Drug targets for idiopathic pulmonary fibrosis

Abstract

To provide a drug target for idiopathic pulmonary fibrosis, and the use thereof.SOLUTION: The present invention relates to a drug target for idiopathic pulmonary fibrosis, and the use thereof. The drug target is AREG signaling in AT2 cells of the lung. The drug target can be used to screen drugs for treating and / or preventing pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF), of animals and human beings.SELECTED DRAWING: None

Description

[Background technology]

[0001] Fibrosis is formed by thickening or scarring of connective tissue following injury and is characterized by excessive proliferation of fibroblasts and accumulation of extracellular matrix (ECM) components. This condition is commonly seen in organs such as the lungs, liver, and kidneys, and can lead to the destruction of tissue architecture, resulting in severe impairment of organ function. 1、2 In fact, fibrosis can occur in almost any organ and is a major cause of end-stage organ failure and death in a variety of chronic diseases. 3 A common feature of pulmonary fibrosis is the excessive proliferation of fibroblasts around the air sacs (alveoli) of the lungs. 4 Extensive biomedical research has demonstrated that the combination of increased numbers of fibroblasts and excessive ECM deposition in these lungs ultimately leads to the destruction of alveolar architecture, reduced lung compliance, and impaired gas exchange. 5-7 .

[0002] The most common type of pulmonary fibrosis is idiopathic pulmonary fibrosis (IPF). This disorder eventually affects entire lung lobes, but begins as tiny peripheral fibrotic lesions that gradually progress inwards, eventually resulting in respiratory failure. 8、9 IPF is a fatal disease, with a median survival time of only 2-4 years from diagnosis. 10 Scientifically speaking, the mechanism and nature of the pathogenesis of IPF have yet to be fully elucidated, and several studies have suggested the contribution of a specific subset of alveolar epithelial cells, alveolar type II (AT2) cells. 4、11 .

[0003] Patients with pulmonary fibrosis suffer from reduced lung compliance, impaired gas exchange, and ultimately respiratory failure and death. It is estimated that IPF affects 1 in 200 adults aged 65 years or older in the United States, with a median survival of 2-4 years. The estimated incidence of IPF in China is 3-5 / 100,000, accounting for approximately 65% ​​of all interstitial lung diseases. Diagnosis is usually made between the ages of 50-70, with a male-female ratio of 1.5-2:1. Patients usually survive for only 2-5 years.

[0004] Currently, IPF cannot be cured. Two known drugs, nintedanib and pirfenidone, have similar effects on the rate of decline in forced vital capacity within one year. Although these two drugs have shown a trend toward reducing mortality, they have not been able to significantly extend survival. One of the main reasons is that there is still no ideal drug target for pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF), to screen candidate drugs to treat pulmonary fibrosis, especially idiopathic pulmonary fibrosis (IPF). Summary of the Invention

[0005] The present invention relates to a drug target for idiopathic pulmonary fibrosis and its use. The drug target is AREG signaling in pulmonary AT2 cells. The drug target can be used to screen for drugs to treat and / or prevent pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF). The present invention further provides a method for screening candidate drugs for treating pulmonary fibrosis in animals and humans, particularly idiopathic pulmonary fibrosis (IPF), using the drug target.

[0006] First, the present invention provides a drug target for idiopathic pulmonary fibrosis, which is AREG signaling in pulmonary AT2 cells, hereinafter referred to as AREG target.

[0007] In the present invention, it was found that AREG was detected in AT2 cells of all IPF specimens, but not in AT2 cells of control lungs.

[0008] In the present invention, it was found that AREG signals could not be detected in control lungs of subjects who had or had not undergone PNX, and that AREG signals could not be detected in AT2 cells in control lungs derived from subjects who had or had not undergone PNX.

[0009] In the present invention, it was further revealed that AREG could be detected in AT2 cells in Cdc42-null AT2 lungs, and that the expression level of AREG in the lungs of Cdc42-null AT2 lungs after PNX gradually increased.

[0010] Thus, the expression level of AREG was significantly upregulated in AT2 cells from both a mouse model of progressive fibrosis and a patient with pulmonary fibrosis.

[0011] The present invention further demonstrated that overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0012] Preferably, ectopic expression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0013] Preferably, the AREG target is AREG in pulmonary AT2 cells derived from a subject.

[0014] Preferably, the AREG target is the receptor for AREG in pulmonary AT2 cells derived from a subject.

[0015] Preferably, the AREG target is EGFR in lung fibroblasts from a subject.

[0016] In the present invention, it was demonstrated that the strength of EGFR signaling in α-SMA-positive fibroblasts depends on the expression of AREG in AT2 cells.

[0017] In the present invention, it was demonstrated that reducing the AREG expression level in pulmonary AT2 cells derived from subjects significantly attenuated the progression of pulmonary fibrosis in Cdc42-null AT2 mice.

[0018] Therefore, the present invention demonstrated that AREG and its receptor EGFR are therapeutic targets for treating fibrosis.

[0019] Next, the present invention provides a method for generating an Areg AT2-overexpressing transgenic mouse in which AREG is specifically overexpressed in pulmonary AT2 cells.

[0020] Preferably, the method comprises specifically inducing expression of Areg in AT2 cells after doxycycline treatment, and preferably, the transgenic mouse produced is an Spc-rtTA / teto-Areg mouse. Preferably, the Spc-rtTA / teto-Areg mouse has the characteristic sequence shown in SEQ ID NO:18.

[0021] Preferably, the Spc-rtTA / teto-Areg mouse can be identified by the following primer sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[0022] Third, the present invention provides a transgenic mouse in which AREG is specifically overexpressed in pulmonary AT2 cells. The mouse is a transgenic mouse in which Areg AT2 is overexpressed.

[0023] Preferably, in the transgenic mouse, Areg expression is specifically induced in AT2 cells after doxycycline treatment. Preferably, the transgenic mouse is an Spc-rtTA / teto-Areg mouse. Preferably, the Spc-rtTA / teto-Areg mouse has a characteristic sequence shown in SEQ ID NO:18.

[0024] Preferably, the Spc-rtTA / teto-Areg mouse can be identified by the following primer sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[0025] Fourth, the present invention provides the use of AREG in pulmonary AT2 cells and / or its receptor EGFR in fibroblasts as a drug target for treating pulmonary fibrosis in animals and humans, in particular idiopathic pulmonary fibrosis (IPF).

[0026] Fifth, the present invention provides use of the AREG target or the transgenic mouse for screening agents for treating pulmonary fibrosis in animals and humans, in particular idiopathic pulmonary fibrosis (IPF).

[0027] Sixth, the present invention provides use of a detecting agent for AREG and / or a detecting agent for its receptor EGFR for the manufacture of a diagnostic kit for diagnosing pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals and humans.

[0028] Preferably, the kit can be used with a sample from a subject suspected of having pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF). The sample can be a biopsy tissue. For example, the biopsy tissue can be lung tissue from the subject. Preferably, the biopsy tissue can be from the lower, middle, or upper part of a lung lobe from the subject. If AREG is detected in the upper part of a lung lobe from the subject, the subject can be diagnosed as having severe pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF). Idiopathic pulmonary fibrosis is considered to be the most common type of pulmonary fibrosis, in which fibrotic lesions begin at the periphery of the lung lobe, progress to the center of the lung lobe, and then to the upper part of the lung lobe, eventually resulting in respiratory failure.

[0029] Seventh, the present invention provides use of a substance that targets AREG and / or its receptor in pulmonary AT2 cells, for example, EGFR in fibroblasts, for the manufacture of a medicament for treating pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals and humans.

[0030] Preferably, the agent is an inhibitor of AREG in pulmonary AT2 cells or an inhibitor of EGFR in pulmonary fibroblasts.

[0031] The animal can be a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey or chimpanzee.

[0032] The present invention includes all combinations of the specific embodiments described in the specification. [Brief description of the drawings]

[0033] [Figure 1] FIG. 1 shows the generation of mouse strains with specific deletion of the Cdc42 gene in AT2 cells. [Diagram 2] FIG. 2 shows a fragment of the Cdc42 DNA sequence before and after deletion of exon 2 of the Cdc42 gene in AT2 cells. [Diagram 3] FIG. 3 shows that loss of the Cdc42 gene in AT2 cells impairs AT2 cell differentiation during alveolar regeneration or alveolar steady state after PNX. [Figure 4] FIG. 4 shows that loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-treated mice. [Diagram 5] FIG. 5 shows that loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-naive aged mice. [Figure 6] FIG. 6 shows the development of α-SMA+ fibroblast foci in the lungs of Cdc42 null AT2 mice. [Figure 7] FIG. 7 shows that AREG is strongly and specifically expressed in AT2 cells in Cdc42-null AT2 lungs. [Figure 8]FIG. 8 shows that AREG is strongly and specifically expressed in AT2 cells from human pulmonary fibrosis patients. [Figure 9] FIG. 9 shows the sequence of teto-Areg. [Figure 10] 10 shows that Areg expression is specifically induced in AT2 cells of Spc-rtTA / teto-Areg mice after doxycycline treatment. Overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis. [Figure 11] FIG. 11 shows the Areg DNA sequence before and after deletion of exon 3 of the Areg gene in AT2 cells. [Figure 12] FIG. 12 shows that deletion of the Areg gene in AT2 cells in Cdc42-null AT2 lungs significantly attenuates the development of pulmonary fibrosis. [Figure 13] FIG. 13 Targeting AREG and its receptor EGFR to treat IPF and other fibrotic diseases. DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

[0034] The description of specific embodiments and examples is for purposes of illustration and not limitation, as those of ordinary skill in the art will readily recognize a variety of non-critical parameters that could be changed or modified to yield essentially similar results.

[0035] Idiopathic pulmonary fibrosis (IPF) is a chronic lung disease characterized by a progressive and irreversible decline in lung function. Symptoms usually begin gradually with shortness of breath and a dry cough. Other changes may include fatigue and Hippocratic nails. Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.

[0036] The alveolar epithelium of the lung is composed of both alveolar type I (AT1) and type II (AT2) cells. AT2 cells are alveolar stem cells and can differentiate into AT1 cells during the alveolar steady state and during the repair phase after injury. 12、13Ultimately, AT1 cells, which comprise approximately 95% of the alveolar surface in the adult lung, are large squamous cells that function as the epithelial component of the thin blood-air barrier. 14 In IPF tissues, abnormally proliferating AT2 cells are usually located near fibroblast nests. 15 In clinical practice, gene mutations that affect the function of AT2 cells are commonly observed in IPF tissues. 16、17 In addition, recent advances in identifying the molecular profile of IPF lungs have revealed that TGFβ signaling (a fibrotic signaling pathway common to many fibrotic diseases) is activated in AT2 cells in IPF lungs. Although these multiple lines of evidence together demonstrate the obvious pathological influence of AT2 cells in pulmonary fibrosis, the exact pathological mechanisms behind the abnormal physiological function of AT2 and progressive pulmonary fibrosis remain to be elucidated.

[0037] After administering tamoxifen to the animals, the Sftpc gene promoter-driven recombinase (Spc-CreER) is used to specifically delete genes in AT2 cells. The CreER mouse line is usually used for inducible gene knockout studies.

[0038] Amphiregulin (AREG) is a member of the epidermal growth factor family. AREG is synthesized as a membrane-anchored precursor protein and can act directly on neighboring cells as a junctional secretion factor. After proteolytic processing by plasma membrane proteases (TACE / ADAM17), AREG is secreted and functions as an autocrine or paracrine factor. AREG is a ligand for the transmembrane tyrosine kinase epidermal growth factor receptor (EGFR). By binding to EGFR, AREG can activate major intracellular signaling cascades that control cell survival, proliferation, and differentiation. 19-21 .

[0039] Physiologically, AREG plays an important role in the development and maturation of mammary glands, bone tissue, and oocytes. 20、22Under normal conditions, AREG is expressed at low levels in adult tissues other than the placenta. However, chronic elevation of AREG expression has been shown to be associated with several pathological conditions. Increased expression of AREG is associated with skin phenotypes such as psoriasis and several inflammations. 23 Several studies have described the oncogenic role of AREG in lung, breast, colorectal, ovarian and prostate cancers, as well as in some hematological and mesenchymal cancers. 24、25 In addition, AREG may also be involved in drug resistance to some cancer treatments. 26、27 .

[0040] It has been shown that TGFβ can activate AREG expression in a bleomycin-induced mouse pulmonary fibrosis model 28 It has also been shown that AREG expression levels are increased in liver fibrosis, cystic fibrosis, and polycystic kidney disease. 23 Therefore, it is believed that AREG may contribute to the proliferation and survival of fibrotic cells in these fibrotic diseases, especially in idiopathic pulmonary fibrosis (IPF). However, scientifically, the mechanism and nature of the pathological progression of IPF have not yet been fully elucidated. 29 Although it has been speculated that AREG plays a role in the progression of IPF, the cells in which AREG is expressed during the process of progressive pulmonary fibrosis remain unknown. Furthermore, due to the lack of a mouse model of progressive pulmonary fibrosis, the effect of targeting AREG in progressive pulmonary fibrosis is also unknown.

[0041] In an embodiment of the present invention, it was shown that AREG signals could not be detected in control lungs of subjects who had or had not undergone PNX, and that AREG signals could not be detected in AT2 cells in control lungs derived from subjects who had or had not undergone PNX.

[0042] In an embodiment of the present invention, it was shown that AREG could be detected in AT2 cells of PNX-treated Cdc42 null AT2 lungs or aged Cdc42 null AT2 mice, and the expression level of AREG gradually increased in the lungs of Cdc42 null AT2 lungs after PNX, and surprisingly, AREG was detected in AT2 cells of all IPF specimens. Thus, the present invention showed for the first time that the expression level of AREG was significantly upregulated in AT2 cells of both progressive fibrosis mouse models and pulmonary fibrosis patients.

[0043] In an embodiment of the present invention, a transgenic mouse in which AREG was specifically overexpressed in pulmonary AT2 cells was generated. The transgenic mouse had obvious fibrotic changes in the lungs.

[0044] In an embodiment of the present invention, a transgenic mouse was generated in which both the Areg gene and the Cdc42 gene were deleted. This transgenic mouse is an Areg&Cdc42 double null AT2 mouse. The Areg&Cdc42 double null AT2 mouse showed slight fibrosis on day 21 after PNX, whereas the Cdc42 null AT2 lung showed significant pulmonary fibrosis. Thus, the development of pulmonary fibrosis in Cdc42 null AT2 mice can be significantly attenuated by reducing the expression level of AREG. Thus, the present invention proposes that AREG and its receptor EGFR are therapeutic targets for treating fibrosis. AREG refers to AREG in pulmonary AT2 cells, and EGFR refers to EGFR on pulmonary fibroblasts.

[0045] According to the present invention, the following inventions are provided. [1] AREG signaling in pulmonary AT2 cells from animals or humans, a drug target used in idiopathic pulmonary fibrosis. [2] The drug target described in [1] above, wherein AREG is detected in AT2 cells in the lungs of animals and humans suffering from idiopathic pulmonary fibrosis (IPF) and is not present in AT2 cells in normal lungs of animals or humans. [3] The drug target described in [1] above, in which AREG is detected in AT2 cells of Cdc42 null AT2 lungs and the expression level of AREG is increased in AT2 cells of Cdc42 null AT2 lungs after PNX. [4] The drug target described in [1] above, in which the expression level of AREG is upregulated in pulmonary AT2 cells derived from animals or humans suffering from progressive fibrosis. [5] The drug target according to any one of the above [1] to [4], wherein AREG signaling in pulmonary AT2 cells derived from animals or humans is the AREG target. [6] The drug target described in [5] above, wherein the AREG target is AREG in pulmonary AT2 cells derived from animals or humans. [7] The drug target described in [5] above, wherein the AREG target is a receptor for AREG in pulmonary AT2 cells derived from animals or humans. [8] The drug target according to [5] above, wherein the AREG target is EGFR in pulmonary fibroblasts derived from animals or humans. [9] The strength of EGFR signaling in α-SMA-positive fibroblasts depends on AREG expression in AT2 cells, a drug target as described in [8] above.

[10] The drug target described in [1] above, wherein the drug target reduces the expression level of AREG in pulmonary AT2 cells derived from animals or humans.

[11] A method for generating Areg AT2-overexpressing transgenic mice, in which AREG is specifically overexpressed in mouse lung AT2 cells.

[12] The method according to

[11] above, comprising the step of specifically inducing Areg expression in AT2 cells after doxycycline treatment.

[13] The method according to

[11] or

[12] above, wherein the transgenic mouse produced is an Spc-rtTA / teto-Areg mouse.

[14] The method according to

[13] above, wherein the Spc-rtTA / teto-Areg mouse has a characteristic sequence represented by SEQ ID NO:18.

[15] A pair of primer sequences for identifying the Spc-rtTA / teto-Areg mouse prepared in

[14] above, the primer sequences having the following sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[16] Transgenic mice in which AREG is specifically overexpressed in pulmonary AT2 cells.

[17] The transgenic mouse according to

[16] above, wherein the mouse is a transgenic mouse in which Areg AT2 is overexpressed.

[18] The transgenic mouse according to

[16] or

[17] above, wherein the transgenic mouse is an Spc-rtTA / teto-Areg mouse.

[19] The transgenic mouse according to

[18] above, wherein the Spc-rtTA / teto-Areg mouse has a characteristic sequence represented by SEQ ID NO:18.

[20] The transgenic mouse according to

[19] above, wherein the Spc-rtTA / teto-Areg mouse can be identified by the following primer sequences: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[21] The use of AREG in pulmonary AT2 cells and / or its receptor EGFR in fibroblasts as drug targets for treating pulmonary fibrosis in animals and humans, in particular idiopathic pulmonary fibrosis (IPF).

[22] Use of the AREG-targeted or transgenic mouse described in the above paragraph for screening drugs for treating pulmonary fibrosis in animals or humans, particularly idiopathic pulmonary fibrosis (IPF).

[23] Use of a detection agent for AREG and / or a detection agent for its receptor EGFR for the manufacture of a diagnostic kit for diagnosing pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals or humans.

[24] The use of the kit according to

[23] above, wherein the kit is used for a sample derived from an animal or human suspected of suffering from pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF).

[25] The kit according to

[24] above, wherein the sample is a biopsy tissue from the animal or human, such as lung tissue, preferably a lower, middle or upper lobe of the lung from the animal or human.

[26] The use described in

[25] above, in which AREG is detected in the upper part of the lung lobes derived from the animal or human, and the animal or human is then diagnosed as suffering from severe pulmonary fibrosis, in particular idiopathic pulmonary fibrosis (IPF).

[27] Use of a substance that targets AREG and / or its receptor in pulmonary AT2 cells, for example EGFR in fibroblasts, for the manufacture of a medicament for treating pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), in animals or humans.

[28] The use according to

[27] above, wherein the substance is an inhibitor of AREG in pulmonary AT2 cells or an inhibitor of EGFR in pulmonary fibroblasts.

[29] The drug target according to any one of [1] to

[10] above and the use according to any one of

[22] to

[28] above, wherein the animal is a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey or chimpanzee. In embodiments of the present invention, inhibition of AREG and its receptor EGFR has been shown to be a potential therapeutic approach for treating IPF and other fibrotic diseases. EXAMPLES

[0046] method Mice and survival curve recording Rosa26-CAG-mTmG (Rosa26-mTmG) and Cdc42 flox / flox mouse 30The method has been previously described. All experiments were performed in accordance with the recommendations of the National Institute for Biological Sciences Guide for the Care and Use of Laboratory Animals. To monitor mouse survival, both control and Cdc42 null AT2 mice were weighed weekly after PNX treatment. Mice were sacrificed when they reached predefined endpoint criteria. Endpoints were defined based on predefined criteria. 31、32 .

[0047] Spc-CreER / rtTA (Spc-CreER) knock-in mice were generated. CreERT2, p2a and rtTA elements were enzymatically linked and inserted into the endogenous Sftpc gene of mice. The insertion site was the stop codon of the endogenous Sftpc gene, and then a new stop codon was generated at the 3' end of rtTA. The CreERT2-p2a-rtTA fragment was inserted into the genome using CRISPR / Cas9 technology.

[0048] Areg flox / flox Preparation of mice Based on previous studies, Areg flox / flox mouse 33 Briefly, Areg exon 3 was anchored by loxp. loxp1 (GACACGGATCCATAACTTCGTATAATG TATGCTATACGAAGTTATCGAGTC (SEQ ID NO:3)) was inserted at position 3704 of Areg DNA, and loxp2 (CCGCGGATAACTTCGTATAATGT ATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO:4)) was inserted at position 4208 of Areg DNA. After tamoxifen-induced Cre-loxP recombination, exon 3 of Areg gene was deleted and AREG function was inhibited.

[0049] Generation of teto-Areg mice A tetracycline response element was inserted in front of the CMV promoter-driven Areg, allowing induction of Areg expression upon treatment of mice with doxycycline (Dox). The sequence of the tetracycline response element is as follows: 5'TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGT GATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGA3'(SEQ ID NO:5).

[0050] A minimal CMV promoter was inserted in front of the Areg CDNA to overexpress Areg. The sequence of the CMV promoter is as follows: 5'GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT3' (SEQ ID NO:6).

[0051] The sequence of the Areg cDNA is as follows: 5''(SEQ ID NO:7).

[0052] The tetracycline response element, CMV promoter and Areg cDNA were enzymatically ligated and inserted into the mouse genome. The sequence of teto-Areg is as follows:

[0053] In Spc-rtTA / teto-Areg mice, Areg expression was specifically induced in AT2 cells after doxycycline treatment.

[0054] The primer sequences for sequencing the teto-Areg sequence are as follows: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[0055] Pneumectomy (PNX) Eight-week-old male mice were injected with tamoxifen (75 mg / kg per dose) every other day for a total of four times. 14 days after the last tamoxifen injection, the mice were anesthetized and connected to a ventilator (Kent Scientific, Topo). An incision was made in the chest wall at the fourth intercostal space, and the left lung lobe was removed.

[0056] Pulmonary function tests Pulmonary function parameters were measured using an invasive pulmonary function testing system (DSI Buxco® PFT Controller). Mice were first anesthetized and then an endotracheal cannula was inserted into their trachea. Dynamic compliance results were obtained from resistance and compliance measurements. Forced vital capacity results were obtained from pressure-volume tests.

[0057] Hematoxylin and eosin (H&E) staining and immunostaining Lungs were inflated with 4% paraformaldehyde (PFA) and continuously fixed in 4% PFA for 24 h at 4° C. Lungs were then cryoprotected in 30% sucrose and embedded in OCT (Tissue Tek).

[0058] H&E staining experiments followed standard H&E protocols. Briefly, slides were washed with water to remove OCT. Cell nuclei were stained with hematoxylin (Abcam, ab150678) for 2 min, and cytoplasm was stained with eosin (Sigma, HT110280) for 3 min. After dehydration and clearing steps, sections were sealed with neutral resin.

[0059] Immunofluorescence staining experiments followed a previously described protocol. 34 Briefly, after removing the OCT, lung sections were blocked with 3% BSA / 0.1% TritonX-100 / PBS for 1 h, and then the sections were incubated with primary antibodies overnight at 4°C. After washing the slides three times with 0.1% TritonX-100 / PBS, the slides were incubated with secondary antibodies for 2 h at room temperature.

[0060] The primary antibodies used herein are as follows: [Table 1]

[0061] Secondary antibodies used herein are as follows: [Table 2]

[0062] For p-SMAD2 staining experiments, 4% PFA was supplemented with 1X phosphatase inhibitor (Bimake, B15002) during tissue fixation. Tyramide signal amplification method was used for pSMAD2 staining.

[0063] Human lung tissues were fixed in 4% PFA for 24 h at 4°C, cryoprotected in 30% sucrose, and embedded in OCT. All experiments were performed with the approval of the Institutional Review Boards of both the Beijing National Institute for Biological Sciences and the Beijing China-Japan Friendship Hospital.

[0064] Statistical analysis. All data are presented as mean ± sem (as in example figures). Data shown in figures were collected from multiple independent experiments performed on different days with different mice. Most data shown in figures are based on at least three independent experiments unless otherwise stated. Inferential statistical significance of differences between samples was assessed using unpaired two-tailed Student's t-test.

[0065] Isolation of mouse AT2 cells After four injections of tamoxifen, lungs from Spc-CreER, Rosa26-mTmG mice were dissociated as previously described. 23 Briefly, anesthetized mice were perfused with neutral protease (Worthington-Biochem, LS02111) and DNase I (Roche, 10104159001). AT2 cells were directly sorted based on GFP fluorescence using single cell selection mode on BD FACS Aria II and III instruments.

[0066] Quantitative RT-PCR (qPCR) Total RNA was isolated from whole lung or primary AT2 cells using Zymo Research RNA Mini Prep Kit (R2050). Reverse transcription was performed using a 2-Step cDNA Synthesis Kit (Takara, Cat. No. 6210A / B) according to the manufacturer's recommendations. qPCR was performed using a CFX96 Touch™ real-time PCR detection system. Target gene mRNA levels were normalized to Gapdh mRNA levels. Primers used for qPCR were as follows:

[0067] The primers used for qPCR are as follows: [Table 3]

[0068] AREG ELISA AREG concentration in whole lung lysate was detected using mouse AREG immunoassay kit (R&D Systems, DY989). Specifically, whole lung lobes were pulverized with liquid nitrogen and then lysed with cell lysis buffer. The lung lysate was then added to the wells of the microwell plate to be used. After the reaction, the absorbance value at 450 nm was measured. AREG concentration in human lung tissue lysate was detected using human areg immunoassay kit (abnova, B0RB01090J00018). Briefly, human lung tissue was pulverized with liquid nitrogen and then lysed with cell lysis buffer. The lung lysate was then added to the wells of the microwell plate to be used. After the reaction, the absorbance value at 450 nm was measured. All experiments were performed with the approval of the institutional review boards of both the Beijing National Institute of Biological Sciences and the Beijing China-Japan Friendship Hospital.

[0069] Primer sequences for sequencing fragments of Cdc42 DNA sequence before and after deletion of exon 2 of Cdc42: Forward: CTGCCAACCATGACAACCTAA(SEQ ID NO:1), Reverse direction:AGACAAAACAACAAGGTCCAG(SEQ ID NO:2).

[0070] Primer sequences for sequencing fragments of Areg DNA sequence before and after deletion of Areg exon 3: Forward: AAACAAAACAAGCTGAAATGTGG(SEQ ID NO:14), Reverse: AAGGCCTTAAGAACAAGTTGT (SEQ ID NO:15).

[0071] Example 1. Generation and characterization of Cdc42 null AT2 mice To establish an animal model of progressive pulmonary fibrosis, we generated Cdc42-null AT2 mice by specifically knocking out the Cdc42 gene in alveolar type II cells (AT2).

[0072] To specifically delete the Cdc42 gene in AT2 cells, we generated mice carrying the Spc-CreER allele and Cdc42 floxed (Cdc42 flox / flox ) mice were crossed (Figure 1A). flox / flox In mice, the exon 2 of the Cdc42 gene, which contains the translation initiation exon, has two loxp sites. Spc-CreER / Cdc42 flox / flox In mice, exon 2 of the Cdc42 gene was specifically deleted in AT2 cells by Cre / loxp-mediated recombination after tamoxifen treatment (Fig. 1B). flox / flox The mice were named Cdc42 null AT2 mice.

[0073] Fragments of the Cdc42 DNA sequence before and after deletion of exon 2 of the Cdc42 gene are shown in FIG.

[0074] PNX was performed on control and Cdc42 null AT2 mice, and alveolar regeneration and AT2 cell differentiation were analyzed on day 21 after PNX (Figure 3A). As shown in Figure 3A, 200 μm lung sections of control and Cdc42 null AT2 mice were immunostained with antibodies against GFP, Pdpn, and Prospc. On day 21 after PNX, many newly differentiated AT1 cells and newly formed alveoli were observed in control lungs without prosthesis implantation (Figure 3B). However, in Cdc42 null AT2 lungs, only a few AT2 cells had differentiated into AT1 cells and no new alveoli had formed on day 21 after PNX (Figure 3B). The peripheral alveoli of Cdc42 null AT2 lungs were observed to be largely overstretched (Figure 3B).

[0075] Under normal steady-state conditions, AT2 cells slowly self-renewed, differentiated into AT1 cells, and formed new alveoli. To examine whether Cdc42 is essential for AT2 cell differentiation during steady state, we deleted the Cdc42 gene in AT2 cells when mice were 2 months old and analyzed the fate of AT2 cells until the mice were 12 months old. At 12 months, lungs were harvested from control and PNX-untreated Cdc42-deficient mice (Figure 3C). Images show maximum intensity of 200 μm Z-projections of lung sections stained with antibodies against GFP, Pdpn, and Prospc. In the lungs of 12-month-old control mice, the formation of new alveoli was frequently observed (Figure 3D). However, in the lungs of 12-month-old Cdc42-deficient mice (not subjected to PNX), enlarged alveoli were observed and no new AT1 cells were formed (Figure 3D).

[0076] Longer-term observations were performed on Cdc42 null AT2 and control mice after PNX (Figure 4A). Surprisingly, at 21 days after PNX, some Cdc42 null AT2 mice showed significant weight loss and increased respiratory rate. Indeed, at 60 days after PNX, nearly 50% of PNX-treated Cdc42 null AT2 mice reached the predefined health criteria for end-point euthanasia (Figure 4B), and at 180 days after PNX, approximately 80% of PNX-treated Cdc42 null AT2 mice reached the end-point (Figure 4B).

[0077] H&E staining of control and Cdc42 null AT2 mice after PNX revealed severe fibrosis in the lungs of Cdc42 null AT2 mice at the end point (Figure 4D vs. Figure 4C). To confirm the onset time of pulmonary fibrosis in Cdc42 null AT2 mice after PNX, the lungs of Cdc42 null AT2 mice were analyzed using H&E staining at different time points after PNX (Figure 4D). At 21 days after PNX, some Cdc42 null AT2 lungs showed signs of tissue thickening in the subpleural region (Figure 4D). By the end point, dense fibrosis had already progressed to the center of the majority of Cdc42 null AT2 lungs (Figure 5D). The situation observed in post-PNX and aged Cdc42 null mice resembled the characteristic progression of IPF, where fibrotic lesions first develop in the periphery of the lung and then progress inward toward the center of the lobes.

[0078] Strong immunofluorescence signals of collagen I were detected in these dense fibrotic areas of the lungs of Cdc42 null AT2 mice (Figure 4E). In addition, we observed that the percentage of collagen I-expressing areas per lung lobe gradually increased after PNX in Cdc42 null AT2 mice (Figure 4F). qPCR analysis also showed that collagen I mRNA expression levels were gradually improved from day 21 after PNX (Figure 4G). In addition, we observed that lung compliance gradually decreased in PNX-treated Cdc42 null AT2 mice compared with PNX-treated control mice from day 21 after PNX (Figure 4H). This is an interesting finding, considering that lung compliance is known to frequently decrease during lung fibrosis.

[0079] Since impaired AT2 differentiation and alveolar enlargement were found in 12-month-old Cdc42 null AT2 mice (Figure 3D), we analyzed lungs from PNX-untreated control and Cdc42 null AT2 mice aged 10 to 24 months (Figure 5A). No fibrotic changes were observed in the lungs of control mice even at 24 months of age (Figure 5B). No significant fibrotic changes were observed before Cdc42 null AT2 mice reached 10 months of age (Figure 5C). Further observation up to 12 months showed that fibrosis clearly began to develop in the subpleural region of Cdc42 null AT2 lungs and progressed toward the center of the lungs after 12 months (Figure 5C).

[0080] Fibroblast nests are recognized as relevant morphological markers of progressive pulmonary fibrosis and are considered to be sites where the fibrotic response is initiated and / or sustained in progressive pulmonary fibrosis. 35 Fibroblast nests are composed of proliferating α-SMA + Cdc42 null AT2 mice were stained with an antibody against α-SMA 21 days after PNX (Figure 6A). In the relatively normal alveolar regions of the Cdc42 null AT2 lungs, some α-SMA + We observed that fibroblasts began to gather near the AT2 cell clusters (area 1, Figure 6A). Furthermore, the dense fibrotic areas of the lung were characterized by α-SMA. + The lungs were filled with fibroblasts (area 2, Fig. 6A). In addition, immunostaining with antibodies against both α-SMA and the proliferation marker Ki67 revealed that α-SMA was not expressed in the lungs of Cdc42 null AT2 mice 21 days after PNX. + These results suggest that the proliferation of α-SMA cells is significantly increased. + We show that fibroblasts contribute to the development of pulmonary fibrosis in Cdc42-null AT2 mice ( Fig. 6B ).

[0081] Taken together, loss of Cdc42 in AT2 cells leads to progressive pulmonary fibrosis in PNX-treated mice. Moreover, this progressive pulmonary fibrosis phenotype also begins at about 12 months of age in PNX-untreated Cdc42-null AT2 mice. All these results demonstrate that loss of Cdc42 in AT2 cells leads to IPF-like progressive pulmonary fibrosis in mice. Therefore, a mouse model of IPF-like progressive pulmonary fibrosis can be established and used to study human IPF disease.

[0082] Example 2. Sequence characterization of Cdc42 null AT2 mice Spc-CreER, Cdc42 flox / - Genomic purification and PCR amplification were performed on mice, and the Cdc42 floxed and deleted bands were then purified and sequenced using the following primers: CTGCCAACCATGACAACCTAA(SEQ ID NO:1), AGACAAAACAACAAGGTCCAG(SEQ ID NO:2).

[0083] A fragment of the sequence of Cdc42 DNA before and after deletion of exon 2 of the Cdc42 gene is shown in FIG.

[0084] Example 3. Amphiregulin (AREG) is strongly expressed in AT2 cells of Cdc42-null AT2 lungs after PNX treatment In the Cdc42 null AT2 fibrosis model, Cdc42 null AT2 lungs began to show fibrotic changes from day 21 after PNX (Figure 4D). Control and Cdc42 null AT2 cells after PNX treatment have already been characterized (Figure 7A). By both RNA sequencing analysis and quantitative PCR (qPCR), it was observed that Areg in AT2 cells of Cdc42 null AT2 lungs was one of the most upregulated genes at day 21 after PNX (Figure 7B). By immunostaining, it was observed that AREG could be detected in AT2 cells of Cdc42 null AT2 lungs at day 21 after PNX (Figure 7C). At day 21 after PNX, AREG signal could not be detected in control lungs (Figure 7C). This is consistent with the information of the human-derived tissue atlas. That is, the expression of AREG in adult lung tissue is below the detectable level. In addition, AREG signal was specifically detected in AT2 cells. AREG protein expression in Cdc42 null AT2 lungs was measured using the AREG Elisa kit. It was observed that the expression level of AREG was gradually improved in the lungs of Cdc42 null AT2 mice from day 21 after PNX to day 60 after PNX (Figure 7D).

[0085] Example 4. AREG is strongly expressed in AT2X cells from pulmonary fibrosis patients Just as shown in Example 3, a positive correlation between the expression level of AREG and the progression of pulmonary fibrosis was observed in Cdc42 null AT2 mice. The expression levels of AREG in the IPF lungs of two donors and three patients were analyzed. Surprisingly, it was observed that AREG was detected in AT2 cells (HTII-280 expressing cells) of all IPF specimens, but not in AT2 cells of donor lungs (FIG. 8A). The expression of AREG was measured in the lungs of IPF patients and patients with autoimmune-induced pulmonary fibrosis by AREG Elisa kit. It was found that the expression level of AREG was significantly improved in the lungs of IPF patients and patients with autoimmune-induced pulmonary fibrosis (FIG. 8B).

[0086] Taken together, these results demonstrated that the expression level of AREG was significantly upregulated in AT2 cells from both a mouse model of progressive fibrosis and a patient with pulmonary fibrosis.

[0087] Example 5. Overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis Generation of teto-Areg mice A tetracycline response element was inserted in front of the CMV promoter-driven Areg, allowing induction of Areg expression upon treatment of mice with doxycycline (Dox). The sequence of the tetracycline response element is as follows: 5'TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGT GATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGA3'(SEQ ID NO:5).

[0088] A minimal CMV promoter was inserted in front of the Areg cDNA to overexpress Areg, the sequence of which is: 5'GGTAGGCGTGTACGGTGGGAGG CCTATATAAGCAGAGCT3' (SEQ ID NO:6).

[0089] The sequence of the Areg cDNA is as follows: 5''(SEQ ID NO:7).

[0090] The tetracycline response element, CMV promoter and Areg cDNA were enzymatically ligated and inserted into the mouse genome. The sequence of teto-Areg is as follows:

[0091] In Spc-rtTA / teto-Areg mice, Areg expression was specifically induced in AT2 cells after doxycycline treatment.

[0092] The primer sequences for sequencing the teto-Areg sequence are as follows: Forward: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19), Reverse: GCCGGATATTTGTGGTTCATT (SEQ ID NO:20).

[0093] To evaluate the function of increased AREG expression in AT2 cells, we generated Areg AT2-overexpressing transgenic mice that could specifically overexpress Areg in AT2 cells. First, we generated transgenic mice in which Areg was expressed under the control of the tetracycline-responsive promoter element (tetO). To obtain offspring with Spc-rtTA / teto-Areg, mice with the Spc-rtTA allele were crossed with mice with the teto-Areg allele. Exposure of Spc-rtTA / teto-Areg mice to doxycycline (Dox), a tetracycline analog, specifically induced the expression of Areg in AT2 cells. The Spc-rtTA / teto-Areg mice were Areg-expressing transgenic mice. AT2OE and named mouse (Figure 10A).

[0094] Areg AT2OE Mice were treated with Dox in water for 21 days (Figure 10B). AT2OE Lungs from mice were harvested for analysis. qPCR analysis showed that Areg AT2OE The expression of Areg mRNA was significantly induced in mouse AT2 cells (Fig. 10C). H&E staining revealed that Dox-treated Areg AT2OEObvious fibrotic changes were observed in the lungs of the mice (Figure 10D). Many cells in the fibrotic areas expressed high levels of α-SMA (Figure 10E).

[0095] These results demonstrated for the first time that ectopic expression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis.

[0096] Example 6. Generation of Areg null AT2 mice Areg flox / flox Generation of mice: Based on previous studies, Areg flox / flox The mouse was created 33 Briefly, Areg exon 3 was anchored by loxp. loxp1 (GACACGGATCCA TAACTTCGTATAATGTATGCTATACGAAGTTATCGAGTC (SEQ ID NO:3)) was inserted at position 3704 of Areg DNA, and loxp2 (CCGCGGA TAACTTCGTATAATGTATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO:4)) was inserted at position 4208 of Areg DNA. After tamoxifen-induced Cre-loxP recombination, Areg exon 3 was deleted and AREG function was inhibited.

[0097] Fragments of the Areg DNA sequence before and after deletion of exon 3 of the Areg gene are shown in FIG.

[0098] Example 7. Deletion of the Areg gene in Cdc42-null AT2 cells significantly attenuates the development of pulmonary fibrosis Considering the fibrotic effect of AREG in AT2 cells, we evaluated whether reducing the expression of AREG in Cdc42-null AT2 cells would attenuate the progression of fibrosis in Cdc42-null AT2 lungs. We generated Areg flox mice with two loxp sites on either side of exon 3 of the Areg gene. We analyzed mice with a deletion of the Areg gene in the whole body. Areg - / -The mice were viable and fertile, indicating that the Areg gene is not essential for mouse survival and development. After several generations of breeding, we obtained Areg&Cdc42 double-null AT2 mice in which both the Areg and Cdc42 genes were deleted in AT2 cells.

[0099] We then investigated the effect of Areg gene deletion in Cdc42 null AT2 cells. 14 days before PNX, control, Cdc42 null AT2 and Areg&Cdc42 double null AT2 mice were exposed to 4 doses of tamoxifen (Figure 12A). The lungs of these mice were analyzed at different time points after PNX. 21 days after PNX, qPCR analysis showed that the expression level of Areg was not improved in Areg&Cdc42 double null AT2 cells at 21 days after PNX, demonstrating the deletion of Areg gene in the AT2 cells (Figure 12B).

[0100] AREG binds to EGFR, which can activate the phosphorylation of EGFR. Immunostaining experiments using antibodies against GFP (labeling AT2 cells), p-EGFR, and α-SMA revealed that α-SMA + p-EGFR expression in fibroblasts was examined. In Cdc42 null AT2 lungs, strong expression of p-EGFR was observed in α-SMA positive fibroblasts (Figure 12C). In Areg&Cdc42 double null AT2 lungs, not only were there very few α-SMA positive fibroblasts, but also a reduced expression level of p-EGFR was observed (Figure 12C). This demonstrated that the strength of EGFR signaling in α-SMA positive fibroblasts was dependent on AREG expression in AT2 cells. In addition, on day 21 after PNX, Areg&Cdc42 double null AT2 lungs showed slight fibrosis, whereas Cdc42 null AT2 lungs showed significant lung fibrosis (Figure 12D). Survival curves also showed that Areg&Cdc42 double null AT2 mice had a significantly extended lifespan compared to Cdc42 null AT2 mice (Figure 12E).

[0101] Collectively, these results demonstrated that reducing the expression level of AREG in AT2 cells significantly attenuated the progression of pulmonary fibrosis in Cdc42-null AT2 mice. These results also demonstrated that AREG and its receptor EGFR are therapeutic targets for treating fibrosis.

[0102] Example 8. Sequence characterization of Areg null AT2 mice Spc-CreER, Areg flox / - Genomic purification and PCR amplification were performed on mice, and the floxed and deleted bands of purified Areg were then purified and sequenced using the following primers: AAACAAAAACAAGCTGAAATGTGG(SEQ ID NO:14), AAGGCCTTTAAGAACAAGTTGT(SEQ ID NO:15).

[0103] Example 9. Targeting AREG and its receptor EGFR to treat IPF and other fibrotic diseases Considering the fact that EGFR in α-SMA-positive fibroblasts is activated by AREG (FIG. 12C), we investigated the effect of inhibiting the activity of the AREG receptor EGFR on the progression of pulmonary fibrosis. PNX-treated Cdc42 null AT2 mice were treated with PBS alone or with the EGFR inhibitor gefitinib from day 6 after PNX to day 30 after PNX (FIG. 13A). It was found that gefitinib treatment also significantly inhibited the progression of fibrosis in the lungs of Cdc42 null AT2 mice (FIG. 13B).

[0104] Taken together, these results demonstrate that inhibiting AREG and its receptor EGFR is an ideal therapeutic method for treating IPF and other fibrotic diseases.

[0105] References: 1 Wynn, TA Cellular and molecular mechanisms of fibrosis, The Journal of pathology 214, 199-210, doi:10.1002 / path.2277 (2008). 2 Wynn, TA & Ramalingam, TR Mechanisms of fibrosis: therapeutic translation for fibrotic disease, Nature medicine 18, 1028-1040, doi:10.1038 / nm.2807 (2012). 3 Mehal, WZ, Iredale, J. & Friedman, SL Scraping fibrosis: expressway to the core of fibrosis, Nature medicine 17, 552-553, doi:10.1038 / nm0511-552 (2011). 4 Barkauskas, CE & Noble, PW Cellular mechanisms of tissue fibrosis. 7. New insights into the cellular mechanisms of pulmonary fibrosis. American journal of physiology. Cell physiology 306, C987-996, doi:10.1152 / ajpcell.00321.2013 (2014). 5 Rock, JR et al., Multiple stromal populations contribute to pulmonary fibrosis without evidence for epithelial to mesenchymal transition, Proceedings of the National Academy of Sciences of the United States of America 108, E1475-1483, doi:10.1073 / pnas.1117988108 (2011). 6 Gross, TJ & Hunninghake, GW Idiopathic pulmonary fibrosis. New England Journal of Medicine 345, 517-525 (2001). 7 Vyalov, S.L., Gabbiani, G. & Kapanci, Y. Rat alveolar myofibroblasts acquire alpha-smooth muscle actin expression during bleomycin-induced pulmonary fibrosis. The American journal of pathology 143, 1754 (1993). 8 King Jr, TE, Pardo, A. & Selman, M. Idiopathic pulmonary fibrosis. The Lancet 378, 1949-1961 (2011). 9 Plantier, L. et al., Ectopic respiratory epithelial cell differentiation in bronchiolised distal airspaces in idiopathic pulmonary fibrosis, Thorax 66, 651-657, doi:10.1136 / thx.2010.151555 (2011). 10 Steele, MP & Schwartz, DA Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276, doi:10.1146 / annurev-med-042711-142004 (2013). 11 Camelo, A., Dunmore, R., Sleeman, M. A. & Clarke, D. L. The epithelium in idiopathic pulmonary fibrosis: breaking the barrier. Frontiers in pharmacology 4, 173, doi:10.3389 / fphar.2013.00173 (2014). 12 Barkauskas, CE et al., Type 2 alveolar cells are stem cells in adult lung, The Journal of clinical investigation 123, 3025-3036, doi:10.1172 / JCI68782 (2013). 13 Desai, TJ, Brownfield, DG & Krasnow, MA Alveolar progenitor and stem cells in lung development, renewal and cancer, Nature 507, 190-194, doi:10.1038 / nature12930 (2014). 14 Haies, D. M., Gil, J. & Weibel, E. R. Morphometric study of rat lung cells: I. Numerical and dimensional characteristics of parenchymal cell population. American Review of Respiratory Disease 123, 533-541 (1981). 15 Selman, M. & Pardo, A. Idiopathic pulmonary fibrosis: an epithelial / fibroblastic cross-talk disorder. Respiratory research 3, 3 (2001). 16 Kropski, JA, Blackwell, TS & Loyd, JE. The genetic basis of idiopathic pulmonary fibrosis. European Respiratory Journal 45, 1717-1727 (2015). 17 Goodwin, AT & Jenkins, G. Molecular endotyping of pulmonary fibrosis. Chest 149, 228-237 (2016). 18 Xu, Y. et al., Single-cell RNA sequencing identifies diverse roles of epithelial cells in idiopathic pulmonary fibrosis, JCI insight 1 (2016). 19 Sternlicht, MD & Sunnarborg, SW. The ADAM17-amphiregulin-EGFR axis in mammary development and cancer. Journal of mammary gland biology and neoplasia 13, 181-194 (2008). 20 Berasain, C. & Avila, M. A. Seminars in cell & developmental biology, 31-41 (Elsevier). 21 Sternlicht, MD et al., Mammary ductal morphogenesis requires paracrine activation of stromal EGFR via ADAM17-dependent shedding of epithelial amphiregulin, Development 132, 3923-3933 (2005). 22 Macias, H. & Hinck, L. Mammary gland development. Wiley Interdisciplinary Reviews: Developmental Biology 1, 533-557 (2012). 23 (citation not valid). 24 Busser, B., Sancey, L., Brambilla, E., Coll, J.-L. & Hurbin, A. The multiple roles of amphiregulin in human cancer. Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1816, 119-131 (2011). 25 Chen, Z. et al., Aberrantly activated AREG-EGFR signaling is required for the growth and survival of CRTC1-MAML2 fusion-positive mucoepidermoid carcinoma cells, Oncogene 33, 3869 (2014). 26 Busser, B. et al., Amphiregulin promotes resistance to gefitinib in nonsmall cell lung cancer cells by regulating Ku70 acetylation, Molecular Therapy 18, 536-543 (2010). 27 Wang, X., Masri, S., Phung, S. & Chen, S. The role of amphiregulin in exemestane-resistant breast cancer cells: evidence of an autocrine loop. Cancer research 68, 2259-2265 (2008). 28 Zhou, Y. et al., Amphiregulin, an epidermal growth factor receptor ligand, plays an essential role in the pathogenesis of transforming growth factor-β-induced pulmonary fibrosis, Journal of Biological Chemistry 287, 41991-42000 (2012). 29 Steele, MP & Schwartz, DA Molecular mechanisms in progressive idiopathic pulmonary fibrosis. Annual review of medicine 64, 265-276 (2013). 30 Chen, L. et al., Cdc42 deficiency causes Sonic hedgehog-independent holoprosencephaly, Proceedings of the National Academy of Sciences 103, 16520-16525 (2006). 31 Council, NR Guide for the care and use of laboratory animals (National Academies Press, 2010). 32 Foltz, CJ & Ullman-Cullere, M. Guidelines for assessing the health and condition of mice. Resource 28 (1999). 33 Luetteke, NC et al., Targeted inactivation of the EGF and amphiregulin genes reveals distinct roles for EGF receptor ligands in mouse mammary gland development, Development 126, 2739-2750 (1999). 34 Wang, Y. et al., Pulmonary alveolar type I cell population consists of two distinct subtypes that differ in cell fate, Proceedings of the National Academy of Sciences, 201719474 (2018). 35 Lynch, DA et al., Diagnostic criteria for idiopathic pulmonary fibrosis: a Fleischner Society White Paper, The Lancet Respiratory Medicine 6, 138-153, doi:10.1016 / s2213-2600(17)30433-2 (2018).

Claims

1. Use of an Areg AT2-overexpressing transgenic mouse for screening of therapeutic agents for pulmonary fibrosis in animals or humans, wherein the Areg AT2-overexpressing transgenic mouse is obtained by a method comprising specifically overexpressing AREG in pulmonary AT2 cells of the mouse.

2. 2. The use according to claim 1, wherein the animal is a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey or chimpanzee.

3. The use according to claim 1, wherein the method comprises specifically inducing expression of Areg in AT2 cells following doxycycline treatment.

4. The use according to claim 1 , wherein the transgenic mouse is an Spc-rtTA / teto-Areg mouse.

5. The use described in claim 4, wherein the transgenic mouse has a characteristic sequence shown in SEQ ID NO:

18.

6. The use described in claim 1, wherein the pulmonary fibrosis is idiopathic pulmonary fibrosis (IPF).

Images