Cordyceps sieboldii strain that does not produce thyroxine and method for producing same

Abstract

To provide a Cordyceps militaris strain that does not produce ustiloxin, and to provide a method for creating the same.SOLUTION: The accession number of a Cordyceps militaris strain that does not produce ustiloxin is CGMCC No.40266, and CCM_02059 gene, CCM_02060 gene, or CM_02059 to CCM_02060 genes are not contained. A method for creating the Cordyceps militaris strain by CRISPR / Cas9 gene editing comprises: a step S1 of determining and synthesizing the sgRNA nucleotide sequence of a target gene; a step S2 of determining and synthesizing the nucleotide sequences of upstream and downstream homologous arms of the target gene; a step S3 of constructing a knockout vector by linking the sgRNA nucleotide sequence and the homologous arm nucleotide sequence to pAMA1-Cas9-hyg of the vector; and a step S4 of transforming the knockout vector into protoplasts of Cordyceps militaris via PEG.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to the technical field of genetic breeding of edible fungi, in particular to a Cordyceps truncatula strain that does not produce thyroxine, and a method for producing said strain by CRISPR / Cas9 gene editing. [Background technology]

[0002] Cordyceps militaris (L.) Fr. is the type species of the genus Cordyceps, and is rich in various active ingredients such as cordycepin, cordyceps polysaccharides, cordyceps acid, and carotenoids, and has various pharmacological activities such as antibacterial, anti-fatigue, antitumor, and immunoregulation, making it a good resource for food and pharmaceutical development. At present, Cordyceps fruiting bodies are not only sold as products, but also developed into various foods, health foods, cosmetics, etc., and in China, it has become an industrial chain with an annual output of 10 billion yuan.

[0003] Fungal secondary metabolites have diverse structures and biological activities. The inventors' group was able to confirm that Cordyceps pulcherrimus produces ustiloxin B by high-performance liquid chromatography-high-resolution mass spectrometry. The content of ustiloxin B was 106.5 μg / g in a mixture of insect bodies and mycelium using silkworm pupae as a cultivation substrate, and 66.9 μg / g in fruiting bodies using wheat medium as a cultivation substrate. In addition, ustiloxin B was detected in all fruiting bodies of Cordyceps pulcherrimus cultivated from different origins (Wang Anning, Study on the light-regulated secondary metabolite synthesis gene clusters of two Cordyceps pulcherrimus, Master's thesis, University of Chinese Academy of Sciences, 2022).

[0004] Ustiloxin is a mycotoxin produced by rice malt fungus, and can contaminate water sources and rice. Currently, no toxicity tests have been reported for ustiloxin B, but in a toxicity test for ustiloxin A using mice, when ustiloxin A was administered intraperitoneally at a dose of 400 μg / kg body weight, lesions were observed in the mouse liver and kidney after 10 to 12 days. If the dosage of ustiloxin A in the current mouse toxicity test is taken as a reference and is within the range of the prescribed intake amount of Cordyceps gracilis (the former Ministry of Health set the intake amount of Cordyceps gracilis at 2 g / day or less), the content of ustiloxin will not cause a food safety problem for Cordyceps gracilis. However, the toxicity of ustiloxin B is currently unknown, and there has been little research on the toxicity of ustiloxin to healthy and sub-healthy people. Therefore, it is of great significance to develop a Cordyceps gracilis strain that does not produce ustiloxin. Summary of the Invention

[0005] The present invention has been made in consideration of the above-mentioned problems, and aims to create a Cordyceps mutans strain that does not produce thyroxine by using CRISPR / Cas9 (Clustered regularly interspaced short palindromic repeats / Cas9) gene editing, to provide a new strain for the safe production of Cordyceps mutans, and to provide genetic material for the directional improvement of new varieties of the same.

[0006] In one aspect, the present invention provides a Cordyceps fasciatus strain that does not produce thyroxine, which is currently deposited at the Center for Ordinary Microorganisms, China Commission for the Preservation and Management of Microbial Species (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, Accession Number: CGMCC No. 40266, Date of Deposit: August 3, 2022).

[0007] In another aspect, the present invention provides a method for producing a Cordyceps mutans strain that does not produce thyroxine by CRISPR / Cas9 gene editing, the method comprising the steps of: Step S1: Determine and synthesize the sgRNA nucleotide sequence for the target gene. Step S2: The nucleotide sequences of the upstream and downstream homologous arms of the target gene are determined and synthesized. Step S3: The sgRNA nucleotide sequence obtained in step S1 and the homologous arm nucleotide sequence obtained in step S2 are ligated into the vector pAMA1-Cas9-hyg to construct a knockout vector. Step S4: The knockout vector described above in step S3 is transformed into Cordyceps protoplasts via PEG mediation to obtain a transformant containing the knockout vector.

[0008] In an embodiment of the present invention, the target gene is the CCM_02059 gene, the CCM_02060 gene, or the CCM_02059 to CCM_02060 genes of Cordyceps persicae. The nucleotide sequences of the CCM_02059 gene and the CCM_02060 gene are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively.

[0009] In an embodiment of the present invention, the method for creating a Cordyceps mutans strain that does not produce thyroxine by CRISPR / Cas9 gene editing further comprises the following steps. Step S5: At the genomic DNA level, transformants in which the target gene has been knocked out, ie, positive transformants, are identified from the transformants obtained in step S4 using PCR. Step S6: At the cDNA level, the positive transformants obtained in step S5 are verified by semi-quantitative RT-PCR (Reverse Transcription PCR) to confirm that the target genes of the positive transformants are not expressed at the transcription level. Step S7: The positive transformant obtained in step S6 is subcultured to obtain a Cordyceps strain from which the vector has been deleted and which does not contain a foreign gene. Step S8: Detect the thyroxine content in the fruiting bodies of the Cordyceps miliaria strain identified in step S7.

[0010] In a third aspect, the present invention provides a CRISPR / Cas9 gene editing vector that uses pAMA1-Cas9-hyg as a backbone vector, and further comprises an sgRNA nucleotide sequence of a target gene and nucleotide sequences of upstream and downstream homologous arms of the target gene, wherein the target gene is the CCM_02059 gene (sequence number 1), the CCM_02060 gene (sequence number 2), or the CCM_02059 to CCM_02060 genes.

[0011] In a fourth aspect, the present invention provides a nucleotide sequence involved in the regulation of thyroxine synthesis in Cordyceps truncatula as set forth in SEQ ID NO:1 or SEQ ID NO:2.

[0012] The present invention has obvious beneficial effects compared to conventional factory-produced Cordyceps strains. The present invention uses CRISPR / Cas9 gene editing technology to knock out the CCM_02059 gene, CCM_02060 gene, or CCM_02059-CCM_02060 gene in the Cordyceps genome, thereby producing a Cordyceps strain that does not affect the growth of fruiting bodies and does not produce thyroxine. This can avoid potential health hazards caused by large-scale consumption of Cordyceps, and can also avoid food safety issues caused by genetic recombination into the genome, providing ideas and experimental evidence for directional breeding of Cordyceps. [Brief description of the drawings]

[0013] [Figure 1] FIG. 1 shows the structure of pAMA1-Cas9-hyg, a vector according to the present invention. [Diagram 2] FIG. 1 illustrates a gene knockout strategy according to an embodiment of the present invention. [Diagram 3] Agarose gel electrophoresis graphs of PCR verification of genomic DNA and cDNA of transformants, of which: A. PCR verification of genomic DNA, 33 is positive transformant, 34 is negative control, WT is wild type; B. Semi-quantitative RT-PCR verification, amplification of CCM_02059 semi-quantitative primers, WTc is cDNA, WTg is genomic DNA of wild type. [Figure 4] 1 is a graph of high performance liquid chromatography and mass spectrometry of thyroxine. [Diagram 5] FIG. 1 shows the growth of silkworm pupae and fruiting bodies in wheat medium, where A is wheat medium and B is silkworm pupa medium. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] The technical solution of the present invention will be described below clearly and completely with reference to specific embodiments, and it is understood that the embodiments described below are for illustrating the present invention and should not be regarded as limiting the scope of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without using inventive ability also belong to the protection scope of the present invention.

[0015] The present inventors have found that one gene cluster (CCM_02054-CCM_02066) in the Cordyceps genome is related to the synthesis of ustyroxine B, and further confirmed that the proteins that are the gene products encoded by the core genes CCM_02059 and CCM_02060 of the ustyroxine B synthesis gene cluster contain the same oxidase conserved domain DUF3328. This domain plays an important role in the formation of the initial cyclic peptide skeleton of ustyroxine. Therefore, by knocking out the CCM_02059 and CCM_02060 genes in the Cordyceps genome and disrupting the ustyroxine synthesis gene cluster, a Cordyceps strain that does not produce ustyroxine can be obtained.

[0016] CRISPR / Cas9 editing technology can improve strains by directional editing of the genome, and compared to conventional breeding methods such as crossbreeding, mutation, and domestication, it has the advantages of clear purpose, short operation time, simplicity and efficiency, and no insertion of foreign DNA fragments. Furthermore, the vector element AMA1 (a self-replicating nucleotide sequence in filamentous fungi) allows the vector to maintain replication independent of the chromosome, so the vector is hardly inserted into the fungal genome. Vectors can be easily deleted in transformants under conditions without the selective pressure of antibiotics, so true gene editing without the insertion of foreign genes can be achieved, and the safety issues of gene introduction can be avoided.

[0017] Therefore, if we can use CRISPR / Cas9 editing technology to knock out the CCM_02059 and CCM_02060 genes in the Cordyceps genome and destroy the thyroxine synthesis gene cluster, i.e., lose the ability to synthesize thyroxine, it will be possible to obtain a Cordyceps strain that does not produce thyroxine, thereby realizing the present invention.

[0018] In one aspect, the present invention provides a Cordyceps strain that does not produce thyroxine. The genome of the strain lacks the CCM_02059 gene, the CCM_02060 gene, or both, i.e., the CCM_02059 to CCM_02060 genes. The mycelium of the gene-deficient Cordyceps strain of the present invention on a plate medium does not differ significantly from the wild strain in terms of growth rate and degree of discoloration due to light (accumulation of carotenoids), and can grow normally up to fruiting bodies on wheat medium and in silkworm pupae. Therefore, the gene deletion does not have an adverse effect on the cultivation properties of Cordyceps.

[0019] In an embodiment of the invention, the nucleotide sequence of the CCM_02059 gene is shown in SEQ ID NO:1, and the nucleotide sequence of the CCM_02060 gene is shown in SEQ ID NO:2.

[0020] In another aspect, the present invention provides a method for producing a Cordyceps mutans strain that does not produce thyroxine by CRISPR / Cas9 gene editing, the method comprising the steps of: Step S1: Determine and synthesize the sgRNA nucleotide sequence for the target gene. Step S2: The nucleotide sequences of the upstream and downstream homologous arms of the target gene are determined and synthesized. Step S3: The sgRNA nucleotide sequence obtained in step S1 and the homologous arm nucleotide sequence obtained in step S2 are ligated into the vector pAMA1-Cas9-hyg to construct a knockout vector. Step S4: The knockout vector described above in step S3 is transformed into Cordyceps protoplasts via PEG mediation to obtain transformants containing the knockout vector.

[0021] In an embodiment of the present invention, the method for producing a Cordyceps mutans strain that does not produce thyroxine by CRISPR / Cas9 gene editing further comprises the following steps. Step S5: At the genomic DNA level, transformants in which the target gene has been knocked out, ie, positive transformants, are identified from the transformants obtained in step S4 using PCR. Step S6: At the cDNA level, the positive transformants obtained in step S5 are verified by semi-quantitative RT-PCR to confirm that the target genes of the positive transformants are not expressed at the transcriptional level. Step S7: The positive transformant obtained in step S6 is subcultured to obtain a Cordyceps strain from which the vector has been deleted and which does not contain a foreign gene. Step S8: Detect the thyroxine content in the fruiting bodies of the Cordyceps miliaria strain identified in step S7.

[0022] In an embodiment of the present invention, the target gene is CCM_02059, CCM_02060, or the CCM_02059 to CCM_02060 genes in the Cordyceps genome.

[0023] In an embodiment of the present invention, the sgRNA nucleotide sequence is 20 bp upstream of the protospacer-associated motif (PAM) of the target gene, i.e., 5'-N20-NGG-3', where NGG is the PAM nucleotide sequence and N20 is the recognition nucleotide sequence of 20 bp. A double-strand break (DSB) is formed in the target gene using CRISPR / Cas9 technology, and homologous arm nucleotide sequences are introduced at both ends by the fungus' own DSB repair mechanism, initiating homologous recombination repair. In addition, the upstream homologous arm nucleotide sequence is located upstream of the coding region of the target gene, and the downstream homologous arm nucleotide sequence is located downstream of the coding region of the target gene. The upstream and downstream homologous arm nucleotide sequences are tightly bound to each other, thereby completely deleting the target gene without the insertion of a resistance gene.

[0024] In a specific embodiment of the present invention, for the CCM_02059 gene, i.e., when only the CCM_02059 gene is knocked out, the sgRNA nucleotide sequence is Target1, the nucleotide sequence of which is shown in SEQ ID NO:3, and the sequence of the synthesized Target1 expression cassette is shown in SEQ ID NO:4.

[0025] In a specific embodiment of the present invention, for the CCM_02059 gene, i.e., when only the CCM_02059 gene is knocked out, the upstream homologous arm nucleotide sequence is shown in SEQ ID NO: 5, and the downstream homologous arm nucleotide sequence is shown in SEQ ID NO: 6. The primers for synthesizing the upstream homologous arm nucleotide sequence are up 1-F (SEQ ID NO: 7) / up 1-R (SEQ ID NO: 8), and the primers for synthesizing the downstream homologous arm nucleotide sequence are down 1-F (SEQ ID NO: 9) / down 1-R (SEQ ID NO: 10).

[0026] In a specific embodiment of the present invention, for the CCM_02060 gene, i.e., when only the CCM_02060 gene is knocked out, the sgRNA nucleotide sequence is Target2, the nucleotide sequence of which is shown in SEQ ID NO: 11. The sequence of the synthesized Target2 expression cassette is shown in SEQ ID NO: 12.

[0027] In a specific embodiment of the present invention, for the CCM_02060 gene, i.e., when only the CCM_02060 gene is knocked out, the upstream homologous arm nucleotide sequence is shown in SEQ ID NO: 13, and the downstream homologous arm nucleotide sequence is shown in SEQ ID NO: 14. The primers for synthesizing the upstream and downstream homologous arm nucleotide sequences are up 2-F (SEQ ID NO: 15) / up 2-R (SEQ ID NO: 16) and down 1-F (SEQ ID NO: 17) / down 1-R (SEQ ID NO: 18), respectively.

[0028] Since the CCM_02059 gene is adjacent to the CCM_02060 gene, by introducing sgRNA into the spacer nucleotide sequence between the genes, positioning the upstream homologous arm nucleotide sequence upstream of the coding region of the CCM_02059 gene, and positioning the downstream homologous arm nucleotide sequence downstream of the coding region of the CCM_02060 gene, the CCM_02059 gene, the CCM_02060 gene, and their spacer sequences can be knocked out simultaneously. That is, the CCM_02059 to CCM_02060 genes can be knocked out simultaneously.

[0029] Therefore, in another embodiment of the present invention, the present invention provides a method for producing a Cordyceps tularensis strain that does not produce thyroxine by CRISPR / Cas9 gene editing, the method comprising the steps of: Step S1: Determine and synthesize the sgRNA nucleotide sequence of the spacer sequence between the CCM_02059 gene and the CCM_02060 gene. Step S2: Determine and synthesize the nucleotide sequences of the upstream and downstream homologous arms of the CCM_02059 to CCM_02060 genes. Step S3: The sgRNA nucleotide sequence obtained in step S1 and the homologous arm nucleotide sequence obtained in step S2 are ligated into the vector pAMA1-Cas9-hyg to construct a knockout vector. Step S4: The knockout vector described above in step S3 is transformed into Cordyceps protoplasts via PEG mediation to obtain a transformant containing the knockout vector.

[0030] In a specific embodiment, the spacer sequence between the CCM_02059 and CCM_02060 genes is shown in SEQ ID NO:19.

[0031] In a specific embodiment, for the CCM_02059 to CCM_02060 genes, that is, when the CCM_02059 and CCM_02060 genes are simultaneously knocked out, the sgRNA nucleotide sequence is Target3, the nucleotide sequence of which is shown in SEQ ID NO: 20. The sequence of the synthesized Target3 expression cassette is shown in SEQ ID NO: 21.

[0032] In a specific embodiment, the upstream homologous arm nucleotide sequence of the CCM_02059 to CCM_02060 genes is shown in SEQ ID NO: 22, and the downstream homologous arm nucleotide sequence is shown in SEQ ID NO: 23. The primers for synthesizing the upstream homologous arm nucleotide sequence are up 3-F (SEQ ID NO: 24) / up 3-R (SEQ ID NO: 25), and the primers for synthesizing the downstream homologous arm nucleotide sequence are down 3-F (SEQ ID NO: 26) / down 3-R (SEQ ID NO: 27).

[0033] Therefore, in an embodiment in which a Cordyceps strain in which the CCM_02059 to CCM_02060 genes have been knocked out is obtained, a method for producing a Cordyceps strain that does not produce thyroxine by CRISPR / Cas9 gene editing specifically includes the following steps.

[0034] Step S1: Design the nucleotide sequence of Target3 (SEQ ID NO: 20) and synthesize the sequence of the Target3 expression cassette. Among them, the nucleotide sequence of the synthesized Target3 expression cassette is SEQ ID NO:21.

[0035] Step S2: Primers are designed for synthesizing the upstream and downstream homologous arm nucleotide sequences of the CCM_02059 to CCM_02060 genes, and the upstream and downstream homologous arm nucleotide sequences are amplified by PCR. Based on the upstream and downstream homologous arm nucleotide sequences, primers up 3-F / up 3-R and down 3-F and down 3-R are designed. Using the genomic DNA of a wild-type Cordyceps porphyra strain as a template, the upstream homologous arm nucleotide sequence (SEQ ID NO: 22) and the downstream homologous arm nucleotide sequence (SEQ ID NO: 23) are amplified, respectively. The PCR amplified products are collected, and the primer nucleotide sequences are as follows: up 3-F: 5'-ACCCTGATAAATGCTTCAATAATATTgtcgacaagagaggtggtcc-3' (SEQ ID NO: 24), up 3-R: 5'-AGATTCGCAGcctggacaatctactccgattca-3' (SEQ ID NO: 25), down 3-F: 5′-agattgtccaggCTGCGAATCTGAGTGGTTGG-3′ (SEQ ID NO: 26), down 3-R: 5′-ACTCATACTCTTCCTTTTTCAATATTCAGCGCCCTGTATCCTTTGA-3′ (sequence number 27).

[0036] Step S3: The Target3 obtained in step S1 and the homologous arm nucleotide sequence obtained in step S2 are ligated to the vector pAMA1-Cas9-hyg to construct a knockout vector. In step S3, first, the sequence of the Target3 expression cassette synthesized in step S1 is ligated to the vector pAMA1-Cas9-hyg, and the vector with successful ligation is named pAMA1-Cas9-hyg-Target3. Whether or not the ligation was successful can be verified as follows. For example, the ligated vector is transformed into E. coli DH5α competent cells, and E. coli colonies are selected to verify by PCR whether or not Target3 obtained in step S1 was ligated to the vector pAMA1-Cas9-hyg. The nucleotide sequences of the primers used in PCR are shown in SEQ ID NO: 28 and SEQ ID NO: 29. Colonies correctly identified by PCR are amplified, the vector is extracted and sequenced, and the results are compared with the sequence of the Target3 expression cassette obtained in step S1. Next, the upstream and downstream homologous arm nucleotide sequences obtained in step S2 are ligated to the vector pAMA1-Cas9-hyg-Target3, and the successfully ligated vector is named pAMA1-Cas9-hyg-Target3-HR, i.e., it becomes a knockout vector. Whether or not the ligation is successful can be verified as follows. The ligated vector is transformed, for example, into E. coli DH5α competent cells, and E. coli colonies are selected to verify by PCR whether or not the upstream and downstream homologous arm nucleotide sequences obtained in step S2 are ligated to the pAMA1-Cas9-hyg-Target3 vector. The nucleotide sequences of the primers used in PCR are shown in SEQ ID NO: 30 and SEQ ID NO: 31. Colonies correctly identified by PCR are amplified, and the vector is extracted and sequenced, and the results are compared with the upstream and downstream homologous arm nucleotide sequences obtained in step S2.

[0037] Step S4: The knockout vector pAMA1-Cas9-hyg-Target3-HR obtained in step S3 is transformed into Cordyceps protoplasts via PEG mediation to obtain a transformant containing the knockout vector pAMA1-Cas9-hyg-Target3-HR. Among them, for example, transformants containing the knockout vector pAMA1-Cas9-hyg-Target3-HR can be obtained by screening on a protoplast regeneration medium plate containing 500 μg / mL hygromycin.

[0038] In a further embodiment in which two genes are knocked out (i.e., the CCM_02059 to CCM_02060 genes are knocked out), the method may further include step S5. That is, at the genomic DNA level, PCR is used to identify transformants in which the target genes have been knocked out, i.e., positive transformants, from the transformants obtained in step S4. Also, in order to identify transformants in which the CCM_02059 to CCM_02060 genes have been knocked out, i.e., positive transformants, the genomic DNA of the transformants obtained in step S4 is extracted, and PCR is performed on the transformants using the genomic DNA as a template and primers SEQ ID NO: 32 and SEQ ID NO: 33.

[0039] In a further embodiment in which two genes are knocked out (i.e., the CCM_02059 gene and the CCM_02060 gene are knocked out), the method may further include step S6. That is, at the cDNA level, the positive transformants obtained in step S5 are verified by semi-quantitative RT-PCR to confirm that the positive transformants are not expressed at the transcription level. Also, the RNA of the positive transformants obtained in step S5 is extracted and reverse transcribed into cDNA, which is used as a template to perform semi-quantitative RT-PCR using semi-quantitative primers SEQ ID NO: 34 and SEQ ID NO: 35 to confirm that the positive transformants obtained in step S5 are not expressed at the transcription level. At the transcription level, it is verified that the CCM_02059 to CCM_02060 genes have been knocked out.

[0040] In a further embodiment in which two genes are knocked out, the method further comprises step S7: the positive transformants confirmed to not synthesize thyroxine are subjected to conidiospore isolation and subculture to eliminate the free vector, and then cultured in silkworm pupae or wheat medium to obtain Cordyceps strains that do not produce thyroxine and develop normally into fruiting bodies.

[0041] In a further embodiment in which two genes are knocked out, the method may further include step S8, that is, detecting the thyroxine content obtained in step S7, for example, extracting and purifying thyroxine from the fruiting body of the Cordyceps truncatula strain obtained in step S7, and detecting the thyroxine content thereof using high performance liquid chromatography.

[0042] In a third aspect, the present invention provides a CRISPR / Cas9 gene editing vector that uses pAMA1-Cas9-hyg as a backbone vector and further includes an sgRNA nucleotide sequence of a target gene and nucleotide sequences of upstream and downstream homologous arms of the target gene, wherein the target gene is the CCM_02059 gene (sequence number 1), the CCM_02060 gene (sequence number 2), or the CCM_02059 to CCM_02060 genes.

[0043] Embodiment The present invention will now be described in more detail with reference to specific embodiments. These examples are merely for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention.

[0044] In the following examples, unless otherwise specified, all experimental methods used are routine and are carried out according to the techniques or conditions described in the technical literature or product instructions. In the following examples, unless otherwise specified, all materials, reagents, etc. used are commercially available.

[0045] The wild-type Cordyceps persicae strain used in the following examples is CGMCC 3.16323, and the vector used, pAMA1-Cas9-hyg, was provided by Liu Gang Research Group at the Institute of Microbiology, Chinese Academy of Sciences. A specific embodiment is described using the knockout of two genes as an example.

[0046] 1.1 Design of sgRNA The spacer sequence between the Cordyceps genome CCM_02059 and CCM_02060 genes was selected as the target nucleotide sequence, and sgRNA was designed online using the EukaryoticPathogen CRISPRguiderNA / DNA Design Tool (http: / / grna.ctegd.uga.edu / ) with the Cordyceps CM01 (CGMCC 3.14242) genome (Zheng et al., genome sequence of the insect pathogenic fungus Cordyceps militaris, a valued traditional chinesemedicine. Genomebiology, 2012, r116) as the reference genome. All parameters were default.

[0047] 1.2 Construction of intermediate vector pAMA1-Cas9-hyg-Target3 a. Synthesis of Target3 expression cassette The nucleotide sequence of the synthesized Target3 expression cassette is SEQ ID NO:21.

[0048] b. Enzymatic cleavage and fragment ligation of the vector pAMA1-Cas9-hyg Using pAMA1-Cas9-hyg as the starting vector, the synthesized Target3 expression cassette and pAMA1-Cas9-hyg (linearized with the restriction enzyme BstEII) were recovered from the gel and purified using a gel recovery kit (D205-01) from Beijing Kangrun Chengye Biotechnology Co., Ltd. The nucleotide concentrations of the above DNA fragments and linearized vectors were measured using a NanoDropLite spectrophotometer (ND-NDL-US-CAN) from Thermo Fisher Scientific, and the binding reaction was performed using a One-Step Cloning Kit (C115-02) from Vazyme, referring to the instructions. The reaction system for enzymatic cleavage with the restriction enzyme BstEII is as follows. Vector: 2μg, Restriction enzyme: 2 μL, 10×buffer B: 10 μL, Nuclease-free water: up to 100μL React at optimum operating temperature for 5 to 12 hours.

[0049] The structure of the vector pAMA1-Cas9-hyg is shown in Figure 1.

[0050] c. PCR verification and sequencing of colonies The above ligation product was transformed into competent cells of E. coli DH5α by heat shock and freeze-thawing, and E. coli colonies were selected on LB / Amp+ (tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L) plates. PCR identification was performed using the primer nucleotide sequences of SEQ ID NO: 28 and SEQ ID NO: 29, and colonies correctly identified by PCR were inoculated into LB / Amp+ liquid medium and cultured at 37°C and 200 rpm for 12 hours for amplification. The amplified bacterial liquid was used to extract the vector using a plasmid extraction kit (D201-04) from Beijing Kangrun Chengye Biological Technology Co., Ltd., referring to the instructions. Furthermore, the sequence of the vector was determined by Beijing Bioengineering Biological Engineering (Shanghai) Co., Ltd. Sequence alignment showed that the sequencing results were consistent with the sequence of the Target3 expression cassette described above, meaning that the vector pAMA1-Cas9-hyg-Target3 was successfully constructed.

[0051] The reaction system for PCR identification of E. coli DH5α colonies is as follows. 2×Rapid Taq master mix: 5μL, Primer F (10 μmol / L): 0.2 μL, Primer R (10 μmol / L): 0.2 μL, Bacterial suspension (Colonies on LB / Amp+ plates, 10 μL ddHO 2 Add to O): 4.6 μL.

[0052] The procedure for the PCR amplification reaction is as follows.

[0053] Step 1: 95°C for 3 minutes. Step 2: 95°C for 30 seconds; Step 3: 58°C for 30 seconds; Step 4: 72°C for 5 seconds; Step 5: Repeat steps 2 to 4 for 35 cycles. Step 6: 72°C for 10 minutes.

[0054] 1.3 Construction of vector pAMA1-Cas9-hyg-Target3-HR Using the primers up 3-F / up 3-R and down 3-F / down 3-R, the upstream and downstream homologous arm nucleotide sequences of the CCM_02059-CCM_02060 genes were amplified using the genomic DNA of the wild-type Cordyceps porphyra strain as a template. The nucleotide sequences of the above primers are as follows: up 3-F: 5'-ACCCTGATAAATGCTTCAATAATATTgtcgacaagagaggtggtcc-3' (SEQ ID NO: 24), up 3-R: 5′-AGATTCGCAGCCTGGACAATCTACTCCGATTCA-3′ (SEQ ID NO: 25), down 3-F: 5′-AGATTGTCCAGGCTGCGAATCTGAGTGGTTGG-3′ (SEQ ID NO: 26), down 3-R: The method of claim 6, characterized in that the amino acid sequence is 5'-ACTCATACTCTTCCTTTTTCAATATTCAGCGCCCTGTATCCTTTGA-3' (sequence number 27).

[0055] The amplified upstream and downstream homology arm nucleotide sequences and pAMA1-Cas9-hyg-Target3 (linearized with the restriction enzyme SspI) were recovered from the gel and purified using a gel recovery kit (D205-01) from Beijing Kangrun Chengye Biotechnology Co., Ltd. The linearization reaction system for the restriction enzyme SspI was described in 1.2. The nucleotide concentrations of the above DNA fragments and linearized vectors were measured using a Thermo Scientific NanoDropLite spectrophotometer (ND-NDL-US-CAN), and the ligation reaction was performed using a Vazyme One-Step Cloning Kit (C115-02) by referring to the instructions. The above ligation products were transformed into competent E. coli DH5α cells by heat shock and freeze-thawing, and E. coli colonies were selected on LB / Amp+ plates. PCR identification was performed using primer nucleotide sequences SEQ ID NO:30 and SEQ ID NO:31, and colonies correctly identified by PCR were inoculated into LB / Amp+ liquid medium and amplified. The amplified bacterial liquid was used to extract the vector using a plasmid extraction kit (D201-04) from Beijing Kangrun Chengye Biological Technology Co., Ltd., referring to the instructions. Furthermore, the sequence of the vector was determined by Shanghai Bioengineering Co., Ltd. Beijing Company. Through sequence alignment, the sequence determination result was consistent with the above homologous arm nucleotide sequence, which means that the vector pAMA1-Cas9-hyg-Target3-HR was successfully constructed.

[0056] 1.4 Transformation of wild-type Cordyceps protoplasts with pAMA1-Cas9-hyg-Target3-HR Wild-type Cordyceps mycelium was collected, and 1 mL of 2% cell wall lytic enzyme (Guangdong Institute of Microbiology, cell wall lytic enzyme powder dissolved in 0.8 mol / L KCl, pH = 6.5) was added and enzymatically decomposed for 3 hours at 32°C and 90 rpm. The enzymatically decomposed mycelium was filtered through four layers of gauze, and 1 mL of the bottom filtrate was placed in a 1.5 mL centrifuge tube and centrifuged at 3000 rpm at room temperature for 10 minutes, after which the supernatant was discarded. Then, 100-200 μL STC buffer (sorbitol: 18.2 g, Tris: 0.121 g, CaCl2 : 0.368g, ddH 2 The volume of the suspension was adjusted to 100 mL with 200 mL of HO. The concentration of protoplasts was adjusted to 1 × 10 7 The cells were resuspended by repeated gentle pipetting to a concentration of cells / mL.

[0057] 2 μg of the vector pAMA1-Cas9-hyg-Target3-HR was added to 100 μL of the above-mentioned Cordyceps protoplasts and left on ice for 5 minutes. Then, 50 μL of PEG buffer (PEG4000: 25 g, Tris: 0.121 g, CaCl 2 : 0.368g, ddH 2 The mixture was diluted with 100 mL of 2000 mL of PEG buffer and left on ice for 30 minutes. Then, 0.5 mL of PEG buffer was added to the above system, mixed evenly by gently blowing, and left to stand in a metal bath at 28°C for 20 minutes. Finally, 1 mL of STC buffer was added, mixed evenly by gently blowing, centrifuged at 3000 rpm for 10 minutes, and the supernatant was discarded. The protoplast pellet at the bottom of the centrifuge tube was resuspended in STC buffer and resuspended in protoplast regeneration medium (200 g of peeled, boiled, and filtered potatoes, 20 g of glucose, 10 g of tryptone, 0.6 m of mannitol, ddHO) supplemented with 500 μg / mL of hygromycin. 2 The transformants were cultured in the dark at 25°C for 5-7 days until the mycelium of the transformants germinated and formed colonies, and genomic DNA of the transformants was extracted for PCR identification.

[0058] 1.5 PCR verification of transformants The genomic DNA of the above transformants was extracted by the CTAB method (Yan Qingxiang et al., Extraction of genomic DNA of cassava root by improved CTAB method, China Agricultural Bulletin, 2010, (4): 30-32), and the transformants were subjected to primary screening by PCR using primers SEQ ID NO: 32 and SEQ ID NO: 33. As shown in Figure 3A, the band size of the amplification product of the transformant No. 33 was 1197 bp, and the band size of the amplification product of the wild-type Cordyceps porphyra strain was 3544 bp. The transformant No. 33 was shown to be a positive transformant (M33) with successful gene knockout. The above transformant No. 33 was subjected to gene knockout verification at the transcription level. RNA of the transformant No. 33 and the wild-type Cordyceps porphyra strain was extracted using the RNAPlantKit kit (R6827-02) manufactured by OMEGA. Using the VazymehiScript (registered trademark) II QrT SuperMix for qPCR (+ gDNA wiper) kit (R223-01), RNA was reverse transcribed into cDNA while referring to the instructions, and this was used as a template. Using the semi-quantitative primers sequence number 34, sequence number 35, and two pairs of primers, rpb1-F / R (Lian et al., Variations of SSUrDNA group I introns in different isolates of Cordyceps militaris and the Loss of an intron during cross-mating. Journal of microbiology. 2014 52 (8): 659-666), semi-quantitative RT-PCR was used to verify whether the CCM_02059 to CCM_02060 genes were knocked out at the gene transcription level. As shown in Figure 3B, no expression at the transcriptional level of the CCM_02059 gene was observed in the No. 33 transformant, indicating that the No. 33 transformant (M33) was a positive transformation (CGMCC No. 40266), i.e., deletion of the CCM_02059 to CCM_02060 genes had been achieved.

[0059] The reaction system for semi-quantitative RT-PCR is as follows. 2×Rapid Taq master mix: 5μL, Primer F (10 μmol / L): 0.2 μL, Primer R (10 μmol / L): 0.2 μL, ddH 2 O: 3.6 μL, Template: 1 μL. The PCR amplification reaction procedure was the same as above.

[0060] 1.6 Extraction, purification, and detection of thyroxine The steps of extracting and purifying ustiloxin were adjusted appropriately based on the previous literature (Cao et al., Analysis of ustiloxins in rice using Polymer cation exchange cleanup followed by Liquid chromatography-tandem mass spectrometry. Journal of Chromatography A, 2016, 1476: 46-52). The specific steps are as follows.

[0061] The wild-type Cordyceps mycelium and the above-mentioned transformant M33 (CGMCC No. 40266) mycelium were freeze-dried in a freeze dryer, and three biological replicates were taken for each sample. The freeze-dried samples were thoroughly ground in a mortar. 100 mg of freeze-dried sample powder was weighed and placed in a 2 mL centrifuge tube, and then 1 mL ddHO was added. 2 The tissue homogenate was transferred to a 4.5 mL centrifuge tube and diluted with ddHO and ceramic beads. 2The volume was adjusted to 3 mL with 2020, and the mixture was placed in an ultrasonic extractor for 1 hour, then centrifuged at 12,000 rpm at room temperature for 6 minutes, and the resulting supernatant was transferred to a 10 mL centrifuge tube. 2 mL of dichloromethane was then added to the supernatant, mixed thoroughly, and centrifuged at 12,000 rpm for 6 minutes. The supernatant was sucked up and adjusted to a solution containing 5% formic acid, filtered through a 0.22 μm aqueous membrane, pretreated with 3 mL of methanol (chromatographic purity) on a PCX solid-phase extraction column, and equilibrated with 3 mL of 5% formic acid. The acidified sample was added when the liquid level reached the adsorption layer of the column, and the column was washed with 3 mL of 5% formic acid and 3 mL of methanol, and 5% aqueous ammonia (NH 3 H 2 The target substance was eluted with 3 mL of methanol containing 25%-28% O. The eluate was concentrated to near dryness at 45°C under reduced pressure, and then 1 mL of 15% methanol was added. The mixture was treated with an ultrasonic device for 15 minutes to redissolve the target substance, and the redissolved solution was filtered through a 0.22 μm aqueous membrane.

[0062] Ustiloxin was detected using a Shimadzu LC-20AhPLC system with a Luna OmegaPolar C18 column (4.6 mm × 250 mm, 5 μm), a mobile phase of 0.01% trifluoroacetic acid aqueous solution (A)-methanol (B), and a detection wavelength of 190-400 nm.

[0063] The HPLC detection results are shown in Figure 4. As can be seen from Figure 4, the retention time of ustiloxin in the wild-type strain sample was 22 to 23 minutes, whereas the compound corresponding to the transformant M33 (CGMCC No. 40266) was not detected in the retention time, indicating that a Cordyceps truncatula strain that does not produce ustiloxin was obtained.

[0064] 1.7 Deletion of the vector pAMA1-Cas9-hyg-Target3-HR Conidia of transformant M33 (CGMCC No. 40266) were dipped into a sterilized toothpick, spotted onto the above-mentioned resuscitation medium plate without hygromycin, and subcultured until the vector pAMA1-Cas9-hyg-Target3-HR carrying hygromycin resistance was deleted, thus obtaining a knockout strain without the resistance screening label.

[0065] 1.8 Experiments on the formation of fruit bodies in silkworm pupae and wheat medium The wild-type strain and the transformant M33 (CGMCC No. 40266) were inoculated onto PDA plates and cultured at 20°C for 16 days. The mycelium on the medium plate was washed with sterilized water and then filtered through four layers of gauze. 1 mL of the filtrate was placed in a 1.5 mL centrifuge tube and centrifuged at 8000 rpm for 6 minutes to collect conidia of the wild-type strain and the transformant M33 (CGMCC No. 40266). The concentration of conidia was 1 × 10 6 A suspension of 100 μL per mL was prepared and injected into each silkworm pupa using a sterile syringe. The silkworm pupae were then cultured at 20°C in an edible fungus intelligent fruiting box (Beijing Intelligent Kangxing Biotechnology Co., Ltd.) and the development of the fruiting bodies was observed.

[0066] The wild type and the transformant M33 (CGMCC No. 40266) strains on PDA plates were cultured on a seed medium (200 g peeled boiled potatoes, 20 g glucose, 3 g tryptone, KH 2 PO 4 1g and MgSO 4 7H 2 The liquid seed culture was obtained by inoculating 5 mL of the above liquid seed culture into a wheat medium (wheat: 20 g, nutrient solution: glucose 20 g, tryptone 10 g, KH 2 PO 4 2g MgSO 4 7H 2 The mixture was inoculated into wheat (1 g O, 1 g ammonium citrate, 120 mg vitamin B1, and tap water was added to a volume of 1 L) and cultured at 20°C in an edible fungus intelligent fruiting chamber (Beijing Intelligent Kangxing Biotechnology Co., Ltd.), and the development of the fruiting bodies in the wheat medium was observed.

[0067] As a result, the transformant M33 (CGMCC No. 40266) was able to develop normally into a fruiting body in both silkworm pupae and wheat medium. The fruiting bodies were orderly, uniform, straight, and bright in color, as shown in Figure 5. In addition, the growth rate was faster than that of the wild-type fruiting body in wheat medium.

Claims

1. A shiitake mushroom strain that does not produce ustiloxin, characterized in that the accession number is CGMC No. 40266.

2. Step S1 of determining and synthesizing the sgRNA nucleotide sequence of the target gene; Step S2 of determining and synthesizing the nucleotide sequences of the homologous arms upstream and downstream of the target gene; Step S3 of binding the sgRNA nucleotide sequence obtained in Step S1 and the homologous arm nucleotide sequence obtained in S2 to a CRISPR / Cas9 gene editing vector to construct a knockout vector; Step S4 of transforming the knockout vector obtained in Step S3 into shiitake mushroom protoplasts by PEG-mediated transformation to obtain a transformant containing the knockout vector; including A method for creating a shiitake mushroom strain that does not produce ustiloxin by CRISPR / Cas9 gene editing, characterized in that the target gene is the CCM_02059 - CCM_02060 gene.

3. The method according to claim 2, wherein the sgRNA nucleotide sequence is Target1, 2 or 3, and its nucleotide sequence is shown in SEQ ID NO: 3, SEQ ID NO: 11 or SEQ ID NO: 20, respectively.

4. The method according to claim 3, wherein the nucleotide sequence of the synthesized Target1, 2 or 3 expression cassette is shown in SEQ ID NO: 4, SEQ ID NO: 12 or SEQ ID NO:

21.

5. The method according to claim 2, wherein for the CCM_02059 - CCM_02060 gene, the nucleotide sequence of the upstream homologous arm is SEQ ID NO: 22, and the nucleotide sequence of the downstream homologous arm is SEQ ID NO:

23.

6. For the CCM_02059 - CCM_02060 gene, the primer for synthesizing the upstream homologous arm nucleotide sequence is up 3 - F / up 3 - R, and the primer for synthesizing the downstream homologous arm nucleotide sequence is down 3 - F / down 3 - R. The nucleotide sequences of the primers are up 3 - F: 5′ - ACCCTGATAATATGCTTCAAATAATATTgtcgacaaagagaggttggtcc - 3′ (SEQ ID NO: 24), up 3 - R: 5′ - AGATTCCGCAGCCTGGACAAATCTACTCCGATTCA - 3′ (SEQ ID NO: 25), down 3-F: 5'-AGATTGTCCAGGCTGCG AATCTGAGTGGTTGG-3' (SEQ ID NO: 26), down 3-R: 5'-ACT CATACTCTTCC TTTTTCAATATT CAGCGCCCC TGTATCCTTTGA-3' (SEQ ID NO: 27), the method according to claim 5, characterized in that it is as follows. **Claim 7** At the genomic DNA level, step S5 of identifying a transformant in which the target gene has been knocked out, i.e., a positive transformant, from the transformant obtained in step S4 using PCR; At the cDNA level, step S6 of verifying the positive transformant obtained in step S5 by semi-quantitative RT-PCR and confirming that the target gene of the positive transformant is not expressed at the transcriptional level; Step S7 of subculturing the positive transformant obtained in step S6 to obtain a mycelial strain of Ganoderma lucidum without insertion of foreign genes from which the vector has been deleted; Step S8 of detecting the ustiloxin content in the fruiting bodies of the mycelial strain of Ganoderma lucidum obtained in step S7; The method according to claim 2, further comprising the above steps.

Images