Lipids containing docosapentaenoic acid

Abstract

Provided are extracted plant or microbial lipids containing docosapentaenoic acid (DPA), and methods for producing the extracted lipids. [Solution] An extracted plant or microbial lipid is provided, comprising fatty acids in an esterified form, the fatty acids including omega-6 fatty acids including oleic acid, palmitic acid, linoleic acid (LA), omega-3 fatty acids including alpha-linolenic acid (ALA), and docosapentaenoic acid (DPA), and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%.

Description

[Technical Field]

[0001] The present invention relates to a lipid containing docosapentaenoic acid obtained from plant cells or microbial cells, and and methods for producing and using said lipids. [Background technology]

[0002] Omega-3 long-chain polyunsaturated fatty acids (LC-PUFAs) are important for human and animal health. These fatty acids are now widely recognized as compounds. Linoleic acid (LA, 18:2ω6), both of which are considered essential dietary fatty acids Alternatively, it can be obtained by conversion of alpha-linolenic acid (ALA, 18:3ω3) fatty acid. Humans and many other vertebrates are unable to convert LA or ALA obtained from plant sources to C22. However, this conversion reaction occurs very slowly. Instead of the 4:1 or less ratio of omega-6:omega-3 fatty acids that is commonly used, at least 90% polyvalent Eating an unbalanced diet with omega-6 polyunsaturated fatty acids (PUFA) (Trautwein, 2001). Eicosapentaenoic acid (EPA) for humans , 20:5ω3), docosapentaenoic acid (DPA), and docosahexaenoic acid (DHA, Most readily available dietary sources of LC-PUFAs, such as 22:6ω3, come from fish or fish oil. Therefore, health experts recommend that the human diet contain fish containing significant levels of LC-PUFAs. Increasingly, fish-derived LC-PUFA oils are being used in foods containing e.g. It is used in foods and infant formula. However, the decline of the global and national fishing industry Because of this, there is a need for alternative sources of these beneficial health-promoting oils.

[0003] In contrast to animals, flowering plants produce polyunsaturated fatty acids with chains longer than 18 carbons. In particular, crops and horticultural plants, along with other angiosperms, do not have the ability to synthesize 5-ALA. The derived EPA, docosapentaenoic acid (DPA, 22:5ω3) and DHA They lack the enzymes necessary to synthesize long-chain omega-3 fatty acids. Galls produce substantial amounts of LC-PUFAs and therefore provide an alternative source of these compounds. It is the engineering of the crops we provide. Summary of the Invention

[0004] LC-PUFA biosynthetic pathway The biosynthesis of LC-PUFAs in organisms such as microalgae, mosses, and fungi usually involves a series of acids. The EPA-producing enzymes in these organisms are desaturated and elongated (Figure 1). The most common pathways are Δ6-desaturation, Δ6-elongation, and Δ5-desaturation. The most common pathway is the Δ6-desaturation pathway, while the less common pathway is Δ9-elongation, Δ8-desaturation, and Δ5-desaturation (Δ9-desaturation pathway) These successive desaturation and elongation reactions are shown in the upper left part of Figure 1. The resulting omega-6 fatty acid substrate LA(ω6) is shown in the formula or EPA in the lower right of Figure 1. It can start with either the ω3 substrate ALA(ω3). If the initial Δ6-desaturation reaction is If the LC-PUFA product of the series of three enzymes occurs on the ω-6 substrate LA, it is likely that the ω-6 lipid LC-PUFA synthesis is arachidonic acid (ARA, 20:4ω6). The conversion of EPA to ω3-desaturase is shown as the Δ17-desaturase step in Figure 1. ω3-desaturase can be used to convert ω6 fatty acids to ω3 fatty acids. Several members of the Milli family can act on a variety of substrates ranging from LA to ARA Plant ω3-desaturases often perform the Δ15-desaturation reaction of LA to ALA. whereas fungal and yeast ω3-desaturases specifically catalyze the conversion of ARA to E It may be specific for the Δ17-desaturation reaction to PA (Pereira et al., 200 4a; Zank et al., 2005). Converts a wide range of ω6 substrates to their corresponding ω3 products. Several reports suggest that there may be nonspecific ω3-desaturases that can (Zhang et al., 2008).

[0005] The conversion of EPA to DHA in these organisms occurs via a Δ5-elongation reaction of EPA. This produces DPA, which is then converted to DHA by a Δ4-desaturation reaction (Figure 1). In contrast, mammals catalyze DPA DH through three separate reactions independent of Δ4-desaturase. A is converted to the so-called "Sprecher" pathway (Sprecher et al., 1995).

[0006] Plants, mosses, microalgae, and nematodes (Caenorhabditis elegans The front-end desaturases commonly found in lower animals, such as phosphatidylcholinesterases (PDEs), are It predominantly accepts phosphorus (PC) substrates at the sn-2 position and esterified fatty acid substrates. These desaturases are involved in the synthesis of acyl-PC, lipid-linked, and front-end desaturases. In contrast, the frontal lobes of higher animals are known as the frontal lobes (Domergue et al., 2003). Generally, acetyl-CoA desaturases prefer acyl-C, where the fatty acid substrate is bound to CoA rather than PC. Some microalgae, such as Desaturas, accept oA as a substrate (Domergue et al., 2005). One plant desaturase and one plant desaturase use fatty acid substrates esterified with CoA. It is known that (Table 2).

[0007] Each PUFA elongation reaction consists of four steps catalyzed by a multicomponent protein complex: As a result of the condensation reaction, 2C units are added from malonyl-CoA to the fatty acid, forming β-ketoacids. This is then reduced by NADPH and then dehydrated. This intermediate is finally reduced twice to give the elongated fatty acid. The condensation steps of these four reactions are generally substrate specific, while the other steps are not. In fact, the natural plant elongation mechanism is thought to be a natural mechanism for the elongation of non-natural PUFA substrates. Although the efficiency of the natural plant elongation machinery may be low, PUFA-specific condensing enzymes (usually called "elongation enzymes") This means that the PUFA provided by the introduction of the enzyme can be elongated. In 2007, the identification and characterization of yeast elongation cycle dehydratases was reported. expressed (Denic and Weissman, 2007).

[0008] While elongation reactions occur on substrates in the acyl-CoA pool, in plants, mosses, and PUFA desaturation in plants and microalgae preferentially targets fatty acid substrates in the acyl-PC pool. The transfer of acyl-CoA fatty acids to the PC carrier occurs naturally as a result of lysophosphatidylcholine While the conversion of acyl-PC molecules occurs via phospholipid acyltransferase (LPCAT), The transfer of fatty acids to the CoA carrier occurs via phospholipase (PLA) (Singh et al. , 2005).

[0009] Engineering the production of LC-PUFAs Most LC-PUFA metabolic engineering has been carried out using the aerobic Δ6-desaturation / elongation pathway. In tobacco, the biosynthesis of gamma-linolenic acid (GLA, 18:3ω6) is initiated by cyanobacteria. Cyanobacterium Synechocystis s) was first reported in 1996 (Reddy and T Homas, 1996). More recently, GLA has been found in safflower (GLA 73% in seed oil). %, WO2006 / 127789) and soybean (GLA 28%; Sato et al., 2004) The production of LC-PUFAs such as EPA and DHA has been shown to reduce the associated The number of saturation and elongation steps makes the engineering more complex. A production was first reported by Qi et al. (2004) and was reported in Isochrysis galbana (Iso chrysis galbana) Δ9-elongase, Euglena gracilis (E Δ8-desaturase from Mortierella gracilis and Mortierella alpi A gene encoding Δ5-desaturase from Mortierella alpina The offspring were introduced into Arabidopsis with yields of up to 3% EPA. This work was followed by Abbadi et al. (2004), who also found that Physcomitrella patens (Physcomitrella spp.) Δ6-desaturase and Δ6-elongase of mitrella patens Phaeodactylum tricornutum Using the gene encoding the Δ5-desaturase of the α-isopropyl cellulose (α-isopropyl cellulose), EPA was increased to 0.8% in flaxseed. reported the production of

[0010] The first report of DHA production described the production of 3% DHA in soybean germ (W O04 / 017467, but not the seeds, rolegnia diclina) Δ6-desaturase, Mortierella alpina (Mortierella alpina) Δ6-desaturase, Mortierella alpina Lupin (Mortierella alpina) Δ5-desaturase, saprolegni Saprolegnia diclina Δ4-desaturase, Sa Saprolegnia diclina Δ17-Desachi Durase, Mortierella alpina Δ6- Elongase and Pavlova lutheri Δ5-elongase The largest EPA in the embryo was also produced by the introduction of a gene encoding DHA. The level was 19.6%, indicating that the conversion efficiency of EPA to DHA was small (WO This discovery was made in the zebrafish (Danio rerio) Δ5 / 6-desaturase, Caenorhabditis elegans Δ 6-elongase, and Pavlova salina Δ5-elongase Arabidopsis The production of EPA 3% and DHA 0.5% in the sucrose solution was reported by Robert et al. (200 5) and in 2005, Wu et al. Pythium irregulare Δ6-elongase, slough Thraustochytrid Δ5-desaturase, Physcomitrella patens Physcomitrella patens Δ6-elongase, Kinsen Calendula officianalis Δ12-desaturase, slough Thraustochytrid Δ5-elongase, Phytophthora Infestans (Phytophthora infestans) Δ17-Desachi Durase, rainbow trout (Oncorhyncus mykiss) LC-PUFA elongation Δ4-desaturase, Thraustochytrid Δ4-desaturase and Thraustochytrid LPCAT were used to In Brassica juncea, ARA 25%, EPA 15%, and DHA 1.5% (Wu et al., 2005). A review of attempts to produce oilseed crops with 0) and Ruiz-Lopez et al. (2012). As shown by Pez et al. (2012), DHA production in transgenic plants However, results to date have not come close to the levels seen with fish oil. Recently, Petrie et al. (2012) reported that Arabidopsis thaliana reported that approximately 15% of DHA is produced in the seeds of P. haliana, and published in WO2013 / 18 5184 reported the production of specific seed oils with between 7% and 20% DHA. However, there have been no reports of producing vegetable oils with more than 20% DHA.

[0011] There have been no reports of DPA production in recombinant cells to significant levels without the concomitant production of DHA. Indeed, the present inventors have not found any publicly available method for producing DPA in recombinant cells without DHA production. I don't know the inspiration or motivation behind it.

[0012] Therefore, LC-PUFAs in recombinant cells, especially those like DPA in the seeds of oilseed plants, There remains a need for more efficient production.

[0013] Summary of the Invention Most organisms are unable to produce oils with more than 1-2% DPA. Therefore, large-scale production of DPA from natural sources is an option, if at all. The inventors have found that the DPA levels are significantly higher than those of natural sources. Methods and plants for producing lipids have been identified.

[0014] In a first aspect, the present invention provides a method for the preparation of a soluble fiber comprising the steps of: (a) preparing a soluble fiber comprising: a) a fatty acid in esterified form; b) preparing a soluble fiber comprising: oleic acid; c) preparing a soluble fiber comprising palmitic acid; c) preparing a soluble fiber comprising palmitic acid; d) preparing a soluble fiber comprising palmitic acid; e) preparing a soluble fiber comprising palmitic acid; f ... omega-6 fatty acids, including linoleic acid (LA), and omega-3 fatty acids, including alpha-linolenic acid (ALA) and optionally stearidonic acid (SDA), eicosapentaenoic acid (EPA) , docosapentaenoic acid (DPA) and eicosatetraenoic acid (ETA) and wherein the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 35%. The present invention provides an extracted lipid, preferably an extracted plant lipid or an extracted microbial lipid, which is in this embodiment. In such embodiments, the level of DPA in the total fatty acid content of the extracted lipid is about 7%. ,approximately 8%,approximately 9%,approximately 10%,approximately 12%,approximately 15%,approximately 18%,approximately 20%,approximately 22%,approximately 24%, approximately 26%, approximately 28%, approximately 30%, between approximately 7% and approximately 28%, and between approximately 7% and approximately 25% Between about 10% and 35%, Between about 10% and 30%, Between about 10% and 25% , between about 10% and about 22%, between about 14% and 35%, between about 16% and 35%, about 1 Between 6% and approximately 30%, between approximately 16% and approximately 25%, or between approximately 16% and approximately 22% be.

[0015] In an embodiment of the above aspect, DHA is less than 2% or 0% of the total fatty acid content of the extracted lipid. present at a level of less than 0.5%, and more preferably absent from the total fatty acid content of the lipid .

[0016] In another aspect, the present invention provides an esterified form comprising docosapentaenoic acid (DPA). and providing an extracted lipid, preferably an extracted plant lipid or an extracted microbial lipid, containing fatty acids of the present invention. At least 35% of DPA esterified in the form of triacylglycerol (TAG) In an embodiment, the extracted lipid comprises: (i) a lipid esterified at the sn-2 position of the TAG; omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha-linolenic acid (A omega-3 fatty acids, including one or more or all of the omega-3 fatty acids, including stearidonic acid (S LA), and optionally stearidonic acid (S DA), eicosapentaenoic acid (EPA), and one of eicosatetraenoic acid (ETA) (ii) may contain at least about 40%, at least about 45%, at least about 48%, between 35% and about 60%, or between 35% and about 50% triacylglycerol DPA esterified in the form of cerol (TAG) is esterified at the sn-2 position of the TAG. and (iii) the level of DPA in the total fatty acid content of the extracted lipid. between about 1% and 35%, or between about 7% and 35%, or between about 20.1% and 35% The present invention may be further characterized by one or more or all of the following: In the present study, the level of DPA in the total fatty acid content of the extracted lipid was about 7%, about 8%, about 9%. , about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, about 26% , about 28%, about 30%, between about 7% and about 28%, between about 7% and about 25%, about 10% Between about 10% and about 35%, Between about 10% and about 30%, Between about 10% and about 25%, Between about 10% and about Between 22%, Between about 14% and 35%, Between about 16% and 35%, Between about 16% and about 30% Between about 16% and about 25%, or between about 16% and about 22%. In embodiments, the extracted lipids comprise (i) and (ii), (i) and (iii), or (ii). and (iii), more preferably characterized by all of (i), (ii) and (iii). Preferably, the extracted lipids have a total fat content of between about 2% and 16%. Palmitic acid level in the acid content and, if present, the extract is less than 1% Further characterization was performed by the level of myristic acid (C14:0) in the total fatty acid content of the lipids. It can be done.

[0017] Embodiments of each of the above aspects are described in further detail below. Any feature of the described embodiments that is broader than the corresponding feature of the above aspect is also included in the This does not apply to the following aspects:

[0018] In embodiments, the extracted lipids have the following characteristics: i) the level of palmitic acid in the total fatty acid content of the extracted lipid is between about 2% and 18% between about 2% and 16%, between about 2% and 15%, or between about 3% and 10% To do so, ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids less than 6%, less than 3%, less than 2%, less than 1%, or about 0.1%; iii) the level of oleic acid in the total fatty acid content of the extracted lipid is from about 1% to about 3% Between 0%, between about 3% and about 30%, between about 6% and about 30%, between about 1% and about 20% , between about 30% and about 60%, about 45% to about 60%, about 30%, or about 15% to about 3 0% iv) The level of linoleic acid (LA) in the total fatty acid content of the extracted lipids is between about 4% and between about 4% and about 35%, between about 4% and about 20%, between about 4% and about 17%, or between about 5% and about Between about 10% v) the level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is about 4 Between about 7% and about 40%, Between about 10% and about 35%, Between about 20% and about between about 35%, between about 4% and about 16%, or between about 2% and about 16%, vi) The level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted lipid is 4 %, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, 0.05% to about 7% Between 0.05% and 4%, between 0.05% and about 3%, or between 0.05% and about 2% % between vii) The level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids Less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, less than about 0. Between 0.05% and approximately 7%, Between approximately 0.05% and approximately 6%, Between approximately 0.05% and approximately 4%, Approximately Between 0.05% and about 3%, between about 0.05% and about 10%, or between about 0.05% and about Between 2% viii) The level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipid The bell is less than about 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0.5%, and less than 0.05%. Between % and approximately 6%, Between 0.05% and approximately 5%, Between 0.05% and approximately 4%, 0.05% between about 3% and about 3%, or between 0.05% and about 2%, ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipids is less than 4%, less than about 2%, less than about 1%, between 0.05% and 4%, and between 0.05% and 3% between 0.05% and about 2%, or between 0.05% and about 1%; x) The level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipid , between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10% , between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2% Between xi) The lipid contains ω6-docosapentaenoic acid (22:5) in its fatty acid content. Δ4,7 ,10,13,16 ) xii) The lipid contains less than 0.1% of ω6-docosapentaenoic acid (ω6-docosapentaenoic acid) in its fatty acid content. 22:5 Δ4,7,10,13,16 ) xiii) the lipid has less than 0.1% of one or more or all SDs in its fatty acid content A, EPA and ETA, xiv) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is from about 4% to about 2% between about 5%, between about 4% and about 20%, between about 6% and about 20%, or between about 6% and about 12% % between xv) the total monounsaturated fatty acid level in the total fatty acid content of the extracted lipid is between about 4% and Between about 40%, between about 4% and about 35%, between about 8% and about 25%, and between 8% and about 22% between about 15% and about 40% or between about 15% and about 35%; xvi) the total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipid is about 20% Between 30% and 75%, Between 50% and 75%, About 60%, About 6 5%, about 70%, about 75%, or between about 60% and about 75%; xvii) the total omega-6 fatty acid level in the total fatty acid content of the extracted lipid is between about 35% and Between about 50%, between about 20% and about 35%, between about 6% and about 20%, less than 20%, about 1 less than 6%, less than about 10%, between about 1% and about 16%, between about 2% and about 10%, or about Between 4% and approximately 10% xviii) The level of novel ω-6 fatty acids in the total fatty acid content of the extracted lipid is less than about 10% Full, Less than about 8%, Less than about 6%, Less than 4%, Between about 1% and about 20%, About 1% to about 10% between 0.5% and about 8%, or between 0.5% and 4%; xix) the total omega-3 fatty acid level in the total fatty acid content of the extracted lipid is between 36% and about 6% Between 5%, between 36% and about 70%, between 40% and about 60%, about 30% to about 60% Between about 35% and about 60%, Between 40% and about 65%, Between about 30% and about 65%, Between about 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 6 0%, about 65% or about 70%; xx) the level of new omega-3 fatty acids in the total fatty acid content of the extracted lipids is between 21% and about 45% Between 21% and approximately 35%, between approximately 23% and approximately 35%, between approximately 25% and approximately 35% Between about 27% and about 35%, Between about 23% and about 25%, About 27%, About 30%, About 3 5%, about 40% or about 45%; xxi) the ratio of total ω6 fatty acids to total ω3 fatty acids in the total fatty acid content of the extracted lipid is about Between 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, about 0.5 Less than 0, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, about 1.0 less than, less than about 0.1, about 0.10 to about 0.4, or about 0.2; xxii) The ratio of new ω6 fatty acids to new ω3 fatty acids in the total fatty acid content of the extracted lipid is Between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, about 0 Between 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, about 0.20 less than about 0.15, about 0.02, about 0.05, about 0.1, about 0.2, or about 1.0 Something, xxiii) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 80%, between about 60% and about 98%, between about 70% and about 95%, or about 75% The conversion efficiency of oleic acid to LA by Δ12-desaturase was between 100% and approximately 90%. Based on, xxiv) the fatty acid composition of the lipid is at least about 30%, at least about 40%, at least about 10% about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, Between about 35% and about 60%, or between about 50% and about 70%, of the Δ6-desaturase Based on the conversion efficiency of 5-ALA to SDA by xxv) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 80% about 75%, between about 60% and about 95%, between about 70% and about 88%, or about 75% Based on the efficiency of conversion of SDA to ETA acid by Δ6-elongase, which ranged from 85% to approximately 85% and, xxvi) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least About 75%, between about 60% and about 99%, between about 70% and about 99%, or about 75% Based on the efficiency of ETA to EPA conversion by Δ5-desaturase between about 98% and about 98% thing, xxvii) the fatty acid composition of the lipid is at least about 80%, at least about 85%, at least about 86% At least about 90%, between about 50% and about 99%, between about 85% and about 99%, between about 50% and Between about 95% or between about 85% and about 95% of EPA by Δ5-elongase Based on conversion efficiency to DPA, xxviii) the fatty acid composition of the lipid is at least about 10%, at least about 15%, at least about 16% at least about 20%, at least about 25%, about 20%, about 25%, about 30%, about 10% to Between about 50%, between about 10% and about 30%, between about 10% and about 25%, or about 20% Based on the conversion efficiency of oleic acid to DPA between about 10% and about 30% xxix) the fatty acid composition of the lipid is at least about 15%, at least about 20%, at least about 15% Both are about 22%, at least about 25%, at least about 30%, at least about 40%, and about 25 %, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, Conversion of LA to DPA between approximately 20% and approximately 40%, or between approximately 20% and approximately 30% Efficiency-based xxx) the fatty acid composition of the lipid is at least about 17%, at least about 22%, at least about 18% Also about 24%, at least about 30%, about 30%, about 35%, about 40%, about 45%, about 50% , about 55%, about 60%, between about 22% and about 70%, between about 17% and about 55%, about 22 % to about 40%, or about 24% to about 40% ALA to DPA conversion efficiency Based on xxxi) The total fatty acids in the extracted lipids are less than 1.5% C20:1, less than 1% C20 :1 or about 1% C20:1; xxxii) the triacylglycerol (TAG) content of the lipid is at least about 70 %, at least about 80%, at least about 90%, at least about 95%, about 70% to about 9 between 9% or between about 90% and about 99%; xxxiii) the lipid comprises diacylglycerol (DAG), preferably DAG includes the DPA, xxxiv) the lipid is less than about 10%, less than about 5%, less than about 1%, or less than about 0.001% containing, or consisting essentially of, between about 5% and about 5% free (non-esterified) fatty acids and / or phospholipids does not specifically include it, xxxv) at least 70% of the DPA esterified in the form of TAG, at least 7 2% or at least 80% are at the sn-1 or sn-3 position of the TAG, xxxvi) The most abundant DPA-containing TAG species in the lipid is DPA / 18:3 / 18:3 (TAG 58:12), and the lipid is avian DPA TAG (TAG 66:18 ), and xxxvii) The level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8% %, approx. 9%, approx. 10%, approx. 12%, approx. 15%, approx. 18%, approx. 20%, approx. 22%, approx. 24% , about 26%, about 28%, about 31%, between about 7% and about 31%, between about 7% and about 28%, Between about 10% and about 35%, Between about 10% and about 30%, Between about 10% and about 25%, About Between 10% and approximately 22%, between approximately 14% and approximately 35%, between approximately 16% and approximately 35%, and approximately 1 Between 6% and approximately 30%, between approximately 16% and approximately 25%, or between approximately 16% and approximately 22% and optionally the DHA level is less than 0.5% of the total fatty acid content of the extracted lipid. thing It has one or more of the following.

[0019] In another embodiment, the extracted lipids have the following characteristics: i) the level of palmitic acid in the total fatty acid content of the extracted plant lipids is between 2% and 15% % between ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted plant lipids is approximately 0.1%. iii) the level of oleic acid in the total fatty acid content of the extracted plant lipids is between 1% and 3% 0% iv) The level of linoleic acid (LA) in the total fatty acid content of the extracted plant lipids is 4% between 20% and v) the level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted plant lipids is be between 4% and 40%; vi) The level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted plant lipids , be between 0.05% and 7%; vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted plant lipids is between 0.05% and 10%, viii) Eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted plant lipids levels should be less than 6%; ix) The level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted plant lipids The bell is less than 4%. x) the extracted plant lipids have less than 0.1% ω6-docosapentaenoic acid in their fatty acid content; Acid (22:5 Δ4,7,10,13,16 ) xi) The level of new omega-6 fatty acids in the total fatty acid content of the extracted plant lipid is less than 10%. That is, xii) The ratio of total omega-6 fatty acids to total omega-3 fatty acids in the fatty acid content of the extracted plant lipids is 1. be between 0 and 3.0 or between 0.1 and 1, xiii) The ratio of new ω6 fatty acids to new ω3 fatty acids in the fatty acid content of the extracted plant lipids is 1 Between 0.0 and 3.0, or between 0.02 and 0.1, or between 0.1 and 1 and, xiv) The fatty acid composition of the extracted plant lipids is at least 10% oleic acid to DPA Based on the conversion efficiency of xv) The fatty acid composition of the extracted plant lipids has a conversion efficiency of at least 15% of LA to DPA. Based on the rate, xvi) The fatty acid composition of the extracted plant lipids contains at least 17% of ALA converted to DPA. Based on conversion efficiency, xvii) the total fatty acids in the extracted plant lipids are less than 1.5% C20:1; and Beauty xviii) The triacylglycerol (TAG) content in the extracted plant lipids is at least 70% and may be characterized by one or more of the following features: xix) The extracted plant lipids contain diacylglycerol (DAG) containing DPA. , xx) The extracted plant lipids contain less than 10% free (non-esterified) fatty acids and / or phosphorus. containing or essentially free of lipids; xxi) At least 70% of the DPA esterified in the form of TAG is s of said TAG being the n-1 or sn-3 position; xxii) The most abundant DPA-containing TAG species in the extracted plant lipids is DPA / 18:3 / 18:3 (TAG58:12), and xxiii) The extracted plant lipids contain tri-DPA TAG (TAG66:18). It has one or more of the following.

[0020] In an embodiment, the total fatty acid content of the extracted plant lipids is preferably 0.1 to 1.0% by weight of eicosapentaenoic acid (EP). A) levels are between 0.05% and 10%.

[0021] In a further embodiment, the level of DHA in the total fatty acid content of the extracted plant lipids is: Less than 2%, preferably less than 1%, or between 0.1% and 2%, more preferably undetectable Preferably, the plant, or a part thereof such as a seed, or the microbial cell is a Δ Δ4-desaturase-encoding polynucleotides or In another embodiment, the extracted lipid is in the form of an oil. at least about 90% by weight, at least about 95% by weight, at least about 98% by weight , or between about 95% and about 98% by weight of the oil is lipid.

[0022] Preferably, the extracted lipids are lipids from Brassica seed oil or Camelina sativa. It is a lipid from the seed oil of Camelina sativa.

[0023] In a preferred embodiment of the first aspect, a lipid or oil, preferably a seed oil, is used. More preferably, the seed oil of Brassica napus or Camelina sativa is The total fatty acid content of the lipid or oil has the following characteristics: DPA level is about 7 % to 30% or about 7% to 35%, and palmitic acid levels are about 2% to The myristic acid level is less than 1% and the oleic acid level is between about 1% and about 16%. Between about 1% and about 30%, LA levels between about 4% and 35%, and ALA The total saturated fatty acid level in the total fatty acid content of the extracted lipids is about 4% to about 25%. The ratio of total ω6 fatty acids to total ω3 fatty acids in the fatty acid content of the extracted lipids was between 0. The triacylglycerol (TAG) content of the lipids ranges from about 0.5 to about 3.0. At least about 70%, and optionally the lipid may be essentially free of cholesterol. and / or the lipid comprises tri-DPA TAG (TAG66:15). Alternatively, the lipid or oil, preferably a seed oil, may have one or more or all of the following characteristics: Further, at least 70% of the DPA is in the form of triacylglycerol (TAG). Esterified at sn-1 or sn-3 positions, ALA accounts for 4% of the total fatty acid content and / or the GLA level is between 100 and 40% of the total fat. The fatty acid content is less than 4%, the SDA level is between 0.05% and about 10%, and E TA levels are less than about 4% and EPA levels are between 0.05% and about 10%. The total monounsaturated fatty acid level in the total fatty acid content of the extracted lipids ranges from about 4% to about 35%. The total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipids is between about 20% and about 75% of the total fatty acid content of the extracted lipids is between new ω-6 fatty acids and new ω-3 fatty acids. The acid ratio is between about 0.03 and about 3.0, preferably less than about 0.50, and the fat of the lipid Fatty acid composition: At least about 60% of oleic acid is converted to LA by Δ12-desaturase Conversion efficiency of at least about 60% of SDA to ETA by Δ6-elongase The efficiency of oleic acid to DPA by Δ5-elongase ranged from about 50% to about 95%. Conversion efficiency, based on a conversion efficiency of at least about 10% of oleic acid to DPA. Or, at least 81% of DPA is located at the sn-1 position of triacylglycerol (TAG). or esterified at the sn-3 position.

[0024] In another preferred embodiment of the second aspect, a lipid or oil, preferably a seed oil, is used. more preferably, Brassica seed oil or Camelina sativa seed oil containing DPA. The oil has the following characteristics: the total fatty acid content of the lipid or oil is higher than that of palm oil; The lactic acid level is between about 2% and about 16%, and the myristic acid level is less than 1%. The oleic acid level is between about 1% and about 30%, and the LA level is between about 4% and 30%. 5%, and ALA is present and contributes to the total saturated fatty acid level in the total fatty acid content of the extracted lipids. The total omega-6 fatty acids in the fatty acid content of the extracted lipids ranges from about 4% to about 25%: The ratio of total omega-3 fatty acids is between 0.05 and about 3.0, and the triacylglycerol content of lipids is The (TAG) content is at least about 70%, and optionally the lipid is tri-DPA It may contain TAG (TAG66:15), a form of triacylglycerol (TAG) At least 35% of the DPA esterified with is esterified at the sn-2 position of the TAG. More preferably, the lipid or oil, preferably a seed oil, additionally comprises: ALA accounts for between 4% and 40% of the total fatty acid content. GLA is present at a level of 4% of the total fatty acid content. SDA levels are between 0.05% and about 10%, and ETA levels are about 4%. %, and the EPA level is between 0.05% and about 10% of the total fat of the extracted lipids. The level of total monounsaturated fatty acids in the acid content is between about 4% and about 35%, and the extract The level of total polyunsaturated fatty acids in the total fatty acid content of lipids ranges from about 20% to about 75% The ratio of new ω6 fatty acids to new ω3 fatty acids in the fatty acid content of the extracted lipids was about 0.03 to between about 3.0 and about 3.0, preferably less than about 0.50, and the fatty acid composition of the lipid is at least: The conversion efficiency of oleic acid to LA by Δ12-desaturase was about 60%. The conversion efficiency of SDA to ETA by Δ6-elongase was approximately 60%, and the conversion efficiency was approximately 50% to approximately 95% efficiency of EPA to DPA by Δ5-elongase, at least about 1 Based on 0% oleic acid to DPA conversion efficiency.

[0025] In connection with the extracted lipids or oils of the present invention, in one embodiment, the extracted lipids or oils The level of DPA in the extract was determined based on the DPA content in the lipids or oils of the plant parts or microorganisms before extraction. In other words, the level of the other extracts is not increased or is substantially the same. No treatment increases the level of DPA in lipids or oils relative to fatty acids. When the lipid or oil is subsequently processed by fractionation or other methods, , the fatty acid composition may be varied.

[0026] In another preferred embodiment, a lipid or oil, preferably a seed oil, more preferably For example, mustard oil, canola oil, or camelina sativa seed oil. Rana (Brassica) seed oil has the following characteristics: Total Fat or Oil The DPA level in fatty acid content ranges from about 7% to 35%, and the palmitic acid level The myristic acid level is between about 2% and about 16%, and the myristic acid level is less than about 6%, preferably less than 1 %, the oleic acid level is between about 1% and about 30%, and the LA level is about 4% to about 35%, ALA is present, and SDA levels are between about 0.05% and about 1 0%, ETA levels are less than about 6%, and EPA levels are between about 0.05% and DHA is found in lipids or oils, preferably in lipids or oils. Preferably, DHA, if present, is not detected in lipids or oils. Present at levels less than 2% of the total fatty acid content of the oil, or less than 0.5%, More preferably, it is not present in the total fatty acid content of the lipid or oil. may be essentially free of cholesterol and / or the lipid may be tri-DPA T More preferably, it may contain lipids or oils, preferably Typically, the seed oil further has one or more or all of the following characteristics: % of DPA is esterified at the sn-1 or sn-3 position of triacylglycerol (TAG). ALA is present at levels between 4% and 40% of the total fatty acid content. GLA is present and / or the GLA level is less than 4% of the total fatty acid content, SD A levels are between 0.05% and about 10% and ETA levels are less than about 4%; EPA levels ranged from 0.05% to approximately 10% of the total fatty acid content of the extracted lipids. The total monounsaturated fatty acid levels in the extracted lipids ranged from about 4% to about 35%. The total polyunsaturated fatty acid level in the extract is between about 20% and about 75%. The ratio of new omega-6 fatty acids to new omega-3 fatty acids in the total fatty acid content of and preferably less than about 0.50, and the fatty acid composition of the lipid is: at least about 60% The efficiency of oleic acid to LA conversion by Δ12-desaturase is at least approximately 60%. The efficiency of conversion of SDA to ETA by Δ6-elongase ranged from approximately 50% to approximately 95%. The conversion efficiency of EPA to DPA by Δ5-elongase was at least about 10%. In embodiments, at least 81% of the DPA is converted to triphosphate. It is esterified at the sn-1 or sn-3 position of acylglycerol (TAG). Alternatively, at least 35% of the DPA esterified in the form of TAG is s of the TAG. It is esterified at the n-2 position.

[0027] In a further embodiment, the extracted lipids of the present invention contain one or more sterols, preferably Further included are plant sterols.

[0028] In another embodiment, the extracted lipid is in the form of an oil and is less than about 10 mg lipid per gram of oil. of sterols, less than about 7 mg of sterols per gram of oil, less than about 1 mg of sterols per gram of oil Between 0.5mg and about 10mg of sterols, or about 1.5mg to 10mg per gram of oil Contains approximately 7 mg of sterols.

[0029] Examples of possible sterols in the extracted lipid include, but are not necessarily limited to, one or more of: or all campestrol / 24-methylcholesterol, Δ5-stigmasterol Ebricol, β-sitosterol / 24-ethylcholesterol, Δ5-avena Sterol / Isofucosterol, Δ7-stigmasterol / Stigmast-7-ene -3β-ol, and Δ7-avenasterol.

[0030] In an embodiment, the plant species is one listed in Table 11, such as canola. The levels of terols are approximately the same as those listed in Table 11 for that particular plant species. The plant species are Brassica napus (B. napus), Brassica juncea (B. juncea), a) or Cannabis sativa (C. sativa), respectively, wild-type Found in rapeseed, mustard greens, or cannabis sativa extract oil Includes levels of sterols per serving.

[0031] In an embodiment, the extracted plant lipids contain one or more or all campesterol / 24-methyl Cholesterol, Δ5-stigmasterol, Ebricol, β-sitosterol / 2 4-Ethylcholesterol, Δ5-avenasterol / isofucosterol, Δ7-stearic acid Gumasterol / stigmast-7-en-3β-ol and Δ7-avenasterol or has essentially the same sterol content as wild-type canola oil.

[0032] In embodiments, the extracted lipids are selected from wild-type canola oil, mustard oil, or cannabis oil. It has essentially the same sterol content as S. sativa oil.

[0033] In embodiments, the extracted lipids contain less than about 0.5 mg of cholesterol, oleic acid, or niacin per gram of oil. Less than about 0.25 mg of cholesterol per gram of oil, from about 0 mg to about 10 mg per gram of oil Between 0.5 mg of cholesterol, or about 0 mg to about 0.25 mg per gram of oil or essentially free of cholesterol.

[0034] In a further embodiment, the lipid is an oil, preferably an oil seed oil. Examples of suitable oils include, but are not limited to, canola oil or caramel oil. Brassica (Brassica sp.) oils such as China oil, cotton (Gossypium Linum hirsutum) oil, flax (Linum usitatissimum) Oil, Helianthus sp. oil, Safflower (Cart hamus tinctorius) oil, soybean (Glycine max) oil , corn (Zea mays) oil, Arabidopsis (Arabidopsis thaliana) oil, sorghum (Sorghum bicolor) oil, Sorghum vulgare oil, oat (Avena sativ a) Oil, Trifolium sp. oil, Guinea oil Elaesis guineenis oil, Nicotiana benthamiana ana benthamiana) oil, barley (Hordeum vulgare) ) oil, Lupinus angustifolius oil, Rice (Oryza sativa) oil, African rice (Oryza glaberr ima) oil, Camelina sativa oil, Cranberry Crambe abyssinica oil, Giant miscanthus Miscanthus x giganteus oil, or Misc anthus sinensis) oil. More preferably, the oil is Brassica sp. oil, Camelina sativa sativa oil or Glycine max (soybean) In an embodiment, the lipid is a rapeseed oil (Brassica napus). s) Brassica oil, such as mustard (Brassica juncea) oil (Brassica sp.) oil, cotton (Gossypium hirsutum) Oil, Linum usitatissimum oil, Helianthus (H elianthus sp.) oil, safflower (Carthamus tinctorius) ius) oil, soybean (Glycine max) oil, corn (Zea mays) palm oil, guinea palm (Elaesis guineenis) oil, Nicotiana benthamiana oil, blue oat Lupin (Lupinus angustifolius) oil, Camelina sativa (C amelina sativa oil, Crambe abyssinica (Crambe abyssinica) sinica) oil, Giant Miscanthus (Miscanthus x gigantea) anteus) oil, or Miscanthus sinensis oil In a further embodiment, the oil comprises or is canola oil, mustard oil. B.juncea oil, soybean (Glycine max) oil, camellia sinensis Camelina sativa oil or Arabidopsis thaliana oil In another embodiment, the oil is Scyllium thaliana (Oryza sativa) oil. A. thaliana oil and / or Camelina sativa (C. sa In an embodiment, the vegetable oil is a vegetable oil other than G. max ( In an embodiment, the oil is an oil other than soybean oil. from plants grown under standard conditions listed above, or from plants grown under standard conditions in the field or in a greenhouse. I got it.

[0035] In a further aspect, the present invention provides a method for producing a pharmaceutical composition comprising: i) lipid-containing plant parts, preferably lipid-containing Brassica seeds or Camelina obtaining seeds or microbial cells of Tiva, wherein the lipids are in an esterified form; Contains fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), and is an omega-6 fat. Fatty acids, omega-3 fatty acids including alpha-linolenic acid (ALA) and docosapentaenoic acid (DPA) and optionally one or more of stearidonic acid (SDA), eicosapentaenoic acid (E PA), and eicosatetraenoic acid (ETA), The level of DPA in the total fatty acid content of the lipid of a portion thereof is between about 7% and 35%. Process, and ii) extracting lipids from the plant parts or microbial cells, wherein the level of DPA in the fatty acid content is between about 7% and 35%; In one embodiment, the method for producing extracted plant or microbial lipids comprises: The level of DPA in the total fatty acid content of the dietary lipids is between approximately 7% and 20% or 20. In one embodiment, the level of DPA is between 7% and 20%. or between 20.1% and 30%, preferably between 20.1% and 35%, more preferably or between 30% and 35%. In some embodiments, the total fatty acid content of the extracted lipids is The level of DPA in the Preferably it is between 11% and 20%, or between 12% and 20%.

[0036] In an embodiment of the above aspect, the present invention provides a method for manufacturing a semiconductor device comprising: i) lipid-containing plant parts, preferably Brassica seeds or Camelina sativa seeds A process for obtaining lipids or microbial cells, wherein the lipids contain fatty acids in esterified form. The lipids are composed of omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha - omega-3 fatty acids including linolenic acid (ALA) and docosapentaenoic acid (DPA), as well as Thearidonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA), (i) the total fatty acid content of the extracted lipid; DPA levels in the range of 7% to 30% or 7% to 35%, preferably 30% (ii) the palmitic acid content of the extracted lipid is between 10% and 35% of the total fatty acid content of the extracted lipid; (iii) the milliliter of the total fatty acid content of the extracted lipid is between 2% and 16%; (iv) the extract has a lactic acid (C14:0) level of less than 6%, preferably less than 1%; (v) the oleic acid level in the total fatty acid content of the lipid is between 1% and 30%; The linoleic acid (LA) level in the total fatty acid content of the extracted lipids was between 4% and 35%. (vi) the content of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is 4% to 10%. 40% or more of eicosatrienoic acid in the total fatty acid content of the extracted lipid; and (viii) the total fatty acid content of the extracted lipid is less than 4%; (ix) the total saturated fatty acid level of the extracted lipid is between 4% and 25%; (x) the ratio of total omega-6 fatty acids to total omega-3 fatty acids in the lipid (xi) the triacylglycerol (TAG) content of the At least 70% of the DPA esterified in the form of AG is at the sn-1 position of the TAG or sn-3 position, and ii) extracting lipids from the plant parts wherein the level of DPA in the total fatty acid content of the extracted lipid is between about 7% and 30%. or between 7% and 35%, preferably between 30% and 35%, of extracted plant lipids or provides a method for producing microbial lipids, preferably DP esterified in the form of TAG. At least 81% or at least 90% of A's are at the sn-1 or sn-3 positions of the TAG It is ranked 1st.

[0037] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: i) lipid-containing cells, preferably plant parts or microbial cells containing lipid-containing cells; More preferably, the step of obtaining seeds of the genus Brassica or seeds of Camelina sativa, The lipids contain fatty acids in esterified form, the fatty acids being docosapentaenoic acid (DP A) containing at least 3 esterified triacylglycerols (TAGs) 5% of the DPA is esterified at the sn-2 position of the TAG, and ii) extracting lipids from the cells The form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid At least 35% of the DPA esterified with is esterified at the sn-2 position of the TAG. In an embodiment, the extracted lipids produced by the method are Lipids are classified as (i) ω-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA); Contains one or more or all of the omega-3 fatty acids, including linolenic acid (ALA), and optionally steatohepatitis Sodium aridonic acid (SDA), eicosapentaenoic acid (EPA), and eicosatetraenoic acid ( (ii) at least about 40%, at least about 4 5%, at least about 48%, between 35% and about 60%, or between 35% and about 50% DPA esterified in the form of triacylglycerol (TAG) is esterified at the 2-position, and (iii) the total fatty acid content of the extracted lipid DPA levels between about 1% and 35%, or between about 7% and 35%, or about 20.1 % to 35%. In such embodiments, the level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8%, approx. 9%, approx. 10%, approx. 12%, approx. 15%, approx. 18%, approx. 20%, approx. 22%, approx. 24 %, approximately 26%, approximately 28%, approximately 30%, between approximately 7% and approximately 28%, between approximately 7% and approximately 25% , between about 10% and about 35%, between about 10% and about 30%, between about 10% and about 25%, Between about 10% and about 22%, Between about 14% and about 35%, Between about 16% and about 35%, About Between 16% and approximately 30%, between approximately 16% and approximately 25%, or between approximately 16% and approximately 22% In a preferred embodiment, the extracted lipids are (i) and (ii), (i) and (ii) i) or (ii) and (iii), more preferably (i), (ii) and (iii) Preferably, the extracted lipids are between about 2% and 16%. The palmitic acid level in the total fatty acid content of the extracted lipid, and, if present, % of the total fatty acid content of the extracted lipids. It can be further characterized.

[0038] In an embodiment of the above aspect, the present invention provides a method for manufacturing a semiconductor device comprising: i) lipid-containing cells, preferably lipid-containing plant parts or microbial cells containing cells More preferably, a step of obtaining seeds of the genus Brassica or seeds of Camelina sativa. The lipids contain fatty acids in esterified form, and the fatty acids are docosapentaenoic acid (D PA), omega-6 fatty acids including oleic acid, palmitic acid, and linoleic acid (LA), alpha- Omega-3 fatty acids, including linolenic acid (ALA), as well as stearidonic acid (SDA) and eicosapentaenoic acid (EFA). It also contains one or more of the following: tetraenoic acid (EPA), eicosatetraenoic acid (ETA), (i) the palmitic acid level in the total fatty acid content of the extracted lipid is between 2% and 16%; (ii) the ratio of myristic acid (C14:0) in the total fatty acid content of the extracted lipid is between (iii) the oleic acid level in the total fatty acid content of the extracted lipid is less than 1%; (iv) the total fatty acid content of the extracted lipid is between 1% and 30% linoleic acid; (v) the total fatty acid content of the extracted lipids is between 4% and 35%; (vi) the total fat content of the extracted lipids is between 4% and 40% alpha-linolenic acid (ALA); The eicosatrienoic acid (ETrA) level in the fatty acid content is less than 4%, and (vii ) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is between 4% and 25%; (viii) the ratio of total ω6 fatty acids to total ω3 fatty acids in the total fatty acid content of the extracted lipid is (ix) the triacylglycerol (TAG) content of the lipid, which is between 0.05 and 1; and (x) is in the form of triacylglycerol (TAG), At least 35% of the esterified DPA is esterified at the sn-2 position of the TAG. ,and ii) extracting lipids from the plant parts The form of triacylglycerol (TAG) in the total fatty acid content of the extracted lipid At least 35% of the DPA esterified with is esterified at the sn-2 position of the TAG. The present invention provides a method for producing extracted lipids, which is

[0039] The step of obtaining the plant part or microbial cell may be carried out by extracting the plant part, preferably the microbial cell, from a plant that produces the plant part. Preferably, harvesting the seeds, recovering the microbial cells from a culture of such cells, and purchases or imports the plant parts or microbial cells from a manufacturer or supplier. The method may comprise obtaining lipids in a plant part or microbial cell sample, or The method may include determining the fatty acid composition of the extracted lipids.

[0040] In a preferred embodiment, the extracted lipids obtained by the method of the present invention are, where applicable, As defined in the specification, for example, one or more of the above defined in relation to the first two aspects It has the following characteristics.

[0041] Embodiments of the above aspects of the present invention are described in further detail below. Thus, any described embodiment that is broader than the corresponding feature of the above aspect is also broader than the corresponding feature of the above aspect. Does not apply to.

[0042] In an embodiment, the plant part is a seed, preferably an oilseed. Examples of such seeds include: , including but not limited to, Brassica sp., Gossypium pium hirsutum), flax (Linum usitatissimum), flax (Linum usitatissimum), Helianthus sp., safflower (Carthamus ti nctorius), soybean (Glycine max), corn (Zea mays) ys), Arabidopsis (Arabidopsis thaliana), sorghum (S orghum bicolor), sorghum (Sorghum vulgare), Tapir (Avena sativa), Trifolium sp. , Elaesis guineenis, Nicotiana benthamiana (N icotiana benthamiana), barley (Hordeum vulga) re), blue-flowered lupin (Lupinus angustifolius), rice (O ryza sativa), African rice (Oryza glaberrima), turtle Camelina sativa, or Crambea abyssinica mbe abyssinica), preferably Brassica sp. ) seeds, Camelina sativa (C. sativa) seeds or G. max (soybean) seeds of Brassica napus, mustard, and more preferably The seeds of B. juncea or Camelina sativa are listed. In an embodiment, the plant part is a seed, preferably a seed of Brassica napus (Brassica napus). oilseed rape (Brassica napus) or mustard (Brassica juncea) Brassica sp., cotton (Gossypium hirsutum), Linum usitatissimum, Helianthus us sp.), safflower (Carthamus tinctorius), soybean (G lycine max), corn (Zea mays), and Guinea oil palm (El aesis guineenis, Nicotiana benthamiana thamiana), Lupinus angustifolius ), Camelina sativa, or Cranberry Abyssinica (Crambe abyssinica), preferably Brassica napus ica napus), mustard (B juncea) or camelina sativa (C. In an embodiment, the seed is an oilseed, such as a canola seed. , mustard seeds, soybean seeds, Camelina sativa seeds Seeds of Arabidopsis thaliana or Arabidopsis thaliana. In an alternative embodiment, the seeds are A. thaliana seeds and / or Or seeds other than seeds of Camelina sativa (C. sativa). In some embodiments, the seed is a seed other than a soybean seed. In some embodiments, the plant part is a Brassica (B The plant part is preferably a Brassica seed or are seeds of Camelina sativa. In an embodiment, the seeds are, for example, seeds of the variety described in Example 1. obtained from plants grown under standard conditions or from plants grown under standard conditions in the field or in a greenhouse Ta.

[0043] In another embodiment, the seeds contain at least about 18 mg of niacin per gram of seed, at least about 2 mg of niacin per gram of seed. 2 mg, at least about 26 mg, between about 18 mg and about 100 mg, between about 22 mg and about 7 between about 0 mg, about 80 mg, between about 30 mg and about 80 mg, or between about 24 mg and about 50 mg Contains between mg of DPA.

[0044] In a further embodiment, the plant part, such as a seed, comprises the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-enriched longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ 6-elongase and Δ5-elongase, iv) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5- Elongase, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ 5-elongase, each polynucleotide encoding one of the and one or more promoters capable of directing expression of said polynucleotide in a cell of Possibly linked.

[0045] In a further embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, is The following set of disjoints; i) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase Δ5-desaturase, Δ6-elongase and Δ5-elongase, ii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5 -Elongase, iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase saturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase, v) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- elongase and Δ5-elongase, vi) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5- Elongated each polynucleotide encoding one of the or one or more promoters capable of inducing expression of said polynucleotide in the cell. The target is operably linked to the target.

[0046] In an embodiment, if the plant part or cell contains lipids containing fatty acids in esterified form, The fatty acid comprises docosapentaenoic acid (DPA), and the triacylglycerol (T At least 35% DPA and / or DHA (if present) esterified in the form of DPA and / or DHA (AG). If the TAG is esterified at the sn-2 position, the TAG can be used in plant parts such as seeds. Recombinant cells, such as bacteria or microbial cells, can be used to synthesize 1-acyl-glycerol-3-phosphate acyl esters. The polynucleotide comprises an exogenous polynucleotide encoding a transferase (LPAAT), The nucleotide is capable of inducing expression of the polynucleotide in the cell or cells of the plant part. In a further embodiment, the cell is operably linked to one or more promoters that are The vacuole contains the following set of enzymes: i) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-eron gauze, and Δ5-elongase, ii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-desaturase longase, and Δ5-elongase, iii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase, and Δ5-elongase, iv) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, v) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-eron gauze, and Δ5-elongase, vi) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase, and Δ5-elongase, vii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA) T), Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- elongase, and Δ5-elongase, viii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA) AT), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5 -Elongase, each polynucleotide encoding one of the operably linked to one or more promoters capable of directing expression of said polynucleotide Preferably, the LPAAT is a C22 polyunsaturated fatty acid such as DPA-CoA. A methyl-CoA substrate can be used.

[0047] Preferably, the plant part or part thereof, such as a seed, or the microbial cell is does not have a polynucleotide encoding a Δ4-desaturase or It does not have a chromatinase polypeptide.

[0048] In embodiments, the Δ12-desaturase is an ω3-desaturase and / or a Δ15 -desaturase activity, i.e., the activity is conferred by one polypeptide. Alternatively, the Δ12-desaturase does not have ω3-desaturase activity, and It has no Δ15-desaturase activity, i.e., Δ12-desaturase is not ω3- A polypeptide having desaturase activity and / or a Δ15-desaturase and another polypeptide It is a lipid.

[0049] In a further embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, is Features below; i) Δ12-desaturase is at least about 60%, at least about 70%, or at least about 80%, between about 60% and about 95%, between about 70% and about 90%, or about 75% in cells of one or more of the plant parts or recombinant cells with an efficiency of between about 85% and about 85%. Conversion of oleic acid to linoleic acid ii) ω3-desaturase is at least about 65%, at least about 75%, or at least about 85%, between about 65% and about 95%, between about 75% and about 91%, or about 80% in cells of one or more of the plant parts or recombinant cells with an efficiency of between about 91% and about 91% Conversion of omega-6 fatty acids to omega-3 fatty acids iii) Δ6-desaturase is at least about 20%, at least about 30%, At least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 30 between about 35% and about 60%, or between about 50% and about 70% and converting ALA to SDA in cells of one or more of said plant parts or in recombinant cells at a rate To exchange, iv) Δ6-desaturase is less than about 5%, less than about 2.5%, less than about 1%, less than about 0.1% between about 0.5% and about 5%, between about 0.5% and about 2.5%, or between about 0.5% and about 1% and efficiently converting γ-linoleic acid into γ-linoleic acid in cells or recombinant cells of one or more of said plant parts. Conversion to linolenic acid v) Δ6-elongase is at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 80%, or between about 75% and about 80% efficiency in one or more of the cells of the plant part or recombinant cells, Converting A into ETA, vi) Δ5-desaturase is at least about 60%, at least about 70%, or at least at least about 75%, at least about 80%, at least about 90%, between about 60% and about 95%, one or more of said plants with an efficiency of between 70% and about 95%, or between about 75% and about 95%. converting ETA to EPA in natural or recombinant cells; vii) Δ5-elongase is at least about 80%, at least about 85%, at least 90%, between about 50% and about 90%, or between about 85% and about 95% efficiency. and converting EPA to DPA in the cells or recombinant cells of said plant parts. and, ix) converting oleic acid to DPA in cells or recombinant cells of one or more of said plant parts. The efficiency of conversion to At least about 25%, about 20%, about 25%, about 30%, between about 10% and about 50%, about 10 Between about 10% and about 25%, or between about 20% and about 30% Between x) converting LA to DPA in cells or recombinant cells of one or more of said plant parts; The efficiency of at least about 25%, at least about 30%, about 25%, about 30%, about 35%, about 15% to about 50% %, between about 20% and about 40%, or between about 20% and about 30%; xi) converting ALA to DPA in cells or recombinant cells of one or more of said plant parts; The conversion efficiency is at least about 17%, at least about 22%, at least about 24%, or At most about 30%, about 30%, about 35%, about 40%, between about 17% and about 55%, about 22% between about 24% and about 35%, or between about 24% and about 35%; xi) one or more cells or recombinant cells of said plant part contain said exogenous polynucleotide. At least about 25%, at least about 30%, about 25% to about 40% of the unfilled counterpart cells %, or between about 27.5% and about 37.5% high in omega-3 fatty acids; xii) Δ6-desaturase is more efficient at converting α-linolenic acid (A) to linoleic acid (LA). LA) to be preferentially desaturated, xiii) the Δ6-elongase also has Δ9-elongase activity; xiv) the Δ12-desaturase also has Δ15-desaturase activity; xv) the Δ6-desaturase also has Δ8-desaturase activity; xvi) the Δ8-desaturase also has Δ6-desaturase activity, or having no desaturase activity; xvii) Δ15-desaturase also has ω3-desaturase activity towards GLA. To do, xviii) ω3-desaturase also has Δ15-desaturase activity towards LA To do, xix) ω3-desaturase desaturates both LA and / or GLA , xx) ω3-desaturase preferentially desaturates GLA compared to LA; xxi) one or more or all desaturases, preferably Δ6-desaturases, and and / or Δ5-desaturase prefers the acyl-CoA substrate to the corresponding acyl-PC substrate. have high activity against xxii) Δ6-desaturase has a higher activity towards ALA than LA as a fatty acid substrate. having low Δ6-desaturase activity; xxiii) Δ6-desaturase binds to the Sn-2 position of PC as a fatty acid substrate. ALA-CoA as a fatty acid substrate has a higher Δ6-desaturase activity than ALA-CoA. having enzyme activity; xxiv) Δ6-desaturase has a higher activity towards ALA as a substrate compared to LA. At least about two-fold higher Δ6-desaturase activity, at least three-fold higher activity, at least having four times greater activity, or at least five times greater activity; xxv) Δ6-desaturase binds A to the sn-2 position of PC as a fatty acid substrate. It has higher activity towards ALA-CoA as a fatty acid substrate than towards LA. xxvi) Δ6-desaturase bound to the sn-2 position of PC as a fatty acid substrate At least about 5 times higher for ALA-CoA as a fatty acid substrate than for ALA having low Δ6-desaturase activity or at least 10 times higher activity; xxvii) the desaturase is a front-end desaturase; and xxviii) Δ6-desaturase does not produce detectable Δ5-desaturase for ETA. No enzyme activity It has one or more or all of the following.

[0050] In a further embodiment, seeds, preferably seeds of Brassica napus or Camelina sativa, are The plant part, such as a seed, or the recombinant cell, such as a microbial cell, may have one or more of the following characteristics: Has everything. i) a Δ12-desaturase that encodes an amino acid sequence having the sequence provided in SEQ ID NO: 4, Biologically active fragments or fragments containing an amino acid sequence at least 50% identical to SEQ ID NO:4. To ii) the ω3-desaturase is an ω3-desaturase having an amino acid sequence as provided in SEQ ID NO: 6, Biologically active fragments or fragments containing an amino acid sequence at least 50% identical to SEQ ID NO:6. To iii) the Δ6-desaturase comprises an amino acid sequence having the sequence provided in SEQ ID NO: 9; or a biologically active fragment of SEQ ID NO: 9, or an amino acid sequence at least 50% identical to SEQ ID NO: 9. Including, iv) Δ6-elongase has the amino acid sequence provided in SEQ ID NO: 16, the sequence SEQ ID NO: 17, or a biologically active fragment thereof, such as SEQ ID NO: 16 and / or SEQ ID NO: 17, comprising an amino acid sequence at least 50% identical to v) Δ5-desaturase, which has the amino acid sequence as provided in SEQ ID NO: 20, Biologically active fragments or amino acid sequences at least 50% identical to SEQ ID NO: 20 Including, and vi) the Δ5-elongase has the amino acid sequence as provided in SEQ ID NO: 25, Biologically active fragments or amino acid sequences at least 50% identical to SEQ ID NO: 25 To include.

[0051] In embodiments, a plant part such as a seed or a recombinant cell such as a microbial cell is Glycerol acyltransferase (DGAT), monoacylglycerol acyltransferase glycerol-3-phosphate acyltransferase (MGAT), glycerol-3-phosphate acyltransferase (G PAT), 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), preferably using a C22 polyunsaturated fatty acyl-CoA substrate such as DPA-CoA. Available LPAAT, acyl-CoA:lysophosphatidylcholine acyltransferase phospholipase (LPCAT), phospholipase A2 (PLA2), phospholipase C (PLC), Phospholipase D (PLD), CDP-choline diacylglycerol choline phosphotran Phosphatidylcholine diacylglycerol acyltransferase (CPT), phosphodiesterase (PDAT), phosphatidylcholine:diacylglycerol choline phosphotransferase acyl-CoA synthase (PDCT), acyl-CoA synthase (ACS), or two or more of these Further included are exogenous polynucleotides encoding the above combinations.

[0052] In another embodiment, the plant part, such as a seed, or the recombinant cell, such as a microbial cell, is 1, DGAT, MGAT, GPAT, LPAAT, LPCAT, PLA2, PLC, PL Thioesterases such as D, CPT, PDAT, and FATB, or Δ12-desaturases and the production of endogenous enzymes in plant part cells selected from the group consisting of enzymes, or a combination of two or more thereof. and / or down-regulating the activity of the introduced mutant or exogenous polynucleotide. Including

[0053] In a further embodiment, at least one, or preferably all, of the promoters is a In embodiments, at least one or all of the promoters are The nucleotide sequence is then converted to an integrated gene, such as a gene encoding oil biosynthesis or oleosin, or These were obtained from seed storage protein genes such as the gene encoding rinrinin.

[0054] In another embodiment, expression of an exogenous polynucleotide encoding a Δ5-elongase is The promoter that induces the Δ12-desaturase and ω3-desaturase is a plant, such as a microbial cell, prior to inducing expression of an exogenous polynucleotide encoding an enzyme. or initiating or peaking expression of the polynucleotide in the developing seed of the recombinant cell. To do so.

[0055] In a further embodiment, the exogenous polynucleotide is expressed in a cell of a plant part or a microbial cell. a DNA molecule, preferably a T-DNA molecule, integrated into the genome of a recombinant cell such as covalently linked and preferably integrated into the genome of the cells of the plant part or the recombinant cell The number of such DNA molecules is 1 or less, 2 or 3 or less, or 2 or 3. This is the case.

[0056] In yet another embodiment, the plant parts are Δ6- at least two different exogenous polynucleotides each encoding a desaturase .

[0057] In a further embodiment, the total oil content of the plant part comprising the exogenous polynucleotide is at least about 10 times the total oil content of the corresponding plant part that does not contain the exogenous polynucleotide. 40%, at least about 50%, at least about 60%, at least about 70%, about 50% to In a further embodiment, the rate of remission is between about 80%, or between about 80% and about 100%. Seeds containing the exogenous polynucleotide are then transfected with corresponding seed grains that do not contain the exogenous polynucleotide. At least about 40%, at least about 50%, at least about 60%, at least about 70% of the amount %, between about 50% and about 80%, or between about 80% and about 100%.

[0058] In another embodiment, the lipid is in the form of an oil, preferably a seed oil from an oil seed. at least about 90% by weight, at least about 95% by weight, at least about 98% by weight, Alternatively, between about 95% and about 98% by weight of the lipids are triacylglycerols.

[0059] In a further embodiment, the method comprises determining the level of DPA as a percentage of the total fatty acid content. For example, the treatment may involve treating lipids to produce free fatty acids. This includes the hydrolysis of esterified fatty acids, or transesterification, for example, canola. A lipid such as an oil is prepared by converting fatty acids in the oil into alkyl esters such as methyl or ethyl esters. It may then be converted to a fatty acid or oil-rich DPA. In embodiments, the fatty acid composition of the lipids after such treatment is at least 40% , at least 50%, at least 60%, at least 70%, at least 80%, or In one embodiment, the total fatty acid content after treatment contains at least 90% DPA. HA levels are less than 2.0% or less than 0.5%, preferably less than that detected in the lipids. I can't.

[0060] Lipids or oils containing lipids, such as free fatty acids or alkyl esters, may also be used. are provided and produced using the methods of the present invention.

[0061] In another aspect, the present invention provides a method for producing methyl or ethyl esters of polyunsaturated fatty acids. The present invention provides a method for extracting plant lipids from plants, the method comprising the steps of: and reacting the extracted vegetable oils with methanol or ethanol, respectively. The protein contains fatty acids esterified in the form of TAG, the fatty acids being oleic acid, palmitic acid, and the like. omega-6 fatty acids including lactic acid, linoleic acid (LA), and omega-3 fatty acids including alpha-linolenic acid (ALA) fatty acids, and docosapentaenoic acid (DPA), and optionally stearidonic acid (SDA) ), eicosapentaenoic acid (EPA), and eicosatetraenoic acid (ETA) or more, and the DPA level in the total fatty acid content of the extracted lipid may be about 7% to 3%. Between 5%, preferably between 20.1% and 30%, or between 20.1% and 35% thereby producing methyl or ethyl esters of polyunsaturated fatty acids.

[0062] In another aspect, the present invention provides a methyl or ethyl ester of docosapentaenoic acid (DPA). The present invention provides a method for producing ethanol from an extracted vegetable oil, the method comprising the steps of: This involves reacting triacylglycerols (TAGs) in the matrix or during the extraction process. The extracted plant lipids contain fatty acids in an esterified form, and the fatty acids are docosapentaenoic acid. The TAG comprises at least 35% of the DPA esterified in the form of TAG. It is esterified at the sn-2 position of AG, thereby forming a methyl or produces ethyl esters

[0063] In a preferred embodiment, the lipid used in the methods of the above two aspects is the extracted lipid of the present invention. or having one or more of the characteristics defined herein in relation to the oil.

[0064] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a) lipids containing fatty acids in esterified form, and b) the following set of enzymes; i) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5- Elongase, ii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5 -Elongated iii) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase saturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase, or iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase enzymes, Δ5-desaturase, Δ9-elongase and Δ5-elongase an exogenous polynucleotide encoding one of Including, Each polynucleotide is capable of directing expression of said polynucleotide in developing seeds of said plant. one or more seed-specific promoters capable of expressing said polynucleotides in said microbial cell; operably linked to one or more seed-specific promoters capable of directing expression of the octide The fatty acids are omega-6 fats, including oleic acid, palmitic acid, and linoleic acid (LA). Omega-3 fatty acids, including gamma-linolenic acid (GLA) and alpha-linolenic acid (ALA) Contains fatty acids, stearidonic acid (SDA) and docosapentaenoic acid (DPA), and in some cases Therefore, eicosapentaenoic acid (EPA) and / or eicosatetraenoic acid (ETA) ), and the DP in the total fatty acid content of the lipids of the seeds or microbial cells. A level between 7% and 35% Oilseed plants or parts thereof such as seeds, preferably oilseeds containing lipids in their seeds A Camelina or Camelina sativa plant, or a microbial cell, is provided. In an embodiment, DHA is less than 2% of the total fatty acid content of the lipids of the seeds and extracted lipids; or Present at levels less than 0.5%, and more preferably undetectable in the total fatty acid content of the lipids. stomach.

[0065] In another aspect, the present invention provides a method for producing a pharmaceutical composition comprising: a) Fatty acids in esterified form, the fatty acids being docosapentaenoic acid (DP A) containing at least 3 esterified triacylglycerols (TAGs) 5% DPA is the fatty acid esterified at the sn-2 position of the TAG, and b) an exogenous polynucleotide encoding one of the following sets of enzymes: i) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, ii) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase, and Δ5-elongase, iii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA AT), Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase, and Δ5-elongase, iv) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA T), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase Longase, v) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) ), ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, vi) 1-acyl-glycerol-3-phosphate acyltransferase (LPAA) T), Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9- elongase, and Δ5-elongase, vii) 1-acyl-glycerol-3-phosphate acyltransferase (LPA) AT), Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase, and Δ5-elongase, viii) 1-acyl-glycerol-3-phosphate acyltransferase (LP) AAT), Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ 5-elongase, A cell comprising the compound, preferably a cell or seed in or from a plant such as an oilseed plant. or preferably a Brassica or Camelina sativa plant. and providing an oil plant or part thereof, or a microbial cell, each of which is a polynucleotide of the operably with one or more promoters capable of directing expression of said polynucleotide in a cell. Preferably, the LPAAT is linked to a C22 polyunsaturated cofactor such as DPA-CoA. Ability to use fatty acyl-CoA substrates and the level of DPA in the total fatty acid content of extracted lipids is between about 1% and 35%, or between about 7% and 35%, or between about 20.1% and 3 In an embodiment, the esterified form is triacylglycerol (TAG). at least about 40%, at least about 45%, at least about 48%, 35% to about Between 60% and 35% to approximately 50% of the DPA is esterified at the sn-2 position of TAG. It has been turned into

[0066] In a preferred embodiment of each of the above two aspects, the Δ15-desaturase is a fungal Δ 15-desaturase, and ω3-desaturase is a fungal ω3-desaturase. be.

[0067] In a preferred embodiment, the oil plant, microbial cell or cells of the invention, where applicable, As defined herein, for example, extracted plant lipids, extracted microbial lipids or methods for their production. The compound has one or more characteristics as defined above.

[0068] Examples of oilseed plants include, but are not limited to, Brassica sp.), cotton (Gossypium hirsutum), flax (Linum usi tatissimum), Helianthus sp., safflower (Carthamus tinctorius), soybean (Glycine max), Maize (Zea mays), Arabidopsis (Arabidopsis thaliana) liana), Sorghum (Sorghum bicolor), Sorghum (Sorghu m vulgare), oat (Avena sativa), Trifolium spp. (T rifolium sp.), Guinea oil palm (Elaesis guineenis ), Nicotiana benthamiana (Nicotiana benthamiana), barley ( Hordeum vulgare), Lupinus agust ifolius), rice (Oryza sativa), African rice (Oryza g laberrima, Camelina sativa, or Crambe abyssinica is an example. The plant is a Brassica sp. plant, Camelina sativa (C. sativa plants or Glycine max (G. max) (soybean) plants. In an embodiment, the oilseed plant is Brassica napus, B. juncea, Soybean (Glycine max), Camelina sativa (Camelina sativa) a) or Arabidopsis thaliana plants. In an alternative embodiment, the oilseed plant is Arabidopsis thaliana (A. thaliana) and and / or Camelina sativa (C. sativa). The seed plant is a plant other than G. max (soybean). The plant is preferably a plant of the genus Brassica. or Camelina sativa. In an embodiment, the oilseed plant is, for example, the oilseed plant described in Example 1. The plants were either field or field-grown or greenhouse-grown under standard conditions as described above.

[0069] In an embodiment, the cells or plants or One or more desaturases present in the plant part can use acyl-CoA substrates. In a preferred embodiment, a Δ6-desaturase, a Δ5-desaturase and a Δ8- The desaturase, if present, is capable of using an acyl-CoA substrate and is preferred. i) Δ6-desaturase and Δ5-desaturase or ii) Δ5-desaturase Each of the Δ8-desaturase and Δ8-desaturase can use an acyl-CoA substrate. In embodiments, the Δ12-desaturase and / or the ω3-desaturase is an acyl- A CoA substrate can be used. The acyl-CoA substrate is preferably a Δ6-desaturase. ALA-CoA is used for Δ5-desaturase, ETA-CoA for Δ8-desaturase, and ETrA-CoA for Δ12-desaturase, oleoyl-CoA for Δ12-desaturase, ω3-desaturases produce LA-CoA, GLA-CoA, and ARA-CoA. There is one or more of these.

[0070] In an embodiment, the harvested seeds of the plant have at least about 28 mg per gram of seed, Preferably, at least about 32 mg per gram of seed, at least about 32 mg per gram of seed about 36 mg, at least about 40 mg per gram of seed, more preferably at least about 40 mg per gram of seed at least about 44 mg or at least 48 mg per gram of seed Approximately 80 mg of DPA, or between approximately 30 mg and approximately 80 mg per gram of seed Has.

[0071] In a further aspect, the present invention provides a Brassica napus (Brassica napus L.) plant capable of producing seeds containing DPA. Brassica napus), mustard (B. juncea) or camelina satay and providing a C. sativa plant, wherein mature harvested seeds of the plant are seed 1. At least about 28 mg per gram, preferably at least about 32 mg per gram of seed mg, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed mg, more preferably at least about 44 mg or at least 48 mg per gram of seed mg, at least about 80 mg per gram of seed, or about 30 mg per gram of seed to about 80 mg DPA.

[0072] In another aspect, the present invention provides a method for the preparation of a nucleic acid molecule of the present invention comprising an exogenous polynucleotide as defined herein. A plant cell of a plant is provided.

[0073] The following features: i) derived from the plant of the present invention; ii) comprising a lipid as defined herein; or iii) plant parts that can be used in the methods of the present invention, preferably Also provided are recombinant cells, such as seeds, or microbial cells.

[0074] In yet another aspect, the present invention provides a composition comprising DPA and between about 4% and about 15% by weight, preferably More preferably, between about 6% and about 8% by weight or between about 4% and about 8% by weight. The main ingredient is mature, harvested rapeseed (B. napus) containing about 4% to about 6% moisture by weight. rassica napus), mustard (B. juncea) or camelina sativa Camelina sativa seeds are provided, and the DPA content of the seeds is determined by the following formula: At least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed g, at least about 36 mg per gram of seed, at least about 40 mg per gram of seed g, more preferably at least about 44 mg per gram of seed or at least about 48 mg per gram of seed, about 80 mg per gram of seed, or about 100 mg per gram of seed It ranges from 30mg to about 80mg.

[0075] In an embodiment, the cells of the invention, the oilseed plants of the invention, the rapeseed (B rassica napus), mustard (B. juncea) or camelina sativa Camelina sativa plants, plant parts of the invention, or seeds of the invention. can be used to produce extracted lipids comprising one or more or all of the characteristics defined herein. Cut.

[0076] Moreover, in a further aspect, the present invention provides a method for producing an extracted lipid of the present invention. A method for producing a plant or cell is provided, the method comprising: a) one or more plant parts, such as seeds, from a plurality of plants or recombinant cells, such as microbial cells The levels of DPA in lipids produced by recombinant cells, such as microbial cells, were assayed. a) each recombinant cell, such as a plant or microbial cell, containing the following set of enzymes: ; i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-enriched longase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ 6-elongase and Δ5-elongase, iv) Δ12-desaturase, ω3-desaturase or Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase longase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase Longase, ix) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase and Δ5-elongase, x) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6- elongase and Δ5-elongase, or xi) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, and one or more exogenous polynucleotides encoding one of: Each polynucleotide is selected from the group consisting of a polynucleotide, a polynucleotide for expression in a plant part or a recombinant cell, and a polynucleotide for expression in a plant part or a recombinant cell. operably linked to one or more promoters capable of inducing and b) one or more of its parts can be used to produce the extracted plant lipids or recombinant cell lipids of the present invention; identifying the plant or recombinant cell from a plurality of plants or recombinant cells that can be isolated; c) optionally, progeny from said identified plant or recombinant cell, or seeds derived therefrom; Producing plants or recombinant cells Includes:

[0077] In embodiments, the plant or recombinant cell comprises a gene encoding an LPAAT as defined herein. It further comprises an exogenous polynucleotide.

[0078] Preferably, the progeny plant is at least a second or third progeny plant derived from the identified plant. generation, and preferably homozygous for one or more polynucleotides. Preferably, the one or more polynucleotides are expressed in the progeny at only one insertion locus. That is, the present invention provides a method for producing plants or seeds from a plurality of transformed candidate plants or seeds. provides a method that can be used as a screening method for identifying the seeds, The identified plants or their progeny preferably produce the lipids of the present invention in their seeds. Such plants or progeny plants or seeds thereof may be used in accordance with the present invention, particularly those having specific DPA levels. The strains are selected for if they produce the lipid of the invention, or are not selected for if they do not produce the lipid of the invention.

[0079] In embodiments, the cell is a microbial cell as defined herein, or a cell such as a plant or part thereof. The foreign polypeptide present in the cell is expressed as a polypeptide that is encoded by the genome of the cell, plant, or plant part, such as a seed. Preferably, the exogenous polynucleotide is stably integrated into one of the genomes. stably integrated into the genome of the cell, plant or plant part, such as a seed, at a locus and is preferably homozygous for the insertion. More preferably, the plant, plant part or The seeds are said to lack any exogenous polynucleotides other than one or more T-DNA molecules. The exogenous vector sequence is further characterized in that it does not contain any other gene other than the T-DNA sequence. It is not incorporated into the Nomu.

[0080] In an embodiment, prior to step a), the method further comprises: This involves introducing the gene into one or more cells of an organism.

[0081] Plants produced using the methods of the invention, and seeds of such plants, are also provided.

[0082] In an embodiment, the plants of the present invention are capable of both male and female reproduction, and preferably are suitable for use in the corresponding fields. Both sexes at least 70% of the live plant, or preferably about the same. In an embodiment, the plant produced from the plant of the invention or the seed of the invention has a fertility level of The pollen produced by the plants was 90-10 times more viable than the pollen produced by the plants as determined by staining with a viability stain. For example, pollen viability may be assessed as described in Example 1. .

[0083] In another aspect, the present invention provides a method for producing seeds, the method comprising: a) preferably a collection of at least 1000 or 2000 or 3000 such plants At least 1 hectare or 2 hectares of cultivated land as a combined part or planted at standard planting density 1000 to 3000 hectares of land, or in a greenhouse under standard conditions, growing a plant that produces a plant part of the invention or produces a seed of the invention; b) harvesting seeds from said one or more plants; and c) optionally extracting lipids from the seeds, preferably at least 60 kg or produce oil with a total DPA yield of 70 kg or 80 kg DPA / hectare thing Includes:

[0084] In an embodiment, the plant, plant cell, plant part or seed, or recombinant cell of the present invention is , with the following features: i) the oil is as defined herein; or ii) the plant parts or seeds or recombinant cells can be used in the methods of the present invention. It has one or more of the following.

[0085] For example, the seeds can be used to produce plants of the invention. They may be grown in the field or in a greenhouse under standard conditions as described in 1.

[0086] In a further aspect, the present invention provides a method for producing a cell of the present invention, an oilseed oil seed of the present invention, or a plant cell of the present invention, using the method of the present invention. The present invention relates to the Brassica genus, Brassica napus. ica napus), mustard (B. juncea), soybean (G. max) or Camelina sativa plants, plant parts of the present invention, or a plant, plant cell, plant part or seed of the present invention. or a lipid or oil obtained therefrom. Preferably, the lipid or oil is Purify to obtain nucleic acids (DNA and / or RNA), proteins and / or carbohydrates, or To remove contaminants such as pigments like chlorophyll, refine lipids or oils, e.g. For example, the removal of free fatty acids (FFA) or phospholipids can enrich the TAG fraction.

[0087] In an embodiment, the lipid or oil is obtained by extracting oil from oil seeds. Examples of oils from oilseeds include, but are not limited to, canola oil (Brassica napus) and ica napus, Brassica rapa ssp), mustard oil (Bra ssica juncea), other brassica oils, sunflower oil (Helianth us annus), linseed oil (Linum usitatissimum), Glycine max oil, safflower oil (Carthamus tinctorius) torius), corn oil (Zea mays), tobacco oil (Nicot iana tabacum), peanut oil (Arachis hypogaea) , palm oil, cottonseed oil (Gossypium hirsutum), coconut oil (Cocos nucifera), avocado oil (Persea american a), olive oil (Olea europaea), cashew oil (Anacar dium occidentale), Macadamia oil (Macadamia int ergrifolia), almond oil (Prunus amygdalus), or Arabidopsis seed oil (Arabidopsis thaliana). can be.

[0088] In an embodiment, the cells (recombinant cells) of or used in the present invention are suitable for fermentation. Microbial cells, such as desired cells, preferably to a level of at least 25% by weight. A preferred fermentation method is a method for producing oleaginous microbial cells capable of accumulating acylglycerol. The anaerobic fermentation process is well known in the art. Suitable fermentation cells, usually microorganisms, are fermentable, i.e., capable of fermenting sugars such as glucose or maltose, either directly or indirectly Examples of fermenting microorganisms include fungal organisms such as yeast. As used herein, "yeast" refers to the genus Saccharomyces. myces spp.), Saccharomyces cerevisiae (Saccharomyces cerevisiae), Saccharomyces carlsbergensis (Saccharom yces carlbergensis, Candida spp., Kluveromyces spp., Pichia spp. spp.), Hansenula spp., Trichoderma spp. choderma spp.), Lipomyces starkeyi (Lipomyces sta rkey), and preferably alkane-utilizing yeast (Yarrowia lipolytica ica) is an example.

[0089] In a further aspect, the present invention provides a method for producing a cell of the present invention, an oilseed oil seed of the present invention, or a plant cell of the present invention, using the method of the present invention. The present invention relates to the Brassica genus, Brassica napus. ica napus), mustard (B. juncea), soybean (G. max) or Camelina sativa plants, plant parts of the present invention, or a plant, plant cell, plant part or seed of the present invention. or a fatty acid obtained therefrom. Preferably, the fatty acid is DPA. The fatty acid may be a mixture of fatty acids having a fatty acid composition as described herein, or a fatty acid, preferably Preferably, the DPA comprises at least 40% or at least 90% of the fatty acid content of the mixture. In embodiments, the fatty acids are not esterified. Alternatively, the fatty acid may be esterified, for example to a methyl, ethyl, propyl, or butyl group. It has been done.

[0090] Seed meal obtained from the seeds of the present invention or from the plants of the present invention Preferred seed meals include, but are not limited to, arabidopsis thaliana. Rana genus (Brassica sp.), rapeseed (Brassica napu s), mustard (B. juncea), soybean (Glycine max) seed meal In an embodiment, the seed meal comprises an exogenous polynucleotide as defined herein. In a preferred embodiment, the seed meal comprises a nucleotide and / or a genetic construct. , seed meal is obtained, but most lipids or oils are extracted at low levels (e.g., The seeds retain some of the lipids or oils produced within the seeds (less than 2% by weight). The food meal may be used as an ingredient in animal feed or food products.

[0091] In another aspect, the present invention provides a method for producing a composition comprising one or more lipids or oils of the present invention, fatty acids of the present invention, The cells according to the invention, the oilseed plants according to the invention, the Brassica spp. p.), rapeseed (Brassica napus), mustard (B. juncea) cea), soybean (Glycine max) or camelina sativa (Cameli a plant of the present invention, a plant part of the present invention, a seed of the present invention, or a seed meal of the present invention In embodiments, the composition is for pharmaceutical, food, or agricultural use. use, seed treatment compounds, fertilizers, other food or feed ingredients, or added protein or Contains a suitable carrier for the vitamins.

[0092] One or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, The oilseed plant of the present invention, Brassica sp., (Brassica napus), mustard (B. juncea), soybean (Gly cine. max) or Camelina sativa plant , a plant part of the invention, a seed of the invention, or a seed meal of the invention, or a composition of the invention Also provided are feeds, cosmetics or chemicals containing the lipids of the present invention. It is an infant formula containing oil.

[0093] In another aspect, the present invention provides a method for producing a feed, preferably an infant formula, said method comprising: The method comprises the step of: providing one or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, the The oilseed plant of the present invention, the Brassica sp. of the present invention, Rana (Brassica napus), mustard (B. juncea), soybean (G lycine. max) or Camelina sativa a plant, a plant part of the invention, a seed of the invention, or a seed meal of the invention, or The method includes mixing the composition with at least one other food ingredient. , baking, extruding, emulsifying, or otherwise formulating feed, or packaging feed, or in samples The method may include a step of analyzing the amount of lipid or oil in the sample.

[0094] In another aspect, the present invention provides a method for treating a condition that would benefit from a PUFA, preferably DPA. The present invention provides a therapeutic or prophylactic method for the treatment of a rheumatoid arthritis, the method comprising administering to a subject one or more lipids or oils of the present invention, The fatty acids of the invention, the cells according to the invention, the oilseed plants of the invention, the Brassica (B rassica sp.), rapeseed (Brassica napus), challah China (B. juncea), soybean (Glycine max) or camelina sativa Camelina sativa plants, plant parts of the invention, seeds of the invention, and comprises administering the seed meal of the present invention, the composition of the present invention, or the feed of the present invention. In a preferred embodiment, the PUFA is administered in the form of a pharmaceutical composition comprising an ethyl ester of the PUFA. The subject can be a human or a non-human animal.

[0095] Examples of conditions that may benefit from PUFAs include, but are not limited to, serum triglycerides Increased serum cholesterol levels, including elevated triglyceride levels and elevated LDL cholesterol levels, Cardiac regulation, angiogenesis, inflammation, asthma, psoriasis, osteoporosis, kidney stones, AIDS, multiple sclerosis, Rheumatoid arthritis, Crohn's disease, schizophrenia, cancer, fetal alcohol syndrome, attention deficit hyperactivity disorder Disorders, cystic fibrosis, phenylketonuria, unipolar depression, aggressive hostility, adrenocortical disorders Codystonia, coronary heart disease, hypertension, diabetes, obesity, Alzheimer's disease, chronic obstructive pulmonary disease obstructive pulmonary disease, ulcerative colitis, restenosis after angioplasty, eczema, hypertension, platelet aggregation, gastrointestinal outflow blood, endometriosis, premenstrual syndrome, myalgic encephalomyelitis, chronic fatigue after viral infections or eye Diseases include:

[0096] One or more of the lipids or oils of the invention, the fatty acids of the invention, the cells of the invention, The oilseed plant of the present invention, Brassica sp., (Brassica napus), mustard (B. juncea), soybean (Gly cine. max) or Camelina sativa plant , a plant part of the invention, a seed of the invention, or a seed meal of the invention, a composition of the invention, or or administering the feed of the present invention to treat a condition that would benefit from PUFA, preferably DPA. The use of the compound in the manufacture of a therapeutic or prophylactic medicament is also provided.

[0097] The pharmaceutical preparation comprises a pharmaceutical composition comprising the oil of the present invention in a pharmaceutically acceptable form for the treatment of the conditions described herein. The method may include first purifying the oil and / or mixing it with a suitable carrier. transesterification and / or fractionation of the oil to increase the level of DPA. In certain embodiments, the method may include using a lipid or oil, such as canola oil. The oil is treated to convert the fatty acids in the oil into alkyl esters such as methyl or ethyl. Further processing, such as fractionation or distillation, may be carried out to enrich the DPA in the lipids or oils. In a preferred embodiment, the pharmaceutical agent is an ethyl ester of DPA. In an even more preferred embodiment, the level of the ethyl ester of DPA in the pharmaceutical preparation is The bell is between 30% and 50%, or at least 80%, or at least 85%, or or at least 90%, or at least about 95% of the total fat in the pharmaceutical product. Ethyl esters of EPA with an acid content between 30% and 50%, or at least 90% Such medicaments may be administered to humans or animals for the treatment of the conditions described herein. Suitable for administration to a subject.

[0098] In another aspect, the present invention provides a method for obtaining seeds of the present invention and cultivating the seeds obtained for monetary gain. The present invention provides a method for trading seeds, including trading seeds for the purpose of

[0099] In an embodiment, obtaining the seed comprises cultivating a plant of the invention and / or growing said plant. This includes harvesting seeds from

[0100] In another embodiment, obtaining the seeds includes placing the seeds in a container and / or Further includes storing the offspring.

[0101] In a further embodiment, obtaining the seeds further comprises transporting the seeds to a different location. Included.

[0102] In yet another embodiment, the method further comprises transporting the seeds to a different location after trading the seeds. The method further includes:

[0103] In a further embodiment, the transaction is carried out using electronic means, such as a computer. do.

[0104] Yet in a further aspect, the present invention provides a method for producing a medicament for the treatment of a pulmonary arthritis, comprising: a) wrapping, uprooting and / or harvesting the above-ground parts of plants containing the seeds of the invention; b) Threshing and / or winnowing the plant parts to separate the seeds from the remainder of the plant parts. , and c) sieving and / or sorting the seeds separated in step b) and and filling the separated seeds into a storage box, thereby producing a seed box. A method of manufacture is provided.

[0105] In embodiments, where relevant, lipids or oils of or useful in the present invention, preferably Preferably, the seed oil has a fat level similar to that provided in the tables in the Examples section. It has a

[0106] Any embodiment herein may be used interchangeably with any other embodiment unless expressly stated otherwise. Any changes that need to be made should be made and applied to the current situation.

[0107] The present invention is not limited to the specific embodiments described herein, which are intended for illustrative purposes only. Functionally equivalent products, compositions and methods are not limited in scope by the methods described herein. As such, it is clearly within the scope of the present invention.

[0108] Throughout this specification, unless expressly stated otherwise or the context requires otherwise, A reference to a step, composition of matter, group of steps or group of compositions of matter includes one and more. (i.e., one or more) of these steps, compositions of matter, groups of steps or compositions of matter should be construed to encompass groups.

[0109] The invention will now be described by way of the following non-limiting examples and with reference to the accompanying figures. [Brief explanation of the drawings]

[0110] [Figure 1] Aerobic DPA biosynthesis pathway. [Figure 2]Map of the T-DNA insertion region between the left and right borders of pJP3416-GA7. RB indicates the right border; LB indicates the left border; TER indicates the transcription terminator / polyadenylation region; PRO indicates the promoter; the coding region is indicated above the arrow, and the promoter and terminator are indicated below the arrow. Micpu-Δ6D is the Micromonas pusilla Δ6-desaturase; Pyrco-Δ6E is the Pyramimonas cordata Δ6-elongase; Pavsa-Δ5D is the Pavlova salina Δ5-desaturase; Picpa-ω3D is the Pichia pastoris ω3-desaturase; Pavsa-Δ4D is the P. salina Δ4-desaturase; Lackl-Δ12D is the Lachancea kluyveri Δ12-desaturase; and Pyrco-Δ5E is the Pyramimonas cordata Δ5-elongase. NOS denotes the Agrobacterium tumefaciens novaline synthetic transcription terminator / polyadenylation region; FP1 denotes the Brassica napus truncated napin promoter; FAE1 denotes the Arabidopsis thaliana FAE1 promoter; Lectin denotes the soybean (Glycine max) lectin transcription terminator / polyadenylation region; Cnl1 and Cnl2 denote the flax (Linum usitatissimum) conlinin 1 or conlinin 2 promoter or terminator; and MAR denotes the tobacco (Nicotiana tabacum) Rb7 matrix binding region. [Figure 3] (A) is the structure of a basic plant sterol, with ring and side chain numbers. (B) is the chemical structure of some plant sterols. [Figure 4]Map of the T-DNA insertion region between the left and right borders of pJP3662. RB indicates the right border. LB indicates the left border. TER is the transcription terminator / polyadenylation region. PRO is the promoter. The coding region is indicated above the arrow, and the promoter and terminator are indicated below the arrow. Micpu-Δ6D is the Δ6-desaturase from Micromonas pusilla. Pyrco-Δ6E is the Δ6-elongase from Pyramimonas cordata. Pavsa-Δ5D is the Δ5-desaturase from Pavlova salina. Picpa-ω3D is the ω3-desaturase from Pichia pastoris. Lackl-Δ12D is the Δ12-desaturase from Lachancea kluyveri. Pyrco-Δ5E is the Δ5-elongase from Pyramimonas cordata. NOS is the nopaline synthase transcription terminator / polyadenylation region from Agrobacterium tumefaciens. FP1 is the truncated napin promoter from Brassica napus. FAE1 is the FAE1 promoter from Arabidopsis thaliana. Lectin is the Glycine max lectin transcription terminator / polyadenylation region. Cnl1 is the Linum usitatissimum conlinin 1 promoter or terminator. MAR indicates the Rb7 matrix binding region from tobacco (Nicotiana tabacum).

[0111] Array table key SEQ ID NO:1 - pJP3416-GA7 nucleotide sequence. SEQ ID NO:2 - pGA7-mod_B nucleotide sequence. SEQ ID NO: 3 - Plant Lachancea Kluyveri ) Codon-optimized open reading frame for expression of the Δ12 desaturase. SEQ ID NO: 4 - Lachancea Kluyveri Δ1 2 desaturases. SEQ ID NO: 5 - Plant Pichia pastoris ω3 desa Codon-optimized open reading frame for expression of turase. SEQ ID NO:6 - Pichia pastoris ω3 desaturase -ze. SEQ ID NO:7 - Micromonas pusilla Δ6 - an open reading frame encoding a desaturase. SEQ ID NO:8 - Micromonas pusilla (Micromonas pusilla) ) Codon-optimized open reading frame for expression of Δ6-desaturase. SEQ ID NO:9 - Micromonas pusilla Δ6 -Desaturase. SEQ ID NO: 10 - Ostreococcus lucimarinus cimarinus) Δ6-desaturase-encoding open reading frame . SEQ ID NO: 11 - Plant Ostreococcus lucimarinus (Ostreococcus Codon-optimized open reading frame for expression of (Luciferus lucimarinus) Δ6-desaturase ing frame. SEQ ID NO: 12 - Ostreococcus lucimarinus cimarinus) Δ6-desaturase. SEQ ID NO: 13 - Ostreococcus tauri ) Δ6-desaturase. SEQ ID NO:14 - Pyramimonas cordata Open reading frame encoding Δ6-elongase. SEQ ID NO: 15 - Plant Pyramimonas cordata ta) Codon-optimized open reading frame (3' end) for expression of Δ6-elongase truncated at the ends and encodes a functional elongase). SEQ ID NO:16 - Pyramimonas cordata Δ6-desaturase. SEQ ID NO: 17 - Truncated Pyramimonas cordata ta) Δ6-desaturase. SEQ ID NO: 18 - Pavlova salina Δ5-desaturase An open reading frame encoding the enzyme. SEQ ID NO: 19 - Pavlova salina Δ5-desa Codon-optimized open reading frame for expression of turase. SEQ ID NO: 20 - Pavlova salina Δ5-desaturase -ze. SEQ ID NO:21 - Pyramimonas cordata Open reading frame encoding Δ5-desaturase. SEQ ID NO:22 - Pyramimonas cordata Δ5-desaturase. SEQ ID NO:23 - Pyramimonas cordata Open reading frame encoding Δ5-elongase. SEQ ID NO: 24 - Plant Pyramimonas cordata ta) Codon-optimized open reading frame for expression of the Δ5-elongase. SEQ ID NO:25 - Pyramimonas cordata Δ5-elongase. SEQ ID NO:26 - Pavlova salina Δ4-desaturase An open reading frame encoding the enzyme. SEQ ID NO: 27 - Pavlova salina Δ4-desa Codon-optimized open reading frame for expression of turase. SEQ ID NO: 28 - Pavlova salina Δ4-desaturase -ze. SEQ ID NO:29 - Isochrysis galbana Δ 9-Elongase. SEQ ID NO: 30 - Plant Emiliania huxleyi i) Codon-optimized open reading frame for expression of the Δ9-elongase. SEQ ID NO: 31 - Emiliania huxleyi C CMP1516Δ9-elongase. SEQ ID NO: 32 - Pavlova pinguis Δ9-elonga An open reading frame encoding the enzyme. SEQ ID NO: 33 - Pavlova pinguis Δ9-elonga -ze. SEQ ID NO:34 - Pavlova salina Δ9-elonger An open reading frame encoding ze. SEQ ID NO: 35 - Pavlova salina Δ9-elonger See. SEQ ID NO: 36 - Pavlova salina Δ8-desaturase An open reading frame encoding the enzyme. SEQ ID NO: 37 - Pavlova salina Δ8-desaturase -ze. SEQ ID NO: 38 - V2 viral suppressor. SEQ ID NO:39 - Open reading frame encoding V2 viral suppressor . SEQ ID NO:40 - Arabidopsis thaliana LPA AT2. SEQ ID NO: 41 - Limnanthes alba LPAAT . SEQ ID NO: 42 - Saccharomyces cerevisiae visiae)LPAAT. SEQ ID NO: 43 - Micromonas pusilla L PAAT. SEQ ID NO: 44 - Mortierella alpina LPAAT. SEQ ID NO:45 - Braccisa napus LPAAT. SEQ ID NO:46 - Brassica napus LPAAT. SEQ ID NO: 47 - Phytophthora infestans estans)ω3-desaturase. SEQ ID NO: 48 - Thalassiosira pseudonana (Thalassiosira pseu donana) ω3-desaturase. SEQ ID NO: 49 - Pythium irregulare ω3-desaturase. SEQ ID NOs: 50-58 - Oligonucleotide primers / probes. DETAILED DESCRIPTION OF THE INVENTION

[0112] General Methods and Definitions Specifically, unless otherwise specified, all technical and scientific terms used herein are understood to be within the skill of those of ordinary skill in the art. (e.g., cell culture, molecular genetics, fatty acid synthesis, transgenic plants, recombinant cells, shall be understood to have the same meaning as commonly understood by the is.

[0113] Unless otherwise indicated, the protein, cell culture, and immunological techniques utilized in the present invention are within the skill of the art. This technique is a standard method well known to those skilled in the art. l Guide to Molecular Cloning,John Wiley and Sons (1984), J. Sambrook et al., Molecu lar Cloning:A Laboratory Manual,Cold Spr. ing Harbor Laboratory Press (1989),TA Brown(editor),Essential Molecular Biolog y:A Practical Approach,Volumes 1 and 2,I RL Press (1991),DMGlover and BD.Hame s (editors), DNA Cloning: A Practical Appr. oach, Volumes 1-4, IRL Press (1995 and 199 6),FMAusubel et al.(editors),Current P rotocols in Molecular Biology,Greene Pub .Associates and Wiley-Interscience (1988 ,including all updates until present),Ed Harlow and David Lane (editors), Antibod ies:A Laboratory Manual,Cold Spring Harb our Laboratory,(1988),and JEColigan et al.(editors),Current Protocols in Immun ology, John Wiley & Sons (including all current editions), etc. The following is described and explained based on the references in the materials.

[0114] The term "and / or," e.g., "X and / or Y," means "X and Y" or " It should be understood to mean either "X or Y" and not both or either. It is understood to explicitly support taste.

[0115] As used herein, the term "about" refers to a reference value unless otherwise stated. ±10%, more preferably ±5%, more preferably ±1% of

[0116] Throughout this specification, the words "comprise" or "comprises" Variations such as "rises" or "comprising" refer to The term "element, integer or step" refers to a group of elements, integers or steps, but does not include other elements, It is understood that this does not mean excluding any integer or step or group of elements, integers or steps. It will be solved.

[0117] Selected Definitions As used herein, the terms "extracted plant lipid" and "isolated plant lipid" refer to, e.g., , refers to a lipid composition extracted from a plant or part thereof, such as a seed, for example, by pressing. The extracted lipids may be, for example, relatively crude compositions obtained by pressing plant seeds, or may be extracted from plant seeds. One or more, if not all, of the following from the material: water, nucleic acids, proteins, and carbohydrates If so, it may be possible to remove most of the components and obtain a purer composition. Examples of purification methods are described below. In embodiments, the extracted or isolated plant lipids comprise at least about 60% by weight of the composition, at least at least about 70% by weight, at least about 80% by weight, at least about 90% by weight, or at least The lipids may be solid or liquid at room temperature. In an embodiment, the extract of the present invention may be a liquid, which when liquid is considered to be an oil. Blending lipids with other lipids, such as DPA produced from other sources (e.g., DPA from fish oil) In an embodiment, after extraction, oleic acid is added to DPA, palmitic acid is added to DPA, and one or more of niacin, linoleic acid for DPA, and total omega-6 fatty acids: total omega-3 fatty acids; All ratios were not significantly changed when compared to the ratios in untreated seeds or cells (e.g. In another embodiment, the extracted plant lipids are added to the intact seeds. When compared with the ratios in the nuclei or cells, the ratios of oleic acid to DPA and palmitic acid to DPA one or more of niacin, linoleic acid for DPA, and total omega-6 fatty acids: total omega-3 fatty acids; The extract was not subjected to methods such as hydrogenation or fractionation that could alter all of the ratios. When lipids are contained in oil, the oil may further contain non-fatty acid molecules such as sterols. may be included in.

[0118] As used herein, the terms "extracted vegetable oil" and "isolated vegetable oil" refer to an extract. refers to a substance or composition that contains plant lipids or isolated plant lipids and is liquid at room temperature. The oil is obtained from a plant or a part thereof, such as a seed. The extracted or isolated oil is , for example, relatively crude compositions obtained by pressing plant seeds, or water derived from plant material. most, if not all, of one or more of each of: nucleic acids, proteins, and carbohydrates The composition may be lipid or non-lipid. In embodiments, the oil comprises at least about 60% by weight of the oil, ... at least about 70% by weight, at least about 80% by weight, at least about 90% by weight, or at least In an embodiment, the extracted oil of the present invention comprises about 95% by weight (w / w) of extracted plant lipids. , and blended with other oils such as DPA produced from other sources (e.g., DPA from fish oil). In an embodiment, after extraction, oleic acid to DPA, palmitic acid to DPA Acid, linoleic acid for DPA, and one or more of the total omega-6 fatty acids: total omega-3 fatty acids The ratios of α- and β-actin were not significantly changed when compared with those in untreated seeds or cells (e.g. In another embodiment, the extracted plant oil is added to untreated seeds. Or, when compared with the ratio in cells, oleic acid to DPA, palmitic acid to DPA phosphonic acid, linolenic acid for DPA, and total omega-6 fatty acids: one or more of total omega-3 fatty acids or total The extract of the present invention has not been subjected to methods such as hydrogenation or fractionation that may alter the overall ratio of the plant matter. The oil may also contain non-fatty acid molecules such as sterols.

[0119] As used herein, the terms "extracted microbial lipid" or "extracted microbial oil" and the like refer to The main difference is that they are derived from lipids or oils, and are referred to as "extracted plants" or "extracted plants," respectively. "Vegetable oil extract" has a similar meaning to "vegetable lipid" and "vegetable oil extract."

[0120] As used herein, "oil" refers to a composition that contains primarily lipids and is liquid at room temperature. For example, the oil of the present invention preferably contains at least 75% by weight of at least At least 80%, at least 85% or at least 90% by weight of lipids. The refined oil is a lipid-rich oil having at least 90% by weight of triacylglycerol (TA) Contains diacylglycerol (DAG), free fatty acids (FFA), phospholipids and sucrose. Minor components of the oil, such as terols, may be present as described herein.

[0121] As used herein, the term "fatty acid" refers to a long-chain aliphatic terminal fatty acid that may be saturated or unsaturated. It refers to a carboxylic acid (or organic acid) that often has a terminal end. Usually, fatty acids are short in length. carbon-carbon bonds of at least 8 carbon atoms, more preferably at least 12 carbons in length Preferred fatty acids of the present invention have a chain length of 18 to 22 carbon atoms (C18, C20, C 22 fatty acids), more preferably 20 to 22 carbon atoms (C20, C22) and most preferably Preferably, the carbon chain is 22 carbon atoms (C22). Most naturally occurring fatty acids have a Since the biosynthesis of acetone involves the incorporation of acetate, which has two carbon atoms, Fatty acids may be in the free state (non-esterified) or in the form of triglycerides, diacylglycerides, monoglycerides, nonacylglycerides, acyl-CoA (thioester) bond or other bond moieties The fatty acids may be in esterified form. ethanolamine, phosphatidylserine, phosphatidylglycerol, phosphatidyl Esterified as phospholipids such as inositol or diphosphatidylglycerol In embodiments, the fatty acid may be, for example, a methyl or C20 or C22 PUFA. The fatty acids are preferably esterified with a methyl or ethyl group, such as ethyl esters. EPA, or DPA, or EPA, DPA and DHA, or EPA and DPA The methyl or ethyl ester.

[0122] "Saturated fatty acids" contain no double bonds or other functional groups along the chain. The idea is that every carbon (apart from the carboxylic acid [-COOH] group) contains as many hydrogen atoms as possible. In other words, the omega (ω) end is made up of three hydrogen atoms (-CH3 -), and each carbon in the chain contains two hydrogens (-CH2-).

[0123] An "unsaturated fatty acid" is one in which there are more than one alkene functional group on the chain, and each alkene is at one position on the chain. The double bond "-CH2-CH2-" part is replaced with the double bond "-CH=CH-" part (i.e., another carbon atom). They are similar to saturated fatty acids except that they are substituted with carbon atoms (carbon atoms double-bonded to carbon atoms). The two adjacent carbon atoms in the chain that are attached to either side of the double bond can be cis or In an embodiment, the lipid may be in the trans or trans configuration, preferably in the cis configuration. or oil or the present invention has less than 1% of carbon-carbon double bonds in the trans configuration It has a fatty acid composition that includes fatty acids (trans fatty acids).

[0124] As used herein, the term "monounsaturated fatty acid" refers to a fatty acid having at least one unsaturated fatty acid in its carbon chain. A fatty acid containing 12 carbon atoms and only one alkene group (carbon-carbon double bond) in the chain As used herein, the term "polyunsaturated fatty acid" or "PUFA" refers to At least 12 carbon atoms in the carbon chain and at least two alkene groups (carbon- represents a fatty acid containing a carbon-carbon double bond.

[0125] As used herein, the term "long-chain polyunsaturated fatty acids" or "LC-PUFAs" refers to The term refers to a group having at least 20 carbon atoms in its carbon chain and at least two carbon-carbon dimers in the chain. As used herein, "VLC-PUFA" refers to a fatty acid containing a double bond, and therefore includes VLC-PUFA. The term "very long chain polyunsaturated fatty acids" or "VLC-PUFA" refers to fatty acids that have a medium to short carbon chain. Fatty acids containing at least 22 carbon atoms and at least 3 carbon-carbon double bonds in the chain Usually, the number of carbon atoms in a fatty acid chain represents an unbranched carbon chain. If the main chain is branched, the number of carbon atoms excludes those of the side chain groups. The long-chain polyunsaturated fatty acids are ω3 fatty acids, i.e., the methyl end of the fatty acid is The third carbon-carbon bond has desaturation (a carbon-carbon double bond). In some embodiments, the long-chain polyunsaturated fatty acid is an ω6 fatty acid, i.e., the methyl end of the fatty acid It has a desaturation (carbon-carbon double bond) at the sixth carbon-carbon bond. In some embodiments, the long chain polyunsaturated fatty acid is arachidonic acid (ARA, 20:4Δ5,8, 11, 14;ω6), eicosatetraenoic acid (ETA, 20:4Δ8, 11, 14, 17 ;ω3), eicosapentaenoic acid (EPA, 20:5Δ5, 8, 11, 14, 17;ω3 ), docosapentaenoic acid (DPA, 22:5Δ7, 10, 13, 16, 19;ω3), or or docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19;ω3) The LC-PUFA is selected from the group consisting of dihomo-γ-linoleic acid (DGLA) or or eicosatrienoic acid (ETrA, 20:3Δ11, 14, 17;ω3). The LC-PUFAs produced in accordance with the present invention may be a mixture of any or all of the above. and may contain other LC-PUFAs or derivatives of any of these LC-PUFAs. In a preferred embodiment, the omega-3 fatty acid is at least Also DPA, or DPA and DHA, or EPA, DPA and DHA, or EPA and DPA. In embodiments, DPA is about 7% to 30% or 3.5%, and DHA is absent or, if present, less than 2.0%. Preferably, it is present at a level of less than 1.0%, more preferably less than 0.5%, and most preferably This is because the Δ4-desaturase is not present in the cell. In embodiments, the DPA level is greater than the EPA level, More preferably, greater than the level of each of EPA and DHA, and most preferably, greater than the level of EPA and DHA. In this embodiment, DHA may be absent, If present, it is present at a level of less than 0.5% of the total fatty acid composition.

[0126] Additionally, as used herein, "long chain polyunsaturated fatty acids" (LC-PUFAs) and "Very long chain polyunsaturated fatty acids" (VLC-PUFAs) are found in free (non-esterified) or Triglycerides (triacylglycerols), diacylglycerides, monoacylglycerides Fatty acids in esterified form, such as esters, acyl-CoA conjugates, or other conjugates In triglycerides, LC-PUFAs or VLC-PUFAs such as DPA are It may be esterified at the sn-1 / 3 or sn-2 positions, or the triglyceride may be esterified at the sn-1 / 3 or sn-2 positions. The glyceride is a PUFA having two or three acyl groups selected from LC-PUFA and VLC-PUFA. For example, triglycerides may contain two acyl groups at the sn-1 and sn-3 positions. Both may contain DPA. Fatty acids may be used in phosphatidylcholine (PC), ... Phosphatidylethanolamine, phosphatidylserine, phosphatidylglycerol, As phospholipids such as sphatidylinositol or diphosphatidylglycerol forms Thus, LC-PUFAs can be incorporated into cellular lipids or cells, tissues, or may be present as a mixture in the form of refined oils or lipids extracted from organisms. In an embodiment, the present invention provides at least said triacylglycerol comprising an LC-PUFA. and the remainder being present as other forms of lipids, such as those mentioned, including at least 75% or at least 85% triacylglycerol. followed by hydrolysis, e.g., with a strong base, to liberate the free fatty acids; or It may be further purified or processed by transesterification, distillation, etc.

[0127] As used herein, "total ω6 fatty acids" or "total ω6 fatty acid content" and the like refer to Where appropriate, the fatty acid content may be expressed as a percentage of the total fatty acid content of the extracted lipids, oils, recombinant cells, or the like. All esterified and non-esterified omega-6 fatty acids in the cells, plant parts or seeds These omega-6 fatty acids are LA, GLA, D (if present), and Contains GLA, ARA, EDA and ω6-DPA, and contains ω3 fatty acids and monounsaturated fatty acids The omega-6 fatty acids present in the plants, seeds or oils of the present invention are all polyunsaturated. It is classified as a polyunsaturated fatty acid (PUFA).

[0128] As used herein, "new ω-6 fatty acid" or "new ω-6 fatty acid content" and the like refer to Where appropriate, the fatty acid content may be expressed as a percentage of the total fatty acid content of the extracted lipids, oils, recombinant cells, or the like. Removal of esterified and non-esterified LA in cells, plant parts or seeds These new ω-6 fatty acids represent the sum of all the ω-6 fatty acids introduced into the cells. Expression of the exogenous polynucleotide constructs (exogenous polynucleotides) results in the production of the cells, plants, plant parts and Fatty acids produced in the seeds, including (if present) GLA, DGLA, ARA, Contains EDA and ω6-DPA, but does not contain LA, ω3 fatty acids, or monounsaturated fatty acids Illustrative total ω6 fatty acid content and novel ω6 fatty acid content were determined as described in Example 1. The fatty acids in the sample are determined by converting them to FAMEs and analyzing them by GC.

[0129] As used herein, "total omega-3 fatty acids" or "total omega-3 fatty acid content" and the like refer to a state Where appropriate, the fatty acid content may be expressed as a percentage of the total fatty acid content of the extracted lipids, oils, recombinant cells, or the like. All esterified and non-esterified omega-3 fatty acids in the cells, plant parts or seeds These omega-3 fatty acids are ALA, SDA, and Contains ETrA, ETA, EPA, DPA and DHA, omega-6 fatty acids and monounsaturated fatty acids All omega-3 fatty acids present in the plants, seeds or oils of the present invention are polyunsaturated fatty acids. It is classified as a saturated fatty acid (PUFA).

[0130] As used herein, "new ω-3 fatty acids" or "new ω-3 fatty acid content" and the like refer to Where appropriate, the fatty acid content may be expressed as a percentage of the total fatty acid content of the extracted lipids, oils, recombinant cells, or the like. Esterified and non-esterified ALA in the cells, plant parts or seeds These new ω-3 fatty acids represent the sum of all ω-3 fatty acids removed from the cells. The expression of a gene construct (exogenous polynucleotide) allows the cells, plants, plant parts and and omega-3 fatty acids produced in the seeds, including SDA, EtrA, and E (if present). Contains TA, EPA, DPA and DHA, but also ALA and omega-6 and monounsaturated fatty acids Illustrative total omega-3 fatty acid content and novel omega-3 fatty acid content are described in Example 1. As shown in the figure, the fatty acids in the sample are converted to FAMEs and analyzed by GC. do.

[0131] As one skilled in the art will recognize, "obtaining plant parts" as a step in the method of the present invention refers to the process The method may further comprise harvesting one or more plant parts for use. Harvesting the plant parts may be performed using a mechanical harvester. from plants, such as by using, purchasing plant parts, or receiving plant parts from a supplier. In another example, obtaining the plant parts includes harvesting the plant parts. The purpose of the plant may be to acquire the plant from someone else who has done so.

[0132] Desaturases, elongases and acyltransferases that can be used in the present invention The proteins and the genes encoding them may be any of those known in the art or their homologues. The gene and encoded protein sizes are either log or derivative. Examples of desaccharin-containing enzymes known to be involved in LC-PUFA biosynthesis are listed in Table 1. All of the desaturase enzymes belong to the group of so-called "front-end" desaturases. The desired protein or protein combination is SEQ ID NO: 1 and SEQ ID NO: 2 provided herein. It is encoded by a genetic construct.

[0133] As used herein, the term "front-end desaturase" refers to three highly together with a typical fatty acid desaturase domain containing a conserved histidine box. Structurally characterized by the presence of an N-terminal cytochrome b5 domain, A member of a class of enzymes that introduces a double bond between the carboxylic acid group of the chain and a pre-existing unsaturated moiety. represents (Napier et al., 1997).

[0134] The activity of any elongase or desaturase for use in the present invention can be determined by, for example, For example, in a cell, such as a plant cell, or preferably in a somatic embryo or transgenic plant. In the organism, the gene encoding the enzyme is expressed, and the cell, embryo or plant does not express the enzyme. have an enhanced ability to produce LC-PUFAs compared to comparable cells, embryos or plants This can be tested by determining whether

[0135] In one embodiment, one or more desaturases and / or The elongase can be purified from microalgae, i.e., a polypeptide that can be purified from microalgae. The amino acid sequence is identical to that of the tid.

[0136] While certain enzymes are specifically described herein as "bifunctional," such terms The absence of a specific enzyme does not necessarily mean that it has any activity other than that specifically defined. It doesn't mean that. [Table 1] TIFF2023075083000002.tif255170TIFF2023075083000003.tif255170TIFF2023075083000004.tif255170TIFF2023075083000005.tif25517 0TIFF2023075083000006.tif255170TIFF2023075083000007.tif255170TIFF2023075083000008.tif255170TIFF2023075083000009.tif25276 As used herein, the term "desaturase" refers to a desaturase that desaturates, for example, acyl-CoA esters. The carbon-carbon double bond is inserted into the acyl group of the fatty acid substrate, which is usually in the esterified form, such as esters. It represents an enzyme that can be introduced. It adds an acyl group to a phospholipid such as phosphatidylcholine (PC). or to an acyl carrier protein (ACP), or in a preferred embodiment, CoA Desaturases can therefore generally be divided into three groups: In one embodiment, the desaturase is a front-end desaturase.

[0137] As used herein, a "Δ4-desaturase" refers to a desaturase that desaturates the carboxylic acid terminus of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the fourth carbon-carbon bond. "Δ4-desaturase" refers to a protein that can convert at least DPA to DHA. Preferably, the "Δ4-desaturase" is capable of converting DPA-CoA to D It is capable of converting HA-CoA, i.e., it is an acyl-CoA desaturase. In this form, "Δ4-desaturase" is a enzyme that catalyzes the synthesis of D-esterified PC at the sn-2 position. Preferably, the Δ4-desaturase is capable of converting DPA to DHA-PC. It has greater activity against DPA-CoA than against DPA-PC. The resulting desaturation step is catalyzed by Δ4-desaturase in non-mammalian organisms, The gene encoding this enzyme is found in the freshwater protist species Euglena gracilis ( ilis) and the marine species Thraustochytrium s p.) (Qiu et al., 2001; Meyer et al., 2003). In this embodiment, the Δ4-desaturase encodes an amino acid sequence having the sequence of SEQ ID NO: 28, or Thraustochytrium sp. Δ4-desaturase ze, a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:28 In embodiments, the total extractable fatty acid content is 5% to 35% DPA. The plants, plant parts (or the like) of the present invention or used in the present invention that produce a high level of DPA are seeds, etc.) or cells do not contain a gene encoding a functional Δ4-desaturase.

[0138] As used herein, a "Δ5-desaturase" refers to a desaturase that desaturates the carboxylic acid terminus of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the fifth carbon-carbon bond. In an embodiment, the fatty acid substrate is ETA and the enzyme produces EPA. Preferably, the "Δ5-desaturase" converts ETA-CoA to EPA-CoA. In an embodiment, the "Δ5- The "desaturase" can convert ETA esterified at the sn-2 position of PC. Preferably, the Δ5-desaturase is more efficient at converting ETA-CoA to ETA-PC. Examples of Δ5-desaturases are described by Ruiz-Lopez et al. 2012) and Petrie et al. (2010a) and are listed in Table 1 herein. In one embodiment, the Δ5-desaturase encodes an amino acid sequence having the sequence of SEQ ID NO: 20: a biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO: 20 In another embodiment, the Δ5-desaturase comprises an amino acid sequence having the sequence of SEQ ID NO:22. an amino acid, a biologically active fragment thereof, or an amino acid at least 53% identical to SEQ ID NO:22 In another embodiment, the Δ5-desaturase is derived from a strain of Thraustochytrium sp. Thraustochytrium sp. or Emiliania huxleyi (Emi liania huxleyi).

[0139] As used herein, a "Δ6-desaturase" refers to a enzyme that catalyzes the synthesis of a carboxylic acid terminal ester of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the sixth carbon-carbon bond. In an embodiment, the fatty acid substrate is ALA and the enzyme produces SDA. Preferably, the "Δ6-desaturase" converts ALA-CoA to SDA-CoA. In an embodiment, the "Δ6- "Desaturase" can convert ALA esterified at the sn-2 position of PC. Preferably, the Δ6-desaturase is more efficient at converting ALA-CoA to ALA-PC. Δ6-desaturase has high activity against It may also have a Δ5-desaturase activity towards ALA that is greater than the Δ5-desaturase activity towards ETA. As long as it has 6-desaturase activity, it is called a Δ5 / Δ6-bifunctional desaturase. Examples of Δ6-desaturases are described by Ruiz-Lopez et al. (2012) and Petri (2010a) and listed in Table 1 herein. The enzymes are Micromonas pusilla, Pythium Pythium irregulare or Ostreococcus tau It is derived from Ostreococcus taurii.

[0140] In embodiments, the Δ6-desaturase is selected from the group consisting of: i) linoleic acid ( α-linolenic acid (ALA, 18:3Δ9,12,,ω6) ,15,ω3); ii) PC ​​as a fatty acid substrate ALA bound to the sn-2 position is preferred over ALA-CoA as a fatty acid substrate. iii) Δ6-desaturase activity towards ETrA; and iii) Δ8-desaturase activity towards ETrA. and preferably in a plant cell, having at least two, and preferably all three, of the Such Δ6-desaturases are listed in Table 2.

[0141] In embodiments, the Δ6-desaturase has a higher activity towards an ω3 substrate than the corresponding ω6 substrate. and have a high activity when expressed from an exogenous polynucleotide in a recombinant cell, such as a plant cell. At least 30%, more preferably at least 40%, or most preferably at least ALA with at least 50% efficiency, or at least 35% efficiency when expressed in yeast cells. In contrast, octadecatetraenoic acid (stearidonic acid, SDA, 18:4Δ6,9,12 In one embodiment, the Δ6-deoxyribonucleotide has the activity to produce Δ6-deoxyribonucleotide (Δ6-deoxyribonucleotide). The saturase has higher activity towards ALA than LA as a fatty acid substrate, e.g., In another embodiment, both have approximately two-fold higher Δ6-desaturase activity. The enzyme reacts with ALA bound to the sn-2 position of PC as a fatty acid substrate, and High activity against ALA-CoA as a substrate, e.g., at least about 5-fold higher Δ6-desaturase activity In a further embodiment, the Δ6 -desaturase catalyzes the synthesis of fatty acid substrates ALA-CoA and ALA-CoA bound to the sn-2 position of PC. It has activity against both. [Table 2]

[0142] In one embodiment, the Δ6-desaturase is capable of producing detectable Δ5-desaturase relative to ETA. In another embodiment, the Δ6-desaturase is selected from the group consisting of SEQ ID NO: 9 and 10. , amino acids having the sequence of SEQ ID NO: 12 or SEQ ID NO: 13, biologically active fragments thereof or an amino acid sequence at least 77% identical to SEQ ID NO:9, SEQ ID NO:12 or SEQ ID NO:13 In another embodiment, the Δ6-desaturase comprises the amino acid sequence of SEQ ID NO: 12 or 13, a biologically active fragment thereof, or SEQ ID NO: 12 or or SEQ ID NO: 13. The Δ6-desaturase may also have Δ8-desaturase activity.

[0143] As used herein, a "Δ8-desaturase" refers to a desaturase that desaturates the carboxylic acid terminus of a fatty acid substrate. A desaturase reaction is carried out to introduce a carbon-carbon double bond into the eighth carbon-carbon bond. The Δ8-desaturase represents a protein that can convert at least ETrA to ETA. Preferably, the Δ8-desaturase transcribes ETrA-CoA to ETA-CoA. In an embodiment, the Δ8- The desaturase can convert ETrA esterified at the sn-2 position of PC. Preferably, the Δ8-desaturase is more selective for ETrA-C than for EtrA-PC. Δ8-desaturase has a high activity against oA. It may also have a Δ6-desaturase activity for ETrA that is greater than the Δ6-desaturase activity for ALA. As long as it has the corresponding Δ8-desaturase activity, it is called a Δ6 / Δ8 bifunctional desaturase. Examples of Δ8-desaturases are listed in Table 1. In one embodiment, The saturase may comprise an amino acid sequence having the sequence of SEQ ID NO: 37, a biologically active fragment thereof, or or an amino acid sequence that is at least 80% identical to SEQ ID NO:37.

[0144] As used herein, an "ω3-desaturase" refers to an enzyme that catalyzes the synthesis of methyl-terminated fatty acid substrates. A desaturase reaction that introduces a carbon-carbon double bond into the third carbon-carbon bond Therefore, ω3-desaturase converts LA to ALA and GLA to SDA (saturated fatty acid). C18 fatty acids), or DGLA to ETA, and / or ARA to EPA (C20 fatty acids) Some ω3-desaturases (group I) can be found in plants and It is only active against C18 substrates such as bacterial ω3-desaturases. This ω3-desaturase is also a Δ15-desaturase. The enzymes were either inactive (Group II) or active (Group III) on the C18 substrate. Type III), which has activity towards C20 substrates. Such ω3-desaturases are The preferred ω3-desaturase is also a 17-desaturase. (Pichia pastoris) ω3-desaturase (SEQ ID NO: 6), A group that converts ALA, GLA to SDA, DGLA to ETA, and ARA to EPA. Examples of ω3-desaturases include those described by Pereira et al. (2004) a) (Saprolegnia diclina ω3- desaturase, group II), Horiguchi et al. (1998), Berberi (1998) and Spychalla et al. (1997) (Caenorhabditis erythropoeias C. elegans ω3-desaturase, group III) In a preferred embodiment, the ω3-desaturase is a fungal ω3-desaturase. As used herein, "fungal ω3-desaturase" refers to a fungal ω3-desaturase produced by the fungal ω3-de-saturase family of oomycetes. of fungal origin, including variants thereof with amino acid sequences at least 95% identical The genes encoding many ω3-desaturases are listed in Table 1. For example, Phytophthora infestans s) (Accession No. CAJ30870, WO2005083053; SEQ ID NO: 47), SAPRO Saprolegnia diclina (Accession number AAR2 0444, Pereira et al., 2004a and US7211656), Pythium ilex Pythium irregulare (WO2008022963, group II; SEQ ID NO: 49), Mortierella alpina (Mortierella alpi na) (Sakuradani et al., 2005; Accession No. BAD91495; WO2006 019192), Thalassiosira pseudonana (Thalassiosira pse udonana) (Armbrust et al., 2004; accession number XP_002291057 ; WO2005012316, SEQ ID NO: 48), Lachancea kluyveri (Lachan cea kluyveri) (Saccharomyces kluyveri) es kluyveri; Oura et al., 2004; Accession No. AB1186 63) have been isolated from fungal sources. Xue et al. (2012) reported that C20 substrates are preferred. The oomycete Pythium aphanide can efficiently convert ω6 fatty acid substrates into the corresponding ω3 fatty acids. Pythium aphanidermatum, Phytophthora soja Phytophthora sojae and Phytophthora ramorum ophthora ramorum), that is, That is, they have stronger Δ17-desaturase activity than Δ15-desaturase activity. These enzymes lacked Δ12-desaturase activity but could tolerate acyl esters as substrates. Both the fatty acids from the -CoA and phospholipid fractions can be used.

[0145] In a more preferred embodiment, the fungal ω3-desaturase is derived from Pichia pastoris (Pi chia pastoris ω3-desaturase / Δ15-desaturase (Zha ng et al., 2008; Accession No. EF116884; SEQ ID NO: 6), or at least 95% are identical polypeptides.

[0146] In embodiments, the ω3-desaturase is capable of converting ARA to EPA, DGLA to ETA, G LA to SDA, ARA to EPA and DGLA to ETA, ARA to EPA and G At least one conversion from LA to SDA or all three is possible .

[0147] In one embodiment, the ω3-desaturase is a serotype that has at least three carbon-carbon double bonds. and having Δ17-desaturase activity on a C20 fatty acid, preferably ARA, having In another embodiment, the ω3-desaturase is a C1 desaturase having three carbon-carbon double bonds. 8 fatty acids, preferably GLA. , both activities are present.

[0148] As used herein, a "Δ12-desaturase" refers to an enzyme that cleaves the carboxylic acid end of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond into the 12th carbon-carbon bond from the end Δ12-desaturase usually refers to the protein that converts oleoyl-phosphatidyl Either choline or oleoyl-CoA was added to linoleoyl-phosphatidylinositol, respectively. converting it to linoleoyl-CoA (18:1-PC) or linoleoyl-CoA (18:1-CoA) The subclass that uses PC-bound substrates is called phospholipid-dependent Δ12-desaturases. Therefore, the latter subclass is called acyl-CoA-dependent Δ12-desaturases. Plant and fungal Δ12-desaturases are generally a subclass of the former, while animal Δ12-desaturases are a subclass of the latter, as described, for example, by Zhou et al. (2008) There is a Δ12-desaturase encoded by a gene cloned from an insect. Many other Δ12-desaturase sequences were readily identified by searching sequence databases. can.

[0149] As used herein, a "Δ15-desaturase" refers to a enzyme that cleaves the carboxylic acid end of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond into the 15th carbon-carbon bond from the end Numerous genes encoding Δ15-desaturases are found in plants and It has been cloned from fungal species. For example, US Pat. No. 5,952,544 is a plant Δ15-desaturase. These enzymes are expressed in plant Δ15- It contains the amino acid motif that is characteristic of desaturases. Many other Δ15-desaturases have been described. The enzyme sequences can be readily identified by searching sequence databases.

[0150] As used herein, a "Δ17-desaturase" refers to a enzyme that cleaves the carboxylic acid end of a fatty acid substrate. A desaturase reaction that introduces a carbon-carbon double bond into the 17th carbon-carbon bond from the end Δ17-desaturase is a protein that acts on a C20 substrate to produce an ω3 bond. If it also introduces desaturation, it is also considered an ω3-desaturase.

[0151] In a preferred embodiment, a Δ12-desaturase and / or a Δ15-desaturase is a fungal Δ12-desaturase or a fungal Δ15-desaturase. When used, "fungal Δ12-desaturase" or "fungal Δ15-desaturase" is of fungal origin, including oomycete origin, or a variant with an amino acid sequence at least 95% identical thereto It represents a Δ12-desaturase or a Δ15-desaturase derived from a variety of Genes encoding saturases have been isolated from fungal sources. Δ12-de of Saprolegnia diclina WO2009016202 describes saturases. a robusta, Laccaria bicolor, Lottia gigant ea, Microcoleus chthonoplastes, Monosiga b revicollis, Mycosphaerella fijiensis, Myco spaerella graminicola, Naegleria gruben, N ectria haematococca, Nematostella vectens is, Phycomyces blakesleeanus, Trichoderma resii, Physcomitrella patens, Postia place nta, Selaginella moellendorffii and Microdoc describes a fungal desaturase from Hum nivale. 12316 is a Δ1 WO2003 / 099216 describes 2-desaturases. spora crassa, Aspergillus nidulans, Botryt The fungus Δ isolated from Is cinerea and Mortierella alpina The genes encoding Δ12-desaturase and Δ15-desaturase are described. WO2007133425 discloses Saccharomyces kluyveri, Mortierella alpina, Aspergillus nidulans, Neurospora crassa, Fusarium graminearum, F usarium moniliforme and Magnaporthe grisea The present invention describes a fungal Δ15-desaturase isolated from The turase is derived from Phytophthora sojae (Ruiz-L opez et al., 2012).

[0152] Fungal Δ12-desaturases, and another subclass of fungal Δ15-desaturases, are Bifunctional fungal Δ12 / Δ15-desaturases. The genes encoding them are: Fusarium monoliforme (accession number DQ272516, Damude et al., 2006), Acanthamoeba castellanii (Acanthamoeba cas tellanii) (accession number EF017656, Sayanova et al., 2006), - Perkinsus marinus (WO20070425 10), Claviceps purpurea (accession no. No. EF536898, Meesapyodsuk et al., 2007) and Coprinus cinere Coprinus cinereus (accession number AF269266, Zhang et al., 2007).

[0153] In another embodiment, the ω3-desaturase has at least some activity and is preferred. or have greater activity towards acyl-CoA substrates than the corresponding acyl-PC substrates. As used herein, a "corresponding acyl-PC substrate" refers to a substrate in which a fatty acid is converted to the acyl-C The same fatty acid as in the oA substrate, phosphatidylcholine (PC), is esterified at the sn-2 position. For example, the acyl-CoA substrate may be ARA-CoA. The corresponding acyl-PC substrate is sn-2ARA-PC. Preferably, the ω3-desaturase is at least two times greater than the acyl-CoA substrate. and the corresponding acyl-PC substrates, and Examples of such ω3-desaturases are Among the fungal desaturases that have been cloned are known:

[0154] In a further embodiment, the ω3-desaturase comprises an amino acid sequence having the sequence of SEQ ID NO:6. , a biologically active fragment thereof, or at least 60% identical to SEQ ID NO: 6, or an amino acid sequence that is at least 90% or at least 95% identical to SEQ ID NO:6. include.

[0155] In yet a further embodiment, the desaturase for use in the present invention is It has greater activity towards acyl-CoA substrates than towards acyl-PC substrates. In certain embodiments, the desaturases for use in the present invention convert the corresponding acyl-CoA substrates to It has high activity towards acyl-PC substrates, but some activity towards both substrates. As mentioned above, a "corresponding acyl-PC substrate" is a substrate in which a fatty acid is attached to the acyl-CoA group. Esterified at the sn-2 position of phosphatidylcholine (PC) with the same fatty acid as in the substrate. In embodiments, the greater activity is at least two times greater. In embodiments, the desaturase is a Δ5 or Δ6-desaturase, or an ω3 -desaturases, examples of which include, but are not limited to, those listed in Table 2. The substrate on which the desaturase acts, e.g., acyl-CoA or acyl-CoA, To test the ru-PC substrate, Domergue et al. (2003 and 2005) The assay can be carried out in the yeast cells described. When the elongase catalyzes the elongation of the product of the desaturase, the elongase is less When both have an enzymatic conversion efficiency within the plant cell of about 90%, the acyl desaturase Based on this, the GA7 construct (see Example 2, Figure 2 and Sequence Listing) was used to predict the ability of the GA7 construct to utilize α-CoA as a substrate. Δ5-desaturase expressed from α-aspartic acid (see column no. 1) and its mutants (Example 3) Δ4-desaturase and Δ4-desaturase react with their respective acyl-CoA substrates, ETA-CoA It can desaturate DPA-CoA and DPA-CoA.

[0156] Elongated Fatty acid elongation consists of four steps: condensation, reduction, dehydration, and a second reduction. Biochemical evidence suggests that, in the context of the present invention, "elongase" refers to enzymes that are produced under appropriate physiological conditions. Below, the polypeptide that catalyzes the condensation step in the presence of other members of the elongation complex is depicted. Intracellular heterologous expression of only the condensing component ("elongase") of the protein complex or homologous expression Expression is known to be necessary for the elongation of each acyl chain. The engineered elongase can successfully recruit reducing and dehydrating activities from the transgenic host. The acyl elongation reaction is successfully carried out. The characteristics of the elongation reaction depend on the chain length and degree of unsaturation of the fatty acid substrate. The isomerism is thought to belong to the condensation component. This component is also thought to be rate-limiting in the elongation reaction. can be.

[0157] As used herein, a "Δ5-elongase" refers to an enzyme that at least converts EPA to DPA. Examples of Δ5-elongases include those disclosed in WO2005 / 103253. In one embodiment, the Δ5-elongase has the following activity against EPA: At least 60%, more preferably at least 65%, more preferably at least 70% , most preferably with an activity to produce DPA with an efficiency of at least 80% or 90%. In a further embodiment, the Δ5-elongase has the amino acid sequence of SEQ ID NO: 25, a bioactive fragment, or an amino acid sequence that is at least 47% identical to SEQ ID NO: 25; In a further embodiment, the Δ6-elongase is derived from Ostreococcus tauri (O streococcus taurii) or Ostreococcus lucimarinus ( Ostreococcus lucimarinus (US2010 / 08 8776).

[0158] As used herein, a "Δ6-elongase" refers to an enzyme that at least converts SDA to ETA. Examples of Δ6-elongases include those listed in Table 1. In one embodiment, the Δ6-elongase comprises an amino acid sequence having the sequence of SEQ ID NO: 16, a biologically active fragment of SEQ ID NO: 17 (such as a fragment of SEQ ID NO: 16 or comprises an amino acid sequence that is at least 55% identical to one or both of SEQ ID NO: 17. In embodiments, the Δ6-elongase is derived from Physcomitrella patens. rella patens) (Zank et al., 2002; Accession No. AF428243) and is Thalassiosira pseudonana (Ruiz-Lopez et al., 20 12) Origin.

[0159] As used herein, "Δ9-elongase" refers to an enzyme that converts ALA to ETrA at least once a year. Examples of Δ9-elongases are listed in Table 1. In one embodiment, the Δ9-elongase comprises an amino acid sequence having the sequence of SEQ ID NO: 29: A biologically active fragment thereof, or an amino acid sequence at least 80% identical to SEQ ID NO:29 In another embodiment, the Δ9-elongase comprises an enzyme having the sequence of SEQ ID NO: 31. amino acid, a biologically active fragment thereof, or at least 81% identical to SEQ ID NO: 31 In another embodiment, the Δ9-elongase comprises the amino acid sequence of SEQ ID NO: 33. or a biologically active fragment thereof, or a sequence at least 50% identical to SEQ ID NO: 33. In another embodiment, the Δ9-elongase comprises an amino acid sequence which is identical to SEQ ID NO: 35. or a biologically active fragment thereof, or a combination of SEQ ID NO: 35 and at least In a further embodiment, the Δ9-elongase comprises an amino acid sequence that is 50% identical to They have greater activity towards ω6 substrates than the corresponding ω3 substrates, or vice versa.

[0160] As used herein, "a compound that has greater activity on an ω6 substrate than on the corresponding ω3 substrate" means a compound that has greater activity on an ω6 substrate than on the corresponding ω3 substrate. The term "performs" refers to the action of ω-3 desaturase and the relative activity of the enzymes on different substrates. Preferably, the ω6 substrate is LA and the ω3 substrate is ALA.

[0161] The elongase having Δ6-elongase and Δ9-elongase activity is at least (i) SDA can be converted to ETA, and (ii) ALA can be converted to ETrA, and Δ9- In one embodiment, the enzyme has a Δ6-elongase activity greater than the elongase activity of the enzyme. Longase has at least 50%, more preferably at least 60%, activity relative to SDA. Conversion efficiency to produce ETA and / or ALA is at least 6%, preferably Preferably, the conversion efficiency to produce ETrA is at least 9%. The elongase exhibits at least about 6.5-fold greater Δ6-elongase activity than Δ9-elongase activity. In a further embodiment, the elongase has detectable Δ5-elongase activity. It has no longase activity.

[0162] Other enzymes into recombinant cells, such as microbial cells, or into transgenic plants or parts thereof The introduced transgene may also encode LPAAT. Phosphatidic acid acyltransferase or acyl-CoA-lysophosphatidic acid acyltransferase 1-acylglycerol-3-phosphate acyltransferase, also known as 1-acylglycerol-3-phosphate acyltransferase The term "lipoproteinase (LPAAT)" refers to the enzyme sn-1-acylglycerol-3-phosphate activator (SN-1A). Phosphatidic acid (sn-1G-3-P) is acylated at the sn-2 position to give phosphatidic acid (PA). Therefore, "1-acyl-glycerol-3-phosphate acylate" refers to the protein produced. The term "transferase activity" refers to the activity of the enzyme that converts sn-1 G-3-P into acetyltransferase at the sn-2 position. The preferred LPAAT is Polyunsaturated C22 acyl groups are converted to LP using polyunsaturated C22 acyl-CoA as a substrate. A is capable of transferring to the sn-2 position of A to generate PA. The unsaturated C22 acyl-CoA is DPA-CoA. 6 and can be tested as described therein. In an embodiment, useful LPs of the present invention AAT is a compound containing an amino acid sequence having any one of SEQ ID NOs: 40 to 46, and its biologically active compounds. fragment, or any one or more of SEQ ID NOs: 40-46, which are at least 40% identical In another embodiment, the LPAAT comprises an amino acid sequence selected from the group consisting of any one of SEQ ID NOs: 44. In a preferred embodiment, the amino acid sequence is C22 polyunsaturated fatty acid. LPAATs useful in the present invention can use a dihydrol-CoA substrate, preferably DPA-CoA. The amino acid sequence of SEQ ID NO: 41, 42, or 44, and its biological activity a fragment of any one or more of SEQ ID NOs: 41, 42 and 44 and at least 40 In a preferred embodiment, the amino acid sequence is a C22 polyunsaturated fatty acyl LPAATs useful in the present invention can use a -CoA substrate, preferably DPA-CoA. , an amino acid having any one of the sequences of SEQ ID NO: 41 or 42, a biological activity flag thereof ment, or any one or more of SEQ ID NOs: 41 or 42, In an embodiment, the LPAAT preferably comprises an amino acid sequence Mortierella alpina (Mortierella alp) as set forth in SEQ ID NO: 44 a) LPAAT, or DPA-CoA as a substrate, converts DPA to LPA. It is another LPAAT that can transfer to generate PA with DPA at the sn-2 position.

[0163] Introduced into recombinant cells, transgenic cells, transgenic plants or parts thereof The introduced transgene may also encode a DGAT. glycerol acyltransferase (EC 2.3.1.20; DGAT) The term refers to the transfer of a fatty acyl group from acyl-CoA to a diacylglycerol substrate to form a triacylglycerol. Therefore, "diacylglycerol acyl" refers to a protein that produces diacylglycerol. The term "transferase activity" refers to the activity of acyl-CoA to diacylglycerol transferase. These genes are DGAT1 and DGAT2, respectively, which produce triacylglycerol. There are three known types of DGATs, called DGAT1 and DGAT3. DGAT2 typically has 10 transmembrane domains, while DGAT3 typically has 2 transmembrane domains. DGAT1 polypeptides are typically soluble, whereas DGAT3 polypeptides are typically soluble. Aspergillus fumigatus ) (Accession number XP_755172), Arabidopsis thaliana (Arabidopsis thaliana liana)(CAB44774), Ricinus communis( AAR11479), Vernicia fordii (ABC94 472), Vernonia galamensis (A BV21945, ABV21946), Euonymus alatus ( AAV31083), Caenorhabditis elegans (AAF 82410), Brown rat (Rattus norvegicus) (NP_44588 9), Homo sapiens (NP_036211), and The polypeptide encoded by the variant and / or mutant DGAT1 gene of Examples of DGAT2 polypeptides include those derived from Arabidopsis thaliana ( sis thaliana) (accession number NP_566952), castor bean (Ricinus communis) s communis) (AAY16324), Vernicia f ordii) (ABC94474), Mortierella lamaniana (Mortierella la ramanniana) (AAK84179), Homo sapiens (Homo sa piens) (Q96PD7, Q58HT5), cattle (Bos taurus) (Q70 VD8), Mus musculus (AAK84175), Micromouse Micromonas CCMP1545, and its mutants and / or explants Examples include polypeptides encoded by natural mutant DGAT2 genes. Examples of polypeptides include those derived from peanuts (Arachis hypogaea, Saha et al., 2006) and its variants and / or mutants of the DGAT3 gene Examples of such polypeptides include:

[0164] Polypeptides / Peptides The terms "polypeptide" and "protein" are generally used interchangeably.

[0165] A polypeptide or a classification of polypeptides is determined by its amino acid sequence relative to a reference amino acid sequence. The degree of identity (percent identity) of sequences or the degree of identity of one reference amino acid sequence to another A reference amino acid sequence can be defined as having a greater percent identity to the reference amino acid sequence. The % identity of a polypeptide to a sequence is typically calculated using a gap creation penalty of 5, and GAP analysis (N eedleman and Wunsch, 1970; GCG program). The query sequence must be at least 15 amino acids long, and the GAP analysis must be at least 15 Aligns two sequences across a region of amino acids. More preferably, the query sequence is: At least 50 amino acids in length, and GAP analysis is performed over a region of at least 50 amino acids. More preferably, the query sequence is at least 100 amino acids long. GAP analysis aligns two sequences over a region of at least 100 amino acids. Even more preferably, the query sequence is at least 250 amino acids in length. Thus, GAP analysis aligns two sequences over a region of at least 250 amino acids. More preferably, GAP analysis aligns the two sequences over their entire length. A class of peptides or polypeptides may have the same enzymatic activity as a reference polypeptide, It may have a different activity or no activity. is at least 10%, at least 50%, at least 75% or has at least 90% enzyme activity.

[0166] As used herein, a "biologically active" fragment is, for example, a desaturase and and / or a definition of a full-length reference polypeptide having elongase activity or other enzymatic activity. As used herein, a polypeptide is a portion of a polypeptide as defined herein that maintains the desired activity. When used herein, a biologically active fragment excludes the full-length polypeptide. The components can be moieties of any size as long as they maintain the defined activity. Preferably, the biologically active fragment comprises at least 10% of the full-length protein, at least The compound may retain at least 50%, at least 75% or at least 90% of its activity.

[0167] For a defined polypeptide or enzyme, higher identities than those provided herein It will be understood that the percentage figures encompass preferred embodiments. If so, the polypeptide / enzyme is identified as having the same or similar identity as the relevant designated sequence number, based on the minimum % identity figure. and at least 60%, more preferably 65%, more preferably 70%, more preferably is 75%, more preferably 76%, more preferably 80%, more preferably 85%, more preferably Preferably 90%, more preferably 91%, more preferably 92%, more preferably 93% %, more preferably 94%, more preferably 95%, more preferably 96%, more preferably At most 97%, more preferably 98%, more preferably 99%, more preferably 99.1% , more preferably 99.2%, more preferably 99.3%, more preferably 99.4%, More preferably, 99.5%, more preferably, 99.6%, more preferably, 99.7%, Preferably, the amino acid sequence is 99.8%, and even more preferably 99.9% identical. It is preferable to

[0168] Amino acid sequence variants / mutants of the polypeptides defined herein are referred to herein as By introducing appropriate nucleotide changes into the defined nucleic acid, or Such variants / mutants can be prepared by in vitro synthesis of the nucleotides. The term "deletion, insertion and substitution" refers to a deletion, insertion or substitution of residues within the amino acid sequence. Combinations can be performed to arrive at the final construct, provided that the final peptide construct has the desired enzymatic activity. It has sexuality.

[0169] Mutant (altered) peptides can be prepared using any technique known in the art. For example, the polynucleotides defined herein can be subjected to in vitro mutagenesis. Induction or DNA shuffling as extensively described by Harayama (1998) Mutation / altered DNA derived products can be generated using the techniques described herein. and they can be readily screened using techniques such as those described above to identify enzymes that are capable of, for example, desaturases or erodes. It can be determined whether the protein has enzyme activity.

[0170] In designing amino acid sequence mutants, the location of the mutation site and the nature of the mutation are determined by the modification. The site of the mutation will depend on the characteristics to be enhanced. For example, (1) first, a conservative amino acid sequence is selected. Substitution by selection of an acid, then by selection of more radicals depending on the results obtained, (2) by deleting the target residue, or (3) by inserting another residue adjacent to that position. These can be modified individually or sequentially.

[0171] Deletions of amino acid sequences generally range from about 1 to 15 residues, more preferably from about 1 to 10 residues. Typically in the range of about 1 to 5 adjacent residues.

[0172] Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and The most attractive sites for substitutional mutagenesis are: These sites include those that are not conserved among naturally occurring desaturases or elongases. Positions are preferably substituted in a relatively conservative manner to maintain enzymatic activity. Suitable conservative substitutions are shown in Table 3 under the heading "Illustrative Substitutions."

[0173] In a preferred embodiment, the mutant / variant polypeptide has a When the amino acid sequence has only conservative amino acid changes, or when the amino acid sequence has only conservative amino acid changes, the amino acid sequence has one or two or three or four The details of the conservative amino acid changes are shown in Table 3. As will be appreciated, such small changes can be made to the polypeptide when expressed in recombinant cells. The activity is not altered and is reasonably predictable. [Table 3]

[0174] Polynucleotides The present invention relates to chimeric genes, such as genes, isolated polynucleotides, and T-DNA molecules. The use of the polynucleotide, which may be a gene construct or chimeric DNA, is also provided. The peptides may be DNA or RNA of genomic or synthetic origin, double- or single-stranded. and may be a carbohydrate, lipid, protein, or The term "polynucleotide" as used herein may be used interchangeably with "polynucleotide" or "polynucleotides ... , is used interchangeably with the term "nucleic acid molecule."

[0175] In embodiments, the polynucleotide is non-naturally occurring. Examples of non-naturally occurring polynucleotides include may be mutated (such as by using the methods described herein), and protein-encoding open reading frames that are not associated in nature. A polynucleotide operably linked to a promoter (such as the constructs described herein) Examples include:

[0176] As used herein, the term "gene" should be considered broadly and includes any gene that is transcribed. the deoxyribonucleotide sequence containing the region and, if translated, the structural gene and for a distance of at least about 2 kb on either end, It contains sequences adjacent to the coding region on both the 5' and 3' ends and is involved in the expression of the gene. In this regard, genes are composed of control signals such as promoters, enhancers, and termination. and / or the polyadenylation signal naturally associated with a given gene, or The term "chimeric gene" refers to a gene containing heterologous regulatory signals. The sequences located 5' and present on the mRNA are called 5' untranslated sequences. The sequences located 3' or downstream of the coding region and present on the mRNA are called 3' untranslated sequences. The term "gene" encompasses both cDNA and genomic forms of a gene. A genomic body or clone of a gene contains "introns" or "intervening regions" or "intervening sequences" Introns are sequences that encode the coding region of a nuclear RNA molecule. Introns are segments of a gene that are transcribed into hnRNA (hnRNA). Introns may be removed or "deleted" from the nuclear or primary transcript. splicing; thus, introns are inserted into the messenger RNA (mRNA) transcript. mRNA is the sequence or order of amino acids in a nascent polypeptide during translation. The term "gene" refers to any or all of the proteins described herein. A synthetic or fusion molecule encoding a portion and a complementary nucleotide to any one of the above. Contains code arrays.

[0177] As used herein, "chimeric DNA" or "chimeric gene construct" or similar A "DNA construct" refers to a DNA molecule that is not a naturally occurring DNA molecule in its natural location, and is used herein to refer to a "DNA construct" Typically, chimeric DNA or chimeric genes are naturally occurring, operably linked together. No homologous regulatory and transcriptional or protein sequences were found, i.e., non-homologous to each other. Therefore, chimeric DNA or chimeric genes are prepared from different sources. The nucleotide sequence and the coding sequence, or sequences derived from the same source but arranged differently from those found in nature, It may include regulatory and coding sequences located therein.

[0178] "Endogenous gene" refers to a native gene in its natural location in the genome of an organism. As used herein, "recombinant nucleic acid molecule," "recombinant polynucleotide," or variants thereof refers to a nucleic acid molecule constructed or modified by recombinant DNA technology. "Exogenous polynucleotide" or "exogenous polynucleotide" or "heterologous polynucleotide" refers to a nucleic acid that has been introduced into the genome of a cell by experimental manipulation. A foreign or exogenous gene is a gene that is not naturally occurring. a gene inserted into a natural organism, a natural gene introduced into a new location within its natural host, or A "transgene" is a gene that is introduced into a genome by a transformation method. The terms "genetically modified," "transgenic," and variations thereof are introducing genes into cells by transformation or transduction; Mutating and the genes in the cells or organisms in which these actions occur or their descendants As used herein, "genomic region" includes altering or modulating the regulation of The transgene or group of transgenes (also referred to herein as a cluster) is introduced into the cell or represents the location in the genome where it was inserted into its ancestor. Such regions are described herein. It includes only nucleotides incorporated by human intervention, such as by a method.

[0179] The term "exogenous" in reference to a polynucleotide refers to an altered form of the polynucleotide compared to its natural state. In one embodiment, the cell is A cell that does not naturally contain the polynucleotide. However, the cell may contain the encoded The cells contained non-endogenous polynucleotides resulting in altered production of the polypeptide. The exogenous polynucleotide may be present in a transgenic (recombinant) cell or in a If so, the polynucleotide is not separated from other components of the cell-free expression system, and such cells Produced in a cell-free system that has been subsequently purified away from cells or at least some other components An exogenous polynucleotide (nucleic acid) is a naturally occurring nucleoside. It can be a contiguous stretch of peptides or can be joined together to form a single Nucleotides from different sources (natural and / or synthetic) that produce single-stranded polynucleotides Typically, such chimeric polynucleotides comprise two or more contiguous stretches of the target operable with a suitable promoter to drive transcription of the open reading frame in the cell The nucleic acid sequence comprises at least an open reading frame encoding a polypeptide linked to

[0180] With respect to the defined polynucleotides, percent identity characteristics higher than those stated above are preferred. It will be appreciated that this encompasses embodiments where applicable. In terms of the percent identity figure, the polynucleotide has at least 6 identical sequences with the associated designated SEQ ID NO. 0%, more preferably 65%, more preferably 70%, more preferably 75%, more preferably or 80%, more preferably 85%, more preferably 90%, more preferably 91%, More preferably 92%, more preferably 93%, more preferably 94%, more preferably 95%, more preferably 96%, more preferably 97%, more preferably 98%, more preferably Preferably 99%, more preferably 99.1%, more preferably 99.2%, and even more preferably is 99.3%, more preferably 99.4%, more preferably 99.5%, more preferably 99.6%, more preferably 99.7%, more preferably 99.8%, even more preferably Preferably, the polynucleotide sequences are at least 99.9% identical.

[0181] A polynucleotide may contain deletions, insertions, or deletions of nucleotide residues when compared to the native molecule. may have one or more mutations that are substitutions. Polynucleotides may be naturally occurring (i.e., isolated from natural sources) or synthetic (e.g., derived from the nucleic acids described above). either by site-directed mutagenesis or DNA shuffling of the Thus, whether the polynucleotide is of natural origin or recombinant, It is clear that preferred polynucleotides can be derived from plant cells, as known in the art. It has a coding region that is codon-optimized for translation within the

[0182] Recombinant vector Recombinant expression is used to produce recombinant cells, or plants or plant parts of the invention. The recombinant vector can be used to express a heterologous polynucleotide sequence, i.e., A polynucleotide molecule as defined herein derived from a species other than the species from which the polynucleotide molecule is derived. The vector contains a polynucleotide sequence not found in nature adjacent to the RNA molecule. They can be either A or DNA and are usually plasmids. Plasmid vectors are , usually an expression cassette in a prokaryotic cell, for example, a pUC-derived vector, a pSK-derived vector , pGEM-derived vector, pSP-derived vector, pBS-derived vector, or preferably , easy selection, amplification, and transformation of binary vectors containing one or more T-DNA regions - Patents.com The additional nucleic acid sequence provides for autonomous replication of the vector. an origin of replication, preferably a selectable marker gene encoding antifungal or herbicide resistance; Provides multiple sites for inserting genes encoded within a gene, nucleic acid sequence, or nucleic acid construct Unique multiple cloning site and facilitates transformation of prokaryotic and eukaryotic cells (especially plants) The recombinant vector preferably contains a sequence that encodes a chimeric gene construct as defined herein. In combination with the construct, more than one polynucleotide as defined herein, e.g., 3 Each of the polynucleotides may comprise one, four, five or six of the polynucleotides defined herein. The polynucleotide is operably linked to an expression control sequence operable in a cell of interest. Preferably, the expression control sequences include or are all heterologous promoters. That is, they are heterologous with respect to the coding regions they control. More than one polynucleotide, e.g., three, four, five, or six polynucleotides Preferably, seven or eight polynucleotides each encoding a different polypeptide. The genes are preferably covalently linked in one recombinant vector within one T-DNA molecule. and then introducing the resulting vector as a single molecule into a cell to produce a recombinant cell according to the invention; Preferably, the gene is integrated into the genome of a recombinant cell, e.g., a transgenic plant. Integration into the genome can be in the nuclear genome or in the plastids of transgenic plants. It may be integration into the genome, whereby the polynucleotide so linked , will be inherited together as a single locus in the progeny of the recombinant cell or plant. A host or plant may contain two or more such recombinant vectors, each containing, for example, For example, multiple recombinant vectors each containing three, four, five, or six polynucleotides. It contains a number of polynucleotides.

[0183] As used herein, "operably linked" refers to the binding of two or more nucleic acids (e.g., DNA) Represents the functional relationship between segments, usually transcriptional regulatory elements for transcribed sequences The functional relationship of the promoter. For example, a promoter is a A polynucleotide as defined herein is considered to be a polypeptide of interest if it stimulates or modulates the transcription of a coding sequence of the polypeptide. Generally, it is operably linked to a transcription sequence. A promoter transcriptional regulatory element is physically adjacent to a transcribed sequence, i.e., However, some transcriptional regulatory elements, such as enhancers, The transcription factors are located physically adjacent to or in close proximity to the coding sequence whose transcription they promote. There's no need to be.

[0184] When multiple promoters are present, each promoter may be independently selected from the same or different promoters. Preferably, at least three of the six different promoter sequences are used. can be used in recombinant vectors to control the expression of exogenous polynucleotides. do.

[0185] Recombinant molecules, such as chimeric DNA or gene constructs, (a) encode a single peptide sequence; and the expressed polypeptide as defined herein produces or Localization of the expressed polypeptide, e.g., of the polypeptide in the endoplasmic reticulum (ER) within the cell. (b) one or more secretion signals that provide for retention of the nucleic acid as a fusion protein; and / or It may also include fusion sequences that result in expression of a molecule. Any signal sequence capable of inducing the secretion or localization of a polypeptide as defined herein. A recombinant molecule includes a nucleic acid sequence surrounding and constitutive of a nucleic acid molecule as defined herein. and / or may also include intervening and / or untranslated sequences.

[0186] To facilitate identification of transformants, the nucleic acid construct may be a foreign or Selectable as, or in addition to, an exogenous polynucleotide or preferably contains a screenable marker gene. The marker gene confers a different phenotype on cells that express it, and therefore, such transformation The term "transformed cells" refers to a gene that allows transformed cells to be distinguished from cells that do not have the marker. A selectable marker gene is a gene that inhibits the growth of a plant by the action of a selective agent (e.g., a herbicide, fungicide, radiation, heat, or "selection" based on resistance to other treatments that damage untransformed cells Screenable marker genes (or reporter genes) by observation or testing, i.e., "screening" (e.g., β-glucuronidal enzymes, luciferase, GFP, or other enzymatic activities not present in untransformed cells. The marker gene and the nucleotide sequence of interest provide an identifiable characteristic. The actual selection of the marker is performed by associating it with the cell of choice, such as a plant cell. As long as the combination is functional (i.e., selective), it is not critical.

[0187] Examples of selectable markers are ampicillin, chloramphenicol or tetracycline. A marker that confers resistance to phosphorus, preferably antibacterial resistance, such as kanamycin resistance. Illustrative selectable markers for selection of transformants include, but are not limited to, However, the hyg gene encodes resistance to hygromycin B; kanamycin, paromomycin , neomycin phosphotransferase (nptII) that confers resistance to G418 genes that confer resistance to glutathione-inducing herbicides, such as those described in EP 256223 rat liver glutathione S-transferase; e.g., when overexpressed, WO87 / 05327, and glutamine synthetase inhibitors such as phosphinothricin. resistance to the selective agent phosphinothricin described in EP 275957. Streptomyces viridchromogenes ochromogenes) acetyltransferase genes, e.g., Hinch Conferring resistance to N-phosphonomethylglycine, as described by ee et al. (1988) Gene encoding 5-enolshikimate-3-phosphate synthase (EPSPS) or preferably resistant to bialaphos, e.g. as described in WO 91 / 02071 An example is the bar gene, which confers

[0188] Preferably, the nucleic acid construct is stably integrated into the genome of the cell, such as a plant cell. The nucleic acid may also contain appropriate elements that allow the molecule to be integrated into a genome. Preferably, the left and right border sequences of the T-DNA molecule or construct are integrated into the chromosome of the cell. Place it in a suitable vector that can be loaded.

[0189] Expression As used herein, an expression vector is a vector that is used to transform a host cell and express one or more It is a DNA vector capable of influencing the expression of a specific polynucleotide molecule of The expression vector of the present invention is capable of expressing genes in recombinant cells such as plant cells or microbial cells. The expression vector useful in the present invention includes a transcriptional control sequence, a translational control sequence, a replication activator, and a transcription factor. Origin and recombinant cells compatible with and controlling the expression of the polynucleotide molecules of the present invention. In particular, the polynucleotides or vectors useful in the present invention may contain regulatory sequences such as The target contains transcriptional control sequences, which control the initiation, elongation, and termination of transcription. In particular, important transcription control sequences are transcription control sequences such as promoter and enhancer sequences. Suitable transcription control sequences include those that control transcription initiation. The transcription control sequence may be any that can function in the cell. The choice of regulatory sequence used depends on the target gene. Such regulatory sequences depend on the target organism, such as a plant and / or organ or tissue. They may be obtained from eukaryotic organisms such as plants or plant viruses, or may be chemically synthesized. A variety of such transcription control sequences are known to those skilled in the art. Particularly preferred transcription control sequences are: Consistently or depending on the use of the plant or its parts, specific stages and / or tissues Either is an active promoter that directs transcription in plants.

[0190] Several suitable vectors for stable transfection of plant cells or establishment of transgenic plants are available. Some vectors are described, for example, in Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987;Weiss bach and Weissbach, Methods for Plant Molecules lar Biology, Academic Press, 1989; and Gelvin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Generally, plant expression The vector may contain, for example, 5' and 3' regulatory sequences and transcriptional control sequences of a dominant selectable marker. Such plant expression vectors may include one or more of the following cloned plant genes: target regulatory region (e.g., inducible or constitutive, environmentally regulated or developmentally regulated, or or regulatory regions that control cell- or tissue-specific expression), transcription start sites, ribosomal tyrosine-binding sites, RNA processing signals, transcription termination sites, and / or polyadenylation It may also include a signal.

[0191] Several constitutive promoters active in plant cells have been described. Suitable promoters include, but are not limited to, those derived from cauliflower mosaic virus (Ca MV) 35S promoter, Figwort mosaic virus (FMV) 35S, and rib Light-inducible promoter from the small subunit of sulose-1,5-bisphosphate carboxylase Examples include:

[0192] For the purpose of expression of source tissues of the plant, such as leaves, seeds, roots or stems, the promoters utilized in the present invention are It is preferred that the promoter have relatively high expression in these specific tissues. are well known in the art. Various plant gene promoters that are regulated in response to the Alternatively, organ-specific promoters may be used, or it may be advantageous to use organ-specific promoters.

[0193] As used herein, the term "seed-specific promoter" or variations thereof refers to a promoter that is Preferentially, when compared to other plant tissues, plants, preferably Brassica ca sp.), Camelina sativa or soybean ( 1 depicts a promoter that directs gene transcription in developing seeds of G. max plants. In this study, seed-specific promoters were compared to the developing seeds of a plant compared to the leaves and / or stems of the plant. It is expressed at least five times more strongly in the developing seed embryo than in other plant tissues. Preferably, only the promoter is present in the developing seed. and / or expression of the gene of interest in other parts of the plant, such as leaves. Not detectable by either IR or RT-PCR. Usually promoter During seed growth and development, especially during the synthesis phase and accumulation of storage compounds within the seed, Such promoters drive expression in the entire plant storage organ or in the seed coat, or Only the part thereof, such as the cotyledon, preferably the embryo in the seed of a dicotyledonous plant, or the seed of a monocotyledonous plant It can drive gene expression in the endosperm or aleurone layer of the offspring.

[0194] Preferred promoters for seed-specific expression include: i) fatty acid desaturase and Genes encoding enzymes involved in fatty acid biosynthesis and accumulation in seeds, such as α- and β-glucanases, and elongases ii) promoters from genes encoding seed storage proteins and iii) genes encoding enzymes involved in carbohydrate biosynthesis and accumulation in seeds. Suitable seed-specific promoters include those derived from the Brassica napus gene. promoter (US 5,608,152), broad bean USP promoter (Bauml ein et al., 1991), Arabidopsis oleosin (Arabidopsis oleosin osin) promoter (WO98 / 45461), Phaseolus vulgaris (Pha Seolus vulgaris phaseolin promoter (US 5,504,200 ), the Brassica Bce4 promoter (WO91 / 13980) or the reg from broad bean The MinLeB4 promoter (Baumlein et al., 1992) and the genes encoding maize and barley Promoters that confer seed-specific expression in monocotyledonous plants such as barley, wheat, rye, and rice Suitable notable promoters include the barley lpt2 or lpt1 gene promoters. Motor (WO95 / 15389 and WO95 / 23230) or WO99 / 168 90 (barley hordein gene, rice glutelin gene, Lysine gene, rice prolamin gene, wheat gliadin gene, wheat glutelin gene corn zein gene, oat glutelin gene, sorghum cilin (ka The promoters from the sirin gene and the rye secalin gene are also included. As a researcher, Broun et al. (1998), Potenza et al. (2004), US20 Examples include those described in US20030159173 and US20030159173. In embodiments, seed-specific promoters are preferentially located in defined regions such as the embryo, cotyledon, or endosperm. Examples of such specific promoters include, but are not limited to, However, the FP1 promoter (Ellerstrom et al., 1996), pea leg min promoter (Perrin et al., 2000), bean phytohemagglutonin promoter (Perrin et al., 2000), conrithm of the gene encoding flax 2S storage protein nin1 and conrinin2 promoters ( Cheng et al., 2010 ), Arabidopsis ( A The promoter of the FAE1 gene from S. rabidopsis thaliana Bn, a globulin-like protein gene from Brassica napus GLP promoter, peroxidase from flax (Linum usitatissimum) An example is the LPXR promoter of the ciledoxin gene.

[0195] The 5' untranslated leader sequence may be added to the polynucleotide of the present invention to express heterologous gene sequences. The promoter can be derived from a promoter selected for the purpose, or preferably, the promoter encoding the enzyme to be produced. region and, if desired, specifically to enhance translation of the mRNA. For a review of optimal expression of transgenes, see Koziel et al. (1996). The 5' untranslated region is used to encode the 5' untranslated region of plant viral RNA (especially tobacco mosaic virus, tobacco Coetch virus, corn dwarf mosaic virus, alfalfa mosaic virus From the appropriate eukaryotic genes, plant genes (wheat and maize chlorophyll a It can also be obtained from a gene leader (i.e., a nucleotide sequence of the ... The present invention relates to a method for producing a 5' untranslated sequence in which the untranslated region is derived from a 5' untranslated sequence that accompanies a promoter sequence. The present invention is not limited to constructs that utilize a leader sequence separated from an unrelated promoter or coding sequence. Leader sequences useful in the context of the present invention include the maize Hsp70 leader - (US 5,362,865 and US 5,859,347), and TMV Omega Element Includes

[0196] Transcription termination is performed by 3-amino-3-methyl-2-(2-methyl-2-propanol)-3 ... The 3' untranslated region of the recombinant DNA molecule is used to Polyadenylation, which functions to cause the addition of adenylate nucleotides to the 3' end of RNA The 3' untranslated regions are obtained from various genes expressed in plant cells. Nopaline synthase 3' untranslated region, pea small subunit rubis The 3' untranslated region from the ko gene is a soybean 7S seed storage protein gene or a amacon The 3' untranslated region from the linin gene is commonly used for this purpose. The 3' transcribed untranslated region contains a polyadenylation signal from the um tumor-inducing (Ti) plasmid The area is also appropriate.

[0197] Recombinant DNA techniques can be used to, for example, increase the number of copies of polynucleotide molecules in a host cell, The efficiency with which polynucleotide molecules are transcribed, the efficiency with which the resulting transcription products are translated, and the translation To improve expression of transformed polynucleotide molecules by manipulating the efficiency of post-modification Recombinants useful for increasing expression of the polynucleotide molecules defined herein. Techniques include, but are not limited to, staining of one or more host cells with polynucleotide molecules. integration into the body, addition of stable sequences to mRNA, replacement or modification of transcription control signals (e.g. (e.g., promoters, operators, enhancers), replacement or modification of translational control signals (e.g., ribosome binding site, Shine-Dalgarno sequence), and host cell codon usage These include modifications of polynucleotide molecules to accommodate the nucleotide sequence and deletion of sequences that destabilize transcription. It can be obtained.

[0198] Transgenic plants When used herein as a noun, the word "plant" refers to the entire plant, but the adjective When used as a cell, for example, a plant organ (e.g., leaf, stem, root, flower), a single cell (e.g., Present in, obtained from, or derived from plants, such as pollen, seeds, or plant cells The term "plant part" refers to a substance related to a plant. The term "plant part" refers to a substance related to a plant, and the plant part is a part of the plant that contains the lipids according to the present invention. As long as the compound is synthesized, for example, leaves or stems, roots, floral organs or flower structures, pollen, seeds, embryos seed parts such as endosperm, scutellum or seed coat, plant tissues such as vascular tissue, and their It refers to all plant parts that contain plant DNA, including plant structures such as vesicles and progeny.

[0199] Generally, "transgenic plants," "genetically modified plants," or variations thereof A gene construct ("transgene") that is not found in wild-type plants of the same species, variety, or cultivar is called a transgenic. A transgenic plant as defined in the context of the present invention refers to a plant containing a recombinant and genetically modifying the plant or plant organ as defined herein using techniques to produce the desired plant or plant organ. a plant or its descendants that produces the desired lipid or at least one polypeptide Transgenic plant cells and transgenic plant parts are defined by the corresponding meanings. As used herein, a "transgene" is a gene that is commonly used in the field of biotechnology. has its usual meaning, produced or modified by recombinant DNA or RNA technology, and is contained within a plant cell A transgene includes a gene sequence introduced into a cell other than a plant cell. the same species, variety or cultivar as the plant cell from which it was introduced or from a different species, variety or cultivar, or from the same species as the plant cell from which it was derived The transgene typically contains a genetic sequence derived from a plant cell, which may be a plant, a variety, or a cultivar. are introduced into cells of plants and the like by human manipulation, such as transformation, Either method can be used, as will be appreciated by those skilled in the art.

[0200] The terms "seed" and "grain" are used interchangeably herein. "Grain" refers to the plant that has been harvested. mature grain such as grain that has been harvested or grain that is still on the plant but ready for harvest It refers to grain that has been ripened, but depending on the context it can also refer to grain that has been imbibed or germinated. The seeds usually have a moisture content of less than about 18-20%, preferably less than 10%. Brassica seeds, such as rapeseed seeds, typically have a corn content of about 4-8% or 6-8%, preferably 10-20%, at maturity. As used herein, "developing seeds" refers to seeds that have matured. Refers to seeds found within the reproductive structures of a plant, usually after fertilization or flowering, but removed separately from the plant. It may also refer to such seeds that have been released before they mature.

[0201] As used herein, the terms "obtaining plant parts" or "obtaining seeds" Plant parts are harvested from plants in the field or in containment such as a greenhouse or growth chamber. This includes harvesting the plant parts or seeds, or purchasing the plant parts or seeds from a supplier. refers to any means of obtaining plant parts or seeds by means of or receiving, respectively. Standard growing conditions at room temperature are natural light, a daytime temperature of 22-24°C, and a temperature of 16-18°C. 8°C night temperature. The seeds may be suitable for coloring, i.e., germinating or producing progeny plants. or have been treated so that they can no longer germinate, e.g., as food or feed. crushed, ground or milled seeds useful for food use or for the extraction of lipids of the present invention. It is possible.

[0202] As used herein, the term "plant storage organ" refers to a plant that contains, for example, proteins, carbohydrates, etc. Part of a plant specialized to store energy in the form of carbohydrates, fatty acids and / or oils Examples of plant storage organs include seeds, fruits, tuberous roots, and tubers. The most important plant storage organ is the seed.

[0203] The plants or plant parts of or used in the present invention are preferably phenotypically positive. As used herein, the term "phenotypically normal" refers to a genetically modified The growth and fertility of the modified plant or plant organ, especially when compared to an unmodified plant or plant organ, It refers to storage organs such as seeds, tubers or fruits whose reproductive capacity has not been significantly reduced. In this state, the phenotypically normal genetically modified plant or plant organ is free from the exogenous polynucleotide. A plant or organ that is essentially the same in growth or development as an isogenic plant or organ that does not contain nucleotides. Preferably, the plant has the ability to reproduce, and the biomass, growth rate, germination rate, storage organ size, etc. The size, pollen viability, fertilization, seed size and / or number of viable seeds produced were determined under the same conditions. When grown under the conditions described above, 90% or more of the plants do not contain the exogenous polynucleotide. Preferably, the pollen viability of the plants of the invention, or of the plants produced from the seeds of the invention, is higher than that of the corresponding The pollen viability of wild-type plants is approximately 100%. However, there are some phenotypes, such as the ballerina phenotype of seedling leaves. It does not include characteristics of plants that do not affect the usefulness of the plant for industrial purposes.

[0204] Plants provided by the present invention or contemplated for use in the practice of the present invention include monocotyledons. In a preferred embodiment, the plants of the present invention include both oviposited and dicotyledonous plants. grains and pulses (e.g., corn, wheat, potato, tapioca, rice, moro) rice, foxtail millet, cassava, barley, or peas) or other legumes Plants may be grown for the production of edible roots, tubers, leaves, stems, flowers or fruits. Plants of or useful in the present invention include: Sorghum (Zea mays), rapeseed (Brassica napus, B rassica rapa ssp.), mustard (Brassica juncea) , flax (Linum usitatissimum), alfalfa (Medicag o sativa), rice (Oryza sativa), rye (Secale c erale), sorghum (Sorghum bicolour, Sorghum vul) gare) sunflower (Helianthus annuus), wheat (Tritium aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Gossypium hirsutum) ), sweet potato (Lopmoea batatus), cassava (Manihot e sculenta), coffee (Cofea spp.), coconut (Cocos nucifera) cifera), pineapple (Anana comosus), citrus trees (citr is tree) (Citrus spp.), cocoa (Theobroma caca o), tea (Camellia senensis), banana (Musa spp.) abo Kado (Persea americana), Fig (Ficus casica), Guava (Psidium guajava), Mango (Mangifer indica ), Olive (Olea europaea), Papaya (Carica papaya) ), cashew (Anacardium occidentale), macadamia (Mac Adamia intergrifolia, Almond (Prunus amygd) alus), sugar beet (Beta vulgaris), oat, or barley It may be wheat.

[0205] In a preferred embodiment, the plant is an angiosperm.

[0206] In an embodiment, the plant is an oilseed plant, preferably an oilseed crop. As used herein, the term "oilseed plant" refers to any plant grown for the commercial production of oil from the seeds of that plant. Oilseed plants are plant species used for the production of oilseed rape. ) (such as canola), corn, sunflower, soybean, moro The oilseed plant may be rice, flax (linseed) or sugar beet. Brassicas, cotton, peanuts, poppies, mustard, castor beans , Sesame, Sunflower, Safflower, Camelina, Crambe The plant may be an olive, oil palm or corn plant. The present invention can be applied to horticultural plants such as coconuts, which produce high levels of oil in their fruits. The items include lettuce, endive, or cabbage, broccoli, or cauliflower The present invention is applicable to tobacco, cucurbits, carrots, strawberries, tomatoes, Or it can be applied to peppers.

[0207] In a further preferred embodiment, the method for producing the transgenic plants of the present invention is The non-transgenic plants to be treated preferably have, particularly in the seeds, i) less than 20%, less than 10% or less than 5% 18:2 fatty acids and / or ii) less than 10% or less than 5% 18:3 fats Produces an acidic oil.

[0208] In a preferred embodiment, the transgenic plant or part thereof is a plant whose progeny contain the desired Each and every gene (exogenous) introduced (transgene) does not segregate for the phenotype. A transgenic plant is a plant that is homologous to the introduced transgene. The plants may be genetically heterologous and preferably grown, for example, from hybrid seeds. Such plants may be uniformly heterologous for the transgene, such as F1 progeny of the It may have advantages such as hybrid vigor known in the art or may be used in plant breeding or backcrossing. It can be used.

[0209] Where relevant, transgenic plants or parts thereof include, but are not limited to, Δ 6-desaturase, Δ9-elongase, Δ8-desaturase, Δ6-elongase , Δ5-desaturase, ω3-desaturase, Δ5-elongase, diacylglycerol Lactose acyltransferase, LPAAT, Δ17-desaturase, Δ15-desaturase Enzymes involved in the production of LC-PUFAs, such as Δ12-desaturase and / or Δ12-desaturase, Such a gene may also contain additional transgenes encoding proteins that have one or more of these activities. Examples of such enzymes are known in the art and include those described herein. So, transgenic plants are; a) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, and Δ6- Elongase, b) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, and Δ9- Elongase, c) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, Δ6-ero ligase, and Δ15-desaturase, d) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, Δ9-ero ligase, and Δ15-desaturase, e) Δ5-desaturase, Δ6-desaturase, Δ5-elongase, Δ6-ero ligase, and Δ17-desaturase, f) Δ5-desaturase, Δ8-desaturase, Δ5-elongase, Δ9-erodate ligase, and Δ17-desaturase, g) ω3-desaturase or Δ15-desaturase, Δ6-desaturase, Δ 5-desaturase, Δ6-elongase and Δ5-elongase, h) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-desaturase, Δ9-elongase and Δ5-elongase, i) a Δ12-desaturase, an ω3-desaturase, or a Δ15-desaturase; Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase -ze, j) Δ12-desaturase, ω3-desaturase or Δ15-desaturase; Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase -ze, k) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-eron gauze, and Δ5-elongase, l) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, m) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ero ligase, and Δ5-elongase, n) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, o) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-eron gauze, and Δ5-elongase, p) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, q) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-ero ligase, and Δ5-elongase, or r) 1-acyl-glycerol-3-phosphate acyltransferase (LPAAT) , Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase , Δ8-desaturase, Δ5-desaturase, Δ9-elongase, and Δ5-erodate gauze, The present invention comprises at least a set of exogenous polynucleotides encoding the following:

[0210] In an embodiment, the exogenous polynucleotide is derived from Pythium irregulare. m irregulare) Δ6-elongase, Thraustochytrid (Thraus tochytrid Δ5-desaturase or Emiliana huxleyi (Emi liana huxleyi Δ5-desaturase, Physcomitrella patens (Physco mitrella patens Δ6-elongase, Thraustochytrid (Thr austochytrid) Δ5-elongase or Ostreococcus tauri (O streocccus taurii Δ5-elongase and Phytophthora inf Phytophthora infestans ω3-desaturase or Pythium irregulare ω3-desacchi The gene encodes a set of polypeptides that are enzymes.

[0211] In an embodiment, the plants of or used in the present invention are grown in a field, preferably in an essentially or at least 1 hectare or 2 hectares in area. It grows in colonies of 1,000, 1,000,000 or 2,000,000 plants. Planting density depends on plant species, plant variety, weather, soil conditions, fertilizer rates and other factors known in the art. For example, rapeseed usually requires 1.2-1.5 acres per hectare. The plants are grown at a planting density of 5 million plants. The plants are harvested and the plants are then fertilized as known in the art. swathing, plucking and / or reaping, and then threshing and / or winnowing the plant material to separate it from the remaining plant parts, which are often in the form of chaff; Alternatively, the seeds may be separated from the corn by a single treatment, e.g., a combine harvester. You can also use a harvester to harvest from plants in the field.

[0212] Plant transformation Transgenic plants were grown according to the method described by A. Slater et al., Plant Biotechnol. ogy-The Genetic Manipulation of Plants,O xford University Press (2003), and P. Christo u and H. Klee, Handbook of Plant Biotechno logy, John Wiley and Sons (2004) These can be produced using techniques known in the art, such as:

[0213] As used herein, "stably transforming," "stably transformed," and and its variants grow in progeny cells during cell division without the need for active selection for their presence. The term "incorporation" refers to the integration of an exogenous nucleic acid molecule into the genome of a cell so that it can be transferred to the cell. Confirmed transformants or their progeny were analyzed by Southern blot or genomic DNA analysis. Any method known in the art, such as in situ hybridization of NA Preferably, plant transformation is carried out as described in the Examples herein. do.

[0214] Agrobacterium-mediated transfer allows for the transient or stable expression of DNA in the genome of plant cells. For integration either in whole plant tissue or plant organs or cells in explants in tissue culture This allows the transfer of DNA into plant cells, making it a widely applicable system for transferring genes into plant cells. The Agrobacterium-mediated plant integration vector is used to introduce DNA into plant cells. The use of vectors involves the use of Agrobacterium or other bacteria capable of transferring DNA into plant cells. These include the floral dip method, which is well known in the art (see, e.g., US517701 0, US5104310, US5004863 or US5159135). The DNA region to be transfected is delimited by border sequences, and the intervening DNA (T-DNA) is usually Furthermore, the T-DNA integration is relatively precise with little retransposition. These plant varieties where Agrobacterium-mediated transformation is efficient are In this context, the ease and defined nature of gene transfer makes it the method of choice. Agrobacterium transformation vectors allow for convenient manipulation as described. It can replicate in E. coli as well as in cereals (Klee et al., In: Plant DNA I nfectious Agents, Hohn and Schell, eds., Sp. ringer-Verlag, New York, pp.179~203(1985)) .

[0215] Acceleration methods that can be used include, for example, particle bombardment. One example of a method for delivering molecules into plant cells is microprojectile bombardment. This method was described by Yang et al. .Particle Bombardment Technology for Gen e Transfer.Oxford Press,Oxford,England(1 994) is outlined. Non-biological particles (microparticle ejecta) are coated with nucleic acid and propelled by the propulsion force. Illustrative particles include those made of tungsten, nickel, platinum, etc. In addition to being an efficient means of reproducibly transforming monocotyledonous plants, A particular advantage of biolistic bombardment is that neither protoplast isolation nor susceptibility to Agrobacterium infection is required. It is unnecessary.

[0216] In another alternative embodiment, the plastids can be stably transformed. The methods disclosed for transformation include the incorporation of selectable markers and the introduction of homologous DNA. and particle gun delivery of DNA targeted to the plastid genome via recombination. (US5,451,513, US5,545,818, US5,877,402, US5 ,932479, and WO99 / 05265).

[0217] Other methods of cell transformation may also be used, including but not limited to direct DNA transfer into pollen. by direct injection of DNA into the reproductive organs of plants or by injecting DNA into the cells of immature embryos. DNA can be introduced into plants by directly injecting the .gamma.- and then rehydrating the desiccated embryos. The following are some of the reasons for this.

[0218] Regeneration of plants from a single plant protoplast transformation or from various transformed explants The methods of growth, development, and cultivation are well known in the art (Weissbach et al., In:Met. hods for Plant Molecular Biology,Academi (C Press, San Diego, Calif., (1988)). The development process involves the selection of transformed cells, the establishment of plantlets, and the normal stages of embryo development. The process typically involves culturing these individualized cells to produce transgenic embryos and seeds. The resulting transgenic rooted shoots are then grown in a suitable plant growth medium such as soil. Cultivate in a medium.

[0219] Development or propagation of plants containing foreign or exogenous genes Regeneration or regeneration of the plant is well known in the art. Preferably, the regenerated plant is transformed with a homologous transformant. Alternatively, pollen from the regenerated plants can be used in agronomical experiments. Conversely, the desired exogenous nucleic acid is hybridized with a plant grown from seeds of a biologically important line. Transgenic plants of the invention are cultivated using methods well known to those skilled in the art. Transgenic plants of the invention containing nucleic acids are cultured using methods well known to those skilled in the art.

[0220] To confirm the presence of the transgene in transgenic cells and plants, Polymerase chain reaction (PCR) amplification or Southern blot analysis is performed using methods known to those skilled in the art. The expression product of the transgene can be isolated by any of a variety of methods, depending on the nature of the product. These can be detected by a variety of methods, including Western blot and enzyme assays. Once the plants are obtained, they can be cultured to produce plant tissues or parts having the desired phenotype. The plant tissue or parts may be harvested and / or the seeds may be collected. Additional plants containing tissues or parts with the desired characteristics may serve as a growth source.

[0221] Transgenic plants produced using Agrobacterium or other transformation methods Typically, a single gene locus is contained on one chromosome. Such transgenic plants are It can be said that the gene is hemizygous. Transgenic plants that are homozygous for the two additional genes, i.e., A homozygous transgenic plant has one gene at the same locus on each chromosome of a chromosome pair. Transgenic plants were obtained by self-pollinating hemizygous transgenic plants and producing several seeds. The desired gene can be obtained by germination of the desired plant material and analysis of the resulting plants for the gene of interest.

[0222] Two different transgenes containing two independently segregating exogenous genes or loci Genetic plants can also be crossed (mating) to produce offspring containing both sets of genes or loci. Self-pollination of suitable F1 progeny results in homozygotes for both the foreign gene or locus. This allows the production of plants that are homozygous. Outcrossing is also considered botanical propagation. Others commonly used for different traits and crops For a description of breeding methods, see Fehr, In:Breeding Methods for C ultivar Development,Wilcox J.ed.,America n Society of Agronomy,Madison Wis.(1987) can be seen in.

[0223] Enhanced and stabilized expression of exogenous RNA levels Silencing suppressors In embodiments, the plant cell, plant or plant part contains a silencing suppressor protein. The recombinant vector contains an exogenous polynucleotide encoding a protein.

[0224] Post-transcriptional gene silencing (PTGS) is a process that degrades cellular and viral mRNAs. Target S and stably or transiently transform with foreign (heterologous) or endogenous DNA. occurs in the introduced plant or fungus and accumulates RNA molecules with sequence similarity to the introduced nucleic acid. It is a nucleotide sequence-specific host defense mechanism that can result in a reduction of

[0225] Co-expression of a transgene of interest and a silencing suppressor results in the expression of a silencing suppressor from the transgene. It has been widely thought that this would increase the levels of RNA present in the cell that is transcribed. While this has proven true for cells in vitro, significant side effects have been observed in many whole-cell transplants. More specifically, Mallory et al. (2002), Cha pman et al. (2004), Chen et al. (2004), Dunoyer et al. (2004), Z (2006), Lewsey et al. (2007), and Meng et al. (2008) As described above, plant-expressed silencing suppressors are generally expressed under constitutive promoters. Often, they are phenotypically abnormal to the extent that they are not useful for commercial production.

[0226] Recently, RNA molecule levels have been increased and / or silenced. By restricting expression of the suppressor to the seeds of the plant or its parts, the It has been found that the compound can be stabilized over a long period of time (WO2010 / 057246). When silencing suppressor proteins, or SSPs, are specifically Expression products from different transgenes in plant cells over repeated generations of transformed plants In some embodiments, S is a polypeptide that can be expressed in plant cells to enhance the organism's level. SPs are viral silencing suppressors or their mutants. Virus silencing suppressors are known in the art and include, but are not limited to: , P19, V2, P38, Pe-Po and RPV-P0. The virus silencing suppressor is an amino acid sequence having the sequence of SEQ ID NO: 38, Active fragments or fragments at least 50% identical to SEQ ID NO: 38 and silencing sequences It contains an amino acid sequence that has repressor activity.

[0227] As used herein, "stable expression," "stably expressed," "stably expressed" " and variations thereof refer to RNA molecules encoding silencing suppressors. When compared to isogenic plants that do not contain the native polynucleotide, repeated generations, e.g. For example, the progeny may be grown for at least three generations, at least five generations, or at least ten generations. However, this term does not apply to repeated generations. Therefore, there is some loss of RNA molecules when compared to the previous generation, e.g. The possibility of losses of 10% or more is not excluded.

[0228] The suppressor may be selected from any source, e.g., plant, viral, mammalian, etc. The viruses from which the suppressor can be obtained and the suppressors from each particular virus can be selected. List of repressor proteins (e.g., B2, P14, etc.) or coding region designations See WO2010 / 057246. Multiple copies of the suppressor may be used. Multiple suppressors may be used together (e.g., in series).

[0229] RNA molecule Essentially, any RNA that is desired to be expressed in plant seeds can be silenced. The encoded polypeptide can be co-expressed with a suppressor. may be related to the metabolism of compounds, nutrients, or proteins, peptides, fatty acids, Fats, waxes, oils, starches, sugars, carbohydrates, fragrances, odors, toxins, Rotenoids, hormones, polymers, flavonoids, storage proteins, phenolic acids alkaloids, lignins, tannins, cellulose, glycoproteins, glycolipids, Others, preferably, may be involved in the biosynthesis of TAG or the synthesis of aggregates.

[0230] In particular examples, the plants produced are Brassica, e.g., rapeseed or castor bean. Barley, safflower, flax, cotton, soybean, camelina or corn It increased the levels of enzymes for oil production in plants such as ginger.

[0231] Produced LC-PUFA levels LC-PUFA or LC-PUFAs produced in recombinant cells or plant parts such as seeds The level of a particular LC-PUFA or related LC-PUFA combination is important. PUFAs, such as ω3LC-PUFAs or ω6LC-PUFAs, or VLCs -total fatty acids, which may be PUFAs or other fatty acids that can be determined by methods known in the art The levels may be expressed as a percentage of the dry weight of the material containing the recombinant cells. Percentage of LC-PUFA in a food, e.g., percent of the weight of the seed that is LC-PUFA The levels may be expressed as a percentage of LC-PUFA content, such as % of LC-PUFAs produced in oilseeds. The LC-PUFAs in these foods are more abundant than those in vegetables or grains that are not grown for oil production. The LC-PUFA content is quite high, and both have similar LC-PUFA compositions. However, both may be used as a source of LC-PUFA for human or animal consumption. will be recognized.

[0232] LC-PUFA levels may be determined by any method known in the art. In a preferred method, total lipids are extracted from cells, tissues or organisms and analyzed by gas chromatography. Fatty acids are converted to methyl esters prior to analysis by GC. Such a technique is shown in Example 1. 1. Chromatographic peak positions were used to identify each specific fatty acid. The amount can be determined by the integrated area under each peak. Unless otherwise specified, the percentage of a particular fatty acid in a sample is expressed as a percentage of the total area of ​​the fatty acid in the chromatogram. The percent is determined from the area under the peak for this fatty acid, which is essentially a weight percent. The identity of the fatty acids can be confirmed by GC-MS. Total lipids are determined by the method of the art. The fractions may be separated by techniques known in the art to purify fractions such as the TAG fraction. For example, thin layer chromatography (TLC) can be performed on an analytical scale to identify the lipids of TAG. To determine the acid composition specifically, DAG, acyl-CoA, or other lipids such as phospholipids The TAG can be separated from the fraction.

[0233] In one embodiment, the sum of the fatty acids ARA, EPA, DPA, and DHA in the extracted lipid is between about 21% and about 40% of the total fatty acids in the cell. In a preferred embodiment, the total fatty acids in the extract have less than 1% C20:1. Possible TAGs include fatty acids at the levels indicated herein. The invention also encompasses each possible combination of the defined features.

[0234] The level of LC-PUFA production in a recombinant cell, plant, or plant part, such as a seed, is determined by the method of the present invention. The specificity of one or more produced fatty acids, also referred to herein as "conversion efficiency" or "enzyme efficiency," It may also be expressed as the percent conversion of substrate fatty acids. This parameter is useful for cells, plants, The fatty acid composition of lipids extracted from plant parts or seeds, i.e., one or more substrate fatty acids LC-PUFAs produced as a percentage of the total fatty acids (including all other fatty acids derived from them) The general formula for percent conversion is: 00 x (percentage sum of produced LC-PUFA and all products derived therefrom) / (substrate fatty acid and the percentage sum of all products derived therefrom). Acid (e.g., OA, LA, ALA, SDA, ETA, or EPA) and DP derived from the substrate As a ratio of DPA level to the level of all products including A (total fatty acid content in lipids) This may be expressed as a percentage of the conversion. The conversion percentage or conversion efficiency may be expressed as a percentage of the conversion in a single pathway. It can represent a single enzymatic step, or part or the entire pathway.

[0235] The specific conversion efficiency is calculated herein according to the formula: 1. OA to DPA=100x(DHA%+DPA%) / (OA, LA, GLA, D GLA, ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DH % sum of A). 2. LA to DPA=100x(DHA%+DPA) / (LA, GLA, DGLA, % Total of ARA, EDA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA sum). 3. ALA to DPA=100x(DHA%+DPA%) / (ALA, SDA, ET (% sum of rA, ETA, EPA, DPA and DHA). 4. EPA to DPA = 100x(DHA%+DPA) / (EPA, DPA and DHA) % sum of A). 5. DPA to DHA (Δ4-desaturase efficiency) = 100X (DHA%) / (D % sum of PA and DHA). 6. Δ12-desaturase efficiency = 100x (LA, GLA, DGLA, ARA, E % Sum of DA, ALA, SDA, ETrA, ETA, EPA, DPA and DHA) / (O A, LA, GLA, DGLA, ARA, EDA, ALA, SDA, ETrA, ETA, E (% sum of PA, DPA and DHA). 7. ω3-desaturase efficiency = 100x (ALA, SDA, ETrA, ETA, EP % total of A, DPA and DHA) / (LA, GLA, DGLA, ARA, EDA, ALA , % sum of SDA, ETrA, ETA, EPA, DPA and DHA). 8. OA to ALA=100x(ALA, SDA, ETrA, ETA, EPA, DP A and DHA % sum) / (OA, LA, GLA, DGLA, ARA, EDA, ALA, (% sum of SDA, ETrA, ETA, EPA, DPA and DHA). 9. Δ6-desaturase efficiency (ω3 substrate ALA) = 100 x (SDA, ETA, E % Sum of PA, DPA and DHA) / (ALA, SDA, ETrA, ETA, EPA, D % of PA and DHA 10. Δ6-elongase efficiency (ω3 substrate SDA) = 100 x (ETA, EPA, D (% Sum of SDA, ETA, EPA, DPA and DHA) / (% Sum of SDA, ETA, EPA, DPA and DHA). 11. Δ5-desaturase efficiency (ω3 substrate ETA) = 100x (EPA, DPA and (% Sum of ETA, EPA, DPA and DHA) / (% Sum of ETA, EPA, DPA and DHA). 12. Δ5-elongase efficiency (ω3 substrate EPA) = 100 x (DPA and DHA) % Sum) / (% Sum of EPA, DPA and DHA).

[0236] The fatty acid composition of the lipids of the present invention, preferably the seed oils, is: total ω6 fatty acids: total ω3 fatty acids or new ω-6 fatty acids: new ω-3 fatty acids, the ω-6 fatty acids in the total fatty acid content It is also characterized by the ratio of omega-3 fatty acids to total omega-6 fatty acids, total omega-3 fatty acids, and new omega-6 fatty acids. The terms fatty acid and new omega-3 fatty acid have the meanings defined herein. from the fatty acid composition of lipids extracted from cells, plants, plant parts or seeds by the method described above, It is desirable to have greater levels of omega-3 than omega-6 fatty acids in lipids, therefore Therefore, an ω6:ω3 ratio of less than 1.0 is preferred. A ratio of 0.0 indicates that no defined ω6 fatty acids are present. A ratio of 0.03 was obtained, indicating the absence of ω3-desaturated fatty acids. ze, in particular Pichia pastoris ω exemplified herein Δ, which has ω3 substrate preference, along with fungal ω3-desaturases such as ω3-desaturase This can be achieved by using 6-desaturase in combination.

[0237] The yield of LC-PUFA per weight of seed was calculated based on the total oil content in the seed and the content of the oil. For example, if the oil content of canola seeds is If about 40% (w / w) and about 12% of the total fatty acid content in the oil is DPA, The DPA content of the seeds is about 4.8% or about 48 mg per gram of seed. In terms of DPA content, canola seeds or Camelina sativa (Camelina s ativa seeds have a DPA content of approximately 84 mg per gram of seed. The invention relates to the cultivation of rapeseed (Brassica napus), mustard (B. juncea), and cea and Camelina sativa plants, and seed gra and at least about 80 mg or at least about 84 mg of DPA per gram from the plant. The seeds are harvested mature seeds after drying (4 to 15% moisture content). The present invention relates to the method of obtaining seeds and extracting oil from the seeds. and a method for obtaining the oil comprising extracting the plant according to the invention, and the use of said oil. Also provided is a method for obtaining seeds comprising harvesting seeds from

[0238] The amount of DPA produced per hectare is also calculated if the seed yield per hectare is already For example, the amount of oil palm oil in Australia is Rapeseed typically produces about 2.5 tonnes of seed per hectare and has an oil content of 40%. The yield of oil is approximately 1000 kg. At 20.1% DPA of total oil, This gives about 200 kg of DPA per hectare. If the oil content is reduced by 50%, This still gives about 100 kg DPA per hectare.

[0239] Evidence to date suggests that several desaturases expressed heterologously in yeast or plants These results suggest that the enzyme has relatively low activity in combination with some elongases. The ability to use the acyl-CoA form of fatty acids as substrates in LC-PUFA synthesis This may be alleviated by providing desaturases with the desired activity, which may be used in recombinant cells, particularly in plants. Particularly beneficial combinations for efficient DPA synthesis are For example, Micromonas pusilla Δ6-desaturase Δ6-desaturases with a preference for ω3 acyl substrates, such as enzymes such as enzymes (SEQ ID NO: 9). or variants thereof having at least 95% amino acid sequence identity, e.g., Pichia pastoris ω3-desaturase (SEQ ID NO: 6) and fungal ω3-desaturases.

[0240] As used herein, the term "essentially free" refers to a composition (e.g., a liquid or or oil) contains almost all of the specified components (e.g., less than about 0.5%, less than about 0.25%, This means that the amount of soluble solids contained in the soluble solids is less than 0.1%, or less than about 0.01%, or completely free of soluble solids. In this context, "essentially free" means that the detection of specific fatty acids (ω6- Cosapentaenoic acid, etc.) were analyzed using gas chromatography as outlined in Example 1. This means that the minute cannot be detected.

[0241] In an embodiment, the extract of the invention (of or used in a process / method of the invention) Extracted lipids, extracted oils, plants or plant parts such as seeds, feed, or the like of the present invention. The composition of all cis-6,9,12,15,18-heneicosapentaenoic acid (n-3 H PA) is not included.

[0242] Oil production Techniques routinely practiced in the art can be used to culture the cells, plants, seeds, etc. of the invention. It can be used to extract, process, and analyze oils produced by plant seeds. is cooked, pressed and extracted to produce crude oil, which is then degummed and refined. Generally, seed crushing techniques are known in the art. For example, oilseeds are sprayed with water to soften them to a suitable moisture content, say 8. It can be increased up to 5%, and the smooth roller is set with a gap of 0.23~0.27mm. Depending on the type of seed, it may not be necessary to add water before grinding. Heat inactivates enzymes, promotes further cell destruction, aggregates oil droplets, and disintegrates protein particles. All of these facilitate the extraction process.

[0243] In an embodiment, the majority of the seed oil is liberated by passing it through a screw press. The cake expelled from the screw press is then passed through a heat tracking column. or solvent extraction with, for example, hexane using a traced column; The crude oil produced by the squeezing operation is poured into a settling tank with a grooved wire drainage top cover. This allows the removal of solids that may have developed in the oil during the pressing operation. The remaining fine solid particles can be removed by passing it through a frame filter. The oil recovered from the can be combined with the clarified oil to produce a blended crude oil.

[0244] Once the solvent is removed from the crude oil, the combined pressed and extracted portions are generally Conventional oil processing methods are followed. As used herein, the term "oil-based oils" refers to oils that are combined with the lipids or oils of the present invention. When used in conjunction, the term "purified" refers to an extracted lipid or oil. This refers to the use of one or more processing steps to increase the purity of the lipid / oil components. The manufacturing process may include one or more of the following steps: degumming, deodorizing, bleaching, drying, and / or separating the extracted oil. However, as used herein, "purified" may include any of the above or all of the above. The term "fatty acid" refers to a compound of the present invention that increases DPA content as a percentage of the total fatty acid content. Does not include interesterification or other processes that alter the fatty acid composition of the lipid or oil. In other words, the fatty acid composition of a refined lipid or oil is different from that of an unrefined lipid or oil. It is essentially the same as Il.

[0245] degumming Degumming is the initial step in oil refining, and its main purpose is to remove approximately 1-2% of the total extracted lipids. The aim is to remove most of the phospholipids from the oil. Addition of about 2% water, usually containing phosphoric acid, to crude oil resulted in the association of trace metals and pigments. Most of the phospholipids are separated. The insoluble material removed is mainly phospholipids and triacylglycerol. It is a mixture of concentrated phosphoric acid and crude seed oil. By adding the phosphatides to the phosphate buffer, degumming is performed and non-hydratable phosphatides are converted to hydratable phosphatides. The gum is then centrifuged to separate the seed oil from the cellulose. Separate from the file.

[0246] Alkali Refining Alkali refining, sometimes called neutralization, is one of the refining methods for processing crude oil. This is usually done after degumming and before bleaching. After degumming, a sufficient amount of alkaline solution is added to remove the color from the seeds. The oil can be treated to titrate out all of the fatty acids and phosphates, thus removing the soaps formed. Suitable alkaline substances include sodium hydroxide, potassium hydroxide, sodium carbonate, Examples include lithium hydroxide, calcium hydroxide, calcium carbonate, and ammonium hydroxide. This method is usually carried out at room temperature and removes the free fatty acid moieties. The separation or soap is removed by extraction into a solvent and the neutralized oil is washed with water. Any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulfuric acid.

[0247] bleaching Decolorization can be achieved in the presence of bleaching earth (0.2-2.0%), in the absence of oxygen, with nitrogen or steam. Heat the oil at 90-120°C for 10-30 minutes by operating under vacuum. This step in oil processing removes unwanted pigments (carotenoids, chlorophyll, etc.). The method is designed to remove oxidative products, microorganisms, etc. It also removes minor metals, sulfur compounds and traces of soap.

[0248] Deodorization Deodorization is carried out by using oil and The seed oil is usually added at a rate of about 0.1 ml / min / 100 ml. This is done by introducing steam into the oil. After about 30 minutes of sparging, the seed oil The oil is then cooled under vacuum. The seed oil is then transferred to a glass container, usually before being stored in a refrigerator. This treatment improves the color of the seed oil and removes any volatiles or residual Removes most of the odorous compounds, including free fatty acids, monoacylglycerols, and oxidation products do.

[0249] Let's take it off Winterization is the process of converting oils and fats into solids (stearins) by crystallization at subambient temperatures. It is sometimes used in the commercial production of oils to separate the crude (sugar) and liquid (olein) fractions. It was first applied to cottonseed oil to produce a solids-free product. It is commonly used to reduce fatty acid content.

[0250] Transesterification As used herein, "transesterification" refers to the transfer of fatty acids within and between TAGs. This refers to the process of transferring a fatty acid to another alcohol to produce an ester. may first involve liberating the fatty acids from the TAG as free fatty acids, or directly Fatty acid esters, preferably fatty acid methyl esters or ethyl esters, can be produced. In the transesterification reaction of TAG with alcohols such as methanol or ethanol, The alkyl group of the alcohol forms an ester bond with the acyl group of the TAG (including DPA). When combined with preparative methods, transesterification can be used to modify the fatty acid composition of lipids. (Marangoni et al., 1995). Transesterification can be achieved by chemical (e.g., strong Either acid or base catalyzed or enzymatic means can be used, the latter of which is to convert the fatty acids of the TAGs can be position-specific (sn-1 / 3 or sn-2 specific) or more specific than others Lipases with selectivity for some fatty acids are used (Speranza et al., 201 2) Fatty acid fractionation, which increases the LC-PUFA concentration in oil, can be performed using techniques such as freeze crystallization, Complexation with urea, molecular distillation, supercritical fluid extraction, countercurrent chromatography This can be done by any of the methods known in the art, such as by precipitation and silver ion complexation. Complexation with urea helps to reduce the saturated and monounsaturated fatty acid levels in the oil. It is the preferred method due to its simplicity and efficiency (Gamez et al., 2003). The TAGs in oils are often hydrolyzed under either acid or base catalyzed conditions. In the form of a fatty acid ester, the resulting alkylated fatty acid is split into its constituent fatty acids. The excess was used to allow separation of the ester from the glycerol produced by lipase. at least 3 moles of alcohol (e.g., ethanol for ethyl esters) One mole of TAG is reacted with the alcohol or methanol for the methyl ester. , these free fatty acids or fatty acid esters, whose fatty acid composition is usually not altered by processing. may be mixed with an ethanolic solution of urea for complexation. Saturated and monounsaturated fats The acid readily forms a complex with urea, crystallizes on cooling, and can be removed by filtration. The non-urea complex fraction is thereby enriched in LC-PUFAs.

[0251] feed The present invention includes compositions that can be used as feed. For purposes of this invention, "feed" means a (a) to nourish or store tissue or provide energy when taken up by and / or (b) maintain, restore, or support adequate nutritional status or metabolic function. The feed of the present invention includes, for example, a food or preparation for human or animal consumption that contains the Nutritional compositions for infants and / or young children, such as infant formula and seedmeals of the present invention Examples include:

[0252] The feed of the present invention may comprise, for example, the cell of the present invention, the plant of the present invention, the plant part of the present invention, or the seeds, the extract of the invention, the product of the method of the invention, the product of the fermentation process of the invention, or a suitable The term "carrier" includes compositions with or without nutritional value. As the skilled artisan will recognize, In addition, the carrier is used in the feed so as not to have a harmful effect on the organism consuming the feed. The substance must be suitable (or used in a sufficiently low concentration) for

[0253] The feed of the present invention can be prepared directly or indirectly by the use of the methods described herein, cells or plants. The composition may be a solid or liquid, and may comprise an oil, fatty acid ester, or fatty acid produced by the process. In addition, the composition may contain edible macronutrients in amounts desired for a particular use. It may contain nutrients, protein, carbohydrates, vitamins, and / or minerals. The amounts of these ingredients may vary depending on whether the composition is intended for use by a normal individual or an individual suffering from a metabolic disorder or the like. It depends on whether it is intended for use by individuals with specialized needs such as Deaf.

[0254] Examples of suitable carriers with nutritional value include, but are not limited to, edible fats and other Examples of such edible fats include: Non-limiting examples include coconut oil, borage oil, fungal oil, Kuroshio oil, and soybean oil. Examples of such carbohydrates include glycerides, glycerols, and mono- and diglycerides. Examples of suitable carbohydrates include, but are not limited to: glucose, edible lactose, and hydrolyzed starch. Further examples of proteins that may be utilized in the nutritional compositions of the present invention include, but are not limited to: (not included) soy protein, electrodialyzed whey, electrodialyzed skim milk, milk whey, or hydrolysates of these proteins.

[0255] Regarding vitamins and minerals, the feed composition of the present invention may contain the following: Good for: calcium, phosphorus, potassium, sodium, chloride, magnesium, manganese, iron , copper, zinc, selenium, iodine, and vitamins A, E, D, C, and B complex. Other such vitamins and minerals may also be added.

[0256] The ingredients utilized in the feed compositions of the present invention may be semi-purified or purified raw materials. By purified or purified is meant the purification of a natural substance or a substance prepared by de novo synthesis. Taste.

[0257] The feed composition of the present invention may be added to food even when dietary supplementation is not required. For example, the composition may be added to any of the following: margarine, modified butter, Cheese, milk, yogurt, chocolate, candy, snacks, salad oil, Add it to any type of food, including cooking oils, cooking fats, meats, fish and vegetables. good.

[0258] Additionally, fatty acids produced according to the present invention or traits that contain and express the gene of interest may be used. The transformed host cells can be used to make them more desirable for human or animal consumption, animal resuscitators, eggs, It may also be used as an animal nutritional supplement to alter milk fatty acid composition. Examples of animals include sheep, cattle, horses, and poultry such as chickens.

[0259] Furthermore, the feed of the present invention can be used to feed fish or crustaceans, such as shrimp, for human or animal consumption. It can be used in aquaculture to increase fatty acid levels, with salmon being the preferred fish.

[0260] The preferred feed of the present invention can be used directly as food or feed for humans or other animals. Plants, seeds and other plant parts such as leaves and stems. For example, animals are grown in fields. They may eat plants such as these directly or be fed more measured amounts in controlled feeding. The present invention relates to the use of LC-PUFAs in foods to increase the levels of LC-PUFAs in humans or other animals. This includes the use of such plants and plant parts in the manufacture of medicines and pharmaceuticals.

[0261] In an embodiment, the feed is an infant formula comprising the lipid or oil of the present invention. As used in this specification, "infant formula" means a formula that meets at least some of the nutritional needs of an infant. "Infant" means a non-natural composition that meets the requirements of the Food and Drug Administration (FDA) for the treatment of infants from birth to 1 year of age. "Corrected age" means a human subject of age 0 to 12 months, including an infant of corrected age between 0 and 12 months. The phrase "age" refers to the infant's chronological age minus the period during which the infant was premature. Age is the age the infant would be if born at full term. "Non-natural" means that the product does not occur in nature but is created by human intervention. As used herein, the infant formula of the present invention means to be produced. is produced in pure human breast milk (Koletzko et al., 1988) and by non-human animals. Although not including pure milk, the infant formula of the present invention may contain, for example, whey protein or It may contain milk-derived components such as milk proteins or carbohydrates, such as lactose. The infant formula of the present invention is free of natural meats such as beef, marine meat, whale meat or fish. Although the infant formula of the present invention does not contain any artificial colorants, it may contain components, such as proteins, derived from these sources. The infant formula of the present invention preferably contains 0.05% by weight of the total fatty acid content. The DPA-containing lipids of the present invention are always present at a level of between about 0.5% by weight. as TAGs, as phospholipids, or as non-esterified fatty acids, or The lipids or oils of the present invention may be present in a milk or milk product using methods known in the art. For example, those skilled in the art will recognize that DPA is a compound found in the following references: Added in addition to or instead of one or more of the polyunsaturated fatty acids listed WO2008 / 027991, US20150157048, US201 Generally, the methods described in US 5,094,382 and US 2015,014,8316 are used. Therefore, the infant formula of the present invention can be easily produced.

[0262] In one example, the infant formula contains DPA (i.e., the omega-3 fatty acids described herein). GA-3 DPA), optionally with prebiotics, in particular polydextrose (PD X) and galacto-oligosaccharides (GOS), lactoferrin from non-human sources, and other In some embodiments, the nutritional composition comprises a long-chain polyunsaturated fatty acid (LC-PUFA). In one embodiment, the composition further comprises SDA and / or gamma-linolenic acid (GLA). Infant formula contains less than about 7g / 100kcal of fat or lipid source, more preferably contains about 3g / 100kcal to about 7g / 100kcal of fat or lipid source, In some cases, the fat or lipid source has a content of at least about 0.5 g / 100 kcal, more preferably about 0.5 g / 100 kcal. Preferably about 1.5g / 100kcal to about 7g / 100kcal; about 7g / 100kcal al or less of a protein source or protein equivalent source, more preferably about 1g / 100kcal approximately 7g / 100kcal of protein or protein equivalent; and at least Carbohydrates of at least about 5g / 100kcal, more preferably about 5g to about 25g / 100kcal l of carbohydrates. Infant formulas should: 1) contain at least about 10 mg / 100 kcal of Lactoferrin, more preferably about 10 mg / 100 kcal to about 200 mg / 100 kcal cal lactoferrin; 2) about 0.1g / 100kcal to about 1g / 100kcal and 3) a prebiotic composition containing PDX and GOS; and At least about 5 mg / 100 kcal of additional LC-PUFA (i.e., LC-PUFA other than DPA) -PUFA), more preferably 5 mg / 100 kcal to about 75 mg containing DHA / 100kcal additional LC-PUFA, That's fine.

[0263] In an embodiment, the ratio of DPA:DHA in the total fatty acid content of the infant formula is 1 The ratio is between 2:3 and 2:1. EPA may be present, but is preferably absent. If present, the ratio of EPA:DPA in the total fatty acid content is preferably less than 1:2 The ratio is preferably less than 1:5. ARA may be absent, but its presence is preferred. Preferably, the ratio of ARA:DPA in the total fatty acid content is preferably between 1:3 and 2:1. Most preferably, the level of each LC-PUFA in the infant formula is between any These levels are similar to those found in human breast milk, which naturally varies with maternal age and It varies depending on genetic predisposition, dietary intake, and nutritional status. See, et al. (1988). In a preferred embodiment, the infant formula contains a detectable level of It does not contain heneicosapentaenoic acid (HPA, 21:5ω3).

[0264] For example, infant formula can be liquid, powder, gel, paste, solid, concentrated, or suspended. It can refer to liquid or ready-to-use enteral, oral, or infant formulas. .

[0265] Prebiotics useful in the present disclosure include polydextrose, polydextrose, Powder, lactulose, lactosucrose, raffinose, gluco-oligosaccharides, inulin , fructooligosaccharides, isomalto-oligosaccharides, soybean oligosaccharides, lactosucrose, Sialyl-oligosaccharides, chito-oligosaccharides, manno-oligosaccharides, alibino-oligosaccharides, sialyl- oligosaccharides, fuco-oligosaccharides, galacto-oligosaccharides, and gentio-oligosaccharides. stomach.

[0266] Lactoferrin may also be included in the nutritional compositions of the present disclosure. Therefore, it is a single polypeptide chain of about 80 kD containing 1 to 4 glycans. The 3D structures of lactoferrins are very similar, but not identical. Each lactoferrin has an N-lobe. and C-lobes, which correspond to the N-terminal and C-lobes of the molecule, respectively. Refers to the C-terminal portion.

[0267] Protein sources or protein equivalent sources include, for example, nonfat milk, whey protein, Zein, soy protein, protein hydrolysates, amino acids, and other ingredients used in the field Bovine milk protein sources useful in the practice of the present disclosure include, but are not limited to, Not limited to, but includes milk protein powder, milk protein concentrate, milk protein isolate, and nonfat milk Milk solids, nonfat milk, skim milk powder, whey protein, whey protein isolate, whey protein Protein concentrate, sweet whey, acid whey, casein, acid casein, caseinates (e.g. (e.g., sodium caseinate, sodium calcium caseinate, calcium caseinate, etc.), and and any combination thereof.

[0268] Suitable carbohydrate sources include, for example, lactose, glucose, fructose, corn syrup, Rice syrup solids, maltodextrin, sucrose, starch, rice syrup solids, etc. The amount of carbohydrate component in the nutritional composition may be any of those used in the art. At most about 5g / 100kcal, and generally between about 5g and about 25g / 100kcal. In some embodiments, the amount of carbohydrates can vary between about 6g and about 22g / 100kcal. In other embodiments, the amount of carbohydrate is between about 12g and about 14g / 100 cal. In some embodiments, corn syrup solids are preferred. Hydrolyzed, partially hydrolyzed, and / or fully hydrolyzed carbohydrates However, due to its ease of digestion, it may be desirable for inclusion in nutritional compositions. Generally, hydrolyzed carbohydrates are less likely to contain allergenic epitopes. Non-limiting examples of carbohydrate substances suitable for use herein include corn Hydrolyzed or spoiled milk from milk, tapioca, rice, or potato sources These include starches that are free of starch, natural or chemically modified, waxy or non-waxy. Non-limiting examples of suitable carbohydrates include hydrolyzed corn starch, maltose, and maltodextrin. Todextrin, maltose, corn syrup, dextrose, corn syrup solids , glucose, and various other glucose polymers, and combinations thereof Other suitable carbohydrates include, but are not limited to, various hydrolyzed starches characterized by: Typical examples include sucrose, lactose, fructose, and high fructose corn syrup. Indigestible oligosaccharides, such as fructooligosaccharides, often referred to as saccharin , and combinations thereof.

[0269] Preferably, one or more vitamins in amounts sufficient to provide the subject's daily nutritional requirements and and / or minerals may be added to the infant formula. It is understood that such vitamin and mineral requirements vary based, for example, on the age of the child. The nutritional composition may optionally contain, but is not limited to, the following vitamins or their derivatives: May contain one or more derivatives: Vitamin B1 (thiamine, thiamine pyrophosphate, TPP, thiamine Thiamine triphosphate, TTP, thiamine hydrochloride, thiamine nitrate), vitamin B2 (riboflavin vin, flavin mononucleotide, FMN, flavin adenine dinucleotide, FAD, Lactoflavin, ovoflavin), vitamin B3 (niacin, nicotinic acid, nicotinic acid) Niacinamide, niacinamide, nicotinamide adenine dinucleotide, NAD, nicotinic acid Mononucleotide, NicMN, pyridine-3-carboxylic acid), Vitamin B3 precursor triphosphate Pyrophosphate, Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine, pyridoxine hydrochloride) doxin), pantothenic acid (pantothenate, panthenol), folate (folic acid, folacin) Vitamin B12 (cobalamin, methylcobalamin, dextroyl glutamic acid), Adenosylcobalamin, cyanocobalamin, hydroxycobalamin, adenosylcobalamin Lamin), Biotin, Vitamin C (Ascorbic Acid), Vitamin A (Retinol, L-Acetate) Retinyl, retinyl palmitate, retinyl esters with other long-chain fatty acids, retinal , retinoic acid, retinol ester), vitamin D (calciferol, cholecalciferol) Vitamin D3, 1,25-dihydroxyvitamin D), Vitamin E (α-tocopherol) Tocopherol, α-tocopherol acetate, α-tocopherol succinate, α-tocopherol nicotinate ferol, α-tocopherol), vitamin K (vitamin K1, phylloquinone, naphthoquinone), Quinone, Vitamin K2, Menaquinone-7, Vitamin K3, Menaquinone-4, Menadione, Menaquinone-8, menaquinone-8H, menaquinone-9, menaquinone-9H, menaquinone- 10, menaquinone-11, menaquinone-12, menaquinone-13), choline, inositol β-carotene, β-carotene, and any combination thereof. may contain, but are not limited to, one or more of the following minerals or their derivatives: boron, potassium Calcium, calcium acetate, calcium gluconate, calcium chloride, calcium lactate, Calcium phosphate, calcium sulfate, chlorine, chromium, chromium chloride, chromium picoronate Copper, copper sulfate, copper gluconate, copper sulfate, fluorine, iron, iron carbonyl, ferric iron, fumaric acid Ferrous iron, ferric phosphate, iron trituration, iron polysaccharide, iodide chloride, iodine, magnesium, magnesium carbonate, magnesium hydroxide, magnesium oxide Magnesium stearate, magnesium sulfate, manganese, molybdenum, phosphorus, potassium Selenium, potassium phosphate, potassium iodide, potassium chloride, potassium acetate, selenium, sulfur Yellow, sodium, docusate sodium, sodium chloride, sodium selenate, molybdenum Sodium bdate, zinc, zinc oxide, zinc sulfate, and mixtures thereof. Mineral compounds Non-limiting examples of derivatives of include salts, alkali salts, esters, and any mineral compounds. Examples of minerals include calcium phosphate and glycerol phosphate. Calcium, sodium citrate, potassium chloride, potassium phosphate, magnesium phosphate In the form of salts such as iron sulfate, zinc sulfate, copper sulfate, manganese sulfate, and sodium selenate Additional vitamins and minerals known in the art may be added to the nutritional composition. This may also be done.

[0270] In embodiments, the infant formula of the present invention or the infant formula made using the present invention Milk powder does not include human or animal milk or extracts thereof that contain DPA.

[0271] In another embodiment, the level of omega-6 DPA in the total fatty acid content of the infant formula is The content of HCl is less than 2%, preferably less than 1%, or between 0.1% and 2%, and more preferably More preferably, it is not included.

[0272] composition The present invention relates to compositions, in particular to one or more fatty acids and / or preferably ethyl fatty acids. Pharmaceutical compositions containing the oils produced using the methods of the present invention in the form of esters are also included. Includes.

[0273] Pharmaceutical compositions may be prepared using any standard, well-known non-toxic pharmaceutically acceptable carriers, excipients, or phosphate buffers. Saline solution, water, ethanol, polyols, vegetable oils, wetting agents or water / oil emulsions In combination with a vehicle such as an emulsion, one or more fatty acids and / or oils The composition may be either a liquid or a solid. For example, the composition may , tablets, capsules, ingestible liquids or powders, injections, or topical ointments or It may be in the form of a cream. Suitable fluidity may be achieved by, for example, the required particle size in the case of a dispersion. The concentration can be maintained by using surfactants and isotonic agents such as sugars and sodium chloride. In addition to such inert diluents, the composition may also contain a wetting agent. Adjuvants such as sweetening, flavoring, and perfuming agents may also be included. .

[0274] In addition to the active compound, the suspending agent may contain ethoxylated isostearyl alcohol, polyoxyethylene Styrene sorbitol and sorbitan esters, crystalline cellulose, aluminum metahydrogen may include oxide, bentonite, agar, and tragacanth or mixtures of these substances. stomach.

[0275] Solid dosage forms such as tablets and capsules can be formulated using techniques well known in the art. For example, fatty acids produced according to the present invention may be added to acacia, corn starch, or gelatin. disintegrating agents such as potato starch or alginic acid, and stearic acid or or magnesium stearate, in combination with a lubricant such as lactose, sucrose, and Tablets can be made with conventional tablet bases such as cornstarch. Capsules can be prepared with antioxidants and related The formulation is based on the incorporation of these excipients into gelatin capsules along with the associated fatty acids. Cut.

[0276] For intravenous administration, the fatty acids or derivatives thereof produced according to the present invention may be incorporated into commercial formulations. It may be incorporated.

[0277] Typical dosages of specific fatty acids range from 0.1 mg to 20 g (1 mg / day) taken 1 to 5 times daily. 00g), preferably in the range of about 10 mg to about 1, 2, 5, or 10 g per day (taken in one or more doses). As known in the art, a minimum of about 300 mg Fatty acids, especially LC-PUFAs, are preferred per day. However, any amount of fatty acids It is thought that this would be beneficial for elephants.

[0278] Possible routes of administration of the pharmaceutical compositions of the present invention include, for example, enteral (e.g., oral and rectal) ) and parenteral. For example, liquid preparations may be administered orally or rectally. The homogeneous mixture is then mixed under sterile conditions with a physiologically acceptable diluent, preservative, buffer or spray. It can be completely dispersed in water and mixed with a propellant to create a spray or inhalant.

[0279] The dosage of the composition to be administered to a patient may be determined by one skilled in the art and may take into account factors such as the patient's weight, age, , depending on the patient's overall health, the patient's medical history, the patient's immune status, etc.

[0280] Additionally, the compositions of the present invention may be utilized for cosmetic purposes. The fatty acids produced in accordance with the invention may be used as the sole "active" ingredient in cosmetic compositions. For convenience, they may be added to an already existing cosmetic composition. [Example]

[0281] Example 1. Materials and Methods Expression of genes in plant cells in transient expression systems The exogenous gene constructs were prepared as described in Voinnet et al. (2003) and Wood et al. (2009). The vectors were expressed in plant cells in a transient expression system essentially as described by [ 1 ].

[0282] Gas chromatographic (GC) analysis of fatty acids 30m SGE-BPX70 column (70% cyanopropyl polysilphenylene silane) Xanthane, id 0.25mm, film thickness 0.25mm, FID, split / splitless Injector and Agilent Technologies 7693 Series Auto Agilent Technologies78 equipped with sampler and injector by gas chromatography using a 90A GC (Palo Alto, CA, USA). FAMEs were analyzed. Helium was used as the carrier gas. The oven temperature was 150°C. The sample was injected in split mode (ratio 50:1) at 100°C. After injection, the oven temperature The temperature was held at 150°C for 1 minute, then increased to 210°C at 3°C / min, and then increased again to 50°C / min. The temperature was raised to 240°C in 1.5 minutes and finally held at 240°C for 1.4 minutes. External standard GLC-4 Based on the response of known amounts of 11 (Nucheck) and C17:0-ME internal standard, Ag Ilent Technologies ChemStation Software (Rev Peaks were quantified using a HPLC-MS / ... It has become.

[0283] Liquid chromatography-mass spectrometry (LC-MS) of lipids 12 days after anthesis (daf), freeze-dried developed seeds and Tri-C1 as an internal quantification standard Total lipids were extracted from mature seeds after addition of known amounts of 7:0-TAG. 10 mM butylated hydroxytoluene in tributanol:methanol (1:1 v / v) The extracted lipids were dissolved in mL of HCl and analyzed using an Agilent 1200 series LC and 6410b electrophoresis system. Analysis was performed using Trospray ionization triple quadrupole LC-MS at a flow rate of 0.2 mL / min. Ascentis Express RP-Amide using a binary gradient The liquid was separated using a column (50 mm x 2.1 mm, 2.7 μm, Supelco). The separation was carried out by chromatographic method. The mobile phase was: A. 10 mM ammonium formate aqueous solution: Methanol A. ethanol:tetrahydrofuran (50:20:30 v / v / v); B. 10 mM ammonium formate Aqueous sodium solution:methanol:tetrahydrofuran (5:20:75 v / v / v). The MRM list is based on collision energy 30V and fragmentor 60V. V is used to identify the following major fatty acids: 16:0, 18:0, 18:1, 18:2, 18:3, 1 8:4, 20:1, 20:2, 20:3, 20:4, 20:5, 22:4, 22:5, 2 Based on 2:6. Ammonia-combined precursor from neutral loss of 22:6 Individual MRM TAGs were identified based on the ion and product ions. TAG was quantified using a stearin external standard.

[0284] Lipid profiling using LC-MS Agilent 6410B electrospray ionization QQQ-MS (Agilent An Agilent 1200 Series LC coupled to a chromatograph (Panasonic Corporation, Palo Alto, California, USA) was used. The extracted total lipids were analyzed using a binary gradient at a flow rate of 0.2 mL / min. Ascentis Express RP-Amide 50mm x 2.1mm, 2 0.7 μm HPLC column (Sigma-Aldrich, Castle, Australia) Using a leech (Hill), 5 μL of each total lipid extract was injected and separated by chromatographic methods. The mobile phase was: A. 10 mM ammonium formate aqueous solution: methanol: tetrahydrofuran (5 0:20:30 v / v / v); B. 10 mM ammonium formate aqueous solution:methanol:tet Hydrofuran (5:20:75 v / v / v). Collision energy 30 V and flag Selection was performed by multiple reaction monitoring (MRM) using a mentation energy of 60V. Selected neutral lipids (TAG and DAG) and phospholipids (PC, PE, PI, PS, PA, P The following major fatty acids were analyzed: 16:0 (palmitic acid), 18:0 (sucralose), 19:0 (sucralose), 19:1 (sucralose), 19:2 (sucralose), 19:3 (sucralose), 19:4 (sucralose), 19:5 (sucralose), 19:6 (sucralose), 19:7 (sucralose), 19:8 (sucral stearic acid), 18:1ω9 (oleic acid, OA), 18:2ω6 (linoleic acid, LA) , 18:3ω3 (α-linolenic acid, ALA), 18:4ω3 (stearidonic acid, SDA) , 20:1, 20:2, 20:3, 20:4ω3, 20:5ω3, 22:4ω3, 22: 5ω3 and 22:6ω3 target neutral lipids, while 0-3, 0-4, and 0- C with 5, 4-6 double bonds 16 , C 18 , C 20 and C 22 Phosphorus lipids, including chemical species Scanned for quality.

[0285] 20:1, ammoniated protons from the neutral loss of SDA, EPA and DHA Individual MRM TAGs were identified based on precursor and product ions. TAG and DAG were determined using 50 μM tristearin and distearin as the internal standard. 10 μM di-18:0-PC, di-17:0-PA, di-17:0-PE, 17:0-17:1-PG, di-18:1-PI and di-17:0-PS external standards (Av anti Polar Lipids, Alabaster, Alabama, USA) and PL Selected TAG, DAG, and PL species were quantified using an Agilent 6520Q-T Further confirmation was achieved by OF MS / MS.

[0286] Determination of seed fatty acid profile and oil content To determine the seed oil content, the seeds were dried in a desiccator for 24 hours and approximately 1000g of seeds were extracted. 4 mg was transferred into a 2 ml glass vial with a Teflon-coated screw cap. 0.05 mg of triheptadecanoin dissolved in 0.1 ml of toluene was used as an internal standard. added to the ial.

[0287] Seed FAMEs were added to the vial containing the seed material by adding 1N HCl in methanol (Supe 0.7 ml of 100% CO₂ was added, vortexed briefly, and incubated at 80°C for 2 hours. After cooling to room temperature, 0.3 ml of 0.9% NaCl (w / v) and 0.1 ml of acetone was added to the vial and a Heidolph Vibramax 110 The FAMEs were collected in a 0.3 ml glass insert and mixed thoroughly for 10 minutes. The samples were analyzed by GC equipped with a flame ionization detector (FID) as follows.

[0288] The commercially available standard GLC-411 (NU-CHEK PREP, INC., USA) Based on the peak area response of known amounts of the same FAME, the peak areas of individual FAMEs were calculated using the GLC-411 contains 31 fatty acids in equal amounts ranging from C8:0 to C22:6 ( For fatty acids that were not present in the standards, we selected the most similar F The peak area response of AME was used. For example, the peak area response of FAME of 16:1d9 was used for 16:1d7, and the FAME response of C22:6 was used for C22:5. By comparison with the mass, the corrected area was used to calculate the mass of each FAME in the sample. The pellets were stored primarily in the form of TAG, the weight of which was calculated based on the weight of FAME. Calculate the moles of each FAME and divide the total moles of FAME by 3 to determine the glycerol The total moles of FAME were determined. Relationship: Wt% of Oil = 100 x ((41 x Total FAME) moles / 3) + (total number of grams of FAME - (15 x total number of moles of FAME))) / number of grams of seeds (formula where 41 and 15 are the molar weights of the glycerol moiety and the methyl group, respectively. TAG was calculated as the sum of glycerol and fatty acyl moieties.

[0289] Analysis of sterol content in oil samples Approximately 10 mg of oil was added together with an aliquot of C24:0 monool as an internal standard. The sample was saponified with 4 mL of 5% KOH in 80% MeOH and then The reaction mixture was heated at 80°C for 2 hours in a capped glass tube. After cooling, the reaction mixture was Add 2 mL of water and sterols to the hexane:diisopropyl alcohol by shaking and vortexing. The mixture was centrifuged and the sterols extracted. The extract was removed and washed with 2 mL of Milli-Q water. The sterol extract was then shaken and centrifuged. The extract was evaporated in a stream of nitrogen gas and 200 mL of BSTFA was used. The sterol was silylated using HCl and heated at 80°C for 2 hours.

[0290] For GC / GC-MS analysis of sterols, the sterol-OTMSi derivatives were heated to 40°C. The mixture was then dried under a nitrogen gas stream on a heat block, and then immediately before GC / GC-MS analysis. The solution was redissolved in chloroform or hexane. )-1 Fused silica capillary column (15m x 0.1mm (inner diameter), film thickness 0 .1μm), FID, split / splitless injector and Agilent Equipped with a Technologies 7683B series autosampler and injector Agilent Technologies 6890A GC (California, USA) Sterol-OTMS was analyzed by gas chromatography (GC) using a 1000-kJ / kg aliquot (Palo Alto, CA). The derivatives were analyzed. The carrier gas was helium. The oven temperature was 120°C. The sample was injected in splitless mode. After injection, the oven temperature was increased to 270°C at 10°C / min. The temperature was then increased to 300°C at 5°C / min. ogies ChemStation software (Palo Alto, California, USA) The peaks were quantified using the GC method. The GC results have an error of ±5% of the individual component areas.

[0291] Perform GC-mass spectrometry (GC-MS) analysis on the Finnigan Thermoquest GCQ GC=MS and Finnigan Thermo Electron Corp Both systems were equipped with an on-column injector and a T Hermoquest Xcalibur software (Austin, Texas, USA) Each GC was equipped with a capillary column of the same polarity as the one described above. Mass spectrometry data was used and the retention time data was compared with that obtained by reliable standards and laboratory standards. Individual components were identified by comparing the data. A link analysis was performed.

[0292] RT-PCR conditions 10 pmol (picomoles) of forward primer and 30 pmol of reverse primer, final 400ng (nanograms) of RNA total, including MgSO4 and buffers up to a concentration of 2.5mM A 25 μL volume of Superscribe was prepared using the nucleotide components according to the manufacturer's instructions. The pt III One-Step RT-PCR system (Invitrogen) was used. Reverse transcription PCR (RT-PCR) amplification was routinely performed under the following conditions: typical temperature conditions were 45°C. reverse transcription for one cycle at 94°C for 30 minutes; then for one cycle at 94°C for 2 minutes; Then, 40 cycles of 94°C for 30 seconds, 52°C for 30 seconds, and 70°C for 1 minute; After one cycle of 72°C for 2 minutes, the reaction mixture was cooled to 5°C.

[0293] Determining transgene copy number by digital PCR To determine the copy number of the transgene in the transgenic plants, the following steps were performed: This method was used to verify that plants were transfected with the gene constructs described herein. It should also be possible to determine whether a person is genetically transgenic. Meters of leaf tissue were harvested from each individual plant and placed in collection microtubes (Qia The samples were then freeze-dried for 24-48 hours. A stainless steel ball bearing was added to each dried sample for thawing. The tube was shaken in the Tissuelyser. Extraction buffer (375 μL, 0.1 M Tris-HCl pH 8, 0.05M EDTA pH 8 and 1.25% SDS) were added to each tube. The mixture was then incubated at 65°C for 1 hour, and after cooling, the mixture was diluted with 6M vinegar. 187 μL of ammonium chloride (4°C) was added to each tube with thorough mixing. The samples were then centrifuged at 3000 rpm for 30 minutes. The supernatant from each tube was then stored at room temperature for 5 minutes. in new microfuge tubes each containing 220 μL of isopropanol for DNA precipitation for 1 min. The DNA was extracted by centrifuging the tube at 3000 rpm for 30 minutes. The collected DNA pellet was washed with 320 μL of 70% ethanol, dried, and then resuspended in 225 μL of water. The DNA was resuspended in PBS. Insoluble material was removed by centrifugation at 3000 rpm for 20 minutes. The cells were pelleted and 150 μL of each supernatant was transferred to a 96-well plate for long-term storage.

[0294] DNA is used to express transgenes or clones for efficient and quantitative digital PCR (ddPCR). To ensure that multiple copies of the insert are physically separated, restriction enzymes were used prior to the amplification reaction. Therefore, an aliquot of the DNA preparation was diluted with 10x EcoRI buffer, 5 μL of DNA EcoRI and Bam in a 20 μL volume using 4 units of each enzyme per L and sample. Digestion was carried out by incubation with HI at 37°C overnight.

[0295] The primers used in these PCR reactions were determined to be mutually exclusive between the reference and target gene primers. Ensure that no interactions are anticipated or that such interactions will not be a problem under the conditions of use. The reference gene used in the assay was , Brassica napus Hmg (high mobility group) present in one gene per Brassica napus genome gene (Weng et al., 2004). Because Brassica napus is an allotetraploid, In Brassica napus, four copies of the Hmg gene , i.e., there are two alleles of each of the two genes. The reference gene response is The following primer pairs and dual-labeled probes were used: sense primer, Can11 GCGAAGCACATCGAGTCA (SEQ ID NO: 50); antisense primer, C an12 GGTTGAGGTGGTAGCTGAGG (SEQ ID NO: 51); probe, H mg-P3 5'-Hex / TCTCTAC / zen / CCGTCTCACATGACG C / 3IABkFQ / -3' (SEQ ID NO: 52). The amplification product size was 73 bp.

[0296] The PPT selectable marker gene was used to screen all transgenic plants. In one target gene amplification reaction that detected the region, the sense primers were Can17, AT ACAAGCACGGTGGATGG (SEQ ID NO: 53); the antisense primer was Can18 TGGTCTAACAGGTCTAGGAGGA (SEQ ID NO: 54); Pro The probe is PPT-P3 5'- / FAM / TGGCAAAGA / zen / GATTTCG AGCTTCCTGC / 3IABkFQ / -3' (SEQ ID NO: 55). The gene amplification product was 82 bp. Sometimes, a second target gene assay is performed using T-DNase. This second assay was performed in parallel to detect the partial insertion of A. Can23 CAAGCACCGTAGTAAGAGAGCA (SEQ ID NO: 56), Sense primer, Can24 CAGACAGCCTGAGGTTAGCA (SEQ ID NO: No. 57); probe, D6des-P3 5'- / FAM / TCCCCACTT / ze n / CTTAGCGAAAGGAACGA / 3IABkFQ / -3' (SEQ ID NO: 58) The Δ6-desaturase gene region was detected using the Δ6-desaturase gene. The size was 89 bp. Reactions routinely used 2 μL of digested DNA preparation. Reaction composition per reaction: in a total volume of 25 μL, reference sense primer (10 pM), 1 μL; Antisense primer (10 pM), 1 μL; reference gene probe (10 pM), 0. 5 μL: target gene sense primer (10 pM), 1 μL: target gene antisense primer Primer (10 pM), 1 μL; target gene probe (10 pM), 0.5 μL; ddP CR reagent mixture, 12.5 μL; water 5.5 μL.

[0297] Then, a QX100 droplet press was used to divide each sample into 20,000 nanoliter-sized droplets. All samples were processed and transferred to a 96-well PCR plate. This was done in an 8-well cartridge until the plate was Heat seal with pierceable foil using a heat sealer machine. The samples were then treated under the following reaction conditions: 95°C for 10 minutes, 2.5°C / then 94°C for 30 seconds with a ramp of 2.5°C / second for 39 seconds Cycle: 61°C for 1 minute with ramping at 2.5°C / sec; 98°C for 10 minutes, then After the DNA amplification reaction in the droplets, the plate was subjected to a two-color detection system. Each droplet was individually placed into a QX100 droplet reader for analysis (FAM or Hex Droplet digital PCR data was plotted on a fluorescence intensity graph for each sample. 1-D plot of droplets, or plotting fluorescence (FAM) against fluorescence (Hex) for each droplet. The software displays the data for each fluorophore in each sample either as a 2-D plot or as a 3-D plot. The number of positive and negative droplets was measured for each solution (FAM or Hex). The software determines the input target DNA molecule concentration in units of copies / µL, so the positive The droplet fractions were fitted to a Poisson algorithm. Copy number variation was calculated using the formula: CNV = (A / B)*Nb (where A = target gene concentration, B = reference gene concentration, and Nb = 4, The number of copies of the reference gene in the genome was used to calculate the variance.

[0298] Assessment of pollen viability Fluorescein diacetate (FDA) was dissolved in acetone at 2 mg / ml to prepare the raw material. Sucrose solution (0.5M) was added until saturation was reached, indicated by the appearance of persistent cloudiness. The FDA dilutions were prepared immediately before use by adding 2 ml of FDA stock solution dropwise.

[0299] Propidium iodide (PI) was dissolved in sterile distilled water at 1 mg / ml to obtain a stock solution. Immediately before use, 100 μl of the stock solution was added to 10 ml of sterile distilled water to prepare a working solution. To check the ratio of powder to non-viable pollen, PI and FDA stock solutions were mixed in a 2:3 ratio.

[0300] Transgenic and oocytes were grown under standard conditions in a greenhouse at 22 ± 2°C with a 16-hour photoperiod per day. Wild-type rapeseed and mustard plants were grown. Mature flower buds ready to flower the next day. The pollen from bloomed flowers was stained with the FDA / PI mixture. and visualized using a Leica MZFLIII fluorescence microscope. GFP-2, 480 / A 510 nm long-pass emission filter with a 40 nm excitation filter (transmitting red and green light) Viable and non-viable pollen were detected using PI staining. Although they appeared red under the microscope, viable pollen appeared bright green when stained with PI and FDA. .

[0301] Example 2. Transgenic plant in Camelina sativa seeds Stable expression of the nicked DHA pathway

[0302] The binary vector pJP3416-GA7 (see Figure 2 and SEQ ID NO: 1) was Agrobacterium tumefaciens strain AGL1 and floral dilutions for transformation Transformed Agrobacterium used to treat Camelina sativa flowering plants using the tup method (Lu and Kang, 2008). Plant growth and maturation After that, T1 seeds of the treated plants were harvested and sown in soil. The resulting plants were transformed with pJP3416 -GA7 is transgenic for the bar selectable marker gene present in the T-DNA. To select for plants that express this gene, the plants were spray treated with the herbicide BASTA. The surviving herbicide-resistant T1 plants were self-pollinated and grown to maturity. 2 seeds were harvested. Five transgenic plants were obtained, and all three of these were It contained T-DNA.

[0303] Lipids were extracted from a pool of approximately 20 seeds from each of three plant species containing the complete T-DNA. Two of the pooled samples contained very low, barely detectable levels of DHA. The third pool contained approximately 4.7% DHA. Lipids were extracted from 10 individual T2 seeds from the same cultivar and the fatty acid composition was analyzed by GC. Individual seed fatty acid composition data for this transgenic line are also shown in Table 4. Total seed lipid protease activity The data collected from the files (Table 4) are shown in Table 5.

[0304] DHA was present in 6 of the 10 individual seeds. Four other seeds contained no DHA. does not contain T-DNA, based on hemizygous T-DNA insertion in the parent plant. The highest levels of DHA were extracted from a single seed. The lipids contained 9.0% DHA, while the total percentage of EPA, DPA, and DHA was 1. The rate was 1.4%. [Table 4] TIFF2023075083000013.tif24788 [Table 5]

[0305] Homozygous seeds from this line were obtained at the T4 generation. In event FD5-46-18-110, which had an average of 7.3% DHA, the DHA was produced in the subsequent generation (T5). In particular, the stability of DHA was further investigated. The prevalence was not stabilized until the T4 generation due to the presence of multiple transgenic loci. Despite this, the maximum DHA levels observed were found to be stable through the fifth generation. No obvious difference in germination efficiency or speed was observed between the T5 seed batch and the parent Camelina sativa. The seeds were then germinated on MS medium in vitro. The transgenic generations (T6, T7, etc.) did not show a decrease in seed DHA levels. The nicked plants are fully fertile and the pollen has approximately 100% viability, similar to that of wild-type plants. Analysis of the oil content of seeds containing different levels of DHA showed that Arabidopsis In contrast to the correlation observed in Ta.

[0306] In some further transgenic lines, DH of a single seed from an independent event The A content was over 12%. The transgenic:null ratio of these lines was approximately The ratio was found to be between 3:1 and 15:1. Representative lipids of the top DHA samples from each construct Analysis of the fatty acid profile did not detect any other new ω6 PUFAs, accounting for only 1.2-1.4%. In contrast, new ω3 PUFA (SDA), ω3 LC-PUFA ( ETA, EPA, DPA, DHA) with a DHA level of 9.6% of the total fatty acid content Δ6-desaturation was found to be 32% and EPA was found to be 0.5% of the total fatty acids. The Δ5-elongation efficiency was 93%, and the Δ6-elongation efficiency was 0.8%. The gating efficiency was 60%. Detected.

[0307] The observed segregation ratio (approximately 3:1 to approximately 15:1) was due to one or, at most, two translocations. The transgenic locus produces DHA levels similar to those found in Camelina sativa fish oil. This indicates that transgenic traits are essential for the stable transfer of the introduced gene. This has important implications not only for sex but also for ease of reproduction.

[0308] The homozygous seeds were distributed across several greenhouses to generate a total of over 600 individual plants. Various methods were used, including Soxhlet, acetone, and hexane extraction. Oil was extracted from the seeds.

[0309] To determine the positional distribution of ω3LC-PUFAs in TAG, transgenic camelina For Sativa seed oil, 13 C NMR regiospecific analysis was performed. Events with EPA and DHA were selected to maximize the response to these fatty acids. , the ratio of sn-1,3 to sn-2 is 0.75:0.25 for EPA, and D For HA, the ratio is 0.86:0.14, whereas the unbiased distribution would be 0.66:0.33. That is, 75% of EPA and 86% of DHA were located at the sn-1,3 positions of TAG. This means that although EPA has a lower priority than DHA, both fatty acids are essential for the development of turtles. The results showed that DHA is preferentially located at the sn-1,3 positions of the TAG of L. sativa. The finding that the 1st and 3rd positions were preferentially observed is in agreement with previous results reported in Arabidopsis seeds. The results were similar to those of (Petrie et al., 2012).

[0310] A few independent transgenic lines were obtained in the above transformation experiments, and further transgenic lines were then developed. L. sativa transformation was performed using the GA7-modB construct (Example 3). Many transformants were obtained and homozygous lines producing more than 20.1% DHA were identified.

[0311] Example 3. Modification pathway of T-DNA encoding DHA in plant seeds Improved DHA production level in rapeseed exceeding the level described in WO2013 / 185184 To improve the efficiency of the vectors, the binary vectors pJP3416-GA7-modA and pJP3416- GA7-modB, pJP3416-GA7-modC, pJP3416-GA7-mo dD, pJP3416-GA7-modE and pJP3416-GA7-modF, The constructs were constructed as described in O2013 / 185184 and tested in transgenic plants. These binary vectors are variants of the pJP3416-GA7 construct, specifically, Δ DHA synthesis in plant seeds by improving 6-desaturase and Δ6-elongase functions SDA has a relatively low activity compared to Δ5-elongase. In some seeds transformed with the GA7 construct, the Δ6-elongase efficiency was Among other modifications, two elongase gene loci are inserted into the T-DNA to allow for accumulation of It was observed that the

[0312] The two elongase encoding sequences in pJP3416-GA7 were inserted into the T-DNA These positions were switched to replace the Pyramimonas cordata Δ5-elongase cassette. To transfect the Pyramimonas cordata Δ6-enantiomers into the Sbf1 site of pJP3416-GA7, pJP3416-GA7-mo This construct was transformed into a microenvironmental vector under the conlinin Cnl2 promoter (pLuCnl2). The FP1 promoter driving the Pseudomonas pusilla Δ6-desaturase was replaced with p JP3416-GA7-modB was further modified to obtain Δ6-desaturated This modification was made in an attempt to increase enzyme expression and thereby enzyme efficiency. The truncated napin promoter results in higher expression of transgenes in Brassica napus There should be a possibility of obtaining

[0313] Eight transgenic pJP3416-GA7-modB Arabidopsis events and 15 transgenic pJP3416-GA7-modG Arabidopsis thaliana plants. A total of 7.7% of the pooled pJP3416-GA7-modB seeds were Between 0.2% DHA was observed in the pooled T2 pJP3416-GA7-modG strain. The highest DHA content was observed in the offspring of pJP3416-GA7- Some of the modB events were plated on selective media and the surviving seedlings were grown to the next generation. The offspring are analyzed for DHA content. Pooled T1 seeds are segregated for the transgene. The population represented a homozygous population containing any null segregants, so the offspring plants were homozygous. The researchers expected that this would increase DHA levels to 30% of the total fatty acid content in the seed oil. Other modified constructs were transformed into Arabidopsis thaliana. Although the transformants obtained were not able to obtain higher levels of DHA than the modB construct, There was no.

[0314] The pJP3416-GA7-modB construct was also used in cultivars Oscar and NX002, NX00 3. A series of breeding lines designated NX005, NX050, NX052 and NX054 Transformed Brassica napus plants were used to generate 77 independent Oscar transformations. Transgenic plants (T0) and their seed oils due to the effect of mutations in the FAD2 gene 189 for NX005, a line with a high oleic acid content in A total of 1558 transformed plants were obtained, including 1480 independent plants for the purpose of the present study. The T-DNA had low levels of LA and ALA as determined by digital PCR. Transgenic plants (Example 1) showing more than four copies of the Approximately 25% were culled by this criterion. Approximately 53% of the T0 transgenic plants were They have one or two copies of the T-DNA as determined by digital PCR, and % had approximately 3 copies, and 24% had 4 or more copies. After pollination, approximately 450 transgenic lines were harvested and allowed to flower to avoid outcrossing. The T1 seeds were then bagged onto the plants. Approximately 1-2% of the plant lines were either male or female sterile. As a result, no viable seeds were produced and the TO plants were discarded.

[0315] Seed pools (20 T1 seeds in each pool) were analyzed for DHA levels in the pooled seed oil. The strains with the highest levels were selected. Lines with a DHA content of at least 2% of the total fatty acid content in the offspring were selected. % of the transgenic lines were selected in this way; the other 85% were culled. Some of the lines are CT132-5 (variety Oscar), CT133-15, -24, -63, They were named -77, -103, -129 and -130 (NX005). The lines are CT136-4, -8, -12, -17, -19, -25, -27, -49 and -51. 20 seeds of selected lines including CT132.5 and 11 seeds of CT133.15 The seeds were soaked and after 2 days, oil was extracted from half the cotyledons from each individual seed. The other half of the cotyledons were kept and cultured on medium to maintain the specific progeny line. The acid composition was determined; the data is shown in Table 6 for CT132.5. 20 seed sacs analyzed The DHA levels in these 10 range from 7 to 20% of the total fatty acid content as determined by GC analysis. The other seeds contained less than 7% DHA and were derived from pJP3416-GA7-modB. It is possible that the plants contained partial (incomplete) copies of the T-DNA of the transgenic plants. The lines appeared to contain multiple transgene insertions that were not genetically linked. Seeds from the transgenic line CT133.15 contain DHA levels ranging from 0 to 5%. Seeds without DHA appeared to be null segregants. These data Therefore, the modB construct was found to be sufficient for DHA production in canola seeds. Confirmed.

[0316] 20 or 4 T1 plants obtained from each of the selected transgenic lines after self-pollination 0 individual seeds (T2 seeds) were individually tested for fatty acid composition. Seeds containing DHA at levels similar to those of CT136-27- were identified (Table 7). 18-2 and CT136-27-18-19 were 21.2% and 22.7%, respectively. The total omega-3 fatty acid content in these seeds was 100% of the total fatty acid content. The ω6 content was approximately 60% at the time of analysis, and less than 10% at the time of analysis. Alternatively, a set of 40 T2 seeds was tested for fatty acid composition. DH up to 34.3% Seeds containing A were identified, for example, in seed CT136-27-47-25 (Table 9). The fatty acid composition of the seed oil obtained from 136-27-47-25 is shown in Table 9. The composition is 34.3% DHA along with approximately 1.5% DPA, 0.6% EPA and 0.5% ETA. The SDA level was approximately 7.5%, ALA approximately 21.9%, and LA approximately 6. The new ω6 PUFA showed GLA 1.1%, but ω6-C20 and -C22 No LC-PUFAs were detected. Total saturated fatty acids: 9.6%; monounsaturated fatty acids: 12% 0.5%; total PUFA, 75.2%; total ω6-PUFA (including LA), 7.2%; total ω3 -PUFA, 66.9%; total ω6:ω3 fatty acid ratio, 9.3:1; neoω6:neoω3 fatty acids , 37:1. The efficiency of each enzymatic step from oleic acid to DHA was as follows: Δ12-desaminated DHA; Δ15 / ω3-desaturase, 90%; Δ15 / ω3-desaturase, 89%; Δ6-desaturase, 67%; Δ6-elongase, 83%; Δ5-desaturase, 99%; Δ5-elongase Δ4-desaturase, 98%; Δ4-desaturase, 96%. Overall efficiency of oleic acid conversion to DHA. The percentage of fatty acids in the seed oils was approximately 50%. DHA-producing seeds contain between 20.1% and 30% DHA or 20.1% of the total fatty acid content. The seeds were identified as containing between 30% and 35% DHA and were clearly selected. Ta.

[0317] The oil content in some seeds ranged from about 44% in wild-type seeds to 10% in some DHA-producing seeds. The DHA content in the seeds was reduced to about 31-39%, but this was similar to the wild-type levels in other DHA-producing seeds. It was.

[0318] Crossing various transgenic plant lines that produce DHA at levels of at least 10% in T2 seeds to produce F2 progeny homozygous for multiple T-DNA insertions. The F1 progeny were then self-pollinated. Seed oil from homozygous seeds was analyzed, and the contents of the seed oil were Up to 30% or 35% of the total fatty acid content is DHA.

[0319] In oils obtained from CT136-27-18-2 and CT136-27-18-19 The positional distribution of DHA on the glycerol backbone of the TAG molecule was 13 CN DHA preferentially binds at the sn-1,3 position. More than 70%, in fact more than 90%, of the DHA was at the sn-1,3 position. Ta.

[0320] In some further transgenic lines, DH of a single seed from an independent event The transgenic:null ratio of these lines was 1.5%. The ratio of the two transgenic loci was approximately 3:1. The ratio of each construct with the highest level of DHA was found to be 15:1, corresponding to the The analysis of the representative fatty acid profile of the samples from these researchers showed that they did not contain any new ω6 PUFAs and had a fatty acid content of 1.2 to 1. Only 0.4% of GLA was detected. In contrast, the new ω3 PUFA (SDA) and ω3 LC- PUFA (ETA, EPA, DPA, DHA) in GA7-transformed seeds. 25.8% for the modF construct and 21 for the modG construct compared to 5%. The DHA levels in the oils of these seeds were 9.6% and 9.9%, respectively. , 12.4% and 11.5%. Δ6-desaturation was observed in the modF- and modG-forms. The GA7-transformed seeds were lower than the GA7-transformed seeds (32% vs. 47% and 43%), which , which resulted in a decrease in ALA in modF and modG compared to GA7. Another notable difference was the accumulation of EPA in modF seeds (compared to the other two transgenic plants). 3.3% vs. 0.8% in the nick seeds, which is higher than the GA7 and modG seeds (93% and 9 The lower Δ5-elongation observed in modF (80%) seeds compared to modF (4%) The slightly more active Δ6-desaturation actually increased the amount of SDA. However, there was a slight increase in Δ6-elongation in these seeds (66% vs. 60% and 6 DHA was detected in the polar seed lipid fraction of the GA7 line.

[0321] 7 of the rapeseed breeding line NX54 transformed with the T-DNA of the modB construct The fatty acid composition of lipids in the T1 seeds of 0 independent transgenic plants was analyzed. One of the transgenic plants contains DPA but no DHA in its seed oil. The T1 seeds of this line (CT-137-2) were observed to produce seeds. The present inventors have found that the corn starch produced approximately 4% DPA with no detectable DHA in the seeds. This indicates that spontaneous mutations have resulted in the development of Δ4-desaturases in that particular inserted T-DNA. We investigated whether the inactivation of the enzyme gene was the cause of the disease by PCR analysis and DNA sequence analysis. The deletion was observed at nucleotides 12988-15 of the T-DNA of GA7-modB. A deletion of 317 was revealed (SEQ ID NO: 2). The deleted nucleotide is a Δ4-desaturase. The Linus Cnl2 promoter portion driving expression of the enzyme coding region and Δ 4-desaturase coding region itself, thereby defining the T-DNA containing the deletion. This explains why seeds transformed with β-actin did not produce DHA.

[0322] Approximately 50 T1 seeds from this transgenic line were germinated, and one seed from each was harvested. The ripe cotyledons were analyzed for fatty acid composition in the remaining oil. Selected seedlings showing DPA were grown to maturity and T2 seeds were harvested. The acid composition is shown in Table 8, and more than 7% DPA was observed in these lines. It was produced from the Brassica napus DPA line CT-137-2 and contains fatty acid protease. A maximum of 13% DPA was detected in the mature seed samples collected. It was observed that

[0323] Oil from seeds containing approximately 10% DPA was treated with mild alkali to dehydrate the fatty acids. I understood.

[0324] Another transgenic line designated B0003-514 showed approximately It showed 10-16% DPA, 15.8% DPA, 0.2-0.9% DHA, and Seeds containing 0.1-2.5% EPA were selected. The T2 seed group was characterized by high DPA:medium DPA. The PA:non-DPA ratio was 1:2:1. In the feline strain, the existence of a single locus for DPA production is suggested.

[0325] Oil was extracted from LC-PUFA-producing seed samples using a screw press. Seed meal was prepared from the above.

[0326] Structure design While the focus of this experiment was to demonstrate the production of DHA and DPA within oilseed crop species, These results were also interesting from a construct design perspective. First, the Δ6- and The switch in the position of the Δ5-elongase coding region resulted in lower Δ5-elongation. This resulted in the intended profile change, which included more EPA accumulated due to the Δ6- A concomitant increase in elongation was observed, which resulted in lower SDA levels. This is due to the fact that the truncated napin promoter is driven by the more active amaryllis 2 promoter. Substitution of the motor (FP1) as well as extraneous expression in Micromonas pusilla Δ6-desaturase Δ6-desaturation in modF-transformed seeds caused by the addition of a lyase expression cassette The somewhat smaller increase in Δ6-desaturation observed with the modG construct was due to , resulting from the utilization of a highly expressed Δ5-elongase cassette in GA7. The switch in the position of the Δ5-elongase and Δ6-elongase coding regions results in greater Δ6-desaturation. In this case, replacement of the FP1 promoter with the Cnl2 promoter resulted in did not decrease Δ5-elongase activity.

[0327] These data indicate that the modB, modF, and modG constructs are useful in Arabidopsis and Like rapeseed, camelina seeds showed good results for DHA production.

[0328] The inventors have generally found that the efficiency of rate-limiting enzyme activities in the DHA pathway is significantly reduced in the single-copy T-DNA form. The pathway may be greater in multicopy T-DNA transformants compared to transgenic transformants. It is thought that this can be increased by inserting multiple genes into the T-DNA that encode enzymes that can be restricted within the Evidence for the possible importance of multicopy transformants was obtained by transforming with the GA7 construct. The highest yielding DHA events observed in transformed Arabidopsis seeds were those in the host genome. The multiple genes can be the same or, preferably, are different variants encoding the same polypeptide or have overlapping expression patterns. For example, even if the same protein is produced, Therefore, increased expression should be achievable by expression of multiple Δ6-desaturase coding regions. In pJP3416-GA7-modF and pJP3416-GA7-modC, For example, there are two variants of Micromonas pusilla Δ6-desaturase, which have different The coding sequences were expressed by different codon usage and therefore different nucleotide sequence, reducing the potential silencing or co-suppression effect but resulted in the production of the same protein. [Table 6] [Table 7] [Table 8] [Table 9]

[0329] Example 4. Analysis of TAGs in transgenic Arabidopsis seeds producing DHA The positional distribution of DHA on TAG in transgenic Arabidopsis seeds was measured by NMR. Total lipids were analyzed by hexane before transferring the ground seeds to a glass tube containing 10 mL of hexane. Extraction was performed from approximately 200 mg of seeds by first crushing the seeds under a microscope. The hexane solution was heated to approximately 55°C in a bath, then vortexed and centrifuged. The extracts were combined and rotary evaporated. The lipid extract was concentrated in a porator, and TAG in the lipid extract was extracted with 20 mL of 7% diethyl ether in hexane. The lipids were separated from the polar lipids and purified by passage through a short silica column. The acyl group position distribution on purified TAG was quantitatively determined as previously described (Petrie et al., 2014). 010a and b).

[0330] Analysis showed that the majority of DHA in the total seed oil was located at the sn-1 / 3 position of TAG, This indicates that the sn-2 position was hardly observed. :4 Δ5、8、11、14 ) 50% of the sn-2 of transgenic canola oil While the ARA-producing seeds were ranked high, only 33% were found to be within the range expected for random distribution. This was in contrast to TAG from (Petrie et al., 2012).

[0331] The total lipids of transgenic Arabidopsis seeds were analyzed using the major DHA-containing triacylglycerols. The compounds were also analyzed by triple quadrupole LC-MS to measure the cerol (TAG) species. The most abundant DHA-containing TAG species was DHA-18:3-18:3 (TAG58: 12; nomenclature that does not express positional distribution), and the second most abundant is DHA-18: 3-18:2 (TAg58:11). 66:18) were observed in total seed oil at low, but detectable levels. The main DHA-containing TAG species are DHA-34:3 (TAG 56:9) and DHA-36:3 (TAG58:9), DHA-36:4(TAG58:10), DHA-36:7(TA The two main D The HA-containing TAG species were further confirmed by Q-TOF MS / MS.

[0332] Example 5. Assay of sterol content and composition of oils Phytosterols from 12 plant oils purchased from commercial sources in Australia. is the O-trimethylsilyl ether (OTMSi-ether) derivative described in Example 1 The sterols were characterized by GC and GC-MS. Identification was achieved by toll analysis and comparison of literature and experimental standard mass spectral data. was quantified by using 5β(H)-cholan-24-ol internal standard. The phytosterol base structure and chemical structure of the hydroxybenzoates are shown in Figure 3 and Table 10.

[0333] The plant oils analyzed were: sesame (Sesamum indicum), olive (Oli ea europaea), sunflower (Helianthus annuus), castor bean (R icinus communis), Brassica napus ), safflower (Carthamus tinctorius), peanut (Arach is hypogaea), flax (Linum usitatissimum) and daikon The relative abundances across all oil samples were In the reduction of phytosterols, the main phytosterols were: β-sitosterol (28% of the total sterol content); ~55% range), Δ5-avenasterol (isofucosterol) (3-24%), Δ5-stigmasterol (2-33%), Δ5-stigmasterol (0.7-18%), Δ7- Stigmasterol (1-18%) and Δ7-avenasterol (0.1-5%) Several other minor sterols were identified, these being: cholesterol, brassica ternate The four C29 C30:2 and two C30:2 sterols were also detected, but the identification of these minor components has not been completed. Further investigation is needed to determine whether this is the case. In addition, some of the other identified sterols Although present in some of the oils, due to its very low abundance, the mass spectra The intensity was not sufficient to identify the structure. [Table 10]

[0334] The sterol content expressed as mg / g of oil in the reduced amounts was: canola oil (6. 8mg / g), sesame oil (5.8mg / g), flaxseed oil (4.8-5.2mg / g) , sunflower oil (3.7-4.1mg / g), peanut oil (3.2mg / g), Safflower oil (3.0 mg / g), soybean oil (3.0 mg / g), olive oil (2.4mg / g), castor oil (1.9mg / g). The total sterol content is shown in Table 11.

[0335] In all seed oil samples, the major phytosterol was generally β-sitosterol. (range 30-57% of the total sterol content). Other tumor sterols: Campes esterol (2-17%), Δ5-stigmasterol (0.7-18%), Δ5-avena of oil with a proportion of sterols (4-23%) and Δ7-stigmasterol (1-18%). The oils of different species have a wide range of properties, some with v...

Claims

1. The fatty acids include oleic acid, palmitic acid, lysine, niacin ... ω6 fatty acids including alpha-linolenic acid (ALA), ω3 fatty acids including alpha-linolenic acid (ALA), and Contains cosapentaenoic acid (DPA), and optionally stearidonic acid (SDA), eicosapentaenoic acid (EIA), Contains one or more of pentaenoic acid (EPA) and eicosatetraenoic acid (ETA). and wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. Extracted plant or microbial lipids.

2. Features include: i) the level of palmitic acid in the total fatty acid content of the extracted lipid is between about 2% and 15% %, or between about 3% and 10%; ii) the level of myristic acid (C14:0) in the total fatty acid content of the extracted lipids , about 0.1%; iii) the level of oleic acid in the total fatty acid content of the extracted lipid is from about 1% to about 3% Between 0%, between about 3% and about 30%, between about 6% and about 30%, between about 1% and about 20% , between about 30% and about 60%, between about 45% and about 60%, about 30%, or between about 15% and about 3 0% iv) the level of linoleic acid (LA) in the total fatty acid content of the extracted lipids is between about 4% and between about 4% and about 35%, between about 4% and about 20%, between about 4% and about 17%, or between about 5% and about 35%. Between about 10% v) the level of alpha-linolenic acid (ALA) in the total fatty acid content of the extracted lipid is about 4 between about 7% and about 40%, between about 10% and about 35%, between about 20% and about between about 4% and about 16%, or between about 2% and about 16%, vi) the level of gamma-linolenic acid (GLA) in the total fatty acid content of the extracted lipids; Less than 4%, less than about 3%, less than about 2%, less than about 1%, less than about 0.5%, 0.05% to 7% between 0.05% and 4%, between 0.05% and about 3%, or between 0.05% and about 2% % between vii) the level of stearidonic acid (SDA) in the total fatty acid content of the extracted lipids Less than about 10%, less than about 8%, less than about 7%, less than about 6%, less than about 4%, less than about 3%, less than about 0. between about 0.05% and about 7%, between about 0.05% and about 6%, between about 0.05% and about 4%, Between 0.05% and about 3%, between about 0.05% and about 10%, or between about 0.05% and about Between 2% viii) The level of eicosatetraenoic acid (ETA) in the total fatty acid content of the extracted lipid The bell is less than about 6%, less than about 5%, less than about 4%, less than about 1%, less than about 0.5%, less than 0.05%. % to about 6%, 0.05% to about 5%, 0.05% to about 4%, 0.05% between about 3% and about 3%, or between 0.05% and about 2%; ix) the level of eicosatrienoic acid (ETrA) in the total fatty acid content of the extracted lipids is less than 4%, less than about 2%, less than about 1%, between 0.05% and 4%, and between 0.05% and 3% or between 0.05% and about 2%, or between 0.05% and about 1%; x) the level of eicosapentaenoic acid (EPA) in the total fatty acid content of the extracted lipid , between 4% and 15%, less than 4%, less than about 3%, less than about 2%, between 0.05% and 10% , between 0.05% and 5%, between 0.05% and about 3%, or between 0.05% and about 2% Between xi) if the level of DHA in the total fatty acid content of the extracted lipid is less than 2% or or between 0.05% and about 2%; xii) the lipid contains ω6-docosapentaenoic acid (22:5) in its fatty acid content Δ４， ７，１０，１３，１６ ) xiii) the lipid has less than 0.1% ω6-docosapentaenoic acid in its fatty acid content (22:5 Δ４，７，１０，１３，１６ ) xiv) the lipid has less than 0.1% of one or more or all SDA in its fatty acid content. , EPA and ETA; xv) the total saturated fatty acid level in the total fatty acid content of the extracted lipid is from about 4% to about 25% %, between about 4% and about 20%, between about 6% and about 20%, or between about 6% and about 12% Between xvi) the total monounsaturated fatty acid level in the total fatty acid content of the extracted lipid is between about 4% and between about 4% and about 40%, between about 4% and about 35%, between about 8% and about 25%, 8% to about 22% between about 15% and about 40% or between about 15% and about 35%; xvii) the total polyunsaturated fatty acid level in the total fatty acid content of the extracted lipid is about 20 between 30% and about 75%, between 30% and 75%, between about 50% and about 75%, about 60%, about 65%, about 70%, about 75%, or between about 60% and about 75%; xviii) the total ω6 fatty acid level in the total fatty acid content of the extracted lipid is between about 35% and between about 20% and about 50%, between about 20% and about 35%, between about 6% and about 20%, less than 20%, about less than 16%, less than about 10%, between about 1% and about 16%, between about 2% and about 10%, or between about 4% and about 10%; xix) the level of new ω6 fatty acids in the total fatty acid content of the extracted lipid is less than about 10%; Less than about 8%, less than about 6%, less than 4%, between about 1% and about 20%, between about 1% and about 10% , between 0.5% and about 8%, or between 0.5% and 4%; xx) the total omega-3 fatty acid level in the total fatty acid content of the extracted lipid is between 36% and about 65% %, between 36% and about 70%, between 40% and about 60%, between about 30% and about 60% , between about 35% and about 60%, between 40% and about 65%, between about 30% and about 65%, about Between 35% and about 65%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60 %, about 65% or about 70%; xxi) The level of new omega-3 fatty acids in the total fatty acid content of the extracted lipid is from 21% to about 4%. Between 5%, between 21% and about 35%, between about 23% and about 35%, about 25% to about 35% Between about 27% and about 35%, between about 23% and about 25%, about 27%, about 30%, about 35%, about 40% or about 45%; xxii) the ratio of total ω6 fatty acids to total ω3 fatty acids in the total fatty acid content of the extracted lipid is Between about 1.0 and about 3.0, between about 0.1 and about 1, between about 0.1 and about 0.5, about 0. Less than about 0.50, less than about 0.40, less than about 0.30, less than about 0.20, less than about 0.15, less than about 1. less than 0, less than about 0.1, from about 0.10 to about 0.4, or about 0.2; xxiii) The ratio of new ω6 fatty acids to new ω3 fatty acids in the total fatty acid content of the extracted lipid is , between about 1.0 and about 3.0, between about 0.02 and about 0.1, between about 0.1 and about 1, Between 0.1 and about 0.5, less than about 0.50, less than about 0.40, less than about 0.30, about 0.2 Less than 0, less than about 0.15, about 0.02, about 0.05, about 0.1, about 0.2, or about 1.0 That is, xxiv) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 10% about 80%, between about 60% and about 98%, between about 70% and about 95%, or about 75% Based on the efficiency of conversion of oleic acid to LA by Δ12-desaturase, which is between 0.1 and 90%, To build xxv) the fatty acid composition of the lipid is at least about 30%, at least about 40%, at least about 50% at least about 50%, at least about 60%, at least about 70%, between about 30% and about 70%, Between 35% and about 60%, or between about 50% and about 70% Δ6-desaturase Based on the conversion efficiency of ALA to SDA xxvi) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 10% about 75%, between about 60% and about 95%, between about 70% and about 88%, or about 75% Based on the efficiency of conversion of SDA to ETA acid by Δ6-elongase of between about 85% and about 85% thing, xxvii) the fatty acid composition of the lipid is at least about 60%, at least about 70%, at least about 75%, between about 60% and about 99%, between about 70% and about 99%, or about 75% Based on the efficiency of conversion of ETA to EPA by Δ5-desaturase between about 98% and about 98% To xxviii) the fatty acid composition of the lipid is at least about 80%, at least about 85%, at least about 90%, between about 50% and about 99%, between about 85% and about 99%, about 50% Between about 85% and about 95%, or between about 85% and about 95%, of EPA produced by Δ5-elongase based on the conversion efficiency of HCl to DPA; xxix) the fatty acid composition of the lipid is at least about 10%, at least about 15%, at least about 16% at least about 20%, at least about 25%, about 20%, about 25%, about 30%, about 10% to about Between about 50%, between about 10% and about 30%, between about 10% and about 25%, or between about 20% and Based on an oleic acid to DPA conversion efficiency of between about 30%; xxx) the fatty acid composition of said lipid is at least about 15%, at least about 20%, at least about 15% At least about 22%, at least about 25%, at least about 30%, at least about 40%, at least about 25% %, about 30%, about 35%, about 40%, about 45%, about 50%, between about 15% and about 50%, Conversion of LA to DPA between about 20% and about 40%, or between about 20% and about 30% Efficiency-based xxxi) the fatty acid composition of the lipid is at least about 17%, at least about 22%, at least about 18% at least about 24%, at least about 30%, about 30%, about 35%, about 40%, about 45%, about 5 0%, about 55%, about 60%, between about 22% and about 70%, between about 17% and about 55%, about Conversion of ALA to DPA between 22% and about 40%, or between about 24% and about 40% Efficiency-based xxxii) The total fatty acids in the extracted lipids are less than 1.5% C20:1, less than 1% C2 having a C20:1 of 0:1 or about 1%; xxxiii) the triacylglycerol (TAG) content of the lipid is at least about 7 0%, at least about 80%, at least about 90%, at least about 95%, about 70% to about 99%, or between about 90% and about 99%; xxxiv) The lipid comprises diacylglycerol (DAG), and DAG is preferably including a DPA; xxxv) the lipid is less than about 10%, less than about 5%, less than about 1%, or less than about 0.001% containing, or consisting essentially of, between about 5% and about 5% free (non-esterified) fatty acids and / or phospholipids. not include it in xxxvi) at least 70% of the DPA esterified in the form of TAG, at least 72% or at least 80% are at the sn-1 or sn-3 position of the TAG 、 xxxvii) The most abundant DPA-containing TAG species in the lipids is DPA / 18:3 / 18:3 (TAG56:12), xxxviii) the lipid comprises a tri-DPA TAG (TAG 66:18); and xxxix) The level of DPA in the total fatty acid content of the extracted lipid is about 7%, about 8% , about 9%, about 10%, about 12%, about 15%, about 18%, about 20%, about 22%, about 24%, About 26%, about 28%, about 31%, between about 7% and about 31%, between about 7% and about 28%, about Between 10% and about 35%, between about 10% and about 30%, between about 10% and about 25%, about 1 Between 0% and about 22%, between about 14% and about 35%, between about 16% and about 35%, about 16 % to about 30%, between about 16% to about 25%, or between about 16% to about 22%. and optionally, the DHA level is less than 0.5% of the total fatty acid content of the extracted lipid. and The lipid of claim 1, having one or more of the following:

3. The lipid is an oil, preferably an oil from an oilseed, more preferably The lipid is Brassica napus oil or mustard Brassica sp., such as Brassica juncea oil .) oil, cotton (Gossypium hirsutum) oil, flax (Linum usitatissimum oil, Helianthus sp. . ) oil, safflower (Carthamus tinctorius) oil, soybean ( Glycine max) oil, corn (Zea mays) oil, Guinea Palm oil (Elaeasis guineenis), Nicotiana benthamiana (Nic otiana benthamiana oil, lupin (Lupinus angustifolius oil, Camelina sativa (Camelina sativa) va) Oil, Crambe abyssinica oil, Giant Miscanthus (Miscanthus x giganteus) oil, or Miscanthus sinensis oil, 3. The lipid according to claim 1 or 2.

4. i) obtaining plant parts or microbial cells containing lipids, wherein said lipids are esterified The fatty acids are in a form selected from the group consisting of oleic acid, palmitic acid, linoleic acid (LA), ) containing ω6 fatty acids, α-linolenic acid (ALA) containing ω3 fatty acids, stearidonic acid (S DA), docosapentaenoic acid (DPA), and optionally one or more eicosapentaenoic acids enoic acid (EPA) and eicosatetraenoic acid (ETA), The level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. Process, and ii) extracting lipids from said plant parts or microbial cells wherein the level of DPA in the total fatty acid content of the extracted lipid is between 7% and 35%. A method for producing certain extracted plant or microbial lipids.

5. 10. The extracted lipids have one or more of the characteristics defined in claim 2 or claim 3.

4. The method according to claim 4

6. The plant part is a seed, preferably a seed of Brassica napus ) or Brassica (Brassica juncea) cas sp.), cotton (Gossypium hirsutum), flax (Linum usitatissimum), Helianthus sp., Nibana (Carthamus tinctorius), soybean (Glycine ma x), corn (Zea mays), Guinea oil palm (Elaesis gui) neenis), Nicotiana benthamiana , Blue-flowered lupine (Lupinus angustifolius), Camelina sativa Camelina sativa, or Crambe abyssinica byssinica), preferably rapeseed (Brassica napus) ), mustard (B. juncea) or camelina sativa (C. sativa) 6. The method of claim 4 or 5, wherein the plant is an oilseed such as a seed.

7. The plant part or microbial cell is capable of producing the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene Δ5-elongase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ Δ6-elongase and Δ5-elongase, iv) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5- Elongase, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase Δ5-elongase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ 5-elongase, ix) ω3-desaturase or Δ15-desaturase, Δ6-desaturase; a Δ5-desaturase, a Δ6-elongase and a Δ5-elongase, or x) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-Desaturase, Δ9-elongase and Δ5-elongase each polynucleotide encoding one of the plant parts one or more polynucleotides capable of inducing expression of said polynucleotide in a molecule or microbial cell The method of any one of claims 4 to 6, wherein the gene is operably linked to a promoter.

8. The plant part or microbial cell has the following characteristics: i) the Δ12-desaturase is at least about 60%, at least about 70%, at least about 80%, between about 60% and about 95%, between about 70% and about 90%, or about 75% % to about 85% efficiency in one or more cells of said plant part or microbial cell. Conversion of leic acid to linoleic acid ii) the ω3-desaturase is at least about 65%, at least about 75%, at least about 85%, between about 65% and about 95%, between about 75% and about 91%, or about 80% % to about 91% efficiency in one or more cells of said plant part or microbial cell, Converting omega-6 fatty acids to omega-3 fatty acids iii) the Δ6-desaturase is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, Between 30% and about 70%, between about 35% and about 60%, or between about 50% and about 70% and converting ALA to SDA in one or more cells of said plant part or microbial cell with an efficiency of To do, iv) the Δ6-desaturase is less than about 5%, less than about 2.5%, less than about 1%, less than about 0% Between 1% and about 5%, between about 0.5% and about 2.5%, or between about 0.5% and about 1% and converting linoleic acid to γ-linoleic acid in one or more cells of said plant part or microbial cell with an efficiency of 100% or less. Conversion to norenic acid v) the Δ6-elongase is at least about 60%, at least about 70%, at least about 75%, between about 60% and about 95%, between about 70% and about 80%, or about 75% and / or about 80% SDA efficiency in one or more of said plant parts or microbial cells. to ETA, vi) the Δ5-desaturase is at least about 60%, at least about 70%, at least about 75%, at least about 80%, at least about 90%, between about 60% and about 95% , or between about 70% and about 95%, or between about 75% and about 95% efficiency, or converting ETA to EPA within one or more cells of the microbial cells; vii) the Δ5-elongase is at least about 80%, at least about 85%, at least about 90%, between about 50% and about 90%, or between about 85% and about 95% efficiency. converting EPA to DPA in one or more cells of said plant part or microbial cell. 、 viii) converting oleic acid into DPA in one or more cells of said plant part or microbial cell. The efficiency of conversion to At least about 25%, about 20%, about 25%, about 30%, between about 10% and about 50%, about 10% % to about 30%, or about 10% to about 25%, or about 20% to about 30% Between ix) converting LA to DPA within one or more cells of said plant part or microbial cell. Efficiency is at least about 15%, at least about 20%, at least about 22%, at least about 25%, at least about 30%, about 25%, about 30%, about 35%, about 15% to about 50% between about 20% and about 40%, or between about 20% and about 30%; x) converting ALA to DPA in one or more cells of said plant part or microbial cell; Efficiency is at least about 17%, at least about 22%, at least about 24%, at least about 30%, about 30%, about 35%, about 40%, between about 17% and about 55%, between about 22% and about 3 between 5% or between about 24% and about 35%; xi) one or more cells of said plant part or microbial cell contain said exogenous polynucleotide at least about 25%, at least about 30%, about 25% to about 30% of the total number of cells containing the nucleotides, 40%, or between about 27.5% and about 37.5% high in omega-3 fatty acids; xii) the Δ6-desaturase is capable of converting α-linolenic acid (LA) to linoleic acid (LA). preferentially desaturating (ALA); xiii) the Δ6-elongase also has Δ9-elongase activity; xiv) the Δ12-desaturase also has Δ15-desaturase activity; xv) the Δ6-desaturase also has Δ8-desaturase activity; xvi) the Δ8-desaturase also has Δ6-desaturase activity, or lacking 6-desaturase activity; xvii) the Δ15-desaturase has ω3-desaturase activity on GLA Also have xviii) the ω3-desaturase has Δ15-desaturase activity on LA Also have xix) The ω3-desaturase desaturates both LA and / or GLA thing, xx) the ω3-desaturase preferentially desaturates GLA relative to LA. and, xxi) one or more or all of said desaturases convert the corresponding acyl-PC substrates , having high activity towards acyl-CoA substrates; xxii) The Δ6-desaturase converts LA to ALA as a fatty acid substrate. having high Δ6-desaturase activity; xxiii) The Δ6-desaturase binds to the Sn-2 position of PC as a fatty acid substrate. ALA-CoA as a fatty acid substrate has a higher Δ6-desaturase activity than ALA-CoA as a fatty acid substrate. having thrombinase activity; xxiv) the Δ6-desaturase has a higher activity against ALA as a substrate compared to LA. and at least about two-fold higher Δ6-desaturase activity, at least three-fold higher activity, have four times higher activity, or at least five times higher activity, xxv) The Δ6-desaturase binds to the sn-2 position of PC as a fatty acid substrate. It has higher activity towards ALA-CoA as a fatty acid substrate than towards ALA. and, xxvi) The Δ6-desaturase binds to the sn-2 position of PC as a fatty acid substrate. at least about 5% for ALA-CoA as a fatty acid substrate than for ALA-CoA as a fatty acid substrate 2-fold higher Δ6-desaturase activity or at least 10-fold higher activity; xxvii) the desaturase is a front-end desaturase; and xxviii) the Δ6-desaturase exhibits detectable Δ5-desaturase activity against ETA No urase activity 8. The method of claim 7, comprising one or more or all of:

9. The plant part or microbial cell is capable of expressing diacylglycerol acyltransferase ( DGAT), monoacylglycerol acyltransferase (MGAT), glycero 1-acyl-glycerol-3-phosphate acyltransferase (GPAT), 3-phosphate acyltransferase (LPAAT), preferably DPA-CoA, etc. LPAAT, which can use a C22 polyunsaturated fatty acyl-CoA substrate of: Lysophosphatidylcholine acyltransferase (LPCAT), phospholipase A ２ (P.L.A. ２ ), phospholipase C (PLC), phospholipase D (PLD), CDP- Choline diacylglycerol cholinephosphotransferase (CPT), phosphatase glycerol diacylglycerol acyltransferase (PDAT), phosphatidylcholine Choline:diacylglycerolcholinephosphotransferase (PDCT), acyl- CoA synthase (ACS), or a combination of two or more thereof.

9. The method of claim 7 or claim 8, further comprising leotide.

10. The exogenous polynucleotide is integrated into the genome of a cell of the plant part or microbial cell. covalently linked within the incorporated DNA molecule, preferably a T-DNA molecule, the number of such DNA molecules integrated into the genome of the cells of said plant part or microbial cell is 1 Any one of claims 7 to 9, wherein the number of saturates is 1 or less, 2 or 3 or less, or 2 or 3. The method described in paragraph .

11. the total oil content of said plant part or microbial cell containing said exogenous polynucleotide is , the total oil of the corresponding plant part or microbial cell that does not contain the exogenous polynucleotide. At least about 40%, at least about 50%, at least about 60%, at least about 70%, between about 50% and about 80%, or between about 80% and about 100%.

11. The method according to any one of claims 4 to 10.

12. Treating the lipid to increase the level of DPA as a percentage of the total fatty acid content and said treating further comprises one or more of fractional distillation, distillation or methylation of DPA.

12. The process according to claim 4 to 11, comprising a transesterification reaction such as the formation of an ester or ethyl ester.

10. The method according to any one of claims 1 to 9.

13. Oilseed plants or parts thereof, or microbial cells, containing lipids in their seeds 、 a) a lipid comprising fatty acids in esterified form, and b) the following set of enzymes: i) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase enzymes, Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5- Elongase, ii) Δ12-desaturase, ω3-desaturase and / or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5 -Elongase iii) ω3-desaturase and / or Δ15-desaturase, Δ6-desaturase a Δ5-desaturase, a Δ6-elongase and a Δ5-elongase, or iv) ω3-desaturase and / or Δ15-desaturase, Δ8-desaturase enzymes, Δ5-desaturases, Δ9-elongases and Δ5-elongases an exogenous polynucleotide encoding one of Including, Each polynucleotide is capable of directing expression of said polynucleotide in developing seeds of said plant. one or more seed-specific promoters capable of expressing said polynucleotides in said microbial cell; operably linked to one or more promoters capable of inducing expression of the nucleotides; The fatty acids are omega-6 fatty acids, including oleic acid, palmitic acid, and linoleic acid (LA), alpha-linoleic acid, and omega-3 fatty acids including norenic acid (ALA), stearidonic acid (SDA), and docosapentaenoic acid dihydroxybenzoic acid (DPA), and optionally eicosapentaenoic acid (EPA) and / or and eicosatetraenoic acid (ETA), and the lipids of said seeds or microbial cells. the level of DPA in the total fatty acid content is between 7% and 35%; The oilseed plant, or part thereof, or microbial cell.

14. Brassica napus, which is capable of producing seeds containing DPA ), mustard (B. juncea) or camelina sativa (Camelina sativa) tiva) plant, wherein the mature harvested seeds of said plant have a low At least about 28 mg per gram of seed, preferably at least about 32 mg per gram of seed At least about 36 mg per gram of seed, and at least about 40 mg per gram of seed, more preferably or at least about 44 mg or at least 48 mg per gram of seed, At least about 80 mg per ram, or about 30 mg to about 80 mg per gram of seed The plant has a DPA content between .

15. 14. The plant cell of claim 13, comprising the exogenous polynucleotide.

16. Features include: i) derived from the plant according to claim 13 or 14; ii) comprising a lipid according to any one of claims 1 to 3; iii) It can be used in the method according to any one of claims 4 to 12. a plant part, preferably a seed, or a microbial cell, having one or more of:

17. DPA and between about 4% and about 15% by weight, preferably about 6% to about 8% by weight or between about 4% and about 8% by weight moisture. Rana (Brassica napus), mustard (B. juncea) or camellia Camelina sativa seeds, the DPA content of said seeds at least about 28 mg per gram of seed, preferably at least about 10 mg per gram of seed at least about 32 mg per gram of seed, at least about 36 mg per gram of seed, at least about 32 mg per gram of seed More preferably, at least about 40 mg per gram of seed or at least about 44 mg per gram of seed At least about 48 mg per gram, about 80 mg per gram of seed, or The seeds have a content of between about 30 mg and about 80 mg per gram.

18. Use for producing the extracted plant lipid or extracted microbial lipid according to any one of claims 1 to 3.

1. A method for producing a plant or microbial cell capable of producing a microbial cell, said method comprising: a) produced by one or more plant parts or microbial cells from a plurality of plants or microbial cells Assaying the level of DPA in the lipids produced by each plant or microbial cell but the following set of enzymes: i) ω3-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6-ene Δ5-elongase and Δ5-elongase, ii) Δ15-desaturase, Δ6-desaturase, Δ5-desaturase, Δ6 -elongase and Δ5-elongase, iii) Δ12-desaturase, Δ6-desaturase, Δ5-desaturase, Δ Δ6-elongase and Δ5-elongase, iv) a Δ12-desaturase, a ω3-desaturase, or a Δ15-desaturase , Δ6-desaturase, Δ5-desaturase, Δ6-elongase and Δ5-elongase gauze, v) ω3-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9-desaturase Δ5-elongase and Δ5-elongase, vi) Δ15-desaturase, Δ8-desaturase, Δ5-desaturase, Δ9 -elongase and Δ5-elongase, vii) Δ12-desaturase, Δ8-desaturase, Δ5-desaturase, Δ 9-elongase and Δ5-elongase, viii) Δ12-desaturase, ω3-desaturase or Δ15-desaturase Δ8-desaturase, Δ5-desaturase, Δ9-elongase and Δ5-elongase Longase, ix) ω3-desaturase or Δ15-desaturase, Δ6-desaturase; a Δ5-desaturase, a Δ6-elongase and a Δ5-elongase, or x) ω3-desaturase or Δ15-desaturase, Δ8-desaturase, Δ 5-Desaturase, Δ9-elongase and Δ5-elongase and one or more exogenous polynucleotides encoding one of: Each polynucleotide is a polynucleotide that is expressed in a plant part or a microbial cell. operably linked to one or more promoters capable of inducing expression of the And, and b) one or more parts thereof of the extracted plant lipid or micro-lipid according to any one of claims 1 to 3 The plant or microbial cells can be isolated from a plurality of plant or microbial cells that can be used to produce biolipids. To determine c) optionally, progeny from said identified plant or microbial cell, or seeds derived therefrom. Producing plant or microbial cells The method comprising:

19. 1. A method for producing seeds, said method comprising: a) preferably a collection of at least 1000 or 2000 or 3000 such plants; Cultivated land as a combined area or at least 1 hectare or 2 hectares planted at standard planting density. 13 or 14, or a plant according to claim 13 or 14, on an area of ​​1000 m² or 3 hectares.

16. Growing a plant that produces a plant part according to claim 16 or a seed according to claim 17. and, b) harvesting seeds from said one or more plants; and c) optionally extracting lipids from said seeds, preferably at least 60 kg or producing oil with a total DPA yield of 70 kg or 80 kg DPA / hectare. thing The method comprising:

20. The following features: i) comprising an oil as defined in claim 2 or claim 3; and ii) the plant part or seed or microbial cell is a plant part or a seed or a microbial cell according to any one of claims 4 to 12 It can be used in the manner described The plant, plant cell, or plant part according to any one of claims 13 to 17, Minutes or seeds, or microbial cells.

21. The cell of claim 15, the cell of claim 16, or the cell of claim 17, 14. The oilseed plant according to claim 13, the microbial cell according to claim 13, and the horsefly according to claim 14. Rana (Brassica napus), mustard (B. juncea) or turtle 17. A Camelina sativa plant, a plant part according to claim 16, or or a lipid or oil produced by or obtained from the seed of claim 17.

22. 18. A plant obtained from the seed of claim 17 or from the plant of claim 13 or 14. Seed meal.

23. One or more lipids or oils according to claim 21, a cell according to claim 15, or a compound according to claim 20. a plant cell or a microbial cell according to claim 17, a seed according to claim 18, or a seed according to claim 22. A composition comprising domir.

24. One or more lipids or oils according to claim 21, cells according to claim 15, and / or cells according to claim 13. the oilseed plant according to claim 20, the plant cell or microbial cell according to claim 14 Brassica napus, mustard (B. juncea) or a Camelina sativa plant, as claimed in claim 20. A plant part, a seed according to claim 17, a seed meal according to claim 22, or a plant part according to claim 23. A livestock feed, cosmetic or chemical product containing the composition.

25. 1. A method for producing livestock feed, said method comprising: The lipid or oil according to any one of claims 1 to 3, the cell according to claim 15, The oilseed plant of claim 13, the plant cell or microbial cell of claim 20, 14. Brassica napus and mustard (B. juvenile) ncea or Camelina sativa plants, 20, the seed of claim 17, the seed meal of claim 22, or 24. The method of claim 23, comprising mixing the composition of claim 23.

26. Claims for the manufacture of a medicament for the treatment or prevention of conditions that would benefit from PUFAs. One or more lipids or oils according to any one of claims 1 to 3, and the cell according to claim 15.

21. The plant cell or microbial cell of claim 20, the plant part of claim 20, or claim 1 24. Use of the seed according to claim 7, the seed meal according to claim 22, or the composition according to claim 23.

Images