Method for producing sterile lepidopteran insects and agent for sterilizing lepidopteran insects

Abstract

To provide a method for producing sterile lepidopteran insects by a sterilization method that can simply, stably, and efficiently sterilize lepidopteran insects and that causes abnormalities only in germ line cells, and a sterilization agent with which the method can be implemented.SOLUTION: Loss of function of the nanosP gene in the host lepidopteran insect is brought about.SELECTED DRAWING: None

Description

[Technical field]

[0001] The present invention relates to a method for producing sterile lepidopteran insects and a sterilizing agent for lepidopteran insects to be used in said method. [Background technology]

[0002] Genetic modification techniques, such as recombinant DNA techniques, are essential for the functional analysis of genes and proteins, and for the production of substances such as proteins. Conventionally, Escherichia coli and yeast have been used as host organisms in recombinant DNA techniques. However, these organisms are not suitable as a production system for mass production of proteins.

[0003] In recent years, therefore, silkworms (Bombyx mori) have been attracting attention as a host for mass-production of proteins. Silkworms are insects that have long been used industrially to produce silk, and because they spin cocoons in the pre-pupal stage, they can mass-produce silk thread in a short period of time. This is due to the high protein-producing ability of the silkworm's silk gland. Technology that utilizes this production ability to create genetically modified silkworms (transgenic silkworms) and mass-produce useful proteins other than silk thread has attracted attention.

[0004] On the other hand, substance production systems using recombinant DNA technology are accompanied by the problem of genetic environmental contamination due to the escape of recombinant organisms into the wild. Silkworms have completely lost the ability to fly, and therefore are approved for Type 1 use under the Cartagena Protocol, i.e., use without preventing their spread into the environment. However, the possibility cannot be ruled out that female silkworms may hybridize with male mulberry silkworms (Bombyx mandarina), a closely related species that has the ability to fly and can invade from the outside. For this reason, the development of sterilization techniques for silkworms that do not produce offspring is industrially important in order to maintain useful strains and prevent the spread of recombinant organisms into the environment.

[0005] Methods for sterilizing insects have been developed and implemented mainly for producing sterile insects in the sterile insect technique (SIT). Known sterilization methods include, for example, irradiation.

[0006] The radiation irradiation method is a method of sterilizing the target insects by irradiating the reproductive cells of the target insects with radiation such as X-rays or gamma rays, thereby inducing sperm inactivation, egg loss, reduced egg count, and inability to mate, etc. (Non-Patent Documents 1 and 2). However, this method has problems such as safety concerns due to the need for irradiation facilities, as well as concerns that radiation exposure may reduce the vitality of the insects. [Prior art documents] [Non-patent literature]

[0007] [Non-Patent Document 1] Agriculture, Forestry and Fisheries Journal (1980), Vol. 3, No. 2, pp. 32-34 [Non-Patent Document 2] Chemistry and Biology (1993), vol.31, No.2, p.137-139 Summary of the Invention [Problem to be solved by the invention]

[0008] The object of the present invention is to develop a new sterilization method that can sterilize lepidopteran insects simply, stably and efficiently and that brings about abnormalities only in germ line cells, and to develop and provide a method for producing sterile lepidopteran insects using the same, and a sterilization agent with which the method can be carried out. [Means for solving the problem]

[0009] The present inventors have conducted intensive research aimed at solving the above problems, and as a result have found that when the function of the nanosP gene, out of the four nanos genes (nanosM gene, nanosN gene, nanosO gene, and nanosP gene) present in lepidopteran insects, is inhibited, significant abnormalities thought to be due to germ cell lineage failure, such as the almost complete disappearance of mature eggs in the ovaries of adult insects and disappearance of testes, occurred, resulting in sterility. However, it was also revealed that cells other than the germ lineage cells remained normal. By applying this phenomenon, it is possible to genetically sterilize lepidopteran insects. The present invention is based on these findings and provides the following.

[0010] (1) A method for producing a sterile lepidopteran insect, comprising the step of inhibiting the function of the nanosP gene. (2) The method according to (1), wherein the function of the gene is inhibited using a gene knockout method. (3) The production method described in (2), wherein the gene knockout method is a genome editing method. (4) The method according to any one of (1) to (3), wherein the nanosP gene comprises a nucleotide sequence encoding a nanosP protein having an amino acid sequence shown in any one of (a) to (c) below: (a) the amino acid sequence shown in SEQ ID NO:1; (b) an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1; or (c) an amino acid sequence having 90% or more amino acid identity to the amino acid sequence shown in SEQ ID NO:1 (5) The method according to (4), wherein the nanosP gene consists of the base sequence shown in SEQ ID NO:2. (6) A sterile lepidopteran insect in which expression of the nanosP gene is inhibited. (7) The sterile Lepidoptera insect according to (6), wherein the functional inhibition is achieved by gene knockout of each gene. (8) The sterile Lepidoptera insect according to (7), wherein the gene knockout method is a genome editing method. (9) A sterilizer for lepidopteran insects, comprising as an active ingredient a gene function inhibitor that inhibits the function of the nanosP gene. (10) The sterilization agent according to (9), wherein the gene function inhibitor comprises a genome editing tool that specifically disrupts the nanosP gene on the host genome. Effect of the Invention

[0011] According to the method for producing a sterile lepidopteran insect of the present invention, a sterile lepidopteran insect having abnormalities only in germ line cells can be produced simply, stably and efficiently.

[0012] Furthermore, the sterilizing agent for lepidopteran insects of the present invention can easily, stably and efficiently sterilize any desired lepidopteran insect. [Brief description of the drawings]

[0013] [Figure 1] This is a diagram showing the ovaries of adult female silkworms. A shows the ovaries of a wild-type individual, and B shows the ovaries of a nanosP knockout individual. The arrows in the figure indicate developed egg cells. [Diagram 2] This is a diagram showing the reproductive organs of an adult male silkworm. A shows the wild-type reproductive organs, and B shows the reproductive organs of a nanosP knockout individual. The arrow in A indicates the testis. On the other hand, in B, no testis is seen at the position where the testis should be, as indicated by the arrow. [Diagram 3] This is a diagram showing eggs laid by a wild-type female individual after mating, incubated at 28°C for about 5 days, and then laid on an egg-laying mat. B shows eggs laid by a wild-type female individual after mating with a nanosP knockout male individual, and A shows eggs laid by the same wild-type female individual after mating with a wild-type male individual. Fertilized eggs turn black and become bluish eggs. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0014] 1. Method for Producing Sterile Lepidoptera 1-1. Overview A first aspect of the present invention is a method for producing a sterile lepidopteran insect, which is characterized in that the method inhibits the function of the nanosP gene in a target lepidopteran insect to induce abnormalities in germline cells of the insect and produce a sterile lepidopteran insect.

[0015] 1-2.Definition of Terms The definitions of terms frequently used in this specification are explained below. "Lepidoptera insects" refers to insects belonging to the taxonomic order Lepidoptera, and refers to butterflies or moths. Butterflies include insects belonging to the families Nymphalidae, Papilionidae, Pieridae, Lycaenidae, and Hesperiidae. Moths include insects belonging to the families Saturniidae, Bombycidae, Brahmaeidae, Eupterotidae, Lasiocampidae, Psychidae, Geometridae, Archtiidae, Noctuidae, Pyralidae, Sphingidae, and the like. For example, moths include species belonging to the genera Bombyx, Samia, Antheraea, Saturnia, Attacus, and Rhodinia, specifically, silkworms, Bombyx mandarina, Samia cynthia (including Samia cynthia ricini and hybrids of Samia cynthia and Samia ricini), Antheraea yamamai, Antheraea pernyi, Saturnia japonica, and Actias gnoma, but the lepidopteran insects of the present invention are not limited to these. Preferably, the silkworm is used.

[0016] As used herein, the term "target lepidopteran insect" refers to a lepidopteran insect to which the method for producing a sterile lepidopteran insect of the present invention is applied, or a lepidopteran insect to which the lepidopteran insect sterilization composition of the present invention is administered.

[0017] As used herein, the term "infertility" refers to the loss or significant decrease of fertility, resulting in the loss or decrease of the reproductive ability to produce the next generation. Infertility as used herein may be caused primarily by, but is not limited to, abnormalities in germ lineage cells.

[0018] As used herein, the term "sterilization" refers to changing an individual in a normal state to an infertile state.

[0019] As used herein, "infertility" refers to a state of infertility or having the characteristics of infertility.

[0020] As used herein, the term "germline cells" refers to eggs or ova and sperm that are directly involved in reproduction, and cells that will become eggs (ova) and sperm in the future. Specifically, it includes eggs (ova) and sperm, oogonia, oocytes, spermatogonia, spermatocytes, sperm cells, and primordial germ cells (PGCs) that will differentiate into the above cells in the future.

[0021] As used herein, the term "germline cell abnormality" refers to malformation such as loss of germline cells, as well as abnormalities in morphology and properties.

[0022] As used herein, "inhibiting the function of a gene" or "inhibiting gene function" is also referred to as gene knockout, and refers to destroying a gene and completely losing the function of the protein encoded by that gene. Specifically, this includes the destruction of a target gene.

[0023] As used herein, the term "expression vector" refers to a vector that contains an operative nucleic acid molecule encoding a protein or functional nucleic acid and can control the expression of the nucleic acid molecule. Examples include plasmids. In addition, as used herein, "operative state" refers to placing a target nucleic acid molecule under the control of a promoter within an expression vector. This creates a state in which expression of the target nucleic acid molecule is initiated by the activity of the promoter.

[0024] "Genome editing" is a gene targeting technology that utilizes DNA repair mechanisms associated with double strand breaks (DSBs) caused by DNA cleavage enzymes to insert foreign genes (knock-in) or destroy target genes (knock-out) at any position in the genome.

[0025] 1-3. Method The method for producing a sterile lepidopteran insect of the present invention includes a step of inhibiting gene function as an essential step, which will be described in detail below.

[0026] 1-3-1. Gene function inhibition process The "gene function inhibition step" is a step of inhibiting the gene function of the nanosP gene in a target lepidopteran insect. The inventors' research results revealed that in lepidopteran insects, loss of function of the nanosP protein inhibits the formation of germline cells, resulting in sterility in both males and females. In this step, this phenomenon is utilized to inhibit the function of the nanosP gene in a target lepidopteran insect, thereby sterilizing the insect.

[0027] The "nanos gene" (or nos gene) is a gene that codes for the nanos protein. The "nanos protein" is an evolutionarily conserved protein with a zinc finger motif. Research using fruit flies (Drosophila melanogaster) has suggested that the nanos protein functions in the survival and proliferation of primordial germ cells (PGCs) (Keuckelaere ED et al., 2018, Cell Mol Life Sci., 75:1929-1946). Unlike other insects, lepidopteran insects have four nanos paralogs (nanosM, nanosN, nanosO, and nanosP) (Nakao H., et al., 2008, Evolution & Development, 10(5): 548-554;Carter JM, et al.,2015, PLoS ONE, 10: e0144471). Similarly, four paralogous genes (Bm-nosM, Bm-nosN, Bm-nosO, and Bm-nosP) have been identified in silkworms, and tissue expression results suggest that the Bm-nosO protein is important for the formation of primordial germ cells. The phenotype of Bm-nosO gene knockout silkworms using genome editing technology showed abnormal egg formation and, in rare cases, a decrease in the number of mature eggs, suggesting that the Bm-nosO protein is involved in the egg (germ cell) formation process (Nakao H. and Takasu Y., 2019, Developmental Biology, 445:209-36). On the other hand, the specific functions of other nanos paralogs in lepidopteran insects are unknown.

[0028] In the present specification, the nanosP gene to be functionally inhibited is not particularly limited as long as it is the nanosP gene of the target lepidopteran insect to be sterilized. The nanosP gene orthologues of each species may be the target. The base sequence of each may be a base sequence that encodes the respective nanosP protein.

[0029] For example, when the target lepidopteran insect is a silkworm, examples of the wild-type Bm-nosP gene include a wild-type Bm-nosP gene encoding a wild-type Bm-nosP protein consisting of the amino acid sequence shown in SEQ ID NO: 1, an amino acid sequence in which one or more amino acids are deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1, or a mutant Bm-nosP gene encoding a mutant Bm-nosP protein consisting of an amino acid sequence having 90% or more, preferably 95% or more, 96% or more, 97% or more, 98% or more or 99% or more amino acid identity to the amino acid sequence shown in SEQ ID NO: 1. A specific example of the wild-type Bm-nosP gene is a Bm-nosP gene consisting of the base sequence shown in SEQ ID NO: 2. In this specification, the term "multiple" refers to, for example, 2 to 20, 2 to 15, 2 to 10, 2 to 7, 2 to 5, 2 to 4 or 2 to 3. Furthermore, "(amino acid) substitution" refers to substitution within a conservative amino acid group that has similar properties such as charge, side chain, polarity, and aromaticity among the 20 types of amino acids that constitute natural proteins. For example, substitutions within the uncharged polar amino acid group (Gly, Asn, Gln, Ser, Thr, Cys, Tyr) with a low polarity side chain, the branched chain amino acid group (Leu, Val, Ile), the neutral amino acid group (Gly, Ile, Val, Leu, Ala, Met, Pro), the neutral amino acid group with a hydrophilic side chain (Asn, Gln, Thr, Ser, Tyr, Cys), the acidic amino acid group (Asp, Glu), the basic amino acid group (Arg, Lys, His), and the aromatic amino acid group (Phe, Tyr, Trp) can be mentioned. Amino acid substitutions within these groups are preferred because they are known to be less likely to cause changes in the properties of the polypeptide. Furthermore, "amino acid identity" refers to the percentage (%) of identical amino acid residues in one amino acid sequence relative to the total number of amino acid residues in the other amino acid sequence when two amino acid sequences are aligned and, if necessary, gaps are introduced into one or both of the amino acid sequences to maximize the degree of amino acid identity between the two.

[0030] In this step, a manipulation is performed to inhibit the function of the nanosP gene in the target lepidopteran insect to be sterilized. The method for inhibiting gene function will be specifically described below.

[0031] A. Methods for inhibiting gene function As used herein, the term "method of inhibiting gene function" refers to a method of specifically inhibiting the function of a target gene. In this method, the function of the target gene is destroyed, and the function of the target protein is completely lost. The method of inhibiting the function of a specific gene in a lepidopteran insect may be any method known in the art, and is not particularly limited. For example, a gene knockout method may be used.

[0032] The "gene knockout method" is a method for completely eliminating the function of a gene by modifying or deleting the gene sequence on the genome of a target gene. Specific examples of the gene knockout method include genome editing.

[0033] The "genome editing method" is a gene targeting method in which a DNA cutting enzyme (nuclease) recognizes a specific sequence on the genome and makes a double strand break in DNA (referred to as "DSB" in this specification), and then uses the resulting DNA repair mechanism to insert a foreign gene (knock-in) or destroy a target gene (knock-out) at any position. This method makes it possible to destroy a gene in the genome as a target gene simply, specifically, and reliably. Known genome editing techniques include the zinc finger nuclease (ZFN) method, the TALEN method, and the CRISPR / Cas method, and any of these methods may be used in this specification. Each method will be explained below, but all of the gene destruction techniques using these methods are known in the field, and the genome editing method used in this specification also includes kits and support tools for efficiently knocking out target genes that are commercially available from various life science manufacturers, and these can also be used.

[0034] (i) Zinc finger nuclease method The "Zinc Finger Nuclease (ZFN) method" is a genome editing technology that uses an artificial DNA cleavage enzyme consisting of a zinc finger domain as a DNA binding domain and a non-specific endonuclease domain such as the nuclease domain of FokI (Kim YG et al., 1996, Proc Natl Acad Sci USA, 93: 1156-1160). Since one zinc finger motif can recognize three bases and bind to a target nucleic acid, by linking multiple zinc finger motifs, it specifically recognizes and binds to three times the number of bases linked. It functions as a dimer, and after binding to the target site, it uses its endonuclease activity to create a double-strand break (DSB) at a specific site in the target nucleic acid.

[0035] (ii) TALEN method The "TALEN (Transcription Activator-Like Effector Nuclease) method" is a genome editing technique using an artificial DNA cleavage enzyme that fuses a TAL effector (TALE) protein derived from the plant pathogenic bacterium Xanthomonas with a non-specific endonuclease domain (Christian M et al., 2010, Genetics, 186, 757-761; Cermak T, et al., 2011, Nucleic Acids Res 39: e82). TALEN is a protein that consists of a TALE domain containing a repeat of a DNA binding unit consisting of 34 amino acids as shown in SEQ ID NO: 3 as a DNA binding domain, and a non-specific endonuclease domain such as the nuclease domain of FokI. Among these, the nuclease domain, which has the enzymatic activity of cleaving DNA, functions as a dimer, and therefore TALEN functions as a dimer consisting of Left-TALEN, which recognizes the DNA sequence near the upstream side (5' side) of the double-strand break (DSB) site in the target base sequence, and Right-TALEN, which recognizes the DNA sequence near the downstream side (3' side) of the DSB site. The DNA-binding unit constituting the TALE domain has mutations in the amino acid residues at positions 12 and 13 from the N-terminus, and each pair of amino acids can specifically recognize each of the four bases constituting DNA (A: adenine, G: guanine, C: cytosine, T: thymine). For example, the amino acid residues at positions 12-13 recognize adenine when NI or NN, guanine when NN, cytosine when HD, and thymine when NG, respectively. The number of repeats of the DNA-binding unit can be varied depending on the base length of the target base sequence. By manipulating the TALE domain, gene targeting targeting any DNA sequence on the genome becomes possible. A gene knockout method using the TALEN method in lepidopteran insects such as silkworms is a known technique, for example, the method described in Takasu Y., et al., 2013, PLoS One 8, e73458 may be used as a reference.

[0036] (iii) CRISPR / Cas method The "CRISPR / Cas (Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated proteins) method" is a genome editing technology that utilizes the adaptive immune system that evolved in bacteria and archaea to eliminate foreign DNA or RNA such as viruses and plasmids. In addition to the CRISPR / Cas9 method that uses the Cas9 protein, variations using other Cas proteins such as Cpf1 and Cas13a have been reported. Bacteria and archaea fragment the invaded foreign DNA or RNA, insert it into the CRISPR region in the genome, and use it as a template to synthesize CRISPR RNA (crRNA) of about 40 bp. The crRNA binds to a Cas protein with nuclease activity directly or via a trans-activating RNA (tracrRNA) to form a CRISPR / Cas complex. The CRISPR / Cas complex binds to and cleaves a target DNA or RNA sequence that has a complementary base sequence via the crRNA. When a double-stranded nuclease such as Cas9 or Cpf1 is used as the Cas protein, a DSB is induced at the target site.

[0037] In the CRISPR / Cas9 method, which is the most common method for inducing DSB using the CRISPR / Cas method, a single-stranded guide RNA (sgRNA) combining crRNA and tracrRNA designed to have a base sequence complementary to a part of the target gene is injected or expressed into a host cell together with the Cas9 protein to induce DSB in a target gene in the host genome. Design of sgRNA for target genes is a well-known method. For example, the method described in Hanna R. et al., 2020, Nat Biotechnol, 38: 813-823 may be used as a reference. As described above, support tools for efficiently knocking out target genes using the CRISPR / Cas9 method are commercially available from various life science manufacturers, and these may be used.

[0038] In genome editing, in any of the above methods, double-strand breaks (DSBs) are repaired by DNA repair mechanisms such as homologous recombination or non-homologous end joining. Homologous recombination (HD; or Homology-Directed Repair (HDR)) is a mechanism for gene repair by recombination using sequences that are homologous or identical to the 5' and 3' peripheral regions of the DSB site. Although it is generally less frequent than non-homologous end joining, it has the advantage of being less prone to repair errors. In genome editing, it is mainly used when knocking in a foreign DNA sequence at a specific site in the genome, i.e., the DSB site. Non-homologous end joining (NHEJ) does not require a repair template, has high repair efficiency, and unlike HDR, has the advantage of being able to repair throughout the cell cycle. However, during repair, a certain percentage of repair errors such as deletion or insertion of bases called InDel occur around the DSB site. By creating a DSB site in a target gene, the InDel causes a frameshift, etc., which can induce a knockout state of the target gene. In addition, by creating two DSB sites in the target gene, the part between the DSB sites can be deleted, resulting in a knockout state of the target gene.

[0039] (How to install) The method of introducing a genome editing tool to obtain a gene function inhibition effect is to administer the relevant protein prepared in vitro, or a synthetic RNA or expression vector that produces the protein in vivo, to the host. The administration method can be a method known in the art, such as injection administration by microinjection. The concentration of the editing tool in the solution used for introduction should be such that a certain concentration or more is present in the insect body (e.g., eggs) after introduction.

[0040] Microinjection is effective when performed on eggs 2 to 8 hours after egg laying, before cleavage when the nuclei are incorporated into the cell membrane. When introducing the genome editing tool, a marker gene that serves as a selection marker may be introduced at the same time as a donor construct for knocking into the target gene. This makes it easier to select individuals in which genome editing has occurred. Regarding the knock-in method using genome editing in silkworms, a paper has been published on the knock-in technique that uses microhomology of the cleavage surface by TALEN, known as the TAL-PITCh method, and this method may be used (Nakade, S. et al., 2014, Nature Communications, 5:5560).

[0041] (Confirmation and Selection) Individuals treated by genome editing can be selected by confirming InDel (deletion or insertion mutation) in the target gene on the genome as necessary. The confirmation method is not limited. For example, a method of preparing genomic DNA from a part of genome-edited individuals and control individuals and confirming the presence or absence of InDel in the target sequence by PCR or the like, or a method of confirming the loss of expression of the target gene by RT-PCR or the like can be mentioned. As described above, if a marker gene is knocked in as a selection marker during genome editing, genome-edited individuals can be narrowed down based on the activity of the marker gene.

[0042] As used herein, a "marker gene" is a gene that codes for a marker protein. A marker protein refers to a polypeptide that can determine the presence or absence of expression of a marker gene based on its activity. "Based on activity" means "based on the detection result of activity." The activity may be detected directly by detecting the activity of the marker protein itself, or indirectly via a metabolite such as a pigment produced by the activity of the marker protein. Detection may be chemical detection (including enzyme reaction detection), physical detection (including behavioral analysis detection), or sensory detection by the detector (including detection by vision, touch, smell, hearing, and taste).

[0043] The type of the labeled protein is not particularly limited as long as its activity can be detected by a method known in the art. A labeled protein that is less invasive to the host lepidopteran insect upon detection is preferred. Examples of the labeled protein include fluorescent proteins, pigment synthesis proteins, luminescent proteins, exocrine proteins, and proteins that control external morphology. Fluorescent proteins, pigment synthesis proteins, luminescent proteins, and exocrine proteins are particularly suitable because they can be visually detected under certain conditions, are less invasive to lepidopteran insects, and are easy to distinguish and select.

[0044] The fluorescent protein is a protein that emits fluorescence of a specific wavelength when a lepidopteran insect is irradiated with excitation light of a specific wavelength. It may be either a natural type or a non-natural type. In addition, the excitation wavelength and the fluorescence wavelength are not particularly limited. Specific examples include CFP, AmCyan, RFP, DsRed (including derivatives such as DsRed monomer and DsRed2), YFP, GFP (including derivatives such as EGFP and EYFP), etc.

[0045] The pigment synthesis protein is a protein involved in the biosynthesis of a pigment, and is usually an enzyme. The "pigment" referred to here is a low molecular weight compound or peptide capable of imparting a pigment to a transformant, and the type of the pigment is not important. Preferably, the pigment is one that appears as the external color of an individual. Examples include melanin pigments (including dopamine melanin), ommochrome pigments, and pteridine pigments.

[0046] The photoprotein refers to a substrate protein that can emit light without the need for excitation light or an enzyme that catalyzes the luminescence of the substrate, such as aequorin and the enzyme luciferase.

[0047] (passage) The inhibitory effect of the target gene by genome editing is passed on to the progeny. In this specification, the term "progeny" refers to a descendant of the first generation of individuals that have undergone genome editing and that have the target gene destroyed in the genome by genome editing. The number of generations of the progeny is not important.

[0048] 2. Sterile Lepidoptera 2-1. Overview The second aspect of the present invention is a sterile lepidopteran insect. The sterile lepidopteran insect of the present invention is characterized in that the function of the nanosP gene is inhibited. As a result, fertility is reduced or lost in both males and females. The sterile lepidopteran insect of the present invention can be produced by the method for producing a sterile lepidopteran insect described in the first aspect.

[0049] 2-2.Configuration Sterile lepidopteran insects are characterized by the inhibition of the function of the nanosP gene in germline cells. The function of the nanosP gene may be inhibited (knocked out).

[0050] The sterile lepidopteran insect in which the gene function is inhibited is, but is not limited to, an individual obtained by the gene knockout method in the method for producing a sterile lepidopteran insect described in the first aspect, or a homozygous individual in which both nanosP alleles have lost their functions among its progeny.

[0051] The type of sterile Lepidoptera insect is not limited, but preferably includes industrially useful insects, such as insects intended for harvesting silk thread, such as Bombyx mori, Manchuria moth, Cynthia serrata (Eri silkworm), Saturniidae, Anemone persica, and Saturniidae, etc. Preferably, it is Bombyx mori.

[0052] The developmental stage of the sterile Lepidoptera insect is not limited, and may be any of egg, larva, pupa, and adult. However, for the purpose of sterility, it is preferably an adult which is naturally capable of reproduction.

[0053] Sterile Lepidoptera insects of the present invention can be distinguished from fertile Lepidoptera insects based on molecular genetic techniques and / or trait characteristics.

[0054] Distinction based on molecular genetic techniques may be, for example, by confirming or detecting the presence or absence of the nanosP gene on the genome and its expression level. Methods known in the art, such as PCR and Southern hybridization, can be used to confirm the presence or absence of the nanosP gene on the genome. In the case of the sterile lepidopteran insect of the present invention, it is possible to distinguish it from the wild type by an indicator such as the inability to detect a region containing the nanosP gene on the genome. In addition, methods known in the art, such as RT-PCR and Northern hybridization, can be used to measure or detect the expression level of the nanosP gene. In the case of the sterile lepidopteran insect of the present invention, it is expected that the expression of the nanosP gene is lost.

[0055] The distinction based on morphological characteristics can be confirmed by observing the reproductive organs. In the case of the sterile lepidopteran insect of the present invention, the female adult has at most 2 to 3 mature eggs in the abdominal cavity, and egg laying is hardly observed. In addition, the male adult loses the testes and fertility.

[0056] 3. Sterilizers for Lepidoptera Insects 3-1. Overview The third aspect of the present invention is a sterilizing agent for lepidopteran insects. The sterilizing agent of the present invention contains a gene function inhibitor that specifically inhibits the gene function of the nanosP gene as an active ingredient. By using the sterilizing agent of the present invention, any desired type of lepidopteran insect can be easily and efficiently sterilized.

[0057] 3-2.Configuration The components of the sterilizing agent for lepidopteran insects of the present invention will now be described.

[0058] 3-2-1. Active ingredients The sterilizing agent for lepidopteran insects of the present invention contains a gene function inhibitor as an active ingredient. The "gene function inhibitor" specifically destroys the target gene, the nanosP gene, by gene knockout method, and inhibits its function. The gene function inhibitor in the sterilization agent of the present invention is composed of a genome editing tool.

[0059] The genome editing tools constituting the gene function inhibitors vary depending on the type of genome editing method. For example, in the case of the TALEN method, a set of Left / Right-TALE nucleases including a TALE domain that recognizes and binds to the target base sequence of mutation introduction on the target nanosP gene and a FokI nuclease domain, or an expression vector containing a synthetic RNA encoding the nucleases or a gene encoding the nucleases, and donor DNA that is knocked in to the nanosP gene as necessary to destroy the nanosP gene, are included as constituent tools. In addition, for example, in the case of the CRISPR / Cas9 method, a set of sgRNA that recognizes and binds to the target base sequence of mutation introduction on the target nanosP gene and a Cas9 protein, or a synthetic RNA encoding the nucleases or a gene encoding the nucleases, and donor DNA that is knocked in to the nanosP gene as necessary to destroy the nanosP gene are included as constituent tools. These tools may be support tools commercially available from each life science manufacturer to perform gene knockout using the TALEN method or the CRISPR / Cas9 method.

[0060] 3-2-2.Other ingredients The sterilizing agent for lepidopteran insects of the present invention may contain, in addition to the active ingredient, a solvent or carrier acceptable in the field of entomology, as necessary. "Acceptable in the field of entomology" means that it is commonly used in the field of entomology and is harmless or has little effect on the lepidopteran insects to which it is administered.

[0061] Examples of the solvent include water or an aqueous solution, or an organic solvent acceptable to lepidopteran insects. Examples of the aqueous solution include a buffer (such as a phosphate buffer or a sodium acetate buffer), a physiological saline solution, and an isotonic solution.

[0062] Examples of the carrier include glucose, D-sorbitol, D-mannose, D-mannitol, sodium chloride, and other low-concentration nonionic surfactants, polyoxyethylene sorbitan fatty acid esters, and the like.

[0063] 3-3. Method of administration The sterilizing agent of the present invention may be administered to lepidopteran insects in a manner similar to the method for introducing each of the gene expression inhibitors described in the first embodiment. EXAMPLES

[0064] <Example 1> (Objective) To verify the sterility and sterilization efficiency of sterile lepidopteran insects obtained by the method for producing sterile lepidopteran insects of the present invention.

[0065] (method) (1) Material The host lepidopteran insect used was the silkworm (pnd strain) that had been serially reared at the National Agriculture and Food Research Organization (NARO, Japan). (2) Creation of nanosP gene knockout silkworms The sterile silkworm of the present invention, the nanosP knockout silkworm, was produced by two methods using the TALEN technique.

[0066] The first method is a method of inducing a frameshift by targeting the N-terminal side of the nanosP coding region. The TALEN recognition sequences on the N-terminal side were 1F consisting of the base sequence shown in SEQ ID NO: 4 and 1R consisting of the base sequence shown in SEQ ID NO: 5. Note that 1R (SEQ ID NO: 5) is the sequence of the antisense strand of nanosP. The same applies to 2R (SEQ ID NO: 7) described later.

[0067] The second method is a method in which targets are set on the N-terminus and C-terminus of the nanosP coding region, respectively, to generate a large deletion within the coding region. The TALEN recognition sequences on the N-terminus of the second method were SEQ ID NOs: 4 and 5, which are the same as those in the first method. On the other hand, the TALEN recognition sequences on the C-terminus were 2F consisting of the base sequence shown in SEQ ID NO: 6 and 2R consisting of the base sequence shown in SEQ ID NO: 7.

[0068] Plasmids containing TALEN constructs corresponding to the target sequences on the N-terminus and C-terminus of the nanosP coding region were produced by recombinant E. coli according to a conventional method. Each TALEN construct contains a T7 promoter upstream of the TALEN coding region, a silkworm actin3 gene 5'UTR, and an SV40 terminator and polyA sequence downstream, and can express mRNAs capable of producing TALEN proteins in silkworm bodies (cells), i.e., 1F mRNA, 1R mRNA, 2F mRNA, and 2R mRNA, by an in vitro T7 synthesis system. After cleaving each of the prepared plasmids downstream of the polyA sequence, in vitro synthesis of mRNA was performed using mMESSAGE mMACHINE T7 kit (Ambion) according to the attached protocol. Each of the obtained mRNAs was suspended in 5 mM phosphate buffer and adjusted to a final concentration of 0.2 μg / μL to obtain a suspension. In the first method, a suspension containing two types of mRNA, 1F mRNA and 1R mRNA, was obtained. On the other hand, in the second method, a suspension containing four types of mRNA, 1F mRNA, 1R mRNA, 2F mRNA, and 2R mRNA, was obtained.

[0069] (3) Injection into silkworm eggs NanosP knockout silkworms were produced by injecting the in vitro synthesized mRNA into fertilized eggs. For the injection, eggs were used that had been laid on egg-laying paper for 1 hour after female silkworms had been refrigerated at 4°C after mating and returned to room temperature. Between 2 and 4 hours after egg-laying, a glass micropipette was used to microinject the prepared suspensions at several to several tens of nL per egg into the ventral side of the posterior region of each egg. The ventral posterior region of the egg is the region where germline cells will appear in the future, and it was expected that injection into this region would increase the probability of gene editing occurring in germline cells. After the injection, the injection hole was sealed with instant adhesive (Turilon instant adhesive multi-purpose, fast-hardening type: Alpha Shoji). The egg-laying paper was then quickly transferred to a petri dish and covered. Next, to keep the environment humid, a kitchen towel moistened with water was laid inside the tight box, the petri dish was placed on top of it, and the tight box was covered. The tight boxes were incubated at 25–28°C for approximately 10 days until the eggs hatched.

[0070] (4) Confirmation of genome-edited silkworms After hatching, the larvae were reared in a rearing room at 28°C on artificial diet (Silkmate original species 1-3 instars S, Nosan Corporation). The artificial diet was changed as necessary.

[0071] The adults obtained after injection were mated with wild-type adults (pnd strain) and allowed to lay eggs. DNA was extracted from several dozen of the eggs obtained using standard methods, and the presence or absence of editing of the nanosP gene was confirmed. The presence or absence of editing was investigated using the PCR method.

[0072] In the case of the first method, PCR was performed using the extracted DNA as a template, using a primer set consisting of SEQ ID NO: 8 and SEQ ID NO: 9 designed to sandwich the editing site. After PCR, the amplified product was resolved by gel electrophoresis, and the number of bands of the locus containing the nanosP gene was confirmed. If the editing of the nanosP gene is successful, the prepared DNA may include an edited locus and a wild locus with respect to the locus containing the nanosP gene. In this case, even if there is almost no difference in the length of the amplified products of both loci, a heteroduplex is actually formed between the amplified products of the wild locus and the edited locus, which is reflected as a difference in mobility in the gel, and multiple bands are detected. On the other hand, if the editing of the nanosP gene has failed, the prepared DNA may include only the wild locus with respect to the locus containing the nanosP gene. Therefore, only one band is detected by electrophoresis.

[0073] In the case of the second method, PCR was performed using the extracted DNA as a template, using a primer set consisting of SEQ ID NOs: 8 and 10 designed to sandwich two editing sites at once. After PCR, the amplified products were separated by gel electrophoresis, and the number of band patterns of the locus containing the nanosP gene was confirmed. If the editing of the nanosP gene is successful, a relatively large deletion occurs in the locus containing the nanosP gene, and this can be confirmed by the presence of a short band on the gel.

[0074] Since edited bands were observed in both the first and second methods, the remaining eggs were hatched and raised in the hope that they would contain edited individuals.

[0075] (5) Confirmation of the phenotype and reproductive ability of the adult reproductive organs of knockout silkworms DNA was extracted from some of the amputated legs of the adult insects that had been reared, and individuals in which gene editing had occurred were selected.

[0076] The nucleotide sequence of the editing site in the nanosP-edited line obtained by the first method is shown in SEQ ID NO: 11, and the nucleotide sequence corresponding to the editing site in the wild type is shown in SEQ ID NO: 12. In this line, a 4-base deletion consisting of CCCC shown in SEQ ID NO: 13 and an insertion of a 20-base sequence consisting of ATATGATAGAGTCTATCTAT shown in SEQ ID NO: 14 were observed in the editing site, which was determined to cause a frameshift downstream and inhibit the production of the nanosP protein.

[0077] The nanosP-edited line obtained by the second method had a deletion of approximately 1,580 bases at the editing site, resulting in the loss of most of the nanosP ORF, which was believed to result in the failure to produce a functional nanosP protein.

[0078] We then analyzed the phenotype of the nanosP knockout individuals. Phenotype analysis was performed on the nanosP knockout individuals, focusing on development, growth, reproductive organ formation, and reproductive ability. The nanosP knockout individuals were obtained by crossing heterozygous individuals carrying the nanosP gene-edited allele with each other to homozygize them.

[0079] To investigate the formation of reproductive organs, the researchers removed ovaries from unmated nanosP knockout female adults that had emerged, and observed the egg cells in the ovaries. In silkworms, most of the egg cells in the ovaries are mature at the time of female emergence. They also removed reproductive organs from unmated nanosP knockout male adults that had emerged, and observed the morphology of the testes.

[0080] In addition, nanosP knockout males were mated with wild-type females (pnd strain) to lay eggs. After mating, the eggs obtained from the females were confirmed to be fertilized by the addition of pigmented eggs (colored eggs that develop several days after egg laying), and the reproductive ability of the males was examined.

[0081] (result) The results are shown in Figures 1 to 3. In each figure, nanosP knockout and wild-type adult worms are compared. Figure 1 shows the ovarian phenotype in female adult worms, Figure 2 shows the reproductive tract phenotype in male adult worms, and Figure 3 shows the reproductive ability in male adult worms.

[0082] (Ovarian phenotype) As shown in Fig. 1A, in the ovaries of wild-type adult females, most of the egg cells had developed into granular mature eggs (arrows in the figure indicate several examples). In contrast, as shown in Fig. 1B, in the ovaries of nanosP knockout adult females, there were almost no developed egg cells, and only a few slightly developed egg cells (arrows) were occasionally observed. This result suggests that mature eggs are not formed in nanosP knockout individuals.

[0083] (male reproductive organ phenotype) As shown in Fig. 2A, in the reproductive tract of wild-type adult males, a pair of testes was observed at the tip of the vas deferens, as indicated by the arrows. In contrast, as shown in Fig. 2B, in the reproductive tract of nanosP knockout adult males, no testes were observed at the tip of the vas deferens, and the testes themselves were absent. This result suggests that testes are not formed in nanosP knockout individuals.

[0084] (fertility) As shown in Fig. 3B, the eggs laid by wild-type females after mating with nanosP knockout males were low in number and all of them were non-inbred. The ability of these females to produce functional fertilized eggs was confirmed by the fact that most of the eggs laid after mating with nanosP knockout individuals and further mating with wild-type males were inbred (Fig. 3A). These results suggest that the nanosP knockout males are completely deficient in reproductive ability.

[0085] As shown in Figures 1 to 3, it was demonstrated that nanosP alone can induce sterility in lepidopteran insects by inhibiting its expression.

[0086] (Other phenotypes) Throughout the breeding process, observations were made of phenotypes other than germline cells (emergence, growth, morphology, etc.), but no notable phenotypic differences were found other than sterility. In other words, the mutants grew, molted, metamorphosed, produced cocoons normally, and became adults, with no changes in mating behavior. Furthermore, no differences were observed in the size of the larvae or adults compared to the wild type.

Claims

1. A method for producing sterile silkworms, comprising a step of inhibiting the function of the nanosP gene using a gene knockout method.

2. The method of claim 1 , wherein the gene knockout method is a genome editing method.

3. The method according to claim 1 or 2, wherein the nanosP gene comprises a base sequence encoding a nanosP protein having an amino acid sequence shown in (a) to (c) below: (a) the amino acid sequence shown in SEQ ID NO:1; (b) an amino acid sequence in which one or more amino acids have been deleted, substituted or added in the amino acid sequence shown in SEQ ID NO: 1; or (c) an amino acid sequence having 90% or more amino acid identity to the amino acid sequence shown in SEQ ID NO:1;

4. The method according to claim 3, wherein the nanosP gene consists of the base sequence shown in SEQ ID NO:

2.

5. Sterile silkworms in which the function of the nanosP gene was inhibited by gene knockout.

6. The sterile silkworm of claim 5, wherein the gene knockout method is a genome editing method.

7. A silkworm sterilizing agent containing a gene function inhibitor that inhibits the function of the nanosP gene as an active ingredient, The silkworm sterilization agent, wherein the gene function inhibitor comprises a genome editing tool that specifically disrupts the nanosP gene on the host genome.

Images