Methods for preparing mutant plants

Abstract

The present invention provides methods for preparing plants with specific, predetermined mutations in one or more NOIs, which specific, predetermined mutations may preferably result in the identification of plants with desired traits.

Description

[Technical field]

[0001] FIELD OF THEINVENTION The method of the present invention provides a method for preparing plants with specific, predetermined mutations in one or more nucleotides of interest (NOIs), which may preferably result in the identification of plants with desired traits. [Background technology]

[0002] Genetic variation is responsible for almost all phenotypic and genotypic differences in breeding populations. Genetic variation usually occurs naturally due to environmental stress acting on organisms, such as increased exposure to solar radiation, extreme soil conditions, or other abiotic or biotic stresses. This stress-induced variation is one of the drivers of natural diversity, adaptation, and evolution of organisms.

[0003] Conventional breeding utilizes this genetic variation to develop locally adapted crops. One way to increase genetic variation beyond that already present in a breeding population is to actively induce additional genetic variation through increased levels of exposure to stress. This has been done successfully over the past 90 years by mutation breeding, which has resulted in thousands of commercial crop cultivars with beneficial traits based on induced genetic variation. This type of mutagenesis is typically utilized through the establishment of a unique breeding population consisting of mutagenized germplasm, which then serves as a source for the identification of traits and further provides parent organisms for genetic crosses with existing elite breeding lines. A notable feature of a mutagenized breeding population is that it encompasses a greatly increased genetic variation compared to a natural population. To achieve high mutation frequencies, a mutagenesis treatment is often selected that causes a large proportion of treated material to die as a result of the accumulation of too many mutations with deleterious phenotypic effects. To select the optimal mutagenesis treatment, a series of mutation treatments is usually prepared and the ability of the treated organisms to germinate under normal conditions is compared. This is usually referred to as a die-off curve. The kill curves are used as a tool to determine the concentration and duration of treatment at which 50% of the mutagenized material is killed. This treatment is then used to generate mutagenized breeding populations of, for example, cereal grains.

[0004] Mutagenic treatments are carried out with various chemicals or radiation doses. Both the time of exposure to the mutagen and the relative concentration of the mutagen determine the ultimate effect on the organism. The treatment is highly organism dependent.

[0005] The choice of mutagen may depend on the nature of the organism being mutagenized, as some mutagens work better in some organisms than others. The duration of exposure may also range from a few minutes to several hours, and the chemical concentration load may vary depending on the exposure time, the nature of the organism, the tissue, and the chemical mutagen.

[0006] Induced mutations are typically heterozygous, causing chimeric plant genotypes in early mutagenized crops. This means that the grain harvested from the mutagenized regenerants of plants, such as mutagenized seeds, M1 regenerants, etc., have a high degree of genetic diversity. Thus, mutagenized breeding populations are usually represented by M2 regenerants or regenerants from even later generations (e.g., seeds). In this way, most progeny from a plant segregate according to Mendelian genetics for only two alleles (mutant and wild type), allowing homozygous recessive mutations to be expressed (visible) at the phenotypic level. This also allows breeders to use screening techniques characterized by low sensitivity. As screening techniques have become more developed, breeders have begun to utilize screening tools with increased sensitivity by combining the DNA of several M2 regenerants, such as seeds or plants for screening. Known means of screening for genetic variations in mutagenized populations were limited to screening pools of 5-10 plants (heteroduplex analysis, Sanger sequencing, high resolution melting curve analysis), but today some of these pools can be as large as 100 DNA samples when analyzed by advanced sequencing techniques. However, despite notable progress, challenges remain not only with regard to the preparation of a large number of separate DNA samples, but also with regard to the identification of potential mutant plants that could enter breeding programs with a large number of background mutations, i.e., those that are unrelated to the trait of interest but that possibly affect additional crop properties, such as crop yield and reproductive characteristics.

[0007] Although there is no clear definition of a saturated crop mutation library, the basic concept for a mutagenized breeding population is that several mutated alleles for each gene are represented in the entire population. To keep the library size small, each member of the population must carry mutations in several genes. In a typical barley library, each member of the population carries 100-200 mutations in the coding region. These additional coding mutations are of primary interest to the breeder after identification of the desired trait. A truly saturated mutation library should contain a mutant allele for each amino acid in each gene. To achieve that, the mutation frequency or mutation density would have to be higher or the population would have to be larger. However, significantly lower plant fitness remains a limiting factor associated with the utilization of libraries prepared with increased mutation loads. Furthermore, the effort and time involved in constructing libraries of thousands of individuals as well as the cost of screening such libraries limit the possibility of expanding the libraries. One approach to overcome the aforementioned obstacles is associated with the application of high levels of mutagens when libraries of mutants are established. At this point, further reduction in plant fitness limits the increase in the amount of mutations for each individual, and thus no mutagenesis library is truly saturated.

[0008] After mutagenesis by treatments that confer high mutation density or high mutation frequency, backcrossing of the mutant crop to the wild type or parental crop is usually performed to remove mutations that occurred in other parts of the genome, which can help eliminate "side effects" caused by undesired off-target mutations. Summary of the Invention

[0009] Traditionally, the goal of plant breeders has been to use breeding populations with as high a mutation rate or frequency as possible to increase the probability of identifying plants that retain specific traits. In contrast, the present invention provides a method to reduce the number of coding mutations per individual in a mutagenized breeding population. In other words, the present invention provides a method that allows the use of plant populations or regenerated populations with low rates of mutagenesis.

[0010] After mutagenesis by treatments that give high mutation density or high mutation frequency, backcrossing of mutant crops to wild type or parent crops is usually performed to remove mutations that occur in other parts of the genome. This can help to eliminate "side effects" caused by undesirable off-target mutations. In practical situations, the improvement of the breeding problems described herein leads to the disadvantage of radically fewer phenotypes in the organisms of the breeding population. There are fewer of these induced mutations, which over time, i.e., after the actual mutant identification process, lead to difficult or even unfavorable phenotypes - particularly mutations that give phenotypic disadvantages in response to environmental stresses related to temperature and precipitation challenges. In addition, mutants identified by this method can be expected to have enhanced survival rates, since it can avoid the generation of mutations that are only apparent or applicable long after the mutants are obtained. Plants containing many mutations may initially appear to be equally viable as the parent plant, but may turn out to contain additional, as yet unrecognized, mutations that pose challenges to viability under certain conditions, e.g., drought, low temperature, excessive rainfall, etc.

[0011] A low rate of mutagenesis may be expressed as a low number of nonsynonymous mutations in the coding region. A low number of coding mutations per individual reduces the deleterious effects of additional mutations in the mutagenized breeding population. In the case of chemical mutagens, the mutation density per plant depends on the exposure time to the mutagen, the crop, the tissue, the nature and the concentration of the chemical mutagen. For a particular plant, a library containing individuals with a low mutation density can be developed by determining the optimal concentration and / or exposure time for a particular chemical mutagen using a "death curve" test. In the case of the method of the present invention, it is preferable to use a concentration and / or exposure time for a given mutagen that does not result in a reduction in fitness or a reduction in viability of the mutagenized plant population. Ideally, each plant in the mutagenized plant population used in the method of the present invention has between 1 and 30 nonsynonymous mutations, i.e., mutations in the coding region that result in amino acid exchanges in the translated protein.

[0012] Instead of looking at the number of nonsynonymous mutations, a low rate of mutagenesis can also be expressed as a high percentage of genes that do not contain nonsynonymous mutations. Thus, in some embodiments, a low rate of mutagenesis can be at least 99%, such as at least 99.8%, such as at least 99.9%, of the genes of the plant, e.g., in the regenerated parts of generation M1, do not contain nonsynonymous mutations.

[0013] What is considered to be a particularly low rate of mutagenesis may vary from plant to plant, especially based on the ploidy of the plant. Thus, plants with high ploidy can usually tolerate a higher rate of mutagenesis, and therefore the "low rate of mutagenesis" in such plants may be much higher than the "low rate of mutagenesis" in diploid plants. In general, the low rate of mutagenesis in diploid plants may be that at least 99.8%, preferably at least 99.9%, of all genes in M1 do not contain non-synonymous mutations. In general, the low rate of mutagenesis in plants with ploidy higher than diploid, such as tetraploid or hexaploid plants, may be that at least 98.0%, preferably at least 99.0%, of all genes in M1 do not contain non-synonymous mutations.

[0014] The low rate of mutagenesis can also be expressed as low mutation frequency.For example, in a diploid plant, the low rate of mutagenesis can be at least 1 in 500,000, such as 1 in 750,000, such as 1 in 1,000,000 mutation frequency.For example, in a tetraploid plant, the low rate of mutagenesis can be at least 1 in 70,000, such as 1 in 100,000, such as 1 in 300,000 mutation frequency.For example, in a hexaploid plant, the low rate of mutagenesis can be at least 1 in 40,000, such as 1 in 80,000, such as 1 in 200,000 mutation frequency.

[0015] A low rate of mutagenesis can be obtained by using mild mutagenesis conditions. For example, a library containing plants of a given species with a certain number of genes is subjected to random mutagenesis under specific conditions, e.g., at a specific mutagen concentration for a specific duration, as described in Examples 3-5 and 12. Mutants are identified in a given region of a given length, e.g., as described herein. The number of mutants identified in that region can be used to calculate the mutation density for a given mutagenesis condition (concentration and time) used.

[0016] Mutation density can also be determined by sequencing at least all open reading frames in all mutagenized plants or regenerated parts thereof and counting the resulting mutants. Thus, knowing the size of the genome, mutation density can also be calculated.

[0017] The size of the library used usually depends on the number of genes of a given plant. For example, barley has about 30,000 genes, which means that a mutant library consisting of individuals each containing only one nonsynonymous mutation in the coding region must contain at least 30,000 individuals to provide a mutant allele for each gene. However, in libraries prepared by random mutagenesis, the mutations are not statistically completely evenly distributed, and therefore, significantly more than 30,000 randomly mutagenized individuals are required to ensure a library containing one mutant allele for each gene. Considering that a barley gene contains an average of 1,000 codons, a library of at least 30 million individuals is required to identify one mutation in each codon of each gene. The method of the present invention can be implemented to screen large libraries, while greatly reducing backcrossing time or the need for backcrossing.

[0018] Alternatively, the optimal library size can be calculated based on the mutation frequency and the number of mutations to be screened, as described herein. To obtain the optimal library size, a given number of regenerating portions (N p ) should be subjected to mutagenesis. p can be calculated based on the optimal library size, the number of GECNs and the yield of the plant species after mutagenesis.

[0019] To screen such large libraries, the present invention provides a method of pooling plants from mutagenesis breeding populations, followed by the use of highly sensitive detection methods, such as those currently used in diagnostic methods that rely on the detection of rare DNA, such as circulating tumor DNA (ctDNA). Such methods include, for example, the use of digital PCR (dPCR) and / or sophisticated oligonucleotide chemistry that is ultra-specific and can identify and amplify very rare PCR fragments in complex mixtures of DNA. Thus, the pool of plants can be divided into subpools for screening. The optimal subpool size can be calculated based on the number of GECNs and the detection sensitivity of the detection means employed.

[0020] The methods described herein represent the basis for high-throughput screening methods applicable to the screening of very large mutant libraries that can be generated from elite varieties or advanced breeding lines, and for the screening of entire breeding populations or germplasm collections. The methods can also be used to identify genetic variants in untransformable crop species that are not amenable to genetic modification and gene editing procedures.

[0021] Thus, the present invention provides a method for identifying mutant plants of a predefined species having one or more mutations in a nucleotide of interest [NOI] in a given target sequence, the method comprising: a) providing regenerants of a seed parent plant, said regenerants being at least 5,000, such as at least 10,000, for example at least 15,000, such as at least 20,000, for example at least 25,000, for example at least 30,000; b) subjecting the regeneration parts to a step of mutagenesis, preferably random mutagenesis, thereby generating a pool of regeneration parts of generation M0 representing a plurality of genotypes; c) growing the regenerants of generation M0 into mature plants of generation M1 and obtaining regenerants of generation M1 from the mature plants; d) optionally repeating the previous step X times to obtain a plant of generation M(1+X) comprising a regenerant of generation M(1+X); e) dividing regenerants of multiple generations M1 or M(1+X) plants into subpools, each subpool containing regenerants representing multiple genotypes, and all regenerants from a given mature plant are placed into the same subpool; f) preparing a DNA sample, such as a gDNA sample or a cDNA sample, from the mRNA sample from each subpool; g) identifying subpools containing DNA containing the mutation using sensitive detection means; h) identifying regenerants within the subpool containing a mutation, thereby identifying mutant plants; wherein the step of mutagenesis results in a mutagenesis rate of 1-30 non-synonymous mutations per cell of the regenerative part of generation M1, preferably the regenerative part is a vegetative tissue, a seed, a grain, a germline cell in a seed, a grain or germ of a plant, pollen or germ, preferably the regenerative part is a seed. [Brief description of the drawings]

[0022] [Figure 1] Example of a screening procedure. (a) Mutagenized regenerants, here seeds (M0), are grown to maturity in the field, (b) harvested into subpools of 300 plants, (c) seeds are collected as bulk samples representing each pool. The bulk samples are split into fractions, one fraction (d) is used for DNA extraction, and the other fractions are kept as a seed bank for further analysis. DNA from the bulk samples (d) is analyzed using sensitive detection means (e). The original pool of 300 plants carrying the mutation of interest are identified (f) and used for single seed analysis (g). (h) Mutant plants can be germinated from the identified seeds. [Diagram 2] Breeding of mutant barley grain. This diagram illustrates the breeding of mutant grain, here barley mutagenized with sodium azide. Mutant seeds of generation M0 give rise to plants of generation M1. Seeds of plants of generation M1 give rise to plants of generation M2. Seeds of plants of M2 give rise to plants of generation M3, which can be used for screening and crossing. [Diagram 3] Dividing a Pool into Subpools: An example of how to divide a pool into subpools is provided. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0023] definition The term "silent mutation" refers to the mutation that occurs in the sequence of an organism, for example, in the genome sequence, and does not cause changes in amino acid sequence.Thus, silent mutation can be any mutation in the non-coding region of genome, or it can be a mutation in the coding region of genome that does not change the amino acid sequence of the translation product.Synonymous mutation refers to nucleotide substitution that does not change the amino acid sequence of the translation product, and is therefore a kind of silent mutation.

[0024] As used herein, the term "nonsynonymous mutation" refers to a mutation that occurs in an organism's sequence, e.g., a genomic sequence, that results in a change in amino acid sequence. Thus, a nonsynonymous mutation in a coding region can be any mutation that changes the amino acid sequence of the translation product in the coding region of a genome, e.g., by encoding a different amino acid (e.g., missense mutation, read-through mutation), by introducing a premature stop codon (nonsense mutation), and / or by introducing a frameshift. This term is used interchangeably herein with "coding mutation."

[0025] As used herein, the term "mild mutagenesis" or "low mutagenesis" preferably refers to a mutagenesis treatment resulting in 1-30 nonsynonymous mutations (in the coding region, excluding introns), e.g., measured in cells of the regenerated portion of generation M1. Mutation density can be measured by sequencing the entire open reading frame of the genome. What is considered "low mutagenesis" may depend on the type of plant. Thus, the term "low mutagenesis" means that in diploid plants, on average, at least 99.8%, preferably at least 99.9%, of all genes in the regenerated portion of generation M1 do not contain nonsynonymous mutations, and for plants of higher ploidy, "low mutagenesis" may mean that, on average, at least 98.0%, preferably at least 99.0%, of all genes in the regenerated portion of generation M1 do not contain nonsynonymous mutations.

[0026] The term "mutation frequency" - abbreviated as "Mf" - refers to the number of mutations within a given length of nucleic acid, e.g., the number of mutations available in an entire genome. In particular, the mutation frequency can be calculated as follows:

number

number

[0027] In some embodiments of the present invention where the exact mutation frequency is unknown, an estimated mutation frequency may be used. Thus, the mutation frequency (Mf) may be the actual mutation frequency or the estimated mutation frequency.

[0028] As used herein, the term "rate of mutagenesis" may refer to mutation density or mutation frequency.

[0029] The term "allele" refers to a specific version or state of a gene.As used herein, the term "mutant allele" refers to a gene that has one or more predetermined mutations in NOI.If the mutation is the deletion of the entire gene, the mutant allele can also be an allele that does not have the gene.

[0030] When used herein in relation to numerical values, the term "about" refers to ±10%, preferably ±5%, for example ±1%.

[0031] As used herein, the term "blocking probe" refers to an oligonucleotide that cannot be extended at the 3' end by DNA polymerase.A blocking probe is generally an oligonucleotide that is identical or complementary to a target sequence, including a reference NOI linked to a blocking agent, which inhibits the extension of the blocking probe by DNA polymerase.

[0032] As used herein, the term "coding region" or "coding sequence (CDS)" refers to a portion of DNA or RNA, excluding introns, which upon translation gives rise to a protein.

[0033] As used herein, the term "genotype" refers to an organism that contains a particular set of genes. Thus, two organisms that contain the same genome are of the same genotype. The genotype of an organism relative to a particular gene is determined by the alleles carried by that organism. In diploid organisms, the genotype of a given gene can be AA (homozygous, dominant) or Aa (heterozygous) or aa (homozygous, recessive).

[0034] As used herein, the term "phenotype" is the composite of observable characteristics or traits of an organism.

[0035] The term "genetically effective cell number" - abbreviated as "GECN" - refers to the number of cells of a plant that will eventually form gametes. Such cells are also referred to herein as "germline cells". It is considered here as the number of events that generate independent genotypes in the progeny. The GECN is important for calculating the expected diversity in a mutant population, since each genetically effective cell contributes a different mutation event to the library. The GECN can be calculated, for example, as described in Example 12 herein below. For the method of the present invention, it is not necessary to use the actual GECN. Thus, the GECN can be the actual GECN or the predicted GECN. Most frequently, the GECN is at least 2, and thus the predicted GECN can be, for example, 2. The GECN of some selected plants is provided in Table 1 below. [Table 1]

[0036] The term "detection means for detecting a nucleic acid sequence" refers to any detection means that allows the detection of a specific nucleic acid sequence. Thus, the detection means is capable of detecting a mutation in a nucleotide of interest and distinguishing it from a wild type sequence. Many detection means are based on PCR.

[0037] The term "germination ratio" - abbreviated as "Gr" - refers to the average germination ratio of a given plant species after mutagenesis. To determine the germination ratio, a number of regenerants are incubated under conditions that allow growth, and the % of regenerants that start growing is determined. For example, if the regenerants are seeds, a given number of seeds are incubated under conditions that allow germination, and the percentage of germinated seeds is determined after appropriate incubation. Unless otherwise indicated, the germination ratio is given in %. For the method of the present invention, it is not necessary to use the actual germination ratio (Gr). Thus, the germination ratio (Gr) can be the actual germination ratio or the predicted germination ratio.

[0038] The term "harvest rate" - abbreviated as "Hr" - refers to the average number of plants harvested per regenerant subjected to mutagenesis. For some plants, the harvest rate is approximately equal to the germination rate. However, for other plant species, a much larger number of regenerants are sown compared to the number of plants that are actually harvested. Unless otherwise indicated, the harvest rate is given in %. For the method of the present invention, it is not necessary to use the actual harvest rate (Hr). Thus, the harvest rate (Hr) can be the actual harvest rate or the predicted harvest rate.

[0039] The term "germline cells" refers to cells that pass on their chromosomes or hereditary genetic material to their progeny, their descendants or next generations.

[0040] The term "highly sensitive detection means" refers to detection means that allow the detection of one mutant organism in a library of at least 300 organisms, even if the genotype of the mutant organism differs from the genotype of the non-mutant organism by at most one nucleotide. Preferably, they allow the detection of one mutant genome in a library of 300 genomes.

[0041] As used herein, the term "mutation detection probe" refers to an oligonucleotide, optionally linked to a detectable means, which is identical to or complementary to a target sequence, including a predetermined mutation in the NOI.

[0042] As used herein, the term "PCR" refers to polymerase chain reaction. PCR is a reaction for the amplification of nucleic acids. The method relies on thermal cycling, which consists of repeated cycles of heating and cooling the reaction to obtain sequential melting and enzymatic replication of DNA. In the first step, the two strands forming the DNA double helix are physically separated at high temperature in a process also known as DNA melting. In the second step, the temperature is lowered to allow enzymatic replication of the DNA. PCR may also include additional incubations at temperatures to enhance primer annealing and / or optimize the temperature for replication. In PCR, the temperature is usually cycled between various temperatures for a large number of cycles.

[0043] As used herein, the term "PCR reagent" refers to the reagents that are added to PCR in addition to the sample and a set of primers. PCR reagents include at least nucleotides and nucleic acid polymerase. In addition, PCR reagents may include other compounds such as salts and buffers.

[0044] The term "dPCR" refers to digital polymerase chain reaction. It can be used to directly quantify and clonal amplify nucleic acid strands, including DNA, cDNA, or RNA. dPCR measures nucleic acid amounts more accurately than PCR. In traditional PCR, one reaction is performed per single sample. dPCR also relies on a single reaction within a sample, but the sample is compartmentalized, i.e., the sample is separated into multiple compartments and reactions are performed separately in each compartment.

[0045] The term "ddPCR" refers to droplet digital polymerase chain reaction. In ddPCR, one or more PCR amplifications are performed, and each reaction is separated into multiple water-oil emulsion droplets so that PCR amplification of the target sequence can occur in each individual droplet. ddPCR is an example of compartmentalized PCR.

[0046] The term "probability of success" - abbreviated as "PS" - refers to the likelihood that a desired mutation is identified from a library of a given regenerating portion subjected to random mutagenesis. Those skilled in the art can select an appropriate probability of success. In general, it is preferred that the probability of success is at least 85%, preferably at least 90%, more preferably at least 95%, for example at least 98%.

[0047] As used herein, the term "reproduction" refers to both sexual and asexual reproduction. Thus, reproduction can propagate an organism in a clonal manner (also known as "asexual reproduction"). Reproduction can also generate progeny of the organism, which progeny contain the allele from the parent organism. Thus, reproduction of an organism that contains a mutant allele can refer to generating progeny of the organism, which progeny contain the mutant allele. Preferably, the mutant allele retains one or more mutations in the NOI.

[0048] As used herein, the term "reproductive parts of an organism" refers to any part of an organism that can grow into a complete organism under appropriate conditions. For example, if the organism is a plant, the term refers to any part of the plant that can regenerate into a complete plant. Thus, the reproductive parts of a plant can be any "propagating material" of the plant. The reproductive parts of a plant can be, for example, seeds, grains, germ line cells in seeds, grains or germ of plants, vegetative tissues, pollen or germ of exosporium. This term is used interchangeably with "reproductive parts" herein. The term "germ line cells" refers to cells that transmit their chromosomes or heritable genetic material to their progeny, their descendants or the next generation.

[0049] As used herein, the term "set of primers flanking a target sequence" refers to a set of two primers that flank a target sequence such that one primer contains a sequence identical to the 5' end of the target sequence (also referred to as a "forward primer") and one primer contains a sequence complementary to the 3' end of the target sequence (also referred to as a "reverse primer"). A "set of primers" is capable of amplifying a target sequence when a nucleic acid containing the target sequence and PCR reagents are added together in a PCR under conditions that allow amplification of the target sequence.

[0050] As used herein, the term "target sequence" refers to any nucleic acid sequence in which it is desired to generate or identify a mutation. Moreover, the target sequence is preferably a nucleic acid sequence that can be amplified by PCR techniques using primers that flank the target sequence. In addition, the target sequence usually contains one or more NOIs. The present invention provides a method for generating and / or identifying organisms that carry mutations in the NOIs. The target sequence may, for example, be a nucleic acid sequence associated with a particular trait.

[0051] As used herein, the term "reference detection probe" refers to an oligonucleotide optionally linked to a detectable means, which is identical or complementary to a target sequence that includes a reference NOI. Generally, the target sequence that includes a reference NOI corresponds to the target sequence before mutagenesis. A "reference detection probe" may also be referred to as a "wild-type probe".

[0052] The term "barley" in the context of the manufacturing process of barley-based beverages such as beer, particularly as used to describe the malting process, refers to barley grain. In all other cases, unless otherwise specified, "barley" refers to the barley plant (Hordeum vulgare, L.) and includes any breeding line or cultivar or variety, while a part of the barley plant may be any part of the barley plant, for example the external plant structures such as leaves, stems, roots, flowers and grains, known as plant organs. It may also include any tissue or cell.

[0053] "Cereal" plants, as defined herein, are members of the grass family that are cultivated primarily for their starch-containing seeds or grains. Cereal plants include, but are not limited to, barley (Hordeum), wheat (Triticum), rice (Oryza), corn (Zea), rye (Secale), oats (Avena), sorghum (Sorghum), and triticale, rye-wheat hybrids.

[0054] The term "grain quality" as used herein refers to the characteristics of grain obtained from a plant, such as a mutant plant. Thus, the term may refer to grain moisture content, grain weight, discoloration, percentage of broken or damaged grains, grain fragility, milling quality, protein content, oil content, and / or grain viability. Other intrinsic factors include color, composition, bulk density, odor and aroma, size and shape.

[0055] The term "% sterility" as used herein refers to the percentage of flowers in a plant population of a given genotype that do not produce seed.

[0056] Methods for identifying mutant plants The present invention provides a method for identifying mutant plants of a predefined species having one or more mutations in a nucleotide of interest [NOI] of a predetermined target sequence, the method comprising: a) N of the parent plant of the seed p Providing N replay portions, p is an integer of at least 5000,step; b) subjecting the regeneration portion to a step of mutagenesis, preferably random mutagenesis, thereby generating a pool of regeneration portions of generation M0 representing a plurality of genotypes; c) growing the regenerants of generation M0 into mature plants, thereby obtaining regenerants of generation M1 from the mature plants; d) optionally repeating the previous step X times to obtain a plant of generation M(1+X) comprising a regenerant of generation M(1+X); e) dividing regenerants of multiple generations M1 or M(1+X) plants into subpools, each subpool containing regenerants representing multiple genotypes, with all regenerants from a given mature plant being placed into the same subpool; f) preparing a DNA sample, such as an mRNA sample or a cDNA sample prepared from a gDNA sample, from each subpool; g) identifying subpools containing DNA containing the mutation using sensitive detection means; h) identifying regenerants and / or progeny of regenerants within the subpool containing a mutation, thereby identifying mutant plants; wherein the mutagenesis step results in a mutagenesis rate of 1-30 nonsynonymous mutations per cell in the regenerating portion of generation M1.

[0057] It should be understood that the method may be practiced in a preferred embodiment with seeds. However, the method may in some embodiments be practiced with other regenerating parts of the parent plant than the seeds, for example, the germ of the parent plant may be used. In some embodiments of the invention where the plant is a cereal, the seed is a grain of the cereal mentioned above.

[0058] The mutant plants of interest can be identified, for example, using suitable PCR reagents, as described in Examples 3-5 below. PCR reagents generally include at least nucleotides and a nucleic acid polymerase. In addition, the PCR reagents may preferably also include one or more detection probes, for example, a mutation detection probe and / or a reference detection probe, as described above in the "Detection of PCR Products" section of this specification.

[0059] Alternatively, the desired mutants can be identified by sequencing the entire genome of the mutagenized plant or its regenerated portion, as known in the art.Thus, the mutation density can also be determined by sequencing at least all open reading frames in some or all of the mutagenized plants or their regenerated portions, and counting the resulting mutants.Thus, knowing the size of the genome, the mutation density can also be calculated. In addition to the steps outlined above, the method of the present invention may include one or more additional steps. The method may include, for example, preparing a pool of regenerating parts, such as seeds, for example, by mutagenesis. Methods for preparing pools of organisms are described in the "Pool" section below.

[0060] The method may also include a step of propagating one or more plants or regenerant parts within the pool or subpool of plants or regenerant parts, which may include culturing the plants, or regenerant parts, for one or more cycles.

[0061] In the following, we often refer only to "seeds", "crops" or "plants". However, the same considerations apply to methods using crops or other regenerative parts of plants. Each step of cultivation may result in offspring that are not identical to the original plant, seed or other regenerative part. For example, after random mutagenesis of polyploid plants, most plants will carry any random mutation in only one allele and thus be genetically heterozygous for that mutation. In the case of self-pollinating plants, the offspring organisms usually include: (1) organisms without the mutation, (2) offspring organisms genetically heterozygous for the mutation, and (3) offspring organisms genetically homozygous for the mutation. Thus, the offspring of the original pool or pool of regenerative parts such as plants or seeds will not necessarily be identical to the original pool, but will generally represent any mutations present in the NOIs present in the original pool, at least as heterozygous and / or homozygous organisms. Thus, at least some of the offspring will contain mutant alleles. Similarly, the progeny of a subpool may not be identical to the original subpool, but will generally represent at least the mutations in the NOIs present in the original subpool, either in heterozygous or homozygous form.

[0062] Step e) of dividing the pool of regenerative parts into another subpool may therefore comprise a step of propagating the plants or regenerative parts thereof. This may for example be carried out simultaneously with the division of the pool into subpools. Alternatively, this may be carried out after the division of the pool into subpools. The method of the invention may therefore comprise, following step e), a step of propagating the plants or regenerative parts thereof in the subpools.

[0063] Similarly, the method of the invention may comprise a step of propagating the plant or a regenerative part thereof, such as a seed, in a fraction of the subpool following step f). However, in some embodiments of the invention, particularly those in which the plant is a cereal, it may be preferred that the method does not comprise a step of propagating the plant or a regenerative part thereof between steps f) and g).

[0064] In some embodiments of the invention, the method comprises a step of propagating plants or regenerating parts thereof, such as seeds, contained in a subpool or a fraction thereof containing a mutation in the NOI, which may be carried out at any useful time, for example between steps h) and i) as outlined above.

[0065] The method may also include the step of identifying a group of subpools which contain mutations in the NOI. This step can be carried out at any useful time, but is often carried out after step c) of the method above, and may for example be carried out as described in the "Superpools" section herein below.

[0066] Nucleotide of interest (NOI) The present invention relates to a method for identifying one or more plants that carry a mutation in one or more nucleotides of interest. In particular, the method allows the identification of plants that carry one or more predetermined mutations in NOI. The NOI can be inside the coding region or outside the coding region. Thus, the method allows the identification of organisms that carry specific mutations while still relying on traditional breeding methods. The mutations are preferably in a predetermined target sequence.

[0067] The mutation can be any mutation, and one or more of the NOIs of interest are different from the corresponding NOIs in the reference sequence.The reference sequence is often a wild-type sequence.However, the reference sequence can also be any other sequence.Therefore, the reference sequence can already contain some mutations compared to the wild-type sequence, and the mutations can occur naturally or are induced, for example, by mutagenesis.

[0068] The mutation can be any type of mutation, such as deletion, insertion, substitution, or a mixture of the above. The mutation can be a synonymous mutation or a non-synonymous mutation. For example, the mutation can be (1) a mutation that introduces a premature stop codon, (2) a mutation that introduces a frameshift, or (3) a mutation that causes a substitution of an amino acid in the translated protein.

[0069] The NOI may be a single nucleotide or several nucleotides and therefore may consist of at least 1, such as 1, for example 2, 3, such as 4, 5, such as 6, 7, such as 8, 9, such as 10, such as 10-20, such as 20-50, more than 50 etc nucleotides.

[0070] In a preferred embodiment of the invention the NOI consists of a single nucleotide, in which case the mutation may for example be a substitution of the single nucleotide. Such mutations are also known as point mutations.

[0071] In other embodiments of the invention the mutation may be a deletion of the NOI, hi other embodiments the mutation may be an insertion of one or more nucleotides between two nucleotides of interest.

[0072] In one embodiment, the reference sequence is the wild-type sequence, i.e., the sequence most frequently occurring in nature, and the mutations are therefore mutations relative to the wild-type sequence, in other embodiments, the reference sequence already contains mutations, and the mutations are additional mutations compared to the reference sequence.

[0073] In one embodiment, the mutation may be associated with a desirable trait within the species. Depending on the type of species, the desirable trait may be selected from a number of different traits. In some embodiments of the invention where the species is a cultivated plant, the trait may be, for example, enhanced survival rate, enhanced resistance to various environmental factors, enhanced growth, enhanced grain quality or higher yield. In some embodiments of the invention where the species is a plant used for food, feed or beverage production, the trait may also relate to enhanced nutritional value, enhanced flavor characteristics, enhanced storage properties, or enhanced usefulness for the production of the food, feed or beverage.

[0074] The NOI may be located in any target sequence of any nucleic acid. In many cases, the target sequence is part of a genomic DNA (gDNA) sequence. More preferably, the target sequence is part of a gDNA sequence. Thus, the mutation may be a mutation in the gDNA of the organism. The NOI may be located in any part of the gDNA, both in the coding and non-coding regions. In many cases, the NOI may be located in any part of the gene, such as the coding region (e.g., within an exon), intron, or in the regulatory region of the gene, such as the promoter, terminator, and / or intron. Preferably, the mutation is a coding mutation or a non-synonymous mutation. Instead of genomic DNA, cDNA prepared from an mRNA sample can also be used to identify the desired mutation.

[0075] plant In a preferred embodiment of the present invention, the plant may be a green plant, such as a plant selected from the group consisting of flowering plants, conifers, gymnosperms, ferns, club mosses, bryophytes, mosses and green algae. The plant may be, for example, a monocotyledonous or dicotyledonous plant. In particular, the plant may be a cultivated plant. A cultivated plant may be any plant that is cultivated by humans, for example as a source of food, feed, or as a raw material for the production of goods or for aesthetic purposes.

[0076] In a preferred embodiment of the present invention, the species is a cereal. As defined herein, a "cereal" is a member of the Gramineae plant family that is cultivated primarily for its starch-containing seeds or kernels. Cereals include, but are not limited to, barley (genus Hordeum), wheat (genus Triticum), rice (genus Oryza), maize (genus Zea), rye (genus Secale), oats (genus Avena), sorghum (Sorghum) and triticale, a wheat-rye hybrid. The plant may also be other cultivated plants, including tomatoes.

[0077] The parent plant is a crop plant or a flowering plant, such as a plant belonging to the Brassicaceae, Fabaceae, Poaceae, Amaranthaceae, Asteraceae, Solanaceae, Rubiaceae or Orchidaceae family. In a particular embodiment, the plant is barley. The method of the present invention may be particularly advantageous for plants that cannot be easily gene-edited, for example by transformation.

[0078] The parent plant may also be a tree or shrub. The term "tree" is used herein in its broadest sense to mean a perennial plant with a slender trunk or trunk that supports most species of branches and leaves. The term thus encompasses plants such as banana trees or coconut palms. Shrubs are small to medium sized perennial woody plants. The method of the present invention is advantageous for identifying mutants of trees or shrubs. Trees and shrubs have slow growth, so it is particularly advantageous to avoid the need for backcrossing to identify mutants of interest, since this results in a significant reduction in the time required to identify such mutants. In general, the method is particularly advantageous for any plant that has a long reproductive cycle.

[0079] Pool The method of the present invention involves determining the N p The method includes providing regenerants and mutagenizing the regenerants of the plant to obtain a pool of regenerants expressing a plurality of genotypes. The plant may be, for example, any of the plants described in the "Plants" section. The pool of regenerants thus refers to mutagenized regenerants obtained from the regenerants provided in step a) of the method. The pool of regenerants thus consists of the same number of regenerants as the number of regenerants provided in step a). For example, if 30,000 regenerants are provided in step a), the pool of (mutagenized) regenerants will be 30,000 mutagenized regenerants. Thus, a pool of regenerants contains multiple regenerants, all of which belong to the same species, but which represent different genotypes of plants. A pool may contain more than one regenerant of each genotype. However, a pool must contain multiple regenerants of different genotypes.

[0080] As described in Examples 6 and 7 below, a certain optimal library size (OLS) can be preferably used to obtain a certain success probability. Optimal in this context means the optimal library size to obtain a desired success probability. The library size is the total number of different genotypes appearing in the regenerating part of generation M1 or M(1+x). The OLS depends on the mutation frequency and the number of mutations to be screened. In a preferred embodiment, the OLS is determined as described in Example 6 below.

[0081] Based on OLS, the number of regenerated parts to be mutagenized (N p ) can be determined. p depends on the number of germline cells of a particular plant as well as the yield after mutagenesis. In particular, the optimal N p (ON p ) may be determined as described in Example 7 below.

[0082] In a preferred embodiment, N p is 0.7*ON p ~1.3*ON p In the formula:

number

number

[0083] For some plant species, such as cereals, the yield rate is approximately equal to the germination rate. For such plant species, the germination rate Gr is expressed as ON p can be used instead of the yield rate to calculate

[0084] Preferably, the mutation frequency corresponds to a low rate of mutagenesis. The rate of mutagenesis in % genes free of non-synonymous mutations can be calculated based on the mutation frequency, the number of genes and the average length of the genes in a particular plant using the following formula:

number

[0085] In the prior art, the rate of mutagenesis is often described as a mutation frequency. For example, a mutation frequency of 1 in 500,000 may be described in the Arabidopsis thaliana plant generation M2. This corresponds to about 57 genes with coding mutations in the Arabidopsis thaliana plant generation M1, or 99.79% of all genes in the Arabidopsis thaliana plant generation M1 that do not contain nonsynonymous mutations. Furthermore, a mutation frequency of 1 in 10,000 may be described in the Arabidopsis thaliana plant generation M2. This corresponds to about 2862 genes with coding mutations in the Arabidopsis thaliana plant generation M1, or 89.65% of all genes in the Arabidopsis thaliana plant generation M1 that do not contain nonsynonymous mutations. In one embodiment, N p is 0.9*ON p ~1.1*ON p Preferably, N p is 0.9*ON p ~1.1*ONp The range is. ON p In some cases, the actual value of one or more parameters required for the calculation of may not be known. In such cases, a predicted value may be adopted instead of the actual value. Thus, when the yield rate after mutagenesis is not known, a predicted yield rate may be used. The predicted yield rate may be based on the knowledge of the skilled artisan from similar mutagenesis procedures. Similarly, when the exact mutation frequency is not known, a predicted mutation frequency may be used. The predicted mutation frequency may be based on the knowledge of the skilled artisan from similar mutagenesis procedures.

[0086] The person practicing the method of the invention may select a suitable probability of success. Typically, the probability of success is at least 85%, preferably at least 90%, more preferably at least 95%, for example at least 98%.

[0087] In some embodiments, the pool (i.e., N p ) are obtained by culturing at least 5,000 regenerants, such as at least 10,000 regenerants, for example at least 15,000 regenerants, such as at least 20,000 regenerants, for example at least 25,000 regenerants, such as at least 30,000 regenerants, for example at least 40,000 regenerants, such as at least 50,000 regenerants, for example at least 60,000 regenerants, such as at least 70,000 regenerants, for example at least 80,000 regenerants, of plants having different genotypes. 0 regenerated parts, such as at least 90,000 regenerated parts, for example at least 100,000 regenerated parts, such as at least 200,000 regenerated parts, for example at least 300,000 regenerated parts, such as at least 400,000 regenerated parts, for example at least 500,000 regenerated parts, such as at least 600,000 regenerated parts, for example at least 700,000 regenerated parts, such as at least 800,000 regenerated parts, for example at least 900,000 regenerated parts, for example at least 10 6 Pieces of regeneration, even if at least 2.10 6pieces of reproduction, e.g. at least 3.10 6 pieces of reproduction, e.g. at least 4.10 6 pieces of reproduction, e.g. at least 5.10 6 Pieces of regeneration, even if at least 6.10 6 pieces of reproduction, e.g. at least 7.10 6 pieces of reproduction, e.g. at least 8.10 6 pieces of reproduction, e.g. at least 9.10 6 10 regenerated parts, e.g. at least 10 7 In some embodiments, the pool comprises 5,000 to 100,000 regeneration parts, such as 10,000 to 90,000 regeneration parts, such as 15,000 to 85,000 regeneration parts, such as 20,000 to 80,000 regeneration parts, such as 25,000 to 90,000 regeneration parts, such as 30,000 to 100,000 regeneration parts, such as 30,000 to 75,000 regeneration parts. 000 regenerant parts, for example 50,000 to 75,000 regenerant parts, for example 50,000 to 1,000,000 regenerant parts, for example 100,000 to 500,000 regenerant parts, or 500,000 to 1,000,000 regenerant parts, or 600,000 to 900,000 regenerant parts, or 900,000 to 1,500,000 regenerant parts. In some embodiments the regenerant parts are seeds.

[0088] Preferably, the pool of organisms contains a sufficient number of regenerants with different genotypes so that the pool can theoretically contain all possible mutations in all genes of the plant. For example, in some embodiments of the present invention where the species is barley, a pool containing about 1,500,000 randomly mutagenized barley grains theoretically contains all possible mutations in all genes of the barley, given a mutation density of 1 mutation in 1,500 kbp of genomic DNA. To improve the efficiency of the method of the present invention, the pool can contain plant regenerants with at least 2x more different genotypes than theoretically expected to contain all possible mutations. Thus, the pool may comprise at least 5,000 regenerants, such as at least 10,000 regenerants, for example at least 15,000 regenerants, such as at least 20,000 regenerants, for example at least 25,000 regenerants, such as at least 30,000 regenerants, for example at least 40,000 regenerants, such as at least 50,000 regenerants, for example at least 60,000 regenerants, such as at least 70,000 regenerants, for example at least 80,000 regenerants. 00 regenerated parts, such as at least 90,000 regenerated parts, for example at least 100,000 regenerated parts, such as at least 200,000 regenerated parts, for example at least 300,000 regenerated parts, such as at least 400,000 regenerated parts, for example at least 500,000 regenerated parts, such as at least 600,000 regenerated parts, for example at least 700,000 regenerated parts, such as at least 800,000 regenerated parts, for example at least 900,000 regenerated parts, for example at least 10 6 pieces of reproduction, e.g. at least 2.10 6 pieces of reproduction, e.g. at least 3.10 6 pieces of reproduction, e.g. at least 4.10 6 pieces of reproduction, e.g. at least 5.10 6 pieces of reproduction, e.g. at least 6.10 6 pieces of reproduction, e.g. at least 7.10 6 pieces of reproduction, e.g. at least 8.10 6pieces of reproduction, e.g. at least 9.10 6 10 regenerated parts, e.g. at least 10 7 In some embodiments, the pool may contain 5,000 to 100,000 regeneration parts, such as 10,000 to 90,000 regeneration parts, such as 15,000 to 85,000 regeneration parts, such as 20,000 to 80,000 regeneration parts, such as 25,000 to 90,000 regeneration parts, such as 30,000 to 100,000 regeneration parts, such as 30,000 to 75,000 regeneration parts. 000 regenerant parts, for example 50,000 to 75,000 regenerant parts, for example 50,000 to 1,000,000 regenerant parts, for example 100,000 to 500,000 regenerant parts, or 500,000 to 1,000,000 regenerant parts, or 600,000 to 900,000 regenerant parts, or 900,000 to 1,500,000 regenerant parts. In some embodiments the regenerant parts are seeds. This may be the case, for example, in embodiments where the seed in question is barley.

[0089] In some embodiments, the pool of regeneration parts may comprise regeneration parts of at least 5,000,000 plants having different genotypes, such as in the range of 1,000,000 to 100,000,000. In some embodiments, the pool of regeneration parts may comprise at least 5,000 different genotypes, such as at least 10,000 different genotypes, such as at least 15,000 different genotypes, such as at least 20,000 different genotypes, such as at least 25,000 different genotypes, such as at least 30,000 different genotypes, such as at least 40,000 different genotypes, such as at least 50,000 different genotypes, such as at least 60,000 different genotypes, such as at least 70,000 different genotypes, such as at least 80,000 different genotypes. 00 different genotypes, such as at least 90,000 different genotypes, for example at least 100,000 different genotypes, such as at least 200,000 different genotypes, for example at least 300,000 different genotypes, such as at least 400,000 different genotypes, for example at least 500,000 different genotypes, such as at least 600,000 different genotypes, for example at least 700,000 different genotypes, such as at least 800,000 different genotypes, for example at least 900,000 different genotypes, such as at least 10 6 different genotypes, e.g. at least 2.10 6 different genotypes, e.g. at least 3.10 6 different genotypes, e.g. at least 4.10 6 different genotypes, e.g. at least 5.10 6 different genotypes, e.g. at least 6.10 6 different genotypes, e.g. at least 7.10 6 different genotypes, e.g. at least 8.10 6 different genotypes, e.g. at least 9.10 6 different genotypes, e.g., at least 10 7In some embodiments a pool represents 5,000 to 100,000 different genotypes, such as 10,000 to 90,000 different genotypes, for example 15,000 to 85,000 different genotypes, for example 20,000 to 80,000 different genotypes, for example 25,000 to 90,000 different genotypes, for example 30,000 to 100,000, for example 30,000 to 75,000 different genotypes. In one embodiment, the number of different genotypes represented by the number of different genotypes is 50,000 to 75,000 different genotypes, for example 50,000 to 1,000,000 different genotypes, for example 100,000 to 500,000 different genotypes, or 500,000 to 1,000,000 different genotypes, or 600,000 to 900,000 different genotypes, or 900,000 to 1,500,000 different genotypes.

[0090] One advantage of the method of the present invention is that it allows screening of a large number of plant regenerants (such as seeds) of different genotypes. This allows the pool to contain a large number of regenerants of different genotypes. Furthermore, the method of the present invention may allow identification of organisms with a given mutation in any NOI. To be able to identify organisms with a mutation in any NOI, this may require the pool to contain a large number of different genotypes, such as the number of different genotypes mentioned above.

[0091] In a preferred embodiment of the present invention, a pool of regenerants (such as seeds) of a plant is prepared by mutagenesis, in particular by random mutagenesis. Thus, a plurality of regenerants can be subjected to mutagenesis to obtain a pool of regenerants. Said mutagenesis can in particular be random mutagenesis, which can be carried out, for example, as described below.

[0092] It may be sufficient to subject reproductive parts of a multicellular organism to random mutagenesis. In such embodiments, either a plurality of reproductive parts of a plant, such as a plurality of seeds of a plant, or a mixture thereof, are subjected to random mutagenesis.

[0093] A pool may contain multiple regenerants representing multiple genotypes. Thus, a pool may contain multiple regenerants that have been subjected to mutagenesis. However, a pool may also contain the progeny of regenerants that have been subjected to mutagenesis.

[0094] In this specification, the regenerant (e.g., a seed such as a cereal grain) subjected to mutagenesis may be referred to as generation M0. The regenerant, e.g., a seed such as a cereal grain, is sown and allowed to develop into a mature plant, and the regenerant (e.g., a seed such as a cereal grain) is considered as generation M1. The regenerant of generation M1, e.g., a seed, is sown and allowed to grow into a mature plant, and the regenerant (e.g., a seed) is considered as generation M2, and so on. The plant of the variety used to form the library, which has not yet been subjected to mutagenesis, is also referred to as the "parent plant". This is shown in Figure 2.

[0095] The pool of regenerant parts may include regenerant parts, such as seeds, e.g., cereal grains, of any of the generations mentioned above. The pool of regenerant parts may also include regenerant parts, e.g., seeds, e.g., cereal grains, of generations M1, M2 or M3. The pool of regenerant parts includes regenerant parts of generation M1, and preferably all regenerant parts in the pool of regenerant parts are of generation M1.

[0096] Random mutagenesis Efficient mutagenesis protocols are traditionally considered a fundamental requirement for the success of a breeding program. However, the present invention provides methods that involve the use of "mild" mutagenesis to generate anywhere from 1 to 30 non-synonymous mutations in the coding region per plant.

[0097] Random mutagenesis is currently based on the use of chemical mutagens or radiation. Historically, the efficacy of mutagens has been measured in terms of biological effects. However, it is desirable to establish a relationship of the observed biological effects to a well-defined and easily measurable physical quantity that characterizes the amount of radiation or chemical mutagen that confers the effect.

[0098] Random mutagenesis may be carried out by any useful method, such as radiation or chemical treatment. Irradiation can be UV, X-ray or radioactive irradiation. Chemical mutagenesis may include treatment with any mutagenic chemical, such as a chemical selected from the group consisting of sodium azide (NaN3), N-ethyl-N-nitrosourea (ENU), methyl nitrosoguanidine (MNNG) and ethyl methanesulfonate (EMS) or alkylating agents such as the alkylating agents described below. NaN3, ENU and EMS are often used to randomly generate mutants.

[0099] To induce random mutations in the DNA, particularly genomic DNA, of a plant, the grain or regenerable vegetative tissue can be treated with a mutagen or mixture of mutagens, including, but not limited to, sulfonates such as ethyl methanesulfonate (EMS), diethylsulfonate (DES); sulfur mustards, e.g., ethyl-2-chloroethylsulfide; nitrogen mustards, e.g., 2-chloroethyl-dimethylamine; and alkylating agents such as epoxides, e.g., ethylene oxide. Others include ethyleneimine, hydroxylamine (NH2OH), N-methyl-N'-nitro-N-nitrosoguanidine (MNNG), NaN3, and diazomethane. The treated tissue or grain can then be propagated to generate progeny organisms. Such random mutagenesis can be used in plants, such as crop plants, or any of the plants described in the section "Plants."

[0100] The method of the present invention is not limited to any particular type of mutagenesis, so long as it is a "mild" or "low" mutagenesis. Low mutagenesis can be mutagenesis resulting in a mutagenesis rate of 1-30 nonsynonymous mutations in the coding region per plant. In some embodiments, this corresponds to the mutation of interest occurring at a frequency equivalent to 1 mutation per 1.5 bases of genomic DNA. In some embodiments, low mutagenesis in diploid plants can be that more than 99.8%, preferably more than 99.9%, of all genes are free of nonsynonymous mutations in M1, and low mutagenesis in plants with ploidy higher than diploid can be that more than 98.0%, preferably more than 99.0%, of all genes are free of nonsynonymous mutations in M1.

[0101] Mutation rates are known for many types of mutagenesis, and the skilled artisan can easily calculate the optimal mutagen amount, concentration and / or exposure time for each mutagenesis type to obtain the desired mutation density or mutation frequency. Alternatively, the skilled artisan can test the mutagenesis to identify the optimal mutagen amount, concentration and / or exposure time to obtain the desired low mutagenesis rate for the plant species. The method of the present invention is based on performing mutagenesis by any of the methods described herein to obtain a low mutagenesis rate. A low mutagenesis rate can be in particular a mutagenesis rate that results in 1-30 nonsynonymous mutations in the coding region per plant. Alternatively, a low mutagenesis rate can be that more than 99.8%, e.g. 99.9%, of all genes are free of nonsynonymous mutations in diploid plants at M1, and a low mutagenesis rate can be that at least 98.0%, preferably at least 99.0%, of all genes are free of nonsynonymous mutations in plants with ploidy higher than diploid at M1.

[0102] For example, a library containing a plant of a given species with a certain number of genes is subjected to random mutagenesis under specific conditions, such as those described in Examples 3-5, for example at a specific mutagen concentration for a specific duration. Mutants are identified in a given region of a given length, such as those described herein. The number of mutants identified in that region can be used to calculate the mutation density for the given mutagenesis conditions (concentration and time) used. For example, if a 1,000 bp fragment is analyzed for 10,000 individuals and a total of 10 mutations are identified in the analyzed base pairs, the mutation rate under these conditions is 10 / (1,000x10,000)=1.10 -6 In other words, the mutation density under these conditions can be considered to be equal to the number of identified mutants divided by the number of elements (regenerators) screened times the length of the region screened, as shown below: Mutation density = (number of identified mutants) / ((number of mutagenized individuals) x (length of region analyzed)).

[0103] In some embodiments, mutagenesis generates one nonsynonymous mutation in the coding region per plant. In other embodiments, mutagenesis generates 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nonsynonymous mutations in the coding region per plant. In addition to the nonsynonymous mutations in the coding region, the plant may further comprise silent mutations, for example, in non-coding regions.

[0104] In a preferred embodiment, the mutagenesis step is such that the mutagenesis rate is at most 1 nonsynonymous mutation per 1,000 genes, such as at most 1 nonsynonymous mutation per 5,000 genes, such as at most 1 nonsynonymous mutation per 10,000 genes, such as at most 1 nonsynonymous mutation per 20,000 genes, such as at most 1 nonsynonymous mutation per 30,000 genes, such as at most 1 nonsynonymous mutation per 5,000 genes. One nonsynonymous mutation per 1000 genes means that if a plant has 6000 genes, 6 genes are expected to carry nonsynonymous mutations in the coding region, while 5994 genes are expected to lack nonsynonymous mutations, but may still contain other mutations, such as synonymous mutations, outside the coding region. In another preferred embodiment, the mutagenesis step is such that the mutagenesis rate is such that at least 99.8%, preferably at least 99.9%, of all genes are free of nonsynonymous mutations in M1 diploid plants, and the low mutagenesis rate is such that at least 98.0%, preferably at least 99.0%, of all genes are free of nonsynonymous mutations in M1 plants having a ploidy higher than diploid.

[0105] In some embodiments the mutagenesis step converts at most 30 nonsynonymous mutations in the coding regions of a plant of generation M1 or M(1+X), such as at most 25 nonsynonymous mutations in the coding regions, such as at most 20 nonsynonymous mutations in the coding regions, such as at most 15 nonsynonymous mutations in the coding regions, such as at most 10 nonsynonymous mutations in the coding regions, such as at most 5 nonsynonymous mutations in the coding regions, such as at most 4 nonsynonymous mutations in the coding regions, such as at most 3 nonsynonymous mutations in the coding regions, such as at most 2 nonsynonymous mutations in the coding regions, such as at most 1 silent mutation in the coding region.

[0106] Methods involving mutagenesis have often been carried out under conditions in which a significant portion (up to 50%) of the mutagenized organisms are not viable and die. In contrast, since the present method can be carried out on a large number of plants or regenerants thereof, it is advantageous to carry out random mutagenesis under conditions in which most of the plants survive. Preferably, mutagenesis is carried out under conditions in which 90% of the regenerants survive the mutagenesis step, such as at least 91% of the regenerants, such as at least 92% of the regenerants, such as at least 93% of the regenerants, such as at least 94% of the regenerants, such as at least 95% of the regenerants, such as at least 96% of the regenerants, such as at least 97% of the regenerants, such as at least 98% of the regenerants, such as at least 99% of the regenerants survive the mutagenesis step.

[0107] For most crops, ethyl methanesulfonate (EMS) is often the mutagen of choice, but barley mutagenesis is usually carried out using a sodium azide (NaN3)-based mutagenesis treatment.

[0108] Treatment of barley with sodium azide (1.5 mM for 2 h) typically results in a mutation density of 1 for every 500,000 bp (Szurman-Zubrzycka et al., 2018). This number is usually determined by analyzing sequencing data from different genes in a population. With a mutation density of 1:500,000 bp, and a barley genome of 5.3 GB, each barley plant carries about 10,000 mutations. The coding sequence of barley is about 65 Mb, which is 1-2% of the total genome. On that basis, it can be assumed that about 100-200 of the 10,000 induced mutations are in the coding regions.

[0109] Approximately 1 / 3 of sodium azide mutations in coding regions result in silent nucleotide substitutions. Thus, when mutagenesis is performed with sodium azide, Nsnm is typically 66%. Thus, it can be assumed that 50-100 mutations out of 10,000 induced mutations result in nonsynonymous mutations in coding regions. Since mutations occur randomly throughout the genome, it can be assumed that 50-100 amino acid substitutions in coding regions occur in different coding regions or genes throughout the genome. Mutation density is crop and treatment dependent. In other crops, mutation density in a typical TILLING library can range from 1 in every 20,000 bp to 1 in every 1,000,000 bp of total genomic DNA.

[0110] In some embodiments, the mutagen is NaN3. In such embodiments, NaN3 is preferably used at a concentration of less than 1 mM for 2 hours or less, such as 0.9 mM or less, such as 0.8 mM or less, such as 0.7 mM or less, such as 0.6 mM or less, such as 0.5 mM or less, such as 0.4 mM or less, such as 0.3 mM or less for 2 hours or less. In one embodiment, NaN3 is preferably used at a concentration of about 0.3 mM for 1.5 to 2.5 hours.

[0111] The random mutagenesis step may also be carried out with EMS, preferably at a concentration of 4% or less for 2 hours or less, such as 3% or less, for example 2% or less, such as 1.5% or less, for example 1% or less, such as 0.75% or less, for example 0.5% or less, such as 0.4% or less, for example 0.3% or less, such as 0.2% or less for 2 hours or less, such as 0.1% for 24 hours or less.

[0112] Random mutagenesis can also be performed by other methods known in the art, such as random CRISPR mutagenesis (Lu et al., 2017), which uses specific CRISPR arrays to randomly mutagenize a population of plants. For example, an array of CRISPR guide RNAs is synthesized and randomly transformed into plants, thereby generating a library of plants each carrying a CRISPR-induced mutation in their genome.

[0113] Splitting the reclaimed pool into subpools The method of the invention involves dividing a pool of regenerant parts of a plant, such as seeds, of generation M1 or M(1+X) into one or more subpools, each subpool comprising a plurality of regenerant parts of a plant, such as seeds, each subpool comprising regenerant parts representing a plurality of genotypes, and importantly, each subpool comprises all regenerant parts from a given mature plant.

[0114] In some embodiments where the regenerants are of generation M(1+X), it may be preferred that all regenerants of all progeny of a given generation M0 plant are placed into the same subpool.

[0115] In practice, taking the example where the regenerants are seeds of plants grown in a field, once a pool of mutagenized seeds (generation M0) is obtained, the entire pool is sown in a field. The entire field is another pool of seeds of generation M1, which contains all the seeds of the plants that arose from the pool of seeds of generation M0. The total pool of seeds of generation M1 is referred to herein as the "library." The size of the library is determined by the N p Unlike, the M1 seed library is based on GECN count and harvest rate. The M1 seed library is divided into subpools, for example as follows: the field is divided into different regions, and seeds from one region are one subpool. These seeds are then present in this example of M1. The subpools of seeds are then divided into fractions, as detailed elsewhere herein.

[0116] When seeds of generation M2 or later are used, the plants from which the seeds of the later generations are obtained may, in some embodiments, be grown in a manner that allows all seeds of progeny plants of the same M0 to be placed in the same subpool.

[0117] One skilled in the art can transfer the above examples to plants grown under different conditions, such as in a greenhouse, in different pots, etc.

[0118] As described herein in Example 8, the optimal size of the subpools may be determined based on the detection sensitivity of the (high sensitivity) detection means employed and the number of GECNs. Thus, in a preferred embodiment, the optimal subpool size is determined as described in Example 8 below. Therefore, the maximum subpool size (SPm) can be calculated as follows:

number

[0119] Typically, the pool is divided into a number of subpools, preferably into at least 2 subpools, such as into at least 50 subpools, such as into at least 100 subpools, preferably into at least 200 subpools, more preferably into at least 300 subpools, even more preferably into at least 400 subpools, even more preferably into 500 subpools, even more preferably into at least 1000 subpools, even more preferably into at least 1500 subpools.

[0120] In some embodiments, the pool is divided into at least 500, such as at least 1000, such as at least 1500 subpools. This may be particularly the case in some embodiments of the invention where the pool comprises a large number of organisms of different genotypes.

[0121] In principle there is no upper limit to the number of sub-pools, however typically the pool is divided into up to 50,000, such as up to 25,000, such as up to 10,000 sub-pools. In some embodiments, the pool is divided into a range of 90-1000 subpools. Each subpool preferably comprises regenerant parts of multiple plants expressing multiple genotypes. Preferably, each subpool comprises regenerant parts of at least 10 plants, more preferably at least 100 plants, even more preferably at least 200 plants, even more preferably at least 300 plants, even more preferably at least 400 plants, even more preferably at least 500 plants, even more preferably at least 1,000 plants, even more preferably at least 5,000 plants, having different genotypes. In some embodiments, each subpool comprises regenerant parts in the range of 500-5,000 plants, for example in the range of 600-2,000 plants, having different genotypes. In some embodiments, each subpool contains regenerant portions representing in the range of 1,000-2,000 different genotypes.

[0122] It is also preferred that each subpool contains two or more regenerants of each genotype. This can be achieved by ensuring that all regenerants of any given mature plant are placed in the same subpool. In particular, it is preferred that each subpool contains a sufficient amount of regenerants of each genotype in order to randomly divide the subpool into 2, 3 or 4 fractions, in such a way that each fraction theoretically contains regenerants representing each genotype of the subpool. Thus, it is preferred that each subpool contains at least 5, preferably at least 10, and even more preferably at least 15 regenerants representing each genotype. This may be the case in some embodiments of the invention, particularly where the species is a cereal. An example of how a pool can be divided into subpools is provided in FIG.

[0123] Generally, the subpools may be prepared in such a way that all regenerative parts of one particular plant are contained in one subpool. Thus, in one embodiment of the present invention, the method comprises the steps of: - providing a plurality of regenerating parts of a plant, e.g. seeds of a cereal grain; - mutagenizing the seeds, thereby obtaining regenerant parts, such as seeds of the M0 generation; - growing a reproductive part, such as a seed, of generation M0 into a mature plant and obtaining a reproductive part, such as a seed, from the mature plant, wherein the reproductive part, such as a seed, is a seed of generation M1; - optionally repeating the previous steps X times to obtain a plant comprising regenerant parts, such as seeds, of generation M(1+X); - obtaining regenerant parts, such as seeds, of generation M1 or M(1+X) from mature plants, thereby obtaining a pool of regenerant parts, such as seeds (e.g. a pool of cereal grains); - Dividing the pool into sub-pools, where all reproductive parts such as seeds (e.g. cereal kernels) from a given mature plant are placed in the same sub-pool.

[0124] These steps are illustrated in Figure 2 using barley as an example. The method may include the steps illustrated in Figure 2. Those skilled in the art will appreciate that similar principles apply to other plants. Thus, the steps illustrated in Figure 2 may be performed using any flowering plant and are therefore not limited to barley. Other mutagenesis protocols may be used and are not limited to mutations using sodium azide. Also, the steps illustrated in Figure 2 may be performed with any number of mutated plants. Thus, the method may comprise the steps of: - providing a plurality of reproductive parts of a plant, such as seeds of a cereal grain; - mutagenizing the regenerating part, thereby obtaining a regenerating part of generation M0; - optionally culturing regenerants of generation M0 and obtaining regenerants, such as seeds, from mature plants, the regenerants being regenerants of generation M1; - optionally repeating the previous step X times to obtain a plant comprising regenerants of generation M(1+X); - cultivating regenerants, such as seeds, of generations M0, M1 or M(1+X) into mature plants in separate field plots, the regenerants constituting a pool of regenerants; - dividing the area into field sub-plots; - Harvesting all reproductive parts, such as seeds, of all plants in one field sub-plot, thereby obtaining a sub-pool of reproductive parts (e.g. a sub-pool of seeds, such as grain kernels), sometimes called the "grain total".

[0125] Instead of cultivating regeneration parts such as seeds in field plots, they may be cultivated in any useful manner that allows dividing the plants into subgroups and thus obtaining subpools. For example, regeneration parts may be cultivated in separate containers, each containing one or more plants. Seeds may be cultivated in greenhouses.

[0126] Examples of methods for dividing a pool of regenerant portions into subpools are provided in International Application PCT / EP2017 / 065516, in particular the section entitled "WS2: Preparation of an ordered library of grains derived from mutated cereal plants".

[0127] Identifying the subpool The method of the invention involves dividing a pool of regenerant parts, such as seeds, into subpools. DNA samples from each subpool are then prepared and used to identify subpools that contain DNA containing mutations.

[0128] Preferably, the DNA sample is prepared by a method comprising the steps of: (1) dividing each subpool into multiple fractions; and (2) preparing a DNA sample from all the fractions.

[0129] Preferably, the fractions of each subpool are prepared in such a manner that at least two fractions theoretically contain regenerated parts of plants of all genotypes expressed in the subpool. Preferably, all fractions theoretically contain regenerated parts of all genotypes expressed in the subpool. This can be achieved, for example, by thoroughly mixing all regenerated parts of the subpool and randomly dividing the subpool into a range of 2 to 10 fractions, such as a range of 2 to 6 fractions, such as a range of 2 to 4 fractions. It is preferred that at least two fractions each contain a range of 10 to 50%, such as a range of 15 to 50%, such as a range of 20 to 50%, of the regenerated parts of the subpool.

[0130] Thus, a subpool may be divided into at least two fractions, such as at least three fractions, such as at least four fractions, or more fractions, each fraction theoretically containing a reproducing portion of every genotype expressed in the subpool. i. As described in Example 10, the optimal fraction size can be calculated based on the average number of regenerants per plant and the number of GECNs. Thus, in one embodiment, it is preferred that DNA samples are prepared from fractions of the regenerants of the subpools as follows: each subpool is randomly divided, and the first fraction is the (GECN*100 / RP) of the regenerants of the subpool. P )%~(GECN*500 / RP P )%; the first fraction comprises at most 50% of the regenerant portion; ii. preparing a DNA sample of the entire first fraction of each subpool, RP P is the number of regrowths per mature plant. Analysis of the fractions, and therefore identification of the subpools, involves the following steps: a) preparing DNA samples, each containing DNA from each genotype in one fraction, which can be performed, for example, as described herein in the "DNA Sample Preparation" section below; b) using a sensitive detection means to detect the presence of a mutation in the NOI of interest. Step a) may in particular involve DNA (or RNA) being extracted from the entire fraction.

[0131] The step of using a highly sensitive detection means may include the steps of performing multiple PCR amplifications, each comprising multiple compartmentalized PCR amplifications, for example performed as described herein in the section below, "PCR amplifications comprising multiple compartmentalized PCR amplifications"; and detecting PCR amplification products comprising mutations in the NOI of interest, thereby identifying the fraction of interest, and thus the subpool of interest, performed as described herein in the section below, "Detection of PCR amplification products".

[0132] The subpools may be directly identified, for example, insofar as the PCR amplification product contains a mutation in the NOI that can be directly detected after or during PCR amplification. This may be done, for example, when the PCR amplification product contains a detection means that produces one or more detectable signals, insofar as the PCR amplification product contains a target sequence that contains a mutation in the NOI. Such detection means are described in detail herein below in the "Detection of PCR Products" section, and may be, for example, a mutation detection probe. An example of a method for identifying fractions containing one or more specific mutations comprises the following steps: - providing subpools and dividing each subpool into fractions; - preparing samples from all fractions of each subpool; - preparing a DNA sample, such as genomic DNA or mRNA, from the sample; - performing PCR amplification on all of the individual DNA samples from all of the subpools, e.g. in individual wells of a microtiter plate; - Selecting samples containing a mutation in the NOI.

[0133] Preparation of DNA samples The method of the present invention does not require that a DNA sample be prepared separately for each regenerating part contained in a fraction.Indeed, it is preferred that the whole fraction is used to obtain a DNA sample, and the DNA sample is in fact a pooled DNA sample that contains the DNA from all genotypes contained in the fraction.The DNA sample can be a gDNA sample, or it can be a cDNA sample, for example a cDNA sample, made as known in the art from an mRNA sample.Thus, preferably the method does not include the step of preparing a separate DNA sample for each plant or regenerating part of a fraction or subpool.

[0134] The method of the present invention comprises one or more steps of preparing a DNA sample, in particular an mRNA sample, preferably a gDNA or cDNA sample prepared from a gDNA sample. In particular, the method may comprise one step of preparing a DNA sample from the entire fraction.

[0135] The method of the invention may also include the step of preparing a DNA sample from the secondary subpool.

[0136] Generally, the DNA samples of the subpools are prepared in such a manner that the DNA samples theoretically contain DNA from each genotype in the subpool. DNA samples can be prepared from the entire fraction, while the reproductive potential of the reproductive portion of each genotype is maintained in other fractions of the subpool.

[0137] Thus, each subpool will generally contain two or more individual seeds, or regenerant portions, of each genotype, such that when divided into fractions, each fraction will contain two or more individual regenerant portions of each genotype. In particular, it will be preferred that each subpool contains a sufficient amount of regenerant portions of each genotype such that the subpool or superpool can be randomly divided into a range of 2-10 fractions, such as a range of 2-6 fractions, such as 2, 3 or 4 fractions, in such a manner that each fraction theoretically contains a regenerant portion representing each genotype of the subpool or superpool.

[0138] In this way, a portion of the regenerant parts from the subpools, for example, in the range of 10-90%, preferably in the range of 10-50%, for example, in the range of 15-50%, for example, in the range of 20-50%, of the regenerant parts of each subpool, may be used for the preparation of a DNA sample. The portion of the regenerant parts is also referred to herein as a "sample of regenerant parts". The remainder of the regenerant parts of the subpools may be stored under conditions that maintain the reproductive potential of the regenerant parts. It may be sufficient to preserve the seeds of the plant. Seeds, for example cereal grains, are often stored in any dry and dark place.

[0139] Subpools preferably contain several individual regenerants of each genotype as described elsewhere herein, so that often a secondary subpool will contain only a few, possibly only one, regenerants of each individual genotype.

[0140] As explained above, when DNA is obtained from a subpool, DNA is usually extracted from the entire fraction of the subpool. However, when DNA is obtained from a secondary subpool, DNA may be obtained from an individual regenerating part. When the sample is obtained from an individual regenerating part, it is preferable to obtain the sample in a manner that does not significantly impair the reproductive potential of the regenerating part. Thus, the DNA sample may be prepared from a sample that includes or consists of a part of the regenerating part, such as a seed, that is not essential for reproduction. Depending on the species, the sample may be obtained in any useful manner, for example by using biopsy, cutting, punching, grating, tearing, or by applying a syringe with a needle. For example, in some embodiments where the species is a cereal, the sample preferably includes a part of the cereal kernel, which is not essential for reproduction. The sample may be obtained in different ways, such as, for example, by cutting off a part of the kernel using any sharp instrument such as a knife, scalpel, scissors, by grating and collecting a part of the kernel, or by punching the grain. In the latter case, the sample may be the powder obtained after punching.

[0141] Once a fraction of the regenerating part, or a sample obtained from the regenerating part, or a part thereof, is available (also collectively referred to herein as a "sample"), a DNA sample can be prepared from the sample in any useful manner. When the sample contains large structures, e.g., whole seeds, the first step for preparing a DNA sample, such as a gDNA sample, usually involves breaking up the contents of the sample into smaller parts, e.g., by physical means such as crushing or grinding. Methods for preparing a DNA sample usually involve disrupting cells and / or tissues, e.g., by detergents, by enzymes (e.g., lyticase), by ultrasound, or by a combination thereof, thereby generating a crude lysate. The lysate can be separated from any remaining tissue debris by any useful means. The crude lysate can constitute a DNA sample, including a gDNA sample. Alternatively, the DNA, e.g., gDNA or mRNA used to obtain a cDNA sample, can be further purified by separating the DNA from the rest of the lysate, e.g., by binding to a selective matrix, centrifugation, gradient centrifugation and / or precipitation (e.g., using precipitating agents such as salts, alcohols or magnetic beads). Prior to such separation, other components of the lysate, including proteins and / or nuclear proteins, may be denatured or destroyed, for example, by using enzymes and / or denaturants. Other RNA-containing molecules may be removed, for example, with the aid of enzymes. Useful methods for preparing DNA samples, such as cDNA or gDNA samples, are described, for example, in Sambrook et al., Molecular Cloning-Laboratory Manual, ISBN 978-1-936113-42-2.

[0142] Highly sensitive detection means The method of the present invention includes a step of identifying a fraction of the subpools and thus identifying the corresponding subpools of interest using a means for detecting nucleic acid sequences, preferably a highly sensitive detection means. The term "highly sensitive detection means" refers to a detection means that allows the detection of one mutant organism in a library of at least 300 organisms, even if the genotype of the mutant organism differs from the genotype of the non-mutant organism by at most one nucleotide. Preferably, the detection means is sensitive enough to allow the detection of one mutant genome in a library of 300 genomes, even if the mutant genome differs from the other 299 genomes by only one nucleotide.In some embodiments the detection means detects a mutant organism such as a plant in a library of at least 300 organisms such as plants, for example one mutation in a library of at least 400 organisms, such as one mutation in a library of at least 500 organisms, for example one mutation in a library of at least 600 organisms, such as one mutation in a library of at least 700 organisms, for example one mutation in a library of at least 800 organisms, such as one mutation in a library of at least 900 organisms, for example one mutation in a library of at least 1,000 organisms, such as one mutation in a library of at least 1,100 organisms, for example one mutation in a library of at least 1,200 organisms, such as one mutation in a library of at least 1,300 organisms, for example For example, one mutation in a library of at least 1,400 organisms, such as one mutation in a library of at least 1,500 organisms, for example one mutation in a library of at least 1,600 organisms, such as one mutation in a library of at least 1,700 organisms, for example one mutation in a library of at least 1,800 organisms, such as one mutation in a library of at least 1,900 organisms, for example one mutation in a library of at least 2,000 organisms, such as one mutation in a library of at least 2,500 organisms, for example one mutation in a library of at least 3,000 organisms, such as one mutation in a library of at least 4,000 organisms, for example one mutation in a library of at least 5,000 or more organisms.

[0143] For example, the highly sensitive detection means has a detection sensitivity of at least 1 in 1,000, for example, a detection sensitivity of 1 in the range of 1,000 to 10,000, for example, a detection sensitivity of 1 in the range of 1,000 to 5,000.

[0144] For example, the method of the present invention may include a step of amplifying a target sequence by each PCR amplification comprising a DNA sample from one fraction, i.e., from all regenerated portions present in one fraction (e.g., prepared as described in the section above). Each PCR amplification may comprise multiple compartmentalized PCR amplifications, each comprising a portion of the DNA sample, one or more primer sets flanking the target sequence, and PCR reagents.

[0145] RNase H2-dependent PCR (rhPCR) can improve PCR specificity by incorporating a blocked primer that contains a single ribonucleotide residue that is activated by enzymatic cleavage. In particular, the blocked primer for rhPCR contains a single ribonucleotide residue that induces cleavage by RNase H2 after full hybridization to the target. Cleavage occurs at the 5' side of the RNA base, thus releasing the RNA base together with the 3' blocking moiety and allowing selective amplification of the target DNA fragment. A tail sequence can be incorporated into the amplicon to combine the use of a 5' nuclease assay-based reporter system with rhPCR. In some embodiments, the PCR reaction is a rhPCR reaction, for example as described in Example 2.

[0146] In another example, Cas nucleases with trans-cleavage activity, such as Cas12a, can be used as a highly sensitive detection tool (Chen et al., 2018). Recently, several Cas nucleases with trans-cleavage activity have been reported that can detect nucleotide substitutions in complex samples. This method exploits the ability of CRISPR to guide a molecule (in this case Cas12a nuclease) to a specific stretch of DNA or RNA. CRISPR molecules can be designed to be specific for a target sequence that contains a NOI. Upon binding to a target sequence that contains a NOI, Cas12a cleaves the specific RNA or DNA strand. Unlike traditional CRISPR-bound nucleases such as Cas9, Cas12a also initiates cleavage of single-stranded DNA or RNA molecules that are in close proximity to its nuclease. Here, a single-stranded DNA or RNA strand, a reporter molecule labeled with a fluorescent marker, and a quencher are utilized as substrates for Cas12a trans-cleavage. In this embodiment, CRISPR-Cas12a specifically binds to the DNA or RNA sequence that contains only NOI, and initiates the cleavage of the reporter molecule adjacent thereto.The cleavage of the reporter molecule releases fluorophore, signaling the presence of the DNA or RNA molecule that contains NOI.If the reaction only contains the target sequence that does not contain NOI, CRISPR-Cas12a complex does not bind to the target, and therefore does not initiate the trans-cleavage of the reporter molecule, which remains quenched.

[0147] The total PCR reaction comprising multiple compartmentalized PCR amplifications can be prepared in many different ways. In one embodiment, the PCR amplification comprising multiple compartmentalized PCR amplifications can be carried out as digital PCR (dPCR) amplification. Any dPCR amplification known to those skilled in the art can be used in the present invention. In general, at least one dPCR amplification comprising multiple compartmentalized PCR amplifications is carried out for each DNA sample prepared. Thus, at least one dPCR amplification comprising multiple compartmentalized dPCR amplifications is carried out for each fraction of each subpool. In general, compartmentalized dPCR amplification is carried out in a manner that includes the following steps: - preparing a dPCR amplification kit including a DNA sample, a primer set flanking a target sequence, and PCR reagents; - compartmentalizing the dPCR amplification such that nucleic acid molecules in the sample are localized and concentrated into a plurality of spatially separated compartments; - carrying out dPCR amplification; - detecting the dPCR-based amplification product.

[0148] The DNA sample may be a gDNA sample or cDNA obtained from an mRNA sample. In some embodiments, the sample is a gDNA sample.

[0149] Said separated compartment can be any separate compartment in which PCR amplification can be carried out.For example, it can be the well of a plate, for example the well of a microwell plate or a microtiter plate, it can be a microfluidic chamber, it can be a capillary tube, it can be the dispersed phase of an emulsion, or it can be the miniaturized chamber of a droplet or miniaturized chamber array.Separated compartments can also be separate spots on a solid support, for example separate nucleic acid binding surfaces.

[0150] It is generally preferred that DNA sample is randomly distributed in the sample for compartmentalized dPCR amplification.It is also preferred that each compartmentalized dPCR amplification contains only a small number of nucleic acids that contain target sequence.Due to the nature of random distribution, there may be some variation in the number of nucleic acid molecules that are contained in each compartmentalized dPCR amplification.In one embodiment, each compartmentalized dPCR amplification contains, on average, up to 10, for example up to 5, nucleic acid molecules that contain target sequence.

[0151] In one preferred embodiment of the present invention, the dPCR amplification comprising multiple compartmentalized PCR amplifications is droplet digital polymerase chain reaction (ddPCR). ddPCR is a method of performing dPCR based on water-oil emulsion droplet technology. PCR amplification is fractionated into multiple microdroplets, and PCR amplification of target sequences occurs in each individual droplet. In general, ddPCR technology uses PCR reagents and workflows similar to those used to perform conventional PCR. Thus, compartmentalization of PCR amplification is an important aspect of ddPCR technology.

[0152] Thus, the compartmentalized ddPCR amplification may be contained in droplets, which may include, for example, emulsion compositions or mixtures of two or more immiscible fluids (e.g., as described in U.S. Pat. No. 7,622,280 or as described in the Examples herein below). The droplets may be generated by the devices described in WO 2010 / 036352. In particular, the droplets may be prepared using a droplet generator, for example, the QX200 Droplet Generator available from Bio-Rad Laboratories, USA (hereinafter abbreviated as Bio-Rad). The term emulsion, as used herein, may refer to a mixture of immiscible liquids (such as oil and water). The emulsion may be, for example, water in oil droplets, for example, as described in Hindson et al. (2011). The emulsion may thus include aqueous droplets within a continuous oil phase. The emulsion may also be an oil-in-water emulsion, where the droplets are oil droplets in a continuous aqueous phase. Droplets as used herein are typically designed to prevent inter-compartment mixing, not only to prevent evaporation of the contents of an individual compartment, but also to prevent mixing with the contents of other compartments, and thus each droplet can be considered a spatially separated compartment.

[0153] Each droplet for ddPCR can have any useful volume. However, preferably, the droplet has a volume in the nL range. Therefore, it is preferable that the droplet volume is in the range of 0.1 to 10 nL on average.

[0154] Microfluidic methods of producing emulsion droplets using microchannel cross-flow focusing or physical agitation are known to produce either monodisperse or polydisperse emulsions. The droplets may be monodisperse droplets. Also, the droplets can be generated such that their size does not vary by more than ±5% of the average size of the droplets. In some cases, the droplets are generated such that the size of the droplets varies by ±2% of the average size of the droplets.

[0155] Higher mechanical stability may be useful in microfluidic manipulation and high shear fluid processing (e.g., processing in microfluidic capillaries or through 90° turns such as valves in fluid paths). The droplets or capsules before and after heat treatment may be mechanically stable to standard pipetting and centrifugation.

[0156] The droplets can be formed by flowing an oil phase through an aqueous sample. The aqueous phase can comprise or consist of components in a PCR amplification, including PCR reagents, such as a DNA sample, a set of primers flanking a target sequence, and any of the PCR reagents described herein below in the "PCR Reagents" section.

[0157] The oil phase may include a fluorinated base oil, which may be additionally stabilized by combining with a fluorinated surfactant, such as a perfluorinated polyether. In some cases, the base oil may be one or more of HFE7500, FC-40, FC-43, FC-70, or other common fluorinated oils. In some cases, the anionic surfactant is Ammonium Krytox (Krytox-AM), an ammonium salt of Krytox FSH, or a morpholino derivative of Krytox-FSH.

[0158] The oil phase may further comprise additives to adjust oil properties such as vapor pressure, viscosity or surface tension. Non-limiting examples include perfluorooctanol and 1H,1H,2H,2H-perfluorodecanol. The oil phase may be a droplet generation oil, such as Droplet Generation Oil available from Bio-Rad.

[0159] Emulsions can be formulated to produce highly monodisperse droplets with a liquid-like interfacial film that can be converted to microcapsules with a solid-like interfacial film upon heating, and such microcapsules can behave as bioreactors that retain their contents throughout a reaction process, such as PCR amplification. The conversion to the microcapsule form can occur upon heating. For example, such conversion can occur at temperatures greater than 50, 60, 70, 80, 90, or 95° C. In some cases, this heating occurs using a thermocycler. A fluid or mineral oil overlay can be used to prevent evaporation during the heating process.

[0160] In some cases, the droplets are generated using a commercially available droplet generator, such as the Bio-Rad QX100™ Droplet Generator or the Bio-Rad QX200™ Droplet Generator. The ddPCR and subsequent detection can be performed using a commercially available droplet reader, such as the Bio-Rad QX100 or QX200™ Droplet Reader.

[0161] Each PCR amplification can be compartmentalized into any suitable number of compartments. However, in a preferred embodiment, each PCR amplification is compartmentalized into a range of 1,000 to 100,000 compartments (e.g., droplets). For example, each PCR amplification can be compartmentalized into a range of 10,000 to 50,000 compartments (e.g., droplets). For example, each PCR amplification can be compartmentalized into a range of 15,000 to 25,000 compartments (e.g., droplets). Further, each PCR amplification can be compartmentalized into about 20,000 compartments (e.g., droplets).

[0162] Subpool Organization Prior to the step of identifying the subpools, the method of the invention may also include a step of organizing the subpools, which facilitates the identification of subpools that contain regenerant portions, such as seeds, that contain the mutation of interest.

[0163] For example, fractions of DNA samples from several subpools can be combined into a "superpool". The superpools containing DNA with the mutation of interest can then be identified using highly sensitive detection means. Later, only the subpools contained in the superpool that contain DNA with the mutation of interest will be tested. Useful methods for the preparation and testing of superpools are described in WO 2018 / 001884.

[0164] In another example, the subpools are arranged in a multi-dimensional grid, and a superpool of the subpools is prepared in each dimension. This is most easily explained using a two-dimensional grid as an example. The coordinates in the grid of each subpool are (x,y). The fraction of DNA samples of all subpools with coordinate X is pooled and tested for the presence of DNA containing the mutation of interest. Similarly, the fraction of DNA samples of all subpools with coordinate Y is pooled and tested for the presence of DNA containing the mutation of interest. Once a superpool containing DNA samples from a given coordinate X and a given coordinate Y is identified as containing DNA containing the mutation of interest, the subpool containing said DNA can be identified based on its coordinates X and Y. Those skilled in the art will understand that similar systems can be created using multiple dimensions, not just two dimensions.

[0165] Thus, it is contemplated within the methods of the invention that subpools may be constructed such that, rather than testing each subpool for the presence of DNA containing a mutation of interest, a group of subpools may be tested together, which may be performed, for example, using any of the sensitive detection means described herein.

[0166] PCR Reagents In some embodiments, the methods involve performing several rounds of PCR amplification, at least some of which may include multiple compartmentalized PCR amplifications.

[0167] Whether or not the PCR involves compartmentalized PCR amplification, a PCR amplification generally involves a DNA sample, a set of primers that flank a target sequence, and PCR reagents, which may be any of the PCR reagents described in this section of the specification.

[0168] PCR reagents generally include at least nucleotides and a nucleic acid polymerase. The nucleotides may be deoxyribonucleotide triphosphate molecules, and preferably the PCR reagents include at least dATP, dCTP, dGTP and dTTP. In some cases, the PCR reagents also include dUTP.

[0169] A nucleic acid polymerase can be any enzyme capable of catalyzing the template-dependent polymerization, i.e., replication, of nucleotides. The nucleic acid polymerase must be able to withstand the temperatures used in PCR amplification, and it must have catalytic activity at the extension temperature. Several thermostable nucleic acid polymerases are known to those skilled in the art.

[0170] In some embodiments of the invention, the nucleic acid polymerase has 5'-3' nuclease activity, which allows it to be used in amplification reactions with TaqMan® probes.

[0171] The nucleic acid polymerase can be Escherichia coli DNA polymerase I. The nucleic acid polymerase can also be Taq DNA polymerase with strand dependent DNA synthesis instead of 5'-3' exonuclease activity. Other polymerases with 5'-3' nuclease activity include, but are not limited to, rTth DNA polymerase. For example, Taq DNA polymerase from New England Biolabs can include Crimon LongAmp® Taq DNA polymerase, Crimson Taq DNA polymerase, Hemo KlenTaq™, or LongAmp® Taq.

[0172] In some cases, the nucleic acid polymerase can be, for example, E. coli DNA polymerase, Klenow fragment of E. coli DNA polymerase I, T7 DNA polymerase, T4 DNA polymerase, Taq polymerase, Pfu DNA polymerase, Vent DNA polymerase, bacteriophage 29, REDTaq™, genomic DNA polymerase, or Sequenase. DNA polymerases are described, for example, in U.S. Patent Application Publication No. 20120258501.

[0173] In addition, the PCR reagents may include salts, buffers, and detection means. The buffers may be any useful buffer, such as TRIS. The salts may be any useful salt, such as potassium chloride, magnesium chloride, or magnesium acetate or magnesium sulfate.

[0174] The PCR reagents may include a non-specific blocking agent, such as BSA, gelatin from bovine skin, β-lactoglobulin, casein, dry milk, salmon sperm DNA or other common blocking agents.

[0175] PCR reagents may also include biopreservatives (e.g., NaN3), PCR enhancers (e.g., betaine, trehalose, etc.) and inhibitors (e.g., RNase inhibitors). Other additives may include dimethyl sulfoxide (DMSO), glycerol, betaine (mono)-hydrate, trehalose, 7-deaza-2'-deoxyguanosine triphosphate (7-deaza-2'-dGTP), bovine serum albumin (BSA), formamide (methanamide), tetramethylammonium chloride (TMAC), other tetraalkylammonium derivatives [e.g., tetraethylammonium chloride (TEA-Cl)]; tetrapropylammonium chloride (TPrA-Cl) or non-ionic detergents, such as Triton X-100, Tween 20, Nonidet P-40 (NP-40) or PREXCEL-Q.

[0176] In addition, the PCR reagents may also include one or more means for the detection of PCR amplification products containing mutations in the NOI. The above means may be any detectable means, which may be added as individual compounds or may be incorporated into one of the primers or may be covalently attached. Detectable means include, but are not limited to, dyes, radioactive compounds, bioluminescent compounds and fluorescent compounds. In a preferred embodiment, the detection means is one or more probes. Thus, it is preferred that the PCR reagents include one or more detection probes, such as any of the probes described in the "Detection of PCR Amplification Products" section herein below.

[0177] Primers flanking the target sequence The method of the present invention includes the use of one or more primer sets flanking a target sequence. The separate "sets of primers" flanking a target sequence include one primer (also referred to as "forward primer") that contains a sequence identical to the 5' end of the target sequence, and one primer (also referred to as "reverse primer") that contains a sequence complementary to the 3' end of the target sequence. The primer sets can amplify a target sequence when added to a PCR with a nucleic acid that contains the target sequence and PCR reagents under conditions that allow amplification of the target sequence. Although it is possible that different primer sets are used for different steps of the PCR amplification of the present invention, the same primer set can be used for all PCR amplifications of the method according to the present invention.

[0178] In addition to the sequence identical to the 5' end of the target sequence, forward primer can contain additional sequence.Similarly, in addition to the sequence complementary to the 3' end of the target sequence, reverse primer can contain additional sequence.For example, primer can contain additional nucleic acid sequence at 5' end, which does not hybridize with target nucleic acid, but facilitates handling of primer or PCR amplification product, for example, product detection.

[0179] The length of the forward and reverse primers can depend on the sequence of the target sequence. For example, the length of the primers can be determined based on the desired melting temperature T m Thus, the length of the forward primer and the reverse primer may be in the range of 10 to 100 nucleotides, for example, in the range of 10 to 50 nucleotides, such as in the range of 15 to 20 nucleotides, such as in the range of 15 to 25 nucleotides, such as in the range of 15 to 30 nucleotides, such as in the range of 15 to 40 nucleotides, such as in the range of 15 to 45 nucleotides, such as in the range of 15 to 50 nucleotides. m is typically adjusted to a range of 40 to 70°C.

[0180] The primer concentration in the aqueous phase of the PCR amplification may be, for example, in the range of 0.05 to 2.0 μM, such as in the range of 0.1 to 1.0 μM, such as in the range of 0.2 to 1.0 μM, such as in the range of 0.3 to 1.0 μM, such as in the range of 0.4 to 1.0 μM, or in the range of 0.5 to 1.0 μM.

[0181] Forward primers and reverse primers generally comprise or consist of oligonucleotides. However, in some cases, primers may comprise nucleotide analogues. Numerous nucleotide analogues are known to those skilled in the art, including derivatives, sugars modified, such as with 2'-O-methyl, 2'-deoxy-2'-fluoro and 2',3'-dideoxynucleoside derivatives, threose, locked nucleic acid (LNA), LNA derivatives, peptide nucleic acid (PNA), glycol nucleic acid (GNA), threose nucleic acid (TNA), bicyclosugars, or nucleic acid analogues based on other sugar backbones, such as hexose, glycerol and glycol sugars, nucleic acid analogues based on non-ionic backbones, or nucleic acids and their analogues in non-linear topologies, such as dendrimers, comb structures, and nanostructures.

[0182] Primers can also be linked to various tags (eg, fluorescent tags, functionalized tags, or binding tags) that can optionally be attached to their termini, sugars, or nucleobases.

[0183] Primers can be prepared by a variety of methods, including, but not limited to, cloning appropriate sequences and direct chemical synthesis using methods well known in the art [Narang et al., Methods Enzymol. 68:90 (1979); Brown et al., Methods Enzymol. 68:109 (1979)]. Primers can also be obtained from commercial sources.

[0184] The forward and reverse primers may have the same or similar melting temperatures, e.g., melting temperatures of ±5° C. The length of the primers can be extended or shortened at the 5' and / or 3' ends to generate a primer set with a desired melting temperature. Thus, one of the primers in a primer pair can be longer than the other primer.

[0185] Primers can be designed based on melting temperature. The formula for determining the melting temperature of primers smaller than 25 bp is Wallace's rule [T d = 2x(A+T) + 4x(G+C)], where T d is the temperature at a particular salt concentration at which 50% of the oligonucleotide and its perfect filter-bound complement are in double-stranded conformation. Typically, T d is measured in 0.9M NaCl. However, other considerations, such as the predicted secondary structure, are also of weight when designing primers. Several computer programs and online services are available for the design of primers.

[0186] In one embodiment, a set of primers may be designed in such a way that the primers are capable of specifically amplifying a target sequence which comprises a mutation in the NOI, but are unable to amplify a target sequence which comprises a reference NOI. This may be achieved, for example, by designing the forward primer to contain a sequence identical to the NOI which comprises the mutation, and / or it may be done by designing the reverse primer to contain one or more sequences which are complementary to the NOI which comprises the mutation.

[0187] In other embodiments, a set of primers may be designed in such a way that the primers are capable of specifically amplifying a target sequence comprising a reference NOI, but are unable to amplify a target sequence comprising a mutation in the NOI. This may be achieved, for example, by designing a forward primer to contain a sequence identical to the reference NOI, and / or by designing a reverse primer to contain a sequence complementary to the reference NOI.

[0188] However, in some embodiments of the invention, a set of primers is capable of amplifying both a target sequence containing a mutation in the NOI and a target sequence containing a reference NOI.

[0189] It is worth noting that the method of the present invention includes PCR amplifications with two or more primer sets, for example two primer sets, for example three primer sets, for example 2-10 primer sets. Thereby, each PCR amplification may include several primer sets flanking different target sequences. This allows the detection of two or more different mutations during one PCR amplification.

[0190] In some embodiments where PCR is rhPCR, the PCR reaction is preferably carried out in the presence of a blocked primer that contains a single ribonucleotide residue. Such blocked primers are activated by enzymatic cleavage with RNase HE2 after complete hybridization to target DNA. Cleavage occurs at the 5' side of the RNA base, thus releasing the RNA base together with the 3' blocking portion, allowing selective amplification of the target DNA fragment. A tail sequence is incorporated into the amplicon, allowing the use of a 5' nuclease assay-based reporter system to be combined with rhPCR.

[0191] Detection of PCR products In some embodiments the methods of the invention comprise the step of detecting a PCR amplification product comprising a target sequence which comprises a mutation in the NOI of interest. The PCR amplification product may be detected by any useful means.

[0192] As above, the mutations may be substitutions, deletions and / or insertions, involving only one or a few to many nucleotides, and detection may therefore be tailored to the particular mutation specified by the NOI.

[0193] In some embodiments, the set of primers is designed in such a way that the primers can specifically amplify the target sequence that contains the mutation in the NOI, but cannot amplify the target sequence that contains the reference NOI.In other embodiments, the set of primers can be designed in such a way that they can specifically amplify the target sequence that contains the reference NOI, but cannot amplify the target sequence that contains the mutation in the NOI.In such embodiments, detection can be based simply on detecting the presence or absence of PCR amplification products.This may be the case in particular in embodiments of the present invention where the mutation is a mutation of the NOI in a larger number.

[0194] In a preferred embodiment, the PCR amplification products are detected with the aid of a detection probe. This may be especially the case when the mutations are of a smaller number of NOIs, for example one or more point mutations.

[0195] The detection probe may be an oligonucleotide comprising a sequence identical to the NOI comprising the mutation. In addition, the probe will usually also comprise a sequence identical to a region of the target sequence adjacent to the NOI. Similarly, the detection probe may be an oligonucleotide comprising a sequence complementary to the NOI comprising the mutation, and in addition the probe may comprise a sequence complementary to a region of the target sequence adjacent to the NOI. The region adjacent to the NOI may be a sequence immediately 5' and / or 3' to the NOI, respectively. Such a probe will preferably anneal to a PCR amplification product comprising a mutation in the NOI, but will not anneal to a PCR amplification product comprising a reference NOI. Such a detection probe is also referred to herein as a "mutant detection probe". Mutant detection probes typically comprise a range of 10-30 nucleotides. In particular, mutant detection probes may comprise a contiguous sequence in the range of 10-30 nucleotides identical or complementary to a target sequence comprising a mutation in the NOI.

[0196] The detection probe may also be an oligonucleotide that comprises a sequence identical to the reference NOI. In addition, the probe also comprises a sequence identical to a region of the target sequence adjacent to the NOI. Similarly, the detection probe may be an oligonucleotide that comprises a sequence complementary to the reference NOI, and in addition, the probe may also comprise a sequence complementary to a region of the target sequence adjacent to the NOI. Such a probe preferably anneals to PCR amplification products that contain the reference NOI, but not to those amplification products that contain a mutation in the NOI. Such a detection probe is also referred to herein as a "reference detection probe". A reference detection probe typically comprises a range of 10 to 30 nucleotides. In particular, a reference detection probe may comprise a contiguous sequence in the range of 10 to 30 nucleotides that is identical or complementary to a target sequence that contains a reference NOI.

[0197] In some embodiments, the PCR reagent comprises a set of probes consisting of a mutant detection probe and a reference detection probe. The "set of probes" is preferably capable of competing for binding sites in the NOI when added to a PCR amplification with a nucleic acid comprising a target sequence, a set of PCR reagents and primers under conditions that allow amplification of the target sequence. As mentioned above, the detection probes are typically oligonucleotides. In particular, they can be short nucleotide stretches of single-stranded DNA. The detection probes may be incorporated into or further covalently linked to detectable means, including but not limited to reporters, dyes, radioactive compounds, bioluminescent compounds, fluorescent compounds and fluorophore / quencher pairs.

[0198] In some embodiments, the 5'-most nucleotide of the detection probe is not G. Thus, the mutation detection probe may comprise an oligonucleotide, and the 5'-most nucleotide is not G. Similarly, the reference detection probe may comprise an oligonucleotide, and the 5'-most nucleotide is not G.

[0199] The method of the present invention can include the use of both mutant detection probe and reference detection probe.In this case, preferably, the probes are differentially labeled, for example, one of the probes is incorporated or covalently linked to detectable means, while the other probe is not associated or covalently linked.It is also possible that both probes are incorporated or covalently linked to detectable means, and the detectable means are different.

[0200] In one embodiment, the reference detection probe is labeled with a fluorophore at the 5' end and with a quencher at the 3' end.The fluorophore and the quencher can be, for example, HEX and black hole quencher, respectively.In one embodiment, the mutant detection probe is labeled with a fluorophore at the 5' end and with a quencher at the 3' end.The fluorophore and the quencher can be, for example, FAM and black hole quencher, respectively.

[0201] PCR reaction may contain similar amount of mutant detection probe and wild-type detection probe.However, in some embodiments, it may be preferable to use excess mutant detection probe.This may be especially when detecting PCR product after PCR amplification in superpool.In such a case, PCR reaction may contain at least 2 times, more preferably at least 4 times, excess mutant detection probe compared to reference detection probe.

[0202] In some embodiments, the detection probe is a TaqMan® probe, which exploits the 5' exonuclease activity of a nucleic acid polymerase (Heid et.al, 1996). This is why it is preferred that the PCR reagents include a nucleic acid polymerase with 5' exonuclease activity (e.g., Taq polymerase). Typically, the TaqMan® probe can be either a mutant detection probe, as described above, or a reference detection probe, as described above, covalently linked to a fluorophore / quencher pair. This allows the probe to contain a fluorophore, usually at or near the 5' base. In addition, the TaqMan® probe can contain a quencher, which can be at or near the 3' base and can quench the fluorescence of the fluorophore [see Tyagi et al., (1998)]. When illuminated, the excited fluorophore transfers energy to a nearby quencher rather than fluorescent emission [Förster resonance energy transfer or fluorescence resonance energy transfer (FRET)]. Thus, the proximity of the fluorophore and quencher can prevent any emission of fluorescence while the probe is intact. However, when the TaqMan® probe anneals to an internal region of the target sequence and the polymerase replicates the template onto which the TaqMan® probe is bound, its 5' exonuclease activity can cleave the probe. This sequence of events abolishes the functionality of the quenching (i.e., no FRET) and the fluorophore begins to emit fluorescence, which can be measured by any useful means.

[0203] Of note, as highlighted above, the present invention also includes that the method can be used to identify two or more different mutations. This can be achieved by using multiple sets of primers as described above. However, this can also be achieved by using several different detection probes. Thus, in one embodiment, the method can be used to identify two or more different mutations in a NOI in a target sequence. In such an embodiment, the PCR reagents may include a reference detection probe and several mutation detection probes, each mutation detection probe comprising an oligonucleotide having an identical or complementary sequence to one of the mutations. Preferably, the reference detection probe and the mutation detection probe are linked to different detection means. All mutation detection probes may be linked to the same detection means, or to similar detection means, or to different detection means.

[0204] In some cases, the detection probe is a molecular beacon (MB), i.e., a probe that contains a complementary sequence capable of self-hybridization (also called a "stem"), resulting in a "hairpin loop" structure. The loop of the MB may contain a sequence that is complementary to or identical to the NOI, either the mutant or the reference NOI. In addition, the MB typically contains a fluorophore and a quencher located at either end of the MB such that when the probe hybridizes to itself, they are proximal to each other. The MB may be either a mutant detection probe as described above or a reference detection probe as described above covalently linked to a fluorophore / quencher pair and a stem sequence that provides the complementary region of the MB. Further details regarding standard methods for making and using MBs are well established in the literature, and MBs are available from a number of commercial reagent sources.

[0205] In some cases, a primer / probe is used, and in some cases, the primer / probe is a Scorpions™ probe, which can provide a FRET-based stem-loop detection mechanism similar to MB, except that the probe also has an attached segment that functions as either a forward or reverse primer (Whitcombe et al., (1999); U.S. Patent No. 6,326,145). Scorpions™ probes can maintain a stem-loop structure in the unhybridized state in which the fluorophore is quenched. Scorpions™ probes can have a long multi-component structure, such as a 5' fluorophore, then a target-specific stem-loop portion, then a quencher, then a blocker [e.g., hexelenium glycol (HEG)], and finally a 3' primer sequence. The blocker can prevent reverse extension of the product onto the probe.

[0206] In some cases, the primer / probe is a Sunrise™ probe, which comprises a primer attached to a hairpin probe that is extended during amplification. This configuration can separate the internal quencher from the 5' terminal fluorophore (Nazarenko et al., (1997)).

[0207] The detection probe may be of any useful length, for example, ranging from 10 to 60 nucleotides in length. The oligonucleotide probe may also range from 10 to 30 nucleotides in length. The exact sequence and length of the oligonucleotide probe may depend in part on the nature of the target polynucleotide to which it binds. The binding location and length can be modified to achieve appropriate annealing and melting properties for a particular situation. For example, the detection probe may be designed to have a melting temperature within the same range as the forward and / or reverse primer, e.g., within ±10°C, such as within ±5°C.

[0208] The 3' terminal nucleotide of the detection probe can be blocked or rendered non-extendable by a nucleic acid polymerase. Such blocking can be conveniently accomplished by attaching a detectable means, either through a fluorophore or a quencher, to the terminal 3' base of the oligonucleotide probe by a linking moiety.

[0209] There is a wealth of practical guidance in the literature describing useful fluorophore-quencher pairs, including methods for selecting fluorophore-quencher pairs, as exemplified below: -Clegg,Meth.Enzymol.,211:353-388(1992);Wo et al.,Anal.Biochem.,218:1-13 (1994);Pesce et al.,editors,Fluorescence Spectroscopy(Marcel Dekker,New York,1971);White et al.,Fluorescence Analysis:A Practical Approach(Marcel Dekker,New York, 1970); etc. The literature also includes references that provide comprehensive lists of fluorescent and chromogenic molecules and their associated optical properties for selecting reporter-quencher pairs (e.g., Berlman, Handbook of Fluorescence Spectra of Aromatic Molecules, 2nd Edition (Academic Press, New York, 1971); Griffiths, Colour and Constitution of Organic Molecules (Academic Press, New York, 1976); Bishop, editor, Indicators (Pergamon Press, Oxford, 1972); Haugland, Handbook of Fluorescent Probes and Research Chemicals (Molecular Probes, Eugene, 1992) Pringsheim, Fluorescence and Phosphorescence (Interscience Publishers, New York, 1949); etc.). Furthermore, there is extensive guidance in the literature for derivatizing reporter and quencher molecules for covalent attachment via common reactive groups that can be added to oligonucleotides, as exemplified by the following references: Haugland (cited above), Ullman et al., U.S. Pat. No. 3,996,345, Khanna et al., U.S. Pat. No. 4,351,760, and the like.

[0210] Fluorophore and quencher can be selected from, for example, fluorescein and rhodamine dyes.These dyes, in combination with suitable binding methods for binding to oligonucleotides, are described in many references, for example, Khanna et al., (cited above); Marshall, Histochemical J., 7:299-303 (1975); Menchen et al., U.S. Patent No. 5,188,934; Menchen et al., European Patent Application No. 87310256.0; and Bergot et al., International Application No. PCT / US90 / 05565.The latter four documents are incorporated herein by reference.

[0211] A fluorophore / quencher pair can use a fluorophore, such as EDANS or fluorescein, at the 5' end and a quencher, such as Dabcyl, at the 3' end.

[0212] The detection of PCR amplification products may include a step of comparing the signal obtained in a PCR amplification comprising a given DNA sample with the signal obtained in a control PCR amplification. This signal may typically be associated with a detectable means attached to the mutant detection probe and / or the wild-type detection probe. Thus, if the probe is attached to a fluorophore, the signal may be fluorescent. The control PCR amplification may be a PCR amplification carried out under the same conditions but lacking a DNA sample, i.e., the control PCR amplification may lack a DNA template or it may contain only a reference target sequence, e.g., a control DNA comprising only wild-type DNA. In some embodiments, any signal stronger than the signal from the control PCR amplification may be considered a positive signal, i.e., a signal indicating the presence of a target sequence comprising one or more mutations in the NOI.

[0213] In one embodiment, any signal above a certain threshold value can be considered a positive signal. The threshold value can be determined by any useful method, typically by using suitable software, such as the QX200™ Droplet Reader and Quantasoft™ software available from Biorad.

[0214] In embodiments of the invention that use a mutation detection reference probe, the abundance ratio between the signal obtained from the mutation detection probe and the signal of the reference detection probe can be determined and used to assess the presence of the PCR product. The abundance ratio can be determined as the [signal of ("mutant detection probe")] divided by [signal of ("reference detection probe" + "mutant detection probe")]. The sample may be, for example, compared to a control PCR amplification. 1) An increase in the abundance of 2) increasing the concentration of mutant droplets, and / or 3) an increase in the number of mutant events on a scale of 50% or more above the average; The NOI may be considered to contain target DNA which comprises a mutation if the NOI is characterised by:

[0215] A mutant droplet may be a droplet that gives a positive signal from a mutant detection probe. As used herein, a "mutant event" is equal to the number of mutant droplets.

[0216] Identifying the portion of the subpool that will be reclaimed Once a subpool containing a regenerating portion having DNA containing a mutation of interest has been identified, the method generally includes identifying a regenerating portion within the subpool that contains the mutation.

[0217] This may be done in any conventional manner. If the subpools are small enough, this may be done simply by testing for the presence of the mutation in each seed or progeny within the subpool. For example, samples may be taken from each regenerant, or the regenerants may be grown into plants and samples from the plants used to detect whether the food carries the mutation.

[0218] However, less laborious methods can often be employed to identify the regenerating portion in the subpool that carries the mutation.For example, the subpool can be divided into secondary subpools, and the secondary subpool that contains the regenerating portion that has DNA containing the mutation of interest can be identified.This can be carried out in substantially the same manner as described herein above for identifying the subpool that contains the regenerating portion of interest.However, since the subpool is usually much smaller than the initial pool, less sensitive methods can also be employed. In one embodiment, the regenerative portion of interest is identified by a method comprising the steps of: - providing a subpool comprising a plurality of regenerant parts of a plant, the subpool comprising regenerant parts comprising one or several mutations of the NOI; -splitting the reclaimed portion of the subpool into secondary subpools; - obtaining a sample from each regenerant portion of the secondary sub-pool in a manner that keeps the regenerant portion sufficiently intact to be grown into a plant, and mixing all the samples from all the regenerant portions of each secondary sub-pool; - Preparing a DNA sample from the mixed sample; - identifying a secondary subpool containing DNA containing the mutation; - Identifying a regenerating portion within the secondary subpool that contains a mutation.

[0219] In one embodiment, identifying regenerants in the secondary subpool that contain the mutation includes testing each regenerant, such as each seed or progeny thereof, in the secondary subpool for the presence of the mutation. For example, each regenerant may be grown into a plant and a sample from the plant may be used to detect whether the food product carries the mutation.

[0220] Plant phenotypes and modified traits The method of the present invention allows the best cultivars and highest grade breeding lines to be used for library construction. This ensures that the desired traits are brought into the desired base environment for, for example, regional adaptation, high yield, climate change resistance and / or disease resistance breeding stocks. As explained above, the method reduces or eliminates the need for backcrossing. The method of the present invention is based on random mutagenesis. In contrast, GM or gene editing techniques usually require a transformation step and are therefore limited to species that can be transformed, or non-elite transformable varieties that grow vigorously in tissue culture but are not well adapted to the local environment.

[0221] The term plant phenotype is the term used to describe the observable characteristics of a plant such as height, yield, grain size, leaf shape, biomass, etc. A plant phenotype is usually determined as a collective expression of the plant's genotype in combination with the environmental influences on the plant's observable characteristics.

[0222] In some cases, plants of the same genotype interacting with the environment may exhibit different phenotypes, in other cases plants may have the same phenotype but different genotypes.

[0223] After mutagenesis and selection of plants with specific desired mutations, the mutant plants of the present invention have a different genotype compared to the parent plant, in particular, the mutant plants contain 1-30 non-synonymous mutations in the coding region as detailed herein above.

[0224] In one embodiment, the mutant plant and the parent plant have the same phenotype. In another embodiment, the plants have different phenotypes. It is preferred that the mutant plant has the same observed characteristics as the parent plant, except for the characteristics / traits caused by the mutation in the NOI. In other words, it is preferred that the mutant plant has the same phenotype as the parent plant, except for the desired mutated trait.

[0225] Thus, the mutation results in one or more specific traits, which are preferably the only traits that differ between the mutant plants and the plants of generation M0 (i.e., before mutagenesis), which is possible due to the low mutagenesis rate used in the present method.

[0226] In some embodiments, one or more of the appearance, height, biomass, leaf shape and taste of the mutant plant are the same as the parent plant, and preferably all of the appearance, height, biomass, yield, grain size, leaf shape and taste of the mutant plant are the same as the parent plant.

[0227] Yield, grain quality, sterility and other traits A high mutagenesis rate often results in a yield penalty. Since the method is based on a low mutagenesis rate as described herein above, a mutagenized plant with a yield similar to that of the parent plant can be obtained. The mutant plant may in particular produce a yield of at least 90%, such as at least 91%, such as at least 92%, such as at least 93%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, or such as at least 100% of the total (crop) yield of the parent plant. In some embodiments, the mutant plant may have a higher yield than the total yield of the parent plant. Thus, in some embodiments, the mutant plant may produce a yield that is 105% or more, such as 110% or more, such as 120% or more, such as 130% or more, such as 140% or more, such as 150% or more, such as 175% or more, such as 200% or more of the total yield of the parent plant.

[0228] In another embodiment of the present invention, NOI is predefined to affect the yield of mutant plants, and thus in this embodiment, the yield of mutant plants will change compared to the yield of parent plants.In a preferred embodiment, the yield of mutant plants is at least the same as or greater than the yield of parent plants.Since yield may vary depending on growth conditions or soil properties, the yield of mutant plants and parent plants should preferably be compared to plants grown under similar conditions.

[0229] The mutant plants obtained by this method preferably have grain quality substantially the same as or higher than the grain quality of the parent plant.

[0230] Therefore, in some embodiments, the mutation of interest does not harm grain quality.Therefore, one or more of the moisture content, test weight, discoloration, percentage of broken or damaged kernels, grain grinding quality, protein and oil content of grain are the same as or higher than the corresponding characteristics of parent plant.Also, one or more of grain color, composition, bulk density, smell and aroma, size and shape are preferably the same as or better than the corresponding characteristics of parent plant.

[0231] Preferably, the desired mutation does not increase or only slightly increases the sterility of the plant, and thus in some embodiments, the sterility of the mutant plants obtained by the present method, i.e., the percentage of sterile flowers per panicle, is less than 30%.

[0232] Working Example Example 1 - Low Mutation Density Protocol To induce mutations, kernels collected from barley plants were incubated in a solution containing the mutagen sodium azide (NaN3) according to the details provided by Kleinhofs et al., (1978) and those provided in U.S. Patent No. 7,838,053. The concentration of sodium azide used for mutagenesis was reduced to 0.3 mM for 2 hours.

[0233] This procedure induces point mutations in the genomic DNA (gDNA) of barley grains, typically resulting in randomly distributed codons for amino acid substitutions or translation termination of the protein-coding DNA, i.e., resulting in alterations in the protein encoded by the mutagenized DNA and truncations in the protein, respectively. However, the methods of the invention are also useful for producing cereal plants with point mutations in the gDNA in non-protein-coding regions, such as promoters, terminators and introns.

[0234] 15 kg of grain was mutagenized and 7.5 m 2 The plots were then divided into 17 subplots, each corresponding to a subpool, from which seed banks and DNA samples were generated.

[0235] Example 2 - RNase H2-dependent PCR (rhPCR) to detect mutants in a mutant library RNase H2-dependent PCR (rhPCR) (Dobosy et al., 2011) can improve the specificity of PCR amplification by utilizing so-called "blocked primers". These primers contain a single ribonucleotide residue and a 3' blocking portion, which prevents primer extension during PCR. However, primers can be activated by RNase H2, which then allows them to be extended during PCR amplification. RNase H2 cleavage occurs only when the blocked primer binds to a perfect match. Even mismatches with only one nucleotide change can significantly suppress cleavage. This means that blocked primers can be designed to specifically prevent the amplification of non-specific or undesired amplicons, thus providing an extremely sensitive tool for detecting rare specific nucleotide substitutions. A complementary, fluorophore-labeled probe at the 5'-end of the rhPCR primer allows quantification of successful primer extension during rhPCR of specific amplicons.

[0236] A unique rhPCR assay is designed to discriminate between mutant and wild type alleles of Hordeum vulgare (barley) genes (rhAmp® SNP Genotyping System, Integrated DNA Technologies). The rhPCR mutant detection primer is complementary to the coding sequence containing the NOI. The rhPCR reference detection primer is complementary to the coding sequence. The rhPCR reference and mutant detection primers are additionally labeled, for example with the fluorophores FAM and Yakima Yellow, respectively.

[0237] This assay is used to screen a library of subpools derived from a pool of M2 individuals. Purified gDNA is added to a PCR mixture containing the necessary reagents. The samples are thermocycled using standard PCR conditions. Reaction products are quantified in a fluorescent reader.

[0238] Data from the fluorescence reader is analyzed by comparing the average fluorescence signal of all screened subpools to the fluorescence of the individual subpools. Positive subpools are considered candidates if their individual fluorescence signal is at least 2-fold higher than the average fluorescence signal of all subpools.

[0239] Subpools that show higher fluorescence than the average fluorescence signal are considered to contain the mutant. To confirm the presence of the mutant in the subpools, a portion of the subpools is subjected to non-destructive DNA isolation, where tissue samples from individual barley grains are removed and subjected to DNA analysis in the pools. Each of these DNA pools is analyzed with the same rhPCR assay as described above. DNA pools with a fluorescence signal at least two times higher than the average fluorescence signal of the remaining DNA pools are identified. Mutation signals in those pools confirm the presence of the desired mutant.

[0240] Example 3 - Direct sequencing of hypomutagenized barley plants We sequenced a library of 6000 barley plants (cultivar Quench). Grains were mutagenized with 0.3 mM sodium azide for 2 hours. A library of 6000 individual M3 panicles was constructed. One grain per panicle was used for DNA extraction.

[0241] We amplified a 790 bp fragment of the gene of interest and analyzed 645 bp of exon 3 of the gene. The amplicons for all 6000 strains were analyzed for polymorphisms. We identified 3 individual variants within 645 bp for the 6000 strains, which corresponds to 1 variant every 3 / (645x6000)=1.29 million bp, which corresponds to approximately 24 nonsynonymous variants in the coding region. The three mutants correspond to the following mutation sites: 1. Nucleotide G989>A (cDNA) corresponding to amino acid change S330>N (protein) 2. Nucleotide C1091>T (cDNA) corresponding to the amino acid change P364>L (protein) 3. Nucleotide C858>T (cDNA) that did not result in an amino acid change

[0242] We amplified an 860 bp fragment of the gene AAP3 (HvAAP3) and analyzed 648 bp of exon 6 of the gene. The amplicons for all 6000 strains were analyzed for polymorphisms. We identified 3 individual variants within 648 bp for the 6000 strains, which corresponds to 1 variant every 1.296 million bp, which corresponds to approximately 24 nonsynonymous variants in the coding region, which corresponds to 99.94% of the gene not containing nonsynonymous variants. The three mutants correspond to the following mutation sites: 4. Nucleotide C982>T (cDNA) corresponding to amino acid change H328>Y (protein) 5. Nucleotide G820>A (cDNA) corresponding to amino acid change A274>T (protein) 6. Nucleotide C851>T (cDNA) corresponding to amino acid change A284>V (protein)

[0243] Example 4 - Screening for barley mutants with premature termination in amino acid permease 3 (HvAAP3) Mutagenesis of the barley cultivar Planet was carried out as described in Example 1 to obtain a mutation density of approximately 1 mutation in 1.3 million bp (corresponding to approximately 24 nonsynonymous mutations in the coding region, corresponding to 99.94% of the gene containing no nonsynonymous mutations).

[0244] See Example 6 below, if the success rate is greater than 94% and 7 different mutations are sought, the optimal library size is about 520,000. Therefore, the optimal number of regenerants to be cultured is 99,640, calculated according to Example 7 below.

[0245] Screening was performed using a ddPCR protocol with a detection sensitivity of 1 in 2000. Barley has a GECN count of 5-6. Based on this, the theoretical maximum subpool size was calculated to be 363, as outlined in Example 8 below.

[0246] Thus, a library of 374 subpools from a pool of 110,000 plants was screened to identify one positive subpool. Each subpool thus contained grains of generation M1 from approximately 294 plants. A portion of the positive subpools was then screened again to identify mutant grains. Screening was performed by ddPCR as described in international application PCT / EP2017 / 065516. The mutations searched for were stop codons, and thus 7 different mutations were tolerated. One desired variant has a nucleotide change at position 820 of the coding sequence HvAAP3 from guanine to adenine, which results in an amino acid change at position 274 leading to an amino acid change from alanine to threonine in the protein sequence, available at HORVU.MOREX.r2.7HG0553990.1 on the IPK Barley Blast Server by the International Barley Sequencing Consortium (29 September 2019). To identify the mutants, a target-specific forward primer (CCGGCCGAGAACAAG), a target-specific reverse primer (CGTGGTGGTGGAGAC), a 6-carboxyfluorescein (FAM)-labeled mutant-specific detection probe (AGGAAGACAAACCTACTGG) and a hexachlorofluorescein (HEX)-labeled reference-specific detection probe (AGGAAGGCAAACCTACTG) were designed.

[0247] Example 5 - Screening for barley mutants with premature termination in glycine-rich binding protein (HvGR-RBP1) Mutagenesis of the barley cultivar Paustian was carried out as described in Example 1, resulting in a mutation rate of about 1 in about 1.3 million bp, corresponding to 25 non-synonymous mutations in the coding region. We screened a library of 374 subpools from a pool of 110,000 M1 individuals to identify one positive subpool. A subfraction of the positive subpool was then screened again to identify mutant grains. Screening was performed by ddPCR as described in WO2018 / 001884, using primers and probes specifically designed to identify the desired mutation at the HvGR-RBP1 locus.

[0248] The mutations correspond to the following mutation sites: nucleotide G54>A (cDNA), corresponding to amino acid change W18 (protein).

[0249] Mutagenesis of the barley cultivar Planet was carried out as described in Example 1, resulting in a mutation density of approximately 1 mutation in 1.3 million bp (corresponding to approximately 24 nonsynonymous mutations in the coding region, corresponding to 99.94% of the gene containing no nonsynonymous mutations).

[0250] See Example 6 below, if a success probability of greater than 33% is desired and one mutation is being searched for, the optimal library size is approximately 520,620.The optimal number of regenerants to start with is therefore 99,640, as calculated according to Example 7 below.

[0251] Screening was performed using a ddPCR protocol with a detection sensitivity of 1 in 2000. Barley has a GECN number of 5-6. Based on this, the theoretical maximum subpool size was calculated to be 363, as outlined in Example 8 below.

[0252] Thus, a library of 374 subpools from a pool of 110,000 plants was screened to identify one positive subpool. Thus, each subpool contained grains of generation M1 from approximately 294 M1 plants. A portion of the positive subpools was then screened again to identify mutant grains. Screening was performed by ddPCR as described in international application PCT / EP2017 / 065516. The desired variant has a nucleotide change at position 54 of the coding sequence HvGR-RBP1 from guanine to adenine, resulting in an amino acid change at position 18 leading to a premature stop in the protein sequence, available at HORVU.MOREX.r2.6HG0491380.1 on the IPK Barley Blast Server by the International Barley Sequencing Consortium (29 September 2019). To identify the variants, a target-specific forward primer (CGCTGCTTCGTCGG), a target-specific reverse primer (GAGCTAAAAGCAGCCTC), a 6-carboxyfluorescein (FAM)-labeled variant-specific detection probe (CTGTCCTGAAACACCGA) and a hexachlorofluorescein (HEX)-labeled reference-specific detection probe (CTGTCCTGGAACACCG) were designed.

[0253] Example 6 - Determining optimal library size In order to increase the probability of success in identifying the desired mutant, various factors can be considered. First of all, library size can be optimized. The optimal library size (OLS) depends on several factors. If the desired mutation is a translation stop mutation, several possible codons can be targeted. This means that a smaller library can lead to a higher probability of success. If the desired mutation is a specific nucleotide change or codon for amino acid change, only one, sometimes a few events, can give the desired result, and a larger library is preferred to increase the probability of success.

[0254] In general, the optimal library size preferably represents the total number of mutagenized genomes that need to be screened to identify at least one desired mutant. The probability of identifying a particular mutation in a particular library of mutated genomes can be calculated using mutation frequency (Mf). If several mutations are screened simultaneously (e.g., if there are several possible stop codons, which are equally desirable), the probability increases. The number of mutations screened is also referred to herein as n. The probability of identifying at least one desired mutation using a library of library size L and mutation frequency Mf can therefore be calculated as follows: PS=1-Mf LS For example, in a library of M1 seeds derived from 1,000,000 mutagenized rapeseed plants (each with a mutation frequency of 1 / 500 kbp), there is a 0.86 probability of identifying at least one particular nucleotide at the targeted locus, calculated as follows: PS=1-(499999 / 500000) 1000000 =0.86 This formula can also be used to determine the optimal size of the library needed to achieve a particular probability. The optimal library size is equal to the maximum size of the library, which in the above example is equal to 1,000,000 unique genomes. Therefore, the optimal library size can be calculated as follows:

number

[0255] For example, at least one specific nucleotide change in a library of plants, each with a mutation frequency of 1 / 500 kbp, can be identified with a 95% probability when the library is equivalent to 1,497,864 mutated genomes.

number

[0256] Mutation frequency can be determined using the total number of nucleotides screened in the genome and the total number of genetic variants identified among the number of nucleotides screened. Thus, mutation frequency can be calculated as follows:

number

[0257] For example, if one analyzes 1,000,000 nucleotides in a mutated and non-mutated genome and identifies two nucleotides among them that differ, the mutation frequency is 1 in 500,000. Mf = 2 / (1,000,000) = 1 / (500,000)

[0258] Example 7 - Regenerated Part (N p Determining the optimal starting number of The optimal library size may be determined as described in Example 1. Optimal number of regenerating parts (ONs) subjected to random mutagenesis for the method of the present invention p ) can then be determined. In other words, ON p is equal to the optimal number of regenerating parts (e.g. seeds) to be mutated to achieve the probability of success. p is calculated using the optimal library size, germline cell number (GECN) and germination ratio of the material as follows:

number

[0259] In the case of barley, the harvest rate and germination rate are almost the same, so the germination rate is ON p can be used instead of yield rate to calculate

[0260] For example, assuming an average germination rate of 95% and a GECN number of 2, 526,315 seeds need to be mutated to establish a library of 1,000,000 genomes.

number

[0261] Example 8 - Determining the number and size of subpools In order to screen large libraries in the most efficient way, the present invention proposes a multi-step method including at least the steps of dividing the initial pool into subpools, screening the subpools containing the regenerating portions containing the mutations to be screened, and then subsequently identifying the specific regenerating portions containing the mutations to be screened within the identified subpools. The method of the present invention allows for the screening of a very large number of regenerating portions within a reasonable time and work effort.

[0262] One major limiting factor for determining the size of the subpool is the detection limit of the screening method used. If the detection sensitivity were infinite, the total library size would be the largest possible subpool. However, even in this scenario, it would be more beneficial to divide the total library (total pool) into subpools; otherwise, each screening of the total pool would produce a positive result, and identifying the individual regenerating moiety responsible for the positive result would usually be extremely difficult and time-consuming.

[0263] If the detection sensitivity is 1 genome in Y genomes, the maximum subpool size is in principle Y. For example, if the detection sensitivity is 1 genome in 2000 genomes, the maximum subpool size is in principle a subpool containing 2000 different genomes. If the total number of different genomes per subpool is the same as the detection sensitivity, all genomes should be approximately equally represented in the subpool. This means that the samples are preferably collected such that the extraction of pooled DNA results in equal DNA contributions of all genotypes. By placing all regenerants of any given plant in the same subpool, the subpool contains approximately the same amount of regenerants from each plant.

[0264] A subpool smaller than the maximum subpool size (determined based on the detection sensitivity of screening technology) has the advantage that it does not have to be so uniform, which greatly simplifies the preparation of the subpool. For example, when a pool of 200 individuals is established, each individual giving 10 seeds, the total pool is composed of 2000 seeds. A detection sensitivity of 1 / 2000 allows 1999 seeds to be wild type and 1 seed to be mutant, which are identified. Thus, with this pool, 90% less material of one individual could be harvested, while the same or more seeds could be harvested for the remaining 199 individuals to further detect mutants in the final pool.

[0265] Therefore, subpools need to be of an appropriate size for a particular detection sensitivity. The final number of subpools is based on the detection sensitivity and the amount of flexibility required for the heterogeneous DNA pool, and is determined by the total pool size divided by the number of plants per subpool (i.e., N p ) can be determined by

[0266] The method of the invention typically involves growing regenerants into mature plants and dividing the regenerants from the mature plants into subpools in such a way that all regenerants from one mature plant are placed in the same subpool. Preparation of such subpools ensures that the subpools contain approximately the same number of regenerants of each genotype. If the plants contain several germline cells per plant, each mature plant will contribute regenerants of multiple different genotypes. Therefore, for a given subpool (herein referred to as the maximum subpool size (SP m The maximum number of mature plants that can provide regeneration to a single host, called a basal graft, can be calculated as follows:

number

[0267] For example, if the detection sensitivity is 1 in 2000, assuming a GECN number of 5, the maximum subpool size is:

number

[0268] All these factors are highly variable and plant specific. For example, propagation of individual plants of some crops is more expensive than screening, while for other plants the opposite is true. A person familiar with a particular crop will be able to judge all the factors and determine a comfortable size for the total pool. This size is the maximum size of the pool that is practical, not for technical reasons.

[0269] For example, large plants (e.g., banana plants or trees) or plants with large fruits (e.g., watermelon) take up a lot of space and the limiting factor is therefore the total number of plants that can be grown. Thus, if the plant is a watermelon, a smaller amount can be used for this method even though the number of seeds that reach the optimal library size is high.

[0270] When plants are grown in the field, large numbers of plants can usually be grown at low cost, and therefore the number of seeds multiplied is not a limiting factor.

[0271] A notable limiting factor concerns the number of grains that can be harvested per plant. If a plant produces only 10 grains and the number of germline cells is 5, then each germline cell is represented by only 2 grains. In self-pollinated crops, only 75% of the grains from one germline carry the desired mutation, and in cross-pollinated crops only 50%. This number becomes important if it is necessary to split the pool at any stage.

[0272] Example 10 - Preparation of DNA samples Once the subpools are generated, the method of the present invention includes a step of preparing a DNA sample. Generally, the DNA sample is prepared by dividing the entire subpool into a random number of fractions and then preparing DNA from the entire fraction. Depending on the plant, each subpool contains a number of regenerants with the same genotype. The number is determined by dividing the total number of regenerants from the mature plant (RP) and the total number of regenerants from the mature plant (RP). p The number of GECNs depends on the total number of regenerating parts per 1000 genotypes, as well as the number of GECNs. When the number of GECNs is 1, the subpools are composed of RPs with the same genotype. p Contains playback parts. The optimal fraction size is the fraction size where, theoretically, each genotype is represented by one regenerant. Therefore, the optimal fraction size can be calculated as follows:

number

[0273] For example, the following applies to a barley variety, which contains on average 20 seeds per plant, with a GECN number of 5. Each M1 barley plant therefore contains 20 seeds of each genotype. A subpool contains all the seeds of a mature barley plant. In principle, therefore, the optimal fraction size (=25%) of a random fraction of barley seeds of a given subpool would contain one seed representing each genotype.

number

[0274] Example 11 - Low Mutagenesis Rate "Low mutagenesis rate" varies between crops. In particular, the ploidy of the crop plays a key role in how strictly the crop responds to a particular mutation treatment (Tsai et al. 2013). This can also be observed based on the number of mutations (mutation frequency) that can be tolerated in a hexaploid, tetraploid or diploid genome (Kurowska et al. 2013). As explained above, mutation frequency is provided by:

number

[0275] The number of nucleotides per mutation in M2 plants is generally 25% less than that in the corresponding M1 plants due to self-pollination events that usually result in a 25% reduction in all heterozygous mutations.

[0276] To determine the rate of low and high mutagenesis, we compared the number of genes that do not contain any coding mutations in M1 plants. The number of genes that do not contain any coding mutations is based on the number of genes in a given genome, the mutation frequency, and the average length of plant proteins (Tiessen et al., 2012). In diploid crops, hundreds of genes may contain coding mutations after treatment with conventional high mutation doses. In contrast, thousands of genes typically contain coding mutations in conventionally mutagenized hexaploid genomes. To construct a low mutagenesis library, the rate of low mutagenesis in diploid crops corresponds to less than 0.1% of genes with nonsynonymous mutations in generation M1. In polyploid crops, such as hexaploid wheat, a low mutation frequency is considered to be less than 0.1% of genes with nonsynonymous mutations in generation M1. The % of genes free of nonsynonymous mutations (GFoNSM) can be calculated according to the following formula:

number

[0277] Example 12 - Growth of mutagenized Brassica napus populations and screening of mutants with specific mutations in the gene for sinapaldehyde dehydrogenase / coniferaldehyde dehydrogenase (REF1)

[0278] Optimal library size and optimal number of plants The REF1 gene is involved in the biosynthesis of sinapine, the main antinutritional compound in rapeseed (Emrani et al., 2015). We aimed to identify REF1 knockouts in a library of mildly mutagenized (i.e., low mutagenesis rate) B. napus plants. In a conventionally mutagenized library of this tetraploid crop, more than 3.5% of all genes contain coding mutations. In a mildly mutagenized library, less than 1% of all genes contain mutations in the coding region. We used GBS sequencing techniques to identify the number of mutations in our population and the number of mutation origins. We sequenced 12 plants from mutagenized B. napus individuals using commercially available GBS sequencing techniques. We utilized the following filters for data analysis: - Removal of loci from the analysis that are not covered by at least eight sequence reads in all analyzed samples. - Removal of loci with changes from the analysis that have additional changes within a 50 base pair distance as interpreted on the reference genome. - Removal of samples from the analysis that are determined to be outliers. - Ignore a locus change in the analysis if that locus shows change in some control samples. - Ignore locus changes in the analysis from loci that do not show changes in more than 25% of sequence reads. - Ignore locus changes in the analysis for loci that show changes in the sample group as well as in the control samples. - Ignore locus changes in the analysis for loci that show no change in two or more samples in a sample group.

[0279] A total of 6,018,138 loci were included in the analysis. We identified an average of 65.75 mutations per plant, which corresponds to an average mutation frequency of 1 mutation in 86,607 base pairs. We identified 4 mutation origins, or genetically active cells, in this group of plants; i.e., the GECN number is 4. This number can be calculated as follows: Every unique mutation identified in the entire 12 sample set represents a mutation event occurring in the parent plant from which all samples originated. The total unique mutations in the sample set is calculated as the sum of the identified heritable mutations that were present in the parent plants in the examined region of the genome (Sum par )

[0280] If all variation occurs in a single genetic source of parent plants, the total variation is identified in all samples and is calculated as the sum of the unique variation in the entire sample set and the average variation in a single sample (avg. sam ) would be 1. If all 12 samples in the sample set arise from different mutational origins, this ratio would be 12, since all identified mutations should be unique.

[0281] The number of different mutation origins in a parent plant can therefore be estimated as the ratio of the sum of unique parent mutations to the average number of mutations in a single sample.

number

number

[0282] To have a 95% probability of identifying one of the two stop codons in REF1, a library of 129,724 individuals is required. To calculate how many regenerants are needed to obtain a library of 129,724 genotypes, we can use the following formula:

number

[0283] When culturing rapeseed, typically more plants are sown than are harvested, and rapeseed yields are therefore fairly low, about 17%. A yield of 17% and a GECN number of 4,190.771 is the optimal number of seeds to be mutagenized to construct a library with a 95% probability of identifying at least one nucleotide substitution that results in a premature termination in REF1.

[0284] Library construction and mutant identification A mutagenesis library of the rapeseed cultivar Epure was prepared. The library was arranged using the pooling and splitting method described in International Application PCT / EP2017 / 065516. Pools of 200,000 seeds were treated with 0.25% EMS for 16 hours at room temperature and propagated in the field using standard procedures. 34,992 plants were harvested in pools of approximately 300 plants. DNA was extracted from 25% of the harvested material and used for library screening.

[0285] Mutant identification was performed according to the ddPCR screening method described in International Application PCT / EP2017 / 065516. Primers and probes were designed for the identification of specific mutants at the REF1 locus. The desired mutant has a nucleotide change at position 504 of the coding sequence of REF-1, available under GenBank accession number NCBI:FN995990.1, from guanine to adenine, which results in an amino acid change at position 168 leading to a premature stop in the protein sequence, available under GenBank accession number NCBI:FN995990.1. To identify the variants, a target-specific forward primer (TATTGGAGTGGTCGGTC), a target-specific reverse primer (CACTTTCATGGCAAACATAAT), a variant-specific detection probe labeled with 6-carboxyfluorescein (FAM) (ATAATCCCTTGAAATTTTCCAAG) and a reference-specific detection probe labeled with hexachlorofluorescein (HEX) (ATAATCCCTTGGAATTTTCCAA) were designed.

[0286] item 1. A method for identifying mutant plants of a predefined species having one or more mutations in a nucleotide of interest [NOI] in a given target sequence, comprising: a) N of parent plants of the above species p Providing N replay portions, p is an integer greater than 5,000, such as greater than 10,000, such as greater than 15,000, such as greater than 20,000, such as greater than 25,000, such as greater than 30,000; b) subjecting said regenerant portions to mutagenesis, preferably random mutagenesis, thereby generating a pool of regenerant portions of generation M0 representing multiple genotypes; c) growing said regenerants of generation M0 into mature plants of generation M1, and obtaining regenerants of generation M1 from said mature plants; d) optionally repeating the previous step X times to obtain a plant of generation M(1+X) comprising a regenerant of generation M(1+X); e) dividing regenerants of multiple generations M1 or M(1+X) plants into subpools, each subpool containing regenerants representing multiple genotypes, with all regenerants from a given mature plant being placed into the same subpool; f) preparing a DNA sample, such as a gDNA sample or a cDNA sample, from the mRNA sample from each subpool; g) identifying subpools containing DNA containing the mutation using sensitive detection means; h) identifying regenerants within said subpools which contain said mutation, thereby identifying said mutant plants; wherein the step of mutagenesis results in a mutagenesis rate of 1-30 nonsynonymous mutations per cell of the regenerating portion of generation M1. 2. A method for identifying mutant plants of a predefined species having one or more mutations in a nucleotide of interest [NOI] of a given target sequence, comprising: a) N of parent plants of the above species p Providing N replay portions, p is an integer of at least 5,000, such as at least 10,000, such as at least 15,000, such as at least 20,000, such as at least 25,000, such as at least 30,000; b) subjecting said regenerant portions to mutagenesis, preferably random mutagenesis, resulting in a low rate of mutagenesis, thereby generating a pool of regenerant portions of generation M0 representing multiple genotypes; c) growing said regenerants of generation M0 into mature plants of generation M1, and obtaining regenerants of generation M1 from said mature plants; d) optionally repeating the previous step X times to obtain a plant of generation M(1+X) comprising a regenerant of generation M(1+X); e) dividing regenerants of multiple generations M1 or M(1+X) plants into subpools, each subpool containing regenerants representing multiple genotypes, with all regenerants from a given mature plant being placed into the same subpool; f) preparing a DNA sample, such as a gDNA sample or a cDNA sample, from the mRNA sample from each subpool; g) identifying subpools containing DNA containing the mutation using sensitive detection means; h) identifying regenerants within said subpools which contain said mutation, thereby identifying said mutant plants; wherein the low mutagenesis rate in diploid plants is such that on average at least 99.8%, preferably at least 99.9%, of all genes are free of non-synonymous mutations, and in plants of higher ploidy is such that on average at least 98.0%, preferably at least 99.0%, of all genes are free of non-synonymous mutations in the regenerative parts of generation M1, preferably the regenerative parts are vegetative tissues, seeds, grains, germ line cells in seeds, grains or germ, pollen or germ of said plants, preferably the regenerative parts are seeds. 3. Step e) i. determining an optimal size for a sub-pool, where the maximum sub-pool size (SPm) is:

number

number

number

number

[0287] References Chen et al.(2018)CRISPR-Cas12a target binding unleashes indiscriminate single-stranded DNAse activity.Science 27:436-439 Dobosy et al. (2011) RNase H-dependent PCR (rhPCR): improved specificity and single nucleotide polymorphism detection using blocked cleavable primers.BMC Biotechnology 11,80 Emrani et al.(2015)Reduction in sinapine content in rapeseed(Brassica napus L.)by induced mutations in sinapine biosyntheis genes.Molecular Breeding.35.1-11.10.1007 / s11032-015-0236-2. Hindson et al.(2011).High-throughput droplet digital PCR system for absolute quantitation of DNA copy number.Anal Chem 83:8604-8610]. Kleinhofs et al.(1978)Induction and selection of specific gene mutations in Hordeum and Pisum.Mut.Res.51:29-35,1978. Kurowska et al.(2011)TILLING:a shortcut in functional genomics.J Appl Genet.doi:10.1007 / s13353-011-0061-1 Lu et al.(2017)Genome-wide Targeted Mutagenesis in Rice Using the CRISPR / Cas9 system.Mol Plant.2017 Sep 12;10(9):1242-1245. Nazarenko et al.(1997)A closed tube format for amplification and detection of DNA based on energy transfer.Nucl.Acids Res.1997,25:2516-2521 Redei GP and Koncz C(1992).Classical mutagenesis.In:Koncz C et al.(eds.):Methods in Arabidopsis research,Chapter 2 Szurman-Zubrzycka et al.(2018)HorTILLUS-A Rich and Renewable Source of Induced Mutations for Forward / Reverse Genetics and Pre-breeding Programs in Barley(Hordeum vulgare L.).Front Plant Sci.2018 Feb 21;9:216. Tiessen et al.(2012)Mathematical modeling and comparison of protein size distribution in different plant,animal,fungal and microbial species reveals a negative correlation between protein size and protein number,thus providing insight into the evolution of proteomes.BMC Res Notes.doi:10.1186 / 1756-0500-5-85 Tsai et al.(2013)Production of a high-efficiency TILLING population through polyploidization.Plant Physiol.doi:10.1104 / pp.112.213256 Tyagi et al.(1998)Multicolor molecular beacons for allele discrimination.Nature Biotechnology 16:49-53 Whitcombe et al.(1999)Detection of PCR products using selfprobing amplicons and fluorescence.Nature Biotechnol.1999,August 17(8):804-7. US 6,326,145 US 7,838,053 WO 2018 / 001884

Claims

1. 1. A method for identifying mutant plants of a predefined species having one or more mutations in a nucleotide of interest [NOI] in a given target sequence, comprising: a) the N of the parent plant of said species ｐ Providing N replay portions, ｐ is an integer of at least 5,000, and N ｐ But 0.7*ON ｐ ~1.3*ON ｐ In the formula: [0010] and Hr is the expected average yield (%) of said plant species after mutagenesis; and OLS is the optimal library size, [0025] where P is the probability of success (%), Mf is the mutation frequency, n is the number of mutations to be screened, and Mf is the rate of random mutagenesis of step b); b) subjecting said regenerants to a step of mutagenesis resulting in a low rate of mutagenesis, thereby generating a pool of regenerants of generation M0 representing multiple genotypes; c) growing said regenerants of generation M0 into mature plants of generation M1 and obtaining regenerants of generation M1 from said mature plants; d) dividing regenerants of multiple generation M1 plants into subpools, each subpool containing regenerants representing multiple genotypes, wherein all regenerants from a given mature plant are placed in the same subpool; and i. determining an optimal size for the subpool, where the maximum subpool size (SPm) is SPm=Y / GECN; ii. Dividing the regenerant parts into subpools, each subpool containing regenerant parts from a number of mature plants, the number ranging from 0.5*SPm to 1.1*SPm, and all regenerant parts from one given mature plant being placed in the same subpool; wherein 1 in Y is the detection sensitivity of the highly sensitive detection means of step f) and the plant has a genetically effective cell number of GECN; e) preparing a DNA sample from each subpool, said step of preparing a DNA sample comprising: - dividing each subpool into multiple fractions; - Preparing DNA samples of all fractions of each subpool; the steps of: f) identifying a subpool containing DNA containing the mutation using said highly sensitive detection means; g) identifying regenerants within said subpools which contain said mutation, thereby identifying said mutant plants; Including, A method in which low rate mutagenesis in diploid plants is such that on average at least 99.8% of all genes are free of nonsynonymous mutations, and in plants of higher ploidy is such that on average at least 98.0% of all genes are free of nonsynonymous mutations in the regenerated portions of generation M1.

2. The method of claim 1 , wherein the regenerative part is a seed.

3. A method according to any one of claims 1 to 2, wherein the mutagenesis is random mutagenesis.

4. A method according to any one of claims 1 to 3, further comprising, between steps c) and d), a step of repeating step c) X times to obtain a plant of generation M(1+X) comprising a regenerated portion of generation M(1+X), wherein step d) is performed on a plurality of regenerated portions of generation M(1+X).

5. The method of any one of claims 1 to 4, wherein the mutagenesis rate is at most 1 mutation per 1,000 genes.

6. The method according to any one of claims 1 to 5, wherein the mutagenesis results in at most 25 non-synonymous mutations in the coding region in plants of generation M1.

7. The method according to any one of claims 1 to 6, wherein the mutagenesis is radiation-induced mutagenesis or chemical mutagenesis carried out using a mutagenic chemical agent.

8. The method of claim 7, wherein the mutagenic chemical is selected from the group consisting of sodium azide (NaN3), ethyleneimine, hydroxylamine (CH2OH), N-methyl-N'-nitro-N-nitrososoguanidine (MNNG), diazomethane, methyl nitrosoguanidine (MNNG), ethyl methanesulfonate (EMS), diethylsulfonate (DES), N-ethyl-N-nitrosourea (ENU), ethyl-2-chloroethylsulfide, 2-chloroethyldimethylamine, or ethylene oxide.

9. The method of any one of claims 1 to 8, wherein the mutant plant has the same phenotype as the parent plant, except for the phenotypic trait resulting from a mutation in the target sequence.

10. 10. The method according to any one of claims 1 to 9, wherein the mutation of interest occurs at a frequency corresponding to 1 mutation per 1.5 million plants.

11. N ｐ But 0.8*ON ｐ ~1.2*ON ｐ The method according to any one of claims 1 to 10, wherein the range is

12. The method of any one of claims 1 to 11, wherein the probability of success is at least 85%.

13. The method according to any one of claims 1 to 12, wherein at least 5,000 regenerant parts are obtained in step c).

14. The method according to any one of claims 1 to 13, wherein the plant is a crop plant or a flowering plant.

15. The plant species is RP ｐ and step e) has an average number of regenerants per plant of i. randomly dividing each subpool into a plurality of fractions, the first fraction being the (GECN*100 / RP) of the regeneration portion of the subpool; Ｐ )%~(GECN*500 / RP Ｐ ) % range; and said first fraction comprises at most 50% of said regenerant portion; ii. Preparing a DNA sample of the entire first fraction of each subpool; The method according to any one of claims 1 to 14, comprising:

16. Step e) is carried out by dividing each subpool into at least two fractions and preparing a DNA sample from the whole fraction of each subpool, and / or step e) comprises obtaining a fraction containing a regenerated portion of each subpool in the range of 10-50% and preparing a DNA sample from the whole fraction of each subpool, and / or Step f) for each subpool comprises: - performing one or more PCR amplifications comprising said DNA samples from said fractions of subpools, one or more primer sets each flanking a target sequence, and PCR reagents, thereby amplifying said target sequences; - detecting PCR amplification products comprising said target sequence containing one or more mutations in said NOI; The method according to any one of claims 1 to 15, comprising:

17. 10 of generation M0 with different genotypes ６ The method according to any one of claims 1 to 16, wherein said regenerant portion is obtained in step b).

18. 18. The method according to any one of claims 1 to 17, wherein the method comprises a step of reproduction of the organisms, or reproductive parts thereof, in a pool, and wherein the reproduction step can be carried out simultaneously with or after step d) of dividing the organisms into subpools.

19. Step g) comprises: - providing a subpool comprising a plurality of regenerant parts of a plant, said subpool comprising regenerant parts comprising one or several mutations of said NOI; - splitting the regenerated portion of said subpool into a secondary subpool; - obtaining samples from the regenerants of said secondary sub-pools in a manner that leaves the regenerants sufficiently intact to develop into plants, and combining all samples from all the regenerants of each secondary sub-pool; - preparing a DNA sample from said combined sample; - identifying a secondary subpool containing DNA containing said mutation; The method according to any one of claims 1 to 18, comprising:

20. - providing said identified secondary subpool comprising a regenerant portion comprising a mutation in said NOI, said regenerant portion being a seed; - cultivating all the seeds in said secondary subpool for germination; - obtaining a sample from each germinated seed; - testing said sample for the presence of said mutation in said NOI, thereby identifying plants carrying the mutation in said NOI; 20. The method of claim 19, further comprising:

21. After step e) the following step is carried out: - obtaining a fraction of each DNA sample from each subpool; - combining the multiple fractions into a superpool, thereby obtaining a DNA superpool that contains DNA samples from multiple subpools, where DNA from each subpool is present in only one superpool; - performing a plurality of PCR amplifications, each comprising a superpool of DNA samples, each PCR amplification comprising a plurality of compartmentalized PCR amplifications, each comprising a portion of said DNA sample, one or more primer sets and PCR reagents each flanking a target sequence, thereby amplifying said target sequence; - detecting PCR amplification products comprising one or more target sequences containing a mutation in said NOI, thereby identifying superpools containing said mutation; 21. The method of claim 20, further comprising:

Images