porphyrins, and their derivatives and analogs, particularly those used for singlet and triplet oxygen generation useful in photodynamic therapy (van Lier, JEIn “Photodynamic Therapy of Neoplastic Disease”; Kessel, D., Ed., CRC Press, Boca Raton, FL, 1990, Vol.1); various steroid compounds, such as cortisone, estradiol, hydrocortisone, testosterone, prednisolone, progesterone, dexamethasone, beclomethasone, and other methasone derivatives, cholesterol, other steroid derivatives and analogs including digitoxin, digoxin, and digoxigenin; various coumarin derivatives and analogs including dihydroxycoumarin (esculetin), dicumarol, chrysarobin, chrysophanic acid, emodin, and secalonic acid; various dopas, derivatives, and analogs including dopa, dopamine, epinephrine, and norepinephrine (noradrenaline); various antibiotics, such as steroid ... Also included are tumor agents or cell proliferation inhibitors, such as cisplatin and taxanes, including paclitaxel and docetaxel; various barbiturates, including phenobarbitone, amobarbital, allobarbital, pentobarbital, and other barbital derivatives; various benzene derivatives, including aminobenzoic acid, bromobenzoic acid, benzocaine, benzodiazepines, benzothiazides, butyl p-aminobenzoate; various polypeptide derivatives; and various carboxylic acid derivatives, such as bromoisovalerylurea, phenylbutyric acid, phenylvaleric acid, or any combination thereof.

[0243] Other biologically active molecules include, but are not limited to, diphenylhydantoin, adiphenine, anethole, aspirin, azapropazone, bencyclane, chloral hydrate, chlorambucil, chlorpromazine, chlorogenin, cinnamic acid, clofibrate, coenzyme A, cyclohexyl anthranilate, diazepam, flufenamic acid, fluocinolone acetonide, flurbiprofen, guaiazulene, ibuprofen, indican, indomethacin, iodine, ketoprofen, mefenamic acid, menadione, metronidazole, nitrazepam, phenytoin, propylparaben, proscillaridin, quinolones, thalidomide, thiamine lauryl sulfate, thiopental, triamcinolone, vitamins A, D3, E, K3, warfarin, or any combination thereof.

[0244] Other bioactive molecules include antivirals, nucleic acids, and other antivirals including those against any DNA and RNA virus, AIDS, HIV and hepatitis viruses, adenoviruses, alphaviruses, arenaviruses, coronaviruses, flaviviruses, herpesviruses, myxoviruses, oncornaviruses, papovaviruses, paramyxoviruses, parvoviruses, picornaviruses, poxviruses, reoviruses, rhabdoviruses, rhinoviruses, togaviruses and viroids; gram-negative and gram-positive bacteria, Acinetobacter spp., Achromobacter spp., Bacteroides spp., Clostridium spp., C. any antibacterial drug, nucleic acid, and other antibacterial substance including against hlamydia, enterobacteria, Haemophilus, Lactobacillus, Neisseria, Staphyloccus, or Streptoccocus; any antifungal drug, nucleic acid, and other antifungal substance including against Aspergillus, Candida, Coccidiodes, mycosis, phycomycetes, and yeast; any drug, nucleic acid, and other substance against mycoplasma and rickettsia; any antiprotozoan drug, nucleic acid, and other substance; any antiparasitic drug, nucleic acid, and other substance; any drug, nucleic acid, and other substance against heart disease, tumors, and virus-infected cells.

[0245] (a) Nucleic acid In some embodiments, the bioactive molecule (payload) is a nucleic acid, such as RNA or DNA. Suitable nucleic acid active agents for delivery using the micelles of the present disclosure include oligonucleotides, such as all types of RNA and all types of DNA, including probes and primers used in polymerase chain reaction (PCR), hybridization, or DNA sequencing. In some embodiments, the nucleic acid includes mRNA, miRNA, miRNA sponge, tough decoy miRNA (TD), antimiR (antagomiR), small RNA, rRNA, siRNA, shRNA, gDNA, cDNA, pDNA, PNA, BNA, antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.

[0246] In some embodiments, the bioactive molecule (payload) comprises small interfering RNA (siRNA), which is a double-stranded RNA that can induce sequence-specific post-transcriptional gene silencing, thereby reducing or even inhibiting gene expression.For example, siRNA can cause specific degradation of homologous RNA molecules, such as mRNA, within the region of sequence homology between both siRNA and target RNA.Non-limiting exemplary siRNAs are disclosed in WO02 / 44321, which is incorporated by reference in its entirety.

[0247] In some embodiments, the bioactive molecule (payload) comprises a short hairpin RNA (shRNA). In some embodiments, the bioactive molecule comprises a miRNA or a miRNA inhibitor (antimiR). In some embodiments, the bioactive molecule (payload) can be 10-30 nucleotides in length, for example, 14-25 nucleotides in length. In some embodiments, the bioactive molecule (payload) has a length of 16-30 nucleotides, 18-25 nucleotides, particularly 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides.

[0248] The sequences of miRNAs are publicly available, for example, through the miRBase registry (Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D154-D158(2008); Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D140-D144(2008); Griffiths-Jones, et al., Nucleic Acids Res., 36(Database Issue):D109-D111(2008)) and other publicly accessible databases.

[0249] In some embodiments, the miRNA inhibitor is an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or modified forms thereof. In some embodiments, the miRNA antagonist is an antimiR. AntimiRs are a particular class of miRNA inhibitors, described, for example, in US2007 / 0213292 by Stoffel et al. AntimiRs are RNA-like oligonucleotides that contain various modifications for RNase protection and pharmacological properties, such as enhanced tissue and cellular uptake. AntimiRs differ from normal RNA in that they have complete 2'-O-methylation of sugars, phosphorothioate backbones, and cholesterol moieties at the 3' end.

[0250] Non-limiting examples of antimiRs and other miRNA inhibitors are described in WO2009 / 020771, WO2008 / 091703, WO2008 / 046911, WO2008 / 074328, WO2007 / 090073, WO2007 / 027775, WO2007 / 027894, WO2007 / 021896, WO2006 / 093526, WO2006 / 112872, WO2007 / 112753, WO2007 / 112754, WO2005 / 023986, or WO2005 / 013901, all of which are incorporated herein by reference.

[0251] In some embodiments, the nucleic acids are phosphodiester antisense oligonucleotides and any oligonucleotide in which the sugar phosphate "backbone" has been derivatized or replaced with a "backbone analog," such as a phosphorothioate, phosphorodithioate, phosphoramidate, alkyl phosphate triester, or methylphosphonate linkage. In some embodiments, the nucleic acid active agents are antisense oligonucleotides and any oligonucleotide or oligodeoxynucleotide with a non-phosphorus backbone analog, such as a sulfamate, 3'-thioformacetal, methylene(methylimino) (MMI), 3'-N-carbamate, or morpholino carbamate.

[0252] In some embodiments, the bioactive molecule (payload) is an antimiR. As used herein, the terms "antimiR", "anti-microRNA", "anti-miRNA" and variations thereof refer to molecules (e.g., synthetically produced molecules) used to neutralize microRNA (miRNA) function in cells for a desired response. miRNAs are sequences (approximately 20-22 bp) complementary to mRNAs involved in RNA cleavage or translational inhibition. By controlling miRNAs that regulate mRNAs in cells, antimiRs (also referred to as anti-miRNA oligonucleotides, AMOs, or antagomiRs) can be used for further regulation as well as for the treatment of certain cellular disorders. This regulation can occur through a steric block mechanism as well as hybridization with miRNAs.

[0253] These interactions between antimiRs and miRNAs in the body can be for the treatment of disorders in which over / under expression occurs or abnormalities in miRNAs lead to problems in coding. Some of the miRNA-related disorders encountered by humans include cancer, muscle diseases, autoimmune disorders, and viruses.

[0254] Various components of antimiRs can be manipulated to affect the binding affinity and potency of antimiRs. The 2'-sugar of antimiRs can be modified to be substituted with fluorine and various methyl groups, nearly all of which increase the binding affinity. However, some of these modified 2'-sugar antimiRs have adverse effects on cell proliferation. Modification of the 5'-3' phosphodiester backbone linkage to a phosphorothioate (PS) backbone linkage is also known to have an effect on target affinity. The use of PS mutations has been shown to decrease the Tm of oligonucleotides, which results in lower target affinity. The final requirement for antimiRs is mismatch specificity and length restriction. Due to miRNAs of the same family sharing a "seed" (shared) sequence and differing only by a few additional nucleotides, one antimiR can potentially target multiple miRNA sequences. One or more examples of antimiR or miRNA sequences are shown in the table below. [Table 1]

[0255] In some embodiments, the payload is a polynucleotide comprising a nucleotide sequence having a length of 5 to 30 nucleotides. In some embodiments, the polynucleotide has a length of 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, the nucleotide sequence has a length of 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26 nucleotides.

[0256] In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that targets hsa-miR-485, e.g., hsa-miR-485-3p. In some embodiments, hsa-miR-485-3p has the sequence GUCAUACACGGCUCUCCUCUCU (SEQ ID NO: 17). In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where U can optionally be T. In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches. In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 18), where the nucleotide sequence has one or two mismatches. In other embodiments, the payload (e.g., antimiR) is a nucleotide sequence that targets the seed sequence of has-miR-485-3p (UCAUACA; SEQ ID NO: 19). In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence comprising UCAUACA (SEQ ID NO: 19), where U can optionally be T (complement of the seed), and the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length.In some aspects, the payload (e.g., antimiR) is a nucleotide sequence comprising UGUAUGA (SEQ ID NO: 20), where U can optionally be T (the complement of the seed), and where the nucleotide sequence comprises 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' end of the complement of the seed sequence and / or 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' end of the complement of the seed sequence.

[0257] In some embodiments, the payload is a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO:23), 5'-GUGUAUGA-3' (SEQ ID NO:24), 5'-CGUGUAUGA-3' (SEQ ID NO:25), 5'-CCGUGUAUGA-3' (SEQ ID NO:26), 5'-GCCGUGUAUGA-3' (SEQ ID NO:27), 5'-AGCCGUGUAUGA-3' (SEQ ID NO:28), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO:29), 5'-GCCGUGUAUGA-3' (SEQ ID NO:30), 5'-GCCGUGUAUGA-3' (SEQ ID NO:31), 5'-GCCGUGUAUGA-3' (SEQ ID NO:32), 5'-GCCGUGUAUGA-3' (SEQ ID NO:33), 5'-GCCGUGUAUGA-3' (SEQ ID NO:34), 5'-GCCGUGUAUGA-3' (SEQ ID NO:35), 5'-GCCGUGUAUGA-3' (SEQ ID NO:36), 5'-GCCGUGUAUGA-3' (SEQ ID NO:37), 5'-GCCGUGUAUGA-3' (SEQ ID NO:38), 5'-GCCGUGUAUGA-3' (SEQ ID NO:39), 5'-GCCGUGUAUGA-3' (SEQ ID NO:40), 5'-GCCGUGUAUGA-3' (SEQ ID NO:41), 5'-GCCGUGUAUGA-3' (SEQ ID NO:42), 5'-GCCGUGUAUGA-3' (SEQ ID NO:43), 5'-GCCGUGUAUGA-3' (SEQ ID NO:44), 5'-GCCGUGUAUGA-3' 29), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 30), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 31), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 32), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 33), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 34), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 35), 5'-GAGAGGAGAGCCGUGUAUG A-3' (SEQ ID NO: 36); 5'-UGUAUGAC-3' (SEQ ID NO: 37), 5'-GUGUAUGAC-3' (SEQ ID NO: 38), 5'-CGUGUAUGAC-3' (SEQ ID NO: 39), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 40), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 41), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 42), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 43), 5'-AGAGCCGUGUAUGAC- 3' (SEQ ID NO: 44), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 45), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 46), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 47), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 48), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 49), or 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 50).

[0258] In some embodiments, the payload is 5'-TGTATGA-3' (SEQ ID NO:51), 5'-GTGTATGA-3' (SEQ ID NO:52), 5'-CGTGTATGA-3' (SEQ ID NO:53), 5'-CCGTGTATGA-3' (SEQ ID NO:54), 5'-GCCGTGTATGA-3' (SEQ ID NO:55), 5'-AGCCGTGTATGA-3' (SEQ ID NO:56), 5'-GAGCCGTGTATGA-3' (SEQ ID NO:57), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO:58), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO:59), 5'-GCCGTGTATGA-3' (SEQ ID NO:510), 5'-GCCGTGTATGA-3' (SEQ ID NO:511), 5'-GCCGTGTATGA-3' (SEQ ID NO:512), 5'-GCCGTGTATGA-3' (SEQ ID NO:513), 5'-GCCGTGTATGA-3' (SEQ ID NO:514), 5'-GCCGTGTATGA-3' (SEQ ID NO:515), 5'-GCCGTGTATGA-3' (SEQ ID NO:516), 5'-GCCGTGTATGA-3' (SEQ ID NO:517), 5'-GCCGTGTATGA-3' (SEQ ID NO:518), 5'-GCCGTGTATGA-3' (SEQ ID NO:519), 5'-GCCGTGTATGA-3' (SEQ ID NO:520), 5'-GCCGTGTATGA-3' (SEQ ID NO:521), 5'-GCCGTGTATGA-3' (SEQ ID NO:522), 5'-GCCGTGTAT '(SEQ ID NO:58), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO:59), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO:60), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO:61), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO:62), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO:63), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO:64); 5'-TGTA TGAC-3' (SEQ ID NO: 65), 5'-GTGTATGAC-3' (SEQ ID NO: 66), 5'-CGTGTATGAC-3' (SEQ ID NO: 67), 5'-CCGTGTATGAC-3' (SEQ ID NO: 68), 5'-GCCGTGTATGAC-3' (SEQ ID NO: 69), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 70), 5'-GAGCCGTGTATGAC-3' (SEQ ID NO: 71), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 72), 5'-GAG A nucleotide sequence comprising: AGCCGTGTATGAC-3' (SEQ ID NO: 73), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 74), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 75), 5'-GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 76), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 77), or 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 78).

[0259] In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that targets hsa-miR-204, e.g., has-miR-204-5p. has-miR-204-5p is shown in Table 1 as UUCCCUUUGUCAUCCUAUGCCU (SEQ ID NO: 13). In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T. In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence that comprises, consists essentially of, or consists of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T, and the nucleotide sequence has one mismatch, two mismatches, three mismatches, or four mismatches. In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence comprising, consisting essentially of, or consisting of AGGCAUAGGAUGACAAAGGGAA (SEQ ID NO: 15), where U can optionally be T, and the nucleotide sequence has one or two mismatches. In other embodiments, the payload (e.g., antimiR) is a nucleotide sequence that targets a seed sequence of has-miR-204-5p (UCCCUUU; SEQ ID NO: 21). In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement of the seed), where U can optionally be T (complement of the seed), and the nucleotide sequence is about 10 nucleotides to 30 nucleotides (e.g., 10-25, 10-24, 10-23, 10-22, 10-21, 10-20, 10-19, or 10-18) in length.In some embodiments, the payload (e.g., antimiR) is a nucleotide sequence comprising AAAGGGA (SEQ ID NO: 22) (complement of the seed), where the nucleotide sequence comprises 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 5' end of the complement of the seed sequence and / or 1, 2 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleic acids at the 3' end of the complement of the seed sequence.

[0260] i. Chemically modified polynucleotides In some aspects, a polynucleotide of the disclosure (e.g., an antimiR, e.g., a miR485 antimiR) comprises at least one chemically modified nucleoside and / or nucleotide. When a polynucleotide of the disclosure is chemically modified, the polynucleotide may be referred to as a "modified polynucleotide."

[0261] "Nucleoside" refers to a compound containing a sugar molecule (e.g., pentose or ribose) or derivative thereof, along with an organic base (e.g., a purine or pyrimidine) or derivative thereof (also referred to herein as a "nucleobase").

[0262] "Nucleotide" refers to a nucleoside that includes a phosphate group. Modified nucleotides can be synthesized by any useful method, for example, chemically, enzymatically, or recombinantly, to include one or more modified non-natural nucleosides.

[0263] A polynucleotide may comprise a region or regions of linked nucleosides. Such regions may have variable backbone linkages. The linkages may be standard phosphodiester bonds, in which case the polynucleotide comprises a region of nucleotides.

[0264] Modified polynucleotides disclosed herein may contain a variety of different modifications.In some embodiments, modified polynucleotides contain one, two or more (optionally different) nucleoside or nucleotide modifications.In some embodiments, modified polynucleotides may exhibit one or more desirable properties, such as improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to target microRNA, reduced non-specific binding to other microRNA or other molecules, compared to unmodified polynucleotides.

[0265] In some aspects, the polynucleotide of the present disclosure is chemically modified.As used herein, with respect to polynucleotide, the term "chemical modification" or, as appropriate, "chemically modified" refers to the modification of one or more of adenosine (A), guanosine (G), uridine (U), thymidine (T), or cytidine (C) ribonucleosides or deoxyribonucleosides, including, but not limited to, their nucleobase, sugar, backbone, or any combination thereof, in their position, pattern, percentage, or population.

[0266] In some embodiments, a polynucleotide of the disclosure (e.g., an antimiR) can have a uniform chemical modification of all or any of the same nucleoside type, or a group of modifications generated by downward titration of the same starting modification at all or any of the same nucleoside type, or a measured percentage of all or any of the same nucleoside type except with random incorporation. In another embodiment, a polynucleotide of the disclosure (e.g., an antimiR) can have a uniform chemical modification of two, three, or four of the same nucleoside type throughout the polynucleotide (e.g., all uridines and all cytosines are modified in the same way, etc.).

[0267] Modified nucleotide base pairing encompasses not only standard adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and / or modified nucleotides containing non-standard or modified bases, where the arrangement of hydrogen bond donors and hydrogen bond acceptors allows hydrogen bonding between the non-standard and standard bases, or between two complementary non-standard base structures. One example of such non-standard base pairing is base pairing between the modified nucleobase inosine and adenine, cytosine, or uracil. Any combination of bases / sugars or linkers can be incorporated into the polynucleotides of the present disclosure.

[0268] Those skilled in the art will understand that, unless otherwise noted, the polynucleotide sequences described in this application recite "T" in representative DNA sequences, but when the sequence represents RNA, "T" is replaced with "U." For example, the TDs of the present disclosure can be administered as RNA, as DNA, or as hybrid molecules containing both RNA and DNA units.

[0269] In some embodiments, a polynucleotide (e.g., an antimiR, e.g., a miR485 antimiR) comprises at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobase combinations.

[0270] In some embodiments, the nucleobases, sugars, backbone linkages, or any combination thereof in a polynucleotide (e.g., an antimiR, e.g., miR485 antimiR) are at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% modified.

[0271] 1. Base modification In certain aspects, a chemical modification is present in a nucleobase in a polynucleotide of the disclosure (e.g., an antimiR, e.g., miR485 antimiR). In some aspects, at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (ψ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methylcytidine (m5C)), a modified adenosine (e.g., 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyladenine (m2A)), a modified guanosine (e.g., 7-methylguanosine (m7G) or 1-methylguanosine (m1G)), or a combination thereof.

[0272] In some aspects, the polynucleotides (e.g., antimiRs, e.g., miR485 antimiRs) of the present disclosure are uniformly modified (e.g., completely modified, modified throughout the entire sequence) for a particular modification. For example, the polynucleotides can be uniformly modified with the same type of base modification, e.g., 5-methylcytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methylcytidine (m5C). Similarly, the polynucleotides can be uniformly modified by substitution of any type of nucleoside residue present in the sequence with a modified nucleoside, e.g., any of those described above.

[0273] In some embodiments, a polynucleotide (e.g., an antimiR, e.g., miR485 antimiR) of the disclosure comprises a combination of at least two (e.g., two, three, four, or more) modified nucleobases. In some embodiments, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of one type of nucleobase in a polynucleotide (e.g., an antimiR, e.g., miR485 antimiR) of the disclosure are modified nucleobases.

[0274] 2. Backbone modification In some aspects, the payload can include a "polynucleotide of the disclosure" (e.g., including an antimiR, e.g., miR485 antimiR), where the polynucleotide includes any useful modification in the internucleoside linkage. Such linkages, including backbone modifications, that are useful in the compositions of the disclosure include, but are not limited to, 3'-alkylene phosphonates, 3'-amino phosphoramidates, alkene-containing backbones, aminoalkyl phosphoramidates, aminoalkyl phosphotriesters, boranophosphates, -CH2-ON(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2-, -CH2-NH-CH2-, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene(methylimino), methyleneformacetyl and thioformacetyl backbones. Formacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH3)-CH2-CH2-, oligonucleosides with heteroatom internucleoside linkages, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioate, phosphotriesters, PNAs, siloxane backbones, sulfamate backbones, sulfide, sulfoxide, and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters, and thionophosphoramidates. [ka]

[0275] In some embodiments, the presence of the backbone linkages disclosed above increases the stability (e.g., thermal stability) and / or resistance to degradation (e.g., enzymatic degradation) of a polynucleotide of the disclosure (e.g., an antimiR, e.g., miR485 antimiR). In some embodiments, the stability and / or resistance to degradation in a modified polynucleotide is increased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to a corresponding unmodified polynucleotide (a reference or control polynucleotide).

[0276] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the backbone linkages in a polynucleotide of the disclosure (e.g., an antimiR, e.g., a miR485 antimiR) are modified (e.g., all of them are phosphorothioate).

[0277] In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 backbone linkages in a polynucleotide of the disclosure (e.g., an antimiR, e.g., a miR485 antimiR) are modified (e.g., phosphorothioate).

[0278] In some embodiments, the backbone comprises linkages selected from the group consisting of phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorothioate linkages, and combinations thereof.

[0279] 3. Sugar modification Modified nucleosides and nucleotides that can be incorporated into polynucleotides (e.g., antimiRs, e.g., miR485 antimiRs) of the disclosure can be modified on the sugar of the nucleic acid. Thus, in some aspects, the payload comprises a nucleic acid, where the nucleic acid comprises at least one nucleoside analog (e.g., a nucleoside having a sugar modification).

[0280] In some embodiments, sugar modifications increase the affinity of the binding of a polynucleotide to its target miRNA. Incorporating affinity-enhancing nucleotide analogs, such as LNA or 2'-substituted sugars, into a polynucleotide can allow the length of the polynucleotide to be reduced, and can also relax the upper limit of the polynucleotide size above which non-specific or aberrant binding does not occur.

[0281] In some embodiments, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% of the nucleotides in a polynucleotide of the disclosure (e.g., an antimiR, e.g., a miR485 antimiR) contain a sugar modification (e.g., LNA).

[0282] In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotide units in a polynucleotide of the disclosure (e.g., an antimiR, e.g., a miR485 antimiR) are sugar modified (e.g., LNA).

[0283] Generally, RNA contains the sugar group ribose, which is a five-membered ring with oxygen. Non-limiting exemplary modified nucleotides include substitution of oxygen in ribose (e.g., with S, Se, or alkylene, e.g., methylene or ethylene); addition of a double bond (e.g., replacement of ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., formation of a four-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., formation of a six- or seven-membered ring with an additional carbon or heteroatom, e.g., anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and phosphoramidate). backbone); polycyclic forms (e.g., tricyclo); and "unlocked" forms such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where the ribose is replaced with a glycol unit linked to a phosphodiester bond), threose nucleic acid (TNA, where the ribose is replaced with α-L-threofuranosyl-(3'→2')), and peptide nucleic acid (PNA, where a 2-amino-ethyl-glycine bond replaces the ribose and phosphodiester backbone). The sugar group may also contain one or more carbons that have the opposite stereochemical configuration to the corresponding carbon in ribose. Thus, a polynucleotide molecule may include nucleotides that contain, for example, arabinose as the sugar.

[0284] The 2' hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2'-position include, but are not limited to, H, halo, optionally substituted C 1~6 Alkyl; optionally substituted C 1~6 Alkoxy; optionally substituted C6~10 Aryloxy; optionally substituted C 3~8 Cycloalkyl; optionally substituted C 3~8 Cycloalkoxy; optionally substituted C 6~10 Aryloxy; optionally substituted C 6~10 Aryl-C 1~6 Alkoxy, optionally substituted C 1~12 (heterocyclyl)oxy; sugar (e.g., ribose, pentose, or any described herein); polyethylene glycol (PEG), -O(CH2CH2O) n CH2CH2OR, where R is H or an optionally substituted alkyl and n is an integer from 0 to 20 (e.g., 0 to 4, 0 to 8, 0 to 10, 0 to 16, 1 to 4, 1 to 8, 1 to 10, 1 to 16, 1 to 20, 2 to 4, 2 to 8, 2 to 10, 2 to 16, 2 to 20, 4 to 8, 4 to 10, 4 to 16, and 4 to 20); "locked" nucleic acids (LNAs) (wherein the 2'-hydroxy is 1~6 Alkylene or C 1~6 They are linked to the 4'-carbon of the same ribose sugar by a heteroalkylene bridge, where exemplary bridges include methylene, propylene, ether, amino bridge, aminoalkyl, aminoalkoxy, amino, and amino acid.

[0285] In some embodiments, the nucleoside analogs present in the polynucleotides (e.g., antimiRs, e.g., miR485 antimiRs) of the disclosure include, for example, 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabinonucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof. In some embodiments, the LNA is, for example, oxyLNA (e.g., β-D-oxy-LNA or α-L-oxy-LNA), aminoLNA (e.g., β-D-amino-LNA or α-L-amino-LNA), thioLNA (e.g., β-D-thio-LNA or α-L-thio-LNA), ENA (e.g., β-D-ENA or α-L-ENA), or any combination thereof.

[0286] In some aspects, nucleoside analogs present in the polynucleotides of the disclosure include locked nucleic acids (LNA); 2'-O-alkyl RNA; 2'-amino DNA; 2'-fluoro DNA; arabino nucleic acid (ANA); 2'-fluoro ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleosides (cEt), 2'-O-methyl nucleic acid (2'-OMe), 2'-O-methoxyethyl nucleic acid (2'-MOE), or any combination thereof.

[0287] In some aspects, a polynucleotide of the disclosure (e.g., an antimiR, e.g., miR485 antimiR) can include both modified RNA nucleotide analogs (e.g., LNA) and DNA units. In some aspects, a polynucleotide of the disclosure is a gapmer. See, e.g., U.S. Patent Nos. 8,404,649, 8,580,756, 8,163,708, and 9,034,837, all of which are incorporated by reference in their entirety. In some aspects, a polynucleotide of the disclosure is a micromiR. See U.S. Patent Application Publication No. US20180201928, which is incorporated by reference in its entirety.

[0288] IV. Micelles The present disclosure also provides micelles comprising the cationic carrier units of the present disclosure. The micelles of the present disclosure comprise the cationic carrier units of the present disclosure and a negatively charged payload, where the negatively charged payload and the cationic carrier units are associated with each other. In some embodiments, the association comprises a covalent bond (see FIG. 1). In other embodiments, the association does not comprise a covalent bond (see FIG. 1). In other embodiments, the association is by ionic bonds, i.e., electrostatic interactions. In some embodiments, the negatively charged payload (e.g., DNA and / or RNA) is not covalently conjugated to the cationic carrier units, and / or the negatively charged payload interacts with the cationic carrier moiety of the cationic carrier units only through ionic interactions.

[0289] In some embodiments, the cationic carrier units and micelles of the present disclosure protect payloads (e.g., DNA and / or RNA) from degradation (e.g., by DNases and / or RNases). First, the cationic carrier units can protect the payload through electrostatic interactions. Second, the micelles sequester the payload in the core of the micelle, i.e., outside the reach of DNases and / or RNases. In some embodiments, protection of the payload from circulating enzymes (e.g., nucleases) can increase the half-life of the negatively charged payload (e.g., DNA and / or RNA) compared to the free payload. In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the plasma half-life of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0290] In some embodiments, the positive charge of the cationic carrier unit, and in particular the charge of the cationic carrier moiety, is sufficient to form a micelle when mixed with a negatively charged payload (e.g., nucleic acid) in solution, where the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is about 1:1. In some embodiments, the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is greater than 1:1, i.e., an excess of cationic carrier unit is used. In some embodiments, the overall ionic ratio between the cationic carrier unit, in particular its cationic carrier moiety, and the negatively charged payload (e.g., nucleic acid) is less than 1:1, i.e., an excess of negatively charged payload is used.

[0291] In some embodiments, when combined with a suitable buffer (e.g., PBS), the complexes formed between the cationic carrier units of the present disclosure and the payload (e.g., antisense oligonucleotides such as antimiR) self-assemble into micelles. See FIG. 5.

[0292] A micelle is a water-soluble or colloidal structure or aggregate composed of one or more amphiphilic molecules. An amphiphilic molecule is a molecule that contains at least one hydrophilic (polar) portion and at least one hydrophobic (non-polar) portion. A "typical micelle" has a single, central, and predominantly hydrophobic compartment or "core" surrounded by a hydrophilic layer or "shell". In aqueous solution, micelles form aggregates in which the hydrophilic "head" region of the amphiphilic molecule is in contact with the surrounding solvent, isolating the hydrophobic single tail region of the amphiphilic molecule in the micelle core. The shape of the micelle is approximately spherical. Other shapes are also possible, such as ellipsoids, cylinders, rod-shaped structures, or polymersomes. The shape and size of the disclosed micelles, and therefore the loading capacity, can be modified by changing the ratio between the water-soluble biopolymer (e.g., PEG) and the cationic carrier (e.g., polylysine). Depending on the ratio, the carrier units may organize as small particles, small micelles, micelles, rod-shaped structures, or polymersomes (see FIG. 6). Thus, the term "micelles of the present disclosure" encompasses not only typical micelles, but also small particles, small micelles, micelles, rod-shaped structures, or polymersomes.

[0293] Micelles of the present disclosure may be composed of either a single unimolecular polymer containing hydrophobic and hydrophilic moieties, or a mixture of assemblies containing multiple amphiphilic (i.e., surfactant) molecules formed above the critical micelle concentration (CMC) in polar solutions (i.e., aqueous solutions). Micelles are self-assembled from one or more amphiphilic molecules, where the moieties are oriented to result in a predominantly hydrophobic inner core and a predominantly hydrophilic exterior.

[0294] Micelles of the present disclosure may range in size from 5 to about 2000 nanometers. In some embodiments, the diameter of the micelles is from about 10 nm to about 200 nm. In some embodiments, the diameter of the micelles is from about 1 nm to about 100 nm, from about 10 nm to about 100 nm, from about 10 nm to about 90 nm, from about 10 nm to about 80 nm, from about 10 nm to about 70 nm, from about 20 nm to about 100 nm, from about 20 nm to about 90 nm, from about 20 nm to about 80 nm, from about 20 nm to about 70 nm, from about 30 nm to about 100 nm, from about 30 nm to about 90 nm, from about 30 nm to about 80 nm, from about 30 nm to about 70 nm, from about 40 nm to about 100 nm, from about 40 nm to about 90 nm, from about 40 nm to about 80 nm, or from about 40 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 30 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 90 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 80 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 70 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 15 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 60 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 50 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 20 nm to about 40 nm. In some embodiments, the diameter of the micelles of the present disclosure is about 25 nm to about 35 nm. In some embodiments, the micelles of the present disclosure have a diameter of about 32 nm. An exemplary distribution of micelle sizes is shown in FIG.

[0295] In some embodiments, a micelle can contain a single type of antimiR (e.g., miR485 antimiR). In other embodiments, a micelle can contain two or more types of antimiR, for example, (i) antimiRs with different structures that target the same miRNA, (ii) antimiRs with different structures that target different miRNAs, (iii) antimiRs with the same structure that target the same miRNA, or (iv) a combination thereof.

[0296] In some embodiments, micelles of the present disclosure include a single type of cationic carrier unit. In other embodiments, micelles of the present disclosure include two or more types of cationic carrier units (e.g., targeting different receptors on the target cell surface). In some embodiments, micelles of the present disclosure can include cationic carrier units with different targeting moieties, different cationic carrier moieties (e.g., to accommodate different payloads), and / or different adjuvant units.

[0297] Different types of cationic or anionic carrier units can be combined together to form micelles with a payload. For example, to target the blood-brain barrier, micelles of the present disclosure can include cationic (or anionic) carrier units linked to a targeting moiety and cationic (or anionic) carrier units not linked to a targeting moiety. In some embodiments, micelles include about 50 to about 200 cationic or anionic carrier units. In other embodiments, micelles include about 50 to about 150, about 50 to about 140, about 50 to about 130, about 50 to about 120, about 50 to about 110, or about 50 to about 100 cationic or anionic carrier units. In some embodiments, micelles include about 60 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 60 to about 150, about 60 to about 140, about 60 to about 130, about 60 to about 120, about 60 to about 110, about 60 to about 100, about 60 to about 90, about 60 to about 80, or about 60 to about 70 cationic or anionic carrier units. In some embodiments, the micelles contain about 70 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 70 to about 150, about 70 to about 140, about 70 to about 130, about 70 to about 120, about 70 to about 110, about 70 to about 100, about 70 to about 90, or about 70 to about 80 cationic or anionic carrier units. In some embodiments, the micelles contain about 80 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 80 to about 150, about 80 to about 140, about 80 to about 130, about 80 to about 120, about 80 to about 110, about 80 to about 100, or about 80 to about 90 cationic or anionic carrier units. In some embodiments, the micelles contain about 90 to about 200 cationic or anionic carrier units. In other embodiments, the micelles contain about 90 to about 150, about 90 to about 140, about 90 to about 130, about 90 to about 120, about 90 to about 110, or about 90 to about 100 cationic or anionic carrier units. In some embodiments, the micelles contain about 100 to about 200 cationic or anionic carrier units.In other embodiments, the micelles contain from about 100 to about 150, from about 100 to about 140, from about 100 to about 130, from about 100 to about 120, from about 100 to about 110, or from about 100 to about 100 cationic or anionic carrier units.

[0298] The present disclosure also includes micelles comprising (i) a nucleotide sequence (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) a cationic carrier unit as described herein. In some embodiments, the present disclosure is directed to micelles comprising (i) a nucleotide sequence, e.g., an miRNA or an miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 85 to about 115, about 90 to about 110, about 95 to about 105) cationic carrier units as described herein, e.g., TM-WP-CC-AM, WP-CC-AM, or combinations thereof (see FIG. 3). In some embodiments, the micelle comprises (i) a nucleotide sequence, e.g., an miRNA or miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 80 to about 120 (e.g., about 80, about 85, about 90, about 95, about 100, about 105, or about 110) cationic carrier units described herein, e.g., optional TM-WP-CC-AM (see FIG. 3). In some embodiments, the micelle comprises (i) a nucleotide sequence, e.g., an miRNA or an miRNA inhibitor (e.g., an oligonucleotide about 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and (ii) about 90 to about 110, e.g., about 100, cationic carrier units, wherein (a) about 45 to about 55, e.g., about 50, of the cationic carrier units comprise TM-WP-CC-AM and (b) about 45 to about 55, e.g., about 50, of the cationic carrier units comprise WP-CC-CM, where TM is phenylalanine and WP is (PEG). 5000and CC is about 40 to about 50 lysines, e.g., about 45, about 46, about 47, about 48, about 49, or about 50 lysines, and about 5 to about 15 lysines, about 10 lysines each are fused to vitamin B3 (nicotinamide).

[0299] In some embodiments, a micelle of the present disclosure comprises (i) a nucleotide sequence, e.g., a miR485-3p inhibitor, e.g., 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 18), and (ii) about 100 cationic carrier units, wherein (a) about 50 cationic carrier units comprise TM-WP-CC-AM and (b) about 50 cationic carrier units comprise WP-CC-CM, wherein TM is phenylalanine and WP is (PEG) 5000 and CC is about 47 lysines, with about 10 lysines each fused to vitamin B3 (nicotinamide).

[0300] In some embodiments, a micelle can contain a single payload (e.g., a single oligonucleotide, e.g., an antimiR). In other embodiments, a micelle can contain more than one payload (e.g., multiple oligonucleotides, e.g., multiple antimiRs).

[0301] V. Manufacturing method The present disclosure also provides methods of making the cationic carrier units and micelles of the present disclosure. In general, the present disclosure provides methods of preparing the cationic carrier units of the present disclosure, including, for example, synthesizing the cationic carrier units as described in the Examples section. As used herein, the term "synthesize" refers to constructing the cationic carrier units using methods known in the art. For example, protein components (e.g., antibody targeting moieties) can be recombinantly prepared and then conjugated to other components of the cationic carrier units. In some aspects, each of the components of the cationic carrier units can be prepared using methods known in the art, such as recombinant protein production, solid-phase peptide or nucleic acid synthesis, chemical synthesis, enzymatic synthesis, or any combination thereof, and the resulting components can be conjugated using chemical and / or enzymatic methods known in the art.

[0302] The cationic carrier unit of the present disclosure can be purified to remove contaminants. In some aspects, the cationic carrier unit comprises a homogenous population of cationic carrier units. However, in other aspects, the cationic carrier unit can comprise multiple types (e.g., some of them contain targeting moieties, and some contain other moieties but do not have targeting moieties). In some aspects, the preparation of the cationic carrier unit of the present disclosure comprises lyophilization or any other type of dry storage suitable for reconstitution. In some aspects, the preparation of the cationic carrier unit in dry form is performed after the cationic carrier unit is combined with a payload (e.g., nucleic acid).

[0303] In some embodiments, the method of preparing a micelle of the present disclosure comprises mixing a cationic carrier unit with a negatively charged payload (e.g., a nucleic acid such as an antisense oligonucleotide, e.g., antimiR) in a 1:1 ionic ratio. In some embodiments, the cationic carrier unit and the negatively charged payload are combined in solution. In some embodiments, after combining the cationic carrier and the negatively charged payload in solution, the resulting solution is lyophilized or dried. In some embodiments, the combination of the cationic carrier and the negatively charged payload is performed in a dry form.

[0304] As shown in Figure 6, the ratio of the number n of monomer units in the water-soluble polymer (A, e.g., PEG) to the number m of monomer units (e.g., lysine) in the cationic carrier moiety (B, e.g., polylysine) (in either case, the number of units n or m can be up to 1,000 units) affects the size and shape of the resulting micelles. At a mB / (nA+mB) ratio of 0.5, the resulting micelles are classical micelles. When mB / (nA+mB) is greater than 0.5, the resulting micelles are rod-shaped micelles or polymersomes. When mB / (nA+mB) is less than 0.5, the resulting micelles are small micelles or small particles.

[0305] The micelles of the present disclosure can be produced using any of the techniques known in the art, such as vortexing, extrusion, or sonication. The formation of micelles depends on the application of conditions that exceed the critical micelle concentration (CMC) of the solution containing the cationic carrier units of the present disclosure. After they reach a certain value of concentration, the surfactants begin to associate and self-assemble into more complex units, such as micelles. The CMC of the solution containing the cationic carriers of the present disclosure can be determined by any physical property (e.g., surface tension) that shows a clear transition around the CMC.

[0306] The well-known Smith-Ewart theory predicts that the number of nucleated particles that lead to the formation of micelles at concentrations above the CMC is proportional to the 0.6 power of the surfactant (in this disclosure, cationic carrier units complexed or associated with an anionic payload) concentration, since for a given surfactant, the number of micelles formed generally increases with increasing surfactant concentration.

[0307] In some aspects, micelles of the present disclosure can be purified, e.g., to remove contaminants and / or to produce a homogenous population of micelles (e.g., micelles having the same size, or micelles having the same payload or the same targeting moiety).

[0308] VI. Pharmaceutical Compositions The present disclosure also provides pharmaceutical compositions comprising the cationic carrier units and / or micelles of the present disclosure (i.e., micelles comprising the cationic carrier units of the present disclosure) suitable for administration to a subject. As noted above, the micelles of the present disclosure can be uniform (i.e., all micelles comprise the same type of cationic carrier units, with the same targeting moiety and the same payload). However, in other aspects, the micelles can comprise multiple targeting moieties, multiple payloads, and the like.

[0309] Pharmaceutical compositions generally comprise the cationic carrier units and / or micelles of the present disclosure and a pharma- ceutically acceptable excipient or carrier in a form suitable for administration to a subject, which is determined in part by the particular composition being administered and the particular method used to administer the composition.

[0310] There are a wide variety of suitable formulations of pharmaceutical compositions comprising the micelles of the present disclosure (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). Pharmaceutical compositions are generally formulated aseptically and in full compliance with all Good Manufacturing Practices (GMP) by the U.S. Food and Drug Administration. In some embodiments, the pharmaceutical compositions comprise one or more micelles described herein.

[0311] In certain embodiments, the micelles described herein are co-administered with one or more additional therapeutic agents in a pharma- ceutically acceptable carrier. In some embodiments, the pharmaceutical composition comprising the micelles described herein is administered prior to administration of the additional therapeutic agent(s). In other embodiments, the pharmaceutical composition comprising the micelles described herein is administered after administration of the additional therapeutic agent(s). In further embodiments, the pharmaceutical composition comprising the micelles described herein is administered simultaneously with the additional therapeutic agent(s).

[0312] In some embodiments, the pharmaceutical carrier is added after micelle formation, while in other embodiments, the pharmaceutical carrier is added before micelle formation.

[0313] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed, and include buffers, such as phosphate, citric acid, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (e.g., octadecyldimethylbenzylammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl, or benzyl alcohol; alkyl parabens, such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; tannins, such as tetrahydrofuran, ... proteins such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic active agents such as TWEEN®, PLURONICS™, or polyethylene glycol (PEG).

[0314] Examples of carrier or diluent include, but are not limited to, water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin.The use of such media and compounds for pharmacoactive substances is well known in the art.Except where any conventional media or compound is incompatible with the cationic carrier unit or micelle disclosed herein, its use in the composition is contemplated.

[0315] Supplementary therapeutic agents may also be incorporated into the compositions of the present disclosure. Typically, pharmaceutical compositions are formulated to be compatible with their intended route of administration. The micelles described herein may be administered parenterally, topically, intravenously, orally, subcutaneously, intraarterially, intradermally, transdermally, rectally, intracranially, intraperitoneally, intranasally, intratumorally, intramuscularly, or as an inhalant. In certain aspects, the micelles of the pharmaceutical compositions described herein are administered intravenously, for example, by injection. The micelles described herein may optionally be administered in combination with other therapeutic agents that are at least partially effective in treating the disease, disorder, or condition for which the micelles described herein are intended.

[0316] The solution or suspension may contain the following components: a sterile diluent, such as water, saline, fixed oils, polyethylene glycol, glycerin, propylene glycol, or other synthetic solvents; an antibacterial compound, such as benzyl alcohol or methylparaben; an antioxidant, such as ascorbic acid or sodium bisulfite; a chelating compound, such as ethylenediaminetetraacetic acid (EDTA); a buffer, such as acetate, citrate, or phosphate, and a compound for adjusting tonicity, such as sodium chloride or dextrose. The pH may be adjusted with an acid or base, such as hydrochloric acid or sodium hydroxide. The preparation may be placed into glass or plastic ampoules, disposable syringes, or multiple dose vials.

[0317] Pharmaceutical compositions suitable for injection use include sterile aqueous solutions (if water soluble) or dispersions and sterile powders. Suitable carriers for intravenous administration include physiological saline, bacteriostatic water, Cremophor EL™ (BASF, Parsippany, NJ), or phosphate buffered saline (PBS). The composition is generally fluid to the extent that it is sterile and easy to pass through a syringe needle. The carrier can be, for example, a solvent or dispersion medium containing water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, etc.), and suitable mixtures thereof. Proper fluidity can be maintained, for example, by using a coating such as lecithin, by maintaining the required particle size in the case of dispersions, and by using surfactants. Prevention of microbial activity can be achieved by various antibacterial and antifungal compounds, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. If necessary, isotonic compounds, for example, sugars, polyalcohols, for example, mannitol, sorbitol, and sodium chloride, can be added to the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition a compound which delays absorption, for example, aluminum monostearate and gelatin.

[0318] The pharmaceutical compositions of the present disclosure can be sterilized by conventional, well-known sterilization techniques. Aqueous solutions can be packaged for use or filtered under sterile conditions and lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.

[0319] Sterile injectables can be prepared by incorporating the micelles described herein in an effective amount and in a suitable solvent, together with one or a combination of the components listed herein, if desired.Generally, dispersions are prepared by incorporating the micelles described herein into a sterile vehicle that contains a basic dispersion medium and any other desired components.In the case of sterile powders for preparing sterile injectables, the preparation method is vacuum drying and freeze-drying, which produces a powder of active ingredient and any other desired ingredients from a previously sterile-filtered solution.The micelles described herein can be administered in the form of depot injections or implant preparations, which can be formulated in such a way as to allow sustained or pulsed release of the micelles described herein.

[0320] Systemic administration of compositions comprising micelles as described herein may be by transmucosal means. For transmucosal administration, a penetrant appropriate to the barrier to be permeated is used in the formulation. Such penetrants are generally known in the art and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be achieved, for example, by using nasal sprays.

[0321] In certain embodiments, pharmaceutical compositions comprising micelles as described herein are administered intravenously to a subject who will benefit from the pharmaceutical composition. In certain embodiments, the compositions are administered to the lymphatic system, for example, by intralymphatic or intranodal injection (see, for example, Senti et al., PNAS 105(46):17908 (2008)), or by intramuscular injection, subcutaneous administration, intratumoral injection, or by direct injection into the thymus or liver.

[0322] In certain embodiments, pharmaceutical compositions comprising the micelles described herein are administered as a suspension. In certain embodiments, the pharmaceutical compositions are administered as a formulation capable of forming a depot after administration. In certain preferred embodiments, the depot slowly releases the micelles described herein into the circulation or remains in a depot form.

[0323] Typically, a pharma- ceutically acceptable composition is highly purified to be free of contaminants, biocompatible, non-toxic, and suitable for administration to a subject. When water is a component of the carrier, the water is highly purified and treated to be free of contaminants (e.g., endotoxins).

[0324] The pharma- ceutically acceptable carrier may be, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methyl hydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and / or mineral oil.The pharmaceutical composition may further comprise a lubricant, a wetting agent, a sweetener, a flavor enhancer, an emulsifier, a suspending agent, and / or a preservative.

[0325] The pharmaceutical compositions described herein comprise the micelles described herein and, optionally, a pharma- ceutical active or therapeutic agent. The therapeutic agent can be a biologic agent, a small molecule agent, or a nucleic acid agent.

[0326] Dosage forms are provided that include the micelles described herein. In some embodiments, the dosage forms are formulated as suspensions for intravenous injection.

[0327] The micelles or pharmaceutical compositions comprising the micelles disclosed herein can be used simultaneously with other drugs. Specifically, the micelles or pharmaceutical compositions of the present disclosure can be used together with drugs, such as hormonal therapeutic drugs, chemotherapeutic drugs, immunotherapeutic drugs, drugs that inhibit the action of cell growth factors or cell growth factor receptors, and the like.

[0328] VII. Methods of Treatment and Use The present disclosure also provides a method of treating a disease or condition in a subject in need thereof, the method comprising administering a micelle of the present disclosure or a combination thereof to the subject, e.g., a mammal, such as a human subject. In some aspects, the present disclosure also provides a method of treating a neurodegenerative disorder or cancer in a subject in need thereof, the method comprising administering a therapeutically effective amount of a micelle of the present disclosure or a pharmaceutical composition of the present disclosure to the subject.

[0329] In some aspects, the micelles of the present disclosure may be administered by intravenous, intramuscular, intraarterial, intrathecal, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, subcapsular, subarachnoid, intraspinal, and intrasternal injection and infusion.

[0330] In some aspects, the micelles of the present disclosure can be used in conjunction with other agents or treatments suitable for treating the diseases and conditions disclosed herein.

[0331] The present disclosure also provides a method of encapsulating a payload for delivery, the method comprising incorporating a payload, for example an anionic payload such as a nucleic acid (e.g., an antimiR), into a micelle of the present disclosure.

[0332] The present disclosure also provides a method for increasing resistance to degradation (e.g., nuclease-mediated degradation) of a payload, the method including incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., antimiR), into a micelle of the present disclosure.

[0333] In some embodiments, the present disclosure provides a method of crossing the blood-brain barrier (BBB), the method comprising administering a micelle disclosed herein, e.g., a micelle comprising tryptophan and / or tyrosine as a targeting moiety. As illustrated in FIG. 7, a micelle of the present disclosure loaded with anti-miRNA can be targeted to a receptor of the BBB, e.g., LAT1, as disclosed above. Once the micelle is translocated through the BBB by receptor-mediated transcytosis and undergoes intracellular uptake by brain cells (e.g., neurons, astrocytes, or microglia), the payload (e.g., antimiR) is released and interacts with a target within the cell (e.g., antimiR can bind to a target microRNA and cause RNase H-mediated degradation).

[0334] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the resistance of the payload to degradation by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% as compared to the free payload (i.e., the payload not within a micelle, e.g., free in solution).

[0335] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the resistance of the payload to degradation by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0336] The present disclosure also provides a method for increasing the stability of a payload during administration (e.g., while in the bloodstream of a subject), the method including incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into a micelle of the present disclosure.

[0337] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the stability of the payload (e.g., increase resistance to nucleases) by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.

[0338] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the stability of the payload (e.g., increase resistance to nucleases) by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0339] The present disclosure also provides a method for increasing the plasma half-life of a payload, the method comprising incorporating a payload, for example an anionic payload such as a nucleic acid (e.g., an antimiR), into a micelle of the present disclosure.

[0340] In some embodiments, encapsulation of a payload in a micelle of the present disclosure increases the plasma half-life of the payload by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% relative to the free payload. The increase may be at least about 100%, at least about 200%, at least about 300%, at least about 400%, at least about 500%, at least about 600%, at least about 700%, at least about 800%, at least about 900%, at least about 1000%, at least about 1100%, at least about 1200%, at least about 1300%, at least about 1400%, at least about 1500%, at least about 1600%, at least about 1700%, at least about 1800%, at least about 1900%, or at least about 2000%.

[0341] In some embodiments, encapsulation of a payload into a micelle of the present disclosure may increase the plasma half-life of the payload by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0342] In some embodiments, the encapsulated payload is an antimiR disclosed herein, such as an antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), wherein encapsulation of the antimiR in a micelle of the present disclosure increases the plasma half-life of the antimiR by at least about 10-fold, at least about 12-fold, at least about 14-fold, at least about 16-fold, at least about 18-fold, or at least about 20-fold compared to the plasma half-life of the free antimiR. In a particular embodiment, the encapsulated payload is an antimiR disclosed herein, such as an antisense oligonucleotide of SEQ ID NO: 18 or a variant or derivative thereof (e.g., an oligonucleotide having at least about 70% identity to the antisense oligonucleotide of SEQ ID NO: 18), wherein encapsulation of the antimiR in a micelle of the present disclosure increases the plasma half-life of the antimiR by about 20-fold compared to the plasma half-life of the free antimiR. In some embodiments, the plasma half-life of an antimiR encapsulated in a micelle of the present disclosure is at least about 30 minutes, at least about 40 minutes, at least about 50 minutes, at least about 60 minutes, at least about 70 minutes, at least about 80 minutes, at least about 90 minutes, at least about 100 minutes, or at least about 120 minutes. In one particular embodiment, the plasma half-life of an antimiR encapsulated in a micelle of the present disclosure (e.g., an antisense oligonucleotide of SEQ ID NO: 18) is at least about 90 minutes.

[0343] The present disclosure also provides a method for increasing the penetration, delivery, translocation, or transport of a payload through a physiological barrier, e.g., the BBB or a plasma membrane, the method comprising incorporating a payload, e.g., an anionic payload such as a nucleic acid (e.g., an antimiR), into a micelle of the present disclosure.

[0344] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the penetration, delivery, translocation, or transport of the payload across a physiological barrier, e.g., the BBB or plasma membrane, by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 100% compared to the free payload.

[0345] In some embodiments, encapsulation of a payload in a micelle of the present disclosure may increase the penetration, delivery, translocation, or transport of the payload across a physiological barrier, e.g., the BBB or plasma membrane, by at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 11-fold, at least about 12-fold, at least about 13-fold, at least about 14-fold, at least about 15-fold, at least about 16-fold, at least about 17-fold, at least about 18-fold, at least about 19-fold, at least about 20-fold, at least about 21-fold, at least about 22-fold, at least about 23-fold, at least about 24-fold, at least about 25-fold, at least about 26-fold, at least about 27-fold, at least about 28-fold, at least about 29-fold, or at least about 30-fold as compared to the free payload.

[0346] In some embodiments, the micelles of the present disclosure can be used to target stem cells, for example, to deliver therapeutic molecules (e.g., therapeutic polynucleotides) or gene therapy components. In other embodiments, the micelles of the present disclosure can be used to treat cancer. For example, the micelles of the present disclosure can target markers specific to certain types of cancer, such as glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, or cervical cancer, and can carry therapeutic molecules (e.g., therapeutic polynucleotides, peptides, or small molecules) as payloads.

[0347] In certain embodiments, the micelles of the present disclosure can be used to treat pancreatic cancer. In some embodiments, the targeting moiety that guides the micelles of the present disclosure to pancreatic tissue is a cyclic RGD peptide. In other embodiments, the targeting moiety that guides the micelles of the present disclosure to pancreatic tissue is a biomarker that is expressed primarily or exclusively on the surface of normal or cancerous pancreatic cells. In some embodiments, the payload of the micelles of the present disclosure is an oligonucleotide that targets K-Ras, where the delivery of the payload to pancreatic tissue effectively reduces the expression of K-Ras.

[0348] In some embodiments, the micelles of the present disclosure can be used to treat or ameliorate symptoms of neurodegenerative diseases, such as Alzheimer's disease. In some embodiments, the micelles of the present disclosure contain a payload (e.g., antimiR) that targets a molecule that is overexpressed in Alzheimer's disease neuronal tissue, such as miRNA-485-3p. In some embodiments, administration of the micelles of the present disclosure (e.g., micelles containing a LAT1 targeting moiety for effectively transporting the micelles and antimiR payload targeting miRNA-485-3p through the BBB) to Alzheimer's disease patients can thus prevent or ameliorate symptoms of Alzheimer's disease, such as apoptosis, loss of mitochondrial function, or inflammation. See FIG. 24.

[0349] In some embodiments, the present disclosure provides a method of reducing inflammation (e.g., neuroinflammation) in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively reducing inflammation (e.g., neuroinflammation) in the subject. In some embodiments, the neuroinflammation is cortical inflammation. In some embodiments, the neuroinflammation is hippocampal inflammation. In some embodiments, the therapeutic agent is an antimiR targeting miRNA-485-3p (e.g., an antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR can reduce the level of miRNA-485-3p in the subject.

[0350] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may reduce the level of neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to the level of neuroinflammation observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0351] In some embodiments, the present disclosure provides a method of reducing amyloid plaque burden in a subject suffering from Alzheimer's disease, the method comprising administering a therapeutically effective amount of a micelle of the present disclosure to the subject, the micelle comprising a therapeutic agent capable of effectively reducing amyloid plaque burden in the subject. In some embodiments, the therapeutic agent is an antimiR that targets miRNA-485-3p (e.g., an antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR can reduce the level of miRNA-485-3p in the subject.

[0352] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may reduce amyloid plaque burden in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the amyloid plaque burden observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0353] In some embodiments, the present disclosure provides a method of restoring and / or inducing neurogenesis in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively restoring and / or inducing neurogenesis in the subject. In some embodiments, the therapeutic agent is an antimiR that targets miRNA-485-3p (e.g., an antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR is capable of reducing the level of miRNA-485-3p in the subject.

[0354] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may restore and / or induce neurogenesis in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to the level of neurogenesis observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0355] In some embodiments, the present disclosure provides a method for improving cognitive function in a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease), the method comprising administering to the subject a therapeutically effective amount of a micelle of the present disclosure, the micelle comprising a therapeutic agent capable of effectively improving the cognitive function of the subject. In some embodiments, the therapeutic agent is an antimiR that targets miRNA-485-3p (e.g., an antimiR of SEQ ID NO: 18 or a fragment or variant thereof), wherein the antimiR can reduce the level of miRNA-485-3p in the subject.

[0356] In some embodiments, administration of a micelle of the present disclosure to a subject suffering from a neurodegenerative disease (e.g., Alzheimer's disease) may increase cognitive function in the subject by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, as compared to cognitive function observed in a subject or population of subjects not treated with a micelle of the present disclosure.

[0357] VIII. Kit The present disclosure also provides a kit or article of manufacture comprising the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and optionally instructions for use. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure in one or more containers. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and a pamphlet. In some embodiments, the kit or article of manufacture comprises the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, and instructions for use. Those skilled in the art will readily understand that the cationic carrier unit, micelle, or pharmaceutical composition of the present disclosure, or a combination thereof, can be easily incorporated into one of the established kit formats well known in the art.

[0358] In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a dry form in a container (e.g., a glass vial), and optionally a vial with a suitable solvent for hydrating the dried cationic carrier units, and optionally instructions for hydrating the cationic carrier units and forming micelles. In some aspects, the kit or article of manufacture further includes at least one additional container (e.g., a glass vial) with an anionic payload of the micelles (e.g., an antisense oligonucleotide). In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a dry form and the anionic payload of the micelles, also in a dry form, in the same container or in different containers. In some aspects, the kit or article of manufacture includes the cationic carrier units of the present disclosure in a solution and the anionic payload of the micelles, also in a solution, in the same container or in different containers. In some aspects, the kit or article of manufacture includes the micelles of the present disclosure in a solution and instructions for use. In some aspects, the kit or article of manufacture comprises a micelle of the present disclosure in dry form and instructions for use (e.g., instructions for reconstitution and administration).

[0359] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology that are within the skill of those in the art, and such techniques are fully explained in the literature. For example, Sambrook et al., ed. (1989) Molecular Cloning A Laboratory Manual (2nd ed.; Cold Spring Harbor Laboratory Press), Sambrook et al., ed. (1992) Molecular Cloning: A Laboratory Manual, (Cold Springs Harbor Laboratory, NY), DNGlover ed., (1985) DNA Cloning, Volumes I and II, Gait, ed. (1984) Oligonucleotide. Synthesis, Mullis et al. U.S. Patent No. 4,683,195, Hames and Higgins, eds. (1984) Nucleic Acid Hybridization; Hames and Higgins, eds. (1984) Transcription And Translation, Freshney (1987) Culture Of Animal Cells (Alan R. Liss, Inc.), Immobilized Cells And Enzymes (IRL Press)(1986), Perbal(1984)A Practical Guide To Molecular Cloning;the treatise,Methods In Enzymology(Academic Press,Inc.,NY), Miller and Calos eds.(1987)Gene Transfer Vectors For Mammalian Cells,(Cold Spring Harbor Laboratory),Wu et al.,eds.,Methods In Enzymology,Vols.154 and 155, Mayer and Walker,eds.(1987) Immunochemical Methods In Cell And Molecular Biology (Academic Press, London), Weir and Blackwell, eds., (1986) Handbook Of Experimental Immunology, Volumes I-IV; Manipulating the Mouse Embryo, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, (1986), Crooke, Antisense drug Technology: Principles, Strategies and Applications, 2nd Ed. CRC Press (2007), and Ausubel et al. (1989) Current Protocols in Molecular Biology (John Wiley and Sons, Baltimore, Md.). .

[0360] All of the references cited above, and all references cited herein, are incorporated herein by reference in their entirety.

[0361] The following examples are offered by way of illustration and not by way of limitation. EXAMPLES

[0362] Example 1 (a) Synthesis of alkyne-modified tyrosine: Alkyne-modified tyrosine was made as an intermediate for the synthesis of tissue-specific targeting moieties (TM, see FIG. 3 ) of cationic carrier units to target micelles of the present disclosure to the LAT1 transporter at the BBB.

[0363] A mixture of N-(tert-butoxycarbonyl)-L-tyrosine methyl ester (Boc-Tyr-OMe) (0.5 g, 1.69 mmol) and K2CO3 (1.5 eq, 2.54 mmol) in acetonitrile (4.0 ml) was added dropwise to propargyl bromide (1.2 eq, 2.03 mmol). The reaction mixture was heated at 60° C. overnight. After the reaction, the reaction mixture was extracted using water:ethyl acetate (EA). The organic layer was then washed using a brine solution. The crude was purified by flash column (10% EA in hexane). The obtained product was then dissolved in 1,4-dioxane (1.0 ml) and 6.0 M HCl (1.0 ml). The reaction mixture was heated at 100° C. overnight. Then, dioxane was removed and extracted with EA. Aqueous NaOH solution (0.5 M) was added to the mixture until the pH value was 7. The reaction mixture was concentrated by evaporating and centrifuged at 12,000 rpm at 0° C. The precipitate was washed with deionized water and freeze-dried.

[0364] (b) Synthesis of poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL): This synthesis step produced the water-soluble biopolymer (WP) and cationic carrier (CC) of the cationic carrier unit of the present disclosure (see FIG. 3).

[0365] Poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring-opening polymerization of Lys(TFA)-NCA using monomethoxy PEG (MeO-PEG) as a macroinitiator. In brief, MeO-PEG (600 mg, 0.12 mmol) and Lys(TFA)-NCA (2574 mg, 9.6 mmol) were dissolved in DMF containing 1 M thiourea and DMF (or NMP) separately. The Lys(TFA)-NCA solution was added dropwise to the MeO-PEG solution by a microsyringe, and the reaction mixture was stirred at 37 °C for 4 days. The reaction bottle was purged with argon and vacuum. All reactions were carried out under an argon atmosphere. After the reaction, the mixture was precipitated in an excess amount of diethyl ether. The precipitate was redissolved in methanol and precipitated again in cold diethyl ether. It was then filtered and a white powder was obtained after drying under reduced pressure. The next step was followed for deprotection of the TFA group of PEG-PLL(TFA).

[0366] MeO-PEG-PLL(TFA) (500 mg) was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was added dropwise to the polymer solution with stirring. The mixture was kept at 37° C. for 1 day with stirring. The reaction mixture was dialyzed against 10 mM HEPES 4 times and against distilled water. A white powder of PEG-PLL was obtained after lyophilization.

[0367] (b) Synthesis of azido-poly(ethylene glycol)-b-poly(L-lysine) (N3-PEG-PLL): This synthesis step produced the water-soluble biopolymer (WP) and cationic carrier (CC) of the cationic carrier unit of the present disclosure (see FIG. 3).

[0368] Azide-poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring-opening polymerization of Lys(TFA)-NCA with azide-PEG (N3-PEG). In summary, N3-PEG (300 mg, 0.06 mmol) and Lys(TFA)-NCA (1287 mg, 4.8 mmol) were dissolved in DMF containing 1 M thiourea and DMF (or NMP) separately. The Lys(TFA)-NCA solution was added dropwise to the N3-PEG solution by a microsyringe, and the reaction mixture was stirred at 37° C. for 4 days. The reaction bottle was purged with argon and vacuum. All reactions were carried out under an argon atmosphere. After the reaction, the mixture was precipitated in an excess amount of diethyl ether. The precipitate was redissolved in methanol and precipitated again in cold diethyl ether. It was then filtered and a white powder was obtained after drying under reduced pressure. The next step was followed for deprotection of the TFA group of PEG-PLL(TFA).

[0369] N3-PEG-PLL (500 mg) was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was added dropwise to the polymer solution under stirring. The mixture was kept at 37° C. for 1 day under stirring. The reaction mixture was dialyzed against 10 mM HEPES four times and against distilled water. A white powder of N3-PEG-PLL was obtained after lyophilization.

[0370] (c) Synthesis of (methoxy or) azido-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (N3-PEG-PLL(Nic / SH)): In this step, a tissue-specific adjuvant moiety (AM, see FIG. 3) was attached to the WP-CC component of the cationic carrier unit of the present disclosure. The tissue-specific adjuvant moiety (AM) used for the cationic carrier unit was nicotinamide (vitamin B3). This step results in the WP-CC-AM component of the cationic carrier unit shown in FIG. 3.

[0371] Azide-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (N3-PEG-PLL(Nic / SH)) was synthesized by chemical modification of N3-PEG-PLL and nicotinic acid in the presence of EDC / NHS. N3-PEG-PLL (372 mg, 25.8 μmol) and nicotinic acid (556.7 mg, 1.02 equivalents relative to the NH2 of PEG-PLL) were dissolved separately in a mixture of deionized water and methanol (1:1). EDC·HCl (556.7 mg, 1.5 equivalents relative to the NH2 of N3-PEG-PLL) was added to the nicotinic acid solution, and NHS (334.2 mg, 1.5 equivalents relative to the NH2 of PEG-PLL) was added stepwise to the mixture.

[0372] The reaction mixture was added to the N3-PEG-PLL solution. The reaction mixture was kept at 37°C for 16 hours with stirring. After 16 hours, 3,3'-dithiodipropionic acid (36.8 mg, 0.1 equiv.) was dissolved in methanol, EDC·HCl (40.3 mg, 0.15 equiv.) and NHS (24.2 mg, 0.15 equiv.) were dissolved in deionized water, respectively. Then, NHS and EDC·HCl were added sequentially to the 3,3'-dithiodipropionic acid solution. After the crude N3-PEG-PLL(Nic) solution was added, the mixture solution was stirred at 37°C for 4 hours.

[0373] For purification, the mixture was dialyzed against methanol for 2 h, DL-dithiothreitol (DTT, 40.6 mg, 0.15 eq.) was added, and then activated for 30 min.

[0374] To remove DTT, the mixture was dialyzed sequentially against methanol, 50% methanol in deionized water, and deionized water.

[0375] (d) Synthesis of phenylalanine-poly(ethylene glycol)-b-poly(L-lysine / nicotinamide / mercaptopropanamide) (Phe-PEG-PLL(Nic / SH)): In this step, a tissue-specific targeting moiety (TM) was attached to the WP-CC-AM building block synthesized in the previous step. The TM building block (phenylalanine) was generated by reaction of the intermediate generated in step (a) with the product of step (c).

[0376] To target cerebral vascular endothelial tissue, phenylalanine as an amino acid targeting LAT1 was introduced by click reaction between N3-PEG-PLL(Nic / SH) and alkyne-modified tyrosine in the presence of copper catalyst. In brief, N3-PEG-PLL(Nic / SH) (130 mg, 6.5 μmol) and alkyne-modified phenylalanine (5.7 mg, 4.0 equiv.) were dissolved in deionized water (or 50 mM sodium phosphate buffer). Then, CuSO4·H2O (0.4 mg, 25 mol%) and Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 3.4 mg, 1.2 equiv.) were dissolved in deionized water and the N3-PEG-PLL(Nic / SH) solution was added. Sodium ascorbate (3.2 mg, 2.5 equiv.) was then added to the mixture solution. The reaction mixture was maintained under stirring at room temperature for 16 h. After the reaction, the mixture was transferred to a dialysis membrane (MWCO = 7,000) and dialyzed against deionized water for 1 day. The final product was obtained after freeze-drying. Figure 4 shows the structure of the carrier unit. 1 Characterization by H-NMR is shown.

[0377] Example 2 Preparation of polyion complex (PIC) micelles Micelles were prepared once the cationic carrier units of the present disclosure were prepared as described in Example 1. The micelles described in the present examples contained cationic carrier units in combination with an antisense oligonucleotide payload.

[0378] Nanosized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL (Nic) and miRNA. PEG-PLL (Nic) was dissolved in HEPES buffer (10 mM) at a concentration of 0.5 mg / mL. Then, miRNA solution (22.5 μM) in RNase-free water was mixed with the polymer solution at a miRNA to polymer ratio of 2:1 (v / v).

[0379] The mixing ratio of polymer to anti-miRNA was determined by optimizing the micelle formation conditions, i.e., the ratio of amines in the polymer (the carrier of the present disclosure) to phosphates in the anti-miRNA (payload). The mixture of polymer (carrier) and anti-miRNA (payload) was vigorously mixed by multi-vortex at 3000 rpm for 90 seconds and kept at room temperature for 30 minutes to stabilize the micelles.

[0380] The particle size distribution and scattered light intensity (SLI) were measured by Zeta-sizer at a wavelength of 634 nm. Figure 9 shows the particle size distribution of miRNA-loaded polyion complex micelles in PBS. The anti-miRNA-loaded micelles showed a particle size of less than 60 nm with a low PDI distribution, indicating that the complexes were uniform particles. As shown in Figure 9, the peak of the distribution was at 32 nm.

[0381] Micelles (anti-miRNA concentration of 10 μM) were stored at 4 °C before use. MeO- or Phe-micelles were prepared using the same method, and micelles containing different amounts of Phe (25%–75%) were also prepared by mixing both polymers during micelle preparation.

[0382] Example 3 Brain targeting using LAT1 and phenylalanine In order to allow the micelles of the present disclosure to penetrate the BBB, LAT1 was selected as a target molecule. As shown in Figure 10, LAT1 was preferentially expressed in the brain in humans. Figure 11 shows that LAT1 was also preferentially expressed in brain tissue in mice.

[0383] To investigate the feasibility of passing the blood-brain barrier using LAT1 protein, Cy5.5 dye or Cy5.5-labeled phenylalanine was intracerebroventricularly administered to mice (n=3), and the fluorescence intensity of brain lysates was analyzed 1 hour after injection. For measurement, Cy5.5 was labeled by click reaction with alkyne-modified tyrosine and N3-Cy5.5.

[0384] Cy5.5-labeled phenylalanine or N3-Cy5.5 (20 μg Cy5.5 concentration) was administered separately by intracerebroventricular injection, and the same volume of PBS was also injected as a control. One hour after injection, all mice (n=3) were sacrificed and the remaining blood was washed with 5 mL PBS for perfusion. Mouse brains were removed and homogenized with lysis buffer using a probe-type sonicator. Lysate samples were transferred to a 96-well plate, and the fluorescence intensity was measured by a multiplate reader at Ex / Em=650 / 690.

[0385] The brain-targeted fluorescently labeled (Cy5.5) carrier unit was indeed able to bind to LAT1 expressed in the brain parenchyma and showed higher accumulation levels than the non-targeted Cy5.5 molecule, see FIG. 12.

[0386] Anti-miRNA-loaded polyion complex micelles targeted to LAT1 (i.e., micelles of the present disclosure) were able to cross the BBB and significantly accumulated in the brain compared to non-targeted micelles.

[0387] Example 4 In vivo stability of micelles of the present disclosure The in vivo stability of the micelles disclosed herein was evaluated by measuring the circulating blood behavior after systemic injection of the micelles. Mice were systemically injected with Cy5.5-labeled miRNA-loaded micelles and naked Cy5.5-labeled miRNA (20 μg miRNA concentration), and 120 μL of blood was collected from the tail vein at the desired time points. The blood samples were centrifuged at 2,500 rpm, and the supernatant plasma samples were transferred to a 96-well plate. The residual fluorescence intensity of the plasma was analyzed by a multiplate reader at Ex / Em=650 / 690.

[0388] Encapsulation of anti-microRNA payloads in micelles of the present disclosure resulted in increased stability. See FIG. 8. Under control conditions, anti-microRNA (antimiR) had a plasma half-life of less than 5 minutes. However, after incorporation of anti-miRNA into micelles of the present disclosure, the plasma half-life increased to 80-120 minutes. The stability of the micelles was not affected by the loading of different anti-miRNAs. Micelles whose carrier units did not contain antimiR were stable as were those with carrier units complexed with 25% or 50% antimiR.

[0389] Example 5 Experiments with Alzheimer's disease models (i) Materials and methods (a) Mice: 5XFAD APP transgenic mice (stock number: 34840-JAX) were purchased from Jackson Laboratory. TG and age-matched wild-type (WT) littermates were used in the study. All animals were housed individually in cages under a 12 / 12-h light / dark cycle with controlled temperature and humidity, as well as food and water. 5xFAD mice, also known as APP / PS1, Tg6799, or Tg-5xFAD, are an animal model system for Alzheimer's disease. 5xFAD mice express human APP and PSEN1 transgenes with a total of five AD-associated mutations: Swedish (K670N / M671L), Florida (I716V), and London (V717I) mutations in APP, and M146L and L286V mutations in PSEN1. Three lines were originally generated: Tg6799, Tg7031, and Tg7092. The Tg6799 line, which expresses the highest levels of mutant APP, is the most studied of the three. These widely used mice recapitulate many AD-related phenotypes and have relatively early and aggressive symptoms.

[0390] Amyloid plaques associated with gliosis are observed in mice as young as 2 months of age. Amyloid pathology is more severe in females than in males. Neuronal loss occurs in multiple brain regions, beginning at approximately 6 months in areas with the most prominent amyloidosis. Mice exhibit a variety of cognitive and motor deficits.

[0391] 3xTg-AD mice carrying three human transgenes, APP (Swe), PS1 (M146V), and tau (P301L), were purchased from Jackson Laboratory. 3xTg-AD mice were generated on a C57BL6 / 129SvJ hybrid background. Mice were housed 4–5 per cage and maintained under a 12-h light-dark cycle, with free access to food and water. Translation of the overexpressed transgene appears to be restricted to the central nervous system, specifically areas associated with Alzheimer's disease, including the hippocampus and cerebral cortex. Initial characterization of this mouse strain showed a progressive increase in deposition of amyloid-β peptide, with intracellular immunoreactivity detected in some brain regions as early as 3–4 months. Synaptic transmission and long-term potentiation are clearly impaired in 6-month-old mice. Between 12–15 months, aggregates of hyperphosphorylated tau with altered conformation are detected in the hippocampus. The mutant mice display plaque and tangle pathology associated with synaptic dysfunction, a feature similar to that observed in Alzheimer's disease patients.

[0392] (b) ASO-MDS treatment (intravenous injection): miR-485-3p antagomiR (antimiR) in micelles (ASO-MDS) of the present disclosure or negative control (miR and micelles only) were prepared for intravenous (IV) injection. All treatments of 8-month-old 5XFAD mice were achieved by intravenous injection of 1.5 mg / kg ASO-MDS on days 7, 14, 21, and 28. See FIG. 17.

[0393] (c) Immunohistochemical staining: For immunohistochemical staining, brains were removed, post-fixed, and embedded in paraffin. Coronal sections (10 μm thick) through the infarcted area were made using a microtome and mounted on glass slides. Paraffin was removed, and sections were washed with PBS-T and blocked with 10% bovine serum albumin for 2 h. The following primary antibodies were then added: rabbit anti-β-amyloid (1–42) (Cell Signaling Technology, Cat#14974), mouse anti-GFAP (Merck, Cat#MAB360), rabbit anti-IL-1β (Abcam, Cat#9722), mouse anti-TNF-α (Santa Cruz, Cat#sc-52746), and anti-actin (Santa Cruz, Cat#sc-47778). After behavioral testing, hippocampal and cortical regions were dissected from H / I mice, and brain tissues were homogenized in ice-cold RIPA buffer containing protease inhibitors. The homogenates were centrifuged at 12,000 rpm for 30 min at 4°C, and the supernatants were collected. Results were visualized using an enhanced chemiluminescence system and quantified by densitometric analysis (Image J software, NIH). All experiments were performed independently at least three times.

[0394] (d) Behavioral tests (Y-maze and passive avoidance): The Y-maze consisted of three black opaque plastic arms (30 cm x 8 cm x 15 cm) at 120° to each other. 5XFAD mice were placed in the center and allowed to explore all three arms. The number of arm entries and the number of trials (standard for number of alternations is three entries into different arms 10 cm from the center) were recorded to calculate the alternation rate. An entry was defined as all three limbs entering an arm of the Y-maze. Alternation was defined as the number of trials divided by the number of arm entries minus 2 and multiplied by 100. The chamber for passive avoidance testing was divided into a white (light) and a black (dark) compartment (41 cm x 21 cm x 30 cm). The light compartment was equipped with a 60 W light bulb. The floor (in the dark room) contained a number of (2 mm) stainless steel rods spaced 5 mm apart. Testing was performed for 3 days.

[0395] On the first day, the mice were habituated to the light compartment for 5 min. The second day was a training phase consisting of two steps. In the first step, each mouse was placed in the light compartment and moved to the dark compartment twice. One hour after the first step, each mouse was placed in the light compartment. The door separating the two compartments was opened after 30 s. When the mouse entered the dark compartment, the door was closed and an electric foot shock (0.3 mA / 10 g) was administered for 3 s through the grid floor. If the mouse did not enter the dark compartment for more than 5 min, it was considered to have learned, and training was performed up to 5 times. 24 hours after the training test, the mouse was placed in the light compartment for testing. The latency was defined as the time it took the mouse to enter the dark compartment after the door separating the two compartments was opened. The time it took the mouse to enter the dark compartment and exit the light compartment was defined as TDC (time spent in the dark compartment).

[0396] (e) Data analysis: All data were expressed as mean ± standard deviation. Post-hoc comparisons (Student-Newman-Keuls test) were performed using Prism 8. Behavioral tests were evaluated by non-parametric statistics. Comparisons among the three groups (control (miR only and micelles only) vs. HI-485-3p) were analyzed by Mann-Whitney U test.

[0397] (ii) Results miRNA-485-3p can be increased in patients with Alzheimer's disease, causing, for example, inflammation, changes in mitochondrial function, and apoptosis. See Figure 23. Thus, micelles of the present disclosure loaded with antimiRs targeting miRNA-485-3p were administered to a mouse model of Alzheimer's disease. These micelles containing antimiR-485-3p are referred to in the figures and throughout this application as "ASO-MDS" (antisense oligonucleotide-micelle delivery system) or "micelle + antimiR-485-3p".

[0398] After ASO-MDS micelles were injected weekly for 4 weeks into 8-month-old 5XFAD transgenic mice, it was observed that neuroinflammation was reduced in the cortex and hippocampus of 5XFAD mice after injection. See Figures 19A, 19B, 20A, and 20B. Furthermore, administration of ASO-MDS micelles caused a reduction in amyloid plaque burden. Figures 21A and 21B. Treatment with ASO-MDS also led to restoration of neurogenesis. See Figures 22A and 22B. In addition to improvements in inflammation, amyloid plaque burden, and neurogenesis, treatment with ASO-MDS also improved cognitive function as shown by Y-maze and passive avoidance tests. See Figures 23A and 23B.

[0399] ASO-MDS showed significantly higher percent alternation, i.e., about 80% alternation, while the negative control showed about 50% in the Y-maze test. See Figure 23A. ASO-MDS also showed significantly less time spent in the dark compartment (seconds) compared to the negative control.

[0400] Example 6 K-Ras silencing in pancreatic cancer To determine whether the micelles of the present disclosure can be used to effectively deliver anti-cancer therapeutics (see FIG. 25), micelles of the present disclosure were targeted to human pancreatic cells using (i) traditional cRGD tumor targeting with peptide ligands or (ii) an alternative targeting strategy (X-target). The payload of the micelles was an antisense oligonucleotide targeting K-Ras.

[0401] Pancreatic tumor mice (n=3) were established 10 days after injection of Panc1 cells into mice. Panc1 is a human cell line used as a pancreatic cancer model. This cell line was established from a pancreatic adenocarcinoma (epithelioid carcinoma) of ductal origin. The cells have a G6PD type B phenotype. Lieber M,et al.“Establishment of a continuous tumor-cell line(panc-1)from a human carcinoma of the exocrine pancreas.”Int.J.Cancer 15:741-747,1975. The two types of micelles mentioned above were intravenously injected once a day for three times. See Figure 26A. After tumor removal, gene silencing effects were evaluated by RT-PCR.

[0402] Administration of micelles with conventional cRGD tumor targeting peptide ligands resulted in approximately 20% knockdown of K-Ras. In contrast, administration of micelles using the alternative X-targeting system resulted in approximately 50% gene knockdown. See Figure 26B.

[0403] Example 7 Intracellular uptake behavior of ASO-MDS in human brain cells Human primary microglia, astrocytes, hepatocytes, and SH-5Y cells were seeded overnight in 6-well plates. Cells were treated with 100 nM Cy5.5-labeled ASO-MDS. ASO-MDS uptake in cells was measured every hour for a total of 48 hours. Uptake capacity was calculated by tracking the percent confluency of the wells using an Incucyte S3 instrument.

[0404] To investigate the uptake ability according to cell type, Cy5.5-labeled ASO-MDS was prepared and the ASO-MDS stock solution was diluted with PBS. The uptake of ASO-MDS was increased in human primary microglia, astrocytes, and SH-5Y cells, but not in human primary hepatocytes (Figure 13). This indicated that ASO-MDS could be specifically delivered to brain cells.

[0405] Example 8 In vitro LAT1 targeting of anti-microRNA-loaded micelles To evaluate the targeting of LAT1 by ASO-MDS micelles, GL-26 cells were used. GL-26 cells were seeded in 96-well plates with DMEM containing 10% FBS, 1% P / S. Four types of samples were used: (i) cells incubated with ASO-MDS targeted to LAT1 ("targeted micelles"); (ii) cells incubated with ASO-MDS not targeted to LAT1 ("non-targeted micelles"); (iii) a sample similar to (i), but in which LAT1 activity in cells was inhibited by preincubation with phenylalanine ("targeted micelles / inhibitors"); and (iv) a sample similar to (ii), but in which LAT1 activity in cells was inhibited by preincubation with phenylalanine ("non-targeted micelles / inhibitors").

[0406] After 24 hours of incubation at 37°C, the medium was replaced with fresh one and 1 mM free phenylalanine was added to samples (iii) and (iv) to inhibit LAT1. The cells were then incubated for another hour and Cy5.5-labeled anti-microRNA-loaded micelles (ASO-MDS) were added at an RNA concentration of 300 nM. The medium was removed and washed twice with PBS, and 100 μL of PBS was added to each well. The remaining fluorescence intensity of the cells was measured using a microplate reader at excitation wavelength: 650 / emission wavelength: 690.

[0407] The residual fluorescence intensity of cells treated with targeted micelles was approximately three times higher than that of cells treated with nontargeted micelles, indicating that the uptake of Cy5.5-labeled anti-microRNA was increased when ASO-MDS micelles were targeted to LAT1.

[0408] When cells treated with either targeted or non-targeted ASO-MDS were preincubated with an LAT1 inhibitor, there was no significant difference in the cellular uptake of Cy5.5-labeled anti-microRNA (Figure 14). This indicated that targeting of ASO-MDS micelles to LAT1 was not sufficient to increase the uptake of Cy5.5-labeled anti-microRNA by cells when LAT1 was inhibited by phenylalanine. In other words, LAT1-mediated uptake of payloads encapsulated in micelles of the present disclosure, where the micelles are targeted to LAT1, depends on the functional state of LAT1.

[0409] Example 9 Biodistribution of anti-microRNA-loaded micelles The biodistribution of anti-microRNA was measured using the IVIS Live Animal Imaging Station. To compare the time-dependent difference in anti-microRNA distribution for naked anti-microRNA and anti-microRNA-loaded micelles (ASO-MDS), both samples (25 μg RNA concentration) were administered to mice via tail vein injection. Fluorescent images of the mice were acquired using the IVIS Live Animal Imaging Station at the desired time points and observed for 16 hours.

[0410] The remaining fluorescence intensity of mice treated with naked anti-microRNA showed rapid localization to the kidney, and the signal almost disappeared at 4 hours. For anti-microRNA-loaded micelles (ASO-MDS), the fluorescence intensity was mainly localized to the brain, liver, and kidney. The fluorescence gradually increased in the kidney until 6 hours and decreased over time. These results indicated that naked anti-microRNA was quickly excreted (within 4 hours) by urine due to the small size of the molecule. Meanwhile, anti-microRNA-loaded micelles (ASO-MDS) showed a long circulation, accumulating in the brain region until 16 hours, and the remaining anti-microRNA was excreted by urine. See Figure 15.

[0411] Example 10 In vitro phagocytosis assays (ELISA and immunocytostaining) Primary mixed glial cells (2 × 10 5 cells) or human primary microglial cells (2 × 10 5 Cells (1 x 10 cells) were cultured overnight in 6-well plates. Cells were treated with ASO-MDS together with fAβ at a final concentration of 1 μM for 4 h. The levels of human Aβ(1–42) in the supernatants were measured using a human Aβ42 ELISA kit (Invitrogen, Cat#KHB3441) according to the manufacturer's instructions.

[0412] In addition, phagocytosis of human primary microglial cells was confirmed by fluorescence microscopy. Coverslips were placed in wells of a 24-well plate, with 8 × 10 cells per cover slip. 4 The ASO-MDS was incubated overnight with human primary microglial cells. Human primary microglial cells were treated with ASO-MDS and incubated with unlabeled fAβ at a final concentration of 1 μM for 4 h. After 4 h, the cells were washed with cold PBS. Then, for measurement of Aβ uptake, the primary glial cells were fixed with 100% methanol at -20 °C for 1 h, washed with PBS-T, and incubated with mouse anti-amyloid β1-16 or rabbit anti-Iba-1 antibodies at 4 °C.

[0413] To evaluate the effect of ASO-MDS on phagocytosis in glial cells, Aβ monomers (100 μM) were incubated at 37° C. for 24 hours, and then Aβ aggregates were prepared by diluting peptide stocks in cell cu...

Claims

1. (i) a water-soluble biopolymer moiety comprising polyethylene glycol (PEG); (ii) a positively charged carrier moiety comprising one or more lysines; (iii) an adjuvant moiety comprising vitamin B3, and (iv) a phenylalanine-containing targeting moiety A cationic carrier unit comprising: the targeting moiety is linked to a water soluble polymer; the water-soluble biopolymer moiety and the positively charged carrier moiety are linked to each other directly or via a bifunctional linker; the one or more lysines comprise: (a) a portion of lysine units covalently linked to the adjuvant moiety ("AM-linked lysine units"); and (b) a portion of lysine units that are positively charged; Each AM-binding lysine unit is covalently linked to a vitamin B3 unit, a cationic carrier unit.

2. A micelle comprising a plurality of the cationic carrier units of claim 1 and an anionic payload, wherein the positively charged carrier moieties and the anionic payload are associated with each other via covalent, non-covalent or ionic bonds.

3. The micelle of claim 2 , wherein the positively charged carrier moieties and the anionic payloads of the plurality of cationic carrier units are associated with each other via a covalent bond.

4. 3. The micelle of claim 2, wherein the positively charged carrier moieties and the anionic payloads of the plurality of cationic carrier units are associated with each other via ionic bonds.

5. The micelle of claim 2, wherein the positive charges of the cationic carrier moieties in the micelle and the negative charges of the anionic payload are in a charge ratio of about 3:1 to about 1:

3.

6. The micelle of claim 5 , wherein the positive charge of the cationic carrier moiety in the micelle and the negative charge of the anionic payload are in a charge ratio of about 1:

1.

7. The micelle of claim 5, wherein the positive charges of the cationic carrier moieties in the micelle and the negative charges of the anionic payload are in a charge ratio of about 1:2 or 2:

1.

8. 8. The micelle of claim 7, wherein the anionic payload comprises a nucleic acid selected from the group consisting of messenger ribonucleic acid (mRNA), microRNA (miRNA), miRNA sponge, tough decoy miRNA, antimir, small RNA, rRNA, small interfering RNA (siRNA), short hairpin RNA (shRNA), genomic deoxyribonucleic acid (gDNA), complementary (cDNA), plasmid (pDNA), peptide nucleic acid (PNA), bridged nucleic acid (BNA), antisense oligonucleotide (ASO), aptamer, cyclic dinucleotide, or any combination thereof.

9. The micelle of claim 8 , wherein the anionic payload comprises an antisense oligonucleotide (ASO).

10. The micelle of claim 8 , wherein the anionic payload comprises an siRNA.

11. The micelle of claim 8, wherein the nucleic acid comprises a nucleotide sequence having a length of 5 to 30 nucleotides.

12. The water soluble biopolymer portion has the structure 【Chemistry 101】 (Wherein, n is 1 to 1000.) The micelle of claim 2 comprising:

13. The water soluble biopolymer portion has the structure 【Chemistry 102】 (In the formula, R ３ is hydrogen, methyl, or ethyl, and n is 2 to 200. The micelle of claim 2 comprising:

14. 14. The micelle of claim 12 or 13, wherein n is from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, or from about 150 to about 160.

15. The micelle of any one of claims 2 to 13, wherein the water-soluble biopolymer portion comprises from about 100 to about 150 ethylene glycol units.

16. The micelle of any one of claims 2 to 13, wherein the positively charged carrier moiety comprises from about 30 to about 1000 lysines.

17. 14. The micelle of any one of claims 2 to 13, wherein the positively charged carrier moiety comprises about 30, about 40, about 50, about 60, about 70 or about 80 lysines.

18. A micelle according to any one of claims 2 to 13, wherein the adjuvant moieties are attached at one or more positions along the positively charged carrier moiety.

19. A micelle according to any one of claims 2 to 13, wherein the adjuvant moiety comprises at least 10 vitamin B3.

20. A micelle according to any one of claims 2 to 13, wherein the adjuvant moiety comprises 20 to 40 vitamin B3.

21. (a) the water-soluble polymer comprises from about 40 to about 1000 ethylene glycol units; (b) the cationic carrier moiety comprises from about 3 to about 100 lysines; (c) the adjuvant moiety comprises 1-100 vitamin B3; A micelle according to any one of claims 2 to 13.

22. (a) the water soluble polymer comprises about 40, 100, 150, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 ethylene glycol units; (b) the cationic carrier moiety comprises about 3, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 lysines; (c) the adjuvant portion comprises about 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, or 100 vitamin B3; A micelle according to any one of claims 2 to 13.

23. (a) the water-soluble polymer comprises from about 100 to about 120 ethylene glycol units; (b) the cationic carrier moiety comprises about 30 to about 40 lysines; (c) the adjuvant moiety comprises about 5 to about 10 vitamin B3; A micelle according to any one of claims 2 to 13.

24. (a) the water-soluble polymer comprises about 120 to about 130 ethylene glycol units; (b) the cationic carrier moiety comprises from about 70 to about 90 lysines; (c) the adjuvant portion comprises about 20 to about 40 vitamin B3; A micelle according to any one of claims 2 to 13.

25. A micelle described in any one of claims 2 to 13, wherein the diameter of the micelle is between 40 nm and 70 nm.

26. A pharmaceutical composition comprising a micelle according to any one of claims 2 to 13 and a pharma- ceutically acceptable carrier.

27. A composition for the treatment of a disease or condition comprising a micelle according to any one of claims 2 to 13.

28. 28. The composition of claim 27, wherein the disease is a cancer selected from glioma, breast cancer, pancreatic cancer, liver cancer, skin cancer, and cervical cancer.

29. 28. The composition of claim 27, wherein the disease is a neurodegenerative disease.

30. 28. The composition of claim 27, wherein the disease is Alzheimer's disease and the micelles reduce amyloid plaque burden.

Images