Pyrrolysyl-tRNA synthetase

Abstract

The present invention provides an efficient method for producing a polypeptide containing a non-natural amino acid, a method for introducing a non-natural amino acid into a polypeptide, a method for producing a tRNA bound to a non-natural amino acid, a system for introducing a non-natural amino acid, or materials to be used therefor. A method for producing a polypeptide containing an unnatural amino acid, comprising a step of contacting a PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with an unnatural amino acid, wherein the method comprises an introduction step selected from the following: (a) introducing the unnatural amino acid into the polypeptide with higher efficiency than when a cell-free protein synthesis system using PylRS (MmPylRS) from Methanosarcina mazei is used, or (b) introducing the unnatural amino acid into the polypeptide with higher efficiency than when an E. coli protein synthesis system is used using a vector carrying the PylRS gene under the control of the glmS promoter and when an E. coli protein synthesis system is used using a vector carrying the PylRS gene under the control of the glnS promoter. Alternatively, a production method is used in which an unnatural amino acid introduction system containing a high concentration of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales is used.

Description

[Technical field]

[0001] The present invention relates to a method for producing a polypeptide containing a non-natural amino acid using pyrrolysyl-tRNA synthetase. [Background technology]

[0002] Aminoacyl-tRNA synthetase (aaRS) is an enzyme involved in protein synthesis. Specifically, it is known to have the activity of synthesizing aminoacyl-tRNA by esterifying amino acids to tRNA. Aminoacyl-tRNA is a molecule involved in the elongation of peptide chains that make up proteins in the ribosome.

[0003] Research has been conducted on the introduction of non-natural amino acids into proteins using pyrrolysyl-tRNA synthetase (PylRS), a type of aminoacyl-tRNA synthetase. For example, Patent Document 1 describes the introduction of an α-hydroxy acid derivative of a lysine derivative into a protein by using PylRS (MmPylRS) from Methanosarcina mazei (M. mazei). Patent Document 2 describes the introduction of a lysine derivative into a protein by using a mutant of MmPylRS. Patent Document 3 describes the introduction of a ZLys derivative into an antibody by using a mutant of MmPylRS. This document also describes the preparation of a chemically modified antibody into which a ZLys derivative has been introduced by using click chemistry.

[0004] In addition, Non-Patent Document 1 describes that the N-terminal domain of PylRS is necessary for in vivo activity, Non-Patent Document 2 describes that the N-terminal domain of PylRS binds to tRNA, and Non-Patent Document 3 describes that the N-terminal domain of PylRS interacts with tRNA.

[0005] Non-Patent Document 4 describes that MmPylRS has an N-terminal domain, whereas PylRS (MaPylRS) from Methanomethylophilus alvus (M. alvus) does not have an N-terminal domain, and also describes that a non-natural amino acid was introduced into a protein by an Escherichia coli protein synthesis system using MaPylRS. [Prior art documents] [Patent documents]

[0006] [Patent Document 1] WO / 2009 / 066761 [Patent Document 2] WO / 2009 / 038195 [Patent Document 3] WO / 2017 / 030156 [Non-patent literature]

[0007] [Non-Patent Document 1] "The amino-terminal domain of pyrrolysyl-tRNA synthetase is dispensable in vitro but required for in vivo activity." Herring et al., FEBS Lett. 2007 Jul 10;581(17):3197-203. [Non-Patent Document 2] "PylSn and the Homologous N-terminal Domain of Pyrrolysyl-tRNA Synthetase Bind the tRNA That Is Essential for the Genetic Encoding of Pyrrolysine" Jiang et al., J Biol Chem. 2012 Sep 21; 287(39): 32738-32746. [Non-Patent Document 3] "Crystal structures reveal an elusive functional domain of pyrrolysyl-tRNA synthetase." Suzuki et al., Nat Chem Biol. 2017 Dec;13(12):1261-1266. [Non-Patent Document 4] "Mutually orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs." Willis et al., Nat Chem. 2018 May 28. doi: 10.1038 / s41557-018-0052-5. [Epub ahead of print] Summary of the Invention [Problem to be solved by the invention]

[0008] Although the above-mentioned Non-Patent Document 4 describes that unnatural amino acids could be introduced even when MaPylRS, which does not have an N-terminal domain, was used, the efficiency of introducing unnatural amino acids in the E. coli protein synthesis system described in Non-Patent Document 4 was not sufficiently high.

[0009] Non-Patent Document 4 describes experiments on the presence or absence of introduction of non-natural amino acids and orthogonality, experiments on the selectivity of non-natural amino acids, and experiments on the introduction of different non-natural amino acids into one polypeptide. However, it does not describe any method for significantly increasing the introduction efficiency compared to MmPylRS. The promoter used for expressing MmPylRS is the glmS promoter (a non-high expression promoter).

[0010] On the other hand, the present inventors attempted to introduce unnatural amino acids into proteins using MmPylRS in a cell-free protein synthesis system. However, when MmPylRS was isolated for use in a cell-free protein synthesis system, it was found that the concentration limit was 4 mg / mL or less, and MmPylRS could not be used at higher concentrations (Experimental Example 1, Examples 2 and 3). As a result, it was not possible to increase the efficiency of introducing unnatural amino acids.

[0011] The present inventors also attempted to introduce unnatural amino acids into proteins using MmPylRS in an E. coli protein synthesis system. In this case, MmPylRS was highly expressed using a high expression promoter. However, the introduction efficiency of unnatural amino acids was low (Example 9). Furthermore, a deterioration in E. coli growth was also observed. This demonstrated that high expression of PylRS is inappropriate in an E. coli protein synthesis system using MmPylRS.

[0012] The present invention has been made in consideration of the above circumstances, and aims to provide an efficient method for producing a polypeptide containing a non-natural amino acid, a method for introducing a non-natural amino acid into a polypeptide, a method for producing a tRNA bound to a non-natural amino acid, a system for introducing a non-natural amino acid, or materials for use therein. [Means for solving the problem]

[0013] As described in the Examples below, the present inventors isolated and purified MaPylRS for the first time. Furthermore, when the MaPylRS solution was concentrated, it was discovered that MaPylRS has a significantly high concentration limit, making it possible to prepare a highly concentrated MaPylRS solution (Examples 1 and 3). This concentration limit of MaPylRS was more than five times that of MmPylRS, which was an unexpected result.

[0014] Furthermore, we attempted to introduce unnatural amino acids into proteins using a cell-free protein synthesis system using a high-concentration MaPylRS solution (Examples 3 and 6). As a result, the introduction efficiency of unnatural amino acids was unexpectedly significantly higher than that of MmPylRS.

[0015] We also attempted to react a fluorescent substrate with TCO*-Lys introduced into a Fab antibody using click chemistry (Example 8). As a result, we were surprised to find that the binding reaction was almost complete in just 10 minutes. Because proteins are unstable, the fact that the reaction could be completed in such a short time was a groundbreaking result.

[0016] In addition, we attempted to introduce unnatural amino acids into proteins using an E. coli protein synthesis system that uses a vector carrying the MaPylRS gene under the control of a strong promoter (Examples 9 to 12). As a result, the introduction efficiency of unnatural amino acids was unexpectedly significantly higher than that of MmPylRS.

[0017] That is, according to one aspect of the present invention, there is provided a method for producing a polypeptide containing a non-natural amino acid, comprising a step of contacting PylRS of an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid, the method comprising an introduction step selected from (a) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than when a cell-free protein synthesis system using MmPylRS is used, or (b) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glmS promoter is used, and when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glnS promoter is used. By using this production method, a polypeptide containing a non-natural amino acid can be efficiently produced. The glmS promoter and the glnS promoter (Plumbridge and Soll, Biochimie. 1987 May;69(5):539-41.) are promoters that do not fall under the category of high expression promoters (non-high expression promoters).

[0018] According to one aspect of the present invention, there is provided a method for introducing an unnatural amino acid into a polypeptide, comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with an unnatural amino acid, the method comprising an introduction step selected from the following: (a) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency than when a cell-free protein synthesis system using MmPylRS is used, or (b) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency than when an E. coli protein synthesis system using a vector having the PylRS gene under the control of the glmS promoter is used, and when an E. coli protein synthesis system using a vector having the PylRS gene under the control of the glnS promoter is used. By using this introduction method, an unnatural amino acid can be efficiently introduced into a polypeptide.

[0019] According to another aspect of the present invention, there is provided a system for introducing an unnatural amino acid, which contains a high concentration of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales, and by using this system for introducing an unnatural amino acid, a polypeptide containing an unnatural amino acid can be efficiently produced.

[0020] According to another aspect of the present invention, there is provided a reaction solution for a cell-free protein synthesis system containing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. By using this reaction solution, a polypeptide containing a non-natural amino acid can be efficiently produced.

[0021] According to another aspect of the present invention, there is provided a method for producing a polypeptide containing a non-natural amino acid, the method comprising contacting a PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid outside a cell. By using this production method, a polypeptide containing a non-natural amino acid can be efficiently produced.

[0022] According to another aspect of the present invention, there is provided a method for introducing an unnatural amino acid into a polypeptide, the method comprising the step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with the unnatural amino acid outside a cell. By using this introduction method, the unnatural amino acid can be efficiently introduced into the polypeptide.

[0023] According to another aspect of the present invention, there is provided a method for producing a tRNA bound to a non-natural amino acid, the method comprising the step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid and a tRNA outside a cell. By using this production method, the tRNA bound to a non-natural amino acid can be efficiently produced.

[0024] Another aspect of the present invention provides a purified PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. The use of this PylRS enables efficient production of polypeptides containing unnatural amino acids.

[0025] According to another aspect of the present invention, there is provided a solution containing 5 mg / mL or more of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. By using this solution, a polypeptide containing a non-natural amino acid can be efficiently produced.

[0026] According to another aspect of the present invention, there is provided a polynucleotide encoding PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales and a high-expression promoter. The use of this polynucleotide enables efficient production of a polypeptide containing a non-natural amino acid.

[0027] According to another aspect of the present invention, there is provided a method for producing a polypeptide containing a non-natural amino acid, the method comprising the step of highly expressing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales in a living cell. By using this production method, a polypeptide containing a non-natural amino acid can be efficiently produced. [Brief description of the drawings]

[0028] [Figure 1] FIG. 1 shows an example of a phylogenetic tree including organisms of the genus Methanomethylophilus or Methanomassiliicoccus. [Diagram 2] FIG. 2 shows the results of alignment of the amino acid sequences of PylRS from M. alvus, M. barkeri, and M. mazei using Clustal Omega. [Diagram 3] FIG. 3 shows examples of lysine derivatives that can be introduced into proteins. [Figure 4] FIG. 4 shows the results of a comparative experiment on the amount of protein synthesis in which a non-natural amino acid was introduced using MaPylRS and MmPylRS in a cell-free protein synthesis method. [Diagram 5] FIG. 5 shows the results of investigating the concentration dependency of MaPylRS in cell-free protein synthesis. [Figure 6] FIG. 6 shows the results of crystal structure analysis. [Figure 7] FIG. 7 shows the results of investigating the activity of MaPylRS mutants. [Figure 8] FIG. 8 shows the results of investigating the PylRS concentration dependency of TCO*-Lys introduction. [Figure 9] FIG. 9 shows the results of investigating the PylRS concentration dependency of pEtZLys or pAzZLys introduction. [Figure 10] FIG. 10 shows the results of investigating the amount of synthesis of ZLys-introduced proteins. [Figure 11] FIG. 11 shows the results of investigating the amount of synthesis of mAzZLys-introduced protein. [Figure 12] FIG. 12 shows the amounts of TCO*-Lys-introduced Fab antibodies synthesized. [Figure 13] FIG. 13 shows the results of binding a fluorescent substrate to TCO*-Lys introduced into a Fab antibody by click chemistry. [Figure 14] FIG. 14 shows the fluorescence intensity of the fluorescent substrate bound to TCO*-Lys. [Figure 15] FIG. 15 shows the results of a comparative experiment on the introduction efficiency of unnatural amino acids by M. mazei, M. alvus, and D. hafniense PylRS in an E. coli expression system. [Figure 16] Figure 16 shows the results of analysis of wild-type GST-GFP fusion protein (3Ser) and amber mutant GST-GFP fusion protein. a: CBB staining after SDS-PAGE. b: MALDI-TOF MS analysis after trypsin digestion of the product. Actual and theoretical values ​​are shown in the table. [Figure 17] FIG. 17 shows the experimental results of site-specific incorporation of unnatural amino acids into proteins using MaPylRS in an E. coli expression system. [Figure 18] FIG. 18 shows the experimental results of site-specific incorporation of ZLys-type unnatural amino acids into proteins using MaPylRS mutants in an E. coli expression system. [Figure 19] FIG. 19 shows the results of investigating the PylRS concentration dependency in the wheat germ-based cell-free protein synthesis method. [Figure 20] FIG. 20 shows the PylRS concentration dependency in the human cell-free protein synthesis method. [Figure 21] FIG. 21 shows the results of investigating the introduction of AcLys. [Figure 22] FIG. 22 shows the results of investigating the introduction of a Phe derivative. [Figure 23] FIG. 23 shows the results of investigating the introduction of Tyr derivatives. [Figure 24] FIG. 24 shows the results of investigating the activity of G1PylRS in a cell-free protein synthesis method. [Diagram 25] FIG. 25 shows the results of comparing the amounts of protein synthesis when G1PylRS, MaPylRS and MaPylRS were used. [Figure 26] FIG. 26 shows the results of investigating the activity of the G1PylRS mutant in a cell-free protein synthesis method. [Figure 27] FIG. 27 shows the results of comparing the amounts of protein synthesis when G1PylRS and MaPylRS mutants were used. [Figure 28] FIG. 28 shows the G1PylRS concentration dependency in the cell-free protein synthesis method. [Figure 29] FIG. 29 shows the results of introducing mAzZLys into proteins in animal cells. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0029] Hereinafter, the embodiments of the present invention will be described in detail. Note that, in order to avoid repetition and complexity, the description of similar contents will be omitted as appropriate.

[0030] One embodiment of the present invention is a novel method for producing a polypeptide containing a non-natural amino acid. This production method includes, for example, a step of contacting a pyrrolysyl-tRNA synthetase (PylRS) of an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid. This production method preferably includes an introduction step selected from the following: (a) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than when a cell-free protein synthesis system using PylRS (MmPylRS) of Methanosarcina mazei is used; or (b) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glmS promoter is used, and when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glnS promoter is used. In this case, according to this production method, a polypeptide containing a non-natural amino acid can be produced with high efficiency. The glmS promoter and the glnS promoter are promoters that do not fall under the category of high expression promoters (non-high expression promoters). Furthermore, in one embodiment of the present invention, the introduction step includes a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than, for example, when MmPylRS is used as the PylRS. In one embodiment of the present invention, the degree of "high efficiency" may be, for example, 1.1, 1.2, 1.3, 1.4, 1.5, 2.0, 5.0, 10.0, 20.0, 30.0, or 40.0 times, or any of these values ​​or more, or within a range between any two of these values, compared to the comparison target.

[0031] One embodiment of the present invention is a method for introducing an unnatural amino acid into a polypeptide, comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with an unnatural amino acid, the method comprising an introduction step selected from the following: (a) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency than when a cell-free protein synthesis system using MmPylRS is used, or (b) a step of introducing an unnatural amino acid into a polypeptide with higher efficiency than when an E. coli protein synthesis system using a vector having the PylRS gene under the control of the glmS promoter is used, and when an E. coli protein synthesis system using a vector having the PylRS gene under the control of the glnS promoter is used. According to this method, the unnatural amino acid can be efficiently introduced into the polypeptide.

[0032] One embodiment of the present invention is a system for introducing an unnatural amino acid containing a PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. From the viewpoint of more efficiently introducing an unnatural amino acid into a protein, this system for introducing an unnatural amino acid preferably contains a high concentration of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales.

[0033] One embodiment of the present invention is a reaction solution for a cell-free protein synthesis system containing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. This reaction solution can contain a high concentration of PylRS. This allows for highly efficient production of a polypeptide containing a non-natural amino acid.

[0034] One embodiment of the present invention is a method for producing a polypeptide containing a non-natural amino acid, comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid outside a cell. This production method can be carried out using a reaction solution of a cell-free protein synthesis system. This reaction solution can contain a high concentration of PylRS. This allows the polypeptide containing a non-natural amino acid to be produced with high efficiency.

[0035] One embodiment of the present invention is a method for introducing an unnatural amino acid into a polypeptide, comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with the unnatural amino acid outside a cell. This introduction method can be carried out using a reaction solution of a cell-free protein synthesis system. This reaction solution can contain a high concentration of PylRS. This allows the unnatural amino acid to be efficiently introduced into the polypeptide.

[0036] One embodiment of the present invention is a method for producing a tRNA bound to a non-natural amino acid, the method comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid and a tRNA outside a cell. This production method can be carried out using a reaction solution of a cell-free protein synthesis system. This allows for highly efficient production of a tRNA bound to a non-natural amino acid.

[0037] One embodiment of the present invention is a purified PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. A solution containing this PylRS can be concentrated to prepare a solution containing PylRS at a high concentration. By using this solution in a cell-free protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency.

[0038] One embodiment of the present invention is a solution containing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. This solution preferably contains 5 mg / mL or more of PylRS. In this case, a reaction solution for a cell-free protein synthesis system can be produced by mixing this solution with a solution containing a non-natural amino acid or tRNA, etc. By using this solution in a cell-free protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency. In one embodiment of the present invention, the solution may contain, for example, a buffer, NaCl, or a reducing agent.

[0039] One embodiment of the present invention is an agent for introducing an unnatural amino acid into a polypeptide, comprising the above-mentioned reaction solution or solution. By using this agent in a cell-free protein synthesis system, the unnatural amino acid can be efficiently introduced into the polypeptide.

[0040] One embodiment of the present invention is a polynucleotide encoding PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. The polynucleotide preferably encodes a high-expression promoter. In this case, by utilizing the polynucleotide in a live cell protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency. The polynucleotide includes a vector. The high-expression promoter may be located upstream of PylRS. The high-expression promoter may be linked within the polynucleotide so as to be capable of controlling the expression of PylRS.

[0041] One embodiment of the present invention is a method for producing a polypeptide containing a non-natural amino acid, comprising the step of introducing the polynucleotide into a cell, or expressing PylRS from the polynucleotide. By utilizing this production method in a live cell protein synthesis system, the polypeptide containing a non-natural amino acid can be produced with high efficiency. This production method may comprise, for example, a step of ligating a polynucleotide to a vector, a step of introducing a polynucleotide encoding a tRNA into a cell, a step of culturing the cell, a step of evaluating the expression of PylRS, a step of evaluating the expression of the polypeptide containing a non-natural amino acid, or a step of purifying or isolating the polypeptide containing a non-natural amino acid. The vector may be, for example, an expression vector, a circular vector, or a plasmid.

[0042] One embodiment of the present invention is a cell containing a polynucleotide encoding PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales and a high expression promoter. By using this cell in a live cell protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency.

[0043] One embodiment of the present invention is a method for introducing an unnatural amino acid into a polypeptide, comprising the step of introducing the polynucleotide into a cell, or expressing PylRS from the polynucleotide. By utilizing this production method in a live cell protein synthesis system, an unnatural amino acid can be efficiently introduced into a polypeptide. This introduction method may include, for example, the same steps as those included in the production method.

[0044] One embodiment of the present invention is an agent for introducing an unnatural amino acid into a polypeptide, comprising the above-mentioned polynucleotide. By utilizing this agent in a live cell protein synthesis system, the unnatural amino acid can be efficiently introduced into the polypeptide.

[0045] One embodiment of the present invention is a method for producing a tRNA bound to a non-natural amino acid, comprising the step of introducing the polynucleotide into a cell, or expressing PylRS from the polynucleotide. By utilizing this production method in a live cell protein synthesis system, it is possible to produce a tRNA bound to a non-natural amino acid with high efficiency. This production method may comprise, for example, the steps of introducing a polynucleotide encoding PylRS into a cell, culturing the cell, evaluating the expression of PylRS, evaluating the expression of tRNA, evaluating the expression of a polypeptide containing a non-natural amino acid, or purifying or isolating the polypeptide containing a non-natural amino acid.

[0046] One embodiment of the present invention is a method for producing a polypeptide containing a non-natural amino acid, comprising a step of highly expressing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales in a living cell. By utilizing this production method in a living cell protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency. The step of highly expressing may comprise, for example, a step of highly expressing PylRS by a high expression promoter.

[0047] In one embodiment of the present invention, the production method or introduction method may be carried out in a non-natural amino acid introduction system containing PylRS, for example.

[0048] In one embodiment of the present invention, the non-natural amino acid introduction system may be, for example, a reaction solution of a cell-free protein synthesis system. In one embodiment of the present invention, the PylRS concentration in the reaction solution may be, for example, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 120 μM, any value thereof or more, or within a range of any two values ​​thereof. From the viewpoint of more efficient introduction of a non-natural amino acid into a protein, it is preferably 25 μM or more, more preferably 50 μM or more, and even more preferably 75 μM or more. The reaction solution may contain, for example, a polynucleotide encoding a gene having a stop codon at a position different from that of the natural type, a tRNA, or a non-natural amino acid. The concentration of the polynucleotide encoding a gene having a stop codon at a position different from the natural type may be, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.5, 3.0, 4.0, 5.0, or 10.0 mg / mL, or may be any value or more, or may be within a range of any two values. The position different from the natural type includes, for example, a position corresponding to a site for introducing a non-natural amino acid into a polypeptide. The position different from the natural type may be, for example, a position corresponding to a constant region of an antibody. The concentration of the tRNA may be, for example, 1.0, 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 12.0, 14.0, 16.0, 18.0, or 20.0 μM, or may be any value or more thereof, or may be within a range of any two values ​​thereof. The concentration of the unnatural amino acid may be, for example, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0, 2.5, 3.0, 4.0, 5.0, or 10.0 mM, or may be any value or more thereof, or may be within a range of any two values ​​thereof.The reaction solution may contain, for example, LMCPY mixture-PEG-DTT, tRNA, magnesium acetate, amino acid mixture, creatine kinase, RNA polymerase, chaperone enhanced S30 extract, buffer, template DNA, GSSG, DsbC, pH adjuster, or water. The concentrations of these components may be within ±40, ±30, ±20, ±10, or ±5% of the concentrations listed in Table 2 below. The template DNA may be, for example, a nucleic acid containing a nonsense codon in the base sequence encoding the target protein for amino acid introduction. In one embodiment of the present invention, the cell-free protein synthesis system may be, for example, an Escherichia coli-derived cell-free protein synthesis system, a mammalian cell-derived cell-free protein synthesis system, an insect cell-derived cell-free protein synthesis system, a wheat germ-derived cell-free protein synthesis system, or a reconstituted cell-free protein synthesis system.

[0049] In one embodiment of the present invention, the non-natural amino acid introduction system may be a cell of a living cell protein synthesis system. In one embodiment of the present invention, the cell may contain a polynucleotide encoding PylRS and a high expression promoter. In one embodiment of the present invention, the high expression promoter includes a promoter that highly expresses a polypeptide (e.g., PylRS). The high expression promoter includes, for example, a glmS promoter and a promoter having higher expression ability than the glmS promoter. The high expression promoter that controls PylRS includes, for example, a high expression promoter derived from a phage such as T3, T5, T7, or SP6, such as tac, trc, lac, lacUV5, araBAD, rhaBAD, SV40, CMV, CAG, SV40, EF-1α, TEF1, PGK1, HXT7, TPI1, TDH3, PYK1, ADH1, GAL1, GAL10, polyhedrin, p10, metallothionein, or Actin 5C. As the high expression promoter, in an E. coli culture system, T3, T5, T7, SP6, tac, trc, lac, lacUV5, araBAD, or rhaBAD is preferred; in a mammalian cell culture system, SV40, CMV, CAG, SV40, or EF-1α is preferred; in a budding yeast (S. cerevisiae) culture system, TEF1, PGK1, HXT7, TPI1, TDH3, PYK1, ADH1, GAL1, or GAL10 is preferred; in a fission yeast (Schizosaccharomyces pombe) culture system, CMV is preferred; in an insect cell (e.g., moth cells infected with baculovirus) culture system, polyhedrin or p10 is preferred; and in an insect cell (e.g., Drosophila S2 cell) culture system, metallothionein or Actin 5C is preferred. Examples of promoters that regulate high expression of tRNA include U6, H1, 7SK, tRNA(Val), tRNA(Arg), tRNA(Tyr), lpp, and T5. In mammalian cell culture systems or insect cell culture systems, this promoter is preferably U6, H1, 7SK, tRNA(Val), tRNA(Arg), or tRNA(Tyr), and in E. coli culture systems, lpp or T5 is preferred.In one embodiment of the present invention, the live cell protein synthesis system may be, for example, bacteria such as E. coli, mammalian cells, insect cells, yeast, or the like.

[0050] In one embodiment of the present invention, the non-natural amino acid introduction system can be applied to non-natural amino acid introduction systems including multiple orthogonal systems.

[0051] In one embodiment of the present invention, a high PylRS concentration in a reaction solution includes, for example, a concentration of 15 μM or more. This concentration may be, for example, 15, 16, 17, 18, 19, 20, 25, 30, 40, 50, 60, 70, 80, 90, 100, or 120 μM, or any value thereof or a range between any two of these values. From the viewpoint of more efficiently introducing an unnatural amino acid into a protein, the concentration is preferably 25 μM or more, more preferably 50 μM or more, and even more preferably 75 μM or more.

[0052] In one embodiment of the present invention, the production method may include a step of mixing a solution containing 5 mg / mL or more of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with a non-natural amino acid to prepare a mixed solution. This mixed solution can contain a high concentration of PylRS. By using the mixed solution containing a high concentration of PylRS in a cell-free protein synthesis system, a polypeptide containing a non-natural amino acid can be produced with high efficiency.

[0053] In one embodiment of the present invention, the PylRS concentration in the solution of 5 mg / mL or more may be, for example, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 25, 26, 27, 28, 29, or 30 mg / mL, any of these values ​​or more, or within a range between any two of these values. When the concentration is 12.6 mg / mL or more, the concentration is particularly easy to prepare in a highly efficient cell-free protein synthesis system. From this viewpoint, the concentration is preferably 12.6 mg / mL or more, more preferably 15 mg / mL or more, and even more preferably 20 mg / mL or more.

[0054] In one embodiment of the present invention, the cell-free protein synthesis system includes a synthesis system in which a cell extract expressing PylRS, crudely purified PylRS, or purified PylRS is added at a high concentration to a reaction solution containing a cell extract of E. coli or the like prepared for cell-free protein synthesis, or a synthesis system in which a cell extract prepared from E. coli or the like expressing a high concentration of PylRS prepared for cell-free protein synthesis is used as a reaction solution.

[0055] In one embodiment of the invention, the naturally occurring amino acid-containing polypeptide comprises a polypeptide conjugated to a drug, the drug including, for example, an anti-cancer drug.

[0056] In one embodiment of the present invention, PylRS includes a protein having an activity of binding an amino acid to tRNA. The amino acid includes, for example, pyrrolysine or a non-natural amino acid. In one embodiment of the present invention, the non-natural amino acid includes, for example, a lysine derivative, a tyrosine derivative, a phenylalanine derivative, a tryptophan derivative, an arginine derivative, a methionine derivative, a leucine derivative, a histidine derivative, a proline derivative, a cysteine ​​derivative, a threonine derivative, a serine derivative, alanine derivative, an isoleucine derivative, a valine derivative, a glutamine derivative, a glutamic acid derivative, an asparagine derivative, an aspartic acid derivative, a glycine derivative, a selenocysteine ​​derivative, a pyrrolysine derivative, a kynurenine derivative, an ornithine derivative, a citrulline derivative, a canavanine derivative, a diaminopimelic acid, or an α-hydroxy acid derivative of any of these. Unless otherwise specified, PylRS includes both wild-type PylRS and mutant PylRS.

[0057] Organisms of the orders Methanomassiliicoccales and Thermoplasmatales form a single cluster and are distantly related to organisms of the genus Methanosarcina, such as M. mazei and M. barkeri. The amino acid sequence of PylRS from an organism of the orders Methanomassiliicoccales and Thermoplasmatales may have a structure in which the amino acid sequence on the N-terminal side is deleted when aligned with the amino acid sequence of PylRS from M. barkeri or M. mazei.

[0058] In one embodiment of the present invention, the organisms of the order Methanomassiliicoccales include organisms of the genera Methanomethylophilus, Methanomassiliicoccus, and Methanoplasma. The organisms of the order Methanomassiliicoccales may also include organisms that are not classified into a genus. The organisms of the genus Methanomethylophilus include, for example, Methanomethylophilus alvus (M. alvus) (WP_015505008) or Methanomethylophilus sp. 1R26 (WP_058747239). The organisms of the genus Methanomassiliicoccus include, for example, Methanomassiliicoccus luminyensis (WP_019176308) or Methanomassiliicoccus intestinalis (WP_020448777). Organisms of the genus Methanoplasma include, for example, Methanoplasma termitum (WP_048111907). Organisms of which the genus is not classified include, for example, Methanomassiliicoccales archaeon RumEn M1 (KQM11560), Methanogenic archaeon ISO4-H5 (WP_066075773), or Methanogenic archaeon ISO4-G1 (AMK13702). The number in parentheses after the organism name indicates the NCBI accession number of PylRS.

[0059] In one embodiment of the present invention, the organism of the order Thermoplasmatales includes, for example, an organism not assigned to a genus. An example of an organism not assigned to a genus includes, for example, Thermoplasmatales archaeon BRNA1 (WP_015492598).

[0060] An example of a phylogenetic tree of PylRS including organisms of the genus Methanomethylophilus or Methanomassiliicoccus is shown in FIG. 1. From the viewpoint of more efficient introduction of unnatural amino acids into proteins, the organism is preferably M. alvus or Methanogenic archaeon ISO4-G1. Methanomethylophilus alvus is sometimes generally written as Candidatus Methanomethylophilus alvus. Thus, in the present specification, Methanomethylophilus alvus includes Candidatus Methanomethylophilus alvus. In addition, with regard to other organisms (including genera, species, etc.), organisms corresponding to names including Candidatus are included in organisms indicated by names not including Candidatus. In other words, an organism indicated by Candidatus X is included in organisms indicated by X.

[0061] In one embodiment of the present invention, MaPylRS includes a protein having an amino acid sequence shown in, for example, SEQ ID NO: 5. In one embodiment of the present invention, G1PylRS includes a protein having an amino acid sequence shown in, for example, SEQ ID NO: 10. When the amino acid sequences of MaPylRS and G1PylRS are aligned with PylRS from archaea such as M. barkeri and M. mazei, for example, they have amino acid sequences with deleted N-terminal regions. The alignment using Clustal Omega is shown in FIG. 2. The boxed portion is a portion that is putatively a pyrrolysine-binding pocket. In one embodiment of the present invention, the amino acid sequence of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales may have 70% or more identity with the amino acid sequence of MaPylRS. This value may be, for example, 70, 75, 80, 85, 90, 95, 97, 98, 99, or 100%, or within a range of any two of these values.

[0062] In one embodiment of the present invention, the PylRS includes a PylRS having an amino acid sequence in which at least 50 amino acids on the N-terminus side are deleted when aligned with the PylRS of, for example, M. barkeri or M. mazei. This value may be 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, or 185, or within a range of any two of these values. From the viewpoint of more efficiently introducing unnatural amino acids into proteins, at least 110 amino acids are preferable, and at least 130 amino acids are more preferable. Alignment may be performed, for example, by Clustal Omega or BLAST of NCBI.

[0063] In one embodiment of the present invention, the PylRS comprises, for example, a PylRS bound to a non-natural amino acid in an amino acid binding pocket, for example, the amino acid in the amino acid binding pocket includes the amino acid at positions 96, 120, 121, 122, 125, 126, 129, 164, 166, 168, 170, 203, 204, 205, 206, 207, 221, 223, 227, 228, 233, 235, 239, 241, or 243 when aligned with MaPylRS. The amino acids in the amino acid binding pocket may include, for example, amino acids at positions 95, 119, 120, 121, 124, 125, 128, 163, 165, 167, 169, 201, 202, 203, 204, 205, 219, 221, 225, 226, 231, 233, 237, 239, or 241 when aligned with ISO4-G1 PylRS. In one embodiment of the present invention, the PylRS includes, for example, a PylRS bound to a non-naturally occurring amino acid (e.g., a lysine derivative) in the amino acid binding pocket.

[0064] In one embodiment of the present invention, the purified PylRS includes, for example, isolated PylRS. PylRS includes, for example, PylRS synthesized in a cell-free protein synthesis system and recombinant PylRS expressed in living cells. In one embodiment of the present invention, the cell includes, for example, Escherichia coli or a mammalian cell. In one embodiment of the present invention, the mammal includes, for example, a human, a rat, a mouse, a rabbit, a cow, or a monkey. The purified PylRS includes, for example, PylRS purified by a purification method such as HisTrap purification or gel filtration chromatography.

[0065] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having an amino acid sequence with 70% or more identity to the amino acid sequence of natural PylRS and having pyrrolysyl-tRNA synthetase activity. The identity may be, for example, 70, 75, 80, 85, 90, 95, 97, 98, 99, 99.5, or 99.9% or more, or within a range between any two of these values. The identity may be less than 100%. The identity may be calculated by calculating the percentage of identical amino acids in two or more amino acid sequences according to a method known in the art. Before calculating the percentage, the amino acid sequences of the amino acid sequences to be compared are aligned, and gaps are introduced into a part of the amino acid sequence if necessary to maximize the percentage of identical amino acids. Methods for alignment, methods for calculating the percentage, methods for comparison, and computer programs related thereto are conventionally well known in the art (e.g., BLAST, GENETYX, etc.). The identity can be expressed as a value measured by BLAST of NCBI. For comparison of amino acid sequences, Blastp can be used with default settings. In this specification, the mutant PylRS and the PylRS mutant are synonymous.

[0066] In one aspect of the present invention, the pyrrolysyl-tRNA synthetase activity includes, for example, the activity of binding a non-natural amino acid to a tRNA. The activity includes, for example, the activity of binding a non-natural amino acid to a suppressor tRNA. The activity includes, for example, the activity of introducing a non-natural amino acid into a protein.

[0067] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having an amino acid sequence encoded by a polynucleotide that specifically hybridizes under stringent conditions to a polynucleotide consisting of a base sequence complementary to a base sequence encoding the amino acid sequence of natural PylRS, and having pyrrolysyl-tRNA synthetase activity. Examples of stringent conditions include the following: (1) using low ionic strength and high temperature for washing (e.g., 0.015 M sodium chloride / 0.0015 M sodium citrate / 0.1% sodium dodecyl sulfate at 50°C), or (2) using a denaturant such as formamide during hybridization (e.g., 50% (v / v) formamide and 0.1% bovine serum albumin / 0.1% ficoll / 0.1% polyvinylpyrrolidone / 50 mM sodium phosphate buffer at pH 6.5, and 750 mM sodium chloride, 75 mM sodium citrate at 42°C). The temperature during washing may be 50, 55, 60, or 65° C., or may be within a range between any two of these values. The washing time may be 5, 15, 30, 60, or 120 minutes, or longer. Several factors, such as temperature and salt concentration, may affect the stringency of the hybridization reaction. For details, see Ausubel et al., Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

[0068] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having one or several amino acid residues deleted, added, inserted, or substituted relative to a wild-type PylRS and having pyrrolysyl-tRNA synthetase activity. Several may be 2, 3, 4, 5, 6, 7, 8, 9, or 10, or within a range between any two of these values. It is known that a polypeptide having one or several amino acid residues deleted, added, inserted, or substituted retains its biological activity (Mark et al., Proc Natl Acad Sci US A. 1984 Sep; 81(18): 5662-5666., Zoller et al., Nucleic Acids Res. 1982 Oct 25; 10(20): 6487-6500., Wang et al., Science. 1984 Jun 29; 224(4656): 1431-1433.). The polypeptide having deletions or the like may be prepared by, for example, site-directed mutagenesis or random mutagenesis. For site-directed mutagenesis, for example, PrimeSTAR mutagenesis kit (Takara Bio Inc.) may be used.

[0069] In one embodiment of the present invention, the amino acid includes an organic compound having an amino group and a carboxyl group. When the polypeptide according to the embodiment of the present invention includes a specific amino acid sequence, any of the amino acids in the amino acid sequence may form a salt or a solvate. Furthermore, any of the amino acids in the amino acid sequence may be L-type or D-type. Even in such cases, the polypeptide according to the embodiment of the present invention can be said to include the specific amino acid sequence.

[0070] In one embodiment of the present invention, the mutant PylRS includes a PylRS having a mutation in an amino acid binding pocket. In one embodiment of the present invention, the mutant PylRS includes, for example, a PylRS that binds to a non-natural amino acid (e.g., a lysine derivative) in the amino acid binding pocket.

[0071] In one embodiment of the present invention, the mutant PylRS includes a PylRS having a mutation at position 96, 120, 121, 122, 125, 126, 128, 129, 164, 166, 168, 170, 203, 204, 205, 206, 207, 221, 223, 227, 228, 233, 235, 239, 241, or 243 when aligned with the wild-type PylRS. These positions are considered to be positions where mutations can be made based on the results of mutagenesis experiments or crystal structure analysis. The mutations may be, for example, mutations to A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, or V. The mutations are preferably mutations to A, L, V, C, or F. The positions 126, 129, 168, and 206 before the mutation may be, for example, Y, M, V, and Y, respectively.

[0072] In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having a higher efficiency of introducing a non-natural amino acid into a protein than that of a natural PylRS. In one embodiment of the present invention, the mutant PylRS includes a mutant PylRS having an activity of introducing TCO*Lys, pEtZLys, or pAzZLys into a protein.

[0073] One embodiment of the present invention is a composition for binding a non-natural amino acid to a tRNA, comprising PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. The composition for binding preferably contains 5 mg / mL or more of PylRS. In this case, the non-natural amino acid can be efficiently bound to the tRNA by mixing the composition for binding with a solution containing the non-natural amino acid, tRNA, or the like. If the composition for binding is used in the synthesis of a polypeptide containing a non-natural amino acid, the polypeptide containing a non-natural amino acid can be efficiently produced. One embodiment of the present invention is the use of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales for the production of a composition for binding a non-natural amino acid to a tRNA. One embodiment of the present invention is a method for binding a non-natural amino acid to a tRNA using PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales.

[0074] In one embodiment of the present invention, the method for introducing a non-natural amino acid into a polypeptide, the method for producing a polypeptide containing a non-natural amino acid, the method for binding a non-natural amino acid to a tRNA, or the method for producing a tRNA bound to a non-natural amino acid may include, for example, the following steps: (1) contacting PylRS with a non-natural amino acid, (2) contacting PylRS with a tRNA, (3) introducing PylRS, a nucleic acid encoding PylRS, or a non-natural amino acid into a solution, (4) introducing tRNA or a nucleic acid encoding tRNA into a solution, (5) contacting a polynucleotide encoding a gene having a stop codon at a position different from that of the natural type with tRNA, or (6) expressing PylRS, tRNA, or a polynucleotide encoding a gene having a stop codon at a position different from that of the natural type in a living cell or a non-cellular protein synthesis system in the presence of the non-natural amino acid. Also, the method may include a step of concentrating a solution containing PylRS, or a step of mixing the concentrated PylRS solution with a non-natural amino acid. The tRNA includes, for example, a suppressor tRNA. The suppressor tRNA includes, for example, an amber suppressor tRNA. The tRNA includes, for example, a tRNA of an organism of the order Methanomassiliicoccales or Thermoplasmatales. Unless otherwise specified, the tRNA includes both natural tRNA and mutant tRNA. The solution may contain, for example, a buffer, a tRNA, a polynucleotide encoding a gene having a stop codon at a position different from that of the natural type, an amino acid mixture, a template DNA, or an RNA polymerase. The method for introducing a non-natural amino acid into a polypeptide or the method for producing a polypeptide containing a non-natural amino acid may employ a cell-free protein synthesis method or a cellular protein synthesis method.

[0075] In one embodiment of the invention, the protein includes, for example, a functional protein or a structural protein. A functional protein includes, for example, an antibody or an enzyme. The protein may contain natural or non-natural amino acids. The site for introducing the non-natural amino acid may be, for example, within the constant region of an antibody.

[0076] In one embodiment of the present invention, the polypeptide includes, for example, a protein. The polypeptide includes a structure formed by linking a plurality of amino acids. The number of amino acids in the polypeptide may be, for example, 10, 20, 30, 50, 70, 100, 200, 400, 500, 700, 1000, or 1500, or any value or more thereof, or within a range of any two values ​​thereof.

[0077] In one embodiment of the present invention, the lysine derivatives include, for example, the compound of Figure 3. The non-natural amino acids include, for example, the non-natural amino acids described in WO / 2017 / 030156. The non-natural amino acids include, for example, amino acid derivatives. The phenylalanine derivatives include, for example, 3-iodo-L-phenylalanine. The tyrosine derivatives include, for example, o-propargyl-L-tyrosine.

[0078] One embodiment of the present invention is a composition. The composition includes, for example, a composition containing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. The composition includes, for example, a composition for introducing a non-natural amino acid into a polypeptide, or for producing a polypeptide containing a non-natural amino acid. The composition may, for example, contain a non-natural amino acid. The composition may, for example, contain a buffer, a tRNA, a template DNA, an amino acid mixture, or an RNA polymerase.

[0079] One embodiment of the present invention is a polypeptide having a non-natural amino acid. The polypeptide can be chemically modified by click chemistry. For example, click chemistry can be performed using techniques such as those described in Hou J et al., Expert Opin Drug Discov. 2012 Jun;7(6):489-501. and Bonnet Det al., Bioconjug Chem. 2006 Nov-Dec;17(6):1618-23. One embodiment of the present invention is a chemically modified polypeptide having a non-natural amino acid. One embodiment of the present invention is a composition comprising a polypeptide having a non-natural amino acid or a chemically modified polypeptide thereof. The composition includes a pharmaceutical composition comprising one or more pharmacologically acceptable carriers.

[0080] One embodiment of the present invention is a template composition for producing a mutant PylRS, comprising PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales, or a nucleic acid encoding the PylRS. One embodiment of the present invention is a method for producing a mutant PylRS, comprising the step of introducing a mutation into PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. Whether the mutated PylRS has pyrrolysyl-tRNA synthetase activity may be evaluated by, for example, a cell-free protein synthesis method or a live cell protein synthesis method, as described in the Examples below. One embodiment of the present invention is a method for producing a polypeptide, comprising a step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with an amino acid, the method comprising an introduction step selected from the following: (a) a step of introducing an amino acid into a polypeptide with higher efficiency than when a cell-free protein synthesis system using MmPylRS is used; or (b) a step of introducing a non-natural amino acid into a polypeptide with higher efficiency than when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glmS promoter is used; and when an E. coli protein synthesis system using a vector having the gene for the PylRS under the control of the glnS promoter is used. One embodiment of the present invention is an amino acid introduction system containing a high concentration of PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales. The amino acid introduction system may be, for example, a reaction solution of a cell-free protein synthesis system, or cells of a live cell protein synthesis system. One embodiment of the present invention is a method for producing a polypeptide, comprising the step of contacting PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales with an amino acid extracellularly. One embodiment of the present invention is a method for producing a polypeptide, comprising the step of highly expressing PylRS from an organism of the order Methanomassiliicoccales or Thermoplasmatales in a living cell.

[0081] All publications, publications (patents or patent applications) cited herein are incorporated by reference in their entirety.

[0082] In this specification, "or" is used when "at least one or more" of the items listed in the text can be adopted. The same applies to "alternative." In this specification, when it is specified that "within a range of two values," the range includes the two values ​​themselves. In this specification, "A to B" means A or more and B or less.

[0083] Although the embodiments of the present invention have been described above, these are merely examples of the present invention, and various configurations other than those described above may also be adopted. Also, the configurations described in the above embodiments may be combined and adopted. EXAMPLES

[0084] The present invention will be further explained below with reference to examples, but is not limited to these.

[0085] <Experimental Example 1> (1) Expression and purification of M. mazei PylRS The His6-SUMO-M. mazei PylRS structural gene was cloned into pET24, transformed into E. coli BL21-Gold(DE3), and cultured in 1L of LB medium at 37°C. When OD600 was 0.7, 1mM IPTG was added and cultured at 20°C overnight (the amino acid sequence of His6-SUMO-M. mazei PylRS is SEQ ID NO:1). The cells were collected, purified with HisTrap, treated with SUMO protease, and purified with HiTrap SP and Superdex 200 HiLoad16 / 60. 4.4 mg of M. mazei PylRS (2.82 mg / ml x 1.56 ml) was collected from 1L of medium. The solution containing this MmPylRS was concentrated, and the concentration limit was 2.82 mg / mL.

[0086] <Example 1> 1.1 Expression and purification of M. alvus PylRS The PylRS (MaPylRS) structural gene (SEQ ID NO: 2) of Methanomethylophilus alvus was cloned into pET28, and then transformed into Escherichia coli BL21-Gold (DE3). The strain was cultured in 1 L of LB medium at 37°C and the OD 600 At pH = 0.6, 1 mM IPTG was added and the mixture was cultured at 20°C overnight. The cells were harvested and purified using HisTrap, Thrombin, HiTrapQ, Hitrap Heparin, and Superdex 200, resulting in the recovery of approximately 100 mg of MaPylRS from 1 L of culture medium. This recovery amount was higher than that of conventional archaeal PylRS. When Methanosarcina PylRS was expressed in E. coli, the recovery amount was small because PylRS was prone to precipitation and purification was difficult. Furthermore, when the solution containing this MaPylRS was concentrated, the concentration limit was 20 mg / mL or more.

[0087] <Example 2> 2.1 Comparison of the amount of protein synthesis containing unnatural amino acids using MaPylRS and MmPylRS in cell-free protein synthesis The compositions of the reaction solution and the external dialysis solution were as shown in Table 1. [Table 1]

[0088] tRNA Pyl is tRNA from M. mazei Pyl and tRNA from M. alvus Pyl The base sequences were SEQ ID NO: 3. The natural PylRSs derived from M. mazei and M. alvus were used (the amino acid sequence of MmPylRS is SEQ ID NO: 4, and the amino acid sequence of MaPylRS is SEQ ID NO: 5). The non-natural amino acids were N ε -(tert-butyloxycarbonyl)-L-lysine (BOCLys) (Bachem) and N ε-propargyloxycarbonyl-L-lysine (PocLys) (SciChem) was used. pN11GFPS1sh-A17Amb was used as the template DNA for introducing unnatural amino acids, and pN11GFPS1sh was used for the control synthesis. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution against 1 mL of dialysis solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to 1 μL, and the fluorescence value was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1, and expressed as a percentage of the normal synthesis of the control.

[0089] As a result, as shown in Figure 4, the introduction of unnatural amino acids using PylRS was confirmed. With BOCLys introduction, the amount of protein synthesis with MaPylRS was more than double that with MmPylRS, and the amount of protein synthesized was equivalent to that of the normal synthesis (WT) control. With PocLys introduction, the amount of protein synthesis with MaPylRS was very high, almost equivalent to that of the control. Therefore, it was demonstrated that unnatural proteins can be efficiently prepared by using MaPylRS.

[0090] <Example 3> 3.1 Native PylRS concentration dependence in cell-free protein synthesis The concentration dependency of TCO*Lys introduction was evaluated when using native PylRS. The composition of the reaction solution and the dialysis solution was as shown in Table 1. Pyl is tRNA derived from M. alvus Pyl The native PylRS derived from M. alvus was used.

[0091] The upper limit of the amount of PylRS that can be added to the reaction solution is the total amount of water (Milli-Q water) that is applied to PylRS. MaPylRS has a concentration limit of 20 mg / mL or more, so it could be added at a final concentration of 80 μM or more. In this experiment, it was used in the range of 10 μM to 75 μM. In the case of MmPylRS, the concentration limit is 4 mg / mL or less, so the maximum concentration that can be added is approximately 10 μM.

[0092] The unnatural amino acid used was TCO*Lys. The template DNA used was pN11GFPS1sh-A17Amb. The synthesis reaction was carried out by dialysis of 30 μL of the reaction solution against 1 mL of external solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to an amount equivalent to 1 μL, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.

[0093] As a result, as shown in FIG. 5, it was confirmed that the amount of protein synthesis increased at concentrations exceeding 10 μM, and increased approximately 2.3-fold at 75 μM PylRS compared to 10 μM PylRS.

[0094] <Example 4> 4.1 Crystal structure analysis of MaPylRS The MaPylRS recovered in Example 1 was subjected to crystallization screening, and crystals were obtained under conditions where PEG was used as a precipitant. Diffraction data with a resolution of 2.2 Å (space group C2) was obtained at the Taiwan Beamline (TPS05A), and the structure was refined after molecular replacement with the MmPylRS structure (R f / R w=28.8 / 22.8). The catalytic domain had a similar structure to that of M. mazei, but the inclination of the two N-terminal α-helices was different from that of M. mazei. Tyr206 (Phe384) does not enter the pocket all the way, but is bent at several residues around Tyr206 and faces inward, leaving the active site pocket wide open. The shape of the active site pocket of MaPylRS is slightly different from that of MmPylRS, and the back of the pocket appears to be a little narrower. Based on the structure, we created PylRS mutants and performed experiments to introduce non-natural amino acids.

[0095] The left side of Figure 6 shows the superimposed structure of the monomer of MmPylRS catalytic domain / pyrrolysyl-AMP complex (MmPylRSc / Pyl-AMP, gray) and the dimer of MaPylRS (apo type, green and blue). The right side of Figure 6 shows an enlarged view of the active site in the superimposed structure of MmPylRSc and MaPylRS (apo type). It also shows the mutated amino acid residues and their corresponding amino acid residues in M. mazei, Asn346 / Asn166, which are necessary for recognition of the carbonyl group of pyrrolysine.

[0096] <Example 5> 5.1 Evaluation of the introduced MaPylRS mutant based on the results of structural analysis The introduction of unnatural amino acids was evaluated using PylRS, whose mutation site was determined based on the results of structural analysis. The composition of the reaction solution and the external dialysis solution were as shown in Table 1. tRNA Pyl is tRNA derived from M. alvus PylMaPylRS was used at 10 μM. PylRS(Y126A / M129A / H227I / Y228P) and PylRS((Y126A / M129L / H227I / Y228P) were prepared by adding a new mutation (H227I / Y228P) derived from the structural analysis results to the conventional PylRS(Y126A / M129A) mutant or PylRS(Y126A / M129L) mutant. PylRS was used at 10 μM. ZLys, mAzZLys, pEtZLys, and TCO*Lys were used as unnatural amino acids. pN11GFPS1sh- A17Amb was used as the template DNA. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution against 1 mL of external solution at 25°C overnight. The reaction solution after synthesis was 1 The fluorescence intensity was measured at excitation 485 nm and emission 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0097] As a result, as shown in Figure 7, introduction of the (H227I / Y228P) mutation into the PylRS(Y126A / M129A) mutant significantly increased the protein synthesis amount for all unnatural amino acids. In particular, the synthesis amount of ZLys, mAzZLys, and TCO*Lys reached the same level as that of WT. By introducing the (H227I / Y228P) mutation, the synthesis amount of ZLys was increased by about 3 times, mAzZLys by about 1.5 times, pEtZLys by about 1.6 times, and TCO*Lys by about 9 times.

[0098] Next, we also introduced the (H227I / Y228P) mutation into the PylRS(Y126A / M129L) mutant, which was effectively treated with TCO*Lys. As with the PylRS(Y126A / M129A) mutant, the synthesis amount reached the same level as that of the WT, increasing by about 4-fold. This suggests that the (H227I / Y228P) mutation may be effective against various mutants.

[0099] <Example 6> 6.1 PylRS concentration dependence of unnatural amino acid incorporation using PylRS mutants in cell-free protein synthesis The composition of the reaction solution and the dialysis solution was as shown in Table 1 above. In this case, the PylRS used was a PylRS mutant. The final concentration of the PylRS mutant was confirmed to be between 5 μM and 75 μM. The amount of water (Milli-Q water) was changed according to the change in the liquid volume accompanying the change in the concentration of the PylRS mutant.

[0100] tRNA Pyl is tRNA from M. mazei Pyl and tRNA from M. alvus Pyl The PylRS mutants used were MmPylRS (Y306A / Y384F / R61K) and MaPylRS (Y126A / M129L). Among the MaPylRS mutants, MmPylRS (Y306A / Y384F / R61K) is a mutant with high activity against large lysine derivatives such as ZLys derivatives (Yanagisawa et al., Chem Biol. 2008 Nov 24;15(11):1187-97.). The unnatural amino acid was N ε -((((E)-cyclooct-2-en-1-yl)oxy)carbonyl)-L-lysine (TCO*-Lys) (SciChem), N ε -(p-ethynylbenzyloxycarbonyl)-L-lysine (pEtZLys) (Sundia / Namiki), N ε -(p-azidobenzyloxycarbonyl)-L-lysine (pAzZLys) (Sundia / Namiki) was used. The template DNA for introducing unnatural amino acids was pN11GFPS1sh- A17Amb, and the template DNA for control was pN11GFPS1sh. Protein synthesis reaction was performed by dialysis of 30 μL of reaction solution with 1 mL of dialysis solution at 25℃ overnight. After synthesis, the reaction solution was diluted approximately 200-fold, and the fluorescence intensity was measured at excitation 485 nm and emission 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0101] The upper limit of the amount of PylRS mutant that can be added to the reaction mixture is the total amount of water (Milli-Q water) that is applied to PylRS. Since the concentration limit of the MmPylRS mutant is 4 mg / mL or less, a maximum of approximately 10 μM can be added. Since the concentration limit of the MaPylRS mutant is 20 mg / mL or more, a maximum of 80 μM can be added.

[0102] As a result, as shown in Figures 8 and 9, it was confirmed that the amount of protein synthesis increased by using a high concentration of the MaPylRS mutant. Figure 8 shows the results of introducing the unnatural amino acid TCO*-Lys, which is promising for click chemistry reactions. At a PylRS mutant concentration of 10 μM, M. mazei was able to synthesize approximately 0.25 mg / mL of GFPS1 protein, and M. alvus was able to synthesize approximately 0.83 mg / mL of GFPS1 protein. On the other hand, synthesis was possible in M. alvus at a PylRS mutant concentration of 75 μM, and at 50 μM, 3 mg / mL of protein was synthesized, which was equal to or greater than the normal synthesis (WT) of the control. This is more than 10 times the synthesis using the MmPylRS mutant. Therefore, it was revealed that the use of a high concentration of the MaPylRS mutant enables the efficient preparation of proteins with TCO*-Lys introduced.

[0103] Figure 9 shows the results when pEtZLys and pAzZLys, which have lower introduction efficiency than TCO*-Lys, were used. When the PylRS concentration was 10 μM, the amount of protein synthesis was low in both M. mazei and M. alvus. On the other hand, in the MaPylRS mutant, the amount of protein synthesis increased in a concentration-dependent manner, and when the concentration of the PylRS mutant was increased to 75 μM, the amount of protein synthesis with pEtZLys introduction increased to about 0.5 mg / mL, about 2.5 times higher than when the concentration of the PylRS mutant was added at 10 μM. With pAzZLys introduction, the amount of protein synthesis increased to about 2 mg / mL, about 4.6 times higher, which was close to the amount of WT synthesis with normal synthesis. Therefore, it was revealed that the amount of protein synthesis can be increased in pEtZLys and pAzZLys, which have low introduction efficiency, by using a high concentration of the MaPylRS mutant.

[0104] <Example 7> 7.1 Introduction of ZLys unnatural amino acid using MaPylRS mutant in cell-free protein synthesis The composition of the reaction solution and the dialysis solution was as shown in Table 1. In this case, the PylRS used was a PylRS mutant. Pyl is tRNA derived from M. alvus Pyl The PylRS mutant used was the mutant from M. alvus shown in Figure 10. The unnatural amino acid was N ε -benzyloxycarbonyl-L-lysine (ZLys) (Bachem) was used. The template DNA for introducing unnatural amino acids was pN11GFPS1sh-A17Amb, and the template DNA for the control was pN11GFPS1sh. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution with 1 mL of external dialysis solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to 1 μL, and the fluorescence value was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1, and expressed as a percentage of the normal synthesis of the control.

[0105] The results of investigating the amount of synthesis of ZLys-introduced proteins are shown in Figure 10. As a result of introducing mutations into the 126th, 129th, 168th, and 206th positions in the amino acid pocket of MaPylRS, the synthesis amount was 40% or more compared to the control. In particular, Y126A / M129A and Y126A / V168C showed high synthesis amounts. These results demonstrated that it is possible to create mutants suitable for ZLys introduction.

[0106] 7.2 Introduction of unnatural amino acids using MaPylRS mutants in cell-free protein synthesis The composition of the reaction solution and the dialysis solution was as shown in Table 1. In this case, the PylRS used was a PylRS mutant. Pyl is tRNA derived from M. alvus Pyl The PylRS mutant used was the mutant derived from M. alvus shown in Figure 11. The unnatural amino acid was N ε-(m-azidobenzyloxycarbonyl)-L-lysine (mAzZLys) (Sundia / Namiki) was used. The template DNA for introducing unnatural amino acids was pN11GFPS1sh- A17Amb, and the template DNA for the control was pN11GFPS1sh. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution with 1 mL of dialysis solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to 1 μL, and the fluorescence value was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1, and expressed as a percentage of the normal synthesis of the control.

[0107] The results of investigating the amount of protein synthesized by introducing mAzZLys are shown in Figure 11. Introducing mutations into the 126th, 129th, and 168th positions in the amino acid pocket of MaPylRS showed a synthesis amount of at least 65% compared to the control. These results demonstrated that it is possible to create mutants suitable for introducing mAzZLys.

[0108] <Example 8> 8.1 Preparation of Fab antibody with TCO*-Lys non-natural amino acid introduced using MaPylRS mutant Cell-free protein synthesis to introduce the unnatural amino acid TCO*-Lys, which is promising for click chemistry reactions, into the L chain of Herceptin Fab antibody was performed using the reaction solution and dialysis solution compositions shown in Table 2 below. [Table 2]

[0109] tRNA Pyl is tRNA from M. mazei Pyl and tRNA from M. alvus Pyl The PylRS mutants used were MmPylRS (Y306A / Y384F / R61K) and MaPylRS (Y126A / M129L). PylThe maximum volume of PylRS and tRNA was 460 μL. Pyl and PylRS mutant at 6.5 μM, and tRNA from M. alvus at 6.5 μM. Pyl The Herceptin Fab H chain was used at 10 μM, and the PylRS mutant was used at 50 μM. The template DNAs used were pN11TVGS_Her-H for the Herceptin Fab H chain and pN11TVGS_Her-L-S203Amb for the Herceptin Fab L chain, which has a codon for the introduction of a non-natural amino acid at amino acid number 203. Protein synthesis was performed by dialysis of 5 mL of the reaction solution against 50 mL of external dialysis solution at 25°C overnight. After synthesis, the reaction solution was subjected to tag cleavage and purification. Click chemistry was performed by mixing with 10 times the amount of TAMRA-tetrazine and reacting at 25°C for 10 and 30 minutes.

[0110] As a result, as shown in Figure 12, the amount of TCO*-Lys-introduced Herceptin Fab dimer synthesized per mL of cell-free protein synthesis reaction solution was 1.7 mg when M. alvus was used, which was 20 times the amount when M. mazei was used.

[0111] Figures 13 and 14 show the results of binding the fluorescent substrate TAMRA to the introduced TCO*-Lys by click chemistry. TCO*-Lys is highly reactive, and the binding reaction was almost complete within 10 minutes. In the synthesis using M. alvus, the electrophoretic image of the L chain after click chemistry migrated to the polymer side, and showed strong fluorescence intensity. On the other hand, in the synthesis using M. mazei, the proportion of the L chain that migrated to the polymer side was half that of M. alvus, and the fluorescence intensity was about 1 / 3. Since the fluorescence intensity per amount of electrophoretic protein is 1.5 times higher in M. alvus, taken together with Figure 12, it was revealed that synthesis using M. alvus makes it possible to prepare a Fab antibody with 30 times the amount of TCO*-Lys introduced.

[0112] Therefore, by using a high concentration of the MaPylRS mutant, it became possible to prepare Fab antibodies with TCO*-Lys introduced more efficiently than before, and the introduction of TCO*-Lys also enabled highly reactive click chemistry.

[0113] <Example 9> 9.1 Comparison of the introduction efficiency of unnatural amino acids by M. mazei, M. alvus, and D. hafniense PylRS in E. coli expression system The non-natural amino acids (ncAA) used were BocLys and AlocLys (Bachem). The wild-type PylRS genes used were MaPylS (M. alvus PylRS gene), MmPylS (M. mazei PylRS gene), and DhPylS (D. hafniense PylRSc gene). tRNA Pyl The gene is MaPylT (M. alvus tRNA Pyl ), MmPylT (M. mazei tRNA Pyl ), DhPylT (D. hafniense tRNA Pyl ) was used. Pyl Genes from the same bacterium were used in combination. E. coli BL21-Gold(DE3) was used. Plasmids were pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA Pyl The plasmid used for protein expression was pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, in which the third Ser from the N-terminus was mutated to an amber codon).

[0114] After transforming E. coli BL21-Gold(DE3) with the pBT5 series and pACYC-GST-GFP(amber3), the strain was cultured at 25℃ for 24 hours in 2 ml or 0.2 ml of 2 x YT autoinduction medium containing 1 mM unnatural amino acids (BocLys, AlocLys). At this time, PylRS was highly expressed by the T5 promoter (sequence number 6) of the pBT5 series. 10μl of E. coli culture was diluted in 0.19 ml of PBS on a 96-well microplate, and the fluorescence was measured at 485 / 510 nm using a SpectraMAX i3 plate reader (molecular devices), converted to the absorbance at 600 nm, and the fluorescence values ​​were compared.

[0115] The results are shown in Figure 15. In the figure, -ncAA means the condition without non-natural amino acids. When DhPylS was used, no fluorescence was detected. When MmPylS was used, fluorescence was detected, and the introduction efficiency was 9% for BocLys. On the other hand, when MaPylS was used, the highest fluorescence value was observed, and the introduction efficiency of BocLys and AlocLys was 57% and 64%, respectively. In the high expression system of PylRS, the introduction efficiency of BocLys when PylRS of M.alvus was used was 6 times that of M.mazei, and the introduction efficiency of AlocLys was 14 times that of M.mazei. In addition, the E. coli with high expression of MmPylRS showed impaired growth, while the E. coli with high expression of MaPylRS showed no impaired growth.

[0116] <Example 10> 10.1 Analysis of wild-type GST-GFP fusion protein (3Ser) and amber mutant GST-GFP fusion protein Wild-type GST-GFP or GST-GFP(amber3) was expressed in 5 ml of medium in the presence of 1 mM BocLys. After harvesting, the cells were disrupted with Bugbuster Master Mix reagent (Merck Millipore), and the proteins were purified with GST SpinTrap (GE Healthcare), followed by SDS-PAGE and staining with Simplyblue safe stain. Gel pieces were excised and digested overnight at 37°C with Trypsin / Lys-C Mix, Mass Spec grade (Promega), purified with His SpinTrap TALON, eluted with 4% acetonitrile containing 0.1% TFA, and analyzed by MALDI-TOF MS.

[0117] The results are shown in Figure 16. The GST-GFP product obtained using MaPylRS was 59 mg (wild-type GST-GFP was 106 mg), and was proportional to the fluorescence value. MALDI-TOF analysis after trypsin digestion confirmed that BocLys had been introduced at the third residue of the 1-12 peptide (MNXSSHHHHHHR) (peak 2), and that the wild-type residue was Ser (peak 1). (Peak 3 is the decomposition of BocLys to Lys by acid treatment (TFA), and * is the peak derived from the product with the initiating Met removed.)

[0118] <Example 11> 11.1 Site-specific introduction of unnatural amino acids into proteins using MaPylRS in an E. coli expression system The non-natural amino acids (ncAA) used were BocLys, AlocLys, DBocLys (Bachem), and PocLys (SynChem). The PylRS used were MaPylRS and MmPylRS (R61K / G131E / Y384F) (BocLysRS2). tRNA Pyl The PylRS and tRNA were derived from M. alvus and M. mazei, respectively. Pyl The E. coli strain used was BL21-Gold(DE3). The plasmids used were the pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA PylThe plasmid used for protein expression was pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, in which the third Ser from the N-terminus was mutated to an amber codon).

[0119] E. coli BL21-Gold(DE3) was transformed with the pBT5 series (pBR322 as a control) and pACYC-GST-GFP(amber3), and then cultured in 2 ml or 0.2 ml of 2 x YT autoinduction medium containing 1 mM unnatural amino acid at 25℃ for 24 hours. At this time, PylRS was highly expressed by the T5 promoter of the pBT5 series. 10 μl of E. coli culture was diluted in 0.19 ml of PBS on a 96-well microplate, and the fluorescence was measured at 485 / 510 nm using a SpectraMAX i3 plate reader, and converted to absorbance at 600 nm.

[0120] The results are shown in Figure 17. In the figure, -ncAA means the condition without unnatural amino acids. When MaPylRS was used in the high expression system of PylRS, BocLys, DBocLys, AlocLys, and PocLys could be introduced more efficiently than when MmPylRS (R61K / G131E / Y384F) was used. Furthermore, impaired growth was observed in E. coli in which the MmPylRS mutant was highly expressed, but no impaired growth was observed in E. coli in which the MaPylRS was highly expressed.

[0121] <Example 12> 12.1 Site-specific incorporation of ZLys-based unnatural amino acids into proteins using MaPylRS mutants in an E. coli expression system The unnatural amino acids used were ZLys (Watanabe Chemical), oClZLys, pNO2ZLys (Bachem), pTmdZLys, oAzZLys, mAzZLys, oEtZLys, AmAzZLys, and AzNO2ZLys (Shinsei Chemical). The MaPylRS mutants used were Y126A / M129L and Y126A / M129L / Y206F. The MmPylRS mutant used was Y306A / Y384F. tRNA PylThe PylRS and tRNA were derived from M. alvus and M. mazei, respectively. Pyl The E. coli strain used was BL21-Gold (DE3). The plasmids used were the pBT5 series (T5 / lacO-PylRS, T5 / lacO-tRNA Pyl The plasmid used for protein expression was pACYC-GST-GFP(amber3) (T7 / lacO-3amb-His6-GST-GFP, in which the third Ser from the N-terminus was mutated to an amber codon).

[0122] E. coli BL21-Gold(DE3) was transformed with the pBT5 series (pBR322 as a control) and pACYC-GST-GFP(amber3), and then cultured at 25℃ for 24 hours in 2ml or 0.2ml of 2 x YT autoinduction medium containing 1mM unnatural amino acid. At this time, PylRS was highly expressed by the T5 promoter of the pBT5 series. 10μl of E. coli culture was diluted in 0.19ml of PBS on a 96-well microplate, and the fluorescence was measured at 485 / 510nm using a SpectraMAX i3 plate reader, converted to the absorbance at 600nm, and the fluorescence value was compared with the fluorescence of wild-type GST-GFPwt as 1.

[0123] The results are shown in Figure 18. In the figure, -ncAA means the condition without non-natural amino acids. All ZLys derivatives could be introduced into the high expression system of PylRS. The introduction efficiency was highest for MaPylRS (Y126A / M129L). In particular, the introduction efficiency of MaPylRS (Y126A / M129L) was higher (3-18 times) than that of MmPylRS (Y306A / Y384F). Furthermore, impaired growth was observed in E. coli that highly expressed the MmPylRS mutant, but not in E. coli that highly expressed the MaPylRS mutant.

[0124] <Example 13> 13.1 Confirmation of PylRS concentration dependency in wheat germ cell-free protein synthesis method To confirm the effectiveness of increasing the concentration of M. alvus PylRS in a eukaryotic protein synthesis system, we conducted a TCO*Lys introduction test using the Premium PLUS Expression Kit (Cell Free Sciences, Inc.), a wheat germ-based cell-free protein synthesis method.

[0125] tRNA Pyl is tRNA from M. mazei Pyl and tRNA from M. alvus Pyl The PylRS mutants used were PylRS (Y306A / Y384F / R61K) from M. mazei and PylRS (Y126A / M129L) from M. alvus, and were added to the reaction solution at a range of 10 μM to 50 μM. The unnatural amino acid was TCO*Lys at a final concentration of 1 mM. The template DNA for introducing unnatural amino acids was pEU-E01-GFPS1sh-A17Amb. The synthesis reaction was carried out at 15°C for 20 hours by layering 206 μL of the substrate solution onto approximately 20 μL of the translation reaction solution. After synthesis, 20 μL of the mixture was diluted approximately 10-fold, and the fluorescence intensity was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0126] As a result, it was confirmed that the amount of protein synthesis increased at concentrations exceeding 10 μM PylRS, and increased approximately 7.2-fold at 50 μM PylRS, as shown in Figure 19. Therefore, the effectiveness of increasing the concentration of M. alvus PylRS in a eukaryotic protein synthesis system was confirmed.

[0127] <Example 14> 14.1 Confirmation of PylRS concentration dependency in human cell-free protein synthesis To confirm the effectiveness of M. alvus PylRS in a human cell-derived protein synthesis system, which is particularly useful among eukaryotes, we conducted an introduction test of TCO*Lys using the Human Cell-Free Protein Expression Maxi System (TAKARA), a human cell-based cell-free protein synthesis method.

[0128] tRNA Pyl is tRNA derived from M. alvus Pyl The PylRS mutant used was PylRS (Y126A / M129L) derived from M. alvus, and was added to the reaction solution in the range of 10 μM to 50 μM. The unnatural amino acid was TCO*Lys at a final concentration of 1 mM. pN11GFPS1sh-A17Amb was used as the template DNA for introducing the unnatural amino acid. The synthesis reaction was carried out at 32°C for 20 hours by dialyzing 30 μL of the reaction solution against 350 μL of external reaction solution. After synthesis, 20 μL of the mixture was diluted approximately 10-fold, and the fluorescence intensity was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0129] As a result, as shown in Figure 20, it was confirmed that the amount of protein synthesis increased with increasing PylRS concentration, and increased by about 1.8 times at 50 μM PylRS. Therefore, the effectiveness of high concentration of M. alvus PylRS in the human cell-free protein synthesis system was confirmed. In addition, since the effectiveness was demonstrated in the cell-free protein synthesis method, it was confirmed that it is also effective in the human cell expression system that uses the same transcription translation system.

[0130] <Example 15> 15.1 AcLys installation confirmation test Using M. alvus PylRS, unnatural amino acid N ε The introduction of -acetyl-L-lysine (AcLys) was confirmed.

[0131] The composition of the reaction solution and the dialysis solution was as shown in Table 1. Pyl is tRNA derived from M. alvus PylThe PylRS mutants were PylRS:AcLysRS3 (121V / 125I / 126F / 129A / 168F) and AcLysRS3-IP (121V / 125I / 126F / 129A / 168F / 227I / 228P) derived from M. alvus, which were added at 10 μM to the reaction solution, and AcLys was used at a final concentration of 1 mM. The template DNA for introducing unnatural amino acids was pN11GFPS1sh- A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was performed by dialysis overnight at 25°C against 30 μL of the reaction solution against 1 mL of dialysis solution. After synthesis, the reaction solution was diluted approximately 200-fold to the equivalent of 1 μL, and the fluorescence intensity was measured at excitation 485 nm and emission 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.

[0132] As a result, as shown in FIG. 21, it was confirmed that AcLys could be introduced by using the M. alvus PylRS mutant.

[0133] <Example 16> 16.1 Confirmation test for introduction of Phe derivatives Using M. alvus PylRS, we confirmed the introduction of 3-iodo-L-phenylalanine (IPhe), a phenylalanine (Phe) derivative.

[0134] The composition of the reaction solution and the dialysis solution was as shown in Table 1. Pyl is tRNA derived from M. alvus PylThe PylRS mutants, PylRS (166A / 168A) and PylRS (166A / 168A / 227I / 228P) derived from M. alvus, were added to the reaction solution at 10 μM, and IPhe was used at a final concentration of 1 mM. The template DNA for introducing unnatural amino acids was pN11GFPS1sh- A17Amb, and the template DNA for the control was pN11GFPS1sh. In addition, since there have been reports of introducing phenylalanine itself into mutants for Phe derivatives, synthesis without adding IPhe was also confirmed. The synthesis reaction was performed by dialysis overnight at 25°C against 30 μL of the reaction solution with 1 mL of external dialysis solution. After synthesis, the reaction solution equivalent to 1 μL was diluted approximately 200-fold, and the fluorescence value was measured at 485 nm for excitation and 535 nm for emission. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.

[0135] As a result, as shown in Figure 22, it was confirmed that IPhe could be introduced by using the M. alvus PylRS mutant, and therefore that the M. alvus PylRS mutant is effective for Phe derivatives.

[0136] <Example 17> 17.1 Tyr derivative introduction confirmation test Using M. alvus PylRS, we confirmed the introduction of the tyrosine (Tyr) derivative o-propargyl-L-tyrosine (oPgTyr).

[0137] The composition of the reaction solution and the dialysis solution was as shown in Table 1. Pyl is tRNA derived from M. alvus PylThe PylRS mutant, PylRS (166A / 168A) derived from M. alvus, was added to the reaction solution at 10 μM, and oPgTyr was used at a final concentration of 1 mM. The template DNA for introducing unnatural amino acids was pN11GFPS1sh- A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution with 1 mL of external dialysis solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold, and the fluorescence intensity was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0138] As a result, as shown in Figure 23, it was confirmed that oPgTyr could be introduced by using the M. alvus PylRS mutant. Therefore, it was confirmed that the M. alvus PylRS mutant is effective for Tyr derivatives.

[0139] <Example 18> 18.1 Confirmation of PylRS from the methanogenic archaeon ISO4-G1 We evaluated the PylRS (G1PylRS) of methanogenic archaeon ISO4-G1. The DNA sequence used for synthesis was (SEQ ID NO: 7) for PylRS of ISO4-G1, and tRNA Pylis GGAGGGCGCTCCGGCGAGCAAACGGGTCTCTAAAACCTGTAAGCGGGGTTCGACCCCCCGGCCTTTCGCCA (SEQ ID NO: 8). Pyl The RNA sequence is GGAGGCGCUCCGGCGAGCAAACGGGUCUCUAAAACCUGUAAGCGGGGUUCGACCCCCCGGCCUUUCGCCA (SEQ ID NO: 9).

[0140] Add ISO4-G1 tRNA to the reaction solution of the E. coli cell-free protein synthesis system. Pyl and PylRS were added at 10 μM, and BocLys or PocLys at 1 mM. The template DNA for introducing unnatural amino acids was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution with 1 mL of external dialysis solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to 1 μL, and the fluorescence intensity was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0141] As a result, efficient protein synthesis by introduction of unnatural amino acids was confirmed using the ISO4-G1 PylRS, as shown in Figure 24. Furthermore, the synthesis amount relative to the control was compared with the PylRSs of M. mazei and M. alvus, as shown in Figure 25. From these results, it was confirmed that the ISO4-G1 PylRS was effective. It was surprising that the G1PylRS showed such excellent introduction efficiency in a cell-free protein synthesis system.

[0142] <Example 19> 19.1 Confirmation of Methanogenic Archaeon ISO4-G1 PylRS Mutants Methanogenic archaeon ISO4-G1 PylRS mutants, PylRS(Y125A / M128A) and PylRS(Y125A / M128L), were used to confirm the introduction of unnatural amino acids. The unnatural amino acids confirmed were ZLys, TCO*Lys, BCNLys, pETZLys, and pAzZLys. tRNA of ISO4-G1 was added to the reaction solution of the E. coli cell-free protein synthesis system. Pyl and PylRS mutants were added at 10 μM each, and unnatural amino acids were added at 1 mM. The template DNA for introducing unnatural amino acids was pN11GFPS1sh-A17Amb, and the template DNA for control was pN11GFPS1sh. The synthesis reaction was performed by dialysis of 30 μL of the reaction solution with 1 mL of external dialysis solution at 25°C overnight. After synthesis, the reaction solution equivalent to 1 μL was diluted approximately 200-fold, and the fluorescence intensity was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence intensity of 1 mg / mL standard GFPS1.

[0143] As a result, efficient protein synthesis by the introduction of unnatural amino acids was confirmed using the PylRS mutant of ISO4-G1, as shown in Figure 26. Furthermore, the synthesis amount relative to the control was compared with the PylRS mutant of M. mazei, as shown in Figure 27. From these results, it was confirmed that the ISO4-G1 PylRS mutant was effective.

[0144] <Example 20> 20.1 Methanogenic archaeon ISO4-G1 concentration dependency confirmation test in cell-free protein synthesis method The methanogenic archaeon ISO4-G1 PylRS and its mutant PylRS have a high concentration limit and can be used at high concentrations, similar to the M. alvus PylRS. Therefore, we confirmed the concentration dependence of pEtZLys, which did not reach 100% of the control synthesis amount in Figure 27, when the methanogenic archaeon ISO4-G1 PylRS mutant PylRS (Y125A / M128L) was used. The compositions of the reaction solution and the external dialysis solution were as shown in Table 1.

[0145] Methanogenic archaeon ISO4-G1 PylRS (Y125A / M128L) was used at concentrations ranging from 10 μM to 75 μM. Pyl The non-natural amino acid pEtZLys was added at 10 μM and 1 mM. The template DNA used was pN11GFPS1sh-A17Amb. The synthesis reaction was carried out by dialysis of 30 μL of the reaction solution against 1 mL of external solution at 25°C overnight. After synthesis, the reaction solution was diluted approximately 200-fold to an equivalent of 1 μL, and the fluorescence value was measured at an excitation of 485 nm and an emission of 535 nm. The amount of synthesized GFPS1 protein was quantified based on the fluorescence value of 1 mg / mL standard GFPS1.

[0146] As a result, as shown in Figure 28, it was confirmed that the amount of protein synthesis increased at concentrations exceeding 10 μM, and increased approximately 6.8-fold at 75 μM PylRS. This result confirmed that the ISO4-G1 PylRS mutant is effective when used at a high concentration.

[0147] <Example 21> 21.1 Introduction of mAzZLys into proteins in animal cells M. alvus PylRS mutant (Y126A / M129L / H227I / Y228P) and M. alvus tRNA Pyl , or the methanogenic archaeon ISO4-G1 PylRS mutant (Y125A / M128L) and ISO4-G1 tRNA Pyl In order to express the protein in animal cells (HEK293c18 cells), we used the system described in a non-patent document (Mukai, et al., Biochem. Biophys. Res. Commun. Vol. 371, pp. 818-822 (2008)). For proteins, we used mutant genes with amber codons (T137 or N157) introduced into the coding region of the gene and their expression systems.

[0148] The results are shown in FIG. 29. In both cases, it was confirmed that the unnatural amino acid was introduced into the protein. In this experiment, although one copy of each tRNA gene was used instead of nine copies, a protein into which an unnatural amino acid was introduced could be synthesized. The above experiments demonstrated that the high expression system of M. alvus PylRS mutant (Y126A / M129L / H227I / Y228P) or Methanogenic archaeon ISO4-G1 PylRS mutant (Y125A / M128L) is effective for the specific introduction of mAzZLys into the desired site in animal cells.

[0149] The present invention has been described above based on the embodiments. However, these embodiments are merely illustrative, and it will be understood by those skilled in the art that various modifications are possible and that such modifications are also within the scope of the present invention.

Claims

1. A method for producing a polypeptide containing a non-natural amino acid, comprising the step of contacting pyrrolysyl-tRNA synthetase (PylRS) with a non-natural amino acid, the PylRS is a wild-type or mutant PylRS, the wild-type or mutant PylRS having 90% or more identity with the amino acid sequence shown in SEQ ID NO:5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions with respect to the amino acid sequence shown in SEQ ID NO:10 and having pyrrolysyl-tRNA synthetase activity; A production method in which the contact is carried out in a non-natural amino acid introduction system containing the PylRS, the non-natural amino acid introduction system being a reaction solution of a cell-free protein synthesis system, and the reaction solution containing 15 μM or more of the PylRS.

2. 2. The method according to claim 1, wherein the unnatural amino acid introduction system introduces the unnatural amino acid into the polypeptide at an efficiency 1.5 times or more higher than when MmPylRS is used as PylRS.

3. 3. The method according to claim 1, wherein the reaction solution in the non-natural amino acid introduction system contains a polynucleotide encoding a gene having a stop codon at a position different from that of the natural type.

4. The method according to any one of claims 1 to 3, wherein the contacting step comprises a step of mixing a solution containing 5 mg / mL or more of the PylRS with a non-natural amino acid to prepare a mixed solution.

5. The method according to any one of claims 1 to 4, wherein the PylRS is derived from an organism of the genus Methanomethylophilus.

6. The method according to any one of claims 1 to 5, wherein the PylRS has an amino acid sequence in which at least 50 amino acids are deleted from the N-terminus when aligned with PylRS derived from Methanosarcina mazei.

7. The method according to any one of claims 1 to 5, wherein the PylRS is a wild-type or mutant PylRS derived from Methanomethylophilus alvus.

8. The method according to any one of claims 1 to 4, wherein the PylRS is a mutant PylRS derived from the methanogenic archaeon ISO4-G1.

9. The method according to any one of claims 1 to 8, wherein the unnatural amino acid is a lysine derivative, a tyrosine derivative, a phenylalanine derivative, a tryptophan derivative, an arginine derivative, a methionine derivative, a leucine derivative, a histidine derivative, a proline derivative, a cysteine ​​derivative, a threonine derivative, a serine derivative, an alanine derivative, an isoleucine derivative, a valine derivative, a glutamine derivative, a glutamic acid derivative, an asparagine derivative, an aspartic acid derivative, a glycine derivative, a selenocysteine ​​derivative, a pyrrolysine derivative, a kynurenine derivative, an ornithine derivative, a citrulline derivative, a canavanine derivative, a diaminopimelic acid, or an α-hydroxy acid derivative of any of these.

10. The method according to any one of claims 1 to 9, wherein the non-natural amino acid-containing polypeptide is conjugated to a drug.

11. A method for introducing an unnatural amino acid into a polypeptide, comprising a step of contacting PylRS with the unnatural amino acid, the PylRS is a wild-type or mutant PylRS, the wild-type or mutant PylRS having 90% or more identity with the amino acid sequence shown in SEQ ID NO:5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions with respect to the amino acid sequence shown in SEQ ID NO:10 and having pyrrolysyl-tRNA synthetase activity; The contact is carried out in a non-natural amino acid introduction system containing the PylRS, the non-natural amino acid introduction system being a reaction solution of a cell-free protein synthesis system, and the reaction solution containing 15 μM or more of the PylRS.

12. 12. The non-natural amino acid introduction system according to claim 11, wherein the reaction solution in the non-natural amino acid introduction system contains a polynucleotide encoding a gene having a stop codon at a position different from that of a natural type.

13. A reaction solution of a cell-free protein synthesis system containing 15 μM or more of a wild-type or mutant PylRS having 90% or more identity with the amino acid sequence shown in SEQ ID NO: 5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions relative to the amino acid sequence shown in SEQ ID NO: 10 and having pyrrolysyl-tRNA synthetase activity.

14. The reaction solution according to claim 13, comprising a polynucleotide encoding a gene having a stop codon at a position different from that of the native gene.

15. A method for producing a polypeptide containing a non-natural amino acid, comprising a step of contacting, outside a cell, a natural or mutant PylRS having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions relative to the amino acid sequence shown in SEQ ID NO: 10 and having pyrrolysyl-tRNA synthetase activity, at a concentration of 15 μM or more in a reaction solution, with a non-natural amino acid.

16. The production method according to claim 15, which has a higher efficiency of introducing unnatural amino acids than when a cell-free protein synthesis system using MmPylRS is used.

17. A method for introducing an unnatural amino acid into a polypeptide, comprising a step of contacting a natural or mutant PylRS having 90% or more identity to the amino acid sequence shown in SEQ ID NO:5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions relative to the amino acid sequence shown in SEQ ID NO:10 and having pyrrolysyl-tRNA synthetase activity, at a concentration of 15 μM or more in a reaction solution, with the unnatural amino acid outside a cell.

18. A method for producing a tRNA bound to a non-natural amino acid, comprising a step of contacting, outside a cell, a natural or mutant PylRS having 90% or more identity to the amino acid sequence shown in SEQ ID NO: 5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions relative to the amino acid sequence shown in SEQ ID NO: 10 and having pyrrolysyl-tRNA synthetase activity, at a concentration of 15 μM or more in a reaction solution, with a non-natural amino acid, and a tRNA.

19. A solution containing 5 mg / mL or more of wild-type or mutant PylRS having 90% or more identity to the amino acid sequence shown in SEQ ID NO:5 and having pyrrolysyl-tRNA synthetase activity, or a mutant PylRS having an amino acid sequence with only Y125A / M128L substitutions relative to the amino acid sequence shown in SEQ ID NO:10 and having pyrrolysyl-tRNA synthetase activity.

20. 20. A method for producing a polypeptide containing a non-natural amino acid, comprising the step of mixing the solution according to claim 19 with a non-natural amino acid to prepare a mixed solution.

21. 21. The method for producing a polypeptide containing a non-natural amino acid according to claim 20, wherein the mixed solution is a reaction solution for a cell-free protein synthesis system.

22. A method for introducing an unnatural amino acid into a polypeptide, comprising the step of adding the solution according to claim 19 to a reaction solution of a cell-free protein synthesis system.

23. 20. An agent for introducing an unnatural amino acid into a polypeptide, comprising the solution according to claim 19.

24. A method for producing a tRNA bound to a non-natural amino acid, comprising the step of adding the solution according to claim 19 to a reaction solution of a cell-free protein synthesis system.

Images